On 2016 Feb 17, Ben Ewen-Campen commented:

Interesting!

On 2013 Dec 19, Raphael Stricker commented:

Clinical Evidence for Rapid Transmission of Lyme Disease Following a Tickbite: Response to Binnicker et al.

Raphael B. Stricker, MD,* Eleanor D. Hynote, MD,* and Phyllis C. Mervine, EdM.*

*International Lyme and Associated Diseases Society, P.O. Box 341461, Bethesda, MD 20827-1461. www.ILADS.org

Binnicker et al. dispute the clinical diagnosis of Lyme disease in our patients based on three factors: (1) a “physician-diagnosed target lesion” was not present at the site of the tickbite; (2) although an IgM antibody response was present, conversion to an IgG response was not documented; and (3) recovery of Borrelia burgdorferi, the spirochetal agent of Lyme disease, was not demonstrated by culture or molecular techniques.

First, it is important to recall that Lyme disease is a clinical diagnosis according to the Centers for Disease Control and Prevention (CDC), which states that “general symptoms” such as fatigue, chills, fever, headache, muscle and joint aches, and swollen lymph nodes “may be the only evidence of infection” in early Lyme disease (CDC, 2012). In addition, the erythema migrans (EM) rash manifests as a “target lesion” in only 9% of cases (Stonehouse et al, 2010), may take up to 30 days to develop (CDC, 2012) and may be completely absent in up to 50% of patients with Lyme disease, as it was in our three patients (Steinberg et al, 1996; Stricker et al, 2006; Kudish et al, 2007). Second, in the setting of a tickbite and clinical symptoms of acute Lyme disease, the prompt administration of antibiotics may abort the typical serological response, as acknowledged by Binnicker et al. and others (Dattwyler et al. 1988; Aguero-Rosenfeld et al, 1996). Few studies have evaluated the serological evolution in Lyme disease patients treated as promptly as ours were (see below). Third, culture and molecular testing is highly insensitive in blood samples and even in tissue or synovial fluid from Lyme disease patients (Coulter et al, 2005; Stricker, 2007; Babady et al, 2008). Thus from a symptom-based and serological perspective, our patients met the CDC case definition of acute Lyme disease even in the absence of a target-shaped EM rash and insensitive laboratory procedures.

Binnicker et al. also mention the CDC “recommendation” that Lyme serology should be performed using a two-tier algorithm. This serological analysis involves a screening enzyme immunoassay or immunofluorescence assay and confirmatory Western blot performed with kits approved by the Food and Drug Administration (FDA) for commercial sale. However the CDC states that this algorithm was developed “for the purposes of surveillance” and was not intended for diagnosis of Lyme disease (CDC, 2011). Furthermore, the FDA-approved commercial two-tier test system has a sensitivity of only 46% and yields results that appear to be biased against women (Binnicker et al, 2008; Stricker and Johnson, 2011). Our patients were tested using a “gender neutral” system that has a sensitivity and specificity of >90% (Shah et al, 2010). Thus our patients had laboratory evaluation that was appropriate for the diagnosis of Lyme disease.

Our report confirms studies in both animals and humans that document transmission of Lyme disease within 24 hours of a tickbite (Piesman et al, 1987; Patmas and Remorca, 1994; Strle et al, 1996a, 1996b; Angelov, 1996; Sood et al, 1997). When animal and human studies produce apparently conflicting results, the contradictory findings should be given serious consideration, even if they contravene existing clinical dogma.

References

1. Aguero-Rosenfeld ME, Nowakowski J, Bittker S, Cooper D, Nadelman RB, Wormser GP. Evolution of the serologic response to Borrelia burgdorferi in treated patients with culture-confirmed erythema migrans. J Clin Microbiol. 1996;34:1-9.
2. Angelov L. Unusual features in the epidemiology of Lyme borreliosis. Eur J Epidemiol. 1996;12:9-11.
3. Babady NE, Sloan LM, Vetter EA, Patel R, Binnicker MJ. Percent positive rate of Lyme real-time polymerase chain reaction in blood, cerebrospinal fluid, synovial fluid, and tissue. Diagn Microbiol Infect Dis. 2008 ;62:464-6.
4. Binnicker MJ, Jespersen DJ, Harring JA, Rollins LO, Bryant SC, Beito EM. Evaluation of two commercial systems for automated processing, reading, and interpretation of Lyme borreliosis Western blots. J Clin Microbiol. 2008;46:2216-21.
5. Binnicker MJ, Theel ES, Pritt BS. Lack of evidence for rapid transmission of Lyme disease following a tick bite. Diagn Microbiol Infect Dis. 2012;73:102-3.
6. Centers for Disease Control and Prevention (CDC, 2011). Lyme disease (Borrelia burgdorferi) 2011 case definition. Available at http://wwwn.cdc.gov/NNDSS/script/casedef.aspx?CondYrID=752&DatePub=1/1/2011 12:00:00 AM. Accessed December 4, 2013.
7. Centers for Disease Control and Prevention (CDC, 2012). Signs and symptoms of Lyme disease. Available at http://www.cdc.gov/lyme/signs_symptoms/index.html. Accessed December 4, 2013.
8. Coulter P, Lema C, Flayhart D, Linhardt AS, Aucott JN, Auwaerter PG, Dumler JS. Two-year evaluation of Borrelia burgdorferi culture and supplemental tests for definitive diagnosis of Lyme disease. J Clin Microbiol. 2005;43:5080-4.
9. Dattwyler RJ, Volkman DJ, Luft BJ, Halperin JJ, Thomas J, Golightly MG. Seronegative Lyme disease. Dissociation of specific T- and B-lymphocyte responses to Borrelia burgdorferi. N Engl J Med. 1988;319:1441-6.
10. Hynote ED, Mervine PC, Stricker RB. Clinical evidence for rapid transmission of Lyme disease following a tickbite. Diagn Microbiol Infect Dis. 2012;72:188-92.
11. Kudish K, Sleavin W, Hathcock L. Lyme disease trends: Delaware, 2000 - 2004. Del Med J. 2007;79:51-8.
12. Patmas MA, Remorca C. Disseminated Lyme disease after short-duration tick bite. J Spiro Tick Dis. 1994;1:77-78.
13. Piesman J, Mather TN, Sinsky RJ, Spielman A. Duration of tick attachment and Borrelia burgdorferi transmission. J Clin Microbiol. 1987;25:557-8.
14. Shah JS, Du Cruz I., Narciso W, Lo W, Harris NS. Improved clinical sensitivity for detection of antibodies to Borrelia burgdorferi by Western blots prepared from a mixture of two strains of B. burgdorferi, 297 and B31, and interpreted by in-house criteria. European Infect Dis. 2010;4:56–60.
15. Sood SK, Salzman MB, Johnson BJ, Happ CM, Feig K, Carmody L, Rubin LG, Hilton E, Piesman J. Duration of tick attachment as a predictor of the risk of Lyme disease in an area in which Lyme disease is endemic. J Infect Dis. 1997;175:996-9.
16. Steinberg SH, Strickland GT, Pena C, Israel E. Lyme disease surveillance in Maryland, 1992. Ann Epidemiol. 1996;6:24-9.
17. Stonehouse A, Studdiford JS, Henry CA. An update on the diagnosis and treatment of early Lyme disease: "focusing on the bull's eye, you may miss the mark". J Emerg Med. 2010;39:e147-51.
18. Stricker RB, Lautin A, Burrascano JJ. Lyme disease: the quest for magic bullets. Chemotherapy. 2006;52:53-9.
19. Stricker RB. Counterpoint: long-term antibiotic therapy improves persistent symptoms associated with lyme disease. Clin Infect Dis. 2007;45:149-57.
20. Stricker RB, Johnson L. The pain of chronic Lyme disease: moving the discourse backward? FASEB J. 2011;25:4085-7.
21. Stricker RB, Hynote ED, Mervine PC. Clinical evidence for rapid transmission of Lyme disease following a tickbite: response to Piesman and Gray. Diagn Microbiol Infect Dis. 2012;73:104-5.
22. Strle F, Nelson JA, Ruzic-Sabljic E, Cimperman J, Maraspin V, Lotric-Furlan S, Cheng Y, Picken MM, Trenholme GM, Picken RN. European Lyme borreliosis: 231 culture-confirmed cases involving patients with erythema migrans. Clin Infect Dis. 1996a;23:61-5.
23. Strle F, Maraspin V, Furlan-Lotric S, Cimperman J. Epidemiological study of a cohort of adult patients with Erythema migrans registered in Slovenia in 1993. Eur J Epidemiol. 1996b ;12:503-7.

