Hypothesis

10,000 Matching Annotations

Nov 2021
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266493

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266493: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266493
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266502

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266502: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The CoronAVI@S study and the KING cohort extension were approved by the Ethics Committee Boards from the Institut Universitari d’Investigació en<br>Consent: All participants provided written informed consent before inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of anti-SARS-CoV-2 antibodies: The presence of anti-SARS-CoV-2 antibodies against S2+RBD or NP in plasma samples was evaluated using an in-house developed sandwich-ELISA, as previously described [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2+RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CoronAVI@S study and the KING cohort extension were approved by the Ethics Committee Boards from the Institut Universitari d’Investigació en</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KING</div><div>suggested: (KING, RRID:SCR_009251)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standard curve was calculated by plotting and fitting the log of standard dilution (in arbitrary units) vs. response to a 4-parameter equation in Prism 8.4.3 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Even though an assessment of the immune response several months after vaccination has been performed, our study has some limitations. First, the relatively small number of participants, especially for the uninfected elder group, which was unexpectedly low. While 64% of the cohort tested positive by PCR in massive tests screenings during outbreaks, SARS-CoV-2 serologic test revealed that 84% of residents suffered from COVID-19. In addition, we did not assess specific SARS-CoV-2 cellular responses before and after vaccination, which could also be used as a correlate of protection [28]. Further follow-up of the immune responses, as well as registration of breakthrough infections in COVID-19-uninfected residents from LTCF will allow to define the immune correlate of protection in this frail and vulnerable population. To this purpose, determination of the quality of humoral immune response, using functional neutralization assays, is necessary in the population older than 65 years. Taken together, our results suggest that only the uninfected-residents, who do not develop adequate immune responses, will clearly benefit from a booster vaccine dose; an adapted vaccination calendar would be necessary to respond to the immune needs of this vulnerable population. Importantly, hybrid immunity seems to be active in elders and can be relevant to design vaccine boosting campaigns.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266502
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266496

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266496: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed and signed consent was obtained from each participant.<br>IRB: Ethical clearance: This study was authorised by the Ministry of Health of the Central African Republic (N° 603/MSPP/DIRCAB/CMRF-21) and by the Ethics and Scientific Committee of the University of Bangui (N°09/UB/FACSS/IPB/CES/20)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We performed a random cluster sampling according to the method described by Bennett et al. (9).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the Wantai ELISA kit used is based on a double-antigen sandwich assay: the solid phase is coated with recombinant SARS-CoV-2 antigens, which can simultaneously bind antibody isotypes (IgA, IgM, and IgG) directed against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collection and analysis: The data were entered into an Access 2016 database, and the statistical analyses were performed with STATA version 14 software (StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266496
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266501

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266501: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The survey requests were sent by the research agency (Rakuten Insight, Inc., Tokyo, Japan) to the 224,389 panelists who were selected by each gender, age, and prefecture category using simple random sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Several limitations should be noted. First, this study was cross-sectional so that causality cannot be determined. Although we adjusted for a prior history of depression to omit reverse causality, a longitudinal study is needed to clarify the association between risk factors and workplace bullying, SPD, and suicidal ideation in the COVID-19 pandemic. Second, workplace bullying was measured by a self-labeling method, which may cause underestimation compared to the behavioral experience method that asks respondents how often they experienced the various negative acts without using the term “harassment” or “bullying.”1 Third, there might be a sampling bias due to the nature of an online survey. This may limit generalizability of our study results. Despite these limitations, this study was the first to identify important risk factors of workplace bullying, SPD, and suicidal ideation in the nationwide large-scale study for the general working population in Japan. The strengths of this study were investigating various risk factors including working styles and a change in job demands and revealed new risk factors: working from home for SPD or suicidal ideation and managers for workplace bullying. Further research is needed to examine other possible risk factors of workplace bullying, SPD, and suicidal ideation.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266501
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266499

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266499: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The study was approved by the Institutional Review Board of Beijing Ditan Hospital, Capital Medical University in Beijing (approval number JDLY2020-020-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Corresponding serum samples were tested for anti-SARS-CoV-2 antibodies using a chemiluminescence immunoassay (CLIA; Bioscience, Chongqing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral RNA was extracted using Kingfisher Flex Purification System (ThermoFisher, Waltham, MA, USA), and Libraries were prepared using a Nextera XT Library Prep Kit (Illumina, San Diego, CA, USA), and the resulting DNA libraries were sequenced on a MiniSeq platform (Illumina) using a 300-cycle reagent kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiniSeq</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole-genome sequence alignment was conducted using the Muscle tool in MEGA (v7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Muscle</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The statistical analyses were performed using SPSS version 25.0 (SPSS IBM, Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had some limitations. There were relatively few cases in the unvaccinated group, and most patients did not have full genome sequencing results, which may be related to the low viral load (high CT value) in some patients which were tested negative in the origin country. In addition, the number of patients that had breakthrough infections after being vaccinated with non-inactive vaccines was much lower than the number of patients vaccinated with inactive vaccines. Being vaccinated does not mean we can throw caution to the wind and put ourselves and others at risk, mainly because the research is still ongoing into how much vaccines protect against disease, infection, and viral transmission. Therefore, for the foreseeable future, we still need to continue wearing masks and washing our hands, and we need to ensure good indoor ventilation, continue physical distancing, and continue avoiding crowds.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266499
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.19.469276

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.469276: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.19.469276
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.19.468693

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.468693: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Word clouds were generated in Python using the wordcloud package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, there were some limitations to our study. First, although the pandemic survey was conducted in a subset of the pre-pandemic respondents and therefore was more directly comparable, the responses were anonymized, and we are unable to do a direct one-to-one comparison of pre-pandemic to pandemic responses on an individual level. Furthermore, although we were able to assess caregivers through responses to a handful of questions, including the written responses, we did not directly ask if respondents were parents or caregivers, limiting our ability to assess those effects more directly. Lastly, because of sample sizes, we were limited in our ability to assess certain metrics for some demographics such as the LGBTQ, third gender, individuals with disabilities and certain races/ethnicities. To be able to parse out potential differences between racial and ethnic groups, we pooled all individuals into three broad groups; white, Asian and URM. Nonetheless, these data still represent a rich collection of information about the postdoctoral experience before and during the pandemic. As is apparent from our survey data, access to institutional resources is critical not only for the ability of postdocs to complete their work in safe and supportive environments - as is often the focus of institutional efforts - but also for their mental and physical wellbeing as we note in this manuscript. Along with these resources, our data indicate the importance of institutional tracking of post...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.19.468693
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266580

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266580: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study also has limitations. Jurisdictions’ self-reported CICT performance measures were not intended for this analysis. Although we employed the previously described data quality checks (eFigure 3 in Supplement 1), the reported measures that we used were likely influenced by differences in jurisdictions’ surveillance systems, CICT platforms and protocols (e.g., how they enrolled and monitored contacts). The extent to which these differences affected our results is unclear. We also only assess the impact over two months (60 days) of the pandemic and in 23 US jurisdictions. Results may differ for other periods (e.g., during the surge of the Delta variant and wider use of vaccine) and jurisdictions. Because cases were spiking across the entire US during the period that we analyzed and the vaccine had not yet been widely administered, it is likely that our estimates provide an upper limit of cases averted by CICT during the pandemic as of this writing (August 31, 2021). Finally, because we used statewide data, our results dilute potentially meaningful differences in CICT performance within jurisdictions (e.g., rural versus urban counties). Our analysis combined primary implementation data with mathematical modeling to estimate the health impact of COVID-19 case investigation and contact tracing across nearly half of US state and territory CICT programs. The volume of estimated cases and hospitalizations averted underscores the critical role CICT programs play in curtailing th...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266580
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266547

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266547: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for Human IgG Antibodies Specific for the SARS-CoV-2 Spike Protein Receptor-Binding Domain (RBD): This is a sandwich ELISA in which a capture antibody, rabbit anti-mouse IgG, is adsorbed onto microtititer wells, followed by antigen capture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the Generalized Linear Model (GLM) for assessing potential confounding factors or interactions between the study groups and each of the factors associated with IgG antibody concentrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266547
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266489

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266489: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Data were de-identified and determined by an independent institutional review board as nonhuman subject research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of the 4,091 residents with confirmed COVID-19 infections in the study population, 2,277 (55.7%) were female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">13 Analysis was conducted using Python 3.9.0 and the EconML and Scikit-Learn packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>Scikit-Learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266489
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266581

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266581: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Several limitations are present in this observational study. The relatively small number of events, despite fulfilling the a priori power calculation to detect a difference, does not allow for generalization as a prognostic factor for intubation. This was a single centre study, with a limited number of cases; therefore caution is necessary when attempting to generalize the results. Future multicenter clinical trials included larger number of subjects are awaited to provide data about this prognostic factor. Another important constraint was the patient inflow, as the major proportion of patients were transferred from other hospitals, days after symptom onset and various stages of disease, having received various therapeutic agents. The baseline measurements of our study may not be homogenous with respect to days since symptom onset and treatment naïveté or nosocomial infection; in a larger sample this heterogeneity would yield a much more robust result. Another important constraint is the lack of evaluation for observer agreement for the radiological findings of chest computed tomography. Our data was not sufficient to run such analyses; as a result, this important parameter of disease severity could not be reliably assessed as a contributing factor. Despite the limitations, there are several strengths in the current comparison. The most important is the inclusion of all admitted patients, regardless of comorbidities or previous respiratory disease. This allows for generalizat...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266581
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266408

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266408: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: These are unselected Helix customers and patients in the Renown Health System who chose to consent to participate in research projects and respond to our survey.<br>IRB: The Helix DNA Discovery Project study was reviewed and approved by Western Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The participants in this cohort are aged 18 to 89+, 65% are female, and 85% are of European genetic ancestry (Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: This was followed by genotype imputation for all 1000 Genomes Phase 3 sites with MAF>=1% that have genotype quality (GQ) values less than 20.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266408
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.17.468943

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.468943: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.5 Cytotoxicity assays: Vero cell lines (ATCC® CCL-81™) were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.1 Cloning, protein overexpression and purification of SARS-CoV-2 PLpro: A fragment of SARS-CoV-2 ORF pp1a/ab encoding the PLpro domain and corresponding to amino acids 746-1060 of non-structural protein 3 (YP_009742610.1) was cloned into pETM11(EMBL), which encodes N-terminal hexa-his tag followed by a tobacco etch virus (TEV) protease cleavage site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETM11</div><div>suggested: RRID:Addgene_108943)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Final rounds of manual refinement with either Refmac48 or Phenix49 together with manual model building applying COOT resulted in the final refined structures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel and GraphPad Prism (version 8.3.1) were used for analyzing the results and preparation of corresponding figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture supernatant was harvest 42 h post-infection and viral RNA was purified using MagMAX™</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MagMAX™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50-values were calculated by fitting the data using GraphPad Prism version 8.00 (GraphPad Software, La Jolla California USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.17.468943
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.21.469423

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.469423: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each of the six subgenus-level datasets was aligned with MAFFT using default settings (Katoh and Standley 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of potential transcriptional regulatory sequences: SuPER was used to detect transcriptional regulatory sequence leader (TRS-L) sites and a custom Python (Rossum and Drake 2010) script was used to infer transcriptional regulatory sequence body (TRS-B) sites (Yang et al. 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 15. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.21.469423
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.21.469172

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.469172: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal experiments were approved by the Experimental Animals Committee of SHMC, and all methods were carried out in accordance with relevant guidelines and regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Female BALB/c mice (6-8 weeks of age) were purchased from Beijing Vital Laboratory Animal Technology Co., Ltd. (Beijing, China) and Shanghai Jiesjie Laboratory Animal Co., Ltd. (Shanghai, China), and were kept in SPF conditions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All animal studies were performed with randomized animal selection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female BALB/c mice (6-8 weeks of age) were purchased from Beijing Vital Laboratory Animal Technology Co., Ltd. (Beijing, China) and Shanghai Jiesjie Laboratory Animal Co., Ltd. (Shanghai, China), and were kept in SPF conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide pool derived from SARS-CoV-2 Spike protein: The spike receptor-binding domain (RBD) peptide pool (SARS-CoV-2 spike protein 258-518aa) published previously7 was used for the study (Table 1). Immunization: The mice were injected twice, with a two-week interval, via the intramuscular route (i.m.) with 25 μg pGX9501 expressing a synthetic, optimized sequence of the SARS-CoV-2 full-length spike glycoprotein7 and then electroporation was applied with the Cellectro2000 device.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX9501</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six hours later, the percentage of labeled cells in spleens was detected with LSRFortessa flow cytometry (BD) and analyzed by FlowJo (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics were performed using GraphPad Prism 7 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.21.469172
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266605

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266605: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We downrated for risk of bias when studies using passive surveillance (assuming some under ascertainment) and unverified cases contributed to a synthesis, and for indirectness for comparisons across all ages and both sexes, due to the large heterogeneity in incidence rates across ages (for males) and sexes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For randomized controlled trials (RCTs), we used the report of the largest population as the primary (included) publication and cited associated papers used for data extraction; sub-studies within RCTs, for example of different ages, were considered different studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other Non-Indexed Citations and Daily <1946 to October 05, 2021> and Embase <1974 to 2021 October 05>.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also searched the Cochrane Library and medRxiv (last 2 months).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the Cochrane Collaboration ROB 2.0 tool18 for RCTs, and the JBI (formally Joanna Briggs Institute) checklist for cohort studies19 for observational studies/surveillance data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Collaboration ROB</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The key messages from the patient/parent perspective, co-developed with our patient partners, include: Strengths and limitations of the review: There are several strengths of this review. A comprehensive, peer-reviewed search strategy was used and inclusion of gray literature captured in several cases very recent data. A second reviewer screened the most relevant (based on machine learning) citations, and verified all data and risk of bias assessments. GRADE assessments were based on team consensus including clinical experts. Patient partners reviewed the evidence and developed interpretations from the patient perspective. The main limitation is that in the era of COVID-19 the literature base is evolving with incredible rapidity and new evidence will emerge; nevertheless, there was some moderate certainty evidence found in this review. Because many reports used overlapping populations and reported findings based on different methods of case ascertainment (e.g., risk interval, whether cases were verified) a quantitative synthesis was not undertaken and some of the descriptive summary statements may not fully account for this. We also avoided making any conclusions about any one possible estimate of average incidence and instead relied on ranges.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266605
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266512

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266512: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study oversight: Approval was obtained from the Newcastle & North Tyneside 2 Research Ethics Committee (20/NE/0161), the NHS Digital Data Access Request Service (DARS-NIC 381078-Y9C5K) and the British Heart Foundation Data Science Centre CVD-COVID UK Approvals and Oversight Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For computational efficiency, analyses included all people with the outcome of interest or with a record of COVID-infection, and a 10% randomly sampled subset of other people.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses used SQL, Python and RStudio (Professional) Version 1.3.1093.1 driven by R Version 4.0.3 (2020-10-10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. First, the survival analyses allowed for variations in diagnoses with calendar time, so should control for the reductions in hospital attendance the period of maximum disruption (March and April 2020). However, some vascular events not have been recorded either because patients died in nursing homes with few diagnostic resources, or were so unwell that MI, stroke, PE or DVT diagnoses would have been difficult. Second, patients may have avoided healthcare after minor vascular events because of fear of COVID-19. If this was more likely in people without COVID-19, then estimated hazard ratios would have been biased upwards. Third, because the English primary care dataset did not include information on PE and DVT, the incidence of milder venous events may have been underestimated. Fourth, we had limited resolution to determine the date order of COVID diagnosis and arterial thromboses or VTE events for some hospitalised patients. Some patients hospitalised with a vascular event either developed a nosocomial infection or had a COVID-19 diagnosis after routine testing on admission. For some patients, a raised troponin with COVID-19 may have led to a diagnosis of MI.12 Therefore the very high hazard ratios within one week of COVID-19 diagnosis may have been inflated by reverse causality. Fifth, there was under-ascertainment of COVID-19 infection before testing for SARS-CoV-2 became widely available for mild or asymptomatic infections. Such underdia...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266512
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.20.469409

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.20.469409: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: AECs from children were obtained under study #12490 approved by the Seattle Children’s Hospital Institutional Review Board.<br>Consent: Parents of subjects provided written consent and children over 7 years of age provided assent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary bronchial AECs from adults were purchased from Lonza® or obtained from a tracheal segment lung transplant donor lung tissue.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lonza®</div><div>suggested: (Lonza, RRID:SCR_000377)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using Prism® 9.0 software (GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism®</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, there are several limitations of our primary airway epithelial model system. First, our ex vivo system lacks interaction with immune cells and the complex immune responses that occur in vivo in the context of COVID-19, and therefore we cannot assess how heterogeneity in interferon responses to SARS-CoV-2 at the level of the airway epithelium relate to systemic immune responses or clinical outcomes in vivo. Second, in this study we did not investigate potential genetic or epigenetic factors that may explain the between subject heterogeneity in interferon responses and viral replication that we observed. Finally, given the limitations posed by the complex logistics of completing these experiments in a biosafety level 3 (BSL-3) facility, together with limitations in available material from organotypic cultures from a sizeable number of human donors, we were constrained in the number of feasible sample harvesting timepoints which prevented us from conducting a high resolution assessment of the time kinetics of viral infection and interferon responses in the present study; however, our choice to harvest supernatant 48 hours following SARS-CoV-2 infection and RNA 96 hours following infection was informed by both our prior work with RSV(29) and preliminary experiments with SARS-CoV-2 (data not shown) where we observed that in organotypic primary ALI cultures type I and III interferon responses peak between 24-48 hours while expression of downstream ISGs peak between 72-96 h...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.20.469409
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.20.469369

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.20.469369: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All patient enrollment and tissue collection was approved by the Boston University Medical Campus Institutional Review Board.<br>Consent: For this cohort, informed consent was waived, and samples were accompanied by limited demographic data available from chart review.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">cohort (April-May 2020) involved tissue collection from placentas designated for pathology analysis either from women who tested positive via SARS-CoV-2 nasopharyngeal PCR testing at the time of delivery or from contemporary controls who tested negative.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Decidua basalis areas were manually surveyed at 100× followed by automated acquisition at 200× of 4 tiled images from 5 randomized areas per slide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All ImageJ analysis and calculations were performed on blinded samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were diluted 1:100 in PBS-T as follows: single labeling: CD14 (mouse anti-human, 14-149-82, Invitrogen), CD56 (mouse anti-human, 14-0567-82, Invitrogen); double labeling: SARS CoV-2 spike glycoprotein (rabbit anti-human, ab272504 Abcam), CD3 (mouse anti-human, 14-0038-82, Invitrogen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>anti-human , 14-149-82 , Invitrogen) , CD56</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human , ab272504 Abcam) , CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human , 14-0038-82 , Invitrogen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescently labeled secondary antibodies were diluted 1:500 in PBS-T as follows: single labeling: Alexa 594 (anti-mouse, ab150108 Abcam); double labeling: AlexaFluor 594 (anti-mouse, ab150108 Abcam)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Abcam Cat# ab150108, RRID:AB_2732073)</div></div><div style="margin-bottom:8px"><div>anti-mouse ,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collection: Demographic and clinical variables (as summarized in Tables 1 and 2) were obtained from the electronic medical record (EMR) and recorded in a secure, de-identified RedCap Database (https://www.project-redcap.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RedCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative Image Analysis: Image area and integrated density were measured via ImageJ software (imagej.net) for each immunofluorescent 200× image (n=5/slide) along with mean fluorescence values from 5 randomly selected background readings per image cohort were used to calculate a corrected total cell fluorescence (CTCF) per published protocols (Taglauer et al., 2020; Benarroch et al., 2021; Kenan et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using R version 3.6.1 (https://www.r-project.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All laboratory statistical analysis was performed using Prism 9 software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The current study has several limitations. First, we only had access to basic clinical demographic data from the retrospective cohort, and it is possible that the women had severe COVID-19 disease as these tissues were collected during the first-wave of COVID-19, limiting the generalizability of these results. Importantly, the findings of increased macrophages and NK cells were replicated in our third-trimester group in the prospective, fully-consented cohort study with contemporary controls. A limitation in the prospective cohort study is the small sample size collected from a single clinical site. Taken as a whole, these results demonstrate that immune cell infiltrates in the placenta following COVID-19 are driven by timing of infection during gestation. While additional studies are required to more fully evaluate the immune profile in pregnancies affected by maternal COVID-19, these data provide early evidence supporting the role of decidual leukocytes in the physiologic response against SARS-CoV-2 at the maternal-fetal interface.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.20.469369
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266297

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266297: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">From our pool of positive samples 185 were randomly selected for the mutation panel assay following the assay workflow (Figure 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA extraction: RNA was extracted from 200 µl of patient sample using the Thermo Fisher MagMax Viral/Pathogen II Nucleic Acid isolation kits with MagMax magnetic beads and MS-2 phage internal control, using the automated Thermo Fisher Kingfisher Flex Magnetic Particle Processor (11).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher MagMax</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Thermo Fisher Kingfisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Designing a Genotyping Panel for the Mutation Assay: TaqMan probes specific to SNPs found in variants known to be circulating widely within the United Kingdom around March-May 2021 were used in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mutation Assay</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, previous studies have discussed there are limitations due to sequence drop-out when used to identify specific key mutations (18, 19, 20, 21). Nanopore sequenced long-reads can be susceptible to errors where identifying specific mutations may be problematic. These allelic drop-outs potentially affect PCR-based (tile amplicon) targeted sequencing, thus resulting in incomplete genome coverage, especially at lower amounts, resulting in the loss of both 5’ and 3’ regions that fall outside primer binding positions. The presence of SNPs in the forward and / or reverse primer binding sites may lead to complete or partial lack of amplification. For the study presented here, we demonstrated that genotyping has two major functions. 1) Genotyping is a powerful additional, more in-depth assay for identifying specific mutations and has real clinical health value allowing laboratories to report and action VOC much quicker than genome sequencing. 2) Genotyping is an excellent additional complement to the already powerful tool of genome sequencing already proven for assigning lineages via phylogenetic trees. Our data confirms that SARS-CoV-2 genotyping is essential for real-time identification of VOC here now and tracking those that emerge for informing public health strategy.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266297
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266824

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266824: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266824
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.25.21266090

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.25.21266090: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The rater was thus not blinded to the identity of a dataset as acquired or synthesized, but the rater was blinded to the lesion ratings performed by the neuroradiologists and the cortical volumetric data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A trained data analyst with FreeSurfer expertise (H.J.F.) performed four visual QA ratings per dataset: left and right hemisphere surface and left and right subcortical segmentation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeSurfer</div><div>suggested: (FreeSurfer, RRID:SCR_001847)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.25.21266090
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469860

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469860: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For secondary (P2) virus stock, Vero E6 cells seeded into 25 cm2 tissue culture flasks were infected with 0.5 mL of P1 stored aliquot, and infected cells and supernatant were collected 48 hours post-infection and stored at −80° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection experiments: Caco2 and CaLu3 cells were seeded on 25 cm2 tissue culture flasks until 80% confluency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaLu3</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469860
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469813

