Antibody labeling and image acquisition Four to eight μm FFPE sections were stained with an antibody cocktail (Table S1) containing all antibodies. Briefly, tissue sections were de-paraffinized with xylene and carried through sequential rehydration from 100% Ethanol to 70% Ethanol before being transferred to PBS. Heat-induced antigen retrieval was performed in a decloaking chamber (Biocare Medical) at 95°C for 30 min in Tris/EDTA buffer (10mM Tris, 1mM EDTA, pH9.2). Slides were cooled to room temperature (RT) and were subsequently blocked with PBS+3%BSA for 1h at RT. Meanwhile, the antibody cocktail was prepared in PBS+1%BSA buffer, with the appropriate dilution for each of the antibodies (Table S1). Each slide was incubated with 100 μl of the antibody cocktail overnight at 4°C. The next day, slides were washed 3 times with PBS and labeled with 1:400 dilution of Intercalator-Ir (Fluidigm 201192B) in PBS for 30 min at RT. Slides were briefly washed with H2O three times and air dried for at least 30 minutes before IMC acquisition. The IMC was purchased from Fluidigm (Fluidigm, Hyperion Imaging System™). All IMC operation was performed following Fluidigm’s operation procedure. Briefly, following daily tuning of IMC, image acquisition was carried out following manufacturer’s instruction at a laser frequency of 200 Hz. 1000 μm x 1000 μm regions around islets were selected based on bright field images.
- May 2020
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Cell Segmentation CellProfiler (Kamentsky et al., 2011) was subsequently used to define cell masks and quantify marker expression. To define cell borders, nuclei were first identified as primary objects based on ilastik probability maps and expanded through the cytoplasm compartment until either a neighboring cell or the background compartment was reached. Cell masks were generated for identification of single cells and used to extract single-cell information (marker abundance, spatial and neighborhood data) from the original images. The results were exported as csv tables for further analysis.
Cell segmentation of images
-
-
diabetes.diabetesjournals.org diabetes.diabetesjournals.org
-
Blinded Study 2: Calculating Insulinlow Islet AbundanceMost, if not all, T1D islets were imaged for synaptophysin, insulin, and Nkx6.1 for 10 control and 15 T1D pancreatic sections. Control islets were imaged with standard exposure; T1D islets were imaged with long exposure for insulin only. Blinded investigators quantified insulinlow islets as percentage of total synaptophysin-positive islets.
Classifying Insulin-low abundance
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Pancreas immunohistochemical and immunofluorescence analysisFFPE pancreatic sections (5 μm thickness) were analyzed as briefly follows. After deparaffinization and rehydration, sections were incubated with Tris-buffered saline (TBS, Sigma-Aldrich) supplemented with 3% H2O2 to block endogenous peroxidases (only for immunohistochemical experiments) and with TBS supplemented with 3% bovine serum albumin (BSA, Sigma-Aldrich) to reduce nonspecific reactions. Antigen retrieval was performed with 10 mM citrate buffer, pH 6.0.For immunohistochemical analysis, sections were incubated with rabbit polyclonal anti–human MPO (Abcam, ab45977) and swine polyclonal anti-rabbit IgG-HRP (DAKO, P0217) as secondary antibody. MPO signal was detected with 3,3′-diaminobenzidine (DAB Quanto, ThermoFisher Scientific, TA-060-HDX). Sections were then incubated with Mayer’s hematoxylin solution (Sigma-Aldrich) to counterstain nuclei, dehydrated, and mounted with Eukitt (Bio-Optica). Sections from the Siena cohort were also incubated with mouse monoclonal anti–human glucagon (R&D Systems, clone 181402, MAB1249) and goat anti-mouse IgG–alkaline phosphatase (ThermoFisher Scientific, 31320) as secondary antibody. Glucagon signal was detected with Liquid Fast Red (ThermoFisher Scientific, TA-060-AL) supplemented with levamisole endogenous alkaline phosphatase inhibitor (DAKO, Agilent Technologies, X3021).For immunofluorescence analysis, sections were incubated with rabbit polyclonal anti–human MPO (Abcam) and mouse anti–citrullinated histone H3 (anti-CitH3; citrulline R2 + R8 + R17, clone 7C10, LifeSpan Biosciences, LS-C144555) antibodies and with goat anti-rabbit IgG Alexa Fluor 488 (Molecular Probes, ThermoFisher Scientific, A11034) and goat anti-mouse IgG Alexa Fluor 594 (Molecular Probes, ThermoFisher Scientific, A11032) as secondary antibodies. nPOD sections were also stained with polyclonal guinea pig anti-glucagon antibody (LifeSpan Biosciences, LS-{"type":"entrez-nucleotide","attrs":{"text":"C20275","term_id":"1632546","term_text":"C20275"}}C20275) and goat anti-guinea pig IgG Alexa Fluor 647 (Molecular Probes, ThermoFisher Scientific, A21450) as secondary antibody. DNA was counterstained with Hoechst 33342 (ThermoFisher Scientific, 62249). Finally, sections were mounted using Vectashield (Vector Laboratories, H1000) mounting medium.OCT-embedded tissues (5 μm thickness) were methanol/acetone (1:1, –20°C) fixed, then blocked (PBS supplemented with 1% denatured BSA) and incubated with primary antibodies: mouse monoclonal anti-MPO (Bio-Rad, clone 4A4, 0400-0002) and polyclonal rabbit anti-CitH3 (citrulline R2 + R8 + R17, Abcam, ab5103). Sections were washed and incubated with the proper secondary antibodies: goat anti-mouse IgG (H+L) Alexa Fluor 488 (Jackson ImmunoResearch, 115-545-003) and goat anti-rabbit IgG (H+L) Alexa Fluor 546 (ThermoFisher Scientific, A11035). DNA was counterstained with Hoechst 33342. Sections were mounted on slides with homemade Mowiol mounting medium (glycerol, G5516; Mowiol 4-88, 81381; and Dabco 33-LV, 290734, Sigma-Aldrich).
IHC and IF analysis of MPO+ cells in pancreas
-
-
academic.oup.com academic.oup.com
-
Formalin-fixed, paraffin-embedded pancreas sections were available from the Network for Pancreatic Organ Donors with Diabetes (nPOD) collection of organ donor pancreases. Analyses were performed with five healthy control (HC), four nondiabetic autoantibody-positive (AutoAb+) subjects, and eight individuals with T1D for whom formalin-fixed, paraffin-embedded specimens were available. All tissue processing procedures were conducted by the nPOD Organ Processing and Pathology Core in accordance with federal guidelines for organ donation and the University of Florida institutional review board. The case identification number, disease condition, patient clinical parameters, tissue histopathological scoring, and serum immunological testing data provided by the nPOD are listed in Supplemental Table 1. The institutional review board of IRCCS San Raffaele Scientific Institute (Milan Italy) approved all work reported. In situ hybridization was performed as previously described (36) to visualize viral RNA and CXCL10 RNA using the Quantigene ViewRNA technique based on branched DNA signal amplification technology, according to the manufacturer’s instructions. A probe set containing multiple oligonucleotides was used, designed to hybridize to human CXCL10 (Quantigene probes, CXCL10 gene; NCBI reference sequence, NM_001565) Tissue sections from the pancreas head, body, tail, and duodenum were analyzed, depending on availability. Quantification of cells positive for each probe was performed within eight randomly chosen fields for section (magnification ×20). The percentage of positive cells examined was scored as 0 (negative), 1 (≤20 cells per field), 2 (20 to 40 cells per field), and 3 (>40 cells per field). All the analyses were performed in blinded fashion.
Quantigene assay of viral and CXCL10 RNA in human pancreas
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
ImmunostainingSections from formalin-fixed paraffin-embedded donor-derived pancreata were obtained from the Network for Pancreatic Organ Donors With Diabetes (nPOD) repository, the Diabetes Virus Detection (DiViD) study, and the tissue bank of A.C.P. at Vanderbilt University (including age-matched control subjects without diabetes). Full details on all donors are listed in Supplementary Table 1. Paraffin sections were rehydrated, and antigen retrieval was performed in a decloaking chamber (Biocare Medical) in 50 mmol/L citrate buffer (pH 6). The following primary antibodies were used: guinea pig anti-insulin (1:400; DAKO), mouse antiglucagon (1:200; Abcam), rabbit anti-53BP1 (1:200; Bethyl), mouse anti-γ−H2AX Ser139 (1:3,000; Millipore), mouse anti-CD45 (1:100; DAKO), rabbit antiphosphorylated (phospho)-Kap1 (1:100; Bethyl), rabbit anti-p53 (1:400; Novocastra), rat anti-CD3 (1:300; Millipore), and rabbit anti–human growth hormone (hGH) (1:200; Abcam). Fluorophore-conjugated secondary antibodies used were donkey anti–guinea pig Alexa Fluor 488, donkey anti-rabbit Cy3/Cy5, and donkey anti-mouse Alexa Fluor 488/Cy3 (The Jackson Laboratory). DAPI (Invitrogen) was used as a nuclei marker. Horseradish peroxidase–conjugated secondary antibody was donkey anti-rabbit (Histofine; Nichirei Biosciences). Diaminobenzidine (Lab Vision) was used as chromogen. Fluorescent images were taken with a Nikon C1 confocal microscope at 400× magnification. Bright-field images were taken with an Olympus BX53 at 400× magnification. Image quantification was performed using the ImageJ software.
Immunostaining
-
-
www.sciencedirect.com www.sciencedirect.com
-
In-Situ HLA-A2 MMr StainingIn-situ immunohistochemistry staining was performed as described (Culina et al., 2018Culina S. Lalanne A.I. Afonso G. Cerosaletti K. Pinto S. Sebastiani G. Kuranda K. Nigi L. Eugster A. Osterbye T. et al.Islet-reactive CD8+ T cell frequencies in the pancreas, but not in blood, distinguish type 1 diabetic patients from healthy donors.Sci. Immunol. 2018; 3: eaao4013Crossref PubMed Scopus (31) Google Scholar). Unfixed, frozen sections were dried for 2 h, loaded with 1 μg of PE-labeled MMrs overnight at 4°C, washed gently with PBS and fixed in 2% paraformaldehyde for 10 min. After a further wash, endogenous peroxidase activity was blocked with 0.3% H2O2. Sections were then incubated serially with a rabbit anti-PE Ab (Abcam), horseradish peroxidase-conjugated swine anti-rabbit Ig (Dako) and 3,3′-diaminobenzidine tetrahydrochloride substrate (ThermoFisher). After a final wash, sections were counterstained with hematoxylin, dehydrated via sequential passages in 95%–100% ethanol and xylene, mounted, and analyzed using a Nikon Eclipse Ni microscope with NIS-Elements D software v4.40.In-situ immunofluorescence staining was performed similarly, but non-specific reactions were blocked with 5% goat serum for 2 h at room temperature before serial incubations with rabbit anti-PE Ab (1:250, 1.5 h at room temperature) and Alexa Fluor 594-conjugated goat anti-rabbit IgG (ThermoFisher; 1:500, 1 h at room temperature). After a further wash, sections were incubated for 1 h at room temperature with rat anti-CD8 mAb (Abcam; 1:100) together with mouse anti-CD45RO mAb (BioLegend; 1:200) followed, after one wash, by one final incubation for 1 h at room temperature with Alexa Fluor 488-conjugated goat anti-rat IgG together with Alexa Fluor 647-conjugated goat anti-mouse IgG (1:500/each; both from ThermoFisher). After DNA counterstaining with DAPI, sections were mounted and analyzed using a Leica TCS SP5 confocal laser scanning microscope with LAS software v2.6.0.7266.
In situ HLA-A2 MMr staining
-
HLA-A2 MMr AssaysAll peptides were synthesized at >90% purity (Synpeptides). HLA-A2 MMrs were produced and used as described (Culina et al., 2018Culina S. Lalanne A.I. Afonso G. Cerosaletti K. Pinto S. Sebastiani G. Kuranda K. Nigi L. Eugster A. Osterbye T. et al.Islet-reactive CD8+ T cell frequencies in the pancreas, but not in blood, distinguish type 1 diabetic patients from healthy donors.Sci. Immunol. 2018; 3: eaao4013Crossref PubMed Scopus (31) Google Scholar). Each pHLA-A2 complex was used at a final concentration of 8-27 nM and conjugated with fluorochrome-labeled streptavidin at a 1:4 ratio. The combinatorial MMr panel was first set up by staining HLA-A2+ PBMCs with the same set of fluorescent streptavidin-labeled MMrs, all loaded with the Flu MP58-66 epitope. Compensations were set using fluorescence-minus-one samples (i.e. omitting one streptavidin at a time). The concentration of each fluorescent MMr was corrected for the variable staining index of each streptavidin, in order to obtain a distinct double-MMr+ population for each fluorochrome pair. The identification of the same MMr+ population by each pair validated the panel. PBMCs were isolated by density gradient centrifugation using 50 ml Leucosep tubes (Greiner/Dominique Dutscher), washed twice in RPMI medium supplemented with AB human serum (Sigma), counted on a ThermoFisher Countess II automated counter and frozen in pre-chilled 10% DMSO solution in AIM-V medium (ThermoFisher) using CoolCell containers (Biocision) stored overnight at −80°C prior to transfer into liquid nitrogen. At thawing, PBMCs were immediately diluted in pre-warmed AIM-V medium. Following centrifugation and one additional wash in AIM-V, PBMCs were counted and rested in the presence of 50 nM dasatinib for 30 min at 37°C before magnetic depletion of CD8– cells (StemCell Technologies). Staining was performed for 20 min at 20°C in 20 μl PBS-dasatinib for 107 cells with the combinatorial double-coded MMr panels (Culina et al., 2018Culina S. Lalanne A.I. Afonso G. Cerosaletti K. Pinto S. Sebastiani G. Kuranda K. Nigi L. Eugster A. Osterbye T. et al.Islet-reactive CD8+ T cell frequencies in the pancreas, but not in blood, distinguish type 1 diabetic patients from healthy donors.Sci. Immunol. 2018; 3: eaao4013Crossref PubMed Scopus (31) Google Scholar) detailed in Figure 3, followed, without washing, by mAb and Live/Dead Aqua staining at 4°C for 20 min. After one wash, cells were acquired using a FACSAria III cytometer configured as detailed in Table S6. Candidate epitopes binding to HLA-A2 (Figure S2) that did not yield any appreciable MMr staining provided negative controls for each panel. Data were analyzed with FlowJo software as described in Figure 3. Cells were sequentially gated on small lymphocytes, singlets, live cells (Live/Dead Aqua–), CD3+CD8+ T cells and total PE+, PE-CF594+, APC+, BV650+, BV711+ and BV786+ MMr+ T cells. Using Boolean operators, these latter gates allowed to selectively visualize each double-MMr+ population by including only those events positive for the corresponding fluorochrome pair. For example, UCN31-9 MMr+ cells (PE+PE-CF594+) were visualized by gating on events that were PE+PE-CF594+APC−BV650−BV711−BV786−. Events negative for all MMr fluorochromes (PE−PE-CF594−APC−BV650−BV711−BV786−) were represented in the same PE/PE-CF-594 dot plot to set the double-MMr+ gate, as shown in Figures 4A–4F. CD45RA and CCR7 staining was subsequently visualized by gating on these MMr+ cells. Each dot plot of Figures 3B and 3C displays a color-coded overlay of each double-MMr+ fraction and of the MMr− population to visualize the separation of each epitope-reactive CD8+ T-cell fraction relative to the others.
HLA-A2 MMr Assays
-
-
pubs.acs.org pubs.acs.org
-
Transmission Electron Microscopy (TEM)A JEOL 2010F transmission electron microscope (TEM) was used for imaging the crystals. The crystals were about evenly distributed across the used 314-square, 3 mm diameter, 200 mesh copper grids with type-B carbon supports (Ted Pella Redding CA, catalog number 1810). Typically, crystals of 3 squares were TEM imaged, that is, 1% of the applied crystals were counted and examined. Crystallinity was confirmed by the crystals’ electron diffraction, and then elemental compositions were determined by energy-dispersive X-ray spectroscopy. In the elemental analyses the peaks of all elements excepting carbon were integrated. The reported values are percentages of the integrals.
TEM imaging of crystals in pancreas
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunofluorescence Stainings and Image Acquisition Paraffinized sections (mouse and human) were prepared for immunofluorescence staining by heating the slides for 15 min at 55°C in an oven, deparaffinized (2 x 100% xylene 5 min each, 2 x 100% ethanol 5 min each, 2 x 95% ethanol 5 min each, 70% ethanol for 5 min) and rinsed in dH2O for 5 min. Antigen retrieval was performed by heating the slides at 95°C for 20 min in HistoVT pH 7.0 (Nacalai USA) for all antibodies used. Specimens were blocked in 5% goat serum PBS-T for 15 min at RT before incubating with primary antibody diluted in 1% goat serum PBS-T overnight at 4°C. For primary antibodies produced in goat, donkey serum was used as the blocking agent. Each slide was rinsed three times in PBS, for 5 min each. Specimens were incubated in fluorochrome-conjugated secondary antibody diluted in 1% goat serum PBS-T for 1 hr at RT in the dark. After rinsing as above, VectorShield with DAPI and coverslip were mounted and slides were allowed to cure overnight at 4°C in the dark before image acquisition. For apoptosis assessment, we used DeadEnd Fluorometric TUNEL (Promega) and performed the staining as recommended by manufacturer. A list of antibodies used can be found in Key Resources Table.Images were acquired using either ApoTome.2 (Zeiss) without structured illumination or LSM780 (Zeiss) and analyzed using ImageJ software unless otherwise stated.
IF and image acquisition
-
For human samples, analysis of H3K27me3, H3, Insulin and DAPI intensities were automated using customized Cell Profiler pipeline (available upon request).
Image quantification of H3K27me, H3, Insulin, DAPI
(Cell Profiler pipeline)
-
-
link.springer.com link.springer.com
-
Immunostained sections were examined with a Nikon Eclipse E600 epifluorescence-bright field microscope and digital images recorded. Group assignment was blinded to the investigator, except groups 1 and 4 where many islets were insulin-deficient. From each pancreatic section, islets with approximately ≥20 endocrine cells were imaged for the presence of IL-1β, insulin, glucagon, CD68 cells (macrophage marker) and CD3 cells (T cell marker). Each of the specific image sets from multiple acquisitions were merged with Adobe Photoshop CS6 (Adobe Systems, San Jose, CA, USA) following conversion of IL-1β immunostained cells to a greyscale fluorescence mode. Fifteen exocrine fields that were devoid of islet and ductal areas were selected randomly by microscopically traversing different regions of each pancreatic section and imaged at ×20 objective. The number of IL-1β-positive cells in each field was enumerated and the mean number per field per section determined. All data were included in the study. For each section, the number of IL-1β-positive cells in the peri- and intra-islet regions was enumerated and the mean number of cells per insulin-positive and -negative islet determined. Islets that showed immunostaining for IL-1β in alpha cells were scored microscopically as negative, weak or moderate intensity.