On 2014 Oct 20, EDWARD BERRY commented:

It is not clear that the FAD assay used here to normalize SQR and SDH activity is applicable for covalently bound FAD, such as that of SDH1p. Unless I badly misunderstand the assay, all of SDH1p flavin will go down in the perchlorate precipitation step, and they are actually measuring noncovalent FAD released by other flavoproteins (and FAD present soluble in the mitochondrial matrix). This could account for the dramatic activation upon incorporation into nanodisks and purifying by IMAC, since a lot of those proteins would not incorporate into discs. This would not invalidate the main conclusions of the paper, which are clear from the fluorescent gels, but the quantitative turnover numbers for Complex II should be taken with a grain of salt until this is cleared up

On 2013 Oct 25, Stephen Turner commented:

This paper examines a wide range of all the available algorithms and software for sequence classification as applied to metagenomic data (i.e. given a sequence, determine its origin). They comprehensively evaluated the performance of over 25 programs that fall into three categories (alignment-based, composition-based, and phylogeny-based) on several different datasets where the composition was known, using a similar set of evaluation criteria (sensitivity = number of correct assignments/number of sequences in the data; precision = number of correct assignments/number of assignments made). They concluded that the performance of particular programs varied widely between datasets due to reasons like highly variable taxonomic composition and diversity, level of sequence representation in underlying databases, read lengths, and read quality. The authors specifically point out that, even though some methods lack sensitivity (as they've defined it) they are still useful, because they have high precision. For example, marker-based approaches (like Metaphyler) might only classify a small number of reads, but they're highly precise, and may still be enough to accurately recapitulate organismal distribution and abundance. Further, the authors note that you can't ignore computational requirements, which varied by orders of magnitude between programs. Selection of the right method depends on the goals (is sensitivity or precision more important?) and the available resources (time and compute power are never infinite -- these are real limitations that are imposed in the real world). Overall, this paper was a great demonstration of how one might attempt to evaluate many different tools ostensibly aimed at solving the same problem but functioning in completely different ways.

On 2017 Aug 17, Alain Destexhe commented:

We are impressed by the time taken by Dr Barbour to make such comments (a search in PubMed shows a quite impressive number of comments by him on various papers). Less impressive is that Barbour comments contain basic physics errors. For example, Barbour's reasoning is made for electromagnetic waves, so yes it is true that radio waves will propagate near the speed of light in neural tissue. However, this confuses electromagnetic propagation with charge movement, which is at the basis of ionic currents in neurons. We suggest that Barbour follows a basic course in electromagnetism to convince himself of the fundamental difference betweem these two phenomena. This confusion between propagation of electromagnetic waves (photons) and the membrane currents (ions) leads to aberrant conclusions.

A basic course in electromagnetism will also teach that the 4th of Maxwell equations (Ampere-Maxwell law) contains a term about the density of the "displacement current" (dD/dt), and which precisely accounts for charge accumulation. This current is neglected in the traditional cable equations, which do not include Ampere-Maxell law. The traditional cable thus forbids charge accumulation in the medium as well as monopoles, by design, and thus cannot be used to make any reasoning about monopoles in neurons. This is why one needs to generalize cable equations, to include the displacement current and make them fully compatible with Maxwell equations, allowing charge accumation for example. Barbour seems not to have understood this, and describes the generalization of cable equations as "un-necessary".

Finally, a basic course of electromagnetism will also teach that electric monopoles are well known in physics, and that they can have various causes. The slow movement of charges is one of these causes, which predicts transient monopolar effects in materials. Our calculations show that the same may apply to neurons - there is a transient time at the onset of ionic currents, where there may be transient monopolar effects. We suggest this as a physical explanation for the monopoles that Riera et al. have observed in their experiments.

On 2017 Jul 31, Boris Barbour commented:

In this commentary about a paper by Reira et al

http://jn.physiology.org/content/108/4/956

Destexhe and Bédard make the naive suggestion that propagation of voltage in physiological saline would be slow enough to enable the creation of temporary current monopoles in violation of Kirchoff's law. They have also unnecessarily attempted to generalise equations governing current flow in brain tissue to allow for this possibility

https://journals.aps.org/pre/abstract/10.1103/PhysRevE.84.041909

The relevant quote from this commentary is:

"A first possible cause of monopolar contribution is that neurons may not strictly obey Kirchoff's laws. According to the standard model, the charges are assumed to move instantaneously (infinitely fast), which gives rise to the fact that the return current appears immediately. However, in reality, there is an inertia time to charge movement, because the mobility of ions in a homogeneous electrolyte is finite and is considerably slower compared to electrons in a metal."

The authors provide no usable quantification of this effect. In reality, the propagation of the voltage will be close to the speed of light and the associated delays will therefore be totally negligible on spatiotemporal scales of interest in biology. As succinctly explained on this wikipedia page

https://en.wikipedia.org/wiki/Velocity_factor

the propagation velocity will only be reduced from the speed of light by a factor of sqrt(er), where er is the relative permettivity. For pure water er = 80, and we can use this as an upper limit, because the addition of ions causes a modest decrease of er. The velocity of propagation would therefore be approximately

c/sqrt(80) ~ 3E8/sqrt(80) m/s = 3.4E7 m/s.

If we generously consider the brain to have a characteristic dimension of 1 m, even then propagation would require only 90 ns. Over a millimetre that would be 90 ps.

Thus, Kirchoff's law remains a spectacularly accurate approximation under physiological conditions and deviations from it cannot explain the apparent monopoles reported. In addition, there is no foreseeable benefit to neuroscience in modelling violations of the law.

On 2014 Feb 12, Stephen Bond commented:

Users may find that their projects have a higher success rate if they switch from the 3-step secondary PCR reaction (as described in the paper) to a 2-step reaction, where the annealing step is essentially merged with the 72°C extension step (setting hold time to 30 sec/kB). This has been validated in our lab, and also by a number of independent investigators who have shared their experience through personal correspondence.

On 2013 Jun 28, Rafael Irizarry commented:

This is a must-read paper for anybody analyzing high throughput DNA methylation data. In particular, those performing Epigenome-wide association studies (EWAS) using blood as primary tissue should be particularly careful. Study Figure 2 carefully and beware of confounding.

On 2017 Apr 10, Harri Hemila commented:

Problems in the meta-analysis on zinc and the common cold

Several problems in the meta-analysis by Science et al. have been pointed out, see HDL and CMAJ eLetter.

On 2013 Nov 21, ANDREW SU commented:

It is a shame that the website for this promising-looking resource is currently unavailable (and has been unavailable for at least one month) just one year after publication.

On 2014 Jul 14, Naresh Kasoju commented:

This work was highlighted by Nature India: https://www.natureasia.com/en/nindia/article/10.1038/nindia.2012.82

On 2014 Apr 03, Naresh Kasoju commented:

This work was highlighted by Extracellular Matrix News: http://www.extracellularmatrixnews.com/issue/volume-3-18-may-10/

On 2014 Apr 03, Naresh Kasoju commented:

None

On 2016 Aug 30, Rodolphe Thiebaut commented:

This is absolutely true: the right number is NCT00477321. Thank you very much for pinpointing this typo. Rodolphe Thiébaut & Yves Levy

Pr Rodolphe Thiebaut INSERM U1219, INRIA SISTM team ISPED Bordeaux School of Public Health Bordeaux Segalen University Clinical Trials Unit of Bordeaux University Hospital Vaccine Research Institute 146 Rue Leo Saignat 33076 Bordeaux, France Web U1219: http://www.bordeaux-population-health.center Web SISTM: http://www.inria.fr/equipes/sistm

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0047732. We believe the correct ID, which we have found by hand searching, is NCT00477321.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Aug 29, John Denning commented:

A correction has been submitted to the journal noting an error in the cutoff for TOMMe10 (errors on the first 10 items of TOMM trial 1). The correct cutoff, showing the greatest accuracy in predicting pass/fail on the MSVT, is 2 or more errors on the first 10 items. Sensitivity = .71, Specificity = .93 for that cut off. Table 8 and Table 11 as well as the text refer to a cut off of 1 or more errors which is incorrect. The author apologizes for this error.

