On 2015 Jan 11, Donald Forsdyke commented:

ANOTHER "INTRONS-FIRST" SCENARIO - UPDATE

Punctuation problems garbled my comment published with the paper in Biology Direct in 2012 http://www.biology-direct.com/content/7/1/11/comments#893696. The comment should read:

The statement in the abstract of Rogozin et al. that "the introns-first scenario is not supported by any evidence" seems to refer to the particular version of "introns-first" which was developed from the ideas of Darryl Reanney by Penny and his colleagues [references 47 and 48 of the Rogozin paper]. There is, however, another "introns-first" scenario, which has considerable bioinformatic support and is in at least two textbooks [1, 2]. Since the Rogozin paper does "not attempt a comprehensive coverage" and appears to favor introns invading protein-encoding regions, rather than the converse, readers of Biology Direct might like to review the evidence for the "introns-first" scenario that I began to elaborate in 1981 [3, 4]. Full details may be found in my webpages. A course on introns for High School and College students may be accessed through You Tube (videos 37-54 of Forsdyke Evolution Academy)[5].

Updating this, a full paper was later published [6].

[1] Forsdyke DR: Evolutionary Bioinformatics.: 2nd edition. New York: Springer; 2011: 249-266.

[2] Forsdyke DR: The interrupted gene. In Lewin's Genes X. Edited by Krebs JE, Goldstein ES, Kilpatrick ST. Boston: Jones and Bartlett; 2011:79-97, 172-175.

[3] Forsdyke DR: Are introns in-series error detecting sequences?. J Theoret Biol 1981, 93:861-866.Forsdyke DR, 1981

[4] Barrette IH, McKenna S, Taylor DR, Forsdyke DR: Introns resolve the conflict between base order-dependent stem-loop potential and the encoding of RNA or Protein: Further evidence from overlapping genes. Gene 2001, 270:181-189.Barrette IH, 2001

[5] Evolution Academy http://post.queensu.ca/~forsdyke/videolectures.htm

[6] Forsdyke DR: Introns first. Biological Theory 2013, 7:196-203; DOI 10.1007/s13752-013-0090-6 http://post.queensu.ca/~forsdyke/introns3.htm

On 2014 Feb 02, Huiqi Qu commented:

The INS gene could be a potential drug target for type 1 diabetes. A new chemical promoting production of ectopic insulin in thymus could induce immune tolerance and prevent the autoimmunity causing type 1 diabetes.

On 2013 Jun 18, Noah Simon commented:

Really clever idea for removing selection bias. Works very well in practice with an intelligently chosen density estimate (there is a bunch of good recent work on nonparametric density estimates that achieve parametric rates)

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the two nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=37191680&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=37191681&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2014 Aug 23, F. Douglas Scutchfield commented:

Has this been of any utility to someone who is doing research in the area?

On 2014 May 05, Madhusudana Girija Sanal commented:

Creativity in biology-reply to Bruce Alberts

Bruce Alberts, describes biology as 'not at all an easy science' (1). This entirely depends on the definitions of boundaries! Biology is more factual and visual (and hence ‘easy’ for majority) than physics and mathematics. However, biology attains the same degree of difficulty at its interface with these subjects were mathematics or physics is applied to answer biological questions.This relative ease may be one of the reasons we find more students graduating in biology than other basic sciences (2). Creativity in the generation of new ideas and concepts is the essence of science. The current 'reward-recognition' system which just counts the papers is not recognizing this fact. The current trend is to evaluate scientists on the basis of the number of publications and their impact factors rather than their impact on the growth of science and the betterment of the society. This has resulted in a ‘publish or perish’ situation leading to an increase in junk and fraudulent publications (2). The cracking of the central dogma in biology or the invention of PCR brought new concepts in biology. Personalized medicine, designer molecules and proteins and regenerative medicine have huge potential. However,currently the society is wasting its resources in premature translational research and personalized medicine which are growth arrested in infancy, awaiting major developments in technology to overcome the bottlenecks (3). Any significant leap in biology needs a major leap in chemistry, physics and mathematics. These subjects provide not only technology and tools but also concepts for the growth of biology. So funding and research in other fields need be encouraged for the development of biology (2).

Life Sciences-where ‘workers’ take a lead over thinkers!

The number of publications in biology is proportional to the amount of ‘work done’ rather than “adventure of ideas”. This is causing many problems. For example this results in the dissolution of the boundaries between a scientist, a technician and a robot (2). The number of papers and the journals in which they are published often becomes a matter of chance, available workforce, availability of funds and collaborations which in turn depends on politics, influence and umpteen other factors decreasing the overall importance of intellect on scientific publication. It is difficult to assess individual contributions of the authors-who contributed more for the concept and who did most of the (technician) work-from a research article. Needless to say that who contributed towards the development of the concept should be given more credit. But this is rarely practiced (2).

The future of Biology

We are still taking the same cereals, pulses, milk and meat, which existed thousands of years before! We have yet not created any new plant or animal! Currently in biology, we move in a top to bottom fashion i.e.; explore the existing biological systems and reveal the science behind them and copy it, re-engineer it, according to our need. For example, find out a gene, find its importance, function, the protein coded, structure, interactions etc But I feel biology mature enough to think moving the other way i.e.; design a gene according to our need-plan its structure function, interactions etc according to our need design it. If I extend this view we should be able to engineer and produce totally new proteins or organisms rather than building or modifying from an existing (natural) platform (2).

Other major advancements will be in creating brain-computer interfaces and computer assisted thinking, electronic immortalization of personalities (individuals), planned generation of citizens of varying functions and capabilities for the better service of the society etc. For all this to happen the limiting step is the development of basic sciences which could then be easily translated to appropriate technologies.

1) Alberts B.Creativity at the interface. Science. 2012 Apr 13;336(6078):131. 2) Sanal MG Where are we going in science? Publish and perish! Current Science 2006 3) Maher B. Nature.Tissue engineering: How to build a heart. 2013 Jul 4;499(7456):20-2

On 2014 Jan 07, Brett Snodgrass commented:

Dear Author,

Thank you for the excellent article. I think the fistula may be the anatomic structures described by Joseph Treolar Wearn and named the vessels of Wearn. I read with great interest the article and the venticulocoronary arterial connections present in AA/MS may be comparable to those seen in pulmonary atresia with intact ventricular septum.

Please consider the following link. https://twitter.com/BrettSnodgrass1/status/418829863609331712 http://bit.ly/JTWearn

The connections described by Wearn are distinct from those described by Thebesius http://bit.ly/vasaThebesii

Comments and suggestions are welcome.

Thank you kindly.

On 2014 Jul 19, Daniele Focosi commented:

I totally and definitively agree with this analysis about one of the most striking paradoxes of our age. A recommendable reading.

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the eight nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487746&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487747&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487748&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487749&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487750&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487751&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487752&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=35487753&page=0&tab=ALL

Formulation data https://cananolab.nci.nih.gov/caNanoLab/composition.do?dispatch=summaryView&sampleId=36339712&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2014 Jun 24, Attila Csordas commented:

dataset available via PRIDE/ProteomeXchange http://www.ebi.ac.uk/pride/archive/projects/PXD001077

On 2014 May 17, David Keller commented:

Simvastatin inhibits the endogenous production of Coenzyme Q-10

Simvastatin has demonstrated some evidence that it might be neuroprotective in Parkinson disease (PD) (1,2), as noted in this abstract, and there is interest in testing that hypothesis. However, all statins inhibit the endogenous production of coenzyme Q10 (3), a substance which is thought to be crucial to the health of neurons. Clinical trials in which pharmacological doses of coenzyme Q10 were administered to PD patients had disappointing results (4), however there is ample reason to believe that inducing an outright deficiency of coenzyme Q10 as a side-effect of administration of simvastatin would be harmful to PD patients. Scientists planning a clinical trial testing simvastatin in PD patients should consider supplementation with a sufficient dose of coenzyme Q10 to overcome any statin-induced deficiency.

References

1: Lee YC, Lin CH, Wu RM, Lin MS, Lin JW, Chang CH, Lai MS. Discontinuation of statin therapy associates with Parkinson disease: a population-based study. Neurology. 2013 Jul 30;81(5):410-6. doi: 10.1212/WNL.0b013e31829d873c. Epub 2013 Jul 24. PubMed PMID: 23884037.

2: Yan J, Xu Y, Zhu C, Zhang L, Wu A, Yang Y, Xiong Z, Deng C, Huang XF, Yenari MA, Yang YG, Ying W, Wang Q. Simvastatin prevents dopaminergic neurodegeneration in experimental parkinsonian models: the association with anti-inflammatory responses. PLoS One. 2011;6(6):e20945. doi: 10.1371/journal.pone.0020945. Epub 2011 Jun 22. PubMed PMID: 21731633; PubMed Central PMCID: PMC3120752.

3: Marcoff L, Thompson PD. The role of coenzyme Q10 in statin-associated myopathy: a systematic review. J Am Coll Cardiol. 2007 Jun 12;49(23):2231-7. Review. PubMed PMID: 17560286.

4: Parkinson Study Group QE3 Investigators, A randomized clinical trial of high-dosage coenzyme q10 in early Parkinson disease: no evidence of benefit. JAMA Neurol. 2014 May 1;71(5):543-52. doi: 10.1001/jamaneurol.2014.131. PubMed PMID: 24664227.

On 2014 Dec 17, Sean Ekins commented:

Slides on this work http://www.slideshare.net/ekinssean/acs-combining-cheminformatics-methods-and-pathway-analysis-to-identify-molecules-with-whole-final

On 2014 Dec 17, Sean Ekins commented:

find out about CDD Vault here https://www.collaborativedrug.com/

On 2015 Oct 22, George McNamara commented:

This publication might now be open access at

http://downloads.hindawi.com/journals/acp/2012/904828.pdf

On 2013 Nov 15, George McNamara commented:

For fluorescence spectra data, please see the current PubSpectra download site at

http://works.bepress.com/gmcnamara/9/

For spectra graphing web sites, please see my comment in PubMed 16969821, McNamara et al 2006 Spectral imaging microscopy web sites and data. Cytometry A 69:863-871.

On 2016 May 02, Riccardo Polosa commented:

Exogenous lipoid pneumonia is a rare condition that may occur from aspiration or inhalation of fatlike material, such as mineral oil found in commercial products and various aerosolized industrial materials. In fact, lipoid pneumonia has been reported after excessive or inappropriate use of oil-based laxatives, lip balm and flavoured lip gloss.