Imaging and Quantitation of IL-1b, insulin, glucagon, CD68, CD3 cells
-
The immunohistochemical specificity of anti-IL-1β (catalogue no. 12242; Cell Signaling Technology) has been validated by the manufacturer. Thus, by immunohistochemistry, it successfully detects IL-1β immunoreactive cells in human colonic sections from individuals with chronic colitis. Further, by western blotting, the same antibody detects mature recombinant human and mouse IL-1β and the human precursor (molecular mass of 34 kDa) in extracts of Raw 264.7 and human monocyte-derived THP-1 cells, following exposure to Brefeldin and lipopolysaccharide (LPS), respectively. Anti-IL-1β was replaced with diluent to act as negative controls. As further controls, paraffin sections of THP-1 cells, harvested after incubation with LPS (100 ng/ml for 3 h) and without (from Cell Signaling Technology), were evaluated in this laboratory for IL-1β immunohistochemical specificity. The immunostaining protocol for IL-1β was tested with formalin-fixed tonsil sections, supplied by Department of Surgery, University of Auckland. Sections from selected pancreas and tonsil were immunostained for IL-1β in two separate sections. They were then exposed to rabbit anti-CD68 or rabbit anti-CD3, followed by donkey anti-rabbit IgG-biotin and then streptavidin–Alexa 568. Pancreatic sections were immunostained subsequently for insulin as above, followed by donkey anti-guinea pig IgG–Alexa 488.
IHC for IL-1b
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Histology and immunohistochemistryFor quantitative analyses of HS, HSPGs, insulin and glucagon localization in human islets, paraffin sections (4 μm thickness) of nPOD human pancreases and isolated human islets fixed in 10% neutral-buffered formalin were stained with hematoxylin and eosin (H&E) or by immunohistochemistry. Antigen retrieval for HS and Col18 was performed using 0.05% pronase (Calbiochem, Japan) [27, 28], whereas heat/citrate buffer (pH 6) was used for Sdc1 and heparanase [27, 28]. HS and HSPG core proteins were detected immunohistochemically using 10E4 anti-HS (1/5-1/10; https://dx.doi.org/10.17504/protocols.io.kvzcw76), anti-Col18 (1/100; https://dx.doi.org/10.17504/protocols.io.kvzcw76) and rat anti-mouse Sdc1 (CD138, 1/10; BD Biosciences) (https://dx.doi.org/10.17504/protocols.io.kv3cw8n) mAbs, with horseradish peroxidase-conjugated rabbit anti-mouse or anti-rat Ig (Dako, Carpinteria, USA). Heparanase was localized using the HP130 mouse anti-human heparanase mAb (1/5; Insight Biopharmaceuticals, Rehovot, Israel), biotinylated anti-mouse IgG (1/250) and avidin-biotin-complex (ABC reagent; PK-2200, Vector Laboratories, Burlingame, CA) (https://dx.doi.org/10.17504/protocols.io.kv4cw8w). Background staining was checked using the corresponding isotype control Ig and human pancreatic lymph node (PLN) was used as a positive control. Insulin and glucagon were detected using mouse anti-insulin (ascites; 1/250) or mouse anti-glucagon (ascites; 1/500) mAbs (Sigma-Aldrich) and biotinylated anti-mouse IgG/ABC reagent (https://dx.doi.org/10.17504/protocols.io.kv6cw9e). 3-amino-9-ethylcarbazole (AEC; Sigma-Aldrich) was used as the chromogen. Specimens were de-identified prior to morphometric analysis. Image J software with color deconvolution plugin was used for the quantitative analysis of the % of islet area stained [27, 28] in 7–10 islets/donor pancreas.
Staining and quantitative analysis of HS, HSPGs, Insulin and Glucagon
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Development of an automated morphometric analysis processα-cell area was quantified on glucagon-stained slides (4 slides by patient, 2 from the head and 2 from the tail), β-cell area on insulin-stained slides (2 slides by patient, 1 from the head and from the tail), and non-exocrine-non-endocrine (non-acinar, non-insular) pancreatic tissue area on both insulin- and glucagon-stained slides (i.e. 6 slides by patient, 3 from the head and 3 from the tail).On each slide, three different areas were evaluated: the total pancreatic tissue area, the non-exocrine-non-endocrine pancreatic tissue area and the Fast Red-stained area, the latter corresponding either to alpha-cells or to beta-cells area, depending on the immunostaining.In R software, a picture is converted into 3 matrices, corresponding respectively to the blue, green and red color levels, each matrix element accounting for one pixel. The principles used for the selection of the pixels, belonging to the 3 predefined areas were the following.For total pancreatic tissue area delineation, the first step consisted in resizing the original picture to one hundredth of its full-resolution initial size. In other words, the original picture, whose size was between 1x108 and 6x108 pixels, was divided into squares of 10-pixel sides, each of these squares being integrated, in the resized picture, into one single central pixel, whose blue, green and red color levels were respectively the mean of blue, green and red levels from the 10x10 corresponding pixels in the original picture. This step allowed the smoothing of the existing discontinuities in the original picture to define a continuous pancreatic tissue surface (S2 Fig). The next step consisted then in the selection of any colored pixel, i.e. any pixel whose blue, green and red color levels were superior to the respective color levels of background pixels in the resized picture (Fig 1). The main difficulty in automating this process was to be able to take into account the differences in contrast and staining intensity between slides. The choice was therefore made to build an R script aimed at generating several propositions for total pancreatic tissue selection, by varying the color level threshold used by the different filters applied in the script (S1 File). An additional step of visual selection of the most accurate proposition by one investigator (FBS), in comparison to the original picture, was further carried out, allowing a critical step of visual control in the automated process (Fig 1).Open in a separate windowFig 1Example on the slide 14262.The first R script, used for the selection of the pixels belonging to total pancreatic tissue, generated 22 different propositions. The choice of the investigator is framed in red and the subsequent result indicated under the picture. An example of background pixel has been also pointed out on the picture miniature.For exocrine+endocrine pancreatic tissue area delineation, the first step also consisted in resizing the original picture, like in the total area delineation, but to a bigger size than for total pancreatic tissue, i.e. to one twentieth of its initial size. The next step consisted in the selection of either hematoxylin-stained blue pixels, i.e. colored pixels, whose blue level was superior to green and red levels, or to diaminobenzidine, brown, pixels or Fast Red, red, pixels, defined as colored pixels, whose red level was superior to green level. The R script intentionally generated automatically several propositions for exocrine+endocrine pancreatic tissue selection (S2 File). The choice of the most adequate selection by the investigator added a second step of visual control in the automated process (Fig 2).Open in a separate windowFig 2Example on the slide 14262.The second R script, used for the selection of the pixels belonging to functional pancreatic tissue, generated 16 different propositions. The choice of the investigator is framed in red and the subsequent results indicated under the picture.Given the small size of Fast Red-stained regions, the use of the full resolution picture was necessary for appropriate selection of the corresponding area. However, given the large size of the original picture, this required its split into several smaller pictures to allow easy manipulations within R software. The final Fast Red-stained selected area was then calculated by summing the results obtained on each small picture. The selection principle of Fast Red-stained pixels relied on the selection of colored pixels whose red level was higher than blue and green levels. However, the main difficulty encountered in this process was the presence of light pink artifact pixels on some slides, most often organized into large very slightly colored sheets, but sometimes with a color intensity similar to that of some weakly Fast Red-stained alpha- or beta islet cells. Thus, to gain detection sensitivity without losing specificity, a multi-step selection R-script was built (Fig 3) (S3 File). Briefly, assumption was made that every truly positive Fast Red-stained pixel should either display a high red level itself or a high red level pixel in its vicinity; artifact pixels being low in intensity and located in expanded regions only containing low red level pixels. Hence, the first step of the script selected high red level pixels (Fig 3B); the second step drew circles with a 50-pixel radius around each selected pixel (Fig 3C), thus pinpointing the regions where true Fast Red-stained pixels were located; and the final step identified the red pixels with a lower threshold within these circles as Fast Red-stained pixels (Fig 3D). The main drawback of this approach should be the inappropriate selection of islet neighboring tissue submitted to bleeding of the overstaining existing on some slides. However, the validation of the present methodology on some well-established parameters, as beta-cell mass, suggested that this effect was negligible (Fig 4). The whole process of picture analysis has been summarized on a flowchart (S3 Fig) (S4 File).
Automated morphometric analysis
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
IHC-IF.Six sections of formalin-fixed, paraffin-embedded pancreas specimens (4 μm thick and 30–200 μm apart) were labeled for each marker. All murine and human pancreas sections were stained with primary and secondary antibodies for detection of insulin, amyloid, CC3, TUNEL, RAGE, AGEs, S100B, and IAPP. Images were taken using a Leica fluorescence microscope. Quantitative analysis using MetaMorph LASF imaging software was performed by an investigator blinded to the experimental condition. Detailed methods for histological studies can be found in Supplemental Table 1 and the Supplemental Methods.
IHC-IF
(insulin, amyloid, CC3, TUNEL, RAGE, AGEs, S100B, IAPP)
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
ImmunohistochemistryParaffin sections were incubated with primary antisera (Supplementary Table 3), followed by the appropriate secondary antisera conjugated to aminomethylcoumarin (AMCA), Cy2, Cy3, or Cy5 (Jackson ImmunoResearch) and DAPI (Molecular Probes, Eugene, OR) as previously described (1). Primary antisera were as follows: 1:100, ARX (AF7068; R&D Systems), β3 tubulin (NB100-1612; Novus Biologicals), CD3 (PA1-37282; Thermo Fisher Scientific), CD31 (ab28364; Abcam), chromagranin A (ab8204; Abcam), ghrelin (H-031-77; Phoenix Pharmaceuticals), GLUT1 (07-1401; Millipore), ISL1&2 (39.4D5; DSHB), INSM1 (sc-271408; Santa Cruz Biotechnology), NeuN (MAB377; Millipore), Nkx2.2 (ab191077; Abcam), Nkx6.1 (F55A12; DSHB), pancreatic polypeptide (PP) (18-0043; Invitrogen), PCNA (2586S; Cell Signaling Technology), PC1/3 (AB10553; Millipore), Pdx1 (NBP2-38865; Novus Biologicals), phospho-histone H3 (9701S; Cell Signaling Technology), proinsulin (GN-ID4; DSHB), SNAP25 (MAB331; Millipore), somatostatin (SS) (18-0078; Invitrogen), synaptotagmin 1A (ab133856; Abcam), Sox9 (AB5535; Millipore), Sox9 (pS181) (ab59252; Abcam), and synaptophysin (18-0130, Thermo Fisher Scientific, and AB6245, Abcam); 1:250, glucagon (ab8055 and ab10988; Abcam) and Ki67 (550609; BD Biosciences); and 1:1,500, insulin (A0564; Dako).
IHC
-
Islet MorphometryIslet endocrine and α-cell morphometry were assessed with Volocity 6.1.1 (PerkinElmer) as previously described (9). Zeiss AxioImager M1 (Carl Zeiss Microscopy) with automated X-Y stage and Orca ER camera (Hamamatsu) acquired images of tens of thousands of individual nuclei/sample (Supplementary Table 4).
Islet morphometry
-
TUNELApoptosis analysis was performed in a subset of available control and T1D samples as previously described (1). Total terminal deoxynucleotide TUNEL-positive islet endocrine cells were assessed in >85,000 islet cells/condition. Total TUNEL+ Sox9Cyt cells were assessed in 993 islet cells/condition. In every sample, TUNEL+ pancreatic ducts were imaged to ensure adequate TUNEL staining.
TUNEL
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunohistochemistry and image digitalisationEach pancreas received was divided into a head, body and tail region, each of which was subjected to serial transverse sectioning. Within each region, tissue pieces were consecutively and alternately used for preparation of both formalin-fixed paraffin-embedded and frozen tissue blocks. Three consecutive paraffin sections were cut at 4 µm from one representative formalin-fixed paraffin-embedded tissue block within each region. All sections were deparaffinised and rehydrated with serial passage through changes of xylene and graded ethanol. All slides were subjected to heat-induced antigen retrieval in Target Retrieval Solution (Dako, Carpinteria, CA, USA). The tissue sections were double stained for insulin (polyclonal guinea pig anti-insulin,1:2000 dilution; catalogue no. A0564, RRID:AB_10013624; Dako) and one of the following markers: CD68 for macrophages (monoclonal mouse anti-CD68, 1:2000 dilution; catalogue no. M0814, RRID:AB_2314148; Dako); CD45 for leucocytes (monoclonal mouse anti-CD45, 1:200 dilution; catalogue no. M0701, RRID:AB_2314143; Dako) or Ki67 for DNA replication (monoclonal mouse anti-Ki67, 1:160 dilution; catalogue no. M7240, RRID:AB_2142367; Dako) as previously described [8]. Antigen–antibody binding was visualised using the EnVision G/2 Doublestain (peroxidase-DAB and alkaline phosphatase-Permanent Red; catalogue no. K5355; Dako) polymer system. Subsequently, the slides were counterstained with Mayer’s Hematoxylin (catalogue no. S3309; Dako), dehydrated in ethanol and mounted with Cytoseal XYL media (Richard-Allan Scientific, Kalamazoo, MI, USA). Stained slides were then digitalised and processed in preparation for statistical analysis (see ESM Methods for image acquisition and processing details).
IHC and image digitalisation
(Ins, CD68, CD45, Ki67)
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
CD3, CD68, and glucagon stainingThe coimmunostaining for CD3, CD68, and glucagon was performed on the automated platform Discovery XT-VENTANA. After deparaffinization and antigen retrieval using CC1 solution, slides were incubated 1 hour at 37°C with a mix of anti-CD3 (A0452, Dako) and anti-CD68 (M0876, Dako) antibodies, before incubating anti-mouse (FP-SC 4110, Interchim) and anti-rabbit (FP-SB 5110, Interchim) secondary antibodies for 45 minutes at 37°C. Anti–glucagon-FITC antibody (BS-3796-A488, Interchim) was subsequently incubated for 45 minutes at 37°C. Slides were digitalized with the slide scanner NANOZOOMER 2.0RS/C10730-12 (Hamamatsu; objective ×20, resolution 0.46 μm/pixel). Image analysis was performed on the whole pancreas slide by using an algorithm from HALO platform combined with a tissue classifier (Indica Labs). Segmentation between exocrine/endocrine pancreas and other tissue types (connective tissues) were processed using Tissue Classifier based on color, texture, and contextual features. Islet regions were identified as a contiguous area of glucagon. CD3 and CD68 cells were detected according to thresholds of intensity within the endocrine and exocrine pancreas. The algorithm calculates the total number of cells within each pancreas part, the number of CD3+ cells, the number of CD68+ cells, and the areas of endocrine and exocrine parts of the pancreas. Quantification was performed under blinded conditions, with anonymized slides from control and T1D donors.
CD3, CD68, and glucagon staining
-
The HERV-W-Env IHC was performed on the automated platform Benchmark (Ventana, Roche) with the detection kit UltraView DAB (brown chromogen), without pretreatment. GN_mAb_Env03 monoclonal antibody was developed by GeNeuro and has already been validated in several publications (24, 25, 30). GN_mAb_Env03 monoclonal antibody was used at a concentration of 5 μg/ml for the 77 slides. Eight additional slides (4 T1D, 4 non-T1D) were used as controls, with mouse IgG2a isotype. Counterstaining was applied with hematoxylin II and bluing reagent. Slides were digitized with the slide scanner (Hamamatsu), objective ×20, and quantification was made using Indica Labs HALO platform. An algorithm was designed based on pattern recognition that discriminates pancreas tissue (analyzed areas) from fatty inclusions, vasculo-nervous structures, and surrounding connective tissue (excluded areas). Image analysis based on red, green, and blue (RGB) spectra was used to detect brown staining (DAB) within the positive areas (pancreas). The algorithm was designed to allow the detection of specific brown staining according to a threshold of intensity, and nonspecific edge staining of sections was not taken into account. It calculates pancreas area (mm²), staining area (mm²), and percentage (% stained area/pancreas area). Quantification was performed under blinded conditions, with anonymized slides from control and T1D donors.
HERV-W-Env staining using GN_mAb_Env03 antibody
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunohistochemistry Sections (4μm) from formalin fixed paraffin embedded pancreas tissues were deparaffinized and rehydrated with serial passage through changes of xylene and graded ethanol. All slides were subjected to heat induced antigen retrieval in Target Retrieval Solution (Dako). The tissue sections were stained for insulin as a part of routine collection protocol for nPOD tissues (previously described (Campbell-Thompson et al., 2016; Campbell-Thompson et al., 2012b)) or double stained for insulin (polyclonal guinea pig anti-insulin,1:1000 dilution, Dako (Santa Clara, CA)) and glucagon (monoclonal mouse anti-glucagon, 1:5000 dilution, Abcam, Cambridge, MA) by immunohistochemistry (IHC), scanned using an Aperio CS Scanscope (Leica/Aperio, Vista, CA), and stored in the nPOD online digital pathology database (eSLIDE version 12, Leica/Aperio). For donors indicated in Table S1, scanned images of insulin-stained slides available from the block(s) nearest to the tissues used for total protein extraction (described above) were evaluated for fractional insulin area using Indica Labs, Inc image analysis software (Corrales, NM). For insulin and glucagon double stained slides, antigen-antibody binding was visualized using the EnVision G/2 Doublestain System (Dako). For control (n=5) and T1D subjects (n=11), glucagon + insulin positive islets, glucagon positive islets, insulin positive single cells, and clusters of two to five insulin positive cells were annotated by hand using the Aperio viewing platform and analyzed using Image Scope, Leica Biosystems analysis software (Version 12.1.0.5029, Buffalo Grove, IL).
IHC and quantification of glucagon + insulin cells
-
Proinsulin, Insulin, C-peptide, Islet Amyloid Polypeptide and Glucagon by ELISA and Luminex Commercially available kits from ALPCO (Salem, NH) were utilized to measure total proinsulin, insulin and C-peptide from pancreas protein extracts as indicated in Table S1. The proinsulin, insulin and C-peptide assays are specific and do not cross react with each other. Glucagon was measured with a commercial ELISA assay provided by Mercodia (Winston Salem, NC). Islet amyloid polypeptide was measured by an assay from Millipore (Billerica, MA) using magnetic bead technology (Luminex). A total protein Bradford assay from Thermo-Fisher (Waltham, MA) was performed on each supernatant and used to normalize mass and extraction efficiency.
Proinsulin, Insulin, C-peptide, Islet Amyloid Polypeptide and Glucagon by ELISA and Luminex
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
In situ hybridizationSections were dried for 1 hour at 60°C, pretreated and hybridized with an hs-ITPR2 probe (Homo sapiens inositol 145-trisphosphate receptor type 2 (ITPR2) mRNA) for 2 hours at 40°C. Probes were custom-designed and labeled for use with RNAscope 2.5HD (Advanced Cell Diagnostics, Newark, CA, USA). Some sections were stained with Hs-PPIB or dapB probes as positive and negative controls, respectively. Amplification steps were performed prior to the detection of signals with 3,3′-diaminobenzidine. Sections were counterstained and mounted with Permount (Fisher scientific, Waltham MA, USA).
