On 2014 Feb 25, Jim Woodgett commented:

[This entry is incorrectly cited by PubMed. The correct page numbers are 10992-11000.]

Nevermind - It's the correct shortening/abbreviation 10992-1000. Looks odd but is correct. My mistake. Thanks @clathrin @michaelhoffman

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Oct 13, Ivan Oransky commented:

This paper has been subjected to a significant correction for duplicate publication: http://retractionwatch.com/2014/10/09/u-illinois-chancellor-earns-mega-correction-for-duplicate-publication/

On 2013 Dec 30, Mike KLYMKOWSKY commented:

the "text" link points to a completely unrelated paper

On 2015 Dec 11, Harri Hemila commented:

Available at http://dx.doi.org/10.1016/0378-1119(92)90625-Y

On 2016 Aug 19, Morten Oksvold commented:

Please note that this article has been retracted and should therefore not be cited in the future:

"The above article and associated erratum, published online on 11 November 2005 and 6 February 2014, respectively, in Wiley Online Library (wileyonlinelibrary.com), have been retracted by agreement between the authors, the journal Editor-in-Chief, Professor Peter Lichter, and Wiley Periodicals, Inc. In addition to what was corrected in the erratum, a university investigation involving the first and the corresponding author determined that several figures in this paper were re-used, mislabeled, manipulated, or duplicated while processing/compiling the final figures assembled from the original data sources. Therefore, the authors are retracting the paper in its entirety although they maintain that these issues did not affect the major conclusions. They apologize for any inconvenience this may have caused".

Link: http://onlinelibrary.wiley.com/doi/10.1002/ijc.30267/full

On 2015 Jul 16, Bill Cayley commented:

A good example of when a "less-medical" approach is better: https://lessismoreebm.wordpress.com/2015/07/16/nonsurgical-management-of-partial-adhesive-small-bowel-obstruction-with-oral-therapy-a-randomized-controlled-trial/

On 2015 Nov 18, Diana Petitti commented:

Reviewing articles about vitamin D and falls, I discovered that, while the abstract states that this was a randomized, placebo-controlled trials of vitamin D to prevent falls, all subjects were prescribed 600 mg of elemental calcium in the form of calcium carbonate (p. 1182). Thus, the trial was a randomized trial of vitamin D plus calcium versus calcium alone.

On 2013 Oct 28, DAVID SANDERS commented:

See the earlier articles "Sulfhydryl involvement in fusion mechanisms" [2000]Sanders DA, 2000 and "Ancient viruses in the fight against HIV" [2003] Sanders DA, 2003 for the prediction of the results published here.

On 2014 Aug 18, Nicholas J L Brown commented:

cf. http://www.ncbi.nlm.nih.gov/pubmed/23855896

On 2016 Aug 21, Morten Oksvold commented:

Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:

https://ori.hhs.gov/content/case-summary-dasmahapatra-girija

This article should therefor not be cited.

On 2017 Jan 05, Pablo Tamayo commented:

A key aspect of the Gene Set Enrichment Analysis (GSEA) approach is the preservation of gene-gene dependency in estimating the significance of enrichment (i.e., coordinate expression) of a set of genes. Because we know that genes are not independent variables, modeling dependencies as done by GSEA better mirrors the underlying biology of the systems we seek to study. While simpler statistical tests may reduce computational complexity, they do so at the expense of making unrealistic assumptions not supported by the data. In our response (http://www.ncbi.nlm.nih.gov/pubmed/23070592) to the claims in http://www.ncbi.nlm.nih.gov/pubmed/20048385 we carefully considered the assumptions of the proposed “simplified” SEA method and its results. This included a comparative analysis on a large collection of 50 benchmarks. By randomizing phenotypes, we showed that gene-gene correlations produce significant variance inflation in SEA results, which in turn produce very high false positive rates and inflated p- and q-values, while GSEA does not. These results provide strong empirical evidence that gene-gene correlations cannot be ignored and agree with the extensive literature providing theoretical or empirical evidence against the gene independence assumption. See, e.g., https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3091509/ https://www.ncbi.nlm.nih.gov/pubmed/16646853 https://www.ncbi.nlm.nih.gov/pubmed/17303618

On 2013 Nov 12, James Hadfield commented:

Who would run a differential gene expression experiment today and NOT look at gene set enrichment analysis? It is difficult to remember the impact this paper had on the field and what we were doing just five years earlier with the first microarrays!

On 2013 Jun 28, Rafael Irizarry commented:

I agree with Rob that this is an important paper. The idea of analyzing differential expression for groups of genes, as opposed to individual genes, was an important step forward in the analysis of gene expression data. In one of the papers Rob links to we point out that the method would have worked just as well (or perhaps better) using simple (existing) statistical tests rather than the novel versions of the KS-test presented in the paper. Examples of some of these simpler tests are implemented in the Bioconductor limma package. The critique is not just about power, but about interpretability and ease of implementation. But these critiques should not take away from the important contribution made by this paper.

On 2013 Jun 16, Robert Tibshirani commented:

This is an important paper, one that introduced the idea of analyzing the differential expression of groups of genes, rather than individual genes. The advantage is both in power and interpretability. Importantly, this group has also created and curated an impressive collection of gene sets for this purpose. See http://www.broadinstitute.org/gsea/index.jsp

The particular test here- the KS statistic- has been criticized for lack of power and alternatives have been suggested (see eg http://arxiv.org/pdf/math/0610667.pdf and http://www.ncbi.nlm.nih.gov/pubmed/20048385.

A response to the latter is in http://www.ncbi.nlm.nih.gov/pubmed/23070592

On 2014 Jan 09, Tom Kindlon commented:

Will the CDC CFS Research team (and other teams) please now look at enteroviruses in CFS

(This was originally accepted as a comment here: http://www.biomedcentral.com/1471-2334/5/78/comments in 2007. However, the formatting has been removed meaning few may read it there. Also, many people may not read the paper on the biomedcentral site and thus not see the comment there)

Not for the first time [1-2], a CDC-funded research team produces a paper on CFS which has a title which mentions a lack of an association with a particular infection[3]. It would be good if some of the CDC's (not inconsiderable) CFS research budget could be used to investigate enteroviruses in CFS.