McCauley et al (1) add electronic cigarette use to the list of potential causes of exogenous lipoid pneumonia. They document the intriguing case of a 42-year-old-woman with lipoid pneumonia and speculate that this could have been resulted from the regular exposure to glycerine-based oils found in electronic cigarette vapour.

For a balanced interpretation of this case report, it is worth emphasizing that this patient also had a schizoaffective disorder for which she was taking multiple psychiatric medications. Schizoaffective disorder is a mental illness characterized by recurring episodes of mood disorder and psychosis. These are known to be associated with eating disorders, odd behaviours, and suicidality related to delusional ideas or distorted cognitions related to food or body perception (2,3). These patients have been described to ingest coins, glycerin soap, urine, flowers, glycerin suppositories, candles, or inhale dangerous substances. Therefore, the lipoid pneumonia of this psychiatric patients might have been due to inappropriate ingestion of glycerine-based oils in the e-liquid of her electronic cigarette. In a follow up of hundreds of regular users of electronic cigarette with prefilled cartridges (containing a small cotton roll soaked in glycerine-based nicotine solution) no major adverse event were reported to date (4-7). Thus, the case reported by McCauley et al (1) simply indicates that harm can be caused by electronic cigarettes when these products are not used as recommended by the manufacturers.

It also interesting to note that "the patient reported a recent exposure to fumigation chemicals, as the result of a bedbug infestation of her apartment building 2 weeks prior to her hospitalization." Although causality (or con-causality) cannot be proven for certain, the temporal relationship of the clinical symptoms with the reported exposure of fumigation chemicals should be also considered in this case report. New generation fumigation chemicals include crude essential oils (8,9). Therefore, a role of these products for her lipoid pneumonia cannot be discounted.

References. 1. McCauley L, Markin C, Hosmer D. An unexpected consequence of electronic cigarette use. Chest. 2012 Apr;141(4):1110-3.

1. Goldstein G, Haas GL, Pakrashi M, Novero AM, Luther JF. The cycle of schizoaffective disorder, cognitive ability, alcoholism, and suicidality. Suicide Life Threat Behav. 2006 Feb;36(1):35-43.

2. Correll CU. Understanding schizoaffective disorder: from psychobiology to psychosocial functioning. J Clin Psychiatry. 2010;71 Suppl 2:8-13.

3. Polosa R, Caponnetto P, Morjaria JB, Papale G, Campagna D, Russo C. Effect of an electronic nicotine delivery device (e-Cigarette) on smoking reduction and cessation: a prospective 6-month pilot study. BMC Public Health. 2011;11:786.

4. Efficacy and safety of an electronic nicotine delivery device (E-cigarette). http://clinicaltrials.gov/ct2/show/NCT01164072?term=electronic+cigarette&rank=1

5. Efficacy and safety of an electronic nicotine delivery device (E-cigarette) without nicotine cartridges. http://clinicaltrials.gov/ct2/show/NCT01194583?term=polosa&rank=2

6. A structured protocol to evaluate efficacy and safety of a popular electronic nicotine delivery device (E-cigarette). http://clinicaltrials.gov/ct2/show/NCT01188239?term=polosa&rank=3

7. Keita SM, Vincent C, Schmit J, et al. 2001

8. Shaaya E, Ravid U, Paster N, et al 1991

On 2016 Dec 21, Adam Safron commented:

Thank you for this fascinating work! Some alternative suggestions regarding the proposal that preservation of feelings with bilateral insula damage suggests a subcortical basis for feeling awareness: 1. Cingulate cortex is preserved, which is likely to be able to engage in some degree of perceptual inference of interoceptive states, since all cortex has both "sensory" and "motor" properties. 2. A substantial amount of feeling is likely not purely interoceptive (e.g. via body position and patterns of muscular tension), and even if it were, such information is likely substantially instantiated in non-insular (and non-cingulate) body maps, particularly since this brain damage occurred in adulthood, and so 'representations' have had a great deal of time to become more generally distributed. 3. It seems that for a structure to be sufficient for supporting awareness, it must also able to hierarchically model a world in which things with specific attributes are able to be situated relative to other things with specific attributes, with spatiotemporal situating potentially being particularly important (i.e., precise feature binding allowing for the realization of the kinds of synthetic a priori categories that Kant suggested may represent pre-conditions for any judgment/sense-making whatsoever).

On 2017 Nov 22, Adam VanWert commented:

Do you think this could be a transporter, such as DRA (SLC26A3)?

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0137868. We believe the correct ID, which we have found by hand searching, is NCT01037868.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2018 Jan 09, Andy Collings commented:

A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (https://doi.org/10.7554/eLife.13620) and the results of the experiments were published in a Replication Study (https://doi.org/10.7554/eLife.29747).

On 2014 Nov 25, David Mage commented:

The authors mention "Mortality rate ratios for PM2.5 fluctuated over time, but without clear trends despite a substantial drop in the sulfate fraction," which led to the prior published comment "Is ambient PM2.5 sulfate harmful?" Perhaps they all have forgotten the historic work of Mary Amdur (PMID 679907, 2667973) who wrote "The irritant potency of the sulfate species varies so widely that the term 'suspended sulfate' is toxicologically meaningless," and "Sulfate is an unsatisfactory surrogate in existing epidemiological studies."

On 2017 Apr 21, EDUARDO FRANCO commented:

Please see PMID: 28417747. It is the same item

On 2014 May 07, Conrad Schoch commented:

The PCR protocols published as Table S1 in this paper has 2 errors:

The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.

The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC

On 2017 Jan 20, Andy Collings commented:

A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (http://dx.doi.org/10.7554/eLife.04586) and the results of the experiments were published in a Replication Study (http://dx.doi.org/10.7554/eLife.18173).

On 2014 Feb 11, David Keller commented:

None

On 2014 Feb 10, David Keller commented:

Mingrone and colleagues report that morbidly obese patients with poorly-controlled type 2 diabetes were able to achieve glycated hemoglobin levels of 4.95 +/- 0.49% after biliopancreatic-diversion bariatric surgery. Fasting glucose levels for these patients are reported in Table 2 as 3.89 mm/L +/- 0.67, which corresponds to 70 mg/dL +/- 12. This remarkable result raises the question of whether any of these patients were troubled by episodes of hypoglycemia, particularly those with fasting blood sugar levels of 58 mg/dL, at the low end of the range. Hypoglycemia is widely defined for diabetic patients as a blood sugar level of less than 70 mg/dL, and diabetic patients accustomed to hyperglycemia may not initially tolerate these lower blood sugar levels. Were there any reported episodes of severe or symptomatic hypoglycemia among the patients treated with bariatric surgery?

On 2015 Jun 28, Erick H Turner commented:

Below is a list of DOIs and links to the FDA review documents used in the writing of this article (of which I was lead author):

doi:10.6083/M4R2102M Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/1 doi:10.6083/M4M907BW Aripiprazole medical review http://digitalcommons.ohsu.edu/fdadrug/2 doi:10.6083/M4GH9GN2 Aripiprazole statistical review http://digitalcommons.ohsu.edu/fdadrug/3

doi:10.6083/M4BV7F9M Iloperidone administrative correspondence http://digitalcommons.ohsu.edu/fdadrug/4 doi:10.6083/M4736PMN Iloperidone approval letter http://digitalcommons.ohsu.edu/fdadrug/5 doi:10.6083/M43B5XVG Iloperidone medical review http://digitalcommons.ohsu.edu/fdadrug/6 doi:10.6083/M4ZK5FCK Iloperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/7 doi:10.6083/M4TT4PNV Iloperidone summary review (Division Director) http://digitalcommons.ohsu.edu/fdadrug/8 doi:10.6083/M4Q23XXF Iloperidone not approvable letter http://digitalcommons.ohsu.edu/fdadrug/9 doi:10.6083/M4K9367Z Iloperidone Office Director memo http://digitalcommons.ohsu.edu/fdadrug/10

doi:10.6083/M4FN14W3 Olanzapine complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/11

doi:10.6083/M49W0D67 Paliperidone statistical review http://digitalcommons.ohsu.edu/fdadrug/12 doi:10.6083/M4639NFT Paliperidone medical review http://digitalcommons.ohsu.edu/fdadrug/13

doi:10.6083/M42B8WQ3 Quetiapine statistical review http://digitalcommons.ohsu.edu/fdadrug/14 doi:10.6083/M4XK8D76 Quetiapine medical review http://digitalcommons.ohsu.edu/fdadrug/15

doi:10.6083/M4ST7NHG Risperidone Consta complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/16 doi:10.6083/M4DN43RQ Risperidone immediate release complete Drug Approval Package (all reviews) http://digitalcommons.ohsu.edu/fdadrug/19

doi:10.6083/M4P26WTH Ziprasidone statistical review http://digitalcommons.ohsu.edu/fdadrug/17 doi:10.6083/M4JD4VG2 Ziprasidone medical review http://digitalcommons.ohsu.edu/fdadrug/18

On 2016 Mar 22, M Mangan commented:

This paper, like others associated with the Infascelli group, has been retracted. Visit the journal's link for further details. The crux of this matter is:

"The University of Naples concluded that multiple heterogeneities were likely attributable to digital manipulation, raising serious doubts on the reliability of the findings."

On 2016 Feb 05, Kristina Hanspers commented:

The network in figure 7 is available as a pathway in the "Open Access Publication" collection at WikiPathways: http://wikipathways.org/index.php/Pathway:WP2290. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2014 Jun 19, Robert Badgett commented:

This meta-analysis is updated as a living meta-analysis at https://github.com/openMetaAnalysis/Colchicine-for-Pericarditis.

On 2016 Aug 24, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT88597077. We believe the correct ID, which we have found by hand searching, is NCT00597077.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2016 Aug 30, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT200811021020. This trial ID is, in fact, a sponsor ID for the correct trial, but on the EU Clinical Trials Register. We believe that this trial may not have been registered on ClinicalTrials.gov, as we have searched for it in this register without success.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Feb 20, Egon Willighagen commented:

Figure 3 is available as WikiPathway at http://www.wikipathways.org/index.php/Pathway:WP2359

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT0023968. We believe the correct ID, which we have found by hand searching, is NCT00239681.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2015 Jun 12, Bill Cayley commented:

A great example of when Less is More: https://lessismoreebm.wordpress.com/2015/05/08/management-of-asymptomatic-inguinal-hernia-a-systematic-review-of-the-evidence/

On 2013 Oct 31, John Cannell commented:

The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2017 Feb 23, Michael Hoffman commented:

Correction: In Online Methods, subsection "Training Parameters": "each segment label q ∈ [1, n] to 1/n" should be "each segment label q ∈ [1, m] to 1/m". (Thanks to Sharmi Banerjee.)