ISH with hs-ITPR2
-
ImmunofluorescencePancreatic slides were deparaffinized with Slidebrite (BioCare Medical, Concord CA) and dehydrated using graded ethanol concentrations. Slides were boiled in antigen retrieval citrate buffer pH6, blocked for 1hr with 2% normal goat serum, 2% bovine serum albumin, 0.5% Tween 20 in phosphate buffer saline followed by incubation with primary antibodies overnight at 4°C using different combinations. The staining series included antibodies to IP3R2 (Abcam, Cambridge, MA, USA 1:50), Translocase of outer mitochondrial membrane 20 (TOM20) (Santa Cruz biotechnologies, Dallas Texas, USA 1:50), VDAC-1 (Abcam, 1:100), mitofusin-2 (Abcam, 1:100), insulin (Dako, Carpinteria, CA, USA 1:150), glucagon (Abcam, 1:200). Secondary antibodies coupled to a fluorochrome (AF488, AF555, AF647, Life Technologies, Grand Island, NY, USA) were added for 30 min at RT according to the species of primary antibodies. Nuclei were stained with Hoechst 33342 (Sigma-Aldrich) and preparations were mounted in Prolong Gold anti-fade reagent (Life Technologies). Slides were analyzed with a slide scanner AxioScan.Z1 (Carl Zeiss SAS, Marly le Roi, France) at x40 magnification.
IF for IP3R2, TOM20, VDAC-1, mitofusin-2, insulin and glucagon
-
In situ proximity ligation assayDuolink II in situ proximity ligation assay (PLA) (Olink Bioscience, Uppsala Sweden) enables detection, visualization, and quantification of protein interactions (<40 nm) as an individual dot by microscopy. Primary antibodies to assess ER-mitochondria interactions were against IP3R2 (1:100) and VDAC-1 (1:200) as previously described [7]. Digitized slides were analyzed at x20 magnification. When necessary, beta cells and alpha cells were identified using anti-insulin and anti-glucagon antibody staining on the same slide. Dots were quantified in each islet using the Zen program and Fiji-ImageJ software and expressed as percentage of dots per nucleus. Experiments were performed at least twice using 2 to 5 non-consecutive slides for each donor. For Min6-B1 cultures, ER-mitochondria-interactions were assessed using a fluorescent PLA assay, employing antibodies directed against VDAC-1 (Abcam, 1:100) and IP3R1 (Santa Cruz laboratories, Dallas TX, USA 1:500) as described previously [10]. Experiments with Min6-B1 cells were performed at least three times, with a minimum of five fields taken per condition.
In situ proximity ligation assay (PLA) for assessing ER-mitochondria interactions
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
pancreatic islets examined (methods as previously described by Campbell-Thompson et al. [11]) from nine blocks encompassing the pancreas head, body, and tail regions demonstrated CD3+ infiltration (insulitis)
Insulitis determination
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunostaining and morphometric evaluation Paraffin sections were incubated overnight with primary antibody (Key Resources Table). For each antibody, sections were stained and imaged in parallel such that the staining intensity reflects the protein expression. For quantification, images were captured systematically covering the whole section in confocal mode on a Zeiss LSM 710 microscope. Every cluster of insulin-stained cells (3–7 cells) or islet (8 or more cells)/section was evaluated; sections were coded and read blindly. For each age, 3–4 animals were evaluated for each staining. For human samples, sections from one block from the body of the pancreas from donors as listed in Key Resources Table.
Immunostaining and morphometric evaluation
(includes p53BP1 and IGF1r)
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunofluorescence (IF) Image analysis was performed with Image Pro Premier software on randomly selected islets. For each islet, the difference of the mean intensity in the positive area (MIP), and the mean intensity in the negative area (MIN) (background) was measured (MIP-MIN). The differences between the groups and within the regions of each section were presented as the mean of (MIP-MIN) ± SD. All techniques, image acquisition and analysis have been validated by histology and microscopy specialists, at LJI which enabled us to rightfully quantify the IL-1β expression level.
Quantification of IL-1b IF
-
2.4. AnalysisIn situ hybridization (ISH) Islets were quantified by Image-pro Premier software (Media Cybernetics, Rockville, MD). For each islet, the percentage of the positive area (or positive staining, defined by Image-pro Premier software) within the islet boundary was assessed and the differences between the groups and within the regions of each section were presented as the mean of analyzed islets (mean±SD).
Quantification of IL-1b ISH
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Total terminal deoxynucleotide transferase–mediated dUTP nick end labelingApoptosis analysis was performed in a random sampling of T1D cases, as previously described (30), with modification; sections were predigested in 0.004% trypsin and identified with Cy5-labeled reagents. Total terminal deoxynucleotide transferase–mediated dUTP nick end labeling (TUNEL)–positive β cells were assessed in >95,000 islet cells per condition. In every sample, TUNEL-positive pancreatic ducts were imaged to ensure adequate TUNEL staining.
TUNEL
-
Proliferation analysisKi-67+ cells were measured within insulin-stained slides or ×20 magnification colorimetric images from optimal cutting temperature compound (OCT)–embedded pancreas sections prepared by the nPOD core laboratory, available through the nPOD Datashare. Colorimetric insulin and DAPI were identified using a sample-specific red-green-blue color range, established through sampling of multiple data points. Ki-67+ β-cell and Ki-67+ acinar proliferation was calculated as percent total cell population. Acinar cells were identified as nonislet cells containing DAPI.
Proliferation analysis for beta and acinar cells
-
Slides were imaged to quantify β-cell morphometry using Volocity 6.1.1 (PerkinElmer, Waltham, MA), as previously described (29). Images were acquired with Zeiss Axio Imager M1 (Carl Zeiss Microscopy, Thornwood, NY) with an automated X-Y stage and captured with Orca ER camera (Hamamatsu, Bridgewater, NJ), resulting in images of tens of thousands of individual nuclei per sample (summarized in Supplemental Table 3).
Beta cell morphometry
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Whole sections of pancreas stained for insulin, Ki67, and alcian blue with hematoxylin counterstain were digitally scanned using Aperio ScanScope (Aperio Technologies, Vista, CA). Analysis was performed using Aperio ImageScope version 11.0.2.725. Three sections per case, 1 each from head, body, and tail, were analyzed, except in 1 T1D case [6031] and 7 control cases (6010, 6012, 6013, 6015, 6017, 6021, 6022) in which only head and tail sections were available. All sections were examined and quantified in a blinded manner.Interlobular ducts were defined as ductal structures embedded in mesenchyme and possessing a PDG compartment. PDGs were identified as coiled invaginations composed of columnar epithelium arising from interlobular ducts and lying within the mesenchyme surrounding those ducts. The number of interlobular duct epithelial cells and PDG cells was counted, as was the number of those cells with nuclei staining for Ki67 and cytoplasmic staining for insulin. Small ducts, defined as intralobular ducts not embedded in mesenchyme, were comparably analyzed.
Ki67, Ins staining and analysis in PDG
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Immunohistochemistry was performed using a standard immunoperoxidase approach, as previously described [21]. To examine multiple antigens within the same FFPE section, samples were probed in a sequential manner with up to three different antibodies (ESM Tables 3, 4). The mean fluorescence intensity (MFI) of stained antigens was measured using ImageJ Version 1.50b Java 1.8.0_77; https://imagej.nih.gov/ij/download.html. Some slides were processed with isotype control antisera to confirm the specificity of labelling (ESM Fig. 1). Frozen sections were stained using a standard immunofluorescence approach [22].
Immunohistochemistry
(HLA, Ins, Glu, NLRC5, STAT1, B2M abs determined from supplementary)
-
Using the Affymetrix Human Gene 2.0 ST array, CEL files were generated from both control and type 1 diabetic donors, as previously described [24]. Raw signal-intensity values from Affymetrix spike-in controls demonstrated that array hybridisation had been successful (i.e. bioB<bioC<bioD<Cre). Data quality was verified by measuring the positive vs negative area under the curve. Raw signal-intensity values from all arrays were robust multichip average background corrected, quantile normalised, median polish summarised and log2 transformed [25–27]. NetAffx-determined probe-set annotations for HLA genes (Affymetrix) were re-mapped according to RefSeq, release 73 (15 November 2015; see ftp://ftp.ncbi.nlm.nih.gov/refseq/release/release-catalog/archive/). For each HLA gene, where multiple mappings were possible (i.e. HLA-A, -B, -C and -F), probe sets were annotated according to eight major haplotypes incorporated into the human genome assembly, as previously described [28]. Because probe sets shared mappings, it was not possible to identify HLA subtypes uniquely using this gene chip; rather, transcript clusters were used to examine changes in global gene expression. Processing was carried out using the Partek Genomics Suite, version 6.5 (Partek, St Louis, MO, USA). The resulting normalised expression data for specific genes of interest were then subjected to analysis as described below.
HLA gene expression profiling
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Human pancreas sections were deparaffinized, followed by acidic-pH heat–mediated antigen retrieval. Cultures of single pancreatic islet cells were fixed with 4% paraformaldehyde. Samples were blocked and permeabilized in PBS with 0.3% Triton X-100 and 10% goat or donkey serum. Primary antibodies CHOP (1:100; sc-575, Santa Cruz Biotechnology), GAD6 mouse monoclonal antibody (mAb) against C-terminus of GAD65 (31) (1:1,000); N-GAD65 mouse mAb against the N-terminus of GAD65 (32) (1:300), giantin (1:1,000; ab24586, Abcam); insulin (1:10,000; 4011-01, Linco); insulin (1:2,000; ab14042, Abcam), and CD3 (1:30; M7254, Dako) were incubated overnight at 4°C in PBS with 0.3% Triton X-100 and 1% goat or donkey serum. Alexa Fluor conjugated secondary antibodies (Molecular Probes) were incubated at 1:200 dilution in PBS with 0.3% Triton X-100 for 30 min at room temperature.Image Capture, Analysis, and QuantificationSamples were imaged on a Zeiss LSM700 confocal microscope with 63×/1.40 NA Plan-Apochromat oil-immersion objective for single islet cells and 40×/1.30 NA Plan-Apochromat oil-immersion objective for pancreatic tissue sections. All images for quantification within a single experiment were captured with the same laser power and detector gain. The ratio of GAD65 mean fluorescence intensity (MFI) in the Golgi compartment and post-Golgi vesicles compared with the rest of the cytosol was calculated with a custom ImageJ macro. Individual β-cells in a given field of view were identified and outlined by hand. For each cell, the macro automatically defined a region of interest (ROI) outlining the Golgi compartment, identified by giantin costain or by characteristic morphology and brightness thresholding of GAD65 stain, and GAD65+ vesicles, identified by brightness thresholding of GAD65+ bright puncta. A second ROI defined the remainder of the cell, excluding the Golgi, GAD65+ vesicles, and nucleus. GAD65 Golgi accumulation was reported as the ratio of MFI for the two ROIs.
Staining and quantification of GAD65 Golgi accumulation
-
-
academic.oup.com academic.oup.com
-
Morphometric analysis was carried out with a semiautomated process, as described in Supplemental Methods and Supplemental Figure 1. This process allows analysis of the whole section. Lymph nodes (found in five slides from control Ab− subjects, 1%), and regions with edge artifacts or nonspecific staining were manually excluded. For each slide, we quantified the total tissue area and separated it into exocrine and nonexocrine tissue (adipose and mesenchymal tissues, large ducts, and vessels) vs the insulin-stained area. The percentage of the total tissue area was converted into mass by multiplying it by the weight of the pancreas when available. When the weight of the pancreas was not available, only the ratio of the endocrine area to the total area was calculated. We used Photoshop CS4 (Adobe Systems) to perform thresholding on whole sections, and measurements were performed using ImageJ (http://rsbweb.nih.gov/ij/). Given that only the cytoplasm was stained for β-cells using the insulin Ab, we developed another Photoshop script to quantify the surface of the entire islet.
Morphometric analysis of section images
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Insulitis Leukocyte PhenotypingParaffin sections from blocks having the maximum insulitis frequency for each donor were stained, and positive leukocytes/insulitic islets (six or more CD3+ cells) were counted using multi-immunofluorescence. Serial sections (4 μm) were dewaxed and rehydrated with Tris buffer. Heat-induced antigen retrieval was performed using Trilogy (Cell Marque, Rocklin, CA) at 95° for 20 min followed by rinsing in water for 20 min. The staining series was designed to phenotype leukocytes (total leukocytes [CD45], T [CD3] and B [CD20] lymphocytes, T-lymphocyte subsets [CD4 and CD8], and monocytes [dendritic cells (CD11c) and macrophages (CD68)]) (21) in conjunction with subtyping islets for insulin immunopositivity. The staining series was as follows: 1) CD45+glucagon+insulin, 2) CD20+CD3+glucagon, 3) CD8+CD4+glucagon, and 4) CD11c+CD68+insulin. Chromogranin A staining was also used to delineate endocrine cells. Antigens are listed in order of primary antibody incubation, and the corresponding secondary antibody and conjugated fluorochrome (AF488-AF555-AF647) (Supplementary Table 2). After blocking, sections were sequentially incubated with the primary antibody followed by the appropriate secondary antibody. For anti-CD4, a Cy3 Tyramide Signal Amplification Kit (PerkinElmer, Waltham, MA) was used according to the manufacturer's instructions. All sections were mounted with ProLong Gold Antifade mounting media containing DAPI (Life Technologies, Grand Island, NY). Positive controls included human spleen, tonsil, and donor intrapancreatic lymph nodes, and negative controls included omission of the primary antibody.The numbers of leukocytes/insulitic islets were determined using multichannel image acquisition software on a Zeiss Axiophot microscope (AxioVision; Carl Zeiss Inc., Thornwood, NY). Fluorescent channels were viewed in combination with DAPI to count the number of positive leukocytes/islet.
Insulitis Leukocyte Phenotyping
-
β-Cell and α-Cell Area and MassInsulin- and glucagon-immunopositive areas were determined using the IHC sections to estimate β-cell and α-cell areas, respectively, in relation to total tissue area using a single Aperio colocalization algorithm (22). An average of six sections was used per donor (two sections/head, body, and tail regions). The β-cell and α-cell areas were expressed as a ratio (percent) to the total sectional area, including acinar and interstitial regions, to permit the use of pancreata weights. The average β-cell and α-cell area per pancreas was calculated from regional area averages. The β-cell or α-cell mass (in milligrams) was calculated by multiplication of the respective average area and pancreas weight (in grams).
Beta Cell and Alpha Cell Area and Mass
-
Insulitis Screening and Insulitic Islet Subtyping for Insulitis FrequenciesPancreata were processed to formalin-fixed paraffin blocks for each pancreas region (head, body, and tail) as previously described (20). For each donor, serial sections (average two blocks per region) were stained by hematoxylin-eosin and two double-immunohistochemistry (IHC) stains (Ki67 and insulin, CD3 and glucagon) (Supplementary Table 2) (21). When insulitic islets were found in a given donor, additional blocks were screened (as detailed below). Stained sections were scanned at ×20 magnification using an Aperio CS scanner (Leica/Aperio, Vista, CA), and all images were stored in an online pathology database (eSLIDE; Leica/Aperio).Screening for insulitic islets was performed on CD3+ glucagon–stained sections. An islet was defined as ≥10 α-cells. Insulitis was defined as an islet with six or more CD3+ cells immediately adjacent to or within the islet with three or more islets per pancreas section, according to recent criteria (4). Islets with insulitis were marked in an image layer using ImageScope software (Leica/Aperio). The two IHC serial images were aligned using the synchronization tool, and insulin+ islets were also marked on the image layer. All islets/sections from donors with insulitis were subsequently subtyped as follows: 1) insulin+ CD3−, 2) insulin+ CD3+, 3) insulin− CD3+, and 4) insulin− CD3− (see Table 1 for numbers of islets analyzed). Then, all islets were counted by subtype. The process was reversed for AAb+ donors (i.e., islet subtypes were counted using the Ki67-insulin image after markup for CD3+ insulitic islets and insulin− islets using the CD3-glucagon image). The number of pancreas sections subtyped for insulitis ranged from 2 to 16 sections/donor (8.1 ± 4.1 sections/donor, n = 162 sections) (Table 1). The lowest number of available sections was due to partial pancreas recovery (tail only in nPOD 6198).Insulitis frequency (percent) was calculated as the total number of insulitic islets (sum of insulin+ CD3+ and insulin− CD3+ islets) divided by the total number of islets (sum of four subtypes). The frequency of insulin+ insulitic islets in relation to the total number of insulin+ islets was determined by the ratio of (insulin+ CD3+ islets)/(sum of insulin+ CD3− and insulin+ CD3+ islets) with similar calculations for the frequency of insulin− insulitic islets (insulin− CD3+)/(sum of insulin− CD3+ and insulin− CD3−).
Insulitis Screening and Insulitic Islet Subtyping for Insulitis Frequencies
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
The pancreas was weighed intact and/or after dividing it into three regions (head, body and tail) by cutting the junction between head and body at the notch and dividing the remaining portion in half for body and tail regions.
Pancreas weighing
-
-
link.springer.com link.springer.com
-
To monitor the cellular distribution of cyclin-D isoforms, pancreatic sections were stained with either an anti-cyclin-D3 antibody plus HRP–goat anti-mouse IgG and Alexa Fluor 488 tyramide (Life Technologies, Eugene, OR, USA), or an anti-cyclin-D1 antibody plus HRP–goat anti-rabbit IgG and Alexa Fluor 488 tyramide. The tyramide amplification steps were used to enhance the fluorescence signal and were performed according to the manufacturer’s instructions (Life Technologies). Pancreatic sections were co-stained with an anti-glucagon antibody raised in either mouse or rabbit (each from Abcam) and with guinea pig anti-insulin (Dako, Ely, UK) plus relevant secondary antibodies labelled with Alexa Fluor 568 and Alexa Fluor 647 (Life Technologies), respectively. Images were captured under fluorescence illumination using a Leica AF6000 microscope (Leica, Milton Keynes, UK).
Staining for cyclin-D3 and cyclin-D1
-
-
link.springer.com link.springer.com
-
Insulitis was defined by a recent guideline which stipulates that the total number of leucocytes in close contact with the islet boundary (peri-insulitis) and within the intra-islet areas is equal to or greater than 15 [29].
Quantification of insulitis
-
Peri- and intra-islet CD45 cells were enumerated manually in all sections. For the diabetic group, observers were blinded to the case details, including autoantibody status. Islets with approximately ≥20 endocrine cells were analysed. Single glucagon and insulin cells scattered within the exocrine region were not enumerated, while sections from diabetic cases containing small islets (20 cells) but harbouring at least one insulin cell were recorded. The total numbers of insulin-positive and -negative islets in the pancreatic head, body and tail were also recorded in each section.