Earlier this year a study involving enteroviruses[4] resulted in much excitement in the media on the subject. It found, in a sample of CFS patients who had gastrointestinal symptoms, that 135/165 (82%) biopsies stained positive for VP1 within parietal cells, whereas 7/34 (20%) of the controls stained positive (p=<0.001). Earlier studies have demonstrated circulating antigen of enterovirus, raised antibody titres and viral RNA in the blood and muscle biopsy specimens of patients with CFS[4-8].

John Chia does recognize that other infections could be playing a part in some CFS cases but enteroviruses are by far the most common infection he is finding in his clinic in California[9].

References:

[1] Gelman JH, Unger ER, Mawle AC, Nisenbaum R, Reeves WC: Chronic fatigue syndrome is not associated with expression of endogenous retroviral p15E. Molec Diagnosis 2000, 5:155-156.

[2] Vernon SD, Shukla S, Reeves WC: Absence of Mycoplasma species DNA in chronic fatigue syndrome. J Med Microbiol 2003, 52:1027-1028.

[3] Jones JF, Kulkarni PS, Butera ST, Reeves WC: GB virus-C--a virus without a disease: we cannot give it chronic fatigue syndrome. Jones JF, Kulkarni PS, Butera ST, Reeves WC. BMC Infect Dis 2005, 5:78

[4] Yousef GE, Mann GF, Smith DF, et al: Chronic enterovirus infection in patients with postviral fatigue syndrome. Lancet 1988;1:146-7.

[5] Cunningham L, Bowles NE, Lane RJM, et al: Persistence of enteroviral RNA in chronic fatigue syndrome is associated with abnormal production of equal amounts of positive and negative strands of enteroviral RNA. J Gen Virol 1990;71:1399-402.

[6] Galbraith DN, Nairn C, Clements GB: Phylogenetic analysis of short enteroviral sequences from patients with chronic fatigue syndrome. J Gen Virol 1995;76:1701-7.

[7] Lane RJ, Soteriou BA, Zhang H, et al: Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry 2003;74:1382-6.

[8] Douche-Aourik F, Berlier W, Fe´asson L, et al: Detection of enterovirus to human skeletal muscle from patients with chronic inflammatory muscle disease or fibromyalgia and healthy subjects. J Med Virol 2003;71:540-7.

[9] Chia JK, Chia A: Diverse etiologies for the chronic fatigue syndrome. Clin Infect Dis 2003;36:671-2.

On 2014 Jun 01, Ivan Oransky commented:

This paper has been corrected: http://retractionwatch.com/2014/05/28/failure-to-cite-leads-to-ignoble-end-for-xenon-paper-and-a-correction/

On 2016 Aug 21, Morten Oksvold commented:

Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:

https://ori.hhs.gov/content/case-summary-dasmahapatra-girija

This article should therefor not be cited.

On 2015 Mar 16, Donald Forsdyke commented:

Concluding that this paper showed, if anything, the very opposite of what was claimed, a commentary on this paper was submitted to Bioinformatics in 2005, but was declined for publication. The paper and correspondence with the authors was placed online (2006) at: http://post.queensu.ca/~forsdyke/bioinfo9.htm, and various updates have since been added.

On 2016 May 13, Richard E Harris commented:

The sample size in this study was based on a power calculation using results from the Deluze et al. 1992 study as an estimate of effect size. This was the only publication using acupuncture in fibromyalgia at that time. Our power analysis indicated that we would need 30 participants (per group) to detect a 30% difference between groups at a significance level of 0.05. We enrolled from 27 to 30 per arm suggesting we had significant power to test our hypotheses.

Regarding the drop out rate of 33%, we performed an Intention To Treat analysis which controls for some effects of drop outs. Also there was no significant difference in drop outs (or treatments received) between study arms. These make it unlikely that our results were influenced by dropouts.

On 2016 May 04, Arthur Yin Fan commented:

This study has a significant flaw--the sample size is over small, and could not make sure the acupuncture's efficacy--the design of four groups, should have 800 patients.

The second, the drop out rate 33%, makes the result is not trust-able.

On 2015 Aug 19, Bill Cayley commented:

An example of when less is better: https://lessismoreebm.wordpress.com/2015/06/30/acetaminophen-aspirin-and-caffeine-versus-sumatriptan-succinate-in-the-early-treatment-of-migraine-results-from-the-asset-trial/

On 2014 Aug 07, Randy Blakely commented:

In this paper, the authors report an inability of an hDAT E602G mutant to transport DA or to reach the cell surface. The findings are at odds with a study from my lab (Expression studies of naturally occurring human dopamine transporter variants identifies a novel state of transporter inactivation associated with Val382Ala. Mazei-Robison MS, Blakely RD. Neuropharmacology. 2005 Nov;49(6):737-49). Although the impact of the E602G mutation warrants further analysis, discussions with Drs. Horschitz and Schloss lead to retraction of the Horschitz et al paper As the authors note in their retraction (S Horschitz, R Hummerich, T Lau, M Rietschel & P Schloss Molecular Psychiatry 11, 704-704, 27 June 2006):

"Mazei-Robison and Blakely have published in Neuropharmacology (2005) 49, 737–749, a characterization of several naturally occurring mutants of hDAT. In contrast to our data, in their study the E602G mutant was fully active and comparable to wild-type hDAT. In order to elucidate these contradictory results, both our labs exchanged the mutant cDNAs and re-analysed the properties of the E602G mutant. Uptake experiments in both labs with HEK 293 transiently transfected with both cDNA plasmids revealed transport activity of the E602G mutant comparable to wild-type hDAT. Thus, our conclusion published in Molecular Psychiatry (2005) 10, 1104–1109 is wrong and has to be withdrawn at this point of time."