On 2014 Aug 24, Christopher Southan commented:

The putative molecular identification of SAR110894 as https://pubchem.ncbi.nlm.nih.gov/summary/summary.cgi?cid=11502645 is described at: http://cdsouthan.blogspot.se/2014/08/deja-vu-ncats-repurposing-round-2.html

On 2013 Oct 31, John Cannell commented:

The authors found markers oxidative stress is present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take the Ameri

On 2013 Nov 08, Seth Bordenstei commented:

This Symbionticism blog post is a behind-the-scenes look at the review. The blog post is demarcated into four sections. 1. The study of microbial symbionts in speciation has an interesting history | 2. Ivan Wallin's Hypothesis Was Ahead of His Time | 3. Today's biotechnology and thinking are up to the task | 4. A new phase in the study of symbiont-assited speciation is happening now

On 2015 May 15, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2015/05/14/harvard-biofilm-paper-in-cell-breaks-down-after-challenged-findings-cant-be-repeated/

On 2016 Jan 09, Egon Willighagen commented:

The networks 1 and 2 from Figure 4 are available in the "Open Access Publication" collection on WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2361 and http://wikipathways.org/index.php/Pathway:WP2363 Just in case you want to open them in Cytoscape or PathVisio.

On 2016 Dec 18, Suzy Chapman commented:

A misattribution still stands in the critique of Cognitive-behavioural group treatment for a range of functional somatic syndromes: randomised trial. at PLOS Blog Mind the Brain. On behalf of Prof Allen Frances MD and myself, we would be obliged if you will give this your attention.

On 2016 Dec 08, James C Coyne commented:

This RCT is an excellent example of a badly designed study gone wrong. That the authors switched scoring of outcomes after results of another trial were known is the final blow. The trial:

Was unblinded to patients, interventionists, and to the physicians continuing to provide routine care. Had a grossly unmatched, inadequate control/comparison group that leads to any benefit from nonspecific (placebo) factors in the trial counting toward the estimated efficacy of the intervention. Relied on subjective self-report measures for primary outcomes.

With such a familiar trio of design flaws, even an inert homeopathic treatment would be found effective, if it were provided with the same positive expectations and support as the CBT in this RCT.

The study showed an inexplicably high rate of deterioration in both treatment and control group. Apparent improvement in the treatment group might only reflect less deterioration than in the control group.

The study is focused on unvalidated psychiatric diagnoses being applied to patients with multiple somatic complaints, some of whom may not yet have a medical diagnosis, but most clearly had confirmed physical illnesses.

The “CBT” did not map well into international understandings of the assumptions and delivery of CBT. The complex intervention included weeks of indoctrination of the patient with an understanding of their physical problems that incorporated simplistic pseudoscience before any CBT was delivered.

I provided a more extended and detailed critique at the PLOS blog Mind the Brain http://blogs.plos.org/mindthebrain/2016/12/07/danish-rct-of-cognitive-behavior-therapy-for-whatever-ails-your-physician-about-you/

On 2017 Mar 15, Leonid Teytelman commented:

Turns out that this is not true.

Sanchez C, Sundermeier B, Gray K, Calin-Jageman RJ (2017) Direct replication of Gervais & Norenzayan (2012): No evidence that analytic thinking decreases religious belief. PLoS ONE 12(2): e0172636. doi:10.1371/journal.pone.0172636 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0172636

More about the original and the replication: http://nymag.com/scienceofus/2017/03/thinking-analytically-doesnt-make-you-less-religious.html

On 2014 Dec 31, Andrea Messori commented:

Prevention of venous thromboembolism in major orthopaedic surgery

For nearly two decades, low-molecular weight heparins (LMWHs) have been considered the standard of care for preventing venous thromboembolism (VTE) in patients at risk. In this field, two meta-analyses have summarized the results of all RCTs published in Medline [1,2].

The systematic review by Sobieraj et al.,[1] reported the incidence rates for deep vein thrombosis and for pulmonary embolism which were compared between enoxaparin and other heparins (e.g., unfractionated heparin or LMWH); this review evaluated a total of 13 RCTs.

The meta-analysis by Maratea et al.,[2] reported the incidence rates for the composite end-point of deep vein thrombosis and pulmonary embolism which were compared between enoxaparin and NOACs (novel oral anticoagulants). This meta-analysis evaluated a total of 8 RCTs. Table 1 available at the following website http://www.osservatorioinnovazione.net/papers/heparins_trials_2014.pdf summarizes the raw data for the incidence of the composite end-point obtained from the overall series of trials mentioned above. To compare the various treatments with one another, the class of LMWHs was divided according to the specific agents employed in the trials. Furthermore, enoxaparin was considered as two separate treatments depending on whether this agent was given once daily or twice daily. Our synthesis of effectiveness data can be useful for retrospective evaluations in this therapeutic area and also as a reference for defining the place in therapy of innovative treatments developed for this clinical indication.

References

1.Sobieraj DM, Coleman CI, Tongbram V, Lee S, Colby J, Chen WT, Makanji SS, Ashaye A, Kluger J, White CM. Venous Thromboembolism Prophylaxis in Orthopedic Surgery [Internet]. Rockville (MD): Agency for Healthcare Research and Quality (US); 2012 (b) Mar. Available from http://www.ncbi.nlm.nih.gov/books/NBK92319/ PubMed PMID: 22536611.

2.Maratea D, Fadda V, Trippoli S, Messori A. Prevention of venous thromboembolism after major orthopedic surgery: indirect comparison of three new oral anticoagulants. J Thromb Haemost. 2011 Sep;9(9):1868-70. doi: 10.1111/j.1538-7836.2011.04421.x.

On 2016 May 24, Kevin Hall commented:

A Corrigendum for this article (10.1210/jc.2012-1444) was published on May 10, 2016: http://dx.doi.org/10.1210/jc.2016-1651.

We recently identified an error in the week 30 resting metabolic rate (RMR) data in the above manuscript. In Table 1, the RMR at week 30 in the full 16 subject sample was (mean ±SD) 2015 ±332 kcal/d such that there was a decrease from baseline of 664 ± 469 kcal/d (p<0.0001) with a significant metabolic adaptation of -370 ± 290 kcal/d (p<0.0001). Also in Table 1, the week 30 RMR of the 11 subjects completing measurements at 6 weeks was 1926 ± 328 kcal/d (p=0.001 vs. baseline) and the metabolic adaptation of -345 ± 239 kcal/d (p=0.0004) was no longer significantly different from week 6 (p=0.082). A corrected Figure 2 was published in the Corrigendum.

In Figure 3A, non-resting energy expenditure at week 30 was 1129 ±399 kcal/d and significantly lower than baseline (p=0.04). Physical activity at week 30 shown in Figure 3B was 4.4 ±3.3 kcal/kg/d higher than baseline (p < 0.0001) and significantly lower than week 6 (p =0.02). The previously reported correlation of metabolic adaptation with weight loss at week 30 remained significant (r=0.56, p=0.038) but the correlation with TSH change was no longer significant (r=0.16, p=0.61). The authors regret this error.

On 2013 Jun 19, Jim Brooks commented:

In a radical prostatectomy cohort at our institution, we have noted no deaths in men with Gleason score 3+3=6 prostate cancer in long term follow-up (Brooks JD et al. The Open Prostate Cancer Journal 1:1, 2008). Walsh and Epstein recently published 30 year follow-up at Johns Hopkins, and noted only a single death in patients with Gleason score 6 prostate cancer (Mullins JK et al, J. Urol 188(6):2219, 2012). Interestingly, in that set of patients 5 were scored as having lymph node metastases and it appears that 1 of these patients died of prostate cancer. It is highly likely (or certain) that those 5 patients scored as having lymph node metastases were re-classified by Dr. Epstein as Gleason score 7 or above in the above study. It would have been much more useful, although a lot of work, if the pathologists regraded all cases in this study, rather than only those with lymph node metastases. However, this paper does provide an important insight into Gleason score 6 cancer: it does not have the capacity to metastasize. When coupled with the studies with long term follow-up, it also appears that Gleason score 6 cancer is not lethal, regardless of tumor volume. It will be critical to understand the mechanisms and frequency of the transition of Gleason score 6 to higher grades of prostate cancer.