Quantification of CD45 cells and islets
-
Sections (5 μm) were de-paraffinised, rehydrated and subjected to antigen retrieval with citrate buffer containing 0.05% Tween-20 (Sigma-Aldrich, St Louis, MO, USA). During immunohistochemistry, PBS, pH 7.4, was employed as a wash step. Sections were equilibrated in PBS and blocked with 5% normal goat serum (Sigma-Aldrich) for 1 h at 37°C. A mixture of guinea pig anti-insulin serum (A0564, dilution 1:600; Dako, Glostrup, Denmark) and rabbit anti-glucagon serum (A0565, dilution 1:200; Dako) in 5% normal goat serum (Sigma-Aldrich) was applied and incubated for 1 h at 37°C. Highly cross-adsorbed species-specific goat anti-guinea pig IgG-Alexa 568 (A11075; Invitrogen, Eugene, OR, USA) and goat anti-rabbit IgG-Alexa 488 (A11034, dilution 1:600 in 5% normal goat serum; Invitrogen) were then applied as a mixture and incubated as in the previous step. Sections were incubated with mouse anti-human CD45 (M0701; Dako; clones 2B11 + PD7/26, dilution 1:100 in PBS + 0.1% Tween-20) for 16 h at 4°C, washed and reacted with 3% H2O2 for 15 min. After washing, sections were incubated sequentially with donkey anti-mouse IgG-biotin (715-065-150; Jackson ImmunoResearch, West Grove, PA, USA, dilution 1:200 in PBS + 0.1% Tween-20) and streptavidin-horseradish peroxidase (016-030-084; Jackson ImmunoResearch, dilution 1:200 in PBS/0.1% Tween-20). They were finally exposed to a diaminobenzidine chromogenic mixture (Sigma-Aldrich) to visualise CD45 cells. Non-immune serum or IgG from the immunising species and omission of primary antibodies acted as negative controls.Sections were examined with a Nikon Eclipse E600 microscope under epifluorescence and bright field microscopy and digital images were recorded. All islets in a section with ≥20 endocrine cells were imaged for the presence of insulin, glucagon and CD45 cells and each of the three image sets from multiple acquisitions merged with Adobe Photoshop CS4 following conversion of CD45-positive cells to a greyscale fluorescence mode.
Staining and imaging of CD45, insulin, glucagon in pancreatic sections
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
For morphometric comparison of human islets from 12-LO-positive and -negative cases, a composite image of 50 visual fields at ×200 magnification (area of 50 000 μm2) was captured using the mosaic function of AxioVision analysis software (v4.7; Zeiss). Five composite images of the pancreas were obtained per case, and at least 3 cases per group were studied. Areas positive for insulin or 12-LO were defined by setting a threshold signal for each antigen, and the size of the positive area was quantified automatically based on this threshold. Hematoxylin and eosin (HE)-stained images on the nPOD website from serial sections of the blocks we analyzed were used to determine the islet area for each donor. To quantitate the PP staining intensity, images of 30 islets from the uncinate and nonuncinate areas of pancreas sections immunostained for PP were analyzed for mean densitometric values of PP+ areas using AxioVision v4.7. To normalize staining, mean densitometric background staining with nonimmune serum was subtracted from values obtain for the PP sections. Observers blinded to the clinical information of donors performed all measurements
12-LO staining and analysis
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Paraffin embedded pancreatic sections from female cadaveric donors including non-diabetic controls and type 2 diabetes patients were obtained from the Juvenile Diabetes Research Foundation (JDRF)-sponsored Network for Pancreatic Organ Donors with Diabetes (nPOD) program (http://www.jdrfnpod.org/for-investigators/online-pathology-information/). Insulin positive (Ins+) β-cells were used for staining and quantification.
Staining and quantification of UPR markers
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Concomitant fluorescence in situ hybridization (FISH) and immunofluorescenceParaffin sections were deparaffinized in a xylene series followed by heat mediated antigen retrieval. Slides were then dehydrated in an ethanol series (70%, 80% and 100%) and air dried. Frozen sections were fixed in ice-cold pure ethanol for 10 min and air-dried prior to in situ hybridization. Purified human islets were cultured on rat tail type I collagen coated coverslips. They were fixed in 1% paraformaldehyde for 15 min, then simultaneously permeabilized and blocked in 0.1% (w/v) saponin (Sigma, S4521), 3% BSA solution for 45 min, and subsequently dehydrated in ethanol series. After pre-treatments, tissue sections or cell preparations were incubated with X/Y chromosome FISH probes (Vysis CEP X Spectrum Orange™/Y Spectrum Green™ Direct labelled Fluorescent DNA probe, Abbot Molecular Inc., Des Plaines, IL) as described previously [10]. To study aneuploidy/polyploidy, the CEP 18 probe (Abbot Molecular Inc.) was used in combination with the X/Y probe. After post-hybridization washes, sections or cells were incubated with primary antibodies (and controls as appropriate) specific for insulin (DAKO, A0564), glucagon (DAKO, A0565), somatostatin (Santa Cruz, SC-13099), GATA4 (Santa Cruz, SC-1237), Cytokeratin-19 (Abcam, Ab9221), Ki67 (Abcam, Ab833), CD68 (DAKO, m0876), CD45 (DAKO, M0701), nestin (Millipore MAB5326), or CD34 (Invitrogen, 073403) for 2 hrs at 37°C. After probing with the corresponding fluorescent secondary antibody for 1 hr at room temperature, sections were washed three times in 1× PBS solution, dehydrated, and counterstained with DAPI permanent mounting media (VECTASHIELD®, Vector laboratories, CA).Image analysisFluorescent imaging Images were captured using an Olympus BX41 fluorescent microscope fitted with an AxioCam MRm digital camera (Zeiss, Germany). The X and Y chromosomes were analyzed using the ISIS fluorescent imaging software (Zeiss, Germany) designed for FISH.Confocal microscopy To confirm MMc frequencies, pancreatic tissue sections were screened using a Leica SP5 confocal imaging system at the Wolfson Bioimaging Facility, School of Biochemistry, University of Bristol, UK. Z-stack images of each tissue section were analyzed for FISH and immunofluorescence to allow visualization of X and Y chromosome signals in all planes of the nucleus.Counting strategyFISH signals were checked in individual filter channels to ensure signal fidelity and that the visualization of two red dots representing two copies of the X chromosome was not caused by immunofluorescence cross talk. Only cells that showed clear XY (red and green dot) or XX (two red dots) signals within single nuclei were counted. Any cells with overlapping nuclei were excluded from the analysis. X chromosome “splits” that occasionally appeared as two juxtapositional dots due to DNA breakage were not considered as XX signals. A FISH success rate (the frequency of nuclei with two clear signals visible) of greater than 60% was required before further analysis.All T1D and matched control tissues were stained for FISH and insulin. Overall, as many nuclei as possible were counted (>1000 at least), including at least 20 islets per section. MMc were counted in insulin positive and insulin negative cell fractions. For T1D case 1, 2, and 3, MMc were also examined in CD45+ population. An additional independent, blinded scorer reviewed each candidate female cell.
FISH and image quantification of MMc
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Human ADORA1-VAR. Human pancreas RNA samples with intact 18S and 28S rRNA were used for these studies. Primers were designed to examine if a human equivalent of the mouse Adora1-Var is expressed in the pancreas (Table 2, primer set 5). The forward primer spans exon 2 and 4 and only detects a splice variant lacking exon 3 of the ADORA1 gene ({"type":"entrez-nucleotide","attrs":{"text":"NM_000674.2","term_id":"115305570","term_text":"NM_000674.2"}}NM_000674.2). Primers targeting only exon 3 were designed to detect the full-length human ADORA1 gene (Table 2, primer set 4). For cloning into TOPO, primers spanning the start and stop codon of ADORA1-VAR were used (Table 2, primer set 3). Fusion proteins were synthesized by standard subcloning techniques using the PCR primers listed in Supplementary Table 1.
Human ADORA1-VAR RT-PCR
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Paraffin-embedded pancreatic sections from diabetes-free controls and T1D patients were obtained from the Juvenile Diabetes Research Foundation (JDRF)-sponsored nPOD program (http://www.jdrfnpod.org/online-pathology.php). Sections were used for staining and quantification of expression levels of selected UPR markers.
Staining and quantification of UPR markers
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Human Patient SamplesFrozen sections of human pancreata were obtained from the Network for Pancreatic Organ Donors with Diabetes (nPOD), a collaborative T1D research project sponsored by the Juvenile Diabetes Research Foundation International (JDRF). We used sample/CaseID as indicated on the nPOD website. A total of four T1D and five T2D samples were selected for this study based on their blood glucose, body mass index (BMI) values, and history of diabetes. Samples from healthy patients (n=5) were used as a control. All patient samples used in the study were excised from the tail of the pancreas.Immunohistochemistry of Pancreatic Sections and CellsHuman and mouse pancreatic sections were co-immunostained with IC2, anti-insulin and anti-glucagon or anti-somatostatin antibodies. Frozen sections (5–7-µm thick) were fixed with 4% formaldehyde for 5 min, washed with PBS and blocked with 2% BSA in PBS for 1 hr at room temperature. IC2 (1 µg/ml) and guinea pig anti-insulin (Abcam, Cambridge, MA) and rabbit anti-glucagon antibodies (Abcam), diluted to 1:50 and 1:100, respectively, were mixed in 2% BSA, added to the sections and incubated at room temperature for 2 hr. Then, sections were washed with PBS and incubated in the mixture of goat anti-rat IgM-AF594 (1: 1000 dilution, Invitrogen, Carlsbad, CA), goat anti-guinea pig IgG (H+L)-FITC (1:200 dilution, Abcam) and goat anti-rabbit IgG (H+L) AF-680 (1:500 dilution, Invitrogen) for 2 hr. Next, the sections were washed with PBS, mounted in ProLong® Gold anti-fade reagent with DAPI (Invitrogen), and observed under fluorescence microscope. For pancreatic sections from human patients, the fluorescence intensity was scored on a scale of 1 to 5 by two blinded investigators. In all of these experiments, an irrelevant purified rat monoclonal IgM was used as control for IC2. Staining without primary antibodies was also used as a control.
Staining and scoring for IC2, insulin, glucagon and somatostatin
-
-
link.springer.com link.springer.com
-
Combined immunofluorescence For co-localisation studies, anti-insulin and anti-VP1 immunoreactivity were detected using an AlexaFluor 488-conjugated anti-guinea pig antibody and an AlexaFluor 568-conjugated anti-mouse antibody, respectively (Invitrogen, Paisley, UK). To determine whether the enteroviral VP1 protein co-localised with either PKR or Mcl-1 in beta cells, primary antibodies were incubated as described in ESM Table 3. The primary antibodies were detected with relevant goat secondary antibodies conjugated to AlexaFluor 488 or 568 (Invitrogen) or with goat anti-guinea pig DyLight 405 (Stratech, Newmarket, UK). Control sections were stained with relevant primary and secondary antisera to confirm that no cross-reactivity was detected. Sections were mounted in Vectashield hard-set mounting medium (Vector Laboratories, Peterborough, UK) under glass coverslips. Images were captured using a Nikon Eclipse 80i microscope (Nikon, Kingston upon Thames, UK) and overlaid using NIS-Elements BR 3.0 software (Nikon) to study the relative localisation of each antigen. Sections directly adjacent to those stained using the combined method were stained with an anti-glucagon (rabbit; Dako) or an anti-insulin (guinea pig; Dako) antibody using a standard immunoperoxidase technique to determine total islet numbers in the sections and to distinguish insulin-containing islets (ICIs) from insulin-deficient islets (IDIs).
VP1 combined staining with insulin, PKR and Mcl-1
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Quantitative real-time RT–PCR in tissue, cells, and polysome fractionsTotal RNA was extracted using Trizol reagent and the Qiagen RNeasy mini kit or micro kit, as previously described (Yip et al., 2009). First-strand cDNA was generated using the iScript cDNA synthesis kit (Biorad). Quantitative PCR was performed to measure mouse Eif4g3, Eif4g1, Casp3, Deaf1, Ins2, Fgb, Ela, Ppy, Tyr, Ambp, Gapdh, and Actb mRNA levels, and human EIF4G3, EIF4G1, CASP3 and ACTB, and GAPDH mRNA levels. cDNA was preamplified using the Taqman PreAmp Mastermix (Applied Biosystems) prior to QPCR for Ins2 and for gene expression measured in polysome fractions and LNSC subsets. For all other experiments, cDNA was not pre-amplified. qPCR assays were performed using the 7900HT Fast Real Time PCR System (Applied Biosystems), Taqman Gene Expression Arrays (Applied Biosystems), and SsoFast Probes Supermix (Biorad). For human CASP3 measurements, Quantitect primers (Qiagen) and SsoFast EvaGreen Supermix (Biorad) were used. The comparative Ct method for relative quantification (ΔΔCt) was used, and expression was normalized with housekeeping gene expression.
Quantitative RT-PCR of human (EIF4G3, EIF4G1, CASP3, ACTB, GAPDH) and mouse
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Initial screening for insulin, MHC class I, and CD8. For characterization of the sections before tetramer staining, staining for insulin, CD8, and HLA-ABC (all at room temperature) was performed using the antibodies listed in Table 3. Fixation was with acetone and sections were blocked with goat serum in a standard immunofluorescent staining protocol. An islet was determined as hyperexpressing MHC class I based on a threshold of three unequivocally positive cells, which was the maximum number found in all control islets examined.Table 3.Antibodies used for characterization of the sections prior to tetramer stainingAntigenPrimary antibodyDetection antibodyInsulinPolyclonal guinea pig anti-insulin (Dako; 1/140 dilution, 1-h incubation)Polyclonal goat anti–guinea pig IgG, highly cross-adsorbed, Alexa Fluor 488 (Invitrogen; 1/1000 dilution, 30-min incubation)HLA-ABCMouse monoclonal (clone W6/32) IgG2a against a monomorphic epitope on the 45 kD polypeptide products of the HLA-A, B and C loci (Dako; 1/100 dilution, 1 h incubation)Polyclonal goat anti–mouse IgG2a, isotype-specific, Alexa Fluor 594 (Invitrogen; 1/1000 dilution, 30-min incubation)CD8Mouse monoclonal (clone HIT8a) IgG1 against the CD8 alpha subunit (BD; 1/100 dilution, 1-h incubation)F(ab’)2 fragment of goat anti-mouse IgG, Alexa Fluor 594 (Invitrogen; 1/1000 dilution, 30-min incubation)
Initial screening for insulin, MHC class I, and CD8
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
nPOD central AAb core laboratoryThe nPOD central AAb core laboratory has a long history of excellence in the type 1 diabetes AAb field 10, 13, 15, 21, 22, participating routinely in the Diabetes AAb Standardization Program (DASP), now renamed IASP. The nPOD central AAb core began testing for ZnT8A in nPOD cases using RBA prior to the introduction of the ZnT8A ELISA. This core also tests for IAA as there is currently no reliable ELISA for this analyte. Every case with available serum that is referred to nPOD is tested via RBA for GADA, IA‐2A, ZnT8A and IAA for either confirmation of the ELISA screening results, or for determination of final AAb status. In cases of discrepancy, the RBA supersedes the ELISA as the result reported on the nPOD website (www.jdrfnpod.org).
nPOD AAb core laboratory
-
-
link.springer.com link.springer.com
-
Morphometric analysis Beta cell area (defined as the area of cells stained by insulin) was quantified using computer-assisted morphometric analysis of slides digitally stored in the Aperio System. We obtained the ratio between the insulin stained areas and the total pancreatic section area, i.e. the relative volume of beta cells in patients with diabetes and in normal controls. For each diabetic pancreas we then determined the beta cell index defined as the relative volume divided by the mean relative volume of beta cells of controls multiplied by 100. The beta cell index thus expressed the beta cell area of each diabetic pancreas as a percentage of normal control pancreases. Double immunofluorescent staining for insulin and glucagon was used to determine the percentage of islets devoid of beta cells in pancreases with residual beta cells (i.e. the percentage of insulin-deficient islets). In each section we determined the percentage of insulin-deficient islets (i.e. islets composed of non-beta cell vs the total number of islets). Only islets completely devoid of beta cells were considered insulin-deficient islets.
Morphometric analysis of beta cells and islets
-
For each childhood-onset case, the pancreas was processed in three regions (head, body and tail) and fixed overnight in 10% (vol./vol.) neutral buffered formalin (ThermoFisher, Waltham, MA, USA) prior to processing to paraffin blocks. Tissue sections (5 μm) were obtained stained with haematoxylin and eosin, immunohistochemistry and immunofluorescence. Pancreatic tissue sections were stained: (1) with antibodies to insulin or glucagon, and a panleucocyte marker CD45 and/or a T cell marker (CD3; and in a subset of diabetic pancreases with CD4, CD8, CD20 and CD68 antibodies); and (2) with a cocktail of antibodies to endocrine non-beta cell hormones composed of glucagon, pancreatic polypeptide and somatostatin. In diabetic pancreases with insulitis (as defined below), the infiltrating T cells were further characterised with antibodies to CD4 and CD8 (as well antibodies to CD20 and CD68 to detect B lymphocytes and macrophages). Antibody binding was detected with appropriate secondary antibodies to guinea pig, rabbit and mouse immunoglobulins conjugated with alkaline phosphatase and peroxidase (MACH2 Polymer Systems; Biocare, Concord, CA, USA), followed by chromagen development with fast red (Vector, Burlingame, CA, USA) or diaminobenzidine (Vector). A scanner (CS ScanScope; Aperio, Vista, CA, USA) was used to produce whole slide images for both haematoxylin and eosin and immunohistochemistry-stained slides. In a subset of diabetic pancreases (pancreases containing residual beta cells), the pancreas was also double-stained with antibodies to insulin and class I HLA molecules. Immunofluorescence was performed by incubating the tissue sections with antibody to insulin, glucagon and survivin (Abcam, Cambridge, MA, USA), and with appropriate anti-rabbit and anti-guinea pig immunoglobulins conjugated with aminomethylcoumarin acetate, Cy3 or Cy5. The sections were photographed at ×20 magnification using a microscope B651 (Olympus America, Center Valley, PA, USA) connected with a digital imaging system (Image pro plus, version 6.2; Media Cybernetics, Bethesda, MD, USA) with a camera (Pro 150ES; Pixera, San Jose, CA, USA). Additional images were recorded on an epifluorescence microscope (Microphot FXA; Nikon Instruments, Melville, NY, USA) with a monochrome digital camera (Roper Micromax; PerkinElmer, Waltham, MA, USA) and appropriate software (Intelligent Imaging Innovations, Denver, CO, USA). The photos are displayed in pseudocolour. Immunoperoxidase staining of survivin was performed by incubating the sections with antibody to survivin and visualising with Cytomation Envision+System-HRP (DAB; Dako, Carpenteria, CA, USA). Class I HLA immunostaining was performed with mouse monoclonal anti-human HLA-ABC, Clone W6/32 (Dako), directed against a monomorphic epitope on the 45 kDa polypeptide products of the HLA-A, -B and -C loci. Insulin was detected with polyclonal guinea pig anti-swine insulin (Dako). All secondary goat antibodies (Life Technologies, Carlsbad, CA, USA) were highly cross-adsorbed against the host species of the other primary antibodies and conjugated with Alexa 488 (green) or 594 (red). Anti-fade reagent (Prolong Gold) with DAPI (Life Technologies) was applied upon staining and sections were imaged using an epifluorescence microscope (Eclipse 80i; Nikon) equipped with a mercury arc lamp (X-Cite, Mississauga, ON, Canada) and a digital camera (DXM1200C; Nikon). An air objective (×20; Nikon) was used with a 0.75 N.A. Positive and negative controls for HLA-ABC staining included human spleen and isotope-matched primaries, respectively. Cross-reactivity with the insulin primary was also experimentally excluded. In additional experiments, HLA immunofluorescence staining was performed with rabbit polyclonal antibody (Abcam). An irrelevant rabbit polyclonal antibody served as a negative control.