Since the original Horschitz et al report continues to be cited inappropriately as support for a role for altered DAT (or DA signaling) in BPD, I am hoping the PubMed Commons forum will provide a suitable opportunity to redirect readers attention to the, as yet, unknown properties of the E602G mutation that may include alterations in roles of the hDAT C-terminus (membrane trafficking, interactions with regulatory proteins, DA efflux, e.g. Calmodulin kinase II interacts with the dopamine transporter C terminus to regulate amphetamine-induced reverse transport. Fog JU, Khoshbouei H, Holy M, Owens WA, Vaegter CB, Sen N, Nikandrova Y, Bowton E, McMahon DG, Colbran RJ, Daws LC, Sitte HH, Javitch JA, Galli A, Gether U. Neuron. 2006 Aug 17;51(4):417-29; Attention deficit/hyperactivity disorder-derived coding variation in the dopamine transporter disrupts microdomain targeting and trafficking regulation. Sakrikar D, Mazei-Robison MS, Mergy MA, Richtand NW, Han Q, Hamilton PJ, Bowton E, Galli A, Veenstra-Vanderweele J, Gill M, Blakely RD. J Neurosci. 2012 Apr 18;32(16):5385-97. doi: 10.1523/JNEUROSCI.6033-11.2012. Erratum in: J Neurosci. 2012 Oct 31;32(44):15643).

On 2014 Jul 27, DATTATRAY PAWAR commented:

What is the use of guidelines if no one has free access to them?

On 2016 Jan 05, Morten Oksvold commented:

Please not that this article contains fraudulent data, which was concluded from an investigation by the University of Alabama at Birmingham in 2009 (!):

http://www.uab.edu/reporterarchive/71570-uab-statement-on-protein-data-bank-issues

The case was recently discussed at Retraction Watch: http://retractionwatch.com/2016/01/04/nature-retracts-paper-six-years-after-it-was-flagged-for-fraud/

Biochemistry was informed about this case in 2009, but as far as I can see there has still not been published any retraction.

On 2014 Mar 07, Preben Berthelsen commented:

A foregone conclusion.

The result of this investigation was a dead certainty even before it was conducted. The authors initiating PAC guided therapy 18 hours after the critically ill patients were admitted to intensive care units. This delay in the deployment of the PAC makes it extremely unlikely that PAC guided therapy would influence the mortality rate; it is like shutting the stable door after the horse has bolted. This study does not inform on the timely use of the pulmonary artery catheter.

The primary sample size calculation stipulated that 5673 patients were needed to demonstrate a 5% reduction in mortality. Due to slow recruitment, the primary endpoint was changed to a 10% reduction - 1281 patients were then required. In the end, the authors report the results from 1014 patients.

The principal clinical investigator/corresponding author M. Singer “does consultancy work for, and receives research funds from Deltex Medical, manufacturers of the CardioQ oesophageal Doppler device.”

Preben G. Berthelsen MD

Charlottenlund, Denmark

On 2014 Mar 07, Preben Berthelsen commented:

None

On 2016 Feb 19, E M Martínez-Cáceres commented:

In the light of the recent PubMed comment by Morten Oksvold, the referenced research study was performed entirely in our research centre by the research team led by Dr. Martínez-Cáceres at the time with Dr. Espejo as predoctoral researcher. Hence, the EAE in vivo experiments were performed in Barcelona with no involvement from Dr. Penkowa, who was engaged as an expert histopathologist. Dr. Penkowa received processed and encoded samples with which she performed some of the histopathological studies. The results were returned to us for overall analysis and submission for publication. It was agreed that Dr. Penkowa would be co-author of the published work.

On 2016 Feb 01, Morten Oksvold commented:

Please note that this article is 1 out of 15 publications for which an independent investigation initiated by the University of Copenhagen has found suspicion of scientific dishonesty. The conclusion from the report was published July 23, 2012:

http://news.ku.dk/all_news/2012/2012.8/indications_of_fraud_in_penkowas_early_research/

This articles should therefore not be cited.

On 2017 Aug 29, David Mage commented:

In the introduction the authors write: "the peak incidence of SIDS coincides with the nadir in the physiologic anaemia of infancy (PAI)." This nadir is defined as the minimum in total (T) hemoglobin (Hb)(g/dL) vs age as the infant's fetal hemoglobin (HbF) is replaced by adult hemoglobin (HbA). This gives the relation as follows: THb = HbA + HbF, where HbF decreases with age and HbA increases with age. Differentiating the equation with respect to time t since birth we obtain the relation d(THb)/dt = d(HbA)/dt + d(HbF)/dt. That is, the nadir is the point in time when the increase in HbA plus the decrease in HbF equals 0.

However, because HbF holds oxygen more tightly than HbA does, the available oxygen (AO2) to the tissues from the blood will also have a minimum during the period between birth and the nadir in PAI. This can be seen because when the increase in HbA is equal and opposite to the decrease in HbF, d(AO2)/dt is greater than zero so the nadir in AO2 must occur earlier than the nadir in PAI.

Of course this time differential between the nadirs will be a function of gestational age and the time interval between birth and cord clamping, that relates to the placental transfusion from mother to infant that increases the infant THb.

On 2016 Nov 20, Morten Oksvold commented:

An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

This article should therefore no longer be cited.

On 2013 Nov 08, Mark Gijzen commented:

New results published by others (PMCID: PMC3718677 and Morais JK, 2010) have led us to revise our hypothesis regarding the cross-reactivity of the SC24 antibody. Instead of cross-reactivity with the seed coat peroxidase, it is more likely that the antibody simply cross-reacts with the newly discovered soybean toxin SBTX, since SC24 and SBTX share sequence similarity. Our purified sample of peroxidase enzyme likely contained SBTX, since these two proteins are of the same size, 44 kD.

On 2013 Nov 09, Subhash Thakre commented:

This article is an effort to assess the quality and strengths of study findings. it has also addressed the issue in various corollary. I liked it very much.