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469813: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo antiviral activities of NV-CoV-2: Dose-response of NV-CoV-2 in rats infected with CoV-NL63: Male and female Sprague Dawley rats, 8 to 9 weeks old, were infected with 104 Cov- NL63 viral particles directly into the lungs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The biotinylated detection antibody, 5G8-Biotin, used in this assay has been shown to be specific to NV-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>5G8-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen (NV-CoV-2) is first immobilized onto each well of a 96-well assay plate and then incubated with diluted subject serum samples or positive control, normal serum spiked with rat Anti-NV-CoV-2 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen (NV-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound Anti-NV- CoV-2 antibody is then detected by incubating with 1:1 mixture of HRP-conjugated Goat Anti- Rat IgG and IgM antibodies and quantitated with a chromogenic HRP substrate (TMB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-NV- CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, LLC-MK2 cells (for CoV NL63 virus) and MRC-5 cells (for CoV 229E virus) were plated in 96-well black, clear bottom plates at a density of 30,000 cells per well in 100 μl media for 24hr prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LLC-MK2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo antiviral activities of NV-CoV-2: Dose-response of NV-CoV-2 in rats infected with CoV-NL63: Male and female Sprague Dawley rats, 8 to 9 weeks old, were infected with 104 Cov- NL63 viral particles directly into the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Effect of Number of Days of Dosing of NV-CoV-2 in Rats Infected with CoV-NL63: Male and female Sprague-Dawley rats, 8 to 9 weeks old, were infected with 2 x 104 Cov- NL63 viral particles directly into the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague-Dawley</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following parameters were analyzed using the Ponemah 5.20 SP9 and ECG Analysis Module v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ponemah</div><div>suggested: (Ponemah, RRID:SCR_017107)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469813
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.25.21266866

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.25.21266866: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Understanding Society has ethical approval granted by the University of Essex Ethics Committee and further approvals were not necessary for this secondary data analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We then fitted three mixed–effects generalised logistic regression models with a random intercept for each individual participant, to assess the odds of GHQ-12 caseness by exposure groupings (industry, social class, and occupation).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Covariates: We adjusted for potential confounders that might differentially affect change in mental health across employment groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study strengths and limitations: Our study has several strengths. We used a large nationally representative longitudinal dataset to examine differences in psychological distress during the COVID-19 pandemic across industries, social class groups, and occupations, which fills an important gap in the literature. Our analysis included pre-pandemic outcome measures and six surveys of data collection after the start of the pandemic, and therefore we were able to examine trends before and after the initial lockdown. We also explored multiple dimensions of employment and explored heterogeneity across population groups. Some limitations should be noted. First, while estimates were weighted to adjust for survey non-participation there may still have been some residual bias, as response rates in the COVID surveys were lower than usual. Second, there were changes in the modality of administration of the COVID-19 surveys compared to pre-pandemic surveys (from mixed mode: face-to-face/web/phone, to online), which may have made modest contributions to the changes reported. However, empirical investigation suggests this is unlikely to have biased responses (32). The pandemic context may have also influenced participant reporting more broadly. Furthermore, we need to be cautious as observations in some industries (Agriculture, Forestry and Fishing: N=342; Mining, Energy and Water Supply: N=744 and Real Estate Activities: N=485) were much lower than in others reducing the precision of estimat...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.25.21266866
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266837

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266837: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: Our study is a contemporary, national perspective on patterns of antidepressant use by age and sex, generating insights for mental health services planning. Our analysis of the first year of COVID-19 in Australia identifies the population subgroups most affected by the pandemic, looking beyond the initial stockpiling effects in the early months of the pandemic and considering the impact of population estimate uncertainty on rates of antidepressant use. The main limitations of this study are related to the scope of PBS data. The lack of information on reasons for prescription means antidepressants could have been prescribed for conditions other than anxiety and depression. This is particularly relevant for SNRIs and TCAs, commonly used to treat pain. In addition, since PBS data do not include private and inpatient prescriptions in public hospitals, we underestimate the population-level use of antidepressants. Additionally, due to the drug utilisation design of the study, we provide limited insight into the course of treatment at an individual rather than population level. Finally, our findings are likely only generalisable to other jurisdictions where the circulation of SARS-CoV-2 was limited. We also expect differences in later Australian data due to the higher case numbers and extended lockdown in 2021.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266837
www.medrxiv.org www.medrxiv.org

Anatomy of the first six months of COVID-19 Vaccination Campaign in Italy

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266820: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We model the variations in contacts induced by non-pharmaceutical interventions at workplaces and in the community settings using data from the COVID-19 Community Mobility Report published by Google [20].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The present work comes with limitations. First, the compartmental setup used to model disease progression is a relatively simple one compared to other approaches that consider, for example, also the pre-symptomatic and asymptomatic stages of the infection [36, 37]. Nonetheless, it has been previously used in several works in the context of COVID-19 modeling [22, 38–40]. Second, both the vaccination protocol and the effect of vaccines on disease progression are an approximation of reality [41]. For simplicity we considered, besides the wild type, only one additional virus strain, although we acknowledge that the Alpha variant was not the only variant of concern circulating in Italy during the period considered [42]. Beside the importation data from GLEAM, we model each region separately, thus neglecting the coupling between them via different forms of mobility. Finally, in the counterfactual scenarios we considered all individuals willing to receive vaccines. While the current vaccination rates in Italy show a high vaccine acceptance (81.5% of the population 12+ completed the vaccination course and 85.7% received at least one dose as of 2021/10/19 according to official sources [43]), this is an optimistic assumption. In the Supplementary Information we relax this and we study the effect of vaccine hesitancy. We measured the effects of vaccines respect to a baseline that considers the observed contact patterns during the rollout. As mentioned above, the resurgence of infections...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266820
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266396

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266396: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266396
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266757

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266757: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266757
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266831

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266831: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.11.24.21266831v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266812

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266812: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was waived, as all data were deidentified.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were tested [17] for anti-SARS-CoV-2 antibodies using one of the following three qualitative assays issued emergency use authorization by the FDA that were in use in the clinical laboratories: 1) Architect™ SARS-CoV-2 IgG Assay (nucleocapsid (N) protein; Abbott, Chicago, IL), 2) VITROS® Anti-SARS-CoV-2 IgG Assay (S protein; Ortho-Clinical Diagnostics, Raritan, NJ), and 3) Elecsys® Anti-SARS-CoV-2 Assay (N protein; Roche, Indianapolis, IN) (Supplementary figure 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among 84,683 total serum samples collected during July 27, 2020-August 27, 2020 identified as anti-SARS-CoV-2 antibody positive and had linked age and sex information (as part of the larger serosurveillance study) [17], 3067 serum specimens were selected by convenience sampling for reflex testing with anti-SARS-CoV-2 quantitative IgG and neutralizing antibody assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 quantitative IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calibration of the PhenoSense CoV Neutralizing Antibody Assay® with the First WHO International Standard for Anti-SARS-CoV-2 Immunoglobulin (20/136, National Institute for Biological Standards and Controls, UK) [9] allowed us to generate a calibration factor of 0.0653 (S protein containing G614) and convert NT50 values from titers to international units per mL (IU/mL) by multiplying by the calibration factor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 Immunoglobulin (20/136</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison of Study Antibody Data to Antibody Concentrations Associated with COVID-19 VE: Of the COVID-19 vaccines in use around the world currently, serological correlates of protection thresholds associated with VE have been estimated for ChAdOx1 [11] and mRNA-1273 [12] using the First WHO International Standard for Anti-SARS-CoV-2 Immunoglobulin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 Immunoglobulin.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-hoc Tukey’s tests were performed to identify previous qualitative antibody tests and age categories with significantly different anti-SARS-CoV-2 RBD IgG and NT50 concentrations; p-values were adjusted to account for multiple comparisons.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 RBD IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were tested [17] for anti-SARS-CoV-2 antibodies using one of the following three qualitative assays issued emergency use authorization by the FDA that were in use in the clinical laboratories: 1) Architect™ SARS-CoV-2 IgG Assay (nucleocapsid (N) protein; Abbott, Chicago, IL), 2) VITROS® Anti-SARS-CoV-2 IgG Assay (S protein; Ortho-Clinical Diagnostics, Raritan, NJ), and 3) Elecsys® Anti-SARS-CoV-2 Assay (N protein; Roche, Indianapolis, IN) (Supplementary figure 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Data management tasks, and statistical analyses were performed using SAS version 9.4 (SAS Institute Inc., Cary, NC) and GraphPad Prism 9.0.0 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, due to the absence of information on whether persons had symptoms or if testing had been done or, if so, the date of COVID-19 symptom onset and/or a positive SARS-CoV-2 qRT-PCR or antigen test, we were unable to calculate the number of days that had elapsed between infection and collection of serum for antibody testing and thus the measurements might not reflect peak antibody concentrations. The ChAdOx1 and mRNA-1273 VE trials measured serum antibody concentrations 28 days after the second vaccine dose, presumably at the peak of the measurable humoral immune response to the vaccine. Therefore, if the sera used in this study were collected >28 days after SARS-CoV-2 infection, it is possible that the percentage of persons with antibody concentrations meeting or exceeding those concentrations associated with 70% and 90% COVID-19 VE were underestimated. However, as a result of the sharp rise in COVID-19 cases in the United States in mid-June 2020 (Supplementary Figure 2) [21], >50% of cases reported in the country prior to July 27, 2020 (date first specimens used in this study were collected) occurred after June 15, 2020. This indicates that the majority of sera in this study were likely to have been collected within 73 days of SARS-CoV-2 infection, a time before IgG antibody concentrations would be expected to have significantly waned from peak post-infection levels [22]. Second, 13.6% of persons had anti-RBD IgG concentrations below the...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266812
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21266633

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21266633: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study received approval from local ethics committee of the ASST Spedali Civili Hospital, Brescia (NP 4067, approved 08.05. 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As main limitation of the present study, we did not evaluate the IgG antibodies title data for immunized patients, which might be associate with different degree of systemic and respiratory immune response to SASR-CoV-2 infection. We also acknowledged that the statistical models were limited by the small sample size and that multivariate analyses including prognostic factors or propensity algorithms need to be implemented in on-going multi-center prospective studies. Limitations notwithstanding, our findings argue for a beneficial role of vaccination beyond the prevention of the disease, that dramatically impact on clinical progression and outcomes in COVID-19 disease.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21266633
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266401

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266401: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  24 Our study comes with limitations, most importantly the potential for misclassification of the direction of transmission, the lack of inclusion of waning vaccine protection and the diversity of vaccines lineages and age groups in the dataset. To minimise the potential for misclassification we restrict the main analyses to only those putative transmission pairs where the there was no evidence against direct transmission based on phylogenetic distance (which was available for 63% of all putative transmission pairs) and where symptom onset in the contact did not pre-date that of the index case by more than 2 days. If residual misclassification between infector and infected remained this would re-attribute infection protection to transmission protection and vice versa. We also did not include waning of vaccine protection in our analyses26In the analysed dataset the longest reported time since vaccine receipt was 169 days. While some individuals in the analysis have since become eligible for booster vaccination over concerns of waning protection some of this potential effect will have been absorbed in our model in the age structuring because of the strong correlation between age and timing of vaccine eligibility as per vaccine roll-out strategy in the UK. Lastly, data collection spanned a period of multiple months during which Delta became the dominant strain in circulation in the UK and included participants vaccinated with two different vaccine products; thus requiring sub-str...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266401
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469695

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469695: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Human ACE2-A549 cells were grown to confluency and infected at an MOI of 0.1 in either DMEM with 2%FBS and 0.05mg/ml gentamicin, or in the same media containing 0.01µM, 0.1µM, 1µM or 10µM NHC by allowing virus to adsorb to cells in a volume of 100µl for one hour at 37°C, and then topping up to 500µl with the relevant media afterwards.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results In order to find the appropriate concentration range of NHC in hACE2-A549 cells, to investigate the effect on viral biology, Cell-titer Glo Assay (Promega) were used to measure % ATP production in cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primer-trimmed bam files were further analysed using DiversiTools (http://josephhughes.github.io/DiversiTools/) with the “-orfs” function to generate the ratio of amino acid change in the reads and coverage at each site of protein in comparison to the reference SARS-CoV-2 genome (MN908947.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiversiTools</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absolute IC50 values were calculated using GraphPad Prism 9, using a non-linear 4-parameter logistic regression in a dose-response curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, in-vitro systems have several limitations in comparison to live models of infection, so results should be interpreted with care, although the mechanism of action will be intra-cellular. Use of molnupiravir in a Syrian hamster model infected with SARS-CoV-2 resulted in a drop in viral load and reduced lung pathology compared to controls Treatment 12 hours post-infection resulted in a protective effect 12 but not at 24 hours post- infection. Further work is required to delineate the true treatment window of the drug in humans with mild to moderate disease. Anti-viral drugs are best given early in infection to reduce viral load. In-vivo ferret models have shown that severity is linked to the size of the viral inoculum18. Therefore, molnupiravir likely acts to reduce disease by reducing viral load in patients, and potentially subsequently reducing transmission. 10,12. One of the main benefits of molnupiravir as opposed to remdesivir is that it can be administered orally. However, as was seen with the Influenza anti-viral, Tamiflu, resistance to anti-virals can develop rapidly develop resistance is necessary, though it is likely that any adaptation for resistance will correspond with a reduction in fitness as seen with remdesivir 20. Use of molnupiravir would likely be most beneficial if used in combination with another treatment, preferably targeting a different part of the viral life cycle as has been used with success for HIV treatment. Finally, molnupiravir has broad ...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04746183</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">AGILE (Early Phase Platform Trial for COVID-19)</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469695
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266807

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266807: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Some limitations and uncertainties in this work have already been addressed, particularly those concerning the viral load and the dose-response relationship. However, there are a number of other aspects that increase uncertainty in it. Firstly, the models assume homogenous instantly mixed indoor air to simplify the estimate of a dose. This assumption is unlikely to be true in some spaces, especially in large spaces where the concentrations of virions in the air is likely be a function of the distance from the infected person. It is unclear at which space volume this assumption becomes less useful, but it is likely to be a few thousand cubic metres. The approach described in Section 2 only considers the far-field transmission of virus, and not near-field transmission, which is likely to be the dominant route of transmission. The concentration of the virus in aerosols and droplets per unit volume of air is several orders of magnitude greater closer to the infected person at distances of < 2 m [3, 9]. However, it is likely that the method of calculating the probability of viral load of infected people, P (L), is also important for the dose received by near-field transmission and should be explored further in the future. The distribution of viral load of an infected person around the median will affect the probability of transmission. We apply a log-normal distribution, see Section 2, but another, such as the Weibull distribution, will affect the transmission probabi...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266807
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21264092

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21264092: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were collected by qualified workers of BMSA Group and analyzed by Orthin laboratory or Laboratorio Imagen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imagen</div><div>suggested: (IMAGEN, RRID:SCR_016045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has the natural limitations of non-experimental studies; there was no control over the variables involved (like the virus exposure, comorbidities, health status, etcetera, of the addressed population). In this sense, the study does not have high accuracy. The fact that the highest number of confirmed cases in sample 2 are from males does not necessarily imply that they are more vulnerable to SARS-CoV-2; the population of the set of companies is predominantly males. Data from the Mexican population also show that number of confirmed males is higher than those of females, no matter the total population is composed mainly of females (19). Using the chi-square test, we evaluate the differences in the proportions by age and gender that the two samples (or different subsets) have with the Mexican population to determine their representativity. In the cases representative of the Mexican population, we evaluate the relation of test result (confirmed or negative) with gender (and age) by the chi-square test of independence. We interpret the dependence between those variables as dependence in vulnerability to SARS-CoV-2 infection, a vulnerability that includes several factors such as the social, biological, economic, and cultural, by example. Hence, independence between such variables means independence in the vulnerability to SARS-CoV-2 infection. 4.1 Analysis by gender: For sample 1, the difference in proportions by gender of applied tests (48.2% of males and 51.8% of femal...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21264092
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.22.469642

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.469642: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV nucleocapsid (N) antibody (clone 1C7C7) (kindly provided by Thomas Moran, Icahn School of Medicine at Mount Sinai, New York, NY), conjugated to AlexaFluor 647 was diluted 1:400 in perm-wash buffer, and added directly to samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV nucleocapsid ( N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocked coverslips were incubated with mouse anti-SARS-CoV N antibody (clone 1C7, 1:500 in 4% BSA PBS) overnight at 4C, washed three times with PBS, and incubated for 45 minutes with 1:500 AlexaFluor 488-conjugated anti-mouse (Invitrogen A11001, 1:500 in 4% BSA PBS) plus DAPI (Thermo Fisher Scientific D1306, 1:1000 in 4% BSA PBS) at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All SARS-CoV-2 propagations and experiments were performed in a Biosafety Level 3 facility in compliance with institutional protocols and federal guidelines. scRNAseq: For scRNAseq experiments, Vero-E6 cells in 6 well plates were infected with SARS-CoV-2 at a MOI of 0.1, or with an equivalent volume of control media, in reduced-serum media (2% FBS) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: Vero E6 were seeded in 6-well plates (Falcon REF-353046) with one coverslip (Fisher Scientific 12-550-143) per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fastq files for 5′ libraries sequenced with the extended R1 strategy were generated using bcl2fastq v2.20.0 (Illumina, Inc)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, containing cDNA sequence, using a customized Python/3.7.3 script (available at github link pending) as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python/3.7.3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These were downloaded from the UCSC Genome Browser Table Browser(47) after filtering for TRS-dependent transcripts and score > 900 and exporting to gtf format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSC Genome Browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This SARS-CoV-2 reference was appended to the host ChlSab1.1 Ensembl reference. scCoVseq: To unambiguously assign and quantify scRNAseq reads to SARS-CoV-2 RNAs, the cellranger output BAM was filtered for reads mapping to SARS-CoV-2 or ChlSab1.1 references using samtools (version 1.11)(48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Scaled SARS-CoV-2 UMI expression of 600 sampled cells were clustered with five methods (k means clustering, hierarchical/Ward clustering, DIANA, mixture model-based clustering, and k medoids clustering) using the clValid (version 0.7) package(53).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clValid</div><div>suggested: (clValid , RRID:SCR_014626)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression was performed with edgeR using a generalized linear model quasi-likelihood F test adapted with a term for gene detection rate(55, 56).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed genes with an absolute log2 fold change greater than or equal to 1 and false discovery rate less than 0.05 were considered significant and subject to KEGG enrichment analysis using the KEGG annotations for African Green Monkey as implemented in the edgeR function kegga.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 sgmRNA Junction Sites: We explored the ability of our extended R1 sequencing to detect SARS-CoV-2 sgmRNA junctions using STARsolo (version 2.7.8a)(57)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STARsolo</div><div>suggested: (STARsolo, RRID:SCR_021542)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all viral infections, analysis was performed with FlowJo software (version 10.7.1, Becton Dickinson), excluding cell doublets and debris and gating according to mock infected populations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  It should be noted that there are some limitations to our study. With our dataset, we are unable to know the true infection state of a cell processed for scRNAseq, and therefore we cannot assess the true accuracy of our method to classify infected cells. An additional limitation of our method is that quantification of viral genes with scCoVseq is dependent on accurate annotation of viral RNAs. We derived our annotation based on published empirically-defined TRS-dependent RNAs(12), but this does not preclude the existence of other viral RNAs at time points or in cell types not studied. Importantly, we explicitly exclude TRS-independent RNAs from our analyses. Methods such as STARsolo(57) or sequencing 10X libraries with long-read sequencing(61) may allow for detection and quantification of viral RNAs without reference annotation and irrespective of TRSs.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.22.469642
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469714

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469714: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a control, a same number of cells were stained with BV421 anti-hCD45 antibody (Biolegend, #368522) and the top 3% of the BV421-positive cells were sorted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hCD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the cells were washed two times and resuspended in FACS buffer containing the secondary antibodies at a 1:1000 dilution: AF647-labeled donkey anti-goat IgG (Invitrogen, #A32849) or AF488-labeled goat anti-rabbit IgG (Invitrogen, #A32731).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF647-labeled donkey anti-goat IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-human IgG Fc secondary antibody was used to detect the bound ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To compare GFP expressions in ACE2- and LRRC15-positive cells, pseudovirus-infected cells were stained for surface ACE2 and LRRC15 as described above with following secondary antibodies: AF405-labeled donkey anti-goat IgG (Invitrogen, #A48259) and PE-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch, #711-116-152)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF405-labeled donkey anti-goat IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-labeled donkey anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with recombinant anti-LRRC15 antibody (Abcam, #ab150376) and SARS-CoV-2 spike antibody [1A9] (GeneTex, #GTX632604) at 1:100, followed by incubation with 1:500-diluted Alexa Fluor 555 conjugated goat anti-rabbit IgG antibody (Abcam, #ab150078) and 1:200-diluted Alexa Fluor 488 conjugated goat anti-mouse IgG antibody (Abcam, #ab150117) for 60 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-LRRC15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab150117, RRID:AB_2688012)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For A375 cells, 5 µg/mL blasticidin (Gibco, #A1113903) and 1 µg/mL puromycin (Gibco, #A1113803) were added as appropriate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-dCas</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">7.8 x 107 A375-dCas cells were transduced with the CRISPRa library at ~0.3 MOI to make 2.4 x 107 transduced cells, which is sufficient for the integration of each sgRNA into ~500 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375-dCas</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 8 x 106 HEK293T cells were plated in 10-cm tissue culture dishes and transfected using Lipofectamine2000 (Invitrogen) with plasmids encoding different CoV spike proteins or VSV-G protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For 1:1 ratio co-culture, 1 x 104 HeLa-ACE2 cells and 1 x 104 HeLa or HeLa-sgLRRC15 cells were plated per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa-sgLRRC15</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopic analysis: 8 x 103 HeLa-ACE2 cells and 3.2 x 104 HeLa or HeLa-sgLRRC15 cells (1:4 ratio) were co-plated per well in 8-well chamber slides (Nunc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-dCas9-VP64-Blast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stable ACE2 expressing HeLa cells (HeLa-ACE2) were generated by transducing HeLa-dCas cells with pLENTI_hACE2_HygR (Addgene, #155296) followed selection with hygromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLENTI_hACE2_HygR</div><div>suggested: RRID:Addgene_155296)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ectopic expression of LRRC15, a lentiviral vector pCDH-MSCV-T2A-Puro (System Biosciences, #CD522A-1) was modified to enable zeocin selection instead of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-MSCV-T2A-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A codon-optimized LRRC15 ORF was cloned into pCDH-MSCV-T2A-Zeo with a C-terminal 3xFLAG tag and used to transduce HeLa-ACE2 followed by zeocin selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-MSCV-T2A-Zeo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sgRNAs were cloned into pXPR_502 (Addgene, #96923) with assistance from the Genome Engineering and iPSC Center (GEiC) at Washington University in Saint Louis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pXPR_502</div><div>suggested: RRID:Addgene_96923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene, #170448) and VSV-G (Addgene, #12259) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of genetically modified cell lines: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACATGCAGGCACTGCACTG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min incubation at 4°C, the cells were washed two times, fixed with 4% formaldehyde for 15 min and washed and resuspended in FACS buffer before analyzing by flow cytometry using FACSCelesta (BD Biosciences) or Cytek</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytek</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed with Flowjo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 9 software was used to perform nonlinear regression curve-fitting analyses of binding data to estimate dissociation constants (KD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To compare LRRC15 expression in lung cell lines infected with SARS-CoV-2 vs mock controls [61], we accessed the raw count data from GSE147507 and performed differential expression analysis using DESeq2 as above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was determined using GraphPad Prism 9 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469714
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469765