On 2014 Nov 25, Harri Hemila commented:

The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html

On 2014 Sep 02, M Felix Freshwater commented:

The abstract went MIA so here it is: • Introduction: Denis Keegan is a forgotten pioneer of plastic surgery. He performed over 50 nasal reconstructions in India, published a book and papers in leading medical journals on nasal reconstruction and was even credited by Gillies as being the first surgeon to discover the necessity of providing lining for flaps. Yet, now he remains largely unknown. • Methods: Search engines, journals and texts from the late 19th and early 20th centuries were used to determine Keegan’s place in the history of plastic surgery. • Key results: Keegan first described his technique of lined forehead flaps in The Lancet in 1891. He documented his results with photographs, as opposed to the usual 19th century method of artists’ illustrations. Contemporary journals and textbooks note Keegan’s “superior” or “excellent” results. In 1900, after he retired from the Indian Medical Service, Keegan’s book Rhinoplasty was published in London. He expanded upon his prior publications, credited his colleague Smith with improving his technique, and discussed the social implications of spousal abuse that caused his patients’ injuries. Twenty years later both Gillies in England and Davis in America wrote favorably about the Keegan-Smith method of nasal reconstruction. • Conclusion: Keegan should be remembered for his surgical advances, his modesty and for highlighting the social implications of spousal abuse.

On 2015 Jun 25, Donald Forsdyke commented:

In the light of new reviews (Zhang J, 2015 and Forsdyke DR, 2015), the following email to the senior author (May 27 2012) may be of interest:

'Thank you for a very interesting paper in PNAS Early Edition. The "potentially toxic" effect of protein-protein misinteractions forms the basis of our hypothesis of intracellular self/not-self discrimination, which is now receiving support from studies of the predisposition of females to autoimmune disease (J of Autoimmunity 38, J129-J134). Our earlier studies were influenced by the 1982 paper of E. H. McConkey on the "quinary structure" of proteins (PNAS 79, 3236-40). I have added a reference to your new paper as an "end-note" to the web version of a 2001 paper (see http://post.queensu.ca/~forsdyke/theorimm2.htm). I look forward to your future paper on the effect of interaction avoidance on the usage of synonymous codons.'

On 2013 Jul 11, Joshua L Cherry commented:

This article reports very interesting observations about the contributions of different types of sequence positions to the negative correlation between expression level and protein evolutionary rate (the E-R anticorrelation). However, the case for the assertion that is the title of the article is far from convincing. Much of the argument relies on predictions of protein stability made with I-Mutant2.0. The developers of that software report a correlation of only 0.62 between predicted and observed effects of mutations on stability (Capriotti E, 2005), and other assessments report even lower correlations (Potapov V, 2009). This would seem to leave much opportunity for incorrect classification of sequence positions as unimportant for stability. Furthermore, in seeking to explain their results the authors somewhat glibly discard the possibility of selection for protein function as a cause of E-R anticorrelation (in fact they seem to take it as established fact that toxic effects of misfolded proteins are a major, if incomplete, explanation). Surface residues are certainly involved in protein function, and selection for function should not be ruled out as an explanation of the negative correlation of their rate of evolution with expression level.

On 2016 Aug 21, Morten Oksvold commented:

Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:

https://ori.hhs.gov/content/case-summary-dasmahapatra-girija

This article should therefor not be cited.

On 2014 Nov 25, Harri Hemila commented:

This paper was retracted, see Hemilä H, 2012.

The reasons for the retraction are described in: http://www.mv.helsinki.fi/home/hemila/PPH/CTA/CTA.html

On 2017 Oct 31, Morten Oksvold commented:

Please note that this article contains unreliable data, and should not be cited. The Central ethical review board in Sweden found research misconduct in six articles by Macchiarini, including this one.

Please see the reports from the Central ethical review board in Sweden here: http://www.epn.se/media/2516/pressmeddelande-o-12-2016eng.pdf https://drive.google.com/file/d/0By2HqPi4t2RbYzZweVRieVVMajhJQUM0cmFMekwyRVJTUFVr/view

This information was provided by Leonid Schneider (forbetterscience.com).

On 2015 Jun 15, thomas samaras commented:

There's no doubt that increased stress is related to short height. And this stress is created through the propagation of a false premise based on social bias and not science. If we view human body height and its associated weight in terms of health and survival of our race, shorter height has a number of advantages. In the absence of health factors causing reduced height, shorter people tend to be healthier and have a longer functional life span. In addition, a worldwide population of smaller people reduces demand for energy, food, water and various resources. In addition, air, water and land pollution is sharply reduced if we do not increase the number of people on earth. For example, since the 1900s Americans have increased in height and weight (about 45 lb for males). A CDC researcher found that a 10 lb increase in the weight of the average American would require an increase in airline fuel consumption of 350 million gallons per year. This added fuel consumption would also generate 4 billion tons of air pollution.

Our society also gives short shrift to shorter athletes. A report from Finland found that the average military recruit was taller than boxers, long-distance runners, cross-country skiers, wrestlers and weight lifters. Cantu and others also reported that being shorter was an advantage in gymnastics, diving, ballet, figure skating, long distance running and certain skiing events.

We need to change our scenario from "taller is better" to "shorter is better." Otherwise, we face a bleak future; e.g., extinction or a sharp reduction in our standard of living. Several articles are identified below. The website: www.humanbodysize.com also provides more information on the benefits of smaller human body size and a list of over 45 papers, book chapters and books.

Samaras Thomas, T. Why smaller humans are in our future. Policy Innovations, 10/20/2014 (available from internet)

Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

Samaras TT. The Truth About Your Height, Tecolete Pub., San Diego 1994.(see Amazon Books)

On 2013 Dec 28, Tsuyoshi Miyakawa commented:

"ImageTM", an image analysis appilcation software shown in this video article, is now freely availble from http://www.mouse-phenotype.org/software.html.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2016 May 10, Morten Oksvold commented:

Please pay attention to the following report by ORI (Office of Research Integrity) before reading this article:

https://ori.hhs.gov/content/case-summary-pastorino-john-g

On 2014 Apr 02, Daniel Schwartz commented:

Liraglutide-induced kidney injury is a phenomenon that is being noted clinically more and more often. At our centre, we have occasionally seen a more subacute decline in GFR that seems to improve spontaneously after liraglutide is discontinued.

Full text/mobile access: http://qxmd.com/r/22392833

On 2013 Dec 05, Etienne P Lebel commented:

Provocative findings, but note that we were unable to replicate Slepian et al.’s Study 1 finding in two extremely high-powered, preregistered studies that were very faithful to all procedural and methodological details of the original study (i.e., same cover story, study title, manipulation, measures, item order, scale anchors, task instructions, sampling frame, population, and statistical analyses). See LeBel EP, 2014 for full details (see here for pre-publication manuscript).

Though Slepian et al. reported three other studies supporting the secret burdensomeness phenomenon, we advise that these three other findings need to be independently corroborated before the general phenomenon informs theory or health interventions.

On 2014 May 09, Michael Franklin commented:

The editor of J Physiol Sci has published a letter concerning this article.

J Physiol Sci. 2014 May;64(3):159. doi: 10.1007/s12576-014-0308-9. Expression of concern. Ishikawa Y.

On 2014 Apr 15, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/04/15/nihharvard-team-loses-aging-study-to-manipulated-data/

On 2014 Apr 17, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/04/16/integrity-of-data-undisputed-in-paper-pulled-for-plagiarism/

On 2017 Apr 12, Yi-nong NIU commented:

So it is still inconclusive.

On 2016 Dec 16, Claudiu Bandea commented:

Cell death by glutamine repeats: a revealing paradigm

(This comment was originally posted in Science on 4/4/2012: http://comments.sciencemag.org/content/10.1126/science.1219834)

In their perspective “Cell Death by Glutamine Repeats?,” Link and Saldi (1) expand on the suggestion made by Blum et al. (2) that the role of the polyglutamine-repeat protein PQN-41 in C. elegans nonapoptotic developmental cell death might be relevant for understanding the pathogenic mechanisms associated with Huntington’s disease (HD), Creutzfeldt-Jakob Disease (CJD) and other neurodegenerative diseases (NDs). HD is a progressive ND associated with an expansion of glutamine residues in the huntingtin protein (Htt), and CJD is one of the many fatal NDs associated with the prion protein (PrP), which has a domain rich in glutamine and asparagine (Q/N).

More remarkable, though, Link and Saldi bring forward a heretical concept: “glutamine-rich proteins could have a “natural role” in inducing cell death” (italics added). In other words, as recently proposed (3), the folding and assembly of these proteins into toxic agents that lead to cellular death and NDs are not inadvertent, protein misfolding events as they have been regarded for many decades, but evolutionarily selected properties and mechanisms associated with their biological function. Certainly, this is a radical departure from the current dogma that HD, CJD and many other NDs, including Alzheimer’s, Parkinson’s and ALS are protein misfolding diseases. If correct, as the current evidence indicates (3), this new hypothesis would lead to a major paradigm shift in understanding the etiology of these devastating diseases, which affect tens of millions of people worldwide, and the development of new preventive, diagnostic and therapeutic approaches.

Interestingly, similar to PQN-41, Htt is vital for embryonic development, and there is compelling evidence that it regulates the balance between cellular survival and death (4). There is also strong evidence that PrP, as well as other proteins implicated in NDs, such as Aβ, tau, and α-synuclein, can interfere with the life cycle of microbial and viral pathogens by various immune pathways, including apoptotic and nonapoptotic mechanisms for killing the host cells, which block their life cycle and limit the spread of infection (3). As suggested by Link and Saldi, PQN-4, Htt, PrP, TIA-1 and other Q/N-rich proteins (e.g. TDP-43 and FUS proteins, which are implicated in ALS and FTLD) can affect cellular viability by participating in the formation of cellular stress granules and bodies (5), which similar to other intrinsic cellular and developmental processes, such as RNA interference, might have been selected primarily as innate immune mechanisms (3).