Insulin, glucagon, survivin and HLA staining
-
- Jan 2020
- Dec 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
SGCA
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
TPM2
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
TPM2
-
- Nov 2019
- Oct 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
SLC1A1
-
-
pmc.ncbi.nlm.nih.gov pmc.ncbi.nlm.nih.gov
-
FBXO11
-
developmental delay
-
- Sep 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
RNF13
-
- Aug 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
NEB
-
-
www.sciencedirect.com www.sciencedirect.com
- May 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
- Feb 2019
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
UBE2A
-
UBE2A
-
- Nov 2018
-
www.cell.com www.cell.com
- Aug 2018
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
EXTL3
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
- Jul 2018
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
EXTL3
-
EXTL3
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
LINC00520
-
-
pubmed.ncbi.nlm.nih.gov pubmed.ncbi.nlm.nih.gov
-
On 2016 Aug 25, Theodore I Lidsky commented:
Keller (1) comments on the paper “ Is the aluminum hypothesis dead?” (2) that “Lidsky points out that the clinical presentation of dementia caused by elevated aluminum levels in dialysis patients is clearly distinct from that of true Alzheimer-type dementia.” Keller continues, however viz: “ As a primary-care physician who must answer patients' questions about the risks of dietary aluminum, that distinction truly makes no difference to patients or to myself.”
The kidneys are the primary route of elimination of aluminum. The aluminum-induced dementia described in my paper was observed, and is only observed, in patients with renal insufficiency. Brain concentrations of aluminum of the levels described in cases of dialysis encephalopathy (3) are not found in individuals with normal renal function exposed to dietary aluminum.
Keller D. Dementia caused by elevated aluminum levels in dialysis is not Alzheimer's disease: a distinction without a difference. 2016 Aug 07.
Lidsky TI. Is the aluminum hypothesis dead? J Occup Environ Med. 2014;56(5)(suppl): S73-S79.
Alfrey AC, LeGengre GR, Kaehny WD. The dialysis encephalopathy syn-drome. New Eng J Med. 1976;294:184–188.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Feb 11, Marco Ventura commented:
I do not understand what is the novelty of this study. Very similar studies have been already published about the comparative genomics of the genus Bifidobacterium. Just as a remark for the authors and for the potential readers that are not from this field: see the following papers published in August 2014:
Milani, C., Lugli, G.A., Duranti, S., Turroni, F., Bottacini, F., Mangifesta, M., Sanchez, B., Viappiani, A., Mancabelli, L., Taminiau, B., Delcenserie, V., Barrangou, R., Margolles, A., van Sinderen, D., and Ventura, M. 2014. Genome encyclopaedia of type strains of the genus Bifidobacterium. Appl. Environ. Microbiol. 80(20):6290-302.
Lugli, G.A., Milani, C., Turroni, F., Duranti, S., Ferrario, C., Viappiani, A., Mancabelli, L., Mangifesta, M., Taminiau, B., Delcenserie, V., van Sinderen, D. and Ventura, M. 2014. Investigation of the evolutionary development of the genus Bifidobacterium by comparative genomics. Appl. Environ. Microbiol. 80(20):6383-94.
Enjoy the reading
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Sep 25, Kenneth Witwer commented:
As stated in a letter to the editor (Witwer KW, 2015), monocot-specific MIR528 was the apparently most abundant and best-absorbed miRNA in this study, more abundant than all other detected plant miRNAs combined. Watermelon--the only material ingested by the study volunteers--is a dicot. No sequences identical to mature or precursor MIR528 are found in watermelon sequences in public databases, nor in any currently available dicot genomes. In response to this observation and as evidence for the existence of dicot MIR528, the authors refer to Lin Y, 2013, in which a putative MIR528 relative was identified in an RNA sequencing library prepared from the dicot Dimocarpus longan. This sequence, CTGGAAGTGGATGCAGAGGG, has no fewer than five nucleotide differences from monocot MIR528, gUGGAAGGGGCAUGCAGAGGAGc (lower case letters are precursor nts surrounding the mature miRNA). No such sequence appears to be found in the public genomes or transcriptomes of watermelon or other dicots. The putative longan sequence matches better to various sequences with a common 18-nt stretch found in dicots, but also in animals, than to MIR528. Even if the putative dicot MIR528 sequence were a microRNA, the two differences from monocot at the 3' end would interfere with stem-loop reverse transcription by the monocot-specific assay used by the authors. In any case, for a dicot plant to express an otherwise monocot-specific miRNA, the sequence would first have to be present in the genome of the dicot. Unless and until genomic evidence is provided, MIR528 detected in watermelon or watermelon-fed humans must be presumed to be a contaminant or other artifact.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 22, Stefan Hofmann commented:
Stefan G. Hofmann, Nora Esser, and Giovanbattista Andreoli:
The study by Leichsenring and colleagues highlights the importance of considering the quality of the studies that are included in a meta-analysis when evaluating the results. The Cochrane Collaboration’s Tool (Higgins et al., 2011) is a commonly-used instrument to quantify the risk of bias using the following criteria: allocation sequence concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, and selective outcome reporting. We analyzed the 64 randomized controlled trials of manual-guided PDT for specific mental disorders that were used in the review by Leichsenring et al (see Table 1). Thirty studies showed risk biases in sequence generation, 54 in allocation concealment, and 31 in the blinding conditions. Only one of the studies showed no obvious biases. Our results suggest that the studies included in Leichsenring’s meta-analysis were of poor quality, essentially invalidating the authors’ results and making the findings meaningless. Table 1: http://issuu.com/gvand/docs/quality_ratings_of_studies_in_leich/1 Table 2: http://issuu.com/gvand/docs/description_and_results_of_studies/1 References: Higgins, J.P., Altman, D.G., Gøtzsche, P.C., Jüni, P., Moher, D., Oxman, A.D., Savovic, J., Schulz, K.F., Weeks, L., Sterne, A.C., Cochrane Bias Methods Group, Cochrane Statistical Methods Group (2011). The Cochrane Collaboration´s tool for assessing risk of bias in randomised trials. RESEARCH METHODS & REPORTING, 343.)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 23, David Keller commented:
Results are misleadingly presented; mortality is reduced with moderate alcohol consumption
The Results section of the above abstract misleadingly states:
"The hazard ratio and 95% confidence interval in fully adjusted analyses was 1.02 (0.94-1.11) for <7 drinks/week, 1.14 (1.02-1.28) for 7 to <14 drinks/week, 1.13 (0.96-1.35) for 14 to <21 drinks/week, and 1.45 (1.16-1.81) for ≥ 21 drinks/week."
The above quote falsely implies that all amounts of alcohol consumption increased mortality, either with statistical significance, or at least by trend (depending on whether the confidence interval for a Hazard Ratio crosses 1.0).
These results are from line 5 of Table 2 of this paper, which gives the fully-adjusted results for all study participants. They are misleading, as presented, for two reasons. First, they are normalized by the Hazard Ratio of a newly-defined category called "occasional drinkers", which is a flawed and erroneously defined category of drinkers, for reasons I detail elsewhere [1]. Second, a very important data point has been omitted from these Results, namely the Hazard Ratio for non-drinkers, which is 1.19 (1.11-1.27). Why is the Hazard Ratio for non-drinkers elevated? Because it is normalized by the Hazard Ratio for "occasional drinkers", a statistical maneuver which introduces errors and obscures the true relationship of mortality with alcohol intake.
Thus informed, we see that the non-drinker can lower his Hazard Ratio for all-cause mortality from 1.19 (1.11-1.27) to 1.02 (0.94-1.11) by starting the light consumption of alcohol, drinking <7 standard alcoholic beverages per week. The confidence intervals for the Hazard Ratios of non-drinkers and light drinkers touch at 1.11, but do not overlap, so this is a significant reduction of mortality.
Again, an average non-drinker can significantly lower their risk of all-cause mortality by adding one standard 14 gram serving of ethanol per day, preferably in a dilute form such as beer (to avoid carcinogenic effects on the upper aerodigestive tracts [2]).
References
1: Keller DL, Goulden's data actually confirms that minimum mortality occurs with light-to-moderate alcohol intake, PubMed Commons, accessed on 8/22/2016 at the following URL:<br> http://www.ncbi.nlm.nih.gov/pubmed/27453387#cm27453387_26107
2: Keller DL. Dose-response relationship observed between concentration of ingested alcohol and cancer rate. Comment on PMID 26386538. In PubMed Commons [Internet]. National Library of Medicine; 2015 Sept 26 [cited 2015 Oct 12] at: http://www.ncbi.nlm.nih.gov/pubmed/26386538#cm26386538_11980 The above comment is also posted on the following Annals of Internal Medicine web page: http://annals.org/article.aspx?articleid=2456121
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Dec 13, Evgenia V Dueva commented:
Release active form of antibodies or other substances is not an accepted scientific concept and the term appears only in the articles involving the commercial products of «MATERIA MEDICA HOLDING». According to Avogadro's law, 12 or more centesimal dilutions of compound lead to a lack of any active substance in any amount of solution that a mouse can drink. It seems that commercial products of «MATERIA MEDICA HOLDING» (including Anaferon, Subetta etc.) is a disguised version of homeopathy and the authors have confused the reviewers and readers with their vague descriptions of their "drugs" and hiding concentrations of the initial compounds.
Given the fact that there is no accepted mechanism of action for any treatment with such dilutions as in the case of Anaferon, Subetta, etc. the simpler explanation for the observed biological effects is bias introduced by lack of proper randomization and blinding.
The critical comment on initial paper was published and can be found here: http://onlinelibrary.wiley.com/doi/10.1002/jmv.24761/full
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 16, John Quackenbush commented:
In my opinion, this is one of the foundational papers in modern systems biology and essential reading for anyone interested in the field. The goal of the authors is to create a logical circuit model in lambda phage, one of the most widely studied organisms that exists. The difficulties that are described, the role of stochastic events, and the failure of "rational" design principles in biological pathways lays out many problems that the systems biology community continues to wrestle with today.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 03, FREDERICK DOMANN commented:
Here is a link to the pdf: https://dl.dropboxusercontent.com/u/21339133/Cloning_Discs.pdf
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 03, FREDERICK DOMANN commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2015 Dec 03, FREDERICK DOMANN commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 16, EDWARD BERRY commented:
This is beautiful work, and really answered the question about the Three Core Proteins. But it would have been nice to put it in context of previous work. Something like: ". . . as concluded by Berry et al. 1991 based on heme/protein ratio of the isolated complex, and contrary to the conclusion of Braun and Schmitz 1992 (Eur. J. Biochem. 208,761 -767) based on size estimated by gel filtration".
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
The published version is available at DOI.
A manuscript version of the paper is available at the Helsinki University institutional repository: https://helda.helsinki.fi/handle/10138/42358
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Oct 28, Harri Hemila commented:
With the permission of the editor and the first author, a scanned version of the paper is available at: http://www.mv.helsinki.fi/home/hemila/CP/Hunt_1994_ch.pdf
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Dec 05, S A Ostroumov commented:
Full text online free: Biological Filtering and Ecological Machinery for Self-Purification and Bioremediation in Aquatic Ecosystems: Towards a Holistic View: https://www.researchgate.net/publication/13429633
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Jan 04, S A Ostroumov commented:
Review, opinion paper. A new theory of ecological machinery, function of aquatic biological community toward water purification, improvement of water quality. Full text online: https://www.researchgate.net/publication/13429633
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 May 18, Salzman Lab Journal Club commented:
This very provocative article provides one of the first explorations of the biological function of a circular RNA in vivo. Interestingly, the current annotation of the FMN1 gene does not include exon 4, which is included in their circle and is knocked out in their study. Circular RNAs containing exon 4 are reported as 70% of their detected transcripts. Despite claims that the protein levels are not grossly perturbed, a western blot would have been very useful to allow the reader to assess their claims. It is interesting to note that deleting exon 5 abolishes circular RNA, while maintaining the diagnostic circular junctional sequence and sequences flanking the circle-forming exons.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Feb 01, Joe Newton commented:
These findings are interesting as they are consistent with "increased action potential conduction velocity differentials" as defined in (Newton, Joe Ray Medical Hypotheses 1999 Manic -depression neural conduction speeds and action potential event dyscorrelation.) Many later additional genetic studies support this physiologpathology in a broad ranges of neuropsychiatric disorders. The 1999 hypothesis is testable by several different physical methods.<br> Best wishes, Joe Ray Newton
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 29, Jonathan Wren commented:
New URL is: http://genome-www.stanford.edu/cellcycle/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 May 23, Daniel Schwartz commented:
Calculate the Sequential Organ Failure Assessment (SOFA) score online or using a mobile app at https://www.qxmd.com/calculate/calculator_268/sequential-organ-failure-assessment-sofa
Conflict of interest: Medical Director, QxMD
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Oct 31, Pierre Vabres commented:
In hindsight, one of these children more likely had constitutional mismatch repair deficiency rather than neurofibromatosis type 1.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2018 Feb 01, Jonathan Eisen commented:
I note - the web site linked to in Figure 1 regarding data used for the trees - http://crab2.berkeley.edu/pacelab/176.htm is no longer available. However, it is available at the Internet Archive at https://web.archive.org/web/19990224012002/crab2.berkeley.edu/pacelab/176.htm.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 May 17, Prof.Dr.Jogenananda Pramanik commented:
Invited co-authors: Dr.Myo Wint Zaw, Dr.Lwin Lwin Cho and Dato'Dr.Mahmood bin Abd Yusof, Universiti College Shahputra UCSA, Pahang, Malaysia and Dr. Samik Hazra, Brig.Dr.Soumitra Chatterjee, The Calcutta Medical Research Institute,Kolkata-27,India.
Despite rigorous screening tests, early institution of DOT and individualized patient care, multi-drug resistant tuberculosis is emerging as a dreaded killer disease in developing and developed countries.(1) Diagnostic efficacy of real time PCR assay is widely accepted but it is not cost-effective.Therefore, we need to look for other inexpensive solid media culture methods and immunodiagnostic methods for screening and follow up for suspected cases ( 2-5 ). On the other hand, we may also look for fast acetylator status of isoniazid metabolism before deciding about drug resistance.In recent years a group of advanced research laboratories from several western universities are welcoming outsourcing of patients' samples for diagnostic purpose and willing to support physicians in South East Asian countries to detect various diseases at an early stage.
- Farmer P1, Kim JY. BMJ. 1998 Sep 5;317(7159):671-4. Community based approaches to the control of multidrug resistant tuberculosis: introducing "DOTS-plus". 2.Prof.Dr.J.Pramanik.BMJ.2003.http://www.bmj.com/rapid-response/2011/10/30/delays-diagnosis-tuberculosislet-us-use-thyroxine-supplemented-culture-med: Delays in diagnosis of tuberculosis? Let us use thyroxin supplemented culture medium for early lab-diagnosis. 3.Prof.Dr.J.Pramanik. BMJ: 2004.http://www.bmj.com/rapid-response/2011/10/30/early-diagnosis-tuberculosis-reported-third-world-country Early diagnosis of tuberculosis-reported from third world country:A research letter from India.
- Dr.J.Pramanik et al.,Ind. J. Tub.1997,44, 185-190. Increased yield of excretory-secretory antigen with thyroxine supplementation in in vitro culture of tubercle bacilli.
- Dr.J.Pramanik et al.,Ind.J.Clin.Bioch.2000.,5(1),22-28. Detection of tubercular antibody and antigen in sera of bone and joint tuberculosis.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 May 11, Daniel Haft commented:
This crystallography paper, from 1998, reports a structure for an aminoglycoside-(3)-N-acetyltransferase whose sequence is shown in GenBank record AAB20441.1. It’s interesting to compare AAB20441.1 to a very different aminoglycoside-modifying enzyme, CAG34229.1, the nucleotidyltransferase ANT(2'')-Ia. These two translations are identical over the first twenty amino acids, MLRSSNDVTQQGSRPKTKLG, but are otherwise unrelated. As is readily apparent from examining AJ746361, the source nucleotide record for the latter protein, both these antibiotic resistance genes occur integrated into integrons of the same family, called class 1.
The N-terminal sequence shared by otherwise unrelated antibiotic resistance genes, starting with a plausible-looking ATG-encoded Met in the appropriate reading frame, raises the question of whether this region might actually be translated, and what its contribution to protein structure might be. This crystallography paper is interesting because the extended region was included (along with an additional engineered N-terminal prefix that aided in protein purification) when the enzyme was expressed for the crystallography study, and therefore was studied experimentally. The authors found the N-terminal region to contain sites “that are exquisitely sensitive to trypsin (Arg-3, Arg-14, Lys-16, and Lys-18), suggesting that the N terminus of the enzyme is … disordered.” The N-terminal extension clearly did not participate in forming an ordered crystal structure, and seemed to neither help nor hinder enzymatic activity.
A number of additional unrelated antibiotic resistance genes occur in class 1 integrons and appear in public sequence databases with (probably faulty) translations that start from the same integron-derived candidate start site, resulting in similar N-terminal sequence extensions. Examples include a class A beta-lactamase (BAE71359.1), a trimethoprim-resistant dihydrofolate reductase (BAD07295.1), and a rifampin ADP-ribosyltransferase (CAR63501.1). Readers of this paper may enjoy knowing that the N-terminal sequence extensions shared by these translations reflect integration of unrelated genes at equivalent sites, not conservation of some structural element that would be visible in solved crystal structures.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jul 10, Bill Cayley commented:
A great example of when "less" is "more": https://lessismoreebm.wordpress.com/2015/07/10/primary-care-physicians-and-specialists-as-personal-physicians-health-care-expenditures-and-mortality-experience/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 04, Andrea Messori commented:
Gains in life expectancy from medical interventions: a bibliography of 6 references on this topic published between 1998 and 2014
Andrea Messori, HTA Unit, Tuscany Region, 50100 Firenze (Italy)
The main merit of the paper published by Wright and Weinstein (“Gains in life expectancy from medical interventions--standardizing data on outcomes”. N Engl J Med. 1998 Aug 6;339:380-6) is that, for the first time, the study of gains in life expectancy has been proposed as a method to systematically quantify health-care benefits. One interesting question is how often this method has been used thereafter. According to an empirical literature search, we have identified the following 6 studies published between 1998 and 2014 in which the approach described by Wright and Weinstein has been employed to determine health-care benefits:
- Messori A, Trippoli S, Tendi E. Gains in life expectancy from medical interventions. N Engl J Med. 1998 Dec 24;339(26):1943-4
- Messori A, Santarlasci B, Trippoli S. Guadagno di sopravvivenza dei nuovi farmaci. Pharmacoeconomics – Italian Research Articles 2004;6:95-104. http://www.osservatorioinnovazione.net/papers/guadagnios.pdf
- Fojo T, Grady C. How much is life worth: cetuximab, non-small cell lung cancer, and the $440 billion question. J Natl Cancer Inst. 2009 Aug 5;101(15):1044-8. doi: 10.1093/jnci/djp177. Epub 2009 Jun 29.