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469765: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rabbit polyclonal antibody against SARS-CoV-2 SP/RBD (Cat# 40592-T62) or human SARS-CoV-2 S-NTD antibody (E-AB-V1030) was obtained from Sino Biological or Elabscience.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SP/RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse monoclonal antibody (1A9) against SARS-CoV-2 SP-S2 (Cat# ab273433) was obtained from Abcam.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Abcam Cat# ab273433, RRID:AB_2891068)</div></div><div style="margin-bottom:8px"><div>SP-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-HIVp24 monoclonal antibody was described previously (Ao et al., 2007; Qiu et al., 2011)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-HIVp24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human ACE2 antibody (sc-390851) was obtained from Santa Cruz Biotechnology Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human ACE2 antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-human ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPΔCwt/mutant expression in the different transduced A549 cells was evaluated by WB using an anti-RBD antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus production and infection experiments: SARS-CoV-2 SPΔC pseudotyped viruses (CoV-2-SPΔC-PVs, CoV-2-SPΔCG614-PVs and CoV-2-SPΔCDelta-PVs) or pseudotyped virus-like particles (VLPs) were produced by transfecting HEK293T cells with pCAGGS-SPΔCWT, pCAGGS-SPΔCG614 or pCAGGS-SPΔCDelta and pCMVΔ8.2 with or without a Gluc-expressing HIV vector ΔRI/E/Gluc (Ao et al., 2021a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the infection ability of SARS-CoV-2 SPΔC pseudotyped VPs, equal amounts of each SPΔC-PVs stock (as adjusted by p24 levels) were used to infect A549ACE2, Calu-3 cells, human MDMs or MDDCs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of different SPΔC-expressing A549 stable cell lines: Production of lentiviral vectors expressing different SPΔC: 293T cells were cotransfected with pEF1-SPΔCwt, pEF1-SPΔCG614 or pEF1-SPΔCDelta with packaging plasmid Δ8.2 and VSV-G expressing plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, each produced lentiviral particle was used to transduce A549 cells, and the transduced cells were selected with puromycin for one week.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For syncytium formation of the stable cell line, A549-SPΔCWT or A549-SPΔCDelta cells were detached with 0.05% trypsin and mixed with A549 or A549ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-SPΔCDelta</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid constructs: The SARS-CoV-2 SP protein-expressing plasmids (pCAGGS-nCoVSPΔC and pCAGGS-nCoVSPΔCG614) were described previously (Ao et al., 2021a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-nCoVSPΔC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-nCoVSPΔCG614</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene encoding SPΔCDelta or SPΔCDelta-PD was synthesized (Genescript) and cloned into the pCAGGS plasmid, and each mutation was confirmed by sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pEF1-SPΔCwt, pEF1-SPΔCG614 or pEF1-SPΔCDelta was constructed by inserting the cDNA encoding SPΔCwt, SPΔCG614 or SPΔCDelta through the BamHI and NheI sites into the pEF1-pcs-puro vector (Ao et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEF1-SPΔCG614</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEF1-pcs-puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-C-mGFP-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus production and infection experiments: SARS-CoV-2 SPΔC pseudotyped viruses (CoV-2-SPΔC-PVs, CoV-2-SPΔCG614-PVs and CoV-2-SPΔCDelta-PVs) or pseudotyped virus-like particles (VLPs) were produced by transfecting HEK293T cells with pCAGGS-SPΔCWT, pCAGGS-SPΔCG614 or pCAGGS-SPΔCDelta and pCMVΔ8.2 with or without a Gluc-expressing HIV vector ΔRI/E/Gluc (Ao et al., 2021a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SPΔCWT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-SPΔCG614</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-SPΔCDelta</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMVΔ8.2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of different SPΔC-expressing A549 stable cell lines: Production of lentiviral vectors expressing different SPΔC: 293T cells were cotransfected with pEF1-SPΔCwt, pEF1-SPΔCG614 or pEF1-SPΔCDelta with packaging plasmid Δ8.2 and VSV-G expressing plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEF1-SPΔCwt</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEF1-SPΔCDelta</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence assay: 293T cells transfected with various SARS-CoV-2 SPΔC-expressing plasmids were grown on glass coverslips (12 mm2) in a 24-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPΔC-expressing</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis of cytokine levels, including the results of GLuc assay, Luciferase assay, and various cytokine/chemokines assay, were performed using the unpaired t-test (considered significant at P≥0.05) by GraphPad Prism 9 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469765
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469770

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469770: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469770
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266735

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266735: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 molecular surveillance program sequences whole virus genomes of randomly selected SARS-CoV-2 positive specimens from both community testing (via PHS) and hospitals, using a proper nationwide geographical distribution.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GridION data was analyzed to get consensus genomes, with the SARS2seq pipeline and additional manual curation24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2seq</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations of our study need to be addressed. Asymptomatic or mild cases with low viral load are less likely to be identified and only detectable infections can be sequenced and included. In addition, sequencing is more successful in samples with low to medium Ct values (high to medium viral load). If infection with Beta, Gamma or Delta leads to lower Ct values than Alpha and Ct values are higher for infections after vaccination30–32, this could have led to an overestimation of the studied association. Another limitation is that prior infections could go undetected, especially if occurred during the first wave when there was no mass scale testing capacity. This could lead to an underestimation of cases with a previous infection, as we do not directly measure pre-existing infection-induced immunity. In conclusion, our results confirm a lower vaccine effectiveness against infection for the Delta variant, and similarly the Beta and Gamma variant, compared to Alpha. This effect was largest early after complete vaccination. These findings are informative for considerations on vaccine updates, future vaccination and pandemic control strategies.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266735
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266682

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266682: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses: The data were transcribed by interviewers, while the transcripts were analyzed using NVivo version 12 by NS and AG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NVivo</div><div>suggested: (NVivo, RRID:SCR_014802)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has several limitations, and thus the results should be interpreted with caution. The study has used a qualitative design, with the results based on viewpoints of 88 purposely selected participants; therefore, the results cannot be generalized. However, we argue that the insight provided by the participants is of high relevance in providing tailored services to different immigrant groups, and for future research. Furthermore, participants were partially recruited from a resource group that serves as a breach between health institutions and immigrants, and who provide Covid-19 information to their respective communities in their local languages. Consequently, the information they provided may be partially influenced by their frustration with community members who do not listen and act upon the information provided. However, the interviews were conducted by researchers with a strong competence on migration and health, as well as prior experience with qualitative interviews. Therefore, we are confident that the data were collected professionally, with limited participant- and researcher-related bias. Despite the limitations, the research described in this paper has two main implications. First, the study found that socio-economic factors such as overcrowding households negatively affect an immigrant’s ability to adhere to Covid-19 preventive measures. Overcrowding is a risk factor for various types of ill health, including both somatic and mental health. To reduce the ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266682
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266741

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266741: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study data were collected and managed using REDCap electronic data capture tools hosted at Centro de Investigación Biomédica en Red (CIBER) [57, 58] (Supplementary Note).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, a list of probe sets was removed based on poor cluster separation or excessive minor allele frequency (MAF) difference from The 1000 Genomes Project data (1KGP) [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1000 Genomes Project</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ancestry was then inferred with Admixture [63] using the defined 1KGP superpopulations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Admixture</div><div>suggested: (ADMIXTURE, RRID:SCR_001263)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the main results of both Spanish cohorts (SCOURGE and CNIO) for the overall and sex-stratified analyses were meta-analysed assuming a fixed-effects model using METAL [68].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>METAL</div><div>suggested: (METAL, RRID:SCR_002013)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VEP (https://www.ensembl.org/info/docs/tools/vep/index.html) and the V2G aggregate scoring from Open Targets Genetics (https://genetics.opentargets.org) were used to annotate the most prominent biological effects of the variants in the credible sets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ensembl.org/info/docs/tools/vep/index.html</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ROH calling: The ROH segments longer than 300 Kb were called in SCOURGE using PLINK 1.9 in the European QC-ed genotyped dataset (before imputation) with the following parameters: homozyg-snp 30, homozyg-kb 300, homozyg-density 30, homozyg-window-sn 30, homozyg-gap 1000, homozyg-window-het 1, homozyg-window-missing 5, homozyg-window-threshold 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PLINK</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04374279</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial to Promote Recovery From COVID-19 With Endocrine Thera…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04397718</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Hormonal Intervention for the Treatment in Veterans With COV…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04345887</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Spironolactone in Covid-19 Induced ARDS</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266741
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469842

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469842: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning, expression and purification of recombinant SARS-CoV-2 RBD protein: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCEP4</div><div>suggested: RRID:Addgene_16479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHHs coding sequences were PCR amplified and cloned into a pHEN1 phagmid vector (33)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the second round PCR nanobodies sequences were assembled together and amplified using pHEN1-F and pHEN1-R primers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN1-F</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHEN1-R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’) and pIII-R (5’ CTTTCCAGACGTTAGTAAATG 3’) primers according to the protocol of the BigDyeTerminator 3.1 Cycle Sequencing kit for the Genetic Analyzer 3500 Applied Biosystems (Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIII-R</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values were calculated using four-parameter logistic regression using GraphPad Prism 9 (GraphPad Software Inc, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned with MUSCLE (v3.8.31) (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.1/3.0 aLRT) (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphical representation and edition of the phylogenetic tree were performed with MEGA X (34).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469842
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266779

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266779: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human brain tissues: Post-mortem brain tissue specimens from individuals with severe COVID-19 were collected through an excess tissue waived consent protocol approved by the Mass General Brigham Institutional Review Board.<br>IRB: Human brain tissues: Post-mortem brain tissue specimens from individuals with severe COVID-19 were collected through an excess tissue waived consent protocol approved by the Mass General Brigham Institutional Review Board.<br>IACUC: BIDMC) Institutional Biosafety Committee (IBC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-seq analysis: For assessment of SARS-CoV-2 genome alignment: reads were aligned to the SARS-CoV-2 reference genome (NCBI reference sequence NC_045512.2) using bowtie2 v2.2.9 with options “-X 1000 --no-mixed”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For assessment of differential gene expression: raw sequencing reads were aligned to a reference transcriptome generated from the Ensembl v104 human transcriptome with salmon v1.4.0 using options “--seqBias --useVBOpt --gcBias --posBias --numBootstraps 30 -- validateMappings”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div><div style="margin-bottom:8px"><div>salmon</div><div>suggested: (Salmon, RRID:SCR_017036)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Length-scaled transcripts per million were acquired using the tximport v1.18.0 function, and log2 fold changes and false discovery rates (FDR) were determined by DESeq2 v1.30.1 in R. t-stochastic neighboring embedding analysis was performed using Rtsne v0.15, with counts transformed by the varianceStabilizingTransformation (VST) function from DESeq2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>Rtsne</div><div>suggested: (Rtsne, RRID:SCR_016342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps were generated using pheatmap v1.0.12 using VST-transformed counts, with further scaling across samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis: Signed -log10 FDRs from DESeq2 analyses were used to rank genes for gene set enrichment analysis via fgsea v1.16.0, filtering out genes with an FDR < 0.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Public gene sets used for analyses: Gene Ontology Biological Processes (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Ontology Biological</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We recognize limitations in our study design: the variability in illness duration, the imperfect quality of several samples (as previously reported in similar studies [16]), the modest number of subjects (12 cases and 12 controls), the lack of young COVID-19 subjects, and the specificity of our findings due to COVID-19. Despite these constraints, we were sufficiently powered to identify substantial transcriptome-wide changes between COVID-19 cases and controls, including among younger patients in our patient cohort. Furthermore, in addition to being age-matched, our experimental sample size is larger than previously reported COVID-19 brain transcriptome studies [16, 17, 30], enabling the identification of aging-associated gene expression signatures in our samples. Although our study does not examine the specificity of COVID-19-induced transcriptomic changes in the brain, the implications of our findings may readily extend to related pathologies. For instance, prior clinical trials have shown that cognitive impairment is observed in 55% of survivors of severe acute respiratory syndrome (SARS) 12 months after discharge [31]. Such behavioral observations suggest that similar molecular effects in the brain may be observed not only in severe COVID-19 but also in other conditions characterized by increased peripheral and central inflammation, severe hypoxic insults, and microvascular brain pathologies [1, 32]. Aging is a major risk factor for the development of cognitive deficits a...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266779
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469747

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469747: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target proteins were detected using the following antibodies: mouse anti-Strep tag II (Millipore Sigma: 71590); rabbit anti-Caspase 3 (Cell signaling: 9662); rabbit anti-Cleaved-Caspase 3 (Cell signaling: 9664) and mouse anti-GAPDH antibody (Cell signaling: 2118).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep tag II</div><div>suggested: (Abnova Cat# PAB16601, RRID:AB_10677207)</div></div><div style="margin-bottom:8px"><div>anti-Caspase 3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Cleaved-Caspase 3</div><div>suggested: (Affinity Biosciences Cat# BF0711, RRID:AB_2846190)</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and 293T cell lines were maintained in the high glucose Dulbecco’s modified Eagle’s medium (DMEM) (Corning Cat#: 10-017-CV) with 10% fetal bovine serum (FBS, Gibco Cat#: 100-438-026) and 100 U/mL Penicillin-Streptomycin (Gibco Cat#:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in Eagle’s Minimum Essential medium (EMEM) (Quality Biological Cat#: 112-018-101) with 10% FBS and 100 U/mL Penicillin-Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of Mammalian Cell-specific Activities: 2 x 104 293T or 1 x 104 A549 and Calu-3 cells/well were seeded into a 96-well plate and cultured at 37°C/5% CO2 overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the mammalian ORF3a study, a lentiviral constitutive expression vector pLVX-EF1alpha-IRES-Puro (Takara) that carries the ORF insert (provided by Dr. Nevan J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fission Yeast Plasmid Transformation and Inducible SARS-COV-2 Gene Expression: The SARS-COV-2 gene-carrying pYZ1N plasmids were transformed into a wild type fission yeast SP223 strain by electroporation (5, 57).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYZ1N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in Eagle’s Minimum Essential medium (EMEM) (Quality Biological Cat#: 112-018-101) with 10% FBS and 100 U/mL Penicillin-Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Pair-wise t-test or one-way ANOVA was calculated using software Prism 9 (GraphPad, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 24 and 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469747
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469775

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469775: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Infection was performed in 96-well plates (Nalge Nunc Int, Rochester, New York, USA) for 1 h at 37°C in 5 % of CO2.<br>IACUC: The experiments performed in this section were approved by the Committee on the Use of Laboratory Animals of the Oswaldo Cruz Foundation (CEUA-FIOCRUZ, license L003/21). 2.8.<br>IRB: In vivo assays – Mice treatment and infections: Experiments with transgenic mice expressing human ACE-2 receptor (K18-hACE2-mice), were performed in Animal Biosafety Level 3 (ABSL-3) multiuser facility, according to the animal welfare guidelines of the Ethics Committee of Animal Experimentation (CEUA-INCa, License 005/2021) and WHO guidelines [14].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: African green monkey kidney (Vero, subtype E6) and human lung epithelial (Calu-3) cells were cultured in high-glucose Dulbecco’s modified Eagle medium (DMEM - HyClone, Logan, Utah) supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin (P/S - Thermo Fisher Scientific®, Massachusetts, USA), and 10% fetal bovine serum (FBS - HyClone, Logan, Utah).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 B.1 lineage (GenBank #MT710714) and gamma variant (also known as P1 or B.1.1.28 lineage; #EPI_ISL_1060902) were isolated on Vero E6 cells from nasopharyngeal swabs of confirmed cases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytotoxic assays: Vero cells (2.0 × 104 cell/well) were treated for 3 days with different concentrations of ATV or RDV (ranging from 1 to 600 μM) as previously described by us [7,23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic assays: ATV’s concentration in the plasma and lungs of adult Swiss-Webster mice (8-15 weeks) was evaluated over time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Swiss-Webster</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: African green monkey kidney (Vero, subtype E6) and human lung epithelial (Calu-3) cells were cultured in high-glucose Dulbecco’s modified Eagle medium (DMEM - HyClone, Logan, Utah) supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin (P/S - Thermo Fisher Scientific®, Massachusetts, USA), and 10% fetal bovine serum (FBS - HyClone, Logan, Utah).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific®</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After fluorescence quantification, the Michaelis-Menten constant (Km) and maximum velocity (Vmax) were calculated by non-linear regression using GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The molecular docking calculations were performed with GOLD 2020.2 software (Cambridge Crystallographic Data Center Software Ltd., CCDC, CB2 1EZ, UK) [20].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It was defined 8 □ radius around the active binding site and the figures were generated with PyMOL Delano Scientific LLC software (DeLano Scientific LLC: San Carlos, CA, USA) [21]. 2.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All experiments were carried out at least three independent times, including a minimum of two technical replicates in each assay, and each data was analyzed from Prism GraphPad software 8.0 (Windows GraphPad Software, San Diego, California USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism GraphPad</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469775
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266734

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266734: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SNOMED, for example, is a standard vocabulary for conditions, while RxNorm codes are a standard vocabulary for drug exposures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RxNorm</div><div>suggested: (RxNorm, RRID:SCR_006645)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, hospitalisation data, from the conjunt mínim bàsic de dades de l’alta hospitalària (minimum basic set of hospital discharge data) collated by the Data Analysis Program for Health Research and Innovation (PADRIS) in Catalonia, was also linked at the individual-level.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Data Analysis Program</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: Much of the COVID-19 literature is based on studies where study populations have been drawn from people hospitalised with COVID-19, tested for infection, or who volunteered to participate in a study. Such studies can be subject to a number of biases, in particular collider bias which can lead to the reporting associations that do not exist for the general population or by attenuating, inflating or reversing the sign of true associations.30 This underscores the importance of developing comprehensive datasets to generate the reliable evidence required to inform decision-making related to the pandemic. With more than half a million outpatient cases of COVID-19 captured and a breadth of data capture that allows for comparisons with the general population and subsequent hospital care to be described, the mapped SIDIAP database described here is one such resource. While electronic health record data brings numerous opportunities, with the data collected for non-research purposes careful curation is required. Using a well-established common data model, meant that existing open-source tools could be used to evaluate data quality and that research studies can be run in a distributed manner. This has allowed the database to already have been used in a number of international network research studies, with standardised analytic packages and only aggregated results sets shared. One limitation of the dataset has been seen with the likely underreporting of COVID-...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266734
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266559

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266559: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After administering written informed consent, surveys were administered by research coordinators via an electronic tablet; participants could choose to read and respond to questions themselves or respond orally to questions read aloud.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Predictor variables included age group (18-29, 30-49, 50+), gender (man, woman, transgender person), race/ethnicity (Hispanic/Latinx, non-Hispanic Black, non-Hispanic White, non-Hispanic Asian, non-Hispanic other/unknown race), general trust (“Generally speaking, would you say that most people can be trusted?</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Survey data were recorded in a HIPAA-secure REDCap database [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. First, our retrospective chart review was restricted to data on vaccination in custody and did not include data on vaccination in the community following release. The chart review also excluded individuals who were in custody for under 26 days; future research should examine vaccine acceptance among those who are frequently admitted and released from custody as they may represent a uniquely vulnerable group and may facilitate COVID-19 transmission between jails and the community [28]. Next, the survey findings were limited by sample size and may not be representative of the entire jail population; they are also subject to limitations of self-reported data. Furthermore, although both chart review and survey enrollment occurred across several months, we did not have sufficient power to examine effects of calendar time on vaccine acceptance, as shown elsewhere [23]. While we attempted to infer factors underlying hesitancy and acceptance by linking survey responses with vaccination data, our understanding would be enhanced by more open-ended questions and qualitative data. Finally, these findings may have limited generalizability to the non-incarcerated population as well as to other carceral settings, as jails are often unique in culture, environment, and population.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266559
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266721

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266721: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266721
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266681

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266681: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for obtaining samples for groups 1 -4 was provided by the London – Camden and Kings Cross Research Ethics Committee reference 20/HRA/1817.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Group 3: Individuals without evidence of infection (absence of anti-N antibodies) who had received their second dose of BNT162b2 vaccine at least 28 days previously (DOUBLE VACC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-human secondary antibodies were added for 1 hr at RT: anti-IgGAM, neat (EACONJ654, The Binding Site), anti-IgM clone AF6, 1:2000, anti-IgG1 clone MG6.41, 1:3000, anti-IgG3 clone MG5.161, 1:1000 (all produced at the University of Birmingham).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated anti-human secondary antibodies were added for 1 hr at RT: anti-IgGAM, neat (EACONJ654</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG1</div><div>suggested: (Fitzgerald Industries International Cat# 61R-I161aPE, RRID:AB_1286147)</div></div><div style="margin-bottom:8px"><div>anti-IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, 50 µl COVID negative normal human serum (same source used throughout all assays, containing no detectable S or N specific antibodies as measured by IgGAM ELISA) at a dilution of 1:40 (in 2% BSA plus 5 mM calcium chloride and 5 mM magnesium chloride) was added to each well for 1hr at RT. 100µl of rabbit anti-C1q FITC antibody (Invitrogen PA5-16601) at a 1:200 dilution in PBS-0.1% Tween 20 was added and incubated at 37□C for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-C1q FITC</div><div>suggested: (Abcam Cat# ab4223, RRID:AB_304387)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti-human monoclonal complement antibodies (100ul, diluted in PBS-0.1% Tween 20) were added and incubated at 37□C for 1 hr: mouse anti-C4b, 1:22,500 (Invitrogen, LF-MA0198); mouse anti-C3b, 1:10,000 (Invitrogen MA1-70053); mouse anti-C5b, 1:10,000 (Invitrogen DIA 011-01-02).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human monoclonal complement</div><div>suggested: (Acris Antibodies GmbH Cat# LF-MA0198, RRID:AB_1874068)</div></div><div style="margin-bottom:8px"><div>anti-C4b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-C3b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-C5b</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293F cells were cultured in Freestyle 293 Expression medium (Fisher Scientific) and maintained at a density of 0.2 × 106 cells/mL at 37°C, 8% CO2 and 125 rpm shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was carried out using GraphPad Prism 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One caveat in this argument is that exogenous sources of complement in the form of sera from non-infected individuals were used in these studies and that patients own sera may differ in potency. This was not assessed here as the focus was on antibody-mediated activation of complement. Additionally, these assessments were made using sera from patients who were infected or immunized weeks previously and the antibodies present may not reflect the antibodies present at the time of infection. Certainly, it could be expected that the affinity of the antibodies would increase over time. One striking feature was the variability in the anti-C4b/C3b response detected in the VACC group. It is unclear why this is the case, but it could simply be that there is variability within the wider population in the ability to activate complement downstream. The complement cascade has been reported to be activated through multiple pathways after SARS-CoV-2 infection [19-21]. Amongst these, the engagement of the classical pathway is distinct to the non-antibody-dependent pathways due to the potential multiple roles antibody can play during the course of infection. If induced whilst an infection is ongoing, then the activation of the complement cascade by antibody could worsen disease, particularly as antibody responses become detectable concomitant with risk of severe disease. This could happen either through enhanced inflammation, such as observed during acute respiratory distress syndrome, or thro...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266681
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266540

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266540: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266540
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266713

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266713: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analysis was performed using a Student’s T-test (T-test) and Analysis of Variance (ANOVA) single factor with a p-value of < 0.05 using Origin(Pro), Version 2021b OriginLab Corporation, Northampton, MA, USA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OriginLab Corporation</div><div>suggested: (Origin, RRID:SCR_014212)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266713
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266692

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266692: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples were tested for nucleoprotein (N) antibodies as a marker of previous SARS-CoV-2 infection (Elecsys Anti-SARS-CoV-2 total antibody assay, Roche Diagnostics, Basel, Switzerland: positive ≥1 COI) and spike (S) protein antibodies, which could be infection-or vaccine-derived (Elecsys Anti-SARS-CoV-2 S total antibody assay, Roche Diagnostics: positive⍰≥⍰0.8 arbitrary units (au)/mL to assess vaccine response).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using STATA v.14.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266692
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266711