On 2013 Oct 23, Hilda Bastian commented:

The conclusions of this paper (Ioannidis JP, 2005) were challenged by Goodman and Greenfield in 2007 (and responded to by Ioannidis JP, 2007). They were also challenged by Jager and Leek (Jager LR, 2014). Those authors conclude, using a different analytical approach (false discovery rate), that the literature reliably charts scientific progress. Ioannidis then responds to this discussion, challenging the data and analytical approach here: (Ioannidis JP, 2014). (I discuss this debate in a blog post.)

On 2016 Jul 11, Pedro Reche commented:

This tool isnow available at http://imed.med.ucm.es/Methylator

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2016 Mar 29, Jonathan Wren commented:

Apparently relocated to: http://www.lbgi.fr/balibase/

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Feb 02, Tom Kindlon commented:

Observations on apparent changes in methods of assessing symptoms

(This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).

I notice that the "Symptom Inventory collects information about the presence, frequency, and intensity of .. symptoms during the month preceding the interview". However the Fukuda et al '94 definition [1] is supposed to look for "the concurrent occurrence of four or more of the following symptoms, all of which must have persisted or recurred during 6 or more consecutive months of illness and must not have predated the fatigue".

Was there a particular reason why a time frame of one month was chosen? This would suggest that relatively short-lived symptoms would be counted. If the reasoning was that asking people detailed questions about symptom severity and frequency over a longer period would might not be as accurate, perhaps a two-stage question could be asked: firstly asking whether symptoms "have persisted or recurred during 6 or more consecutive months of illness" and then asking a more detailed question about frequency and intensity.

I also see no mention of the requirement, that was in the initial definition [1], that the symptoms didn't predate the fatigue. Again, if this is a change, it would seem to risk reducing the specificity of the symptom criteria (i.e. increasing the chances that symptoms from other causes are counted) so perhaps again a yes/no question would be good.

References:

[1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.

On 2014 Feb 02, Tom Kindlon commented:

More symptoms could be added to a CFS Symptom Inventory

(This was originally posted here: http://www.pophealthmetrics.com/content/3/1/8/comments but the formatting has been removed and some people may not read the paper there either).

Many would feel that the 8 symptoms used in the CDC '94 definition [1] were chosen in a somewhat arbitrary fashion; so it is to be welcomed that the CDC itself has started to look beyond these symptoms with the CDC CFS Symptom Inventory. The idea of a Short Form of the CDC Symptom Inventory is also interesting.

However, it is not clear to me where the extra symptoms that are on the CDC CFS Symptom Inventory came from. For example, I didn't see some of the symptoms listed in Reeves et al [2].

In 2001, De Becker et al [3] published data on the symptoms found in over 2500 patients. They tried to improve on the 1988 [4] and 1994 CDC criteria. They suggested a list of symptoms that could be used to strengthen the ability to select ME/CFS patients. Many of the symptoms they mentioned are not in the CDC CFS Symptom Inventory.

So to claim that the "CDC Symptom Inventory assesses the full range of CFS associated symptoms" seems questionable. It would be interesting if in future these symptoms (that De Becker et al were suggesting) were added before statistical analyses are performed. The fatigue criteria and functional impairment criteria have become much less restrictive [5]. For example, to satisfy the fatigue criteria, the fatigue is required to be greater than or equal to the medians of the MFI general fatigue (≥ 13) or reduced activity (≥ 10) scales. So it now seems particularly important that the symptom criteria have good sensitivity and specificity or one is going to end up with a definition that leads to very heterogeneous samples.

References:

[1] Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome; a comprehensive approach to its definition and study.Ann Int Med 1994, 121:953-959.

[2] Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER, International Chronic Fatigue Syndrome Study Group: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution.BMC Health Services Research 2003, 3:25.http://dx.doi.org/10.1186/1472-6963-3-25

[3] A definition-based analysis of symptoms in a large cohort of patients withchronic fatigue syndrome, P. De Becker, N. McGregor, and K. De Meirleir.Journal of Internal Medicine 2001;250:234-240

[4] Holmes GP, Kaplan JE, Gantz NM, Komaroff AL, Schonberger LB, Straus SE, et al.: Chronic fatigue syndrome: a working case definition. Ann Intern Med 1988, 108:387-389.

[5] Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA,Unger ER, Vernon SD, Heim C: Chronic fatigue syndrome — a clinically empirical approachto its definition and study. BMC Medicine 2005, 3:16.

On 2016 Aug 21, Morten Oksvold commented:

Please note that this article represents one of eleven publications which were found to contain false data, after an investigation led by ORI in 2015:

https://ori.hhs.gov/content/case-summary-dasmahapatra-girija

This article should therefor not be cited.

On 2017 Apr 27, Mante S Nieuwland commented:

For more in-depth discussion on why this effect may be hard to replicate, and the problems with the original study, see our newest paper in LCN https://osf.io/preprints/psyarxiv/ayd3t

On 2017 Apr 05, Katherine A DeLong commented:

There are a number of concerns regarding Nieuwland et al.'s (2017) multi-lab effort. We here highlight features of their project that undermine confidence in their purported non-replication of the DeLong et al. (2005) findings: http://kutaslab.ucsd.edu/FinalDUK17Comment9LabStudy.pdf

On 2017 Mar 01, Mante S Nieuwland commented:

We've failed to replicate the results of this paper in a recent multi-lab effort. Biorxiv pre-print of our paper is available on http://www.biorxiv.org/content/early/2017/02/25/111807

On 2015 Jun 04, thomas samaras commented:

Additional information on height, CHD and longevity is available from these publications.

Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

On 2015 Jun 02, thomas samaras commented:

Additional information on height, CHD, and longevity is available from these recent publications.

Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.

Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

On 2014 Nov 24, Ivan Oransky commented:

The second author of this paper has agreed to retract it and five others following a finding of misconduct by the Office of Research Integrity: http://retractionwatch.com/2014/11/20/former-vanderbilt-scientist-faked-nearly-70-images-will-retract-6-papers-ori/

On 2016 Jan 07, Gwinyai Masukume commented:

Did anabolic steroids contribute to Mike Webster’s death?