- Fadda V, Maratea D, Trippoli S, Messori A. Comparison between real prices and value-based prices of innovative drugs eBMJ, Part1 and Part2 published 6 December 2010, http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-0 and http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-par
- Messori A, Fadda V, Trippoli S. A uniform procedure for reimbursing theoff-label use of antineoplastic drugs according to the value-for-money approach. J Chemother. 2011 Apr;23(2):67-70. Review. PubMed PMID: 21571620.
- Martone N, Lucioni C, Mazzi S, Fadda V. New oncological drugs: analysis of survival gain. GRHTA 2014; 1(1): 3 – 15. DOI: 10.5301/GRHTA.2014.12359
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 23, Pierre Lindenbaum commented:
!MOVED https://github.com/lindenb/cloneit/tree/master/c
The program has been removed from the INRA server: I saved the sources on github: https://github.com/lindenb/cloneit/tree/master/c
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Feb 09, GUAN ZHU commented:
Acetyl-C0A should Acetyl-CoA. Must be an OCR error...
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Dec 16, Mohammed AlJasser commented:
Labelled as "Free full text" but it does not seem to be the case.
Any advises?
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
Because it emphasized a bedside approach rather than millisecond dissections of electronic catheter tracings, I found Drs. Zimetbaum and Josephson’s discussion of symptoms and circumstances associated with palpitations refreshing (1). They did not mention, however, the tachycardia-polyuria syndrome.
As described in the 1960s, polyuria occurs in approximately half of patients with paroxysmal supraventricular arrhythmias faster than 110 beats per minute lasting for 20 or more minutes when left ventricular failure and stenotic valvular lesions are absent (2,3). Why the syndrome is so underreported to physicians is unclear. Diuresis typically begins 20 to 60 minutes after the onset of the arrhythmia, is most intense in the first 1 to 2 hours, and may last as long as 8 hours if the arrhythmia lasts that long (2,3,4). It is unusual for polyuria to occur before the palpitation or with ventricular arrhythmias.
The syndrome’s physiology is incompletely known, but seems, in part, to depend on a rise in atrial pressure causing release of atrial natriuretic peptides. Of note, in a recent series of 13 patients with atrioventricular nodal reentrant tachycardia (AVNRT), 12 had associated diuresis (5). Compared to other atrial arrhythmias, the rise in atrial pressure was greatest in AVNRT, as might be expected from symptoms typical of this disorder: cannon A waves and a sensation of pounding in the neck (1).
Thus, the tachycardia-polyuria syndrome is probably a useful indicator of a supraventricular tachycardia, and perhaps AVNRT in particular.
(1) Zimetbaum P, Josephson ME. Evaluation of patients with palpitations. N Engl J Med. 1998;338:1369-73.
(2) Wood P. Polyuria in paroxysmal tachycardia and paroxysmal atrial flutter and fibrillation. Br Heart J. 1963;25:273-82.
(3) Luria MH, Adelson EI, Lochaya S. Paroxysmal tachycardia with polyuria. Ann Int Med. 1966;65:461-70.
(4) Zullo MA. Atrial regulation of intravascular volume: observations on the tachycardia-polyuria syndrome. Am Heart J. 1991;122:188-194.
(5) Abe H, Nagamoto T, Kobayashi H, Miura Y, Araki M, Kuroiwa A, Nakashima Y. Neurohumoral and hemodynamic mechanisms during atrioventricular nodal reentrant tachycardia. Pacing Clin Electrophysiol. 1997;20:2783-2788.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 07, Brett Snodgrass commented:
Dear Reader,
Dr. Grollman's excellent article helped me recognize the ambiguous nomenclature of the myocardial vasculature with reference to the Thebesian veins.
The Thebesian veins are distinct from the "vessels of Wearn." Dr. Grollman sagaciously reported this. Unfortunately, there was no pronoun applied to the vessels. Thus, the term "Thebesian veins" was frequently applied to the vessels.
For more information, please see https://twitter.com/BrettSnodgrass1/status/417294264343601152
Comments and suggestions welcome.
Thank you kindly.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 28, DAVID SANDERS commented:
From Science 30 October 1998: Vol. 282 no. 5390 p. 843 DOI: 10.1126/science.282.5390.843a TECHNICAL COMMENTS "Ebola Virus, Neutrophils, and Antibody Specificity" "Thus, we conclude that Ebola sGP does not bind FcγRIIIb (CD16) or any other receptor on neutrophils and that the rabbit IgG against sGP used for detection bound to FcγRIIIb through its Fc moiety as an immune complex with sGP."
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Oct 18, Morten Oksvold commented:
This review is citing Bezwoda WR et al., J Clinical Oncology, 1995, a study which was retracted in 2001 due to fraud. The retracted JCO article represented one of the worst cases of research fraud ever The review article is highlighting the fraudulent research data, and it is therefore surprising that the article is still not retracted.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 May 20, Iffat Sumia commented:
Now there's a game-changing paper.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 26, Harri Hemila commented:
The paper which is commented on is available at DOI.
The comments and reply are available at DOI
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 26, Harri Hemila commented:
The paper which is commented on is available at DOI.
The comments and reply are available at DOI
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Nov 16, Anne Niknejad commented:
Figure 2 ' GenBank accession no. Z46796x5'
should be
' GenBank accession no. Z46796'
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
The paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7980
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 27, David Basanta commented:
In a way I am just testing the Pubmed commons system but this paper is the first one I am aware of that explore the idea of using game theory in order to understand the dynamics between different subpopulations of tumour cells. A couple of very simple game theoretical models highlight how even a very simple mathematical formulation can shed light on the evolutionary mechanisms behind tumour progression toward increasingly more malignant phenotypes.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 05, James Murray commented:
The superoxide dependent nitrogenase described in this (Ribbe M, 1997) paper is extremely unlikely to exist.
The paper describes the purification of the components of an oxygen-tolerant nitrogenase, not homologous to the known nif,vnf, or anf-type, from Streptomyces thermoautotrophicus UBT1, a thermophilic carboxydotroph.
Results published in February 2016 (MacKellar D, 2016) show that three independent isolates of S. thermoautotrophicus, including the original UBT1 strain, do not grow in the absence of combined nitrogen and are incapable of incorporating isotopically labelled dinitrogen into biomass, nor do they contain the claimed superoxide dependent nitrogenase genes. The N-terminal sequences assigned to nitrogenase components in Ribbe M, 1997, and the full DNA gene sequences in the PhD thesis of Carla Hofmann-Findeklee (2000, KF951061.1, KF951060.1, KF951059.1, KF956113.1) are found at near-identity in Bacillus schlegelii DSM9132 (recently renamed to Hydrogenibacillus schlegelii, "SdnMSL-like" sequences in KT861421.1), a non-diazotrophic thermophilic carboxydotrophic organism isolated in the Meyer lab (Krüger & Meyer, 1984) and known to be cultured in the Meyer laboratory in 1994 (Hänzelmann, 1994). The independently isolated B. schlegelii DSM2000 strain also has these sequences at near-identity. The closest relatives to these sequences are to Firmicutes and not Actinomycetes like S. thermoautotrophiucs. The four "nitrogenase" sequences are easily identified as encoding a superoxide dismutase ("st2", sdnO), and a three-subunit aerobic carbon monoxide dehydrogenase ("st1", sdnMSL).
Ribbe M, 1997 relies on an ammonia production assay to determine the nitrogenase activity. This assay is known to have a high background due to environmental ammonia and protein deamination. Incorporation of isotopically labelled dinitrogen is usually considered the gold standard for the identification of a nitrogenase enzyme. No incorporation of isotopically labelled nitrogen into ammonia is shown using the claimed biochemical nitrogenase preparation. The cells were grown in media with 1.5 g/l ammonium chloride, so there was no selection for diazotrophy. No published demonstration of the superoxide dependent nitrogenase has occurred outside the Meyer laboratory.
The nitrogenase scheme described in Ribbe M, 1997 is chemically and biologically implausible. There is no known ATPase domain, as required by the proposed reaction scheme, in any of the described proteins. The known nitrogenase types require the highly reducing ferredoxin or flavodoxin as reductants. Superoxide is an unlikely electron donor for a nitrogenase, as it is not as reducing as even NADPH or NADH, and is reactive and toxic. No other biologically productive use of superoxide as an electron donor is known. An aerobic reduction of nitrogen to ammonia is unknown, and unlikely, as under the highly reducing conditions, oxygen would most probably be reduced in preference to nitrogen. The rate of activity described is too low to be that of a biological enzyme supporting diazotrophic growth, as it would take the proposed nitrogenase over 100 hours just to replace the nitrogen in the enzyme itself, which is also incompatible with the claimed rate of diazotrophic growth of S. thermoautotrophicus (Gadkari D, 1992).
To summarize:
Recent evidence suggests that three independently isolated strains of S. thermoautotrophicus are not diazotrophic.
If the Meyer laboratory did contaminate their S. thermoautotrophicus culture with a strain of B. schlegelii (such as the DSM9132 strain), we would observe the N-terminal sequences presented here and the DNA gene sequences also produced in the Meyer laboratory.
The extremely low activity "nitrogenase" was described based on a problematic ammonia production assay.
A superoxide-dependent aerobic nitrogenase is chemically and biologically implausible.
Declaration: I am an author on the MacKellar D, 2016 paper, but this comment is entirely my own.
References:
Bernd Krüger and Ortwin Meyer. Thermophilic bacilli growing with carbon monoxide. Archives of Microbiology, 139(4):402–408, 1984.
Petra Hänzelmann. Isolierung und Charakterisierung von Kohlenmonoxid-Dehydrogenase aus dem obligat thermophilen Bakterium Bacillus schlegelii. Diplomarbeit thesis, University of Bayreuth, 1994.
Carla Hofmann-Findeklee. Molekularbiologische Untersuchung der Strukturgene des aeroben N2-fixierenden Systems von Streptomyces thermoautotrophicus sowie funktionelle Charakterisierung von rekombinantem SdnO. PhD thesis, University of Bayreuth, 2000.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2018 Jan 24, Jean-Michel Claverie commented:
A brand new version of the above statistical test is now available: ACD 2.0
When the initial version of this test was published, transcriptome data was painfully obtained from "Expressed sequenced tags (EST)" library sequencing, resulting in low counts for each detected transcript. Thanks to the evolution in sequencing technologies ("NGS"), transcriptomes are now investigated using several hundred millions of reads, with every transcripts been detected up to several thousands of times.
A new (free) web service is now available that can handle all levels of counts, from a handful to millions, without approximation and without loosing the mathematical simplicity and universality of the original Audic-Claverie Distribution (ACD) test.
ACD 2.0 now proposes three tools:
1) the simple "one item /2 counts" --> p-value of the null hypothesis (i.e. no change in proportions)
2) "an array of items/ 2 or more counts" --> generate a ranked list of the most discriminant items
3) "an array of items /2 or more counts" --> generate a pairwise distance matrix of the whole samples
A full documentation describes the mathematical details and the computational algorithms used in ACD 2.0. It also explains how the above tools can be used in many more contexts than just transcriptome analysis. These include the comparison of metagenomic/barcoding or ChIP-Seq experiments, or non-biological applications simply involving arrays of items and their cognate counts. A formal publication will follow soon. Keep posted in PubMed!
Without further delay you can start using ACD 2.0 (beta) from the following the link:
http://www.igs.cnrs-mrs.fr/acdtool
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 23, Hilda Bastian commented:
This trial bears the predominant weight for safety concerns about single-session debriefing in a subsequent influential systematic review (Rose S, 2002, of which the lead trialist here is an author). Its results are potentially affected by multiple serious biases.
The trial had a high attrition rate (>22%): 23 lost to follow-up (p78 - participants) and 7 who left hospital before intervention (p78 - results). The number of events was low.
This trial report does not include an intention-to-treat analysis (ITT). ITT was imputed in the systematic review (Rose S, 2002), without description of the additional data or reporting the methods used, and whether or not sensitivity analyses were conducted.
The intervention group was at higher risk of the event at baseline (25% of the intervention arm had others involved in the trauma vs 4% in the control arm, p=0.01; percentage of the body burned, life threat and past significant trauma were also higher, although not significantly so).
There was a disproportionately large number in the intervention group (64 vs 46), due to the method of randomization and having stopped the trial early.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/8159. The analysis of the same studies was extended in Cochrane review Hemilä H, 2007 and Hemilä H, 2013.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 23, Pedro Mendes commented:
Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Feb 16, Bernard Baars commented:
This article is one of the most important neuroscience contributions in recent history.
Mircea Steriade published brain recording studies, in both single-cell and population oscillations in cortex. (The cortico-thalamic system).
Because animal researchers were able to perform direct intracranial recordings long before similar human studies appeared, they published many discoveries that other neuroscientists and psychologists are now seeing in their own data.
Steriade's central finding is that "The cerebral cortex and thalamus constitute a unified oscillatory machine displaying different spontaneous rhythms that are dependent on the behavioral state of vigilance."
This was at a time of extreme skepticism about human scalp EEG, which suffers a thousand-fold loss of voltage due to the attenuating effects of the cranium, scalp muscles, and other protective tissue layers. Direct brain recordings are measured in millivolts, while scalp recordings show up in microvolts, with corresponding vulnerability to electrical noise from the eyes, scalp muscles, and stray EM fields.
Animal researchers solved those problems by learning how to insert electrodes directly into the brain, in species where it was ethically allowable to do so.
Today we are now seeing similar results in humans, using surgical implants prior to epileptic surgery. (See about 200 articles in PubMed under "iEEG" or "ECog". Surprisingly, iEEG has the highest temporal and spatial resolution of any brain imaging technique today.)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 26, Matthew Katz commented:
Both this EORTC trial and the RTOG trials 85-31 and 86-10 established the role of androgen deprivation for improved prostate cancer outcomes with radiation therapy. Long-term followup has confirmed the survival benefit in locally advanced patients Bolla M, 2002.
We are still trying to find the optimal balance of hormone therapy with radiation for both intermediate and locally advanced prostate cancer. Higher radiation doses are now given than in these trials, but there still appears to be a role for androgen deprivation (ADT) for many men with prostate cancer that is higher in stage, grade or PSA. ADT isn't without side effects but worth discussion if considering radiation therapy.
http://www.ncbi.nlm.nih.gov/pubmed/12126818
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 06, thomas samaras commented:
Since this paper was published, a lot of research relating anthropomorphic characteristics to longevity has been published. See below:
Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.
Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.
He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.
Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.
Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.
Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.
Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 23, Gerhard Nebe-von-Caron commented:
Sytox green is not suitable for the detection of membrane integrity as it can label cells negative to propidium iodide that are verified as being able to form colonies.
See figure 2 and 3 in http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6976.2010.00214.x/full
The characterisation of functional cell stains works best in competitive labeling situations were they can be directly compared in their interaction. This is similar to the experience with Bis-oxonol which was also described as a staining for cell death but dis-proven by showing those cells to be culturable.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Mar 16, Donald Forsdyke commented:
NEUTRAL THEORY NOT SUPPORTED. As a reviewer of this paper I recommended acceptance but was unhappy with the conclusion that it supported neutral theory explanations. On the advice of reviewers, my subsequent Letter to the Editor was declined by the Editor (see http://post.queensu.ca/~forsdyke/bioinfor.htm ). The abstract of the letter read:
"Galtier and Lobry compared the optimum growth temperatures of various prokaryotes with the G+C content of their genomic DNA and of various non-mRNA RNA species (e.g. ribosomal RNAs). Since GC bonds confer greater stability on nucleic acid secondary structure than AT bonds, their data strongly suggest that an increase of G+C content is needed for the stabilization at high temperature of rRNA secondary structure (stem-loops), but not of DNA secondary structures.
The authors propose that "any secondary structure that must endure at high temperatures requires a high G+C content", so that "a high proportion" of stem-loop "secondary structures in bacterial genomes is unlikely". Thus, the fact that Chargaff's parity rule (%A=%T, %G=%C) applies to single-stranded DNA (as to single-stranded RNA), is held to be "poorly explained" on the basis of an evolutionary pressure on DNA to form stem-loops (as proposed by Forsdyke 1995; J Mol Evol 41:573-581). Rather the parity rule would be explained by "neutral directional mutational pressure" (Lobry, 1995; J Mol Evol 40:326-330).
However, "any secondary structure" includes the classical duplex DNA secondary structure. This is likely to exist at high temperatures, and presumably requires "other physiological adaptations" than an increase in G+C content. Such adaptations might also apply to DNA stem-loop secondary structure. Thus, in this context selectionist arguments are no less probable than neutralist arguments."
Subsequently the Editor himself (2000; Gene 241: 3-17) came to agree:
"The low GC levels of some thermophilic bacteria do not contradict, as claimed (Galtier and Lobry, 1997), the selectionist interpretation ... . Indeed, different strategies were apparently developed by different organisms to cope with long-term high body temperatures. It is now known that the DNAs of such thermophilic bacteria are very strongly stabilized by particular DNA-binding proteins (Robinson et al., 1998) and that, in turn, their proteins can be stabilized by thermostable chaperoninins (Taguchi et al., 1991)."
For more please see my textbook Evolutionary Bioinformatics (2nd edition 2011, Springer, New York).
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 08, Brett Snodgrass commented:
Thank you for an excellent article.
The fistula between the right ventricle and right coronary artery is probably consistent with a vessel of Wearn.
http://www.ncbi.nlm.nih.gov/pubmed/23332812
If you disagree or agree, please share and why. Comments or suggestions are welcome.
For additional commentary, please see the following link:
https://twitter.com/BrettSnodgrass1/status/412943028790124544
Thank you kindly.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 25, Harri Hemila commented:
A secondary analysis of this study has been published in Hemilä H, 2013, DOI. The secondary analysis calculated that vitamin C reduced the proportion of participants suffering from exercise-induced bronchoconstriction by 50 percentage points (95% CI 23 to 68), from 100% (20/20) on the placebo day to 50% (10/20) on the vitamin C day.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
europepmc.org europepmc.org
-
On 2016 Feb 03, Daniel Schwartz commented:
The Vasculitis Damage Index can be easily calculated using an online tool or mobile app:
https://qxmd.com/calculate/vasculitis-damage-index-vdi
Conflict of interest: Medical Director, QxMD
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Mar 11, Daniel Haft commented:
This paper reports an N-terminal sequence of ASEPAVIYDTAGKYDKSFNEAVFYNGD for the carbapenem-hydrolying metallo-beta-lactamase AsbM1, and notes the very low similarity of this sequence fragment to a known metallo-beta-lactamase with similar properties, CphA. Inspection of several genomic sequences that have since become available from closely related strains of Aeromonas showed each has a subclass B2 metallo-beta-lactamases closely related to CphA. In each of those same genomes there is a full-length protein that aligns to the sequence fragment with just one or two mismatches, and that is related to the lipoprotein PnrA (purine nucleoside receptor A) described in PMID:16418175 rather than to any known beta-lactamase. This observation suggests that the carbapenemase AsbM1 studied in this article is an allele of the CphA family, but that a PnrA family protein was the source of the N-terminal sequence shown.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
The published version is available at http://dx.doi.org/10.1016/S0899-9007(96)00223-7.