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266711: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approval was obtained from the ethics committee of the Berlin Doctors’ Council (reference ID Eth-33/20).<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The number of infections missed by the mandatory notification system was estimated in two ways: first internally, by estimating the proportion of seropositive cases that was unaware of the infection (Table 2) and second by comparing the seroprevalence observed in the study, adjusted for test characteristics, to the number of notified cases, adjusted for sampling density (Table 3 and Table S3).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standardized punches of DBS (DBS Puncher, PerkinElmer, Waltham MA, USA) were extracted according to the manufacturer’s protocol (Euroimmun AG, Lübeck, Germany) and tested for SARS-CoV-2 anti-S1 IgG antibodies using lots E200518BC (from Oct 12th to Dec 2nd, 2020) and E200831BC (from Dec 3rd, 2020 to end of study) of the Anti-SARS-CoV-2-ELISA (IgG) (Euroimmun AG, Lübeck, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG</div><div>suggested: (Imported from the IEDB Cat# 2E10, RRID:AB_2848047)</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2-ELISA ( IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both RKI laboratories have successfully participated in external quality assessments (EQAs) on the detection of SARS-CoV-2 genome and/or SARS-CoV-2 IgG antibodies, offered by INSTAND (INSTAND, Düsseldorf, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The overall infection status was considered positive if at least one of the three indicators (PCR result from the ONS, IgG antibody result from the DBS, or self-reported pre-study SARS-CoV-2 test) was positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with SAS 9.4 (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266711
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266673

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266673: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All convalescent volunteers gave their informed consent to the National Blood services of Magen David Adom.<br>IRB: The study was approved by the ethics committee of the Israeli Ministry of Health (0083-20-WOMC)[20].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples: Serum samples of BriLife® vaccinees were obtained from participants in a randomized, multi-center, placebo-controlled, dose-escalation phase II of an ongoing clinical trial, aimed to evaluate the safety, immunogenicity and potential efficacy of BriLife®, an rVSV-SARS-CoV-2-S vaccine (IIBR-100) in Adults (ClinicalTrials.gov - NCT04608305).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Vero clone E6 cells (Vero E6, ATCC CRL-1586(tm)) were grown in growth medium [Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), MEM nonessential amino acids (NEAA), 2 mM L-glutamine, 100 Units/ml penicillin, 0.1 mg/ml streptomycin, 12.5 Units/ml nystatin (P/S/N), all from Biological Industries, Israel].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero clone E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu3 cells (ATCC HTB-55) were grown in growth medium RPMI supplemented with 10% fetal bovine serum (FBS), MEM non-essential amino acids, 2 mM L-glutamine, 100 units per ml penicillin and 1% Na-pyruvate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant Vesicular Stomatitis Virus Indiana serotype (rVSV-WT) was propagated in Vero cells [1].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All virus stocks were tittered on Vero E6 cells by plaque assay as previously described [1].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera from BriLife® vaccinees or COVID-19 convalescent patients were heat inactivated (HI) (56 °C for 30 min), then diluted in twofold serial dilutions (between 1:20 and 1:1280) in 300 µl of infection medium, mixed with 300 µl of either 300 pfu/ml of SARS-CoV-2 original virus, each variant (alpha, beta, gamma or delta), or rVSV-WT, and incubated at 37 °C, 5% CO2 for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rVSV-WT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plaques in each well were numbered, and the serum dilution that neutralizes 50% of the virions (NT50) was calculated using GraphPad Prism 6 software (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04608305</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate the Safety, Immunogenicity and Potential Efficacy o…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266673
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266676

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266676: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Medical Review Ethics Committee of the Maastricht UMC+ confirmed that the Medical Research Involving Human Subjects Act (WMO) does not apply to the above mentioned study and that an official approval of this study by the committee is not required (METC reference number 2021-2838).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were performed using GraphPad Prism 9.0.0 software (GraphPad, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations were the fact that the number of reported breakthrough infections are an underestimation of the effective number, due to asymptomatic or mild cases or because of severe cases in local hospitals that were not reported to the regional public health service. Furthermore, asymptomatic cases were only followed up for a limited amount of time, possibly leading to the underestimation of symptomatic cases. Thirdly, only samples from cases with sufficiently high viral loads could be sequenced (<CT 32), leading to a limited dataset. Additionally, not all samples were available so some bias could have been introduced if unavailable samples were different than available samples. Lastly, the lack of immunological data, which could help to understand how breakthrough infections occur and why certain individuals experience severe symptoms. In summary, this study has investigated the distribution of breakthrough infections per vaccine type and variant over time in the South Limburg region of The Netherlands. It was found that breakthrough infections were more frequently observed in people who received Oxford-AstraZeneca or J&J/Janssen in comparison with recipients of the mRNA-based vaccines. Furthermore, the predominance of the Delta variant coincided with a rapid increase in breakthrough infections and severe cases were only observed in older individuals. Given that reduced vaccine effectiveness for the Delta variant has been reported by multiple studies, as well as the fact tha...</blockquote>
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266676
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266690

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266690: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design: We conducted a Phase 2, double-blind, randomized, placebo-controlled phase 2 trial at Stanford Healthcare, California. Stanford University School of Medicine Panel on Human Subjects in Medical Research approved the study protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Favipiravir and placebo tablets were identical in appearance to maintain blinding.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size determination: Assuming 1:1 randomization and a two-sided log rank test at alpha□=□0.04999 level of significance for the final analysis, we anticipated 79 shedding cessation events, which provided 80% power to detect a hazard ratio of 2.03.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study Design: We conducted a Phase 2, double-blind, randomized, placebo-controlled phase 2 trial at Stanford Healthcare, California. Stanford University School of Medicine Panel on Human Subjects in Medical Research approved the study protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stanford Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patients self-collected daily anterior nasal swabs on days 1-10, 14, 21, and 28 and submitted them directly for RT-PCR testing with an assay that targeted the viral nucleocapsid gene’s N1 and N3 regions (Quest Diagnostics, Secaucus, New Jersey).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quest</div><div>suggested: (QUEST, RRID:SCR_005210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patients also completed electronic daily symptom surveys and recorded temperature and oxygen saturation using study-provided devices; all data was collected using REDCap Cloud version 1.6 (REDCap Cloud, Encinitas, California).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Of note, in vitro data suggests molnupiravir may also be mutagenic to mammalian cells.[19] Animal studies suggest that favipiravir administered in combination with molnupiravir may be an effective strategy to allow for lower molnupiravir doses and potentially avoid unintended consequences.[20] Our study has several limitations. Most therapeutic studies for COVID-19, like ours, assess antiviral efficacy by using RT-PCR to detect viral RNA from nasal, nasopharyngeal or oropharyngeal swabs. However, detectable RNA may not reflect actively replicating virus and individuals can continue to have detectable RNA intermittently and long after illness recovery.[21] Widespread use of cell culture to detect replication-competent virus and to establish viral clearance is limited by feasibility, cost, and safety considerations.[21] Although we use cycle threshold rather than viral load, our analysis was strengthened by serial testing from individuals. Our primary endpoint was based upon participant-collected nasal swabs, which may be less accurate than nasopharyngeal swabs.[22] However, we found similar results from a secondary analysis of study staff collected oropharyngeal swabs. Our study was powered to detect differences in shedding cessation, not symptom resolution. Our study was not designed to detect a difference in long COVID syndrome, but we found that nearly half of both favipiravir and placebo-treated patients continued to report symptoms 28-day after enrollment. Finally, our st...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04346628</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Oral Favipiravir Compared to Placebo in Subjects With Mild C…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266690
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21264927

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21264927: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement and Sample Collection: Myongji Hospital Institutional Review Board (IRB) approved the use of surplus clinical samples for the NPS/OPS specimen-pooling (IRB No.: MJH 2020-12-028) and clinical performance evaluation (IRB No.: MJH 2020-12-029) tests.<br>Consent: Kangwon National University Hospital IRB approved the use of saliva and NPS/OPS samples for the clinical performance testing of the AccuPower® kits (IRB No.: KNUH-2021-03-014), which were either surplus samples or de-identified patient samples drawn after informed consent (Fig 1).<br>Field Sample Permit: Saliva samples were collected and stored using the Saliva Collection Kit (BIONEER, Korea), which was developed to collect, transport, and preserve saliva specimens for extraction of human genomic DNA, bacterial genomic DNA, and viral DNA/RNA for disease detection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MUSCLE alignment was generated by multiple sequence alignment and viewed in Jalview.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21264927
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266747

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266747: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided written consent during the recruitment stage and verbally restated their consent at the start of their interview.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Team members conducting interviews (four women, six men) had previously researched COVID-19 dashboards [32,50,51].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Confidentiality was assured by assigning each participating dashboard team a random code (e.g., D1) and removing identifying information from verbatim quotes used throughout the paper.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: The first authors analysed the translated interview transcripts to identify descriptive and explanatory themes using elaborative coding [57] and thematic analysis [58] in an Excel tool developed in the approach of Meyer and Avery [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study strengths and limitations: Working in partnership with WHO offered unique access to our target national governmental COVID-19 dashboard teams. The composition of the research team allowed for the use of an extensive range of languages during data collection, aiding recruitment and the richness of exchanges during interviews. The study captured COVID-19 dashboards at a critical point in their development, as teams were actively improving and making adjustments at the time of interviews. It means teams were still deeply immersed in the dashboards, making for little strain to recall processes of the prior year. We acknowledge the following potential limitations. First, the size and composition of core dashboard teams varied across countries/territories and brought some variability to the profile and number of persons met with per dashboard, and ultimately, the nature of their experience. Second, group interviews stimulated joint reflections across teams, enriching data collection, though this approach could also induce group pressure resulting in socially desirable responses. Third, the findings are a snapshot of the first year of the COVID-19 pandemic and may not reflect the current state of implementation. Lastly, the study included national, government COVID-19 dashboards of the WHO European Region and may not be generalizable to the experiences of subnational dashboards, other types of developers, such as academia, independent initiatives, media outlets, or industry, a...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266747
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21266561

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21266561: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Anti-SARS-CoV-2 vaccination was performed in all patients without a prior COVID-19 diagnosis and without signs of ongoing infection who provided written consent from March 24th to April 30th, 2021.<br>IRB: This study has been authorized by the local Ethical Committee of Emilia Romagna (n. 839/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This vaccine was found to be safe and efficacious (94.1%) in preventing symptomatic, laboratory-confirmed COVID-19 in a large, randomized-controlled trial7 and subsequent observational studies11,12.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using SPSS 24® statistical software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations of the study should be enunciated. The retrospective nature of the analysis and the small sample size could lead to unintended bias in the correct estimation of vaccine-related AEs. Measure of AEs magnitude was not collected in our patients, albeit none required acute hospital in-patient care after the administration of vaccine. Lastly, our study provides key information for healthcare workers to plan active surveillance on hemodialysis patients.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04470427</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate Efficacy, Safety, and Immunogenicity of …</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21266561
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266688

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266688: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved as a portion of the study FWR20190037N, reviewed and approved by the Air Force Research Laboratory’s Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This algorithm was used to generate a predicted severity score from 0 to 1 in the Python environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genomic sequences were first downloaded and aligned to the Wuhan reference strain (NCBI: NC_045512.2; GISAID: EPI_ISL_402125) using MiniMap2 (version 2.17) [Li, 2018].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiniMap2</div><div>suggested: (Minimap2, RRID:SCR_018550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned using MAFFT [Katoh 2002] and variants were called using SNP-sites [Page 2016].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used GraphPad Prism 7.0c for performing the t tests and Pearson’s correlation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266688
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469663

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469663: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469663
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21266484

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21266484: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The presence of SARS-CoV-2 nucleocapsid protein antibodies across the three test timepoints was explored via generalized linear mixed models with a logit link.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21266484
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266775

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266775: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. There are inconsistencies and biases in case reporting among states and provinces and across states. In addition, reported incidence is a function of the number of tests administered which can fluctuate over time. To reduce these testing and reporting biases, we scaled cases within each state and province to focus on the timing of the waves rather than their intensity. In addition, at the county level, the Gi* statistic incorporates the variability in a county and its neighbors, thus reducing the noise from any individual county. In addition, it is not yet possible to determine exactly how seasons have affected COVID-19 incidence. It is likely that human and virus factors interact differentially at various seasons shaping the epidemic’s waves. As future research investigates this complex relationship, we recommend that policies and decisions should seriously consider the seasonal patterns of COVID-19. This analysis shows that patterns of waxing and waning of COVID-19 incidence at the state and county level are driven by continental-scale seasonal and geographical patterns. This in turn suggests that future state and county level COVID-19 surges should be at least in part predictable, and therefore preventable.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266775
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.22.469552

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.469552: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-SARS-CoV-2 RBD antibody panel used (CC6.29, CC6.32, CC6.33, CC12.1, CC12.7) was a kind gift from Dennis Burton’s lab at Scripps and were produced and purified according to Rogers et al. (Rogers et al. 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection was enabled by addition of 100 µL Goat anti-Human IgG Fc secondary antibody conjugated to horseradish peroxidase (ThermoFisher #A18817), diluted 1:50,000 into PBSM and incubated in the above plate shaker for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A18817, RRID:AB_2535594)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein was quantified by absorbance at 280 nm using the theoretical extinction coefficient derived from the protein sequence when all four disulfide bonds are intact (WT: 33850 M-1cm-1, RBD6: 37860 M-1cm-1, RBD8: 37860 M-1cm-1, RBD10: 36370 M-1cm-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>M-1cm-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct plasmids pACL002-pACL006 and pACL009-pACL015 containing all RBD design sequences for yeast surface display, DNA sequences were ordered as gBlocks (IDT) and cloned into pETconV4 using restriction enzymes NdeI and XhoI (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACL002-pACL006</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pACL009-pACL015</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct plasmid pACL007, the wild-type RBD sequence was amplified from plasmid pJS699 using primers forward_pJS699_RBD_pETconV4 and reverse_pJS699_RBD_pETconV4 to add regions of pETconV4 homology surrounding the RBD sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACL007</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pJS699</div><div>suggested: RRID:Addgene_168779)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA sequences for plasmids pACL002-pACL006 and Design1_pETconV4-Design7_pETconV4 containing all RBD design sequences were ordered as gBlocks (IDT) and cloned into pETconV4 using restriction enzymes NdeI and XhoI (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETconV4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid pACL008 was created by inserting the BbvCI restriction enzyme site into the pACL005 plasmid using site-directed mutagenesis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACL005</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD designs to be tested further as soluble proteins were codon optimized for P. pastoris (IDT), ordered as gBlocks, and cloned into the pPICZαA secreted expression vector (ThermoFisher V19520) using EcoRI and SacII restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICZαA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD designs were produced recombinantly in Pichia pastoris as follows. pPICZα vectors (ThermoFisher V19520) containing WT RBD or RBD designs were linearized by SacI and greater than 5 μl were transformed into electrocompetent P. pastoris X-33 (ThermoFisher C18000) at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS: 1% w/v yeast extract, 2% w/v peptone, 2% v/v glucose, plus 1.0M sorbitol) supplemented with 100 μg/ml zeocin (ThermoFisher 25001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICZα</div><div>suggested: RRID:Addgene_78171)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These 90 positions were mutated to every other amino acid plus stop codon by comprehensive nicking mutagenesis (Wrenbeck et al. 2016) using NNK primers (Table S2) and template plasmid pACL008.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACL008</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD designs to be tested further as soluble proteins were codon optimized for P. pastoris (IDT), ordered as gBlocks, and cloned into the pPICZαA secreted expression vector (ThermoFisher V19520) using EcoRI and SacII restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>gBlocks</div><div>suggested: (Gblocks, RRID:SCR_015945)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Deep sequencing analysis: All deep sequencing data analysis was performed using the Protein Analysis and Classifier Toolkit (Klesmith and Hackel 2019) available at GITHUB (https://github.com/JKlesmith/PACT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GITHUB</div><div>suggested: (GitHub, RRID:SCR_002630)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The KD,app for each reaction was calculated using non-linear least squares regression performed using custom Python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gel bands were quantified using ImageJ software (Abramoff et al. 2004) to determine the relative density of each band, compared to the average of 3 control (no thermolysin) samples on the same gel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.22.469552
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469537

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469537: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell line and cultures: Human derived neuroblastoma cells (SH-SY5Y) were cultured in DMEM-F12 (Invitrogen) medium supplemented with 10% (v/v) fetal calf serum (FCS), 100 U/mL penicillin and 100 μg/mL streptomycin (Invitrogen, Carlsbad, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SH-SY5Y</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TANGO is an algorithm that predicts aggregation nucleating regions in unfolded polypeptide chains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TANGO</div><div>suggested: (TANGO, RRID:SCR_001770)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed by one way ANOVA tests with Tukey comparison in the software GraphPad (Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 9 and 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469537
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266759

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266759: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We analyzed provisional death counts for 2020 stratifed by four sociodemographic variables: 1) educational attainment (no college, some college, college graduate); 2) race and ethnicity (white non-Hispanic, Hispanic, Black non-Hispanic, Asian non-Hispanic, American Indian/Alaska Native non-Hispanic, Native Hawaiian and other Pacific Islander non-Hispanic, more than one race non-Hispanic, unknown); 3) gender (male, female, unknown); and 4) age group (25-39 years, 40-54 years, 55-64 years).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study Limitations and Public Health Data Gaps: It is likely that COVID-19 deaths in the U.S. have been undercounted (i.e., cause of death has been misclassified), and this misclassification is likely to be differential by social class, resulting in a bias toward the null in our estimates of social class disparities. Misclassification occurs when there is insufficient medical information available at the time of death. Lack of access to medical care and out-of-hospital mortality can result in the use of non-specific cause of death coding on death certificates. We have previously shown that the percent of all non-injury deaths coded to “symptoms, signs, and ill-defined conditions” increased from 2019 to 2020 among working age adults.50 A simple step toward improving COVID-19 surveillance data, which could be implemented immediately across a wide range of data systems, is to add one yes/no question to all individual adult patient encounter medical records: “Has this person completed one or more years of college?” A “no” response on this single data item would identify the working class. A follow-up question for those who replied “yes” (“Does this person have a 4-year college degree?”) would easily identify the three social classes analyzed in this study.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266759
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266669

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266669: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Simulation of an Unmitigated Epidemic: The simulations used an SEIRS model done using difference equations on a Microsoft Excel spreadsheet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  If the vaccine had realistic limitations, such as failure against a new variant, both the “optimistic” and “pessimistic” results would produce even higher case rates. So it might be said that the tables in this report are not a prediction of what will happen in reality; these case rates are the best that can be expected. On the other hand, there is reason to accept these results with caution. First, we must consider a general weakness of simulations. Assuming that they include the proper relationships and parameters, simulations estimate what would happen if a set of conditions is continued for the length of the simulation. We certainly hope that if the pessimistic scenario were in progress and case rates were escalating drastically, the parameters of the system would react and change--NPIs would be restored, vaccination speeds would go up, and some Population 2 individuals would shift to Population 1. These responses would moderate the results. A related objection is the assumption that the members of the whole population are interacting randomly with one another. The complex history of COVID-19 in the US has many examples where cases would flare up in a region, but then die out without spreading nationwide. The popular press has mentioned a “two-month COVID cycle,” in which cases tend to increase for two months and then recede, for unknown reasons (Leonhardt and Wu, 2021). This phenomenon may be caused by localized epidemics that increase until enough susceptibles have been...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266669
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266683

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266683: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266683
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266574

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266574: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linkage to health records and occupational databases: Using the Common Healthcare Identifier (CHI) held on all Scottish health records these individuals were linked to the population register, the national vaccination database, registers of teachers and health care workers, the list of those designated as clinically extremely vulnerable (eligible for shielding), the ECOSS database of test results, a database of hospitalisations (RAPID) that is updated daily, dispensed prescriptions in primary care and death registrations as described elsewhere [4–7].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Common Healthcare</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Statement of principal findings: Strengths and limitations: Strengths of this study are the large cohort of test-positive individuals based on ascertainment of all detected infections in the population, the comprehensive linkage to electronic health records, and the ability to examine associations with occupation. Although reinfections with new strains were not confirmed by sequencing, the 90-day interval should be enough to exclude persistent infection except in the immunosuppressed. Restriction to those with definite previous infection – at least two positive tests or Ct < 30 – excludes those who tested positive only once before September 2020, when the Lighthouse labs began reporting Ct values. Stratification by calendar time should eliminate almost all confounding by Alpha and Delta variants, as it took only a few weeks for each of these variants to replace pre-existing strains in Scotland. The main limitation is that without regular scheduled testing, estimates of association with detected reinfection are subject to ascertainment bias. Because testing rates are lower in unvaccinated than in vaccinated individuals in this cohort, the efficacy of vaccination is likely to be underestimated by a model with calendar timescale. We have attempted to overcome this by comparing two alternative models: a conventional Cox regression with calendar timescale, and a Cox regression with tests as timescale to adjust for differential testing rates. The model with tests as timescale is eq...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266574
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266712

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266712: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the cases where multiple adjacent phosphosites were found to match a pSNV, the highest-impact phosphosite was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSNV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELM 61, HPRD 62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HPRD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ANNOVAR software 63 was used to annotate the SNVs in protein-coding genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ANNOVAR</div><div>suggested: (ANNOVAR, RRID:SCR_012821)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene sets were retrieved from the g:Profiler web server 67 (Mar 25th, 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>g:Profiler</div><div>suggested: (G:Profiler, RRID:SCR_006809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human-human and human-virus PPIs were retrieved from the BioGRID database 43 (V 4.4.199, downloaded on June 29th, 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PPI network was visualized using the Cytoscape software 69.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Disease annotations of pSNVs were then reviewed manually using the ClinVar website (data retrieved on Oct 6th, 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClinVar</div><div>suggested: (ClinVar, RRID:SCR_006169)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has important limitations. We currently have no statistical or clinical evidence of pSNVs associating with SARS-CoV-2 infection, COVID-19 risk or comorbidities, as most pSNVs are infrequent in human populations and remain unmapped in genome-wide association studies. The phosphosites we studied reflect an early post-infection timepoint in cell culture, limiting our analysis of signaling pathways activated further downstream of SARS-CoV-2 infection in human tissues and the immune system. On the one hand, our analysis may overestimate the extent of network rewiring because our sequence-based pSNV impact analysis does not account for co-expression and localization of kinases and substrates. On the other hand, the number of motif-rewiring pSNVs may be underestimated, because many motifs bound by kinases and other phospho-enzymes remain unknown. The known landscape of functional protein-coding SNVs may be extended by analyzing other types of PTMs. Our integrative proteogenomic analysis of pSNVs affecting signaling networks of SARS-CoV-2 enables further studies of viral infection, disease mechanisms and potential translation. Analysis of whole-genome sequencing datasets with matched clinical profiles of COVID-19 information is needed to associate our functional predictions of infrequent pSNVs with patient risk and co-morbidities, and to enable the development of prognostic and predictive biomarkers. The candidate genes, pathways, and kinases identified in this study enable...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266712
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21266594