On 2014 Feb 26, SONAL GROVER commented:

What is the difference between dentigerous cyst transforming into conventional ameloblastoma and the dentigerous cyst transforming into unicystic ameloblastoma with mural proliferation and ameloblastic follicles in the connective tissue capsule....Should have been included in the discussion part.

On 2013 Oct 31, John Cannell commented:

The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take

On 2015 Jul 28, Inigo Martincorena commented:

Readers of this article may be interested in a follow-up review where we discussed in more detail the theory behind the evolution of local mutation rates Martincorena I, 2013, in organisms ranging from bacteria to humans.

On 2014 Jan 07, Brett Snodgrass commented:

Thank you for the excellent report.

The connection identified may possibly be a prominent vessels of Wearn.

Please see: https://twitter.com/BrettSnodgrass1/status/419225934231646208

Prominent vessels of Wearn & (fistula: LAD <=> Pulmonary trunk) causing sudden death.

I appreciate feedback regarding my PubMedCommons comments. My aim is to cooperate c others to produce accurate medical literature. Thank you

On 2016 Mar 18, ZHONGMING ZHAO commented:

My lab recently moved to the University of Texas Health Science Center at Houston. The web site for this database is now available at https://bioinfo.uth.edu/NGS/.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Nov 26, Matthew Katz commented:

This UK trial establishes a key role for bladder preserving chemoradiation in muscle-invasive bladder cancer. While some patients may still benefit from radical cystectomy, chemoradiotherapy offers a viable alternative with good functional outcomes.

Recent data suggest that in the U.S. both cystectomy and chemoradiation and underused and have equal cancer control --> Smith AB, 2014. There has been increasing interest in neoadjuvant chemotherapy before cystectomy, and more research is needed. This trial demonstrates again how chemoradiation can offer cancer patients organ-preserving options.

Still unclear is the ideal area for treatment. This trial treated bladder only while many of the US trials treated small pelvic fields to include lymph nodes. Future studies should better address how to optimally treat bladder cancer patients with chemoradiation.

On 2013 Jun 13, Robert Tibshirani commented:

This paper represents some of the recent work on "Deep Learning", a machine learning approach which models data in an unsupervised way, with multiple hidden layers. This produces factors that are functions of the inputs, which can then be used as input in a supervised problem. It is exciting stuff, and is the centerpiece, for example, of the Google Brain project. I do think that the approach here may be unnecessarily complicated: more recent, simpler proposals can be found eg in

http://ai.stanford.edu/~quocle/faces_full.pdf

http://static.googleusercontent.com/external_content/untrusted_dlcp/research.google.com/en/us/archive/large_deep_networks_nips2012.pdf

On 2015 Jan 11, Donald Forsdyke commented:

ANOTHER "INTRONS-FIRST" SCENARIO - UPDATE

Punctuation problems garbled my comment published with the paper in Biology Direct in 2012 http://www.biology-direct.com/content/7/1/11/comments#893696. The comment should read:

The statement in the abstract of Rogozin et al. that "the introns-first scenario is not supported by any evidence" seems to refer to the particular version of "introns-first" which was developed from the ideas of Darryl Reanney by Penny and his colleagues [references 47 and 48 of the Rogozin paper]. There is, however, another "introns-first" scenario, which has considerable bioinformatic support and is in at least two textbooks [1, 2]. Since the Rogozin paper does "not attempt a comprehensive coverage" and appears to favor introns invading protein-encoding regions, rather than the converse, readers of Biology Direct might like to review the evidence for the "introns-first" scenario that I began to elaborate in 1981 [3, 4]. Full details may be found in my webpages. A course on introns for High School and College students may be accessed through You Tube (videos 37-54 of Forsdyke Evolution Academy)[5].

Updating this, a full paper was later published [6].

[1] Forsdyke DR: Evolutionary Bioinformatics.: 2nd edition. New York: Springer; 2011: 249-266.

[2] Forsdyke DR: The interrupted gene. In Lewin's Genes X. Edited by Krebs JE, Goldstein ES, Kilpatrick ST. Boston: Jones and Bartlett; 2011:79-97, 172-175.

[3] Forsdyke DR: Are introns in-series error detecting sequences?. J Theoret Biol 1981, 93:861-866.Forsdyke DR, 1981

[4] Barrette IH, McKenna S, Taylor DR, Forsdyke DR: Introns resolve the conflict between base order-dependent stem-loop potential and the encoding of RNA or Protein: Further evidence from overlapping genes. Gene 2001, 270:181-189.Barrette IH, 2001

[5] Evolution Academy http://post.queensu.ca/~forsdyke/videolectures.htm

[6] Forsdyke DR: Introns first. Biological Theory 2013, 7:196-203; DOI 10.1007/s13752-013-0090-6 http://post.queensu.ca/~forsdyke/introns3.htm

On 2014 Feb 02, Huiqi Qu commented:

The INS gene could be a potential drug target for type 1 diabetes. A new chemical promoting production of ectopic insulin in thymus could induce immune tolerance and prevent the autoimmunity causing type 1 diabetes.

On 2013 Jun 18, Noah Simon commented:

Really clever idea for removing selection bias. Works very well in practice with an intelligently chosen density estimate (there is a bunch of good recent work on nonparametric density estimates that achieve parametric rates)

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the two nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=37191680&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=37191681&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2014 Aug 23, F. Douglas Scutchfield commented:

Has this been of any utility to someone who is doing research in the area?

On 2014 May 05, Madhusudana Girija Sanal commented:

Creativity in biology-reply to Bruce Alberts

Bruce Alberts, describes biology as 'not at all an easy science' (1). This entirely depends on the definitions of boundaries! Biology is more factual and visual (and hence ‘easy’ for majority) than physics and mathematics. However, biology attains the same degree of difficulty at its interface with these subjects were mathematics or physics is applied to answer biological questions.This relative ease may be one of the reasons we find more students graduating in biology than other basic sciences (2). Creativity in the generation of new ideas and concepts is the essence of science. The current 'reward-recognition' system which just counts the papers is not recognizing this fact. The current trend is to evaluate scientists on the basis of the number of publications and their impact factors rather than their impact on the growth of science and the betterment of the society. This has resulted in a ‘publish or perish’ situation leading to an increase in junk and fraudulent publications (2). The cracking of the central dogma in biology or the invention of PCR brought new concepts in biology. Personalized medicine, designer molecules and proteins and regenerative medicine have huge potential. However,currently the society is wasting its resources in premature translational research and personalized medicine which are growth arrested in infancy, awaiting major developments in technology to overcome the bottlenecks (3). Any significant leap in biology needs a major leap in chemistry, physics and mathematics. These subjects provide not only technology and tools but also concepts for the growth of biology. So funding and research in other fields need be encouraged for the development of biology (2).

Life Sciences-where ‘workers’ take a lead over thinkers!

The number of publications in biology is proportional to the amount of ‘work done’ rather than “adventure of ideas”. This is causing many problems. For example this results in the dissolution of the boundaries between a scientist, a technician and a robot (2). The number of papers and the journals in which they are published often becomes a matter of chance, available workforce, availability of funds and collaborations which in turn depends on politics, influence and umpteen other factors decreasing the overall importance of intellect on scientific publication. It is difficult to assess individual contributions of the authors-who contributed more for the concept and who did most of the (technician) work-from a research article. Needless to say that who contributed towards the development of the concept should be given more credit. But this is rarely practiced (2).

The future of Biology

We are still taking the same cereals, pulses, milk and meat, which existed thousands of years before! We have yet not created any new plant or animal! Currently in biology, we move in a top to bottom fashion i.e.; explore the existing biological systems and reveal the science behind them and copy it, re-engineer it, according to our need. For example, find out a gene, find its importance, function, the protein coded, structure, interactions etc But I feel biology mature enough to think moving the other way i.e.; design a gene according to our need-plan its structure function, interactions etc according to our need design it. If I extend this view we should be able to engineer and produce totally new proteins or organisms rather than building or modifying from an existing (natural) platform (2).