References

(1) Link CD, Saldi TK. 2012. Cell death by glutamine repeats? Science 335:926; Link CD, 2012

(2) Blum ES et al. 2012. Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein. Science 335:970-3; Blum ES, 2012

(3) Bandea CI. 2013. Aβ, tau, α-synuclein, huntingtin, TDP-43, PrP and AA are members of the innate immune system: a unifying hypothesis on the etiology of AD, PD, HD, ALS, CJD and RSA as innate immunity disorders. bioRxiv. doi: 10.1101/000604; http://biorxiv.org/content/biorxiv/early/2013/11/18/000604.full.pdf

(4) Zuccato C, Valenza M, Cattaneo E. 2010. Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiol. Rev. 90:905-81; Zuccato C, 2010

(5) Beckham CJ, Parker R. 2008. P bodies, stress granules, and viral life cycles. Cell Host Microbe 3:206-12; Beckham CJ, 2008

On 2014 Jan 25, Jeffrey Beall commented:

This 2012 article contains the following text:

Such a mild heat shock elicited a heat shock response, characterized by the synthesis of new heat shock proteins normally almost absent in tissues of adult animals and by an increased synthesis of constitutively present or cognate heat shock proteins. This event was followed by a transient increased tolerance to high, normally lethal temperatures (thermotolerance). Later it was found that not only the tolerance to enhanced temperature increases, but also the resistance toward other events like hypoxia, ischemia, inflammation, and exposure to such cellular toxins as heavy metals, endotoxins, and reactive oxygen species (cross-tolerance), all imposing serious stress upon tissues and their composing cells [29].

The text does not occur within quotation marks. The reference number 29 appears as an endnote like this: [29] Tissières A et al. J Mol Biol. 1974 84: 389[PMID: 4219221].

However, the above text is matches exactly the text from this 2001 source: http://physrev.physiology.org/content/81/4/1461.full?related-urls=yes&legid=physrev;81/4/1461. The matching text makes up about the second half of the first paragraph in the introduction. The source is a completely different article from the given footnote.

I think this unattributed copying is common in the journal Bioinformation, and question whether the journal should continue to be included in PMC. Thank you.

On 2016 Aug 30, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00123456. This trial ID does not appear in ClinicalTrials.gov.

We have contacted the corresponding author on the study to ask them for the correct trial ID on 18/08/2016, but received no reply. We have also searched manually for this trial on ClinicalTrials.gov and found no matching study. We therefore believe that this trial may not have been registered on ClinicalTrials.gov.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Jul 23, Gwinyai Masukume commented:

Here are additional terms:

Coffee bean nuclei of ovarian Brenner tumor Ahr A, 1997

Grape-like vesicles of placental mesenchymal dysplasia Taga S, 2013

Raisin-like nuclei on pap smear of koilocytes Histology Blog

Watered-down fat-free milk – scanty thick white female ejaculate Rubio-Casillas A, 2011

On 2016 Oct 21, David Reardon commented:

While the authors are harsh in their criticism of Coleman's reliance on the lifetime diagnosis variable in examining each disorder, it appears from their own analysis (Table 1) that the 30-day and 12-month diagnoses showed significantly higher rates after abortion for diagnoses of PTSD, agoraphobia, alcohol dependence, drug dependence, and bipolar 1 at 12 months. Since they do not show the confidence intervals, it's quite possible that there is not enough sample power in the study for these findings to be statistically significant. Yet even in that case, the elevated rates are consistent with what has been reported in record linkage studies showing higher rates of treatment for psychiatric problems following abortion after controlling for one year prior admissions. Reardon DC, 2003Coleman PK, 2002

More importantly, a recent study Abortion, substance abuse and mental health in early adulthood: Thirteen-year longitudinal evidence from the United States provides results using a larger and more detailed data set.

On 2016 Feb 18, Kristina Hanspers commented:

The schematic in figure 1 is available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2851. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2014 May 08, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/05/07/near-word-to-word-similarities-topple-microflora-paper/

On 2014 Jan 15, Hirotaka Shoji commented:

"ImageLD/EP/TM/FZ", image analysis application softwares used for behavioral analysis in this article, are now freely available from http://www.mouse-phenotype.org/software.html.

On 2016 Nov 20, Morten Oksvold commented:

An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

This article should therefore no longer be cited.

On 2014 Sep 15, Casey M Bergman commented:

In follow-up work estimating allele frequencies of the TE insertion site data in this paper, we identified a small error in the data processing underlying the S1, S2, S3, and S4 supplementary files. These files provided incorrect read support counts based only on the first strain in which the TE insertion was identified, rather than the total number of read counts from all strains merged across the entire dataset.

For 461 TE insertions that are present in more than one strain identified using 454 sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported. For 1,606 TE insertions that are present in more than one strain identified using Illumina sequencing, the corrected number of reads supporting the TE insertion is higher than originally reported.

The location, strand and TE family for 3,379 out of 3,386 TE insertion sites identified using 454 sequencing in Linheiro & Bergman 2012 is unchanged. For 7 out of the 3,386 TE insertions identified using 454 sequencing, properly merging reads across strains led to differences in location, strand or TE family. The location, strand and TE family for all 8,024 TE insertion sites identified using Illumina sequencing in Linheiro & Bergman 2012 is unchanged.

None of the main conclusions of Linheiro & Bergman 2012 are affected by this error, since the Illumina data set formed the basis of the target site duplication and motif analyses. However, four values in the first paragraph of the results should be corrected to read as follows (original --> corrected):

"For the 454 data, we processed 209,979,997 reads from a total of 34 strains and retained 44,254-->53,940 reads (0.021%-->0.026% of the total) across 34 strains that included a TE start/end for a TIR or LTR element that could be mapped to the reference genome. For the Illumina data we processed 7,835,189,604 reads from a total of 176 strains and retained 65,488 --> 97,854 reads (0.00084% --> 0.00124% of the total) across 166 strains that uniquely matched a start or end of a TE for a TIR and LTR element that could be mapped to the reference genome."

Revised versions of Files S1, S2, S3, and S4 that correct this error can be found here:

Revised version of File S1 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170046

Revised version of File S2 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1170047

Revised version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683836

Revised version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.683834

In addition to making these revised files, we have also generated alternate versions of the S3 and S4 .bed files that encode the number of DGRP strains in which the TE insertion is found (rather than the read support count) in the score field. These alternate versions allow estimation of the allele frequency of TE insertions in the DGRP population, and can be found here:

Alternate version of File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168882

Alternate version of File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168883

Finally, to allow determination of which DGRP strain each TE insertion was detected in, we have generated .zip archives of strain-specific .bed files (with read support count in the score field). These datasets can be found here:

Strain-specific annotation files for data in File S3 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168885

Strain-specific annotation files for data in File S4 from Linheiro & Bergman 2012. http://dx.doi.org/10.6084/m9.figshare.1168884

The new alternate and strain-specific files correspond to data in the revised S1, S2, S3, and S4 files.

We apologize for any inconvenience this error could have caused.

On 2014 Sep 15, Casey M Bergman commented:

We have released an implementation of the approach described in this paper to detect non-reference TE insertions using next-generation whole-genome resequencing data here: https://github.com/bergmanlab/ngs_te_mapper

On 2015 Oct 06, Bill Cayley commented:

This is one of many instances showing that for some aspects of wound care, "less" is "more": https://lessismoreebm.wordpress.com/?s=wound

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2017 Oct 05, ROBERT HURST commented:

Although 253JB-V are bladder cancer cells unfortunately, KU-7 is not bladder cancer but is, instead, HeLa cells. PMC3805942

On 2015 Jan 19, Martin Hofmeister commented:

With regard to the interesting study by Mazloumi et al. concerning work ability among employees in one of the Iranian petrochemical industries, allow me to add one aspect. As opposed to numerous findings by other research groups [1-4], exercise activity does not constitute a key factor affecting work ability in the Iranian study. However, the high values relating to exercise activity suggest that the employees’ subjective assessments may have to be considered unrealistic. Studies specifying a degree of criteria for exercise behaviour (in terms of frequency, scope and intensity) that can be expected to produce health benefits, describe considerably lower rates of exercise activity. This implies that a classification of physical exercise activity based on energy consumption can be considered more significant than single pieces of information on exercise activity [5]. Regarding future studies on work ability in Iran, it is thus worth considering whether subjective data on the exercise activity of individuals could be corroborated by objective testing techniques, such as sports motorics and accelerometer testing [6-8].

References

1 van den Berg TI, Elders LA, de Zwart BC, Burdorf A. The effects of work-related and individual factors on the Work Ability Index: a systematic review. Occup Environ Med. 2009;66(4):211-20. van den Berg TI, 2009

2 Airila A, Hakanen J, Punakallio A, Lusa S, Luukkonen R. Is work engagement related to work ability beyond working conditions and lifestyle factors? Int Arch Occup Environ Health 2012;85(8):915-25. Airila A, 2012

3 Kettunen O, Vuorimaa T, Vasankari T. 12-mo intervention of physical exercise improved work ability, especially in subjects with low baseline work ability. Int J Environ Res Public Health. 2014;11(4):3859-69.Kettunen O, 2014

4 Rutanen R, Luoto R, Raitanen J, Mansikkamäki K, Tomás E, Nygård CH. Short- and Long-term Effects of a Physical Exercise Intervention on Work Ability and Work Strain in Symptomatic Menopausal Women. Saf Health Work. 2014;5(4):186-90. Rutanen R, 2014

5 Macera CA, Ham SA, Jones DA, Kimsey CD, Ainsworth BE, Neff LJ. Limitations on the use of a single screening question to measure sedentary behavior. Am J Public Health. 2001;91(12):2010-2.Macera CA, 2001

6 Kaleta D, Makowiec-Dabrowska T, Jegier A. Leisure-time physical activity, cardiorespiratory fitness and work ability: a study in randomly selected residents of Lódź. Int J Occup Med Environ Health 2004;17(4):457-64. Kaleta D, 2004

7 Sörensen L, Honkalehto S, Kallinen M, Pekkonen M, Louhevaara V, Smolander J, Alén M. Are cardiorespiratory fitness and walking performance associated with self-reported quality of life and work ability? Int J Occup Med Environ Health. 2007;20(3):257-64. Sörensen L, 2007

8 Sörensen LE, Pekkonen MM, Männikkö KH, Louhevaara VA, Smolander J, Alén MJ. Associations between work ability, health-related quality of life, physical activity and fitness among middle-aged men. Appl Ergon. 2008;39(6):786-91. Sörensen LE, 2008

On 2017 Jan 06, Melissa Rethlefsen commented:

Though the authors clearly recognize a need to search multiple databases to gather as many relevant references as possible, a major concern is that the information sources listed as searched in this article are largely not databases, but database platforms.