During Mike Webster’s autopsy documented in this case report, dilated cardiomyopathy was found. Mike Webster admitted to trying anabolic steroids during his sporting career: Use of anabolic steroids has been associated with the development of dilated cardiomyopathy Ahlgrim C, 2009, Kalmanovich, 2014 and cardiac dysfunction Baggish AL, 2010 that can eventually be fatal. Although the focus of this excellent case report by Omalu and colleagues was the neuropathology aspect, exploring the dilated cardiomyopathy in someone with a history of anabolic steroid use can have important public health lessons.

On 2013 Oct 29, Michael Eisen commented:

According to recent Frontline documentary "League of Denial" http://www.pbs.org/wgbh/pages/frontline/league-of-denial/ this paper was the first step in a chain of events that has finally led to the NFL acknowledging that repeated head trauma can potentially cause long term problems for professional football players, and to a series of changes in the game designed to reduce head injuries.

Note that, according to Frontline, the NFL originally disputed the finding and attacked the work and its author - see Casson IR, 2006.

On 2014 Jun 02, Pedro Reche commented:

PEPVAC is now available at http://imed.med.ucm.es/PEPVAC/.

On 2016 Jan 02, Prashant Sharma, MD, DM commented:

This highly unusual case was a diagnostic challenge wherein filarial infection diagnosed in a lymph node sample provided clues to the patient's non-healing fistula. Wuchereria bancrofti filariasis is commonly diagnosed in parts of India, and parasitic infections must be considered in the differential diagnosis of non-healing chronic discharging ulcers/fistulae. Please feel free to write to me for the full article.

On 2014 Nov 23, Harri Hemila commented:

A manuscript version of the comment is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7981

On 2015 Jun 26, Bill Cayley commented:

a good example of when "less" is "more": https://lessismoreebm.wordpress.com/2015/06/27/how-little-is-enough-the-evidence-for-post-vasectomy-testing/

On 2017 Mar 26, Misha Koksharov commented:

1) It is really sad to see that almost everyone is still using IPTG even after all these years.

2) Full-text (DOI) link is missing from Pubmed for some reason: Final manuscript, NIH-PA author manuscript.

3) If someone wonders: it doesn't matter if it is exactly alpha-form of lactose - it will equilibrate to about 40:60 ratio of both forms in solution anyway, especially in an autoclave and this works fine.

On 2016 Feb 18, Kristina Hanspers commented:

The pathway in figure 1a is available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP2566. This pathway can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2015 Apr 18, Dorothy V M Bishop commented:

As a psychologist interested in the genetics of lateralization, I frequently come across this paper, which is cited as evidence for early genetic influences on brain asymmetry. As of today, 160 citations are shown in Web of Science.

When I read the paper a couple of years ago, I found some details that did not seem to support the conclusions of the authors. These are described in a blogpost: http://deevybee.blogspot.co.uk/2012/12/genes-brains-and-lateralisation-how.html

I will summarise the main issue below, but I was interested to note that, since that time, other papers have appeared, using larger datasets, which have stressed the remarkable symmetry of early gene expression, notably:

Johnson, M. B., et al (2009). Functional and evolutionary insights into human brain development through global transcriptome analysis. Neuron, 62(4), 494-509. doi: 10.1016/j.neuron.2009.03.027

and

Pletikos, M., Sousa, A. M. M., Sedmak, G., Meyer, K. A., Zhu, Y., Cheng, F., . . . Sestan, N. (2014). Temporal specification and bilaterality of human neocortical topographic gene expression. Neuron, 81(2), 321-332. doi: 10.1016/j.neuron.2013.11.018

Here is a brief account of the main issue I raised about the study. Please see the blogpost for more details.

Sun et al used a method called Serial Analysis of Gene Expression (SAGE) which compares gene expression in different tissues or – as in this case – in corresponding left and right regions of the embryonic brain. The analysis looks for specific sequences of 10 DNA base-pairs, or tags, which index particular genes. SAGE output consists of simple tables, giving the identity of each tag, its count (a measure of cellular gene expression) and an identifier and more detailed description of the corresponding gene. These tables are available for left and right sides for three brain regions (frontal, perisylvian and occipital) for 12- and 14-week old brains, and for perisylvian only for a 19-week-old brain. The perisylvian region is of particular interest because it is the brain region that will develop into the planum temporale, which has been linked with language development. One brain at each age was used to create the set of SAGE tags.

To verify asymmetrically expressed genes the authors performed chi square tests. The chi square involves testing whether the distribution of expression on left and right is significantly different from the distribution of left vs. right expression across all tags in this brain region – which is close to 50%. In the left-right perisylvian region of a 12-week-old embryonic human brain, there were 49 genes with chi square greater than 6.63 (p < .01): 21 were more highly expressed on the left and 28 more highly expressed on the right. But for each region the authors considered several thousand tags. My analysis indicated that the number of asymmetrically expressed genes appeared to be lower than you would expect by chance – entirely consistent with the conclusions of Pletikos et al.

Unless my analysis is mistaken, it would seem this paper should not be cited as evidence for asymmetric fetal gene expression, as it actually shows the opposite.

On 2014 Dec 10, Kath Wright commented:

None

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2015 Oct 07, Bill Cayley commented:

One of several examples showing that sometimes in obstetric care "less" is "more": https://lessismoreebm.wordpress.com/tag/obstetric-gynegologic/

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Aug 10, Matthew Katz commented:

This key RTOG trial established a role for concurrent chemoradiation as a curative treatment. It is often now combined with surgery rather than give higher radiation doses. Although the toxicities in this study were high, keep in mind the initial radiation fields treated the whole esophagus. Now we are more targeted with use of PET-CT and CT-based treatment planning. These advances and other improvements help lessen some of the side effects.

On 2014 May 04, Arnaud Chiolero MD PhD commented:

A fantastic paper, addressing a very important topic.

On 2017 Jul 26, Tetsuya Asakawa commented:

The full text link is wrong, with links to another paper.