Other major advancements will be in creating brain-computer interfaces and computer assisted thinking, electronic immortalization of personalities (individuals), planned generation of citizens of varying functions and capabilities for the better service of the society etc. For all this to happen the limiting step is the development of basic sciences which could then be easily translated to appropriate technologies.

1) Alberts B.Creativity at the interface. Science. 2012 Apr 13;336(6078):131. 2) Sanal MG Where are we going in science? Publish and perish! Current Science 2006 3) Maher B. Nature.Tissue engineering: How to build a heart. 2013 Jul 4;499(7456):20-2

On 2014 Jan 07, Brett Snodgrass commented:

Dear Author,

Thank you for the excellent article. I think the fistula may be the anatomic structures described by Joseph Treolar Wearn and named the vessels of Wearn. I read with great interest the article and the venticulocoronary arterial connections present in AA/MS may be comparable to those seen in pulmonary atresia with intact ventricular septum.

Please consider the following link. https://twitter.com/BrettSnodgrass1/status/418829863609331712 http://bit.ly/JTWearn

The connections described by Wearn are distinct from those described by Thebesius http://bit.ly/vasaThebesii

Comments and suggestions are welcome.

Thank you kindly.

On 2014 Jul 19, Daniele Focosi commented:

I totally and definitively agree with this analysis about one of the most striking paradoxes of our age. A recommendable reading.

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the eight nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487746&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487747&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487748&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487749&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487750&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487751&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487752&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487753&page=0&tab=ALL

Formulation data https://cananolab.nci.nih.gov/caNanoLab/composition.do?dispatch=summaryView&sampleId=36339712&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2014 Jun 24, Attila Csordas commented:

dataset available via PRIDE/ProteomeXchange http://www.ebi.ac.uk/pride/archive/projects/PXD001077

On 2014 May 17, David Keller commented:

Simvastatin inhibits the endogenous production of Coenzyme Q-10

Simvastatin has demonstrated some evidence that it might be neuroprotective in Parkinson disease (PD) (1,2), as noted in this abstract, and there is interest in testing that hypothesis. However, all statins inhibit the endogenous production of coenzyme Q10 (3), a substance which is thought to be crucial to the health of neurons. Clinical trials in which pharmacological doses of coenzyme Q10 were administered to PD patients had disappointing results (4), however there is ample reason to believe that inducing an outright deficiency of coenzyme Q10 as a side-effect of administration of simvastatin would be harmful to PD patients. Scientists planning a clinical trial testing simvastatin in PD patients should consider supplementation with a sufficient dose of coenzyme Q10 to overcome any statin-induced deficiency.

References

1: Lee YC, Lin CH, Wu RM, Lin MS, Lin JW, Chang CH, Lai MS. Discontinuation of statin therapy associates with Parkinson disease: a population-based study. Neurology. 2013 Jul 30;81(5):410-6. doi: 10.1212/WNL.0b013e31829d873c. Epub 2013 Jul 24. PubMed PMID: 23884037.

2: Yan J, Xu Y, Zhu C, Zhang L, Wu A, Yang Y, Xiong Z, Deng C, Huang XF, Yenari MA, Yang YG, Ying W, Wang Q. Simvastatin prevents dopaminergic neurodegeneration in experimental parkinsonian models: the association with anti-inflammatory responses. PLoS One. 2011;6(6):e20945. doi: 10.1371/journal.pone.0020945. Epub 2011 Jun 22. PubMed PMID: 21731633; PubMed Central PMCID: PMC3120752.

3: Marcoff L, Thompson PD. The role of coenzyme Q10 in statin-associated myopathy: a systematic review. J Am Coll Cardiol. 2007 Jun 12;49(23):2231-7. Review. PubMed PMID: 17560286.

4: Parkinson Study Group QE3 Investigators, A randomized clinical trial of high-dosage coenzyme q10 in early Parkinson disease: no evidence of benefit. JAMA Neurol. 2014 May 1;71(5):543-52. doi: 10.1001/jamaneurol.2014.131. PubMed PMID: 24664227.

On 2014 Dec 17, Sean Ekins commented:

Slides on this work http://www.slideshare.net/ekinssean/acs-combining-cheminformatics-methods-and-pathway-analysis-to-identify-molecules-with-whole-final

On 2014 Dec 17, Sean Ekins commented:

find out about CDD Vault here https://www.collaborativedrug.com/

On 2015 Oct 22, George McNamara commented:

This publication might now be open access at

http://downloads.hindawi.com/journals/acp/2012/904828.pdf

On 2013 Nov 15, George McNamara commented:

For fluorescence spectra data, please see the current PubSpectra download site at

http://works.bepress.com/gmcnamara/9/

For spectra graphing web sites, please see my comment in PubMed 16969821, McNamara et al 2006 Spectral imaging microscopy web sites and data. Cytometry A 69:863-871.

On 2016 May 02, Riccardo Polosa commented:

Exogenous lipoid pneumonia is a rare condition that may occur from aspiration or inhalation of fatlike material, such as mineral oil found in commercial products and various aerosolized industrial materials. In fact, lipoid pneumonia has been reported after excessive or inappropriate use of oil-based laxatives, lip balm and flavoured lip gloss.

McCauley et al (1) add electronic cigarette use to the list of potential causes of exogenous lipoid pneumonia. They document the intriguing case of a 42-year-old-woman with lipoid pneumonia and speculate that this could have been resulted from the regular exposure to glycerine-based oils found in electronic cigarette vapour.

For a balanced interpretation of this case report, it is worth emphasizing that this patient also had a schizoaffective disorder for which she was taking multiple psychiatric medications. Schizoaffective disorder is a mental illness characterized by recurring episodes of mood disorder and psychosis. These are known to be associated with eating disorders, odd behaviours, and suicidality related to delusional ideas or distorted cognitions related to food or body perception (2,3). These patients have been described to ingest coins, glycerin soap, urine, flowers, glycerin suppositories, candles, or inhale dangerous substances. Therefore, the lipoid pneumonia of this psychiatric patients might have been due to inappropriate ingestion of glycerine-based oils in the e-liquid of her electronic cigarette. In a follow up of hundreds of regular users of electronic cigarette with prefilled cartridges (containing a small cotton roll soaked in glycerine-based nicotine solution) no major adverse event were reported to date (4-7). Thus, the case reported by McCauley et al (1) simply indicates that harm can be caused by electronic cigarettes when these products are not used as recommended by the manufacturers.

It also interesting to note that "the patient reported a recent exposure to fumigation chemicals, as the result of a bedbug infestation of her apartment building 2 weeks prior to her hospitalization." Although causality (or con-causality) cannot be proven for certain, the temporal relationship of the clinical symptoms with the reported exposure of fumigation chemicals should be also considered in this case report. New generation fumigation chemicals include crude essential oils (8,9). Therefore, a role of these products for her lipoid pneumonia cannot be discounted.

References. 1. McCauley L, Markin C, Hosmer D. An unexpected consequence of electronic cigarette use. Chest. 2012 Apr;141(4):1110-3.

1. Goldstein G, Haas GL, Pakrashi M, Novero AM, Luther JF. The cycle of schizoaffective disorder, cognitive ability, alcoholism, and suicidality. Suicide Life Threat Behav. 2006 Feb;36(1):35-43.

2. Correll CU. Understanding schizoaffective disorder: from psychobiology to psychosocial functioning. J Clin Psychiatry. 2010;71 Suppl 2:8-13.

3. Polosa R, Caponnetto P, Morjaria JB, Papale G, Campagna D, Russo C. Effect of an electronic nicotine delivery device (e-Cigarette) on smoking reduction and cessation: a prospective 6-month pilot study. BMC Public Health. 2011;11:786.