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21266594: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: It received approval from the Hospital La Paz Ethics Committee (Madrid, Spain) and was ratified by the local ethics committees from the participating sites.<br>Consent: Statistical analyses: First, we removed baseline respondents who provided informed consent but did not go on to initiate the survey (n = 95).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sociodemographic variables: Age in years, gender (male, female), educational level (primary, secondary, or university studies), and type of job.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using packages dplyr, gtsummary, flextable, ggplot2, psych, multinom of R Studio for Mac (Version 1.2.5042).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has limitations. First, we used a non-random sample that increases probability of some degree of collider bias and hinders transportability of study results across settings. Also, and in line with other multi-center studies (1,4), response rates varied significantly across sites and facilities, and the possibility of self-selection bias cannot be ruled out. Nevertheless, the baseline sociodemographic characteristics and mental health outcomes were however similar to another Spanish study with a larger and somewhat more representative sample of HCWs (1) and to other, similar European studies (2,3). Second, because of the use of observational data, effect estimates are potentially subject to some degree of residual confounding. Notably, substantial residual confounding is unlikely given that we included measures on all major individual- and region-level confounders and that estimates from crude and adjusted associations are roughly similar. Moreover, sensitivity analyses exploring differences between subsamples (e.g., full vs. partial respondents) and adjusting for baseline measurements of mental health outcomes obtained similar results, suggesting that our models were robust to different model specifications. Third, two thirds of baseline respondents were lost to follow-up. Dropout was independent from age, gender, and mental health outcomes at baseline, but people lost to follow were slightly more concerned about getting the virus and infecting their loved ones (dat...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21266594
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266584

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266584: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model uses Google Community Mobility data26 to capture mobility in various settings: workplaces, retail & recreation venues, transit stations, and grocery & pharmacy locations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Community Mobility</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are a number of limitations in this work which are important to consider. The extent to which immunity from natural infection and from vaccination wanes is uncertain. Individuals may retain very long-term protection against severe outcomes, but have faster rates of waning against less severe outcomes such as mild or asymptomatic infection. We model waning vaccine protection in a way that initially allows protection against different outcomes to be reduced to different extents. Individuals can then return to being entirely susceptible from the vaccinated-and-waned state or from the naturally infected and recovered state (see assumed rates of waning in Table S4). We have parameterised waning rates in relation to measured reductions in protection against severe outcomes, but our assumption that individuals return to being completely naive to infection may still be overly pessimistic. We have not attempted to explore the dynamics of waning immunity from natural infection here in detail. Throughout, we assume identical levels of protection are conferred from natural infection and from vaccination across individuals of all ages. It is likely that protection will differ from person to person and that more clinically vulnerable individuals may have lower levels of protection or faster reductions in protection. Further, we do not consider any differences in vaccine coverage by risk group. This work assumes that no new variants of SARS-CoV-2 possessing any kind of transmission ad...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266584
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266834

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266834: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study Approval: All participants provided signed written informed consent prior to participation.<br>IRB: Institutional Review Board approval was granted by the University of California, San Francisco. Dr.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">A blinded cardiac sonographer performed echocardiograms using a standardized protocol with a GE VIVID E90 machine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Echocardiograms were measured and post-processed by a single echocardiographer with GE EchoPAC software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE EchoPAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were recorded using REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using StataMP 16.1 (StataCorp, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study Limitations: Limitations of this study include the use of a convenience sample and the cross-sectional echocardiographic and biomarker assessments. There is a risk of selection bias from those in the LIINC study who chose to participate in the cardiovascular sub-study, and from the shift in our recruitment criteria toward those with symptoms. To date, there are no formal definitions of cardiopulmonary PASC. We did not have echocardiograms from prior to or during acute infection to examine sub-clinical changes among our sample. Because we are specifically interested in the pathophysiology of persistent symptoms compared to those who fully recover from COVID-19, we intentionally did not include a SARS-CoV-2 uninfected control group, but inclusion of such a control group would have strengthened our inferences. We excluded those with pre-existing heart failure, congenital heart disease, and pulmonary hypertension, so our findings may not be generalizable to those with pre-existing cardiac disease. Third, because we only included a small number of people who received intensive care during acute COVID-19 and none with myocarditis in the setting of acute disease, our findings may not be applicable to those with the highest severity of illness. Finally, the number with pericardial effusions is small so findings particularly with respect to biomarkers and pericardial effusions should be confirmed in larger studies.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362150</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Long-term Impact of Infection With Novel Coronavirus (COVID-…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 33. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266834
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469823

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469823: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CoV-RDB data model is made up of four major entities: published references, viral mutations and variants, antibodies (including mAbs, CP, and VP), and experimental results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curation of published references: Published references included in the CoV-RDB are obtained weekly from three literature sources:i) PubMed using the search term “SARS-CoV-2”; ii) BioRxiv/MedRxiv COVID-19 SARS-CoV-2 preprint servers; and iii) the Research Square SARS-CoV-2/COVID-19 preprint server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study limitations: Neutralizing susceptibility data are highly heterogeneous often resulting in discordant results across studies [16, 17]. There are three main sources for this heterogeneity. First, the composition of neutralizing antibodies among previously infected and vaccinated individuals is heterogeneous [6, 18]. Second, there are different types of neutralizing assays including those performed in cell culture using pseudotyped viruses, chimeric viruses, recombinant viruses, and clinical isolates and, more recently, surrogate neutralizing assays that assess the ability of antibodies to block the interaction between the SARS-CoV-2 RBD and ACE2. Third, results for the same sample against a virus variant can differ even among laboratories using the same type of assay as a result of differences in virus inoculum size, the cells used for culture, and viral replication endpoints [16,17,19]. As neutralizing assays become more standardized and as external controls such as those provided by the WHO [20] are increasingly used, it is likely that reproducibility across studies will improve. Data on the clinical significance of SARS-CoV-2 neutralizing susceptibility is continually evolving [11,21–26]. The utility of neutralizing antibodies as a correlate of immune protection is ultimately determined in epidemiological studies. Therefore, a database devoted to protective immunity should ideally contain both laboratory and epidemiological data. The main obstacle to expanding CoV-RDB ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469823
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.25.21266856

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.25.21266856: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The HELIUS study has been approved by the AMC Ethical Review Board.<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Baseline data were collected between 2011 and 2015 among 24,789 Dutch, South-Asian Surinamese, African Surinamese, Ghanaian, Moroccan, and Turkish origin women and men aged 18-70 years living in Amsterdam.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Potential participants were sampled with a simple random sampling method from the municipality registry, after stratification by ethnicity as defined by registered country of birth [21].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While natural experiments are generally considered strong [29], some limitations persist. First, response bias may have occurred [20] affecting generalizability to the general population. Moreover, random assignment to the control or exposed group was not possible, resulting in baseline differences between these groups. This may be due to phasing of the study, or selective drop-out among exposed participants. For instance, if only healthy participants were comfortable with being examined during the pandemic, this would result in a healthy subset of participants. We attempted to account for these differences through IPW, yet, this method does not account for potentially relevant unmeasured confounders. Despite this limitation, we chose IPW as our method to adjust for baseline differences and possible selective drop-out as it uses the entire sample, whereas propensity score matching would have led to a loss of cases, thereby negatively affecting our power [25]. Moreover, we could not adjust for differences in follow-up time, as this is a direct result of the restrictive measures. Yet, this may have affected variables that change with age, e.g. eGFR and SBP. On average, SBP increases with 7 mmHg every ten years [30] and eGFR decreases with 1 mL/min/year rate [31]. Given that the difference in follow-up time between the control and exposed group is only several months, this is thus unlikely to completely explain our findings. Furthermore, the effect of the mediators may have been...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.25.21266856
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266748

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266748: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was granted by the KCL Ethics Committee (LRS-19/20-18210).<br>Consent: At registration, all participants provided consent for their data to be used for COVID-19 research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The COG-UK data are produced by sequencing a random sample of positive PCR tests from the general community.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We acknowledge the limitations of our observational study. Self-reported data from a mobile phone app may disproportionately represent more affluent populations and can introduce information bias and/or effect bias, although previous work from the CSS has shown that our self-reported data aligns well with surveys designed to be representative of the population.34 Participants could only report a positive test and we cannot confirm the actual variant causing infection, although our assumptions of Delta and Alpha infection are strongly supported by UK-COG surveillance variant testing. During the study, both overall numbers and individual app users fluctuated in their participation in the CSS-app, potentially for many factors including mass-media information, summer vacation, and perception of relevance. Our populations were matched for age and sex but not BMI; and we note higher diabetes prevalence and BMI in the Alpha cohort. Relevantly, vaccination was not only tiered by age but also to those with co-morbidities including diabetes. As mentioned, the timeframes of Alpha and Delta variant predominance differed with respect to guidance on social distancing and behavior in public spaces, highly likely to affect viral diffusion in the population, thus affecting our transmission calculations. Last, vaccine effectiveness could only be determined in tested individuals, noting that we do not have information regarding the reason for testing in these individuals. We were also only able...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266748
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.21.21262716

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.21.21262716: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Institutional ethical clearance was obtained from Institutional Ethical Committee.<br>Consent: After taking informed consent from study participants, data was collected using a predesigned, pretested, structured questionnaire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Exclusion criteria: Sample size: Based on Indian census 2011, family folders maintained at UHTC, Anganwadi, UHTC consists of 11 slums with total 1171 households with a population of 6029, of which 3468 are >18yrs, and 987 are pregnant and lactating women.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data was entered in Microsoft excel and analyzed using SPSS version 24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: The study has few limitations. Although this study comprehensively explored the socio demographic determinants of vaccine Coverage, the influence of essential factors like misinformation on vaccine safety and effectiveness on the intention to vaccinate was not explored in this study. Relationship with trust in the various sources of information such as healthcare sectors and media with vaccine acceptance has also not been addressed, which could also increase the study`s strength. There could be recall bias from the study participants while reporting the type and duration of adverse events following COVID vaccination.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.21.21262716
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.24.469776

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.469776: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed according to Institute of Laboratory Animal Resources guidelines and the protocol was approved by the National Cancer Institute Animal Care and Use Committee.<br>Euthanasia Agents: All mice were anesthetized via isoflurane inhalation (3 - 5 % isoflurane, oxygen flow rate of 1.5 L/min) prior and during BLI using the XGI-8 Gas Anesthesia System.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">6–8-week-old male and female mice were used for all the experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times and incubated with the goat anti-human-IgG Fc secondary antibody conjugated with alkaline phosphatase (AP, Southern Biotech) at a 1:1000 dilution in blocking buffer for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis was determined by flow cytometry, gating on THP-1 cells that were triple-positive for GFP, efluor450 and efluor670 cellular dyes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were washed, sonicated, and incubated with goat anti-guinea pig C3 antibody conjugated with biotin (Immunology Consultants Laboratory) at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-guinea pig C3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Before and after injection, serum samples were collected at 0 min, 10min, 1 h, 6 h, 24 h and 48 h and the ACE2-Fc serum concentration was estimated by indirect ELISA in which SARS-CoV-2 RBDwt (200 ng/well) were used as capturing molecule and the goat-anti-human IgG conjugated with AP (1:1000 dilution) were used as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG1 Fc tag and 8xHis tag) (45), plasmids encoding the respective genes were transfected to 293F cells with the same protocol as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral titers, hACE2-expressing 293T cells (gift from Dr. Allison Malloy, USUHS) were infected with serial PsV dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis was determined by flow cytometry, gating on THP-1 cells that were triple-positive for GFP, efluor450 and efluor670 cellular dyes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dilutions from infected cell homogenates were applied on Vero E6 monolayer. 24 hour post infection, infected Vero E6 cells were washed with PBS, lysed with Passive lysis buffer and transferred into a 96-well solid white plate (Costar Inc) and nanoluciferase activity was measured using Tristar multiwell Luminometer (Berthold Technology) for 2.5 seconds by adding 20 µl of Nano-Glo® substrate in nanoluc assay buffer (Promega Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">96-well Nunc Maxisorp plates (Sigma) were coated with SARS-CoV-2 RBDwt (residue 319-541) (50ng), RBDB.1.351 (50 ng), S-2P (75 ng), SB.1.1.7 (75 ng), SB.1.351 (75ng), SP.1 (75 ng), SB.1.526 (75 ng) and SARS-CoV RBD (50ng) per well in Tris-buffered saline (TBS) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SB.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vivo PsV-based inhibition assays, 6-8-week-old K18-hACE2 mice were intranasally (i.n) treated with Synagis (control IgG, 25 µg), M27 or M81 (5 or 25 µg) one hour before challenge by SARS-CoV-2 PsVD614G or PsVB.1.617.2 (i.n., ∼108 RLU)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For PK studies, C57BL/6J mice were intravenously (i.v.) injected with 100 μg (5 mg/kg) of two engineered ACE2-Fc M81 or M86.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate SARS-CoV-2 RBDwt (residue 319-541 or residue 319-537, for crystallization), RBDB.1.1.7 (residue 329-527, N501Y) and RBDB.1.351 (residue 329-527, K417N/E384K/N501Y), the respective codon optimized DNA segments fused with an N-terminal secretion peptide and a C-terminal 6xHis tag were cloned into the pACP-tag (m)-2 vector using either EcoRI/NotI for RBDwt (319–541), RBD B.1.1.7 and RBDB.1.351 or BamHI/XhoI for RBDwt (319–537) as restriction enzymes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACP-tag</div><div>suggested: RRID:Addgene_101126)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monomeric ACE2wt and engineered ACE2LFMYQY2HA plasmids encoding ACE2 (residue 1-615) with C-terminal HRV-3C-cleavable 8xHis tag (45) were transfected to FreeStyle 293F cells and the resulting protein was purified over Ni-NTA columns (Cytiva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2LFMYQY2HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was used to display the mean and SEM for all groups and used to calculate the area under the curve (AUC) within the concentration range of 0.05-2.5 nM using 5% binding as baseline (Fig. 2D & S2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative cycles of model building and refinement were done in Coot (79) and Phenix (80).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis and Fig. generation were performed in PyMOL (81)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on an LSRII cytometer (BD Biosciences) and data analysis performed using FlowJo v10 (Tree Star)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired and analyzed with Living Image v4.7.3 in vivo software package (Perkin Elmer Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Thus far, the in vivo protective potential of an ACE2-Fc therapeutic has been tested only once in a Syrian hamster model (28) which has several limitations due to its inability to fully recapitulate SARS-CoV-2 pathogenesis and severity. To better test our lead ACE2-Fc variant we utilized a well characterized K18-hACE2 mouse model (67). Due to the constitutive high endogenous human ACE2 expression, this model is highly susceptible to SARS-CoV-2 infection and the disease progression partially recapitulates the severe pathological features of SARS-CoV-2 infection in humans. The model has also been used extensively for evaluating contributions from direct neutralization and Fc-effector activities mediated by nAbs (68) and a non-neutralizing Ab (69). However, a high basal level of hACE2 on target cells in this model, particularly in the brain, poses a significant obstacle for soluble ACE2-based antivirals such as our engineered ACE2-Fc to surmount and achieve protection. Despite these limitations, we detected a strong benefit to the administration of ACE2740 LFMYQY2HA–Fc GASDALIE variant both prophylactically and therapeutically in K18-hACE2 mice. In both settings, ACE2-Fc treatments were associated with markedly improved in vivo efficacy, e.g., a reduction in virus-induced body weight loss, pro-inflammatory cytokine responses and mortality, particularly in the therapeutic context. Given the human Fc-mouse FcγR mismatch may compromise Fc-effector functionality of ACE-Fcs in K18-hA...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56, 51 and 60. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.24.469776
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.23.469755

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.469755: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: In brief, CD34+ HSPCs were purified from human umbilical cord blood (CB) acquired from healthy donors under informed consent from the Department of Gynecology and Obstetrics, Aarhus University Hospital,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Individuals for whom there were no cryopreserved peripheral blood mononuclear cells (PBMCs) at baseline, who were pregnant, breastfeeding or had serum total bilirubin x3 above upper limit of normal were excluded from the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Purified anti-human CD304 (Neuropilin-1), clone 12C2, BioLegend Cat#354502) or isotype control (Ultra-LEAF Purified mouse IgG2a, clone MOPC-173, BioLegend Cat#400264) antibody for 15 minutes prior to stimulation with TLR7 (2.5 μg/mL R837) agonist for 4 hrs in 200 uL, after which the culture volume was topped up to 1 mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD304</div><div>suggested: (BioLegend Cat# 354502, RRID:AB_2564475)</div></div><div style="margin-bottom:8px"><div>Neuropilin-1</div><div>suggested: (BioLegend Cat# 354502, RRID:AB_2564475)</div></div><div style="margin-bottom:8px"><div>TLR7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test whether type I IFN contributes to the pDC-mediated inhibition of SARS-CoV-2 inhibition, antibodies blocking the type I IFN receptor (mouse anti-human IFNAR2 antibody, clone MMHAR-2, PBL Assay Science Cat#21385-1) or isotype control (Ultra-LEAF Purified mouse IgG2a, clone MOPC-173, BioLegend Cat#400264) were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1, clone MOPC-21, BioLegend Cat#400102) were added to 200 μL HSPC-pDC conditioned medium, 10 minutes prior to addition of conditioned medium to the Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFNAR2</div><div>suggested: (PBL Assay Science Cat# 21385-1, RRID:AB_387828)</div></div><div style="margin-bottom:8px"><div>anti-human IFN</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: (BioLegend Cat# 400102, RRID:AB_2891079)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibodies, peroxidase-conjugated donkey-anti-rabbit and donkey-anti-mouse was used (Jackson Immuno Research 711-036-152 and 715-036-150).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>and donkey-anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Calu-3 epithelial lung cancer cells (kindly provided by Laureano de le Vega, Dundee University, Scotland, UK) and human lung adenocarcinoma epithelial A549 cells expressing hACE2 (kindly provided by Brad Rosenberg, Icahn School of Medicine at Mount Sinai, New York, USA) were grown as a monolayer in DMEM10 (Dulbecco’s minimal essential medium, DMEM, Life Technologies, supplemented with 10% (v/v) hiFCS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was propagated using VeroE6 cells expressing human TMPRSS2 (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test whether type I IFN contributes to the pDC-mediated inhibition of SARS-CoV-2 inhibition, antibodies blocking the type I IFN receptor (mouse anti-human IFNAR2 antibody, clone MMHAR-2, PBL Assay Science Cat#21385-1) or isotype control (Ultra-LEAF Purified mouse IgG2a, clone MOPC-173, BioLegend Cat#400264) were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1, clone MOPC-21, BioLegend Cat#400102) were added to 200 μL HSPC-pDC conditioned medium, 10 minutes prior to addition of conditioned medium to the Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Limiting dilution assay: To determine the amount of infectious virus in cell culture supernatant or generated virus stocks, a limiting dilution assay was performed. 2×104 VeroE6-TMPRRS2 cells were seeded in 50 μL DMEM5 in a 96 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRRS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Calu-3 epithelial lung cancer cells (kindly provided by Laureano de le Vega, Dundee University, Scotland, UK) and human lung adenocarcinoma epithelial A549 cells expressing hACE2 (kindly provided by Brad Rosenberg, Icahn School of Medicine at Mount Sinai, New York, USA) were grown as a monolayer in DMEM10 (Dulbecco’s minimal essential medium, DMEM, Life Technologies, supplemented with 10% (v/v) hiFCS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent intensity was measured with a BD LSR-Fortessa X-20, using BD FACSDiva</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software, gates were set using fluorescent minus one (FMO) controls and data were analyzed with Flow-Jo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow-Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein levels were quantified using the Human DuoSet ELISAs for IL-6, IL-8, TNFα, CXCL10 (R&D Systems) or the Human IFN-a pan ELISA kit (Mabtech 3425-1M-6, detecting IFN-a subtypes 1/13, 2, 4, 5, 6, 7, 8, 19, 14, 16 and 17), according to the manufacturer’s instructions on a Synergy SynergyHTX multi-mode platereader (BioTek) using the Gen5 version 3.04 program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data were processed using the nSOLVER 4.0 software (NanoString Technologies) for Dhigh and Dlow separately to ensure proper normalization of each dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nSOLVER</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were plotted using Prism 8.2.0 (GraphPad, La Jolla, CA, USA) and R software version 3.5.1 with the following packages installed: ggplot2, circlize, dendextend, ComplexHeatmap and RColorBrewer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactome pathway overrepresentation analysis: To assign pathways to the gene clusters identified in pDCs from Dhigh and Dlow 48 hrs after SARS-CoV-2 exposure using unsupervised hierarchical cluster analysis on the NanoString nCounter data, we utilized the Reactome Pathway Browser version 3.7, database release 75 (https://reactome.org/PathwayBrowser); a comprehensive web-based resource for curated human pathways.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reactome Pathway Browser</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Disease pathways were excluded from the analyses and we used UniProt as the source of entities (maximum pathway size was 400).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine correlation between IFNα production by pDCs and time of exposure to SARS-CoV-2, as well as to compare gene expression changes in Dhigh and Dlow after 4 and 48 hrs after exposure to SARS-CoV-2, and determine correlation between pDC frequency and disease severity, simple linear regression analysis were performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.23.469755
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266761

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266761: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Pre-Processing: We performed pre-processing using SPM12 (http://www.fil.ion.ucl.ac.uk/spm/) within the MATLAB environment (Mathworks Inc, Massachusetts, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.fil.ion.ucl.ac.uk/spm/</div><div>suggested: (IBASPM: Individual Brain Atlases using Statistical Parametric Mapping Software, RRID:SCR_007110)</div></div><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To visualize the sample distributions and group average compartmental and total brain volumes, we customized and adopted a script in RStudio [34] to generate a ‘raincloud’ figure, as depicted in a recent publication [35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations and Future Directions: Despite our emphasis on group level analysis, we understand that in a clinical setting, it may have little transferability, owing to idiosyncrasies associated with each patient. A possible approach to address this issue would be to compare patient specific VBM against a sufficiently sized control sub-group randomly selected from a larger cohort [47]. However, it may not be very practical in a clinical setting unless a well-designed control dataset is available for a clinician. Nevertheless, our group level results from a single site seem to match single patient findings quite well, especially when they were collected from several centers across different countries [48]. Moreover, currently, we only have 46 COVID subjects. While we do observe significant effects, we still need a larger sample size to verify the main effects more conclusively. Another concern we have is the reversibility or transient nature of some effects. These patients were scanned two weeks after hospital discharge. It is possible some critical effects may have already disappeared through recovery or reversible neurological processes. Therefore, a better approach could be to scan the patients at onset, during and after recovery along with behavioral parameters to assess any possible trends unique to the neurological pathology in COVID patients.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 20, 21 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266761
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266785