The authors searched "Scopus, EBSCOhost, Ovid, and Web of Science platforms." Of those four, only Scopus is a unique database. EBSCOhost is a platform that contains many different databases. I counted 71 beginning with the letter "A" on their title list: https://www.ebscohost.com/title-lists Ovid is similarly a platform with many different database options, though not quite as many as on EBSCOhost. Ovid has "over 100" different database options: http://www.ovid.com/site/catalog/databases/index.jsp Web of Science similarly is a platform with multiple database offerings (22 of them, with different date range options available): http://thomsonreuters.com/en/products-services/scholarly-scientific-research/scholarly-search-and-discovery/web-of-science.html

Unfortunately, this article does not include a replicable search strategy in the text or in a supplementary document, so it is not possible to guess what databases might have been used, or what search strategies were used to search them. Because this is a mixed methods review and did not have an established protocol, it may be unreasonable to expect the authors to report their search methods as stringently as in a "true" systematic review, but since the authors claim a systematic review, it would have been appropriate to document and report the search methods according to known standards (i.e., PRISMA, MOOSE).

This study might have benefited from the inclusion of a librarian or information specialist on the team to improve documentation and reporting of the key methodology used to conduct this work. Additional peer review from librarians and information specialists may help identify reporting concerns, including lack of search detail and details about information sources utilized.

On 2015 Jan 09, Larry Parnell commented:

Please see our more current catalog of cardiometabolic GxEs, with its more in-depth and more thorough analysis. This is available in BioData Mining 7:21 at http://www.biodatamining.org/content/7/1/21 or PMID 25368670. This would be a better citation than the above.

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT01043113. We believe the correct ID, which we have found by hand searching, is NCT01043133.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2013 Oct 29, Tom Kindlon commented:

Findings may be relevant for some patients diagnosed with myalgic encephalomyelitis or chronic fatigue syndrome

I would like to thank the authors for taking the time to write up this case report, as well as thanking the patient for giving permission for the use of her story.

I thought it was worth pointing out that the symptoms described by the authors and the patient would be quite similar to the symptoms patients with myalgic encephalomyelitis (ME) or chronic fatigue syndrome (CFS) would report.^1-7 I don't believe patients with an ME or CFS diagnosis are often assessed for a mitochondrial myopathy using the tests mentioned although a novel test did find evidence for mitochondrial dysfunction.⁸ At least two studies have found carnitine supplementation to be of benefit in patients diagnosed with CFS.^9,10

Excessive acidosis on exercise has been found in patients.^11,12 One study, looking for an association with enterovirus infection, found that 58% of CFS patients had an abnormal lactate response to subanaerobic threshold exercise test.¹³

CFS is increasingly recoognized as being heterogeneous.¹⁴ Despite its name, more symptoms than fatigue are generally associated with it.¹⁵ Mitochondrial problems could relevant for some patients even if they may not be relevant for all patients.

References:

(1) Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome: A comprehensive approach to its definition and study. Annals of Internal Medicine. 1994;121:953-959.

(2) Sharpe MC, Archard LC, Banatvala JE, et al. A report--chronic fatigue syndrome: guidelines for research. J R Soc Med. 1991 Feb;84(2):118-21.

(3) Carruthers B, Jain A, de Meirleir K, Peterson D, Klimas N, Lemer A, et al.: Myalgic encephalomyelitis/chronic fatigue syndrome: clinical working case definition, diagnostic and treatment protocols. J Chronic Fatigue Syndrome 2003;11(1):7-33

(4) Holmes GP, Kaplan JE, Gantz NM, et al. Chronic fatigue syndrome: a working case definition. Ann Intern Med. 1988 Mar;108(3):387-9.

(5) Jason LA, Evans M, Porter N, et al. The development of a revised Canadian Myalgic Encephalomyelitis-Chronic Fatigue Syndrome case definition. American Journal of Biochemistry and Biotechnology. 2010:6;120–135. Retrieved from http://www.scipub.org/fulltext/ajbb/ajbb62120-135.pdf

(6) Carruthers BM, van de Sande MI, De Meirleir KL, et al. Myalgic Encephalomyelitis: International Consensus Criteria. J Intern Med. 2011 Jul 20. doi: 10.1111/j.1365- 2796.2011.02428.x. [Epub ahead of print]

(7) Goudsmit EM, Shepherd C, Dancey CP, Howes S. ME: Chronic fatigue syndrome or a distinct clinical entity? Health Psychology Update, 2009, 18, 1, 26-33.

(8) Myhill S, Booth NE, McLaren-Howard J. Chronic fatigue syndrome and mitochondrial dysfunction. Int J Clin Exp Med. 2009;2(1):1-16. Epub 2009 Jan 15.

(9) Vermeulen RC, Scholte HR. Exploratory open label, randomized study of acetyl- and propionylcarnitine in chronic fatigue syndrome. Psychosom Med. 2004 Mar-Apr;66(2):276-82.

(10) Plioplys AV, Plioplys S. Amantadine and L-carnitine treatment of Chronic Fatigue Syndrome. Neuropsychobiology. 1997;35(1):16-23.

(11) Arnold DL, Bore PJ, Radda GK, Styles P, Taylor DJ. Excessive intracellular acidosis of skeletal muscle on exercise in a patient with a post-viral exhaustion/fatigue syndrome. A 31P nuclear magnetic resonance study. Lancet. 1984 Jun 23;1(8391):1367-9.

(12) Jones DE, Hollingsworth KG, Jakovljevic DG, Fattakhova G, Pairman J, Blamire AM, Trenell MI, Newton JL. Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study. Eur J Clin Invest. 2012 Feb;42(2):186-94.

(13) Lane RJ, Soteriou BA, Zhang H, Archard LC. Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry. 2003 Oct;74(10):1382-6.

(14) Jason, L.A., Corradi, K., Torres-Harding, S., Tay

On 2015 Sep 11, Lydia Maniatis commented:

The authors describe this study as having measured “the effect of context on the mapping between luminance and lightness.” This description unacceptably vague, though not uncommon in lightness research. “Context” is always varied in any experiment in any field, and can mean a million things. Without a clear rationale for the particular choices made, the statement lacks relevant content; but such a rationale is lacking in this study, where the authors justify their choice of stimuli by saying that “we follow in the tradition that uses checkerboard scenes as a model system for studying perceived lightness...” This may not be the best tradition to follow; very poor use of it is made here.

The authors apparently didn't exploit their own visual system to assess the effects of their stimuli, which clearly produce illumination/transparency/luminosity effects of varying ambiguity. When, therefore, in the introduction to their study, they state that their stimuli “are missing the geometric factors that, in natural scenes, are associated with a strong impression of different fields of illumination...” and that their study allows them to investigate “the extent to which photometric manipulation in the absence of such geometric cues affects perceived lightness,” it is unclear whether they mean to imply that the themselves effects are absent, or only that known cues are absent. Since the effects are obviously present, and since they are necessarily contingent on the surface luminance structure – the geometry – of the stimuli, the latter do, in fact, contain unanalyzed “geometric cues” to differential illumination/transparency.

On the basis of an exceptionally crude data-set – observers are asked to rate only the central square while the remaining 24 are varied semi-randomly, the authors, after extended and strenuous mathematical engagement with their data, do, indeed, come to the conclusion that “... observers' lightness matches are consistent with the visual system treating the photometric variation in checkerboard context as spatial variation in the illumination." This was probably the most roundabout way possible to come to a self-evident conclusion (though it should be noted that the apparent illumination changes in their stimuli are not limited to the groups of squares the investigators lightened or darkened as a block – the stimuli are also full of accidental effects.)

In general, the results are “broadly consistent” with what was already known. Where they are supposed to be “novel,” they are so only if scission is treated as not occurring: “Other features of our data are novel. First is the manner in which the shape of the CTFs varies with context. Early proposals about how context affects lightness focused on the notion that lightness is computed via a ratio to some reference luminance (Land, 1986; Wallach, 1948, see Brainard & Wandell, 1986) or as a fixed function of contrast. These models predict that the CTFs will plot as lines of slope 1 in the type of log–log representation we employ and are clearly contradicted by the data.” Obviously, a simple or even not so simple ratio rule or contrast concept is a straw man given the self-evident and semi-acknowledged scission effects. Perhaps this is the reason for the implausible hedging on the question of whether these illumination/transparency effects did, in fact, arise: “However, inferences about how the visual system parsed the stimuli into separately illuminated regions must remain speculative, since our stimuli were not constructed as simulations of illuminated surfaces nor did we measure either the observers' estimates of the illumination or the perceived lightness at locations in the checkerboard context other than the central target patch.” It is very difficult to see what was the point of all this trouble, except to obscure the obvious.

A blind eye is also turned toward luminosity effects. Radonjic et al (2011) had unconvincingly explained away the perception of luminosity in high range stimuli by attributing it to the use of an emissive display, without, however, explaining why the same did not occur for targets of similar luminance in low-range displays. In the present study, the problem of potential luminosity is dealt with by discounting very high reports because they “did not correspond to a palette paper.” Thus, the data are not allowed to show luminosity effects.

It would have been interesting and worthwhile if the authors had made better use of the checkerboard tradition and attempted to analyze the why scission effects occur in stimuli without penumbras or apparent overlap of figural boundaries.

On 2015 Sep 10, Lydia Maniatis commented:

None

On 2013 Jun 15, Steven Salzberg commented:

This is a very cool result. All of our techniques for sequencing transcripts and then assembling them into genes assume the result should be a linear molecule. By relaxing this assumption, Salzman and colleagues found large numbers of RNAs that appear to be circular. It's a whole new model that raises several intriguing new questions: are these translated, and if so how easily? Do they survive longer due to their circularity?