On 2016 Mar 31, Morten Oksvold commented:

Please note that this article contains falsified data and has been retracted after an investigation by ORI:

https://ori.hhs.gov/content/case-summary-thiruchelvam-mona

Unfortunately the retraction note is hidden in the journal (not included here), and the article is still cited.

On 2015 Sep 07, Gauthier Bouche commented:

The results presented in this article match almost word-for-word the results reported in an earlier paper (Lin CY, 2004) published in 2004. Both articles have 8 authors with 7 in common. The first author of this article is the senior author of the other article and is the corresponding author for both.

On 2016 Dec 01, Graham Walker commented:

There's an easy-to-use tool for the Myeloma International Staging System at MDCalc, as well as the Revised Myeloma International Staging System, each with supplemental content on how to use them clinically, next steps, and info about the creators.

On 2014 Jun 29, Ivan Oransky commented:

This paper has been retracted, one of three by the same group: http://retractionwatch.com/2014/06/23/cancer-genetics-group-retracts-three-papers-for-inappropriate-presentation-of-data/

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2015 Feb 27, Ivan Oransky commented:

This paper has been retracted, the second retraction for three of its authors: http://retractionwatch.com/2015/02/27/prominent-geneticist-david-latchmans-group-notches-second-retraction/

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2017 Jul 07, Morten Oksvold commented:

This article should have been retracted after an investigation by The University of Maryland found this article to contain "compromised" data (a total of 26 articles in 11 journals were affected). The journal Cancer Research was informed in August 2016, according to Retraction Watch.

http://retractionwatch.com/2017/04/26/university-asked-numerous-retractions-eight-months-later-three-journals-done-nothing/

On 2016 Jul 16, Jonathan Eisen commented:

I have posted some additional information about this paper on Figshare (notes, journal communications, Figures, etc). See https://figshare.com/projects/Eisen_et_al_1992_Solemya_velum_symbiont_16S_paper_in_J_Bacteriology_notes/14930

On 2014 Sep 01, Matthew Katz commented:

This EORTC trial offers hope for better outcomes for glioblastoma, a very aggressive disease. Temozolomide as a therapy and MGMT methylation status as a key prognostic factor are key advances defined by this phase III trial. In the same issue, the MGMT data were published. Hegi ME, 2005

Five-year updated data were published in Lancet Oncol 2009 update. Stupp R, 2009

On 2015 Jan 20, Patrick Schloss commented:

The source code for DOTUR can now be found at https://github.com/mothur/DOTUR

On 2016 Sep 22, Natalie Clairoux commented:

Free version of this article available at http://hdl.handle.net/1866/678

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2013 Nov 24, John Sotos commented:

Two features of case 5-2005 (1) deserve comment.

First, hyperacute (“flash”) pulmonary edema did not occur. Suggestive X-ray signs of stage 2 pulmonary edema were present initially, but not appreciated. Resting tachycardia and relative hypotension were also present initially, further suggesting a circulatory system nearing its compensatory limits. Only after normal saline administration did frank pulmonary edema become manifest. Missed diagnosis and iatrogenesis should be added to the differential diagnosis of hyperacute pulmonary edema in the case discussion.

Second, like the proverbial elephant in the living room that is scrupulously not discussed, the claim that “the general physical [examination] disclosed no abnormalities” should have been the discussants’ focus. It stretches probability to believe that all physical signs of heart failure, advanced endocarditis, and aortic valvulopathy were initially absent, yet one discussant accepts this, and another partially excuses it. The patient’s vital signs, marked first-degree heart block, and history of hospitalization for heart disease should, from the beginning, have prompted a directed cardiovascular examination in the emergency room.

(1) Biddinger PD, Isselbacher EM, Fan D, Shepard JA. Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 5-2005. A 53-year-old man with depression and sudden shortness of breath. N Engl J Med. 2005 Feb 17;352(7):709-716. Pubmed 15716566

On 2015 May 14, Prof.Dr.Jogenananda Pramanik commented:

Invited author: Dr.Mayo Wint Zaw University College of Saputra UCSA, Kuantan, Pahan, Malaysia

In recent years medical education is changing at a rapid space. Next generation medical teachers need rigorous training in teaching medical students. Extensive inputs from IT sector seem to be urgently required to update our teaching materials. Current students expect more dynamic and advanced approach incorporating recent multimedia technology in developing teaching materials. Monotonous lectures with 2D power point slide presentations are now out of date. Automated computerized anatomy table, animated physiology packages and many other ultramodern technological support from IT sector have shown great impact on medical teaching and training programmes. Use of iPAD and cell phone for taking pictures or video records and also downloading student consult books in laptops introduced paperless academic and research set up. Health informatics, medical transcription etc., are coming up with remarkable progress in this field of medical education. We may look forward to our computer savvy Y-generation for adding up unique values to our teaching materials and help to update.

On 2014 Jul 16, Prof.Dr.Jogenananda Pramanik commented:

"We need to train our teaching work force in academic medicine"

More than a decade passed away, since the campaign for urgent resuscitation of academic medicine was initiated worldwide. We raised our voice to train our teaching work force for a better futuristic academia in medicine (1). Lot has been said and planned for improving and modernizing academic medicine. A number of strategic modifications have been instituted aiming to develop a vision and a set of recommendations for reforming academic medicine in 21st century (2). We expected a rigorous change in this century eliminating the monotonous teaching schedule that emphasizes on parroting of old theories, facts and figures of basic sciences without any relevance to our professional needs. After long struggles and arguments in several medical education conferences, we realized the brutal fact that academic medicine's understanding will always lag behind the doing of good clinical practice (3). Presently in our University, we included small group discussion sessions; problem based learning sessions, meet the expert sessions, self-study sessions etc., in addition to regular lecture classes in our integrated medical curriculum with an ambition to develop well groomed medical graduates. We sincerely aspire that academic medicine must position itself as one aspect of the global health workforce crisis, but recognise that there are broader issues than merely improving career paths(2).