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266785: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was conducted in accordance with the Declaration of Helsinki and local regulations, and was approved by the institutional and national ethics committee (CAAE: 42566621.0.0000.0068).<br>Consent: Patients with CDAI<10 proceeded to the enrollment station, where the unblinded researchers revised the protocol, explained the procedures, collected the informed consent and conducted the randomization, which was performed on the web-based software “The REDcap</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: This was a single-center, randomized, investigator-blind, intervention study performed at the rheumatology outpatient clinic of a tertiary center.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization and masking: Investigators responsible for disease activity measures, statisticians and laboratory personnel were blinded to the allocation groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: The sample size calculation was based on the 2009 non-adjuvanted influenza A/H1N1 primo vaccination in a large cohort of RA patients under MTX, which induced SC rate of 46%, [36].</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The co-primary outcomes were seroconversion (SC) rates for anti-SARS-CoV-2 S1/S2 IgG and neutralizing antibodies (NAb) positivity at D69.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S1/S2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Statistical Package for the Social Sciences, version 20.0 (IBM-SPSS for Windows. 20.0. Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The final small sample size of the study is related to the high rate of refusals to participate and the rigorous exclusion criteria, and is an important limitation of this trial. However, the larger than expected benefit of MTX withdrawal allowed the identification of a significant difference between groups for SC and GMT. We provide herein novel evidence of an increment of approximately 25% in anti-SARS-CoV-2 antibodies induced by Sinovac-CoronaVac vaccine with temporary MTX withdrawal. Such improvement is very similar to the 20% increase first described regarding MTX discontinuation for 2 weeks after influenza vaccine,[15], and could therefore partially reduce the deleterious effects in seroconversion induced by MTX reported for Sinovac-CoronaVac vaccine,[12] and BNT162b2 mRNA COVID-19,[13, 16]. This immunogenicity enhancement was observed even with a high frequency of combined DMARD therapy and corticosteroids, factors that could further impair immune response to COVID vaccine,[12-13]. Importantly, MTX dose was comparable between the groups and all patients had doses above 10mg/week, in line with the observation that only patients with doses greater than 7.5mg/week benefited from MTX withdrawal after influenza vaccine,[15]. Concerning combination therapy, the distribution of drugs was alike between the groups, equalizing possible additional harmful effects of different DMARD. We also deliberately excluded patients under rituximab, due to well-known effect on humoral immuno...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04754698</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 CoronaVac in Patients With Autoimmune Rheumatic Dis…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266785
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.22.469576

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.469576: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were approved by the Animal Care and Use Committees at UTMB and Houston Methodist Academic Institute, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested and stained with antibodies for cell surface markers, including CD80 or CD86 antibodies (BioLegend), and acquired by a BD LSR II flow cytometer (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD80</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD86</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This will be followed by a 1 h incubation with biotinylated HRP conjugated goat anti-mouse IgG subtype antibodies (Southern Biotech). 3,3’,5,5’ tetramethylbenzidine (TMB, BD Biosciences) were added to the well for 15 min and reactions were stopped by sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For IgA measurement, goat anti-mouse IgA (Southern Biotech) coupled to horseradish peroxidase (HRP) was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with antibodies for CD3, CD4, or CD8, fixed in 2% paraformaldehyde, and permeabilized with 0.5% saponin before adding anti-IFN-γ, or control rat IgG1 (e-Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFN-γ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rat IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking with 1% BSA plus 5% FBS, cells were incubated with anti-EEA1 antibody (1:500, Abcam) at 4°C overnight, followed by staining with AF488 -labeled goat anti-rabbit secondary antibody (1:1000 dilution, ThermoFisher) at room temperature for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-EEA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The vector was then packaged into lentivirus to transduce 293FT cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses: SARS-CoV-2 Beta variant, and Delta variant were obtained from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) at the University of Texas Medical Branch (UTMB) and were amplified twice in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero CCL-81 cells (1.2 ×104) in 50 μl of DMEM containing 2% FBS were seeded in each well of black μCLEAR flat-bottom 96-well plate (Greiner Bio-one™).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixture was transferred to the Vero CCL-81 cell plate with the final multiplicity of infection (MOI) of 0.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: 6-week-old BALB/c mice, C57BL/(B)6 mice, and K18 hACE2 mice (stock #034860) were purchased from Jackson Lab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, BM cells isolated from BALB/c mice were cultured for 6 days in medium supplemented with granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-4 (Peprotech) to generate DCs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_APB:4790)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccine preparation: To express and purify the RBD protein, the amino acid residues of 319 to 541 of SARS-CoV-2 S protein were cloned into the lentivirus vector, pCDH-CMV-MCS-EF1α-RFP (System Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-CMV-MCS-EF1α-RFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed and scanned using an ImmunoSpot 6.0 analyzer and analyzed by ImmunoSpot software to determine the spot-forming cells (SFC) per 106 splenocytes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoSpot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Values for viral load, cytokine production, antibody titers, and T cell response experiments were compared using Prism software (GraphPad) statistical analysis and were presented as means ± SEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.22.469576
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.22.21266719

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.22.21266719: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.22.21266719
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.23.21266767

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.23.21266767: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review boards at the Nicaraguan Ministry of Health and the University of Michigan (HUM00119145 and HUM00178355).<br>Consent: Informed consent or parental permission was obtained for all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This study was approved by the institutional review boards at the Nicaraguan Ministry of Health and the University of Michigan (HUM00119145 and HUM00178355).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUM00119145</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.23.21266767
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.24.21266809

1
1. sciscore 30 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.24.21266809: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This study is reported as per Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines. Ethics: This study was approved by the Health Research Ethics Committee of the National Institute of Health Research and Development, Ministry of Health Indonesia (LB.02.01/2/KE.643/2021).<br>IRB: This study is reported as per Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines. Ethics: This study was approved by the Health Research Ethics Committee of the National Institute of Health Research and Development, Ministry of Health Indonesia (LB.02.01/2/KE.643/2021).<br>Consent: The requirement for patient consent was waived as this was a secondary analysis of anonymised routine surveillance data21.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were done in Stata/MP 17.1 (StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had some limitations. The retrospective design and reliance on routine surveillance data meant that, for some key baseline variables, data were incomplete or uniformly unavailable (e.g., type of comorbidities and disease severity classification). As in many other settings, the individual-level socio-demographics data were not recorded in the current Indonesia’s national database22. Comorbidities were often self-reported or could be under-diagnosed, potentially resulting in underreporting and hence underestimation of effect sizes. Details on supportive care and treatment received were also not available for this analysis. There are several other relevant socio-demographics variables such as human development index and public health development index that may represent population and health system vulnerability24 but were only available at the district level, and were not included in our analysis. However, our analysis included all available key variables that compose those indicators (prevalence of infectious and non-communicable diseases, health care workers-population ratio, universal child immunization, and all-cause mortality among under 5 years old population), therefore enhancing credibility of our findings. In conclusion, individual-level risk factors associated with COVID-19 mortality in DKI Jakarta, Indonesia are broadly similar to those in more developed settings, dominated by advanced age and comorbidities. At the community-level, our analysis suggested t...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.24.21266809
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266265

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266265: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were randomly selected from all the province and from all the months studied in order to monitor VOC/VOI circulation in the community.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The strategy described here present some limitations: a)-some samples show inconclusive results, b)-samples with Ct values >30 cannot be typified, c)-many diagnostic PCR platforms can deplete swab material, leaving an inadequate volume of residual sample for a multitube mutation screen [Wang et al. 2021], d)-since VOC/VOI classification is dynamic and is constantly changing [WHO 2021], the strategy must be constantly reviewed and evaluated in order to corroborate whether the algorithm used is adequate for a correct VOC typing, e)-it is not possible to find mutations other than those specifically searched for, which leads to not being able to detect new emerging VOC/VOIs. These limitations show that WGS cannot be replaced by real time RT-PCR specific for VOC/VOI. Furthermore, these methodologies complement each other. While specific real time RT-PCRs for mutations of interest are a useful tool for rapid VOC/VOI screening, WGS-based parallel surveillance is critical to detect new emerging variants and to study phylogeographic relationships between circulating viruses. In conclusion, we report a valid strategy based on real time RT-PCR for VOC/VOI detection, first implemented in Argentina, which balance cost and time processing, capable to monitor currently recognized variants of concern. In the present moment requiring rapid strain typing to guide public health measures, such a rapid and accessible approach is essential.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266265
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266367

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266367: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical Approval: This study was approved by the Institutional Review Board at the University of North Carolina at Chapel Hill.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similar procedures were conducted at month 1 and 3 with one exception: at month 1, participants were provided a Tasso device (Tasso, Inc., Seattle, WA, USA) for self-administered blood collection (30-80 μl), which they could take home and return at a later time to test for SARS-CoV-2 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first was the commercially available Abbott SARS-CoV-2 assay (Abbott, Chicago, IL, USA) to detect IgG antibodies to nucleocapsid antigen using a chemiluminescent microparticle immunoassay (CMIA), which had received an EUA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>detect IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CMIA provides qualitative detection of SARS-CoV-2 IgG antibodies on the Abbott Architect instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay plate was washed, then a cocktail of horseradish peroxidase-conjugated secondary Goat Anti-Human IgG, IgA, and IgM secondary antibodies was used to measure antigen-specific total Ig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific total Ig.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using primers based on the Respiratory Diagnostic Clinic assay and human RNA control primers, amplicons were amplified and then quantified using a ThermoFisher QuantStudio 7 system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher QuantStudio</div><div>suggested: (Primer Express Software, RRID:SCR_017376)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first was the commercially available Abbott SARS-CoV-2 assay (Abbott, Chicago, IL, USA) to detect IgG antibodies to nucleocapsid antigen using a chemiluminescent microparticle immunoassay (CMIA), which had received an EUA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266367
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266437

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266437: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  13, 63 A limitation of this study, however, is that it relied on single individual interviews collected at only one timepoint. Whilst these provide a snapshot in which participants could retrospectively reflect on the impact of COVID-19, the long-term impact of COVID-19 on staff, alongside the sustainability/effectiveness of organisational responses, is not clear. Further longitudinal work that addresses these gaps will be a useful addition to the literature. Moreover, these data represent staff experiences of responding to COVID-19 from within a particular sector, and whilst there is likely to be overlap in experiences between healthcare settings, the nuances in experiences across other healthcare contexts (e.g., the public and private sectors) is not captured.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN16561225</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266437
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266392

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266392: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the purposes of this sub-study, patients with an oxygen requirement during their admission were identified and grouped according to whether dexamethasone was prescribed during their admission (either as part of standard care post-June 16th 2020 or when randomised to dexamethasone in the RECOVERY trial).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266392
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266284

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.21266284: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The low numbers of social and extracurricular contacts identified reflected limitations placed on social gatherings and extracurricular activities during the study period, and prevented risk comparisons. A major strength of our study is that it includes data collection and prospective monitoring for a larger number of primary cases from both public and independent schools. However, our study is limited by the relatively low proportion (42.9%) of close contacts who agreed to undergo asymptomatic testing. Low participation may reflect operational challenges that could be more pronounced in communities with existing barriers to health care. Further research investigating barriers to testing and subpopulations that may derive more benefit from enhanced testing may be warranted.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.15.21266284
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266442

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266442: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After informed consent was obtained from the patient or his/her relatives, longitudinal sampling was performed for the duration of the hospital admission, and one convalescent sample was obtained at the outpatient follow-up appointment, which was scheduled six weeks after hospital discharge.<br>IRB: The Medical Ethics Committee Leiden-Den Haag-Delft (NL73740.058.20) approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical sample size calculation was not performed, the sample size was determined based on availability.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.7 Antibody titer measurement: Semi-quantitative detection of SARS-CoV-2 anti-nucleocapsid (N) protein IgG was performed on the Abbott Architect platform.21-23 In this antibody chemiluminescent microparticle immunoassay (CMIA) test, the SARS-CoV-2 antigen coated paramagnetic microparticles bind to the IgG antibodies that attach to the viral nucleocapsid protein in human serum samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid ( N ) protein IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative detection of SARS-CoV-2 anti-S1/S2 IgG antibodies was performed using the DiaSorin LIAISON platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1/S2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Semi-quantitative detection of SARS-CoV-2 anti-RBD IgM antibodies was performed using the Wantai IgM-ELISA (CE-IVD) kit (Sanbio).24 Briefly, the IgM u-chain capture method was used to detect IgM antibodies using a double-antigen sandwich immunoassay using mammalian cell-expressed recombinant antigens containing the RBD of the spike protein of SARS-CoV-2 and the immobilized and horseradish peroxidase-conjugated antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>horseradish peroxidase-conjugated antigen .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Semi-quantitative detection of SARS-CoV-2 anti-S1 IgA antibodies was performed using the Euroimmun IgA 2-step ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.6 Cytokine measurements by cytometric bead array: Circulating cytokine and chemokine levels were determined in serum using commercially available bead based multiplex assays using the BioPLex 100 system for acquisition as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPLex</div><div>suggested: (BioPlex, RRID:SCR_016144)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.7 Antibody titer measurement: Semi-quantitative detection of SARS-CoV-2 anti-nucleocapsid (N) protein IgG was performed on the Abbott Architect platform.21-23 In this antibody chemiluminescent microparticle immunoassay (CMIA) test, the SARS-CoV-2 antigen coated paramagnetic microparticles bind to the IgG antibodies that attach to the viral nucleocapsid protein in human serum samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses and visualizations were performed in R, version 4.1.0 (R Foundation for Statistical Computing, Vienna, Austria) and RStudio, version 1.4.1717 (RStudio, Boston, MA). 2.10 Role of funding source: The funders had no role in study design, data collection, data analysis, data interpretation, or writing of the report.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266442
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266335

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.21266335: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The downstream analyses were performed at the Division of Genomics and Transcriptomics in the Joint Research Center for Human Retrovirus Infection, Kumamoto University [Approved by the Ethics Review Committee of the Faculty of Life Sciences Kumamoto<br>Field Sample Permit: Specimen collection and storage: For this study, sputum and/or nasopharyngeal swab samples were collected from the Kumamoto city area from August 16, 2021, to September 8, 2021, as part of the regular COVID-19 diagnostic service.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Global genome collections were downloaded from the “Region-specific Auspice source file” of the GISAID database, resulting in 3580 viral genomes (globally distributed random viral strains collected from December 2019 to October 2021) for global phylogenetic tree construction.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the adapter trimming step, a cleaning step was performed using the PRINSEQ tool [25] and Read1 with Phred score > 20 were used for downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRINSEQ</div><div>suggested: (PRINSEQ, RRID:SCR_005454)</div></div><div style="margin-bottom:8px"><div>Phred</div><div>suggested: (Phred, RRID:SCR_001017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adapter trimmed and cleaned reads were then aligned to the SARS-CoV-2 reference genome NC_045512 (isolate Wuhan-Hu-1) using the BWA-MEM algorithm [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the Samtools program [27] was used to remove multiple aligned reads, and Freebayes (Version 1.2.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the aligned files and VCF files were visualized using the Integrative Genomics Browser (IGV) [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integrative Genomics Browser</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, the viral sequences were aligned to the SARS-CoV-2 reference genome NC_045512 (isolate Wuhan-Hu-1) using Geneious Prime (version 2020.2.4) (https://www.geneious.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.geneious.com/</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the aligned sequences were used to construct a maximum-likelihood phylogenetic tree using phyML 3.0 [33] with Smart Model Selection (SMS) [34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.15.21266335
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.17.468980

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.468980: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Test Articles: In vivo Treatment: Thirty-six Sprague Dawley rats (Taconic Biosciences, USA) (three/ each sex in control and in treatment groups) were administered with NV-CoV-2 or NV-CoV-2-R, once per day for 5 days (0, 1, 3, 5, and 7) over a 7-day time period.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.17.468980
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266415

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266415: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study was approved by the IRB and all participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">90 pregnant women who received one of three available COVID-19 vaccines in pregnancy and 12 pregnant women infected with SARS-CoV-2 in pregnancy who had enrolled in a prospective study at two large academic medical centers in Boston, MA enrolled their infants (n=104) in this follow-up study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266415
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266445

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266445: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bacteriophage φ6 (NBRC 105899, NITE) which replicates in Pseudomonas syringae (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NBRC</div><div>suggested: (NBRC, RRID:SCR_002660)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266445
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266410

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266410: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To manage and organise data, preliminary codes and sections of data were entered into a Microsoft Excel 2016 spreadsheet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.2 Limitations: Two main limitations of this study are the narrow geographical and temporal focus of the systematic review of newspapers articles, limited to local newspapers in Kent, Surrey and Sussex published between 1st July and 31st August 2020, alongside national coverage. This is due reasons of resource and funding focus, as these systematic reviews were developed as part of a broader project exploring the impact of COVID-19 infection control guidance on the working lives of domiciliary and residential care staff in Kent, Surrey and Sussex. We are also aware that the issues analysed in this review and reported in newspapers are mediated through journalists and editorial boards. As such, the review does not report the direct experiences and opinions of sector representatives. A qualitative media analysis review of newspaper and/or media coverage of staff perspectives on COVID-19 infection control measures throughout the pandemic might add further insight to the findings presented in this research. Moreover, it is important to note that the majority of the newspaper articles included in the review report comments from sector representatives and care providers whilst the direct voices of carers are less present. It would be fruitful to compare the themes identified in this review with those that might emerge from interviews and/or focus groups with domiciliary and residential care staff on their experience of implementing covid-19 infection control guidance.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266410
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266381

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266381: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266381
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266407

1
1. sciscore 23 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266407: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This study received approval from the Institutional Review Board of Yale University’s Human Research Protection Program (IRB ID: 2000028666).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, this method may have several weaknesses. The model slightly underpredicted floor occupancy. This could be due to inaccurate assumptions used to estimate the model parameters. The model parameters were estimated for 3 age groups. The model fit could be improved in future versions by creating additional subgroups according to age and other risk factors for hospitalization and severe disease in COVID-19 patients. The model also assumes that rates of transition between departments remains constant over time. However, several factors, including changing hospital protocols for triage and treatment, may have resulted in fluctuations in the rates of transition over time. Such non-stationary behavior is challenging to capture and would not be captured by the model or parameter estimation procedure. In addition, the model is deterministic, and the estimates of variance in occupancy are based on uncertainty in parameter estimation rather than inherent stochasticity in the model. Improved estimates of variance might be achieved by making the model fully stochastic. The urgency of the crisis caused by surging COVID-19 patients contributed substantially to the challenge of developing a useful model. We would like to conclude by providing a few recommendations for creating a model in a crisis. First, early collaboration with end-users of the product was essential. After creation of the model structure and early implementation of the web application, we met several times with admini...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266407
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266558

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266558: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Once a person is diagnosed with SARS-CoV-2 infection, public health staff can seek informed consent from the case to access app data for contact tracing purposes.<br>IRB: Ethics: We obtained ethics approval from the University of New South Wales Human Research Ethics Committee (reference number HC200468).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using STATA v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 (StataCorp, College Station, Texas, United States).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were several limitations in our study. First, while app usage among cases in our study was only half of that estimated in the general population in Australia,(19) we did not investigate the reasons for non-uptake among cases. Second, we could not determine to what extent the absence of registered contacts during the entire infectious period of some app-using cases was real or a result of technical problems of the app as described above. Third, prior to August 2020 the quality of surveillance data was insufficient to establish a reliable count of close contacts per case, and app use among contacts that were not app-suggested was not ascertained. As a result, we had to assume the same levels of app uptake among cases and contacts in order to estimate sensitivity (see footnote of Table 2). Fourth, we could not quantify the overall workload generated by the app for public health staff, in particular for the risk assessment of app-suggested contacts that did not meet the close contact definition. Key implications of our findings are that conventional case interviews should remain the primary source of contact tracing information, and that all potential contacts, whether app-suggested or not, should undergo the same risk assessment by public health staff to establish their infection risk. The app may have shown greater benefits if uptake among the population at risk of SARS-CoV-2 infection had been higher. It may also have been more effective had it been used in a more target...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266558
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.12.21265796

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.12.21265796: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This activity was reviewed and approved by the BOP Research Review Board and CDC and conducted consistent with applicable federal law and CDC policy.*<br>Consent: All persons choosing to participate signed informed consent forms, which were provided in English and Spanish.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specimens selected for culture were used to perform limiting-diluting inoculation of Vero CCL-81 cells expressing TMPRSS2, and cultures showing evidence of cytopathic effect were tested by RT-PCR for the presence of SARS-CoV-2 RNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10 Whole genome sequencing (WGS) was performed for one RT-PCR-positive specimen per participant with Ct less than 30 (per sequencing laboratory standard protocols).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This report is subject to several limitations. Due to the small proportion of participants who were not fully vaccinated (19%), statistical comparisons on the basis of vaccination status were underpowered, and negative findings reported here warrant cautious interpretation. To increase the sample size of this group, two partially vaccinated participants were included, potentially diluting the characteristics of unvaccinated participants. However, our conclusions did not change when analyses were performed excluding these two participants. Similarly, only four participants had known prior infection, of which a higher proportion occurred in those not fully vaccinated; therefore, these participants may appear to have slightly greater immunological protection than those without prior infection. On average, unvaccinated participants enrolled earlier in the outbreak and later in their course of infection than vaccinated participants; we utilized Turnbull estimation in survival analyses to account for the possibility of interval censoring in this population. All symptom data was self-reported and collected at the end of the specimen collection period, which may have impacted the accuracy of participants’ recall related to the date of symptom onset. Ct values are semi-quantitative indicators of viral RNA levels and cannot be interpreted as quantitative markers of viral load or infectiousness. To avoid drawing quantitative conclusions around Ct values, we conservatively utilized non-p...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.12.21265796
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266051

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266051: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then chose the parameters that maximize the likelihood of the observed serial intervals (the maximum likelihood estimate): Sequential Least Squares Programming method, implemented in Python, was used to maximize the log-likelihood33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our analysis relies on datasets of transmission pairs gathered from previously published studies and thus has several limitations that are difficult to correct for. Transmission pairs data can be prone to incorrect identification of transmission pairs, including the direction of transmission. In particular, presymptomatic transmission can cause infectors to develop symptoms after their infectees, making it difficult to identify who infected whom. Data from the early outbreak might also be sensitive to ascertainment and reporting biases. For example, people who transmit asymptomatically might not be identified. Moreover, when multiple potential infectors are present, an individual who developed symptoms close to when the infectee became infected is more likely to be identified as the infector. These biases might increase the estimated correlation of the incubation period and the period of infectiousness. We have tried to deal with these biases by using a bootstrapping approach, in which some data points are omitted in each bootstrap sample. The relatively narrow ranges of uncertainty suggest that the results are not very sensitive to specific transmission pairs data points being included in the analysis. We also performed a thorough sensitivity analysis to address several of the potential biases such as the determination of period corresponding to unmitigated transmission, the inclusion of long serial intervals in the dataset, and the incorrect orderings of transmission pairs ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.11.17.21266051v2
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266274

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266274: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.7 Ethical considerations: This study was reviewed and approved by the research ethics committee of the Sergio Arouca National School of Public Health / Oswaldo Cruz Foundation (CAAE: 32219620.9.0000.5240).<br>Consent: Written informed consent was obtained from all study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It is an immunochromatographic test on a differentiated double-path platform for the qualitative detection of IgM and IgG antibodies anti-SARS-CoV-2 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 virus.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 antibodies prevalence and 95% CIs were calculated as the number of positive test results divided by the total number of participants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. First, the possible selection bias, since the sample in this study included those who naturally tend to be more mobile and less likely to keep social distancing, first of all to attend their appointments at health facilities, but also to address their bare necessities since most of them are poor and live in impoverished and underserved communities. Second, the small sample size, notwithstanding corresponding to the caseload of a tertiary, referral, health service, are likely affected by type II errors. Furthermore, questionnaires, especially when applied to studies dealing with long-term patients, living with severe diseases, tend to be affected by both recall [39] and social desirability bias [40].
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266274
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266529