A manuscript version is available at handle
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 03, Harri Hemila commented:
Fulltext is available at DOI
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Jun 22, MARQUIS VAWTER commented:
As first author of this 1996 paper, I wanted to clarify that we were growing olfactory ensheathing cells and other cell types.
"Our immunocytochemistry findings can be partially explained by the presence of ONEC (olfactory nerve ensheathing cells). This interpretation is supported by the finding that 33–66% of ONC are CD401 by flow cytometry. Low-affinity nerve growth factor receptor is used as a marker for ONEC (23, 54, 57) and is also localized to olfactory neurons (4) and olfactory basalcells."
Further in this paper,we concluded that: "Based on expression of CD40, NCAM, and intermediate filaments, the composition of ONC cultures is likely a combination of ONEC, basal cells, and immature olfactory receptor neurons."
The ONEC was defined as olfactory nerve ensheathing cells.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 23, Gerhard Nebe-von-Caron commented:
please see http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6976.2010.00214.x/full fig 2/3 for Sytox green labeling depolarised live cells
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version is available at handle
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version is available at handle. The paper was commented on by Thomas Chalmers http://dx.doi.org/10.1016/0895-4356(96)00190-4 to which a response was published http://dx.doi.org/10.1016/0895-4356(96)00191-6, which is also available at handle
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Nov 23, Harri Hemila commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Aug 10, Matthew Katz commented:
Organ preservation as a treatment strategy effectively demonstrated chemoradiation as the standard of care for anal canal cancer. RTOG proved the point in 83-14 [Sischy B, 1989]. The RTOG phase III trial above confirmed the importance of mitomycin-C as part of the treatment regimen, which remains the standard in 2014.
With the rising incidence of HPV+ anal cancer, which may have a better prognosis, an important question will be whether we should lessen treatment intensity. Further trials will be needed to see if it's possible to lessen treatment toxicity without compromising cancer control.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 13, Karl Broman commented:
This is the first paper to consider interval mapping for binary traits in experimental crosses. Somewhat surprisingly, genetic mapping in humans focused on binary traits and not quantitative ones, while mapping in experimental crosses focused on quantitative traits and not binary ones. The method is developed in the context of marker covariates, and so it is a bit more technically challenging to understand than it might be, but this paper had a lot of influence on my understanding of QTL mapping.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Oct 21, Jeff Bertrand commented:
Looking for a full text version of this article.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 07, Brett Snodgrass commented:
Dear Reader,
The myocardial sinusoids are not a phantom regardless of whether knowledge about them is.
Arteriosinusoidal vessels described by Wearn connect to myocardial sinusoids. The myocardial sinusoids are often pathologically altered and readily apparent on microscopy in pulmonary atresia with intact ventricular septum.
Dr. Wearn's work: http://bit.ly/JTWearn The myocardial sinusoids are not phantom as they connect to the arteriosinusoidal vessels. The vessels of Wearn include the arteriosinusoidal and the arterioluminal vessels of the heart. Wearn's distinguished Harvey lecture of 1940 describes the difference between the "Thebesian veins" and the "AL & AS" vessels (vessels of Wearn). Related references: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933738/ http://www.ncbi.nlm.nih.gov/pubmed/22704295 http://www.ncbi.nlm.nih.gov/pubmed/23332812 https://twitter.com/BrettSnodgrass1/status/419324443068874752
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Aug 21, Robert P O'Shea commented:
The PubMed title of this paper is incorrect. It should be "The extraordinarily rapid disappearance of entoptic images" with two ts in "entropic", as in the paper itself. Entopic is a medical term meaning in the usual place, as opposed to ectopic, which means in the wrong place (e.g., ectopic pregnancy). "Entoptic" means in the eye, requiring the Greek root "optic".
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Sep 11, Bill Cayley commented:
More evidence that "less-medical" primary care can actually be MORE cost-effective (and perhaps better in other ways: https://lessismoreebm.wordpress.com/?s=primary
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 24, John Sotos commented:
[Written in 1996] Speculations regarding Creutzfeldt-Jakob disease (CJD) acquired from beef containing the infectious agent that causes bovine spongiform encephalopathy [1] have resulted in dramatic health policy measures and serious concerns in the lay public about dietary beef intake in Britain. We believe these concerns are out of proportion to the actual risk of CJD, especially when compared to other established risks of beef consumption, such as the development of coronary heart disease (CHD). We therefore sought to estimate a beef-eater’s risk of CJD and CHD based on currently available data.
The ten cases of CJD became manifest over a 20 month span in 1994-1995 [1]. If we suppose a uniform incubation period of 10 years for CJD, then all 10 cases were infected during a 20 month period in 1984-1985, when the mean beef intake among the 56 million Britons was 181.5 g/person/week [2] (roughly equivalent to two hamburgers per week). Assuming the attack rate remains constant, an average Briton would have a 1 in 933,000 chance of developing CJD from 10 years of beef-eating. The risk per hamburger is roughly 1 in one billion.
To determine the beef-attributable risk of CHD, we first calculate the change in serum cholesterol that results when the fat and cholesterol in lean beef [3] are consumed in place of isocaloric carbohydrate or protein. Using the average daily caloric intake in Britons (2040 kcal) [2], the Hegsted equation [4] predicts a 2.1 mg/dl increase in serum cholesterol when 181.5 g beef/week are consumed. For a 30 year-old non-smoking, non-diabetic man with a total cholesterol of 150 mg/dl, an HDL cholesterol of 45 mg/dl, and a systolic blood pressure of 120 mmHg, the Framingham equation [5] predicts that a 2.1 mg/dl increase in serum cholesterol sustained over 10 years raises the risk of CHD during this period by 1 chance in 5300. Thus the CHD/CJD relative risk is approximately 175!
Although our calculations are approximations at best, they clearly show that the risk from fat and cholesterol in beef is, for most of the adult population, orders of magnitude greater than the risk from neurotropic particles contained therein. Other diseases linked to fat intake, such as stroke and colon cancer, have not been considered here. Based on these data we believe that beef-eaters should care for their coronaries, rather thsn perseverate on prions.
[1] Will RG, Ironside JW, Zeidler, et al. A new variant of Creutzfeldt-Jakob disease in the UK. Lancet. 1996;347:921-925.
[2] Ministry of Agriculture, Fisheries and Food. National Food Survey 1994. London: Her Majesty’s Stationery Office, 1995.
[3] American Heart Association Cookbook. Ballantine Books. New York, NY, 1986.
[4] Hegsted OM. Serum-cholesterol response to dietary cholesterol: a re-evaluation. Am J Clin Nutr. 1986;44:299-305.
[5] Anderson KM, Wilson PWF, Odell PM, et al. An updated coronary risk profile: a statement for health professionals. Circulation. 1991; 83:356-362.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jul 23, Jonathan Eisen commented:
I am posting some materials associated with this paper on Figshare (alignments, trees, color figures, etc).
See https://figshare.com/projects/1995_Eisen_RecA_Evolution_JME/15035
Jonathan Eisen
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 02, Robert Eibl commented:
I worked at that time in that lab and I completed the very first isogenic SV129 K.O. constructs for the planned partial K.O of the CD44 gene. Part of my work contributed to the paper above and was acknowledged within the article: "The sizes of the PCR products derived from the phage clones allows an estimate of the intron sizes. These results have been indepentently confirmed by mapping the restriction sites for more than twenty restriction enzymes on (lambda) phage inserts(R.Eibl, unpublished results)."
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2014 Nov 16, Robert Eibl commented:
None
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2018 Jan 21, Tom Kindlon commented:
References:
1 Chalder T, Berelowitz G, Pawlikowska T, Watts L, Wessely S, Wright D, Wallace EP: Development of a Fatigue Scale. J Psychosom Res 1993, 37:147-153.
2 Neu D, Hoffmann G, Moutrier R, Verbanck P, Linkowski P, Le Bon O. Are patients with chronic fatigue syndrome just 'tired' or also 'sleepy'? J Sleep Res. 2008 Dec;17(4):427-31. doi: 10.1111/j.1365-2869.2008.00679.x.
3 Goudsmit, EM., Stouten, B and Howes, S. Fatigue in myalgic encephalomyelitis. Bulletin of the IACFS/ME, 2008, 16, 3, 3-10. https://web.archive.org/web/20140719090603/http://www.iacfsme.org/BULLETINFALL2008/Fall08GoudsmitFatigueinMyalgicEnceph/tabid/292/Default.aspx
4 Goldsmith LP, Dunn G, Bentall RP, Lewis SW, Wearden AJ. Correction: Therapist Effects and the Impact of Early Therapeutic Alliance on Symptomatic Outcome in Chronic Fatigue Syndrome. PLoS One. 2016 Jun 1;11(6):e0157199. doi: 10.1371/journal.pone.0157199. eCollection 2016. https://doi.org/10.1371/journal.pone.0157199.s001 (CSV form: https://www.mediafire.com/file/rvh3brmgoaznude/Goldsmith+2015+FINE+data+journal.csv )
5 A dataset from the PACE trial. Released following a freedom of information request. https://sites.google.com/site/pacefoir/pace-ipd_foia-qmul-2014-f73.xlsx Readme file: https://sites.google.com/site/pacefoir/pace-ipd-readme.txt.
6 Morriss RK, Wearden AJ, Mullis R. Exploring the validity of the Chalder Fatigue scale in chronic fatigue syndrome. J Psychosom Res. 1998 Nov;45(5):411-7.
7 Loge JH, Ekeberg O, Kaasa S. Fatigue in the general Norwegian population: normative data and associations. J Psychosom Res 1998; 45: 53-65. CrossRef | PubMed
8 Van Kessel K, Moss-Morris R, Willoughby, Chalder T, Johnson MH, Robinson E, A randomized controlled trial of cognitive behavior therapy for multiple sclerosis fatigue, Psychosom. Med. 2008; 70:205-213.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2018 Jan 21, Tom Kindlon commented:
My feedback on content of Common Data Elements (Fatigue) - Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) CDE Public Review
I submitted this to the NIH and thought I would also post it here.
Suggested Change: Don't use the Chalder fatigue questionnaire
Rationale: The Chalder Fatigue questionnaire has two separate scoring systems, bimodal (0-11) and Likert (0-33) [1]. Some of the issues raised below are more significant with one system rather than the other.
(i) Doubts about the validity of two of the items in the questionnaire as means to measure fatigue:
The item “Do you have problems starting things” seems as though it could relate more to motivation or some other issue rather than fatigue specifically.
The item “Do you feel sleepy or drowsy” relates more to sleepiness than fatigue. Sleepiness and fatigue are not necessarily the same thing [2].
Most studies that used the Chalder fatigue scale do not give details of scores on individual items but one study [3] reported the following in participants with ME: “Focusing on the individual items revealed that 86.8% of the questions making up the physical fatigue subscale received near maximal or maximum scores. The items which received the greatest number of low scores were question 3 (‘do you feel sleepy or drowsy’) and question 4 (‘do you have problems starting things’).”
(ii) Ceiling effects are a significant issue when the Chalder fatigue questionnaire is used with patients with ME and CFS score, particularly with bimodal scoring:
A study of those with ME [3] found that “Fifty per cent of the patients recorded the maximum score using the bimodal method and 77% recorded the two highest scores [i.e. either 10 or 11].” In the FINE and PACE trials, 76% (147/193) and 65% (417/640) respectively of CFS participants reported the highest score [11] at baseline using bimodal scoring [4,5].
With regards to Likert scoring, a study of those with ME found that there was some evidence of a ceiling effect in those who were severely affected (more details were not reported but the average score for those severely affected was 30.55 (SD: 2.66)). In the FINE and PACE trials 29.1% (57/196) and 14.5% (93/640) of the participants with CFS respectively scored the maximum score of 33 at baseline.
There is also a 14-item version of the instrument with three extra items. A study of 136 individuals with CFS looking at Likert scoring found there was near-maximal scoring on 6 of the 8 physical fatigue items [6].
The authors of the ME study [3] noted with regards to bimodal scoring that there was a “marked overlap between those who rated themselves as moderately or severely ill. These findings are indications of a low ceiling.” This could lead to the questionnaire failing to detect patients moving from being severely to moderately affected and vice versa.
Furthermore, if patients are already at a ceiling score at the start of the intervention, the questionnaire cannot detect their getting worse. This could mean that evidence of harm would not be recorded. Also, this phenomenon could affect measures of efficacy: if a certain percentage of patients improved and the same percentage worsened to a similar level, this could show up as an average improvement because the scores for those who got worse would not change if they were already at the ceiling level.
This could also make interventions that caused a significant number of deteriorations seem better than those that caused fewer. For example, consider a scenario in which one intervention caused a certain percentage of patients to improve while the same percentage, who began at the maximum score, worsened by the same amount. If another intervention caused half the number of patients to both improve and worsen, the average numerical improvement for the first intervention would be twice that of the second, even though rationally the scores should be the same.
(iii) Discussion of the ability of respondents to mark symptoms as occurring “less than usual”:
The fact that participants can rate their fatigue symptoms as occurring “less than usual” can lead to some odd results with Likert scoring of the Chalder scale (it is not an issue with its bimodal scoring). People who have no fatigue problems should generally score 11/33, indicating that they had problems ‘no more than usual’. And, indeed, a study in Norway found that those in the category “No disease/current health problem” had a mean score of 11.2 [7].
However, a study found that people with "multiple sclerosis fatigue" after an intervention reported an average fatigue score of 7.80 – that is, lower than 11; this score also showed lower fatigue than that of a healthy, nonfatigued comparison group in the study [8]. It is very unlikely to be true that patients with multiple sclerosis fatigue at baseline ended the study with lower fatigue than healthy people. Scores of less than 11 were also reported by those with CFS in the FINE and PACE trial [4,5].
I will explore further now how pooling the scores of people who give scores of less than 11 with other scores can give odd results. Say 75% of participants gave a Likert score of 4 and 25% gave a score of 24. This would be an average score of 9 which is a better score than the score of 11 that healthy people report. However, it is likely that people who scored 4 on the scale were confused by the peculiar option on the Chalder questionnaire that allows them to rate themselves as having fewer problems with fatigue than when they were last well (choosing that option is the only way to get a score below 11). If they really meant to say that they had no more fatigue than when they were last well, then their score should really have been similar to that of the average healthy person, at 11.2. Substituting this score instead of 4 in this example would give an average score for the group of 14.4, a worse score than what healthy people score. The latter is, I believe, a better representation of what the average fatigue score for the group would be: that is, if a significant percentage still had significant fatigue, than the overall fatigue level should be worse on average than a healthy group, not better. This shows that the ability to have better scores than healthy people doesn’t just affect the validity of individual scores, it also affects the validity of overall mean scores.
[The references for this comment are in my reply below]
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8076
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Aug 20, Daniel Weiss commented:
This is a paper which is often cited to tout the robust sensitivity of the Western blot for diagnosis of Lyme disease. However, a careful, critical reading of this paper reveals major flaws. The Western blot is, on the contrary quite insensitive for the diagnosis.
I will limit my comments to study patients without recent erythema migrans. Most workers agree that an erythema migrans rash is diagnostic on its own, and that serologic tests are unnecessary as well as unreliable at this stage of the disease. Dressler performed both a prospective and retrospective study to evaluate two-tier testing. Study subjects were recruited from the authors’ Lyme disease clinic from 1990-1991. To participate they had to live in “an area endemic for Lyme disease”. The G39/40 strain of B. burgdorferi was used to generate antigens for the ELISA assay.
Dressler’s prospective study included 54 highly-selected patients with Lyme disease. The prospective group included patients with Lyme arthritis and those with “inactive” Lyme disease. Many patients had a history of the EM rash. Neuroborreliosis was diagnosed in 39 patients; these patients had CSF pleocytosis, increased CSF protein or EMG evidence of an axonal polyneuropathy not caused by other known disease. Ten of the 39 with neuroborreliosis were declared to be “inactive” although this term was not clearly defined. Importantly, only 21 of the 39 were positive by ELISA—a sensitivity of 54%. Of those cases of “active Lyme disease” who had neuroborreliosis, the sensitivity was 58%.
There were 57 patients with an indeterminate ELISA. One third of those who were thought by the investigators to have “active Lyme disease” had a negative Western blot. Thus, the two-tier test performed poorly even in patients whom expert physicians (Dr. Steere and colleagues) were sure had “active Lyme disease”.
In the retrospective study of Dressler et. two-tiered testing was performed on a highly-selected patient cohort. ELISA was negative in two of 25 with Lyme encephalopathy or polyneuropathy; two more patients’ ELISAs were read as indeterminate. Western blot testing in four of the 25 showed a minimal or absent response. Thus, the sensitivity of the test in these patients chosen because the authors were convinced they had Lyme disease reached only 84%.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 08, Brett Snodgrass commented:
Dear Reader,
This excellent study of quail embryos by Poelmann et al. also identified the vessels of Wearn.
The impression was that the vessels of Wearn are only connected to the right ventricle. However, Wearn identified the arteriosinusoidal and arterioluminal connecting to each of the four heart chambers. http://bit.ly/JTWearn
The vessels of Wearn may be appear less significant in healthy individuals, but in disease states such has PAIVS, or AA/MS, they appear more significant.
For additional commentary, please see.
https://twitter.com/BrettSnodgrass1/status/404941362908241920/
My interest is in accurate medical terminology, and I ask that others collaborate towards this end.
Comments and suggestions are welcome.
Thank you kindly.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 21, Kay Dickersin commented:
We need to make sure this article and others are archived properly so that they can be accessed by others. This journal was ahead of its time, and contains important articles.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Oct 23, Pedro Mendes commented:
Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Nov 21, Gary Ward commented:
This report describes a simple yet elegant series of experiments demonstrating that the T. gondii parasitophorous vacuole membrane (PVM) acts as a sieve, allowing small molecules (up to ~1300 Da) to pass from the cytosol into the vacuolar space. The researchers microinjected a panel of fluorescent probes either into the cytosol of infected cells or into the parasitophorous vacuole and observed bi-directional, passive transport across the PVM. These experiments provided an important new insight into the interface between the intracellular parasite and the host cell. The likely presence of nonselective membrane channels in the PVM is analogous to the outer membrane of Gram-negative bacteria, in which membrane porins allow passive transport of nutrients and metabolites into the bacterial periplasmic space.