4. Efficacy and safety of an electronic nicotine delivery device (E-cigarette). http://clinicaltrials.gov/ct2/show/NCT01164072?term=electronic+cigarette&rank=1

5. Efficacy and safety of an electronic nicotine delivery device (E-cigarette) without nicotine cartridges. http://clinicaltrials.gov/ct2/show/NCT01194583?term=polosa&rank=2

6. A structured protocol to evaluate efficacy and safety of a popular electronic nicotine delivery device (E-cigarette). http://clinicaltrials.gov/ct2/show/NCT01188239?term=polosa&rank=3

7. Keita SM, Vincent C, Schmit J, et al. 2001

8. Shaaya E, Ravid U, Paster N, et al 1991

On 2016 Dec 21, Adam Safron commented:

Thank you for this fascinating work! Some alternative suggestions regarding the proposal that preservation of feelings with bilateral insula damage suggests a subcortical basis for feeling awareness: 1. Cingulate cortex is preserved, which is likely to be able to engage in some degree of perceptual inference of interoceptive states, since all cortex has both "sensory" and "motor" properties. 2. A substantial amount of feeling is likely not purely interoceptive (e.g. via body position and patterns of muscular tension), and even if it were, such information is likely substantially instantiated in non-insular (and non-cingulate) body maps, particularly since this brain damage occurred in adulthood, and so 'representations' have had a great deal of time to become more generally distributed. 3. It seems that for a structure to be sufficient for supporting awareness, it must also able to hierarchically model a world in which things with specific attributes are able to be situated relative to other things with specific attributes, with spatiotemporal situating potentially being particularly important (i.e., precise feature binding allowing for the realization of the kinds of synthetic a priori categories that Kant suggested may represent pre-conditions for any judgment/sense-making whatsoever).

On 2017 Nov 22, Adam VanWert commented:

Do you think this could be a transporter, such as DRA (SLC26A3)?

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0137868. We believe the correct ID, which we have found by hand searching, is NCT01037868.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2018 Jan 09, Andy Collings commented:

A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (https://doi.org/10.7554/eLife.13620) and the results of the experiments were published in a Replication Study (https://doi.org/10.7554/eLife.29747).

On 2014 Nov 25, David Mage commented:

The authors mention "Mortality rate ratios for PM2.5 fluctuated over time, but without clear trends despite a substantial drop in the sulfate fraction," which led to the prior published comment "Is ambient PM2.5 sulfate harmful?" Perhaps they all have forgotten the historic work of Mary Amdur (PMID 679907, 2667973) who wrote "The irritant potency of the sulfate species varies so widely that the term 'suspended sulfate' is toxicologically meaningless," and "Sulfate is an unsatisfactory surrogate in existing epidemiological studies."

On 2017 Apr 21, EDUARDO FRANCO commented:

Please see PMID: 28417747. It is the same item

On 2014 May 07, Conrad Schoch commented:

The PCR protocols published as Table S1 in this paper has 2 errors:

The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.

The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC

On 2017 Jan 20, Andy Collings commented:

A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.04586) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.18173).

On 2014 Feb 11, David Keller commented:

None

On 2014 Feb 10, David Keller commented:

Mingrone and colleagues report that morbidly obese patients with poorly-controlled type 2 diabetes were able to achieve glycated hemoglobin levels of 4.95 +/- 0.49% after biliopancreatic-diversion bariatric surgery. Fasting glucose levels for these patients are reported in Table 2 as 3.89 mm/L +/- 0.67, which corresponds to 70 mg/dL +/- 12. This remarkable result raises the question of whether any of these patients were troubled by episodes of hypoglycemia, particularly those with fasting blood sugar levels of 58 mg/dL, at the low end of the range. Hypoglycemia is widely defined for diabetic patients as a blood sugar level of less than 70 mg/dL, and diabetic patients accustomed to hyperglycemia may not initially tolerate these lower blood sugar levels. Were there any reported episodes of severe or symptomatic hypoglycemia among the patients treated with bariatric surgery?

On 2015 Jun 28, Erick H Turner commented:

Below is a list of DOIs and links to the FDA review documents used in the writing of this article (of which I was lead author):

doi:10.6083/M4R2102M Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/1 doi:10.6083/M4M907BW Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/2 doi:10.6083/M4GH9GN2 Aripiprazole statistical review http://digitalcommons.ohsu.edu/fdadrug/3

doi:10.6083/M4BV7F9M Iloperidone administrative correspondence http://digitalcommons.ohsu.edu/fdadrug/4 doi:10.6083/M4736PMN Iloperidone approval letter http://digitalcommons.ohsu.edu/fdadrug/5 doi:10.6083/M43B5XVG Iloperidone medical review http://digitalcommons.ohsu.edu/fdadrug/6 doi:10.6083/M4ZK5FCK Iloperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/7 doi:10.6083/M4TT4PNV Iloperidone summary review (Division Director) http://digitalcommons.ohsu.edu/fdadrug/8 doi:10.6083/M4Q23XXF Iloperidone not approvable letter http://digitalcommons.ohsu.edu/fdadrug/9 doi:10.6083/M4K9367Z Iloperidone Office Director memo http://digitalcommons.ohsu.edu/fdadrug/10

doi:10.6083/M4FN14W3 Olanzapine complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/11

doi:10.6083/M49W0D67 Paliperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/12 doi:10.6083/M4639NFT Paliperidone medical review http://digitalcommons.ohsu.edu/fdadrug/13

doi:10.6083/M42B8WQ3 Quetiapine statistical review http://digitalcommons.ohsu.edu/fdadrug/14 doi:10.6083/M4XK8D76 Quetiapine medical review http://digitalcommons.ohsu.edu/fdadrug/15

doi:10.6083/M4ST7NHG Risperidone Consta complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/16 doi:10.6083/M4DN43RQ Risperidone immediate release complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/19

doi:10.6083/M4P26WTH Ziprasidone statistical review http://digitalcommons.ohsu.edu/fdadrug/17 doi:10.6083/M4JD4VG2 Ziprasidone medical review http://digitalcommons.ohsu.edu/fdadrug/18

On 2016 Mar 22, M Mangan commented:

This paper, like others associated with the Infascelli group, has been retracted. Visit the journal's link for further details. The crux of this matter is:

"The University of Naples concluded that multiple heterogeneities were likely attributable to digital manipulation, raising serious doubts on the reliability of the findings."

On 2016 Feb 05, Kristina Hanspers commented:

The network in figure 7 is available as a pathway in the "Open Access Publication" collection at WikiPathways: http://wikipathways.org/index.php/Pathway:WP2290. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2014 Jun 19, Robert Badgett commented:

This meta-analysis is updated as a living meta-analysis at https://github.com/openMetaAnalysis/Colchicine-for-Pericarditis.

On 2016 Aug 24, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT88597077. We believe the correct ID, which we have found by hand searching, is NCT00597077.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2016 Aug 30, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT200811021020. This trial ID is, in fact, a sponsor ID for the correct trial, but on the EU Clinical Trials Register. We believe that this trial may not have been registered on ClinicalTrials.gov, as we have searched for it in this register without success.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Feb 20, Egon Willighagen commented:

Figure 3 is available as WikiPathway at http://www.wikipathways.org/index.php/Pathway:WP2359

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0023968. We believe the correct ID, which we have found by hand searching, is NCT00239681.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2015 Jun 12, Bill Cayley commented:

A great example of when Less is More: https://lessismoreebm.wordpress.com/2015/05/08/management-of-asymptomatic-inguinal-hernia-a-systematic-review-of-the-evidence/

On 2013 Oct 31, John Cannell commented:

The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2017 Feb 23, Michael Hoffman commented:

Correction: In Online Methods, subsection "Training Parameters": "each segment label q ∈ [1, n] to 1/n" should be "each segment label q ∈ [1, m] to 1/m". (Thanks to Sharmi Banerjee.)

On 2014 Nov 25, Harri Hemila commented:

The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html

On 2014 Sep 02, M Felix Freshwater commented:

The abstract went MIA so here it is: • Introduction: Denis Keegan is a forgotten pioneer of plastic surgery. He performed over 50 nasal reconstructions in India, published a book and papers in leading medical journals on nasal reconstruction and was even credited by Gillies as being the first surgeon to discover the necessity of providing lining for flaps. Yet, now he remains largely unknown. • Methods: Search engines, journals and texts from the late 19th and early 20th centuries were used to determine Keegan’s place in the history of plastic surgery. • Key results: Keegan first described his technique of lined forehead flaps in The Lancet in 1891. He documented his results with photographs, as opposed to the usual 19th century method of artists’ illustrations. Contemporary journals and textbooks note Keegan’s “superior” or “excellent” results. In 1900, after he retired from the Indian Medical Service, Keegan’s book Rhinoplasty was published in London. He expanded upon his prior publications, credited his colleague Smith with improving his technique, and discussed the social implications of spousal abuse that caused his patients’ injuries. Twenty years later both Gillies in England and Davis in America wrote favorably about the Keegan-Smith method of nasal reconstruction. • Conclusion: Keegan should be remembered for his surgical advances, his modesty and for highlighting the social implications of spousal abuse.