On 2015 May 22, Dan Bolser commented:

You can grab the manuscript from here: https://www.scribd.com/doc/266260951/Basic-local-alignment-search-tool

On 2014 Nov 24, Guillaume Filion commented:

For a retrospective of the ideas behind BALST together with some comments by David Lipman, you can check out the blog post "Once upon a BLAST" at the following link. http://blog.thegrandlocus.com/2014/06/once-upon-a-blast

On 2014 Mar 20, Patrice Brassard commented:

We have posted this comment also on the Journal website (http://bja.oxfordjournals.org/content/108/4/623/reply).

Editor - We read with interest the manuscript published by Tang et al. regarding the possible correlation between cerebral oxygen desaturations during single lung ventilation and postoperative cognitive dysfunction in patients undergoing thoracic surgery. The authors reported cerebral oxygen desaturations in an important number of patients during single lung ventilation in thoracic surgery. One-third of patients showed impairment of early postoperative cognitive function, with 90% of these patients normalizing their cognitive function at 24 hour after surgery. These results are potentially clinically important. However, we would like to highlight important missing information and one methodological issue that need to be discussed to fully appreciate the conclusion of this study.

The first issue relates to the use of vasopressors during thoracic surgery. Did the investigators keep blood pressure within a given range with vasopressors during surgery? Administration of local anesthetics through a peridural catheter is frequently associated with perioperative hypotension. Looking at Fig 3, mean arterial pressure was relatively constant throughout surgery. It would be surprising that vasopressors were not used to maintain or restore mean arterial pressure when using peridural analgesia during general anesthesia. This is of importance since recent evidence suggests that the use of phenylephrine (1-3) and norepinephrine (4) is associated with reduced cerebral oxygenation. Cerebral oxygen desaturations reported in this study during thoracic surgery could thus be partly explained by the administration of vasopressor agents used to restore or maintain blood pressure during the procedure.

The other issue pertains to the baseline cerebral oxygenation measure. Why was baseline cerebral oxygenation only monitored with patients breathing 100% oxygen and not also room air? Evidence suggests that patients can respond to supplemental oxygen (i.e. cerebral oxygenation will increase) while others will not respond (5). Breathing 100% oxygen could have increased baseline cerebral oxygenation in responder subjects and thus, artificially widen the difference between baseline cerebral oxygenation and the lowest cerebral oxygenation value monitored during the surgical procedure. Future studies interested in relative changes in cerebral oxygenation during surgical procedure in relation to postoperative cognitive function should present baseline cerebral oxygenation with patients breathing room air and hyperoxic gas.

Jean S. Bussieres, MD, FRCPC (1,3), Philippe Desjardins, R5 (1), Patrice Brassard, PhD (2,3)

(1) Department of Anesthesiology, Faculty of Medicine, Laval University, Quebec, Canada, (2) Department of Kinesiology, Faculty of Medicine, Laval University, Quebec, Canada, (3) Institut universitaire de cardiologie et de pneumologie de Quebec, Canada.

References

1.Brassard P, Seifert T, Wissenberg M, Jensen PM, Hansen CK, Secher NH. Phenylephrine decreases frontal lobe oxygenation at rest but not during moderately intense exercise. J Appl Physiol. 2010;108:1472-1478

2.Meng L, Cannesson M, Alexander BS, Yu Z, Kain ZN, Cerussi AE, Tromberg BJ, Mantulin WW. Effect of phenylephrine and ephedrine bolus treatment on cerebral oxygenation in anaesthetized patients. Br J Anaesth. 2011;107:209-217

3.Nissen P, Brassard P, Jorgensen TB, Secher NH. Phenylephrine but not ephedrine reduces frontal lobe oxygenation following anesthesia- induced hypotension. Neurocrit Care. 2010;12:17-23

4.Brassard P, Seifert T, Secher NH. Is cerebral oxygenation negatively affected by infusion of norepinephrine in healthy subjects? Br J Anaesth. 2009;102:800-805

5.Heringlake M, Garbers C, Kabler JH, Anderson I, Heinze H, Schon J, Berger KU, Dibbelt L, Sievers HH, Hanke T. Preoperative cerebral oxygen saturation and clinical outcomes in cardiac surgery. Anesthesiology. 2011;114:58-69

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the twenty-five nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209792&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209793&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209794&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209795&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209796&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209797&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209800&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34209801&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996225&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996226&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996227&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996229&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996230&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996231&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996232&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996233&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996234&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996235&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996236&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996237&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996238&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996239&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996240&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996241&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=34996242&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2018 Jan 17, Fernando Castro-Chavez commented:

My dear reader,

The article that you have in front of you is an effort to develop square representations of the Genetic Code that are meaningful biologically, the basic findings were that the most used codons per amino acid (AA) and their hydrogen bonds (H-bonds) in humans: The first eight correspond to the codons that end in G; the amino acids that have only one codon correspond to this category: M: AUG and W: UGG; then we have the next twelve codons that end in C, and finally, we have the two most used codons that end in A, one corresponds to the stop (*) function: UGA; while the first most used codons in humans in their genome, in percent per averaged sequences of 1,000 nucleotides (1K) in length are: 1) L, Leu: CUG equally sharing its position with E, Glu: GAG; 2) G, Gly: GGC; M, Met: AUG; D and Asp: GAU; 3) P, Pro: CCC; L, Leu: CUC; S, Ser: AGC...

Attentively,

Fernando Castro-Chavez From Baylor College of Medicine

Zapotlán el Grande, Jalisco, MX

01/17/2018

On 2014 Sep 10, David J Volkman commented:

Despite the isolation of borrelia in two tick vectors throughout the Southeast, the CDC stubbornly insists there is no borreliosis there. A letter to the NEJM addressing the CDC’s flawed diagnostic criteria was rejected in ’12.

The Emperor’s Rash

Reports that Lyme disease (LD) is concentrated in two areas in the US (1) promulgate a myth. As in the “Emperor’s New Clothes” fairy tale people ignore contradictory evidence-based observations. Many individuals nationally remain undiagnosed with LD, a treatable bacterial infection. Several rationales have been proposed to deny the presence of LD in areas like the South, e.g., bactericidal lizard complement, I. scapularis ticks don’t bite Southerners, positive tests must be false positives because LD doesn’t occur there, idiopathic Southern Tick Associated Rash Illness with a characteristic LD rash is not LD, because borrelia cannot be cultured. Opinions have been substituted for evidence-based studies. Notwithstanding the observation of seronegative Lyme disease published in this journal in 1988 (2) seronegative LD is dismissed by claims that there is “no scientific evidence” that there can be infection without anti-borrelia antibodies (3). Similarly, despite molecular and microbiological evidence to the contrary (4) there are still published denials that persistent borreliosis exists (3). The CDC only acknowledges LD cases from areas in which LD has been previously reported and requires that a positive antibody test react in a Western Blot with 5-10 borrelia proteins (so called 2-tier test). Using these revised criteria LD cases in Georgia plummeted from 715 cases in 1989 to only 10 in 2010. The 5 weeks it often takes for antibody production to be detectable further impede diagnosis. Different borrelia strains elicit antibodies that may react poorly with the single Long Island B31 tested. Whole Cell Sonicate (WCS) used in most commercial assays. A new assay (C6) is based on two small peptides that has few B31 antigenic determinants and is less sensitive than WCS. Positive blood tests or PCR assays are dismissed as “false positives” if they are not from designated LD areas although the incidence of predicted false positive IgG antibody or nested PCR assays is <1%. The distinction between the surveillance classification and clinical diagnosis has become blurred. A caveat I inserted in the CDC’s “Surveillance Definition” of LD in 1989 explicitly cautioned that this restrictive definition was only to be used for surveillance and was “NOT appropriate for clinical diagnosis” (4) (CDC’s emphasis); this caution was inexplicably removed in 2008. Even employing imperfect technology based on antibodies binding to the single LI strain and requiring Western Blot confirmation, >70% of cases are currently detected. By simply abjuring unsupported geographic requirements we can diagnose >90% of infections with an ELISA WCS assay; thousands of additional patients can be treated by abandoning unsupported assumptions about false positives, geographic prerequisites, and 2-tier confirmation.

1. Diuk-Wasser MA, Hoen AG, Cislo P, Brinkerhoff R, Hamer SA, Rowland M, Cortinas R, Vourc’h G, Melton F, Hickling GJ, Tsao JI, Bunikis J, Barbour AG, Kitron U, Piesman J, Fish D. Am J Trop Med Hyg, 86, 2012, pp. 320–327.

2. Dattwyler RJ, Volkman,DJ, Luft,BJ, Halperin JJ, Thomas J, and Golightly MG. Seronegative late Lyme borreliosis: Dissociation of Borrelia burgdorferi specific T and B lymphocyte responses following early antibiotic therapy. N Engl J Med, 319: 1441-1446, 1988.

3. Feder HM Jr, Johnson BJ, O'Connell S, Shapiro ED, Steere AC, Wormser GP; A critical appraisal of "chronic Lyme disease". N Engl J Med. 2007;357:1422-30. Letters: 2008;358:1084.

4. Hodzic E, Feng S, Holden K, Freet KJ, Barthold SW. Persistence of Borrelia burgdorferi following antibiotic treatment in mice. Antimicrob Agents Chemother 2008; 52:1728-36.

5. Centers for Disease Control and Prevention. Case Definitions for Infectious Conditions Under Public Health Surveillance. MMWR, 1997;46(RR-10):1-55.

On 2015 Sep 17, Tom Kindlon commented:

This study uses the (so-called) empiric CFS criteria (Reeves et al., 2005)

This study used the Reeves et al. (2005) criteria(1) for defining Chronic Fatigue Syndrome (CFS) (sometimes described by the CDC as an operationalization of the Fukuda et al. (1994) criteria (2)).

These (Reeves) criteria greatly increased the prevalence of CFS. The "empirical" definition gives a prevalence rate of 2.54% of the adult population(3) compared to 0.235% (95% confidence interval, 0.142%-0.327%) and 0.422% (95% confidence interval, 0.29%-0.56%) when the Fukuda definition was used in previous population studies in the US(4,5).

The definition lacks specificity. For example, one research study(6) found that 38% of those with a diagnosis of a Major Depressive Disorder were misclassified as having CFS using the empirical/Reeves definition. A letter of mine discussed my concerns in more detail(7).

Due to the problems with the criteria, these criteria have not been used by researchers outside those contracted to analyse CDC data (apart from Leonard Jason's research team who studied it and showed problems with it (6)).