These results from these experiments are consistent with characterization of the vacuole membrane in host cells infected with the related apicomplexan parasites, Plasmodium falciparum [Desai et al, Nature 362 (1993); Desai and Rosenberg, PNAS 94 (1997)] and Eimeria nieschulzi [Werner-Meier and Entzeroth, Parasitol Res 83 (1997)]. The obligate intracellular microsporidian Encephalitozoon cuniculi also resides within an intracellular vacuole capable of passive transport of fluorescent peptides up to 1100 Da while 10 kDa fluorescently-labeled dextrans are excluded [Rönnebäumer et al, Eukaryot Cell 7 (2008)]. The presence of non-selective membrane channels and the non-fusogenic nature of the parasitic vacuoles established by these phylogenetically distant organisms point to a similar adaptation to an intracellular parasitic lifestyle.
Posted by Gary Ward on behalf of the University of Vermont Toxoplasma Journal Club (UVM ToxoJC); members include Jenna Foderaro, Anne Kelsen, Shruthi Krishnamurthy, Jacqueline Leung, Pramod Rompikuntal, Luke Tilley & Gary Ward
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Mar 03, Md. Shahidul Islam commented:
An extensively updated review on this topic is available: M. S. Islam. Calcium signaling in the islets. In: Islets of Langerhans, edited by M. S. Islam, Dordrecht, Heidelberg, New York, London:Springer, 2014, p. 605-632. ISBN 978-9400766853
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 26, Israel Hanukoglu commented:
Originally we had named this protein as LL5.
This protein has been named as Pleckstrin homology-like domain family B member 1 (Phldb1).
The Uniprot link for this protein is http://www.uniprot.org/uniprot/Q63312
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Aug 17, Lydia Maniatis commented:
Short version:
The authors say: "We hypothesize that how our stimuli are perceived depends on spatial frequency. Our hypothesis is confirmed. (P.S. The effect is size invariant.)"
Translation: "We hypothesize that how our stimuli are perceived depends on spatial frequency. How our stimuli are perceived DOES NOT depend on spatial frequency. Our spatial frequency hypothesis is falsified."
a + (-a) = 0
(The discrete addition of the phrase "at one size" into the abstract, as though this did not upend the entire position, is really quite extraordinary.)
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Apr 11, Lydia Maniatis commented:
It is worth asking why, on the one hand, Solomon and Pelli (1994) seem to be asking questions about initial steps in vision - asking about "visual filters," and, on the other, referring, not to "perception" of letters, but to "identification" or "recognition." In order to identify or recognise, we have to first perceive, but this step is skipped over not only by these researchers but by those contemporary investigators who consider themselves "psychophysicists" in general.
The reason is this: These investigators insist on treating perception as a problem of detection, such that they can recycle the signal detection models first developed by radar researchers.
Thus, they assume that identification/recognition would be perfect if it were not for “internal noise” in the system, which produces uncertainty in the outcome. This noise is the random firing of neurons, base rates etc. This claim about internal noise and perception has never been tested, nor (to my knowledge) have these researchers proposed a way to test or measure the claim, but it is assumed.
It is also assumed that we can add “external noise” to a stimulus and thus counterbalance the “internal noise.” This “external noise” can take the form of variance of the stimulus pool, splotches superimposed on the stimulus (as here), etc. Anything that can be described as “unpredictable.”
If we do this, then there is an equation that we can use that allows us to measure “performance” regardless of the task, as long as we have a value to plug in for our “noise” term.
If we can assume that the “external noise” is much bigger than the “internal noise” then we can use this equation whose output is labelled “E” for efficiency, by plugging in our “external noise” value.
Clear so far?
What is wrong with this story is also the reason researchers adopting it don't refer to “perception.”
The stimulus, which consists of retinal photoreceptors excited by disconnected photons pouring in from the environment does not contain “letters” or any other objects to be “detected.” Only photons are detected by the system. It is the response of the nervous system that organizes these points, based on rules (instantiated in the system) that have been selected for over evolutionary time to produce a good enough match between the objects out there and the objects we perceive. We can understand the importance of sophisticated rules if we consider how easy it is for humans to read the letters of “captchas” used by websites to ensure you're not a robot, but which programmers have a hard time beating. (This is actually a crude and somewhat misleading example, because even seeing the entire captcha without being able to recognize the letters it “contains” is a feat of perceptual organization). So the visual system creates a percept by adding structure to structureless data, and the number of these potential structurings is infinite. The limiting factors are the rules.
So to see a letter, even as a physical shape, implies an enormously complicated process of perceptual organization, based on inferences that constitute the output of the system. What we “identify” or “recognize” is the product of these processes. We are not “detecting” something that is there a priori, in the stimulus, the disconnected photons. Seeing splotches, or any other feature of the percept, is also the result of the same organizing processes. There's no principle justifying calling part of the percept “noise” and another part “signal” if what we are interested in are basic perceptual processes. It is relatedly a problem to overlook that some kinds of “noise” will, for organizational reasons, interfere more with the “signal” that we have in mind than other kinds, something that the makers of “captchas” know well.
But all of these facts are silently overlooked by investigators who choose to treat perception as a detection problem involving imaginary spatial filters and arbitrarily defined “noise”. Which is truly extraordinary.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Mar 12, Lydia Maniatis commented:
Continuation of previous:
Translation: Forget everything we've assumed so far about spatial filters. We don't have special detectors sensitive to the frequency of light bands falling across the retina! Visual angle doesn't matter. The visual system has special detectors for detecting the number of light/dark cycles per (familiar) "letter" - (about 3), actually a range of cycles, since some letters are quite wide (e.g. m's) and others quite narrow (e.g. l's). The processes implicit in organizing points of light into letter shapes so that we can recruit the relevant letter-sensitive channels are not relevant. Our data plus assumptions prove it.
I think this front-page Nature article has zero credible content or face-validity.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2016 Mar 12, Lydia Maniatis commented:
The claims the authors make in this publication lack both empirical and logical support. To make what is perhaps the most clear point, the very tenuous assumptions underlying the project are themselves contradicted by the authors own statements. This is represented as a refinement of the fundamental assumption, but in fact it pulls the rug out from under it. Each step of the way, definite assertions are made which citations provided do not support.
The train of thought (with comments) is this:
Authors: “We hear periodic sounds, or tones, by means of parallel auditory filters, each tuned to a band of temporal frequency (Fletcher, 1940)”
From MIT online Encyclopedia of Cognitive Sciences: To account for the obtained data, Fletcher proposed a “critical band” that likened the ear to a bandpass filter (or, to encompass the entire frequency range, a set of contiguous, overlapping bandpass filters). The proposed “auditory filter” is a theoretical construct that reflects frequency selectivity present in the auditory system...”
Translation: The auditory system exhibits frequency selectivity. We could find no more convincing citations with respect to auditory filters between 1940 and 1994.
Authors: “...and we see periodic patterns, or gratings, by means of parallel visual filters (Campbell and Robson, 1968).”
From Robson and Campbell, 1968: “Thus, it seems that we cannot satisfactorily model the over-all visual system by a simple peak detector following a spatial filter...As a modification of this theory, we may assume...Thus, we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency...Such a model could account for our findings...”
Translation: Robson and Cambell's (1968) results did not bear out their original predictions, and they speculated as to possible alternative accounts. Between 1968 and 1994, no firmer conclusions were apparently available.
Note also that the analogy between frequency of pressure waves and the “frequency of periodic patterns (gratings)” is very loose. What is being claimed, specifically, is that there is a class of visual neurons that are excited by stimuli with a specific, sine-wave-type luminance structure across a region of space (more specifically, across a region of the retina), and that they are sensitive to the frequency of these spatial luminance alterations. But frequency of pressure waves is a fundamental feature of the energy that interacts with our sensory system to initiate perception. Grating patterns, on the other hand, are just one of an infinite number of possible patterns of light impinging on our retinas. If assumptions about vision are to rest on analogy, then frequency of light waves would seem more appropriate.
Authors: “Do these visual filters participate in everyday tasks such as reading and object recognition?”
Translation: We assume the existence of special, “low-level” mechanisms for detecting grating patterns of light on the retina. (Campbell and Robson, 1968 specified visual angle, i.e. extent on the retina, in defining their patterns). We wonder if these exist exclusively to detect grating patterns, or whether they are engaged in seeing other things as well. We're particularly interested in the perception of familiar objects that we can name upon seeing. The possibility that the visual system may possess “low-level” neurons interested only in ecologically irrelevant grating patterns but not in objects seems to us to be not only credible but testable and worth testing...
Authors: “After all, grating visibility only requires the distinguishing of pattern from blank, whereas object recognition, for example letter identification, requires classification by the observer into one of many learned categories.”
Translation: It's possible that letter identification doesn't implicate mechanisms used for seeing “pattern from blank,” or for seeing unfamiliar letters. To the extent that such mechanisms might, in fact, be implicated in letter recognition, we presume they consist of spatial filters.
Authors: “Here, we make use of results from hearing research (Patterson, 1974).”
Translation: An ad hoc model constructed on the basis of hearing experiments is an appropriate model for testing our conceptually confused variant of an assumption about the visual system based on another analogy to audition. (From Patterson, 1974: From Patterson (1974): “Threshold for a pulsed tone was measured as a function of its distance in frequency from the edge of a broad band of noise with very sharp skirts. Tone frequency was held constant at 0.5, 1.0, 2.0, 4.0, or 8.0 kHz while the position of the noise edge was varied about the frequency of the tone. The spectrum level of the noise was 40 dB. As expected, tone threshold decreased as the distance between the tone and the noise edge increased, and the rate of decrease was inversely related to tone frequency. The data were used in conjunction with a simple model of masking to derive an estimate of the shape of the auditory filter. A mathematical expression was found to describe the filter, and subsequently, this expression was used to predict the results reported by several other investigators.”)
Authors: We find that letter-identification and grating detection filters are identical, showing that the recognition of these objects at one size is mediated and constrained by a single visual filter, or 'channel.'
Translation: Our “single visual filter” conclusions contradict the speculations of Campbell and Robson (1968) (the authors we cited as support for the existence of filters to begin with) i.e. that “we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency.” We don't know if our results on "letters" apply to other shapes. The varied shapes and proportions of "letters" have no bearing on the issue. For the visual system, "letters" is a special category of its own.
Authors: Surprisingly, our noise-masking paradigm shows that the same channel performs both low-level detection of narrow-band gratings and high-level identification of broad-band letters.
Translation: Uncorroborated assumptions inspired by analogies to electrical circuits and sound systems, which ignore the fact of neural inhibition and the principles of perceptual organisation, allowed us to show that hypothetical grating-detectors are responsible for the processes involved not only in perceiving, but also in recognizing letters. (Clearly a breakthrough for memory research as well as perception.) Also, we are arbitrarily splitting the part of the pattern we are showing observers into “noise” and “signal” terms, and assume that the visual system agrees with our analysis and segregates letters from splotches, without recourse to any organizing constraints (e.g. figure-ground rules). (Also, see again comment above re: single channel.)
Authors: (Blurb to Figure 1): Note that changes in viewing distance, from 3 to 60cm, hardly affect the visibility of any given letter, indicating that the channel scales with letter size. (cont'd in next comment).
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8077
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 May 03, Hugues BEDOUELLE commented:
For an unknown reason, this article is absent from the archives of "Protein Engineering Design and Selection". A pdf file of the article can be found at URL: http://hugues.bedouelle.free.fr
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Apr 15, Mick Watson commented:
The authors have simply (re)invented integration, a mathematical procedure taught to most high school students. See https://fliptomato.wordpress.com/2007/03/19/medical-researcher-discovers-integration-gets-75-citations/
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 30, Harri Hemila commented:
Believing that the 2% average effect of vitamin E on mortality is valid for all ATBC participants is an example of ecological fallacy.
The ATBC Study, Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group., 1994 reported that the average mortality in participants administered vitamin E was not different from the non-vitamin E group with RR = 1.02 (95% CI 0.95, 1.09).
However, a subsequent subgroup analysis found that the effect of vitamin E was not uniform over all the ATBC Study participants. The combination of age and dietary vitamin C modified the effect of vitamin E so that there was strong evidence of heterogeneity in the effect of vitamin E over 6 subgroups (P = 0.0005) Hemilä H, 2009. Furthermore, given that baseline age modified the effect of vitamin E, a further analysis by the participants’ follow-up age was done and a significant difference in the effect of vitamin E on mortality was observed before and after the age of 71 years (P = 0.03) Hemilä H, 2011.
Ecological fallacy occurs where data about a group is used to conclude information about an individual. Thus, assuming that the +2% average effect of vitamin E on mortality in the ATBC Study is valid for all ATBC participants is an example of ecological fallacy. A substantial proportion of the ATBC Study participants are inconsistent with the average effect.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 29, Israel Hanukoglu commented:
The DOI address for the article is: http://dx.doi.org/10.1016/0960-0760(94)90266-6
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jul 23, Jonathan Eisen commented:
I am posting some notes and other materials relating to this paper on Figshare. See https://figshare.com/account/home#/projects/15032.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Oct 26, EDWARD BERRY commented:
The potato hinge protein has a perfect CX9CX3C----CX3CX9C motif which by homology with vertebrate structures should form a helix hairpin with disulfides holding the two arms together. This is the motif recognized by the MIA40/CHCHD4 disulfide relay import system. And like other MIA40 substrates, the hinge protein ends up in the inter-membrane space (attached to cyt c1 of the bc1 complex). I wonder if anyone has checked whether Hinge is imported by the MIA40 system.
In vertebrates one of the middle cysteines is lost, some residues are inserted, spoiling the perfect cannonical MIA40 import sequence. Only two disulfides are formed, and there is a short leader sequence although it is not a typical mitochondrial targeting sequence.
In Saccharomyces, all but two of the cysteines are lost, and the hairpin is clamped by a single disulfide. Could this represent a switch from one import mechanism to another over the course of evolution?
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 10, Kath Wright commented:
Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Sep 20, Dr Yasmin Momin commented:
mucoepidermoid carcinoma of ovary arising in dermoid is a rare case we reported
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Mar 23, Misha Koksharov commented:
There is a later paper on this topic with important critical comments: Dworak M, 2011
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 May 30, Thomas Heston commented:
The data presented in this study do not support ageism but rather illustrate a primary feature of statistics: as the sample size increases, you are more likely to find a statistically significant p-value. First of all, look at admission rates to the coronary care unit (CCU). If there was a gender bias, then a greater proportion of men (or women) without acute myocardial infarction would be admitted to the CCU compared to the other sex. This study shows clearly that sexism in CCU admission rates is not present. In 1990, 53% of men admitted to the CCU did not have an infarction compared to 52% of women, i.e. over half of the people admitted to the CCU did not have a myocardial infarction yet received CCU level care. This difference is not statistically significant. Then, in 1992 it was found that 48% of men admitted to the CCU did not have infarction compared to 54% of women. This difference was statistically significant, indicating that a greater proportion of women vs men admitted for suspected myocardial infarction received CCU level care. If anything, this represents sexism against men, not against women. But if we look at the data closer, we find that quite a few more people were admitted for suspected infarction in 1992 compared to 1990. This larger sample size means that we are more likely to find statistically significant differences. So while no statistically significant difference was found with the lower sample size (n=1473) in 1990, the higher sample size in 1992 (n=1967) resulted in a statistically significant difference. This is not surprising, this is just how statistical analysis works: large sample sizes are much more likely than small sample sizes to show statistically significant differences. To highlight this further, look at when the authors broke down their data by age (see Table 4). When broken down by age, no significant differences were found, but when all ages were combined, a statistically significant gender difference was found in 1990 and in 1992 in terms of thrombolytic therapy. This does not indicate that the differences are explained by age, but rather indicates that small sample sizes are less likely to show statistically significant differences compared to large sample sizes. The data does show a difference in rate of thrombolysis that is interesting, with an associated difference in mortality rates. My interpretation of this data is that a higher percentage of men vs women with confirmed infarction received thrombolytic therapy, and a lower percentage of men vs women with confirmed infarction died. Unlike the CCU admission rates which are not very illuminating and do clear show gender or age bias, the rate of thrombolysis suggests a bias towards more aggressive treatment of men with infarction (likely starting with differences in their emergency room care Heston TF, 1992). Furthermore, the data also suggest that thrombolysis works, as a lower in-hospital mortality rate was seen for men vs women. However, mortality was not broken down by whether or not the patient had received thrombolysis, so a meaningful analysis of mortality by gender and thrombolytic therapy is not possible.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 13, Karl Broman commented:
The idea is obvious in retrospect, but it wasn't at the time; this paper made a big difference.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2017 Aug 31, Santosh Kondekar commented:
I request the authors to comment on the link below: https://www.ncbi.nlm.nih.gov/pubmed/511337#cm511337_73741 Please share your experience if you had come across any accidental single heavy dose of amikacin. Thank you.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2013 Jun 14, Michael Schatz commented:
This is a seminal paper in genome assembly, precisely defining the unitigging algorithm that forms the basis of all overlap-layout-consensus assemblers since.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2016 Jan 04, S A Ostroumov commented:
New theory is formulated: the role of membrane potential as a multi-functional regulator of membrane proteins, in biomembranes of various types.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 25, Harri Hemila commented:
A secondary analysis of this study has been published in Hemilä H, 2013, DOI. The secondary analysis calculated that the incidence of all asthma attacks was reduced by RR = 0.22 (95% CI 0.06 to 0.81), and the incidence of severe and moderate asthma attacks was reduced by RR = 0.11 (95% CI 0.02 to 0.48).
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2015 Apr 02, Harri Hemila commented:
Secondary analyses of Schachter EN, 1982 have been published in Hemilä H, 2013 and Hemilä H, 2014.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Aug 08, PubMed Commons Moderator commented:
NCBI system test
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Jan 08, Brett Snodgrass commented:
Thank you for the excellent article. Please provide your kind attention to the distinction between the Thebesian veins and the vessels of Wearn.
http://bit.ly/Thebesius http://bit.ly/JTWearn
The Thebesian veins may indeed be involved in drainage of the "dye/contrast" into the ventricles. The authors report what is presumably the vessels of Wearn “direct pathways of drainage into the right ventricle from the septal artery.” That depends on the definition of the term “direct.” If it means before the capillary beds, then it is the vessels of Wearn. If it means all connections excluding the coronary sinus, then it may include both the vessels of Wearn and the Thebesian veins.
For additional commentary on the subject, please see the subsequent link. https://twitter.com/BrettSnodgrass1/status/419196829339639808
Comments or suggestions are welcome.
Thank you very much.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Dec 03, Harri Hemila commented:
Fulltext is available at http://jap.physiology.org/content/54/1/208
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2018 Jan 07, Misha Koksharov commented:
A missing link to the pdf of this paper (on ScienceDirect): https://doi.org/10.1016/0020-711X(83)90066-6
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2018 Jan 09, Misha Koksharov commented:
A link to pdf (which is missing here): http://dx.doi.org/10.1203/00006450-198010000-00008
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
-
europepmc.org europepmc.org
-
On 2014 Nov 23, Harri Hemila commented:
A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/135149
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-