On 2015 Jun 25, Donald Forsdyke commented:

In the light of new reviews (Zhang J, 2015 and Forsdyke DR, 2015), the following email to the senior author (May 27 2012) may be of interest:

'Thank you for a very interesting paper in PNAS Early Edition. The "potentially toxic" effect of protein-protein misinteractions forms the basis of our hypothesis of intracellular self/not-self discrimination, which is now receiving support from studies of the predisposition of females to autoimmune disease (J of Autoimmunity 38, J129-J134). Our earlier studies were influenced by the 1982 paper of E. H. McConkey on the "quinary structure" of proteins (PNAS 79, 3236-40). I have added a reference to your new paper as an "end-note" to the web version of a 2001 paper (see http://post.queensu.ca/~forsdyke/theorimm2.htm). I look forward to your future paper on the effect of interaction avoidance on the usage of synonymous codons.'

On 2013 Jul 11, Joshua L Cherry commented:

This article reports very interesting observations about the contributions of different types of sequence positions to the negative correlation between expression level and protein evolutionary rate (the E-R anticorrelation). However, the case for the assertion that is the title of the article is far from convincing. Much of the argument relies on predictions of protein stability made with I-Mutant2.0. The developers of that software report a correlation of only 0.62 between predicted and observed effects of mutations on stability (Capriotti E, 2005), and other assessments report even lower correlations (Potapov V, 2009). This would seem to leave much opportunity for incorrect classification of sequence positions as unimportant for stability. Furthermore, in seeking to explain their results the authors somewhat glibly discard the possibility of selection for protein function as a cause of E-R anticorrelation (in fact they seem to take it as established fact that toxic effects of misfolded proteins are a major, if incomplete, explanation). Surface residues are certainly involved in protein function, and selection for function should not be ruled out as an explanation of the negative correlation of their rate of evolution with expression level.

On 2016 Aug 21, Morten Oksvold commented:

Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:

https://ori.hhs.gov/content/case-summary-dasmahapatra-girija

This article should therefor not be cited.

On 2014 Nov 25, Harri Hemila commented:

This paper was retracted, see Hemilä H, 2012.

The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html

On 2017 Oct 31, Morten Oksvold commented:

Please note that this article contains unreliable data, and should not be cited. The Central ethical review board in Sweden found research misconduct in six articles by Macchiarini, including this one.

Please see the reports from the Central ethical review board in Sweden here: http://www.epn.se/media/2516/pressmeddelande-o-12-2016eng.pdf https://drive.google.com/file/d/0By2HqPi4t2RbYzZweVRieVVMajhJQUM0cmFMekwyRVJTUFVr/view

This information was provided by Leonid Schneider (forbetterscience.com).

On 2015 Jun 15, thomas samaras commented:

There's no doubt that increased stress is related to short height. And this stress is created through the propagation of a false premise based on social bias and not science. If we view human body height and its associated weight in terms of health and survival of our race, shorter height has a number of advantages. In the absence of health factors causing reduced height, shorter people tend to be healthier and have a longer functional life span. In addition, a worldwide population of smaller people reduces demand for energy, food, water and various resources. In addition, air, water and land pollution is sharply reduced if we do not increase the number of people on earth. For example, since the 1900s Americans have increased in height and weight (about 45 lb for males). A CDC researcher found that a 10 lb increase in the weight of the average American would require an increase in airline fuel consumption of 350 million gallons per year. This added fuel consumption would also generate 4 billion tons of air pollution.

Our society also gives short shrift to shorter athletes. A report from Finland found that the average military recruit was taller than boxers, long-distance runners, cross-country skiers, wrestlers and weight lifters. Cantu and others also reported that being shorter was an advantage in gymnastics, diving, ballet, figure skating, long distance running and certain skiing events.

We need to change our scenario from "taller is better" to "shorter is better." Otherwise, we face a bleak future; e.g., extinction or a sharp reduction in our standard of living. Several articles are identified below. The website: www.humanbodysize.com also provides more information on the benefits of smaller human body size and a list of over 45 papers, book chapters and books.

Samaras Thomas, T. Why smaller humans are in our future. Policy Innovations, 10/20/2014 (available from internet)

Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

Samaras TT. The Truth About Your Height, Tecolete Pub., San Diego 1994.(see Amazon Books)

On 2013 Dec 28, Tsuyoshi Miyakawa commented:

"ImageTM", an image analysis appilcation software shown in this video article, is now freely availble from http://www.mouse-phenotype.org/software.html.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2016 May 10, Morten Oksvold commented:

Please pay attention to the following report by ORI (Office of Research Integrity) before reading this article:

https://ori.hhs.gov/content/case-summary-pastorino-john-g

On 2014 Apr 02, Daniel Schwartz commented:

Liraglutide-induced kidney injury is a phenomenon that is being noted clinically more and more often. At our centre, we have occasionally seen a more subacute decline in GFR that seems to improve spontaneously after liraglutide is discontinued.

Full text/mobile access: http://qxmd.com/r/22392833

On 2013 Dec 05, Etienne P Lebel commented:

Provocative findings, but note that we were unable to replicate Slepian et al.’s Study 1 finding in two extremely high-powered, preregistered studies that were very faithful to all procedural and methodological details of the original study (i.e., same cover story, study title, manipulation, measures, item order, scale anchors, task instructions, sampling frame, population, and statistical analyses). See LeBel EP, 2014 for full details (see here for pre-publication manuscript).

Though Slepian et al. reported three other studies supporting the secret burdensomeness phenomenon, we advise that these three other findings need to be independently corroborated before the general phenomenon informs theory or health interventions.

On 2014 May 09, Michael Franklin commented:

The editor of J Physiol Sci has published a letter concerning this article.

J Physiol Sci. 2014 May;64(3):159. doi: 10.1007/s12576-014-0308-9. Expression of concern. Ishikawa Y.

On 2014 Apr 15, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/04/15/nihharvard-team-loses-aging-study-to-manipulated-data/

On 2014 Apr 17, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/04/16/integrity-of-data-undisputed-in-paper-pulled-for-plagiarism/

On 2017 Apr 12, Yi-nong NIU commented:

So it is still inconclusive.

On 2016 Dec 16, Claudiu Bandea commented:

Cell death by glutamine repeats: a revealing paradigm

(This comment was originally posted in Science on 4/4/2012: http://comments.sciencemag.org/content/10.1126/science.1219834)

In their perspective “Cell Death by Glutamine Repeats?,” Link and Saldi (1) expand on the suggestion made by Blum et al. (2) that the role of the polyglutamine-repeat protein PQN-41 in C. elegans nonapoptotic developmental cell death might be relevant for understanding the pathogenic mechanisms associated with Huntington’s disease (HD), Creutzfeldt-Jakob Disease (CJD) and other neurodegenerative diseases (NDs). HD is a progressive ND associated with an expansion of glutamine residues in the huntingtin protein (Htt), and CJD is one of the many fatal NDs associated with the prion protein (PrP), which has a domain rich in glutamine and asparagine (Q/N).

More remarkable, though, Link and Saldi bring forward a heretical concept: “glutamine-rich proteins could have a “natural role” in inducing cell death” (italics added). In other words, as recently proposed (3), the folding and assembly of these proteins into toxic agents that lead to cellular death and NDs are not inadvertent, protein misfolding events as they have been regarded for many decades, but evolutionarily selected properties and mechanisms associated with their biological function. Certainly, this is a radical departure from the current dogma that HD, CJD and many other NDs, including Alzheimer’s, Parkinson’s and ALS are protein misfolding diseases. If correct, as the current evidence indicates (3), this new hypothesis would lead to a major paradigm shift in understanding the etiology of these devastating diseases, which affect tens of millions of people worldwide, and the development of new preventive, diagnostic and therapeutic approaches.