References:

1 Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic fatigue syndrome – a clinically empirical approach to its definition and study. BMC Med. 2005;3:19.

2 Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.

3 Reeves WC, Jones JF, Maloney E, Heim C, Hoaglin DC, Boneva RS, Morrissey M, Devlin R. Prevalence of chronic fatigue syndrome in metropolitan, urban, and rural Georgia. Popul Health Metr. 2007 Jun 8;5:5.

4 Reyes M, Nisenbaum R, Hoaglin DC, Unger ER, Emmons C, Randall B, Stewart JA, Abbey S, Jones JF, Gantz N, Minden S, Reeves WC: Prevalence and incidence of chronic fatigue syndrome in Wichita, Kansas. Arch Int Med 2003, 163:1530-1536.

5 Jason LA, Richman JA, Rademaker AW, Jordan KM, Plioplys AV, Taylor RR, McCready W, Huang CF, Plioplys S. A community-based study of chronic fatigue syndrome. Arch Intern Med. 1999 Oct 11;159(18):2129-37.

6 Jason, LA, Najar N, Porter N, Reh C. Evaluating the Centers for Disease Control's empirical chronic fatigue syndrome case definition. Journal of Disability Policy Studies 2008, doi:10.1177/1044207308325995.

7 Kindlon T. Criteria used to define chronic fatigue syndrome questioned. Psychosom Med. 2010 Jun;72(5):506-7

On 2014 Jan 22, Tom Kindlon commented:

The 49% figure for alternative diagnoses would be higher if every patient had a full assessment

The abstract states "altogether 184 of 377 (49%) patients had alternative diagnoses to CFS [chronic fatigue syndrome]." However, this is an underestimate as not everyone had a full assessment. Looking at the figures, 113 did have a confirmed CFS diagnosis with another 3 people not meeting fatigue criteria for CFS, 2 people recovered from CFS and 1 person with no conclusive diagnosis following assessment. However, this leaves 74 others. If they were ever assessed individually (which may eventually have happened, either at the St Bartholomew's Hospital CFS service or at a service closer to them), some of them presumably would have been found to have had an alternative diagnosis.

The following sentences are interesting: "There were 67 (35%) reasons in referrals that were declined due to likely alternative medical diagnoses. The majority of these were due to chronic pain being the primary problem (32, 16%)." This suggests that the service uses a model akin to the Oxford criteria for CFS[1]: "a syndrome characterized by fatigue as the principal symptom." However other criteria do not use such a requirement, something which is implicitly expressed in a paper which had the same corresponding author as this paper: "The PACE findings can be generalised to patients who also meet alternative diagnostic criteria for chronic fatigue syndrome[3] and myalgic encephalomyelitis [ME] but only if fatigue is their main symptom [2]." Also, the NICE guidelines for "CFS/ME"[4] does not appear to make such a requirement. Indeed, if one looks at the full version of the NICE guidelines, they investigate situations where "the individual's primary symptom is pain".

The ME Association in the UK published in 2010 possibly the largest ever patient survey[5]. Three thousand five hundred and ninety four people responded to a question asking about their most severe symptom (page 6): "Muscle fatigue (1730), Cognitive Dysfunction (548), Pain (esp in muscles & joints) 504, Sleep Problems (461), Mobility Problems (197), None of these apply (18)". Such data suggests that, among those referred to the St Bartholomew's Hospital CFS service who were said to have alternative diagnoses, some might be considered as having "CFS/ME" by other professionals.

References:

[1]. Sharpe MC, Archard LC, Banatvala JE, et al. A report--chronic fatigue syndrome. J Roy Soc Med 1991; 84: 118-21.

[2]. White PD, Goldsmith KA, Johnson AL, et al on behalf of the PACE trial management group. Comparison of adaptive pacing therapy, cognitive behaviour therapy, graded exercise therapy, and specialist medical care for chronic fatigue syndrome (PACE): a randomised trial. Lancet 2011; 377:823-836.

[3]. Reeves WC, Lloyd A, Vernon SD, et al. The international chronic fatigue syndrome study group identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution. BMC Health Serv Res 2003, 3: 2.

[4]. National Institute for Health and Clinical Excellence. Chronic fatigue syndrome/myalgic encephalomyelitis (or encephalopathy). Diagnosis and management of CFS/ME in adults and children. London: NICE, 2007 http://www.nice.org.uk/nicemedia/live/11824/36191/36191.pdf Accessed February 3, 2012.

[5]. Managing my M.E. - What people with ME/CFS and their carers want from the UK's health and social services. Gawcott, England: ME Association; May 2010. Available at: http://www.meassociation.org.uk/wp-content/uploads/2010/09/2010-survey-report-lo-res10.pdf Accessed February 3, 2012.

Conflict of Interest: I am the Assistant Chairperson and Information Officer of the Irish ME/CFS Association. All my work for the Association is unpaid

On 2017 Aug 15, Andrea Messori commented:

Pearl-I trial: incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo

Andrea Messori, HTA Unit, Regional Health Service, 50100 Firenze, Italy

In the Pearl-I trial [1], women with symptomatic fibroids, excessive uterine bleeding (PBAC score>100) and anemia were randomized to receive oral ulipristal (dose: 5 mg/day for 13 weeks) or placebo (48 women). A third arm received 10 mg/day of ulipristal. In the comparison between ulipristal 5 mg/day and placebo, the end point of controlled uterine bleeding (PBAC score<75) was achieved by 91% of the patients in the treatment group vs 19% in the controls receiving placebo. Figure 2 (Panel A) of the article by Donnez et al.[1] shows the time-to-event curve for treated patients and controls. Nagy et al.[2] have estimated that the value of utility is around 0.83 for patients with mild-to-moderate bleeding vs 0.72 for patients with severe bleeding (see Table 3 of Nagy’s article). We have carried out an analysis of the results of the Pearl-I trial in order to estimate the magnitude of the incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo by expressing this benefit in quality-adjusted life years (QALYs). For this purpose, we employed a statistical tool (WebPlotDigitizer program) with which we analyzed the time-to-event curves reported in Figure 2 Panel A of the Pearl-I trial (time interval: from 0 to 100 days). As regards the ulipristal group, this statistical program estimated an average of 77.38 days per patient after achievement of the end-point vs 22.62 days per patient without achievement of the end-point. Likewise, in the control group there were on average 13.30 days per patient after achievement of the end-point vs 86.70 days per patient without achievement of the end-point. Using the two values of utility previously mentioned, these figures generated the following estimates of quality-adjusted survival: 80.51 quality adjusted days per patient in the treatment group (i.e. 0.22058 QALYs) and 73.46 quality adjusted days per patient in the control group (i.e. 0.20127 QALYs). The difference between these two QALY values yields 0.01931 QALYs per patient (around 7 quality-adjusted days per patient), which represents the incremental benefit between patients treated with ulipristal 5 mg/day and those receiving placebo.

References

[1] Donnez J, Tatarchuk TF, Bouchard P, Puscasiu L, Zakharenko NF, Ivanova T, Ugocsai G, Mara M, Jilla MP, Bestel E, Terrill P, Osterloh I, Loumaye E; PEARL I Study Group. Ulipristal acetate versus placebo for fibroid treatment before surgery. N Engl J Med. 2012 Feb 2;366(5):409-20.

[2] Nagy B, Timár G, Józwiak-Hagymásy J, Kovács G, Merész G, Vámossy I, Ágh T, László Á, Vokó Z, Kaló Z. The cost-effectiveness of ulipristal acetate tablets in treating patients with moderate to severe symptoms of uterine fibroids. Eur J Obstet Gynecol Reprod Biol. 2014 Apr;175:75-81.

[3] Rohatgi A. WebPlotDigitizer, Version: 3.12, Austin, Texas, available at http://arohatgi.info/WebPlotDigitizer, last accessed 15 August 2017

On 2016 Dec 26, induprabha yadev commented:

use of vesssel sealing system expedites the whole operation and results in a clean field. however introduction of this technology in a resource poor setting like india is debatable. the same results achieved with the use of vessel sealing system could be achieved with normal bipolar diathermy as practised in our institution

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT003257540. We believe the correct ID, which we have found by hand searching, is NCT00325754.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2013 Jun 18, Martin Fenner commented:

This study reports the long-term results of a trial first published in 2007 Lorch A, 2007, confirming that in patients with relapsed or refractory germ cell tumors overall survival and progression-free survival after sequential high-dose chemotherapy are comparable to single high-dose chemotherapy, but with fewer early deaths.

This paper is important because it not only shows a high cure rate with high-dose chemotherapy for patients with relapsed or refractory germ cell tumors, but also because it is one of the few successful prospective randomized trials of high-dose chemotherapy in this patient population. Two randomized trials looking at first-line high-dose chemotherapy in IGCCCG poor risk patients (Motzer RJ, 2007 and PMCID: PMC3082158) were underpowered because of recruitment problems, leading to the inclusion of IGCCCG intermediate risk patients (a patient group with very different prognosis) in Motzer RJ, 2007 and premature trial closure in PMCID: PMC3082158.

Prospective randomized trials continue to be a challenge in patients with relapsed/refractory testicular cancer and in patients in the IGCCCG poor prognosis group for a variety of reasons (small number of patients, lack of funding for conventional chemotherapy, good existing treatment options), but are critically important.

On 2014 Jul 14, K Rubia commented:

There is in fact an error in the discussion. The negative correlation reported in the results section is correct. The mention of a positive correlation between premature response errors in ADHD and precuneus activation is incorrect. We apologise for this oversight and any confusion this may cause.

On 2014 Jul 06, Francisco Xavier Castellanos commented:

There seems to be an error in this otherwise excellent paper contrasting boys with Attention-Deficit/Hyperactivity Disorder (ADHD) and Autism Spectrum Disorder (ASD). Near the bottom of page 241, left column, the authors wrote “For ADHD boys, precuneus activation was significantly negatively correlated with premature errors (r = -0.4, P < 0.05). No correlations were significant in ASD.” This suggests that increased precuneus activation, although abnormal in this context, was associated with fewer errors. However, the discussion (pg. 242, near bottom, left column) assumes a positive correlation, which would seem to make more sense: “This is further supported by the negative correlation in controls between DLPFC activation and response variability, and by the POSITIVE correlation between premature response errors in ADHD patients and precuneus activation…” [EMPHASIS ADDED]. Would the authors please clarify?