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266529: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent verbally and written records of consent were made.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collection: Semi-structured interviews were conducted by telephone or video calls (depending on participants’ preferences) by an experienced qualitative, non-clinical researcher (AB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All transcripts were uploaded to the qualitative data management software (NVivo, v.12, QRS International) and analysed thematically (taking an inductive and realist/essentialist approach) (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NVivo</div><div>suggested: (NVivo, RRID:SCR_014802)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Due to the rapid nature of the pandemic, we adapted and extended an existing study to explore the impact of COVID-19 on AMS. This led to some limitations. To ensure prompt recruitment, we used convenience sampling, including participants in the STEP-UP study (focused on implementation of AMS strategies) and others who expressed interest. Although the views of participants from the STEP-UP study and additional GPs did not seem to differ, participants’ views might have still differed from non-participants. Our aim was to capture change over time. However, most change took place at the start of the pandemic before we conducted the first round of interviews. Thus, the findings related to the initial pandemic phase rely on recollections and may be subject to a recall bias and reinterpretation. Most participants were from one Clinical Research Network area; GPs in other areas of England or countries might have reported different views and experiences. As with all qualitative studies, the findings are time- and context-specific. Implications: The main implications of this study relate to the need to resume AMS activities in primary care and adapt them to the post-pandemic models of care. Prioritizing AMS requires addressing other issues, such as finding ways to manage the increased workload or appropriate mix of remote and in-person consultations. Most immediately, CCGs need to resume AMS work to drive re-focusing on, and reinforcing, the importance of prudent antibioti...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266529
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266563

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266563: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Selection, Data Extraction, Risk of Bias Assessment and Quality of Evidence: Two authors independently selected relevant studies, extracted key data and assessed risk of bias in a blinded manner using the online platform Rayyan.[31] We accepted observational studies published as full-length articles in peer-reviewed journals that reported the associations of electrolyte imbalances in patients diagnosed with COVID-19 that were either higher (e.g. hypernatremia) or lower (e.g. hyponatremia) than the normal physiological range.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">30] Search Strategy: We searched three databases (PubMed, Embase and Cochrane Library) from inception till 22nd May 2021 using search terms related to COVID-19 and electrolyte imbalances concerning the electrolytes sodium, calcium, potassium, magnesium, chloride and phosphate (Supplemental Methods).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane Library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted all analyses using RevMan (version 5.4), Stata (version 17) and RStudio (version 1.4) using the meta package (version 4.18).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RevMan</div><div>suggested: (RevMan, RRID:SCR_003581)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Firstly, there were insufficient studies looking at the same outcome and same electrolyte imbalance for a statistically-powered meta-regression and funnel plot for the assessment of publication bias. We were unable to conduct some meaningful subgroup analyses to explain heterogeneity, but this potentially could be explained by the differing impacts of the pandemic on different healthcare systems globally, as well as their varying management strategies. This may be confirmed using future studies for subgroup analyses stratified by country or region. Secondly, participants may be admitted with differing COVID-19 baseline severities, with some being admitted directly to the ICU with an already severe infection. We are unable to discern this group from those that deteriorated after admission, potentially introducing a source of bias as participants who are severely infected will be more prone to having a poor outcome. Nonetheless, we mitigated this by marking down the study’s representativeness on the NOS scale. Thirdly, our results do not allow us to interpret the causality of the association as it is unclear whether the electrolyte imbalances further aggravate participants with COVID-19 or whether its just a general indication of poor health. Furthermore, the temporal sequence between COVID-19 diagnosis and the presence of electrolyte imbalances is hard to establish. Studies also did not monitor the progression of these imbalances throughout the length of hospital ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266563
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266481

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266481: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Our survey questionnaire (Appendix S1) was approved by the University of Idaho Institutional Review Board (IRB #20-119).<br>Consent: Informed consent was obtained from all survey participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The remaining measures are recorded as Boolean variables measuring race (white = 1), gender (female = 1), age (over 64 years = 1), and geography (rural = 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used ArcGIS software from Environmental Systems Research Institute, Inc. (ESRI; West Redlands, CA, USA) to perform this spatial association.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArcGIS</div><div>suggested: (ArcGIS for Desktop Basic, RRID:SCR_011081)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, survey instruments are subject to response bias. Our respondents tend to be older, wealthier, more-educated individuals compared to the population as a whole. This is typical of many survey-based studies [33]. We interpret our findings in light of this limitation. Second, we received fewer responses from Texas (144) than from Idaho and Vermont. However, we received a substantial fraction of rural responses from each state, resulting in a multifaceted picture of rural attitudes; therefore, the effect of a lack of respondents from Texas may have been minimal. Third, with respect to disease data, we are limited by the shortcomings of the disease surveillance and reporting mechanisms. Because of limitations in testing for COVID-19, reported case counts are an underestimate of the true number of cases. This should have little effect on the outcome of our study so long as there are no heterogeneous biases in under-reporting of cases. Fourth, we are limited by the fact that COVID-19 cases are reported at the county level within the US. We may have been able to achieve greater resolution in our study had we been able to associate case counts with census tracts, the geographic level at which the geographic analysis was conducted. Related to this, in determining whether a zip code is rural or urban, we use the RUCA classification system. This system offers a finer level of granularity of which locations are urban and which are rural than the MS...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266481
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266552

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266552: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were first screened for the absence of IgG anti-nucleoprotein antibodies using a qualitative ELISA (ID Screen SARS-CoV-2-N IgG Indirect, ID Vet).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">subsequently, to determine the concentration of anti-Spike IgG antibodies, samples were tested with the SARS-CoV-2 IgG assay (sCOVG) on the ADVIA Centaur XPT platform (Siemens) using the kit cut-off value (reactive ≥1.0 U/mL); the results were expressed in binding antibody units per milliliter (BAU)/mL using the conversion factor of 21.8 determined by the manufacturer based on WHO first standard 20/136 [11].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266552
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266252

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266252: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The observational cohort study was approved by the institutional ethics board of the University Hospital of Strasbourg.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples were tested using the SARS-CoV-2 IgG II Quant assay, detecting IgG antibodies directed against the spike RBD of SARS-CoV-2 with results expressed in Binding Antibody Units/ml (BAU/ml) as recommended by the WHO4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG II Quant assay, detecting IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Protective thresholds are currently very speculative. Also even if the BAUs and the thresholds were to become clearer, these thresholds could change over time as the variants evolve and the humoral avidity could decrease in addition to the indisputable humoral decrease. Sample size is limited.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266252
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.18.21266535

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.18.21266535: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Stanford’s institutional review board approved the study (protocol numbers IRB-55835, IRB-55671).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, generalizability to prisons outside California and to workers in other high-risk settings is unknown. Second, designing and implementing optimal strategies for boosting uptake of Covid-19 vaccines requires detailed understanding of the knowledge, beliefs, and preferences of the hesitant, and we did not measure these factors. Third, CDCR records may have missed vaccines obtained by some staff outside CDR’s program. However, such misclassification is likely to have been uncommon because CDCR required notification and staff who did not show proof of vaccination were required to undergo a continuous testing regimen. Fourth, our measures of co-worker and home community influences are crude; studies with qualitative and mixed-method designs are better able to engage with the nuances of personal motivations. Finally, because of the rapid rollout and sharp uptake of vaccination among staff members who chose to get vaccinated, we were unable to analyze uptake decisions over time as a function of personal experiences with infection and co-worker vaccine decisions. Despite ongoing risks of Delta-variant Covid-19 outbreaks in high-risk carceral settings like the state prisons of California, vaccination rates among prison staff continue to lag those of incarcerated residents. Younger staff, and staff who have had Covid-19, staff who are disproportionately opting to remain unvaccinated may be doing so in part because they perceive themselves to be ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.18.21266535
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266532

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266532: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were performed under two Institutional Review Board approved protocols: SQNM-RND-103 (IRB number 520100174, study number 1269845) and SCMM-RND-402 (IRB number 520180046, study number 1270479). 2.3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These samples were generated by mixing venous serum (screened for SARS-CoV-2 antibodies) with packed red blood cells to create samples with 40% hematocrit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266532
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21265553

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21265553: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: This study was approved by the ethics committee of Asahikawa City Hospital and conducted in accordance with the ethical standards set forth in the Declaration of Helsinki (1983).<br>Consent: The opt-out method was used to obtain patient consent in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Regarding study limitations, the number of cases was limited, and this study was performed retrospectively at a single hospital. Only some patients underwent blood testing at their visit based on the judgment of the physicians. Only 4.93% of patients received SARS-CoV-2 vaccines in this study, and the cutoffs might differ according to the receipt of vaccination. Ferritin and d-dimer levels also significantly differed between patients who did and did not receive oxygen therapy; however, the physicians did not measure these parameters in 14.7% of patients. Because all patients were ethnically Japanese, the results should be verified in other populations. Further studies are needed to confirm our findings. In conclusion, our data suggest that CRP and LDH are useful biomarkers for predicting the need for oxygen therapy among outpatients with COVID-19. Further clinical studies are necessary to confirm our findings.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21265553
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.19.21266579

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.19.21266579: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals were considered eligible if they were aged 16 years or older, and willing and able to sign an informed consent in Dutch.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Secondary outcomes were diagnostic accuracies using a viral load cut-off as a proxy of infectiousness (≥5.2 log10 SARS-CoV-2 E-gene copies/mL), which was the viral load cut-off above which 95% of people with a positive molecular test had a positive virus culture in a recent study by our group6, and diagnostic accuracies stratified by presence of symptoms at time of sampling (yes or no), COVID-19 vaccination status (vaccinated with at least one dose yes or no), having had a prior SARS-CoV-2 infection (yes or no), sex (female or male), age (≥16 to ≤40 or >40 to ≤65 or >65), and testing indication (symptoms and/or close contact without symptoms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All staff assessing test results were blinded to the results of the other test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: Previous diagnostic accuracy studies of Ag-RDTs in people with COVID-19-like symptoms found sensitivities of around 80-85%.3-5,11,12 We based our sample size calculation on an expected sensitivity of 80% for each Ag-RDT, with a margin of error of 7%, type I error of 5% and power of 90%.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study is reported according to the STARD 2015 guidelines: an updated list of essential items for reporting diagnostic accuracy studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STARD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In discordant cases (Ag-RDT negative and RT-PCR positive cases) whole genome sequencing (WGS) of the primary clinical sample was performed when the viral load was above the infectiousness cut-off (supplementary material 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations of this study: Strengths include the protocolised nature of the study, the large sample size covering multiple test sites nationwide, the high data completeness, collection of samples for the index and reference tests at the same time, the implementation of index and reference tests by trained staff who were blinded to the result of the other test, and the availability of follow up information for participants who received negative test results. Our study also has some limitations. First, the reference standards that we used were molecular tests, but platforms and test kits used differed among the three centralised laboratories. However, the diagnostic accuracies of all molecular tests used are similarly high13,14, and we therefore believe that this has not influenced our findings significantly. In addition, Ct values determined by the different platforms were comparable (supplementary material 2). Second, we were unable to meet the predefined sample size in the PanBio/OP-N sampling group. These results are therefore not sufficiently robust and should be interpreted with great caution. Third, while the Delta variant is the dominant SARS-CoV-2 variant in the Netherlands at time of writing, its prevalence was only around 8.6% during the last week of inclusions. However, we checked whether false-negative Ag-RDT results could be linked to specific virus lineages by WGS and we did not find a signal confirming this hypothesis. Fourth, we relied on infectio...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.19.21266579
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266404

1
1. sciscore 22 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266404: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Literature Search: We systematically searched seven databases: MEDLINE, Embase, Web of Science, COVID-END, L- OVE, CDSR, and WHO Ovid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also searched Web of Science (Core Collection) and the Cochrane Database of Systematic Reviews.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Database of Systematic Reviews</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We downloaded and deduped the records using EndNote 9.3.3 (Clarivate) and uploaded to DistillerSR (Evidence Partners).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266404
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468761

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468761: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mice and viral infection: All experiments were performed in accordance with animal protocols approved by the University of California, Irvine Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several primary antibodies were used, including Iba1 (1:500 Wako), GFAP (1:1000 Abcam), Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam), CD8 (1:200 Abcam), MHC I (1:200 Abcam), and MHC II (1:200 Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Iba1</div><div>suggested: (US Biological Cat# S1000-78G1, RRID:AB_2270053)</div></div><div style="margin-bottom:8px"><div>GFAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On the second day, slides were treated with appropriate secondary antibodies (1:1000 goat anti-rat/rabbit Invitrogen, 1:1000 goat anti-chicken, Abcam) following PBS rinsing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat/rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-chicken ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated overnight at 4°C in blocking solution with primary antibodies anti-MAP2 (EnCor Biotech. Cat:NC0388389) and anti-SARS-CoV-2 nucleocapsid (Sino Bio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MAP2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid (Sino Bio.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed with 1X PBS and incubated in blocking solution for 2hrs at RT with secondary antibodies, Alexa Fluor 594-conjugated goat anti-chicken and Alexa Fluor 488-conjugated goat anti-rabbit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-chicken</div><div>suggested: (AnaSpec; EGT Group Cat# 29709-1-H488, RRID:AB_10563238)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8-16 week-old heterozygous K18-hACE2 C57BL/6 [strain: B6.Cg-Tg(K18-ACE2)2Prlmn/J] mice were obtained from Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J]</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The relative fold change between samples used in the ddCt calculation was calculated (2-ddCt). qPCR statistical analysis: Statistical analysis was performed in Prism (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads passing quality control were used for quantification using featureCounts and analyzed with the R package DESeq2 to identify DEGs</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes passing an FDR of 10% were used for GO enrichment analysis using GOrilla (27) (http://cbl-gorilla.cs.technion.ac.il/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://cbl-gorilla.cs.technion.ac.il/</div><div>suggested: (GOrilla: Gene Ontology Enrichment Analysis and Visualization Tool, RRID:SCR_006848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From those lists, the genes with the top 100 most variable TPM were plotted using the R package pheatmap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following fixation, the 24-48hr brains were either cryoprotected in 30% sucrose, embedded in O.C.T. (Fisher HealthCare), and sliced via Cryostat in 10µm sagittal sections.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fisher HealthCare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell quantities were determined using the spots module in Imaris.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04343651</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Efficacy and Safety of Leronlimab for …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04347239</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Efficacy and Safety of Leronlimab for …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04878055</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study on Efficacy and Safety of Reparixin in the Treatment o…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04347226</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Anti-Interleukin-8 (Anti-IL-8) for Patients With COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04389645</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Interferon Gamma Induced Protein 10 (IP-10) in a Clinical De…</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 36. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468761
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21263608

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21263608: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The MITRE Institutional Review Board (IRB) reviewed the study submission, COVID-19 Analytics (MIRB 2020017), and found that it is exempt under the provisions of 45 CFR 46.104(d)(4) as secondary research and approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To further test specific outcomes identified using the logistic regression model, a general linear model using an iteratively reweighted least squares optimization method (Python statsmodels v0.12.2) was fitted to an aggregate continuous variable counting the number of distinct long-COVID symptoms reported after 12-weeks following diagnosis (“Symptom Count”).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study is subject to at least six limitations: First, these findings are based on opportunistic availability of large volumes of patient data and may have geographic, temporal, contractual, and socioeconomic gaps that could influence outcomes. Second, these findings use vaccination data recorded by payer entities or documented in EHRs by providers but do not incorporate dedicated vaccination surveillance data sources and so may have gaps in vaccination data that are presently undetectable. Third, it is possible, but unlikely, that some of the patients with COVID-19 were misclassified due to a false-positive test result (with no documented correction) or an inaccurate COVID-19 diagnosis. Fourth, no distinction was made between which of the three U.S. COVID-19 vaccines administered; it is possible that some of the effect described is related to a specific vaccine, and that such an effect could not be detected based on the data used here. Fifth, while interactions between the observed demographic factors have been explored, interactions between pre-existing chronic conditions have not and may introduce unforeseen effects to the findings described here. And sixth, this analysis was conducted on patient data collected prior to the emergence of the delta variant as the predominant variant circulating in the United States; as a result, we cannot conclude that the protective effect of vaccination against long-COVID described here applies to patients infected with the delta varian...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.11.17.21263608v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.17.468942

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.468942: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, 1 μl random hexamers (50 ng/μl), 1 μl dNTPs mix (10 mM each), and 11 μl template RNA (diluted 1:10 in DNase/RNase free water) were mixed, incubated at 65°C for 5 min and placed on ice for 1 min.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inhibition by IFITM2 antibody and Remdesivir: 30,000 iATII cells were seeded as single cells in 96-well plates coated for 1 h at 37 °C with 0.16 mg/ml Matrigel (Corning, Cat#356238) diluted in DMEM/F12 (Thermo Fisher, Cat#11330032), 24 h later cells were treated with increasing concentrations (20, 40, 80 μg/ml) of α-IFITM2 (Cell Signaling, Cat#13530 S) or Remdesivir (Selleck Chemicals Cat#S8932) (10 μM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM2</div><div>suggested: (Cell Signaling Technology Cat# 13530, RRID:AB_2798248)</div></div><div style="margin-bottom:8px"><div>α-IFITM2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were stained using primary antibodies against IFITM1 (α-IFITM1, Cell Signaling Cat#13126S, 1:1,000), IFITM2 (α-IFITM2 Cell Signaling Cat#13530 S, 1:1,000), IFITM3 (α-IFITM3 Cell Signaling Cat#59212S, 1:1,000), ACE2 (Rabbit polyclonal anti-ACE2 Abcam, Cat#ab166755, 1:1,000); rat anti-GAPDH (Biolegend Cat#607902, 1:1,000) and SARS CoV-2 N (anti-SARS-CoV-2 N Sino Biologicals Cat#40588-V08B, 1:1,000) and Infrared Dye labeled secondary antibodies (LI-COR IRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFITM3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (BioLegend Cat# 607902, RRID:AB_2734503)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells (human epithelial colorectal adenocarcinoma, kindly provided by Prof. Holger Barth (Ulm University)) were grown in the same media as Vero E6 cells but with supplementation of 10% heat-inactivated FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 strains were propagated on Vero E6 (NL-02-2020, Delta), VeroE6 overexpressing TMPRSS2 (Alpha), CaCo-2 (Beta) or Calu-3 (Gamma) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6 h after the second transfection, Calu-3 cells were infected with the various SARS-CoV-2 variants at an MOI of 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained sequenced reads were demultiplexed and mapped against the SARS-CoV-2 reference genome (NC_045512.2) with BWA-MEM3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM3</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.17.468942
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.17.21266455

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.21266455: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.17.21266455
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468633

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468633: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Quantifications were done blind.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: After 48 h, cells expressing mCherry have been validated.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the cells were incubated 2 minutes in 0.05% PBS-tween and then incubated with the primary antibody, a polyclonal SARS-CoV-anti-N IgG, provided by Nicolas Escriou, Institut Pasteur, Paris (or alternatively with a Human SARS-CoV-2 anti-S IgG provided by Cyril Planchais from the group of Hugo Mouquet Institut Pasteur, Paris), overnight at 4 degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG provided by Cyril Planchais from the group of Hugo Mouquet Institut Pasteur , Paris) , overnight at 4 degrees</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing the cells were then incubated with an anti-rabbit (or an anti-human) HRP-conjugated antibody for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibody used were: a rabbit anti-Nucleoprotein (Anti-N, gift from Nicolas Escriou, Institut Pasteur, Paris) (1:500) over night (ON); an anti-human anti-Spike (H2-162, produced by Cyril Planchais from the group of Hugo Mouquet Institut Pasteur, Paris) (1: 100) ON, an anti-mouse J2 (1:50) (Scicons) ON, an anti-sheep nsp3 (1:200) (MRC PPU Reagents).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleoprotein</div><div>suggested: (Bio X Cell Cat# BE0106, RRID:AB_10949017)</div></div><div style="margin-bottom:8px"><div>Anti-N , gift from Nicolas Escriou , Institut Pasteur , Paris </div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human anti-Spike ( H2-162</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse J2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-sheep nsp3</div><div>suggested: (Novus Cat# NB110-61650, RRID:AB_2291744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The day after, cells were thoroughly washed and incubated for 40 min with an anti-rabbit Alexa-Fluor 633-conjugated secondary antibody (Invitrogen), an anti-human Alexa-Fluor 488-conjugated secondary antibody (Invitrogen), goat anti-mouse Alexa-Fluor 633-conjugated secondary antibody (Invitrogen) at 1:500 in 2% BSA (w/v) in PBS 1X respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-D633F6, RRID:AB_10283907)</div></div><div style="margin-bottom:8px"><div>anti-human Alexa-Fluor 488-conjugated secondary antibody ( Invitrogen)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-F633A0, RRID:AB_10279445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For correlative light-and cryo-electron microscopy using the anti-S primary antibody, cells were fixed with PFA 4% for 15 min at 37 °C, quenched with 50 mM NH4Cl for 15 min, and blocked with PBS containing 2% BSA (w/v) for ON at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were labeled with an anti-human AlexaFluor 488-conjugated secondary antibody (Invitrogen) at 1:500 and labelled with HCS Cell Mask TM Blue Stain (Invitrogen, 1:300).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human AlexaFluor 488-conjugated secondary antibody ( Invitrogen )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cell-lines used in this assay included Caco-2, CAD, SH-SY5Y and Vero E6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">250 μl of each dilution was used to infect a confluent monolayer of Vero E6 cells, in a 24 wells multiwell plate, for a total of 6 wells per sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral Transduction: Transduction of SH-SY5Y and Vero E6 cells with a lentiviral vector expressing pCMV-mcherry: 600.000 SH-SY5Y cells 400.000 Vero-E6 were plated in 60 mm plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SH-SY5Y</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the possibility of SARS-CoV-2 transfer from donor to acceptor cells mediated by secretion, the supernatants from SARS-CoV-2 infected Vero-E6 cells were collected centrifuged at 1000 rpm for 10 min to remove floating cells and added on acceptor cells: SH-SY5Y mCherry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral Transduction: Transduction of SH-SY5Y and Vero E6 cells with a lentiviral vector expressing pCMV-mcherry: 600.000 SH-SY5Y cells 400.000 Vero-E6 were plated in 60 mm plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-mcherry</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transduction of SH-SY5Y cells with a lentiviral vector expressing pCMV-H2B-GFP: 600.000 SH-SY5Y cells were plated in 60 mm plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-H2B-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The whole cellular volume was imaged by acquiring 0.45 µm Z-stacks with an inverted confocal microscope (Zeiss LSM 700) using ZEN software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3D rendering of TNTs were performed using IMARIS software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMARIS</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All column graphs and statistical analysis were performed by using GraphPad Prism version 7 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCC was calculated by using JACoP plugins in Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 53, 39 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468633
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468709

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468709: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In-frame nucleotide sequences were translated to amino-acids, aligned with MAFFT (Katoh and Standley 2013), and then mapped back to the nucleotide sequences to produce a codon-aware alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed site-, branch-, and alignment-level selection tests based on the dN/dS (nonsynonymous / synonymous) ratio estimation as implemented in the HyPhy software package v.2.5.31 (Kosakovsky Pond et al. 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HyPhy</div><div>suggested: (HyPhy, RRID:SCR_016162)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Estimating divergence times: 2.3.1 Temporal signal: The temporal signal in each GARD partition was assessed using root-to-tip regression in TempEst v1.5.3 (Rambaut et al. 2016) and tip-dating-randomization tests (TDR) (Duchêne et al. 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each model tested, marginal likelihood was calculated using PathSampling (Lartillot & Philippe 2006) within the Model-Selection package in BEAST 2 with 12 steps, 1,000,000 MCMC steps with 25% burn-in, and an alpha of 0.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bayesian phylogenies were created using 100 million MCMC steps in BEAST2, sampling every 10,000 steps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST2</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trees were summarized using the BEAST2 package TreeAnnotator v2.6.0, discarding 20% of trees as burn-in.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TreeAnnotator</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Convergence of the MCMC chains was assessed using Tracer v1.7.1(Rambaut et al. 2018) and the effective sample size for each estimated parameter was confirmed to be greater than 200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were annotated using FigTree v1.4.4 (available from http://tree.bio.ed.ac.uk/software/figtree/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468709
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.16.468834