Interestingly, similar to PQN-41, Htt is vital for embryonic development, and there is compelling evidence that it regulates the balance between cellular survival and death (4). There is also strong evidence that PrP, as well as other proteins implicated in NDs, such as Aβ, tau, and α-synuclein, can interfere with the life cycle of microbial and viral pathogens by various immune pathways, including apoptotic and nonapoptotic mechanisms for killing the host cells, which block their life cycle and limit the spread of infection (3). As suggested by Link and Saldi, PQN-4, Htt, PrP, TIA-1 and other Q/N-rich proteins (e.g. TDP-43 and FUS proteins, which are implicated in ALS and FTLD) can affect cellular viability by participating in the formation of cellular stress granules and bodies (5), which similar to other intrinsic cellular and developmental processes, such as RNA interference, might have been selected primarily as innate immune mechanisms (3).

References

(1) Link CD, Saldi TK. 2012. Cell death by glutamine repeats? Science 335:926; Link CD, 2012

(2) Blum ES et al. 2012. Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein. Science 335:970-3; Blum ES, 2012

(3) Bandea CI. 2013. Aβ, tau, α-synuclein, huntingtin, TDP-43, PrP and AA are members of the innate immune system: a unifying hypothesis on the etiology of AD, PD, HD, ALS, CJD and RSA as innate immunity disorders. bioRxiv. doi: 10.1101/000604; http://biorxiv.org/content/biorxiv/early/2013/11/18/000604.full.pdf

(4) Zuccato C, Valenza M, Cattaneo E. 2010. Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiol. Rev. 90:905-81; Zuccato C, 2010

(5) Beckham CJ, Parker R. 2008. P bodies, stress granules, and viral life cycles. Cell Host Microbe 3:206-12; Beckham CJ, 2008

On 2014 Jan 25, Jeffrey Beall commented:

This 2012 article contains the following text:

Such a mild heat shock elicited a heat shock response, characterized by the synthesis of new heat shock proteins normally almost absent in tissues of adult animals and by an increased synthesis of constitutively present or cognate heat shock proteins. This event was followed by a transient increased tolerance to high, normally lethal temperatures (thermotolerance). Later it was found that not only the tolerance to enhanced temperature increases, but also the resistance toward other events like hypoxia, ischemia, inflammation, and exposure to such cellular toxins as heavy metals, endotoxins, and reactive oxygen species (cross-tolerance), all imposing serious stress upon tissues and their composing cells [29].

The text does not occur within quotation marks. The reference number 29 appears as an endnote like this: [29] Tissières A et al. J Mol Biol. 1974 84: 389[PMID: 4219221].

However, the above text is matches exactly the text from this 2001 source: http://physrev.physiology.org/content/81/4/1461.full?related-urls=yes&legid=physrev;81/4/1461. The matching text makes up about the second half of the first paragraph in the introduction. The source is a completely different article from the given footnote.

I think this unattributed copying is common in the journal Bioinformation, and question whether the journal should continue to be included in PMC. Thank you.

On 2016 Aug 30, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00123456. This trial ID does not appear in ClinicalTrials.gov.

We have contacted the corresponding author on the study to ask them for the correct trial ID on 18/08/2016, but received no reply. We have also searched manually for this trial on ClinicalTrials.gov and found no matching study. We therefore believe that this trial may not have been registered on ClinicalTrials.gov.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Jul 23, Gwinyai Masukume commented:

Here are additional terms:

Coffee bean nuclei of ovarian Brenner tumor Ahr A, 1997

Grape-like vesicles of placental mesenchymal dysplasia Taga S, 2013

Raisin-like nuclei on pap smear of koilocytes Histology Blog

Watered-down fat-free milk – scanty thick white female ejaculate Rubio-Casillas A, 2011

On 2016 Oct 21, David Reardon commented:

While the authors are harsh in their criticism of Coleman's reliance on the lifetime diagnosis variable in examining each disorder, it appears from their own analysis (Table 1) that the 30-day and 12-month diagnoses showed significantly higher rates after abortion for diagnoses of PTSD, agoraphobia, alcohol dependence, drug dependence, and bipolar 1 at 12 months. Since they do not show the confidence intervals, it's quite possible that there is not enough sample power in the study for these findings to be statistically significant. Yet even in that case, the elevated rates are consistent with what has been reported in record linkage studies showing higher rates of treatment for psychiatric problems following abortion after controlling for one year prior admissions. Reardon DC, 2003Coleman PK, 2002

More importantly, a recent study Abortion, substance abuse and mental health in early adulthood: Thirteen-year longitudinal evidence from the United States provides results using a larger and more detailed data set.

On 2016 Feb 18, Kristina Hanspers commented:

The schematic in figure 1 is available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2851. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2014 May 08, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/05/07/near-word-to-word-similarities-topple-microflora-paper/

On 2014 Jan 15, Hirotaka Shoji commented:

"ImageLD/EP/TM/FZ", image analysis application softwares used for behavioral analysis in this article, are now freely available from http://www.mouse-phenotype.org/software.html.

On 2016 Nov 20, Morten Oksvold commented:

An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

This article should therefore no longer be cited.

On 2014 Sep 15, Casey M Bergman commented:

In follow-up work estimating allele frequencies of the TE insertion site data in this paper, we identified a small error in the data processing underlying the S1, S2, S3, and S4 supplementary files. These files provided incorrect read support counts based only on the first strain in which the TE insertion was identified, rather than the total number of read counts from all strains merged across the entire dataset.

For 461 TE insertions that are present in more than one strain identified using 454 sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported. For 1,606 TE insertions that are present in more than one strain identified using Illumina sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported.

The location, strand and TE family for 3,379 out of 3,386 TE insertion sites identified using 454 sequencing in Linheiro & Bergman 2012 is unchanged. For 7 out of the 3,386 TE insertions identified using 454 sequencing, properly merging reads across strains led to differences in location, strand or TE family. The location, strand and TE family for all 8,024 TE insertion sites identified using Illumina sequencing in Linheiro & Bergman 2012 is unchanged.

None of the main conclusions of Linheiro & Bergman 2012 are affected by this error, since the Illumina data set formed the basis of the target site duplication and motif analyses. However, four values in the first paragraph of the results should be corrected to read as follows (original --> corrected):

"For the 454 data, we processed 209,979,997 reads from a total of 34 strains and retained 44,254-->53,940 reads (0.021%-->0.026% of the total) across 34 strains that included a TE start/end for a TIR or LTR element that could be mapped to the reference genome. For the Illumina data we processed 7,835,189,604 reads from a total of 176 strains and retained 65,488 --> 97,854 reads (0.00084% --> 0.00124% of the total) across 166 strains that uniquely matched a start or end of a TE for a TIR and LTR element that could be mapped to the reference genome."

Revised versions of Files S1, S2, S3, and S4 that correct this error can be found here:

Revised version of File S1 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170046

Revised version of File S2 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170047

Revised version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683836

Revised version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683834

In addition to making these revised files, we have also generated alternate versions of the S3 and S4 .bed files that encode the number of DGRP strains in which the TE insertion is found (rather than the read support count) in the score field. These alternate versions allow estimation of the allele frequency of TE insertions in the DGRP population, and can be found here:

Alternate version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168882

Alternate version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168883

Finally, to allow determination of which DGRP strain each TE insertion was detected in, we have generated .zip archives of strain-specific .bed files (with read support count in the score field). These datasets can be found here:

Strain-specific annotation files for data in File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168885

Strain-specific annotation files for data in File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168884

The new alternate and strain-specific files correspond to data in the revised S1, S2, S3, and S4 files.

We apologize for any inconvenience this error could have caused.

On 2014 Sep 15, Casey M Bergman commented:

We have released an implementation of the approach described in this paper to detect non-reference TE insertions using next-generation whole-genome resequencing data here: https://github.com/bergmanlab/ngs_te_mapper

On 2015 Oct 06, Bill Cayley commented:

This is one of many instances showing that for some aspects of wound care, "less" is "more": https://lessismoreebm.wordpress.com/?s=wound