On 2015 Aug 11, Hugues BEDOUELLE commented:

The GenBank accession numbers for the nucleotide sequence of Fab 4E11 are AJ131288 for the heavy chain and AJ131289 for the light chain (see Thullier P, 1999). The structures of the four complexes between scFv 4E11 and its target (domain 3) in the envelope protein of the dengue virus, one for each serotype, are further analyzed in Lisova O, 2014

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00209795. We believe the correct ID, which we have found by hand searching, is NCT00209794.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2014 Jul 02, Balázs Győrffy commented:

This paper is also our reference for identifying the best cutoff by computing all percentiles between the lower and upper quartiles of gene expression. Some features like multivariate analysis are described in our latest publication regarding the KM-plot analysis tool (http://www.ncbi.nlm.nih.gov/pubmed/?term=24367507).

On 2014 Mar 05, David Reardon commented:

The authors describe the objective of this review¹ "is to provide an updated assessment of the safety of abortion relative to delivery." But those familiar with the literature should be immediately struck by the fact that they fail to cite, much less discuss, the large record linkage studies which contradict their conclusions.

For example, our study of 173,279 low income women in California, linking medicaid records for pregnancy treatments with death certificates, revealed significantly higher rates of death associated with abortion compared to childbirth.² Specifically, we found an elevated relative risk of death associated with abortion for all causes (RR=1.62), suicide (2.54), natural causes (1.44), circulatory diseases (2.87), and cardiovascular disease (5.46). Moreover, these effects persisted over several years.

Even more striking was the authors' failure to note or discuss six or more even better known studies by Gissler et al examining the entire population of women in Finland^3-8. They, too, used centralized records to link death certificates with treatments for pregnancy, and they, too, found significantly higher rates of mortality associated with abortion compared to childbirth.

The Finland studies are especially important in that the authors have conclusively demonstrated that the methodology used by Raymond and Grimes, a simple comparison of reported mortality rates, is unreliable.⁵ Without record linkage, 94% percent of deaths associated with abortion (in the first year alone) could not be identified. ⁴

Moreover, the methods used to collect data on deaths associated with abortion and childbirth in the United States are inconsistent and incomparable in their own right.

Indeed, in response to an inquiry about the appropriateness of comparisons of the kind used by Raymond and Grimes in this review, Dr. Julie Louise Gerberding, director of the CDC, wrote in July of 2004 that maternal mortality rates and abortion mortality rates ”are conceptually different and are used by the CDC for different public health purposes.”⁹

The problems with the Raymond/Grimes approach, and a more complete discussion of the findings of record linkage studies in regard to abortion mortality rates are found in 2004 review of the literature¹⁰. The bottom line is that Raymond and Grimes have chosen to ignore all the research which challenges their conclusion that abortion is safer than childbirth, and they are basing their conclusions on data sets which are not truly comparable.

It is also notable that while it is customary for review papers to consult previously published reviews to address issues raised by previous reviewers of the topic, Raymond and Grimes chose not only to ignored our review¹⁰ but also a second major review published in Obstetrical & Gynecological Survey¹¹ which also had conclusions contrary to theirs.

This should lead readers to be skeptical of the authors claim that: "We systematically reviewed the past decade of PubMed publications for relevant data." Indeed, in light of the body of literature which is out there, and easily found, and has often been raised in the court cases which Dr. Grimes serves as an expert witness, it is patently clear to those of us who have published in this field that the Raymond/Grimes "systematic review criteria" were carefully and precisely constructed to exclude consideration of studies published our California study (published in 2002, examining data through 1997) and those of the population of Finland.

Despite this artifice, it is an indisputable fact that every study which has employ record linkage has found that mortality rates associated with childbirth are significantly lower than those associated with abortion.^2-8

Finally, while the authors can be excused for not being aware of additional record linkage studies in press at the time their "review" was published, it is noteworthy that two studies of the entire population of childbearing women in Denmark between 1998 and 2005 have also higher death rates associated with abortion compared to childbirth.

The first of these Denmark studies found that compared women who deliver a first pregnancy, women who abort a first pregnancy have a significantly elevated risk of death within the first 180 days and this elevated risk of death persists for at least ten years¹². The second revealed that there is also a dose effect associated with abortion, with each exposure of abortion contributing an additional 50% (approximately) increased risk of death over the period examined.¹³

I sincerely hope these authors will use PubMed Commons to publish a thoughtful defense of why they excluded record linkage studies from their review. And secondly, in light of the studies mentioned here, to explain if and how they can persist in their conclusion that the best medical evidence indicates that abortion is 14 times safer than childbirth.

Citations

(1) Raymond, Elizabeth G.; Grimes, David A. The Comparative Safety of Legal Induced Abortion and Childbirth in the United States. Obstetrics & Gynecology. 119(2, Part 1):215-219, February 2012. PMID: 22270271

(2) Reardon DC, Ney PG , Scheuren FJ, Cougle JR, Coleman, PK, Strahan T. Deaths associated with pregnancy outcome: a record linkage study of low income women. Southern Medical Journal, August 2002, 95(8):834-841. PMID: 12190217

(3) Gissler M, Berg C, Bouvier-Colle MH, Buekens P. Pregnancy-associated mortality after birth, spontaneous abortion, or induced abortion in Finland, 1987-2000. Am J Obstet Gynecol. 2004 Feb;190(2):422-7. PMID: 14981384

(4) Gissler M, Berg C, Bouvier-Colle MH, Buekens P.Methods for identifying pregnancy-associated deaths: population-based data from Finland 1987-2000. Paediatr Perinat Epidemiol. 2004 Nov;18(6):448-55. PMID:

(5) Gissler M, Kauppila R, Meriläinen J, Toukomaa H, Hemminki E. Pregnancy-associated deaths in Finland 1987-1994--definition problems and benefits of record linkage. Acta Obstet Gynecol Scand. 1997 Aug;76(7):651-7. Review. PMID:

(6) Gissler M, Hemminki E. Pregnancy-related violent deaths. Scand J Public Health. 1999 Mar;27(1):54-5. PMID:

(7) Gissler M, Berg C, Bouvier-Colle MH, Buekens P. Injury deaths, suicides and homicides associated with pregnancy, Finland 1987-2000. Eur J Public Health. 2005 Oct;15(5):459-63. PMID:

(8) Gissler M, Hemminki E, Lönnqvist J. Suicides after pregnancy in Finland, 1987-94: register linkage study. BMJ. 1996 Dec 7;313(7070):1431-4.

(9) Letter from Julie Louise Gerberding to Walter Weber, July 20, 2004. http://afterabortion.org/pdf/CDCResponsetoWeberReAbortionStats-Gerberding Reply.pdf responding to Weber's April 30, 2004 request for a reassessment of pertinent statistical measures of mortality rates associated with pregnancy outcome. http://afterabortion.org/pdf/WeberLettertoThompson&CDCReAbortionStats.pdf

(10) Reardon DC, Strahan TW, Thorp JM, Shuping MW. Deaths associated with abortion compared to childbirth: a review of new and old data and the medical and legal implications. The Journal of Contemporary Health Law & Policy 2004; 20(2):279-327. PMID: 15239361 http://www.afterabortion.org/pdf/DeathsAssocWithAbortionJCHLP.pdf

(11) Shadigian EM; Bauer ST. Pregnancy-Associated Death: A Qualitative Systematic Review of Homicide and Suicide Obstetrical & Gynecological Survey. 2005. 60:183-190.

(12) Reardon DC, Coleman PK. Short and long term mortality rates associated with first pregnancy outcome: population register based study for Denmark 1980-2004. Med Sci Monit. 2012 Sep;18(9):PH71-6. PMID: 22936199

(13) Coleman PK1, Reardon DC, Calhoun BC. Reproductive history patterns and long-term mortality rates: a Danish, population-based record linkage study. Eur J Public Health. 2013 Aug;23(4):569-74. doi: 10.1093/eurpub/cks107. Epub 2012 Sep 5. PMID: 22954474

On 2017 Sep 12, Eric Vallabh Minikel commented:

A full text pre-print of this article is now available on Zenodo thanks to dissemin.

On 2013 Jul 01, Roger Peng commented:

This is a wonderful paper that introduces principal stratification for air pollution "accountability" analysis. Most studies in this area look for natural experiment type of analyses. The application of principal stratification has the potential for opening up a new methodological avenue for evaluating air pollution interventions.

On 2017 Apr 03, Jeruza Neyeloff commented:

The general suggestion raised by Holman is appropriate: when dealing with different data sets and adjusting the spreadsheets provided, we recommend seeking help from a statistician or someone experienced in meta-analyses.

Particularly, on the cited steps, the additional file indeed does not place a lower bound on I², and depends on the researcher to know that negative values are not possible. The paper should also have more clearly described to not use a recalculated I² statistic, since it should not change according to the model chosen (fixed or random).

As stated in the article, one of the main advantages of conducting the analysis with a step-by-step approach is a better understanding of the complete analysis process and of the formulas used. However, specific-purpose software or statistical packages will yield more stable results and usually require less data manipulation by the end user. In my research group, we tend to use the spreadsheet as a teaching tool (or to generate forest plots for presentations), and to use the R Meta and Metafor packages for more complex analyses.

We hope the article, by providing a view of how the calculations involved in these analyses work, continues to aid students and researchers interested in meta-analyses.

On 2015 Dec 29, Rebecca Holman commented:

A clinical researcher asked me for help in using the Additional file 1: Meta-analyses and forest plots in MS Excel provided by the authors of this paper. The file had produced a strange result for this researcher's meta analysis. My concern is around step 8 of "Steps in analyzing data and producing a forest plot". The authors definition of I² is slightly different to that presented previously (see for example Higgins JP, 2003). The authors of the current manuscript do not place a lower bound of 0% on the value of I² . Hence, in some meta-analysis data sets, the additional file can result in a value of I² of less than 0%. In addition, the authors have not placed a lower bound of 0 on the value of Q-(k-1) when calculating v in step 9B "Random effects model". In some meta-analysis data sets, this can lead to negative values of v (cell M16 in the additional file). This can lead to incorrect results for a random effects based meta-analysis. When viewed in conjunction with previous comments on this paper, I feel that researchers should exercise caution when using the formulas in or additional Excel file to this paper to perform calculations or obtain figures for a meta-analysis.

On 2016 Aug 23, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00738170. We believe the correct ID, which we have found by hand searching, is NCT00738179.