References:

1. Jogenananda Pramanik, BMJ. Academic medicine: who is it for? We need teachers to train teachers Feb 12, 2005; 330(7487): 361–362. doi: 10.1136/bmj.330.7487.361-c
2. Clark J, Tugwell P. Who cares about academic medicine? BMJ 2004;329: 751-2. (2 October.) doi: 10.1136/bmj.329.7469.751
3. William House, and David Peters: Academic medicine: who is it for? Five rescue remedies for academic medicine. BMJ. Feb 12, 2005; 330 (7487): 631. doi: 10.1136/bmj.330.7487.361-a

On 2014 Feb 02, Jan Tunér commented:

The conclusion of this study is questionable since only 0.12 J per finger joint was applied. Energy recommendation of the World Association for Laser Therapy for finger arthritis is 4 J, 1-2 points. The discussion also fails to discuss the great differences in dosage and treatment techniques in the references.

On 2016 Feb 02, Kristina Hanspers commented:

The pathways in figures 3a and b are available in the "Open Access Publication" collection at WikiPathways: http://www.wikipathways.org/index.php/Pathway:WP374 and http://www.wikipathways.org/index.php/Pathway:WP385. These pathways can be downloaded for use in network analysis tools such as Cytoscape and PathVisio.

On 2016 Dec 01, Graham Walker commented:

We just launched an interactive version of the ADHERE algorithm on MDCalc, with additional content on how and when to use it properly (reviewed by Dr Fonarow himself), next steps after applying it, and an interview with Dr Fonarow.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2018 Jan 17, Fernando Castro-Chavez commented:

Reader,

In this review I present the aspect of the hepatology based on my microarray findings, learning that both of the SCD genes (for the stearoyl CoA desaturases), while in the white adipose tissue were dramatically down-regulated: scd1 and scd2, in the perilipin knock out mice, however in the liver they remained normal, which means that "the liver of perilipin-/- mice was healthy and normal, even under high-fat diet when compared with the results published for the scd1-/- mice, which under high-fat diets had a darker liver, suggestive of hepatic steatosis. Scd1 is required for the biosynthesis of monounsaturated fatty acids and plays a key role in the hepatic synthesis of triglycerides and of very-low-density lipoproteins"; furthermore I make a remark on my findings of "increased expression for hemoglobin transcripts and other hemo related genes (hemo-like), and for leukocyte like (leuko-like) genes inside the white adipose tissue of the perilipin-/- mice", as well as my first report of the palindrome sequence that contaminates thousands of genes in the Genbank, and I mention this in the next terms within the body of the article: "I found with microarrays an artificial phenomenon of heterotranscription contaminating thousands of sequences in the Genbank nucleic acids database through the sequence CTCGTGCCGAATTCGGCACGAG or its derivatives".

With my regards,

Fernando Castro-Chavez From the Baylor College of Medicine.

Guadalajara, Jalisco, Mexico 01/17/2018.

On 2014 Jun 02, Pedro Reche commented:

EPIMHC is now available at http://imed.med.ucm.es/epimhc/

On 2015 Dec 30, Scott Federhen commented:

The type strain for Bacillus velezensis is identified as CECT 5686 in the abstract, but CECT 5687 in the body of the text for this paper. CECT 5686 is correct, according to the annotation at the CECT. CECT 5687 is identified as the type strain of Bacillus malacitensis.

On 2013 Oct 28, DAVID SANDERS commented:

See the earlier articles "Sulfhydryl involvement in fusion mechanisms" [2000]Sanders DA, 2000 and "Ancient viruses in the fight against HIV" [2003] Sanders DA, 2003 for the prediction of the results published here.

On 2015 Dec 06, S A Ostroumov commented:

FULL TEXT ONLINE FREE: https://www.researchgate.net/publication/8083617

On 2016 Mar 29, Jonathan Wren commented:

Apparently relocated to: http://agingmind.utdallas.edu/facedb

On 2017 May 09, Sophien Kamoun commented:

Can a biologist fix a smartphone? https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0378-2

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2016 Aug 23, David Keller commented:

Further reading: Constructive suggestions for unleashing the full power of ColoGuard screening

A proposal for risk-stratification of negative ColoGuard (MultiTarget) screening test results using the Composite Score to determine the time until next screening. The higher the Composite Score (below 183), the sooner the patient would be rescreened. Full explanation is at the following URL:

http://www.ncbi.nlm.nih.gov/pubmed/27393107#cm27393107_16519

On 2016 Mar 29, Jonathan Wren commented:

Now at: http://www.cathdb.info/

On 2016 Mar 29, Jonathan Wren commented:

Now at: http://www.noncode.org/

On 2015 Dec 11, Harri Hemila commented:

Available at DOI.

On 2015 Aug 11, GianCarlo Panzica commented:

The staining of neurons in dorsomedial hypothalamus and in other extrahypopthalmic regions suggests that the antibody used in this study cross react with other peptides of the same family of the RF-amide peptides (Colledge, 2009a,b) Colledge WH, 2009 Colledge WH, 2009

On 2015 Aug 11, GianCarlo Panzica commented:

None

On 2017 Jul 25, James M Heilman commented:

Have reviewed some of the claims in this paper and they are not supported by the associated references. For example figure 3: "Combined effect of Pritikin lifestyle intervention on blood glucose and need for oral hypoglycemic medication or insulin therapy. (Data from Refs. 38, 39, 40, 41, 43.)" 38, 40, 41, and 43 do not even mention the diet let alone support the conclusions?

On 2015 Jan 31, peter duesberg commented:

Dear Ruediger,

Could you please send a pdf of your 2004-EuJHist-paper and of subsequent work, if available. I think our new paper, "Karyotypic evolutions of cancer species in rats during the long latencies after injection of nitroso-urea" (Mol Cytogenet, 2014) cob firs and extends much of your work. Will say more after reading your paper.

Cordially,

Peter

On 2014 Mar 26, Tom Kindlon commented:

24 Rapid Responses were posted following the publication of this paper:

Including my response below, 24 Rapid Responses were posted following the publication of this paper. They can be read here: http://www.bmj.com/content/330/7481/14?tab=responses.

Here are direct links to my other responses: "If a treatment helps some patients, should it be described as being "effective" for that condition?" http://www.bmj.com/rapid-response/2011/10/30/if-treatment-helps-some-patients-should-it-be-described-being-effective-co

"CBT has a Cohen's d value of 0.31 in this study" http://www.bmj.com/rapid-response/2011/11/01/cbt-has-cohens-d-value-031-study

"Re: CBT has a Cohen's d value of 0.31 in this study" http://www.bmj.com/rapid-response/2011/11/01/re-cbt-has-cohens-d-value-031-study

"Data on the other SF-36 subscales has been released" http://www.bmj.com/rapid-response/2011/11/02/data-other-sf-36-subscales-has-been-released

On 2014 Mar 26, Tom Kindlon commented:

Actometer data from the trial has been released showing that there was not a statistically significant increase in activity levels in the therapeutic arm of the trial

A BMJ e-letter by me with this title can be read at: http://www.bmj.com/rapid-response/2011/11/02/actometer-data-trial-has-been-released-showing-there-was-not-statistically (or alternatively: http://www.bmj.com/content/330/7481/14?tab=responses)

On 2015 Mar 30, Jacob H. Hanna commented:

A corrected version of this manuscript has been republished on bioRxiv: http://biorxiv.org/content/early/2015/03/30/016816

We will not seek to republish it elsewhere in any peer-reviewed journal, as it has been 10-12 years since publication, and the study lacks any novelty at this point in time.

On 2014 Apr 21, David Keller commented:

Attention USPSTF: the evidence demonstrates that multivitamins benefit older men

The United States Preventative Services Task Force (USPSTF) recently updated their report on multi-vitamin supplements, and again found "insufficient evidence" to recommend their general use. The USPSTF report dismissed the significant reduction in cancers seen in men in both the SU.VI.MAX and Physicians' Health Study (PHS II), partly because the lack of benefit in women caused them to doubt the results found in men. However, they failed to address the reasonable explanation offered by the SU.VI.MAX authors, which is that women have a higher baseline nutritional status than men, and thus have less to gain by adding a multivitamin supplement.

The second reason USPSTF gave for not being able to interpret the results of the PHS II and SU.VI.MAX studies was that they tested different multivitamin supplement formulations. However, the 5 antioxidants used in the SU.VI.MAX supplement are a sub-set of the micronutrients in the Centrum Silver administered in PHS II. I have pointed out elsewhere in PubMed Commons that there is a rudimentary dose-response effect evident when one compares the effects of the low-dose Centrum Silver supplement, versus the higher-dose SU.VI.MAX supplement, with regard to the significant reduction in cancer seen in men in both studies. A dose-response effect tends to corroborate the findings of the individual studies, and it also suggests the need for a dose-ranging study of the SU.VI.MAX supplement. Would increasing the doses of these 5 antioxidant nutrients reduce cancer rates and mortality even further in men? Would a significant effect in women become evident?

Lastly, the updated USPSTF report completely omitted any mention of the significant reduction in all-cause mortality seen while men were taking the SU.VI.MAX supplement.

At this time, there is consistent evidence from 2 large, prospective, randomized, placebo-controlled trials that the low-dose multivitamin supplement used in PHS II significantly reduces the incidence of cancer in men, and that the higher-dose SU.VI.MAX supplement (consisting of 5 antioxidant nutrients in higher doses than in Centrum Silver) reduces cancer rates even more in men, and adds a significant reduction in all-cause mortality. How many more studies must be done to convince the USPSTF that the results of PHS II and SU.VI.MAX are true? How many men will get cancer or die while we wait for those studies?

I propose that the USPSTF change their assessment of multivitamin supplements to reflect the significant dose-related benefits multivitamins have demonstrated for men over the age of 50, who can benefit from reduced cancer rates and overall mortality, according to the best evidence we have. The USPSTF should call for dose-ranging studies to determine whether the benefits of the five antioxidants administered in SU.VI.MAX can be increased by increasing their doses.

At the very least, the USPSTF report should be amended to state that overall mortality was significantly decreased in men taking the SU.VI.MAX supplement. The absence of that fact from their report seems inexcusable.

On 2015 Oct 07, Bill Cayley commented:

One of several examples showing when "Less" is "More" when caring for someone with a migraine: https://lessismoreebm.wordpress.com/?s=migrain

On 2013 Jun 14, Robert Tibshirani commented:

I did a thorough re-analysis of the data in this paper, and it shed serious doubt on the validity of the findings. My re-analysis was briefly summarized in NEJM at http://www.nejm.org/doi/full/10.1056/NEJM200504073521422 and in much more detail in http://www-stat.stanford.edu/~tibs/FL/report

I use this example as a teaching tool, demonstrating how the lack of reproducibility of findings is a serious problem, especially in the age of "big data".

On 2013 Nov 24, John Sotos commented:

The perspective about Merck recalling rofecoxib (1) should not have appeared in a medical journal. Although ensconced under a “Business and Medicine” heading, it was purely a business article having nothing to do with medicine.

The authors, from Harvard Business School, use opaque business formulations such as a “cost of capital of 11.25 percent to discount future earnings” to calculate that Merck’s post-recall stock drop was excessive given the recall’s revenue and litigation impact. Their article then rehashes tired statistics about drug development expense, analyzes Merck’s business strategy, and concludes with patient-safety platitudes.

Where is the medicine? Similarly analyzing a multinational shoe company would be equally relevant to physicians: all patients need shoes, and poorly fitting shoes in diabetics cause considerable morbidity and sometimes mortality.

The Journal’s increasing preoccupation with business is classic mission creep, and incurs opportunity cost: uneven translation of research results to the bedside is a major failing of today’s medical system. High impact publications such as the Journal poorly serve our profession when they divert precious pages to Wall Street intrigues.

(1) Oberholzer-Gee F, Inamdar SN. Merck’s recall of rofecoxib–a strategic perspective. N Engl J Med. 2004 Nov 18;351(21):2147-9. Pubmed 15548771