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.468834: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.16.468834
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.16.468777

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.468777: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, 1 µl random hexamers (50 ng/µl), 1 µl dNTPs mix (10 mM each), and 11 µl template RNA (diluted 1:10 in DNase/RNase free water) were mixed, incubated at 65°C for 5 min and placed on ice for 1 min.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells (Cercopithecus aethiops derived epithelial kidney, ATCC) and TMPRSS2-expressing Vero E6 cells (kindly provided by the National Institute for Biological Standards and Control (NIBSC), No. 100978) were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Cat#41965039) supplemented with 2.5% (upon and after viral infection) or 10% (during all other times) heat-inactivated FBS (Gibco, Cat#10270106), 100 units/ml penicillin, 100 µg/ml streptomycin (ThermoFisher, Cat#15140122), 2 mM L-glutamine (Gibco, Cat#25030081), 1 mM sodium pyruvate (Pan Biotech, Cat# P04-8010), 1x non-essential amino acids (Sigma, Cat#M7145) and 1 mg/mL Geneticin (Gibco, Cat#10131-019) (for TMPRSS2-expressing Vero E6 cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells (human epithelial colorectal adenocarcinoma, kindly provided by Prof. Holger Barth (Ulm University)) were grown in the same media as Vero E6 cells but with supplementation of 10% heat-inactivated FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24 h post-seeding, Calu-3 cells were infected with the different variants of SARS-CoV-2 (MOI 0.05).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained sequenced reads were demultiplexed and mapped against the SARS-CoV-2 reference genome (NC_045512.2) with BWA-MEM[36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM[36</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mapped reads and the pileup file were used to construct the consensus sequence with the iVar package[38] using default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>iVar</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2021.11.16.468777v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.17.468929

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.17.468929: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python source codes and all the datasets supporting this work can be downloaded from https://github.com/luseedbio/TCRBert.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.17.468929
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468720

1
1. sciscore 20 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468720: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal studies and experiments were approved and performed under the Kansas State University (KSU) Institutional Biosafety Committee (IBC, Protocol #1460) and the Institutional Animal Care and Use Committee (IACUC, Protocol #4508.2) in compliance with the Animal Welfare Act.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Virus challenge of animals: Ten male sheep, approximately 6 months of age, were acquired from Frisco Farms (Ewing, IL) and acclimated for ten days in BSL-3Ag biocontainment with feed and water ad libitum prior to experimental procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two independent veterinary pathologists (blinded to the treatment groups) examined the slides and morphological descriptions were provided.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following three washes with PBS-T, 100 μL of HRP-labelled Rabbit Anti-Sheep IgG (H+L) secondary antibody (VWR, Batavia, IL, USA) diluted 1:1000 (100ng/mL) was added to each well and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Sheep IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Indirect ELISA was used to detect bovine coronavirus (BCoV) antibodies in sera with Spike (S) recombinant viral protein (LSBio, Seattle, WA, USA) using the methods described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCoV </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2-specific immunohistochemistry (IHC): IHC was performed as previously described (29) on four-micron sections of formalin-fixed paraffin-embedded tissue mounted on positively charged Superfrost® Plus slides and subjected to IHC using a SARS-CoV-2-specific anti-nucleocapsid rabbit polyclonal antibody (3A, developed by our laboratory) with the method previously described (30).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus isolation was performed by culturing 100 µl of filtered (0.2 µm; MidSci, St. Louis, MO) sample /well in duplicate on Vero E6/TMPRRS2 cells and monitoring for CPE for up to 5 days post inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRRS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Susceptibility of ovine and bovine cells to SARS-CoV-2: The SARS-CoV-2 USA-WA1/2020 strain was passaged 3 times in Vero-E6 cells to establish a stock virus for infection experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell supernatants were titrated on Vero E6 cells to determine SARS-CoV-2 replication kinetics by virus titers (TCID50/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was subsequently cultured on Vero-E6/TMPRSS2 cells in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swabs were placed in 2mL of viral transport medium (DMEM, Corning; combined with 1% antibiotic-antimycotic, ThermoFisher), vortexed, and aliquoted directly into cryovials and RNA stabilization/lysis Buffer RLT (Qiagen, Germantown, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine an accurate relative percentage of each SARS-CoV-2 lineage in each sample, BLAST databases were first generated from individual trimmed and filtered sample reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, McKinney, TX, for 4-7 days at room temperature), trachea, and lungs as well as various other extrapulmonary tissues (liver, spleen, kidneys, heart, pancreas, gastrointestinal tract [stomach, small intestine including Peyer’s patches and colon], cerebrum [including olfactory bulb], tonsils and numerous lymph nodes) were routinely processed and embedded in paraffin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Peyer’s</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468720
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467291

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467291: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 Nsp1 antibody (PA5-116941) was purchased from Themo Fisher Scientific.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The β-actin antibody (GTX109639) was purchased from Gentex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and reagents: The human kidney epithelial cell line Lenti-X 293T was purchased from Takara.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lenti-X 293T</div><div>suggested: RRID:CVCL_4401)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human liver cell line Huh7.5.1 was provided by Dr. Francis Chisari (Scripps Research Institute).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5.1</div><div>suggested: RRID:CVCL_E049)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The baby hamster kidney fibroblast cell line BHK21 (CCL-10), African green monkey kidney epithelial cells (Vero E6; CRL-1586), Caco-2 (HTB-37), Calu-3 (HTB-55) and A549 (CCL-185) were purchased from the American Type Culture Collection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid Construction: Doxycycline-inducible expression of SARS-CoV-2 NP was established in Vero E6, Huh7.5.1, and BHK-21 using TripZ-NP plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA Electroporation: Forty-eight hours post doxycycline treatment, BHK-21-NPDox-ON cells were washed with phosphate buffered saline (PBS), trypsinized, and resuspended in complete growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21-NPDox-ON</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For validation, A549-hACE2, Caco-2 or Calu-3 cells were seeded in 96-well plates at a density of 104 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NP cDNA was subcloned into pTripZ (AgeI/MluI) using the following primers: TripZ-NPf: 5’-ATATAGACCGGTCCACCATGTCTGATAATGGACCCCA- 3’, TripZ-NPr: 5’- ATATAGACGCGTTTAGGCCTGAGTTGAGTCAG-3’</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTripZ</div><div>suggested: RRID:Addgene_127696)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon receipt, fragment 4 was subsequently subcloned into a low-copy plasmid pSMART LCAmp (Lucigen) to increase stability.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSMART</div><div>suggested: RRID:Addgene_102283)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To introduce Nsp1 R124S/K125E, N128S/K129E and K164A/H165A mutations into the SARS-CoV-2-Rep-NanoLuc-Neo replicon, puc57-CoV2-F1 plasmids containing mutated Nsp1 were first created by using overlap PCR method with the following primers: PCR fragments were digested by Bgl II/Nhe I and ligated into Bgl II/Nhe I digested F1 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>puc57-CoV2-F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate standard plasmids, the cDNAs of SARS-CoV-2 ORF1ab gene, NanoLuc gene sgmRNA and neomycin phosphotransferase gene sgmRNA were cloned into a pCR2.1-TOPO plasmid respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR2.1-TOPO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CC50 values were calculated using a nonlinear regression curve fit in Prism Software version 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467291
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266350

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266350: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The Institutional Scientific Ethical Committee of Health Sciences reviewed and approved the study protocol at the Pontificia Universidad Católica de Chile (#200708006).<br>Consent: Informed consent was obtained from all volunteers upon enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A standard curve was used to plot the neutralization response in the samples as international units (IU) by using the WHO International Standard for SARS-CoV-2 antibody (NIBSC code 20/136), which was prepared according to the manufacturer’s instructions [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed with GraphPad Prism 9.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04651790</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy, Safety, and Immunogenicity of Two Vaccination Sche…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266350
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266334

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.14.21266334: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Ethics Committee of National Hospital Organization Utsunomiya National Hospital (No. 03-01; April 19<br>Consent: 9, 2021) approved this study, and written informed consent was obtained from all participants before enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">(250 women, 115 men).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate Spearman’s rank correlation coefficient and perform the Mann–Whitney U test, we used Statistical Package for the Social Sciences (SPSS version 25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations and possible sources of bias in this study include the following. First, the participants were limited in number and were all healthcare workers vaccinated at a single national hospital in Tochigi prefecture. Therefore, the results obtained in this study might not be generalizable on a wide scale, or even within Japan. Second, we excluded participants with Abs against nucleocapsid proteins on the presumption that they had previously been infected with COVID-19. However, some of these patients had slight increases in Ab titres against the spike protein but became negative for Ab titres against nucleocapsid proteins. One possibility is that they had not been infected with COVID-19 and that the Ab titres against the spike protein had been increased by individual differences. The other possibility is that the Ab titres against nucleocapsid proteins might have not increased due to a small viral load of SARS-CoV-2, even though they may still have been infected with COVID-19. To determine the chance of exposure to a small amount of SARS-CoV-2 virus, we analyzed Ab titres in participants who worked in the COVID-19 ward (data not shown). However, their Ab titres were not increased. If the excluded participants were by chance exposed to a small amount of SARS-CoV-2 virus, it may have been through daily life and not the COVID-19 ward. In addition, 5 participants had Ab titres exceeding 3000 U/mL and/or a greater than 80% rate of increase in Ab titres against the spike p...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.14.21266334
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.05.467529

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.05.467529: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Synthesized genes were subcloned into the pET-28a vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a</div><div>suggested: RRID:Addgene_44242)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 of compounds was determined by plotting the initial velocity against various concentrations of testing inhibitor by using the dose-response curve in GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures were determined by molecular replacement with PHENIX software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program Coot was used to rebuild the initial model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.05.467529
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467342

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467342: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin antibiotics in a 37 °C incubator with 5% CO2. 96-well Greiner plate (catalog no. 655090) was seeded with 293T cells to overnight 70–90% confluency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 PLpro expression and purification: SARS-CoV-2 papain-like protease (PLpro) gene (ORF 1ab 1564–1876) from strain BetaCoV/Wuhan/WIV04/2019 with E. coli codon optimization was ordered from GenScript in the pET28b(+) vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28b(+</div><div>suggested: RRID:Addgene_67287)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50 ng of pcDNA3-flipGFP-PLpro-T2A-mCherry plasmid and 50 ng of pcDNA3.1-SARS2-PLpro were used each well in the presence of transfection reagent TransIT-293 (Mirus) per manufacturer protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-flipGFP-PLpro-T2A-mCherry</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS2-PLpro</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467342
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467344

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467344: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT01211470</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Initial Treatment for Acute Bacterial Skin Infections (ABSSS…</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT020388</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02324335</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Effects of Brilacidin Oral Rinse on Radiation-i…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784897</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate the Efficacy and Safety of Brilacidin in…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467344
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467308

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467308: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467308
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.05.466755

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.05.466755: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Discard human fetal samples of gestational age of 17-21 weeks were obtained with informed consent at the First Hospital of Jilin University.<br>IACUC: Protocols involved in the use of human samples and animals were reviewed and approved by the Institutional Review Board and Institutional Animal Care and Use Committee of the First Hospital of Jilin University, and all experiments with SARS-CoV-2 (COVID-19) were performed in biosecurity level 3 laboratory according to the protocols approved by the Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human immune cell reconstitution in humanized mice were determined by flow cytometry using following fluorochrome-conjugated antibodies: anti-human CD45, CD3, CD20, CD33, CD4,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD45</div><div>suggested: (RayBiotech Cat# CS-11-0028, RRID:AB_1227892)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD33</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">), CD20 (DAKO, L26), CD4 (ABclonal; ARC0328), or CD11c (Abcam; EP1347Y), ACE2 (Abcam; EPR4435(2)) antibodies, and the immunoreactivity was detected with UltraSensitiveTM Streptavidin-Peroxidase Kit (KIT-9710, Mai Xin, China) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus preparation and titer determination: SARS-CoV-2 (BetaCoV/Beijing/IME-BJ05-2020) was proliferated in Vero E6 cells, which are maintained in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) with supplemented 2% fetal bovine serum (FBS; Gibco, Auckland, New Zealand).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice and human tissues: NOD-Prkdcem26Cd52Il2rgem26Cd22/Nju (referred to as NSG) mice were purchased from Nanjing Biomedical Research Institute of Nanjing University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NOD-Prkdcem26Cd52Il2rgem26Cd22/Nju</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Examination was performed on a Cytek Aurora (Cytek Biosciences) and data were analyzed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were aligned with STAR RNA-seq aligner (Version 2.7.3a) using the UCSC/hg38 genome assembly and transcript annotation20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression levels were calculated as Fragments per Kilobase of transcript per Million reads (FPKM) using Cufflinks software21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cufflinks</div><div>suggested: (Cufflinks, RRID:SCR_014597)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed using Cuffdiff (version 2.2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cuffdiff</div><div>suggested: (Cuffdiff, RRID:SCR_001647)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">“Cluster Profiler” package (Release 3.16.1)22 and “DOSE” package (Release 3.14.0)23 in R software (version 4.0.2) was used for functional enrichment analysis, and GO biological processes terms at the significant level (q-value < 0.05) were employed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>“Cluster</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Profiler”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analyzed using GraphPad Prism 8 software (San Diego, CA, USA) and presented as mean values ± SEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.05.466755
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468174

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468174: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This work was approved by the Indiana University Institutional Review Board (IRB# 2004155084)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of the patients, the average age was 58 years (range 13-93 years), 25 (45%) were female and 27 (49%) had more than one specimen assessed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells and Viruses: Vero E6 cells (mycoplasma negative) were grown at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, St. Louis, MO) containing 10% fetal bovine serum (FBS) (Wisent Inc.), 2 mM L-glutamine (Thermo Fisher Scientific, Waltham, MA), 50 U/mL penicillin (Thermo Fisher Scientific), and 50 μg/mL streptomycin (Thermo Fisher Scientific).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following a one-hour incubation at 37°C, the serum-virus mixture was transferred to 96-well plates containing high-passage Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 B.1.617.2 was obtained with contributions from B. Zhou, N. Thornburg and S. Tong (Centers for Disease Control and Prevention, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 B.1.617.2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468174
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.01.466863

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.01.466863: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments adhered to the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice and study designs: 7-to 8-week-old female C57BL/6 mice (n=5) were purchased from The Jackson Laboratory (Bar Harbor, ME).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: SARS-CoV-2 Spike as well as HIV-1 Env specific binding antibodies were assessed by Enzyme-linked immunosorbent assays (ELISAs) as described previously [13, 14]. 96-well plates were coated with 1 µg/ml of SARS-CoV-2 S protein (Sino Biological) or HIV-1 clade C Env 459C gp140 in 1× Dulbecco’s phosphate-buffered saline (DPBS) and incubated at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1 clade C</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and S protein expressing pcDNA3.1-SARS CoV-2 SΔCT were co-transfected into HEK293T cells by lipofectamine 2000 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated at 37 °C for 1 h before adding to HEK293T-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice and study designs: 7-to 8-week-old female C57BL/6 mice (n=5) were purchased from The Jackson Laboratory (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the packaging construct psPAX2 (AIDS Resource and Reagent Program)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and S protein expressing pcDNA3.1-SARS CoV-2 SΔCT were co-transfected into HEK293T cells by lipofectamine 2000 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-CMV Puro-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the packaging construct psPAX2 (AIDS Resource and Reagent Program)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIDS Resource and Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism (version 9.0) software (GraphPad Software) and comparison between groups was performed using a two-tailed nonparametric Mann-Whitney U t test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.01.466863
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.02.466951

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.02.466951: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were then probed with SARS-CoV-2 spike antibody (NR-52947, BEI Resources, NIAID, NIH) in blocking buffer for 12 hr at 4°C, followed by secondary Goat Anti-Rabbit IgG antibody (ab6721, Abcam, RRID:AB_955447) incubation for 2hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>detected: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actin was labelled using antibody against beta-actin [AC-15] (HRP) (ab49900, Abcam, RRID: AB_867494).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against beta-actin</div><div>detected: (Abcam Cat# ab49900, RRID:AB_867494)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293 cells were transfected with 100 ng/well of pGL3-Fluc plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol at around 75-90% confluency in a 96 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: The following cell lines were used in this study, namely HEK 293T cells (CRL-1573, ATCC, RRID: CVCL_0045)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>detected: (NIH-ARP Cat# 103-306, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK 293T cells stably expressing human ACE2 (NR-52511, BEI Resources, NIAID, NIH, RRID:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero-E6 cells (CRL-1586, ATCC, RRID: CVCL_0574).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NR-52282, BEI Resources, NIAID, NIH) was propagated and quantified by plaque assay in Vero-E6 cells as described before (Case et al., 2020)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytotoxicity assay: HEK-ACE2 cells were seeded in 0.1 mg/mL poly-L-lysine (P9155-5MG, Sigma-Aldrich) coated 96-well plate to reach 70-80% confluency after 24 Hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus infection: HEK ACE2 cells were seeded in poly-L-lysine coated 24-well plate to reach 80% confluency at the time of infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp1 expression and purification: The gene construct encoding the Nsp1 from SARS-CoV-2 in pCDNA 5-3X-Flag-Nsp1 was amplified and sub-cloned into pET28a with N-terminal His-tag (Schubert et al., 2020; Thoms et al., 2020) using appropriate primers (Supplementary table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA 5-3X-Flag-Nsp1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET28a</div><div>suggested: RRID:Addgene_114156)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">the cultures were then transferred at 16°C at 120 rpm, and the expression of pET28a-His-Nsp1 and pET28a-His-Nsp1Δ40 were induced by adding 1 mM of Isopropyl β-d-1-thiogalactopyranoside (IPTG) and allowed to grow for 18 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a-His-Nsp1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET28a-His-Nsp1Δ40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293 cells were transfected with 100 ng/well of pGL3-Fluc plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol at around 75-90% confluency in a 96 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGL3-Fluc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid expressing the Nsp1 protein (pcDNA 3.1-Nsp1) was co-transfected at 100 ng/well concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.1-Nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 hr incubation, cells were fixed with 4% paraformaldehyde, and crystal violet (C6158, Merck) staining was done to visualize the plaques. Plasmids: pLVX-EF1alpha-SARS-CoV-2-nsp1-2xStrep-IRES-Puro expressing SARS CoV-2 NSP1 was a kind gift from Prof. Nevan Krogan (Gordon et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-nsp1-2xStrep-IRES-Puro</div><div>suggested: RRID:Addgene_141367)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other plasmids used in this study include Plasmids pRL-TK (mammalian vector for weak constitutive expression of wild-type Renilla luciferase), pGL4 (mammalian vector expressing firefly luciferase), pIFN-β Luc (IFN beta promoter-driven firefly luciferase reporter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRL-TK</div><div>suggested: RRID:Addgene_11313)</div></div><div style="margin-bottom:8px"><div>pGL4</div><div>suggested: RRID:Addgene_48744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pMTB242 pcDNA5 FRT-TO-3xFLAG-3C-Nsp1_SARS2 was a kind gift from Prof. Ronald Beckmann.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMTB242</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the library was screened against the 18S rRNA interacting interface of Nsp1-C-ter using the Surflex-dock program, which is available in SYBYL v2.1 (Jain, 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Surflex-dock</div><div>suggested: (Surflex-Dock, RRID:SCR_000196)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was analysed by using ThermControl software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermControl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The two subsequent 100 ns runs from MD simulations were further subjected to perform the MM-PBSA by using the python script (mmpbsa.py) to calculate the binding energy of the two drugs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative intensity of bands was quantified using Fiji/imageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji/imageJ</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.02.466951
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.29.466470

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.29.466470: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Monoclonal antibodies MAb362 isotypes IgG1 and IgA1 has been described before(32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">REGN10987, S309 and CR3022 antibodies heavy and light variable region sequences(33, 34, 58) were synthesized and cloned into pcDNA3.1 vector (Invitrogen™, Thermo Fisher Scientific, Waltham, MA, USA) in-frame with human IgG heavy or light chain Fc fragment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 2G12 monoclonal antibody was expressed in ExpiCHO-S™ cells through co-transfection of plasmids encoding light and IgG heavy chains(59), using the ExpiFectamine™ CHO transfection kit (Gibco™, Thermo Fisher Scientific, Waltham, MA, USA) according to manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2G12</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies 4A8 and 1A9 were purchased from BioVision (Milpitas, CA, USA) and GeneTex (Irvine, CA, USA), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1A9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-6x-His-tag polyclonal antibody, and both HRP-conjugated anti-mouse IgG Fc and anti-human IgG Fc were purchased from Invitrogen™ (Waltham, MA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6x-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used a rabbit anti-6X-His antibody (Invitrogen™, Waltham, MA, USA) to detect histidine-tagged proteins or mouse 1A9 antibody (GeneTex, Irvine, CA, USA) for specific detection of SARS-CoV-2 SΔTM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were washed three times with PBS-T and then incubated with secondary HRP-conjugated anti-rabbit IgG (Abcam, Cambridge, UK) or anti-mouse IgG (Invitrogen™, Waltham, MA, USA) antibodies diluted in 0.5% (w/v) skim milk/PBS-T and incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibodies, HRP-conjugated anti-human kappa antibody (SouthernBiotech, Birmingham, AL, USA) diluted 1:4000 in PBS was used in wells treated with MAb362, CR3022 and S309 antibodies, while HRP-conjugated anti-human IgG Fc (Invitrogen™, Waltham, MA, USA) diluted 1:10,000 in PBS was used in wells treated with REGN10987, 4A8 and 2G12 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human kappa</div><div>suggested: (Abgent Cat# AT4000a, RRID:AB_1554597)</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1). smFRET imaging: Labeled SΔTM spikes (100-200 nM) were incubated in the absence or presence of unlabeled ACE2 or the indicated antibody at a monomer:ACE2 or monomer:antibody ratio of 1:3 for 90 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two-tailed nonparametric Spearman test with 95% confidence was performed to evaluate the correlation level between the occupancy of SΔTM in the open conformation due to allosteric antibody binding and ACE2 binding (Figs. 4 and 5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2 binding (Figs. 4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">glycoprotein ectodomain (SΔTM) (residues Q14–K1211) with SGAG substitution at the furin cleavage site (R682 to R685), and proline substitutions at K986 and V987, was synthesized by GenScript® (Piscataway, NJ, USA) and inserted into pcDNA3.1(−).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SΔTM hetero-trimers for smFRET experiments were expressed by co-transfection with both the untagged SΔTM (D614 or D614G) construct and the corresponding 161/345A4-tagged SΔTM plasmid at a 2:1 molar ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SΔTM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SΔTM concentration was also estimated by densitometric analysis of protein bands on immunoblots with the monoclonal antibody 1A9 as described below, and using ImageJ software v1.52q (NIH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All smFRET data were processed and analyzed using the SPARTAN software (www.scottcblanchardlab.com/software) in Matlab (Mathworks, Natick, MA, USA)(65).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">smFRET trajectories were idealized to a 3-state hidden Markov model and the transition rates were optimized using the maximum point likelihood algorithm(66), implemented in SPARTAN.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dissociation constants (KD) were determined using GraphPad Prism version 9.2.0 (GraphPad Software, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis: Protein structures from RCSB PDB were visualized and analyzed using PyMOL™ software version 2.0.7 (The PyMOL Molecular Graphic System,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL™</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.29.466470
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.29.466402

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.29.466402: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.29.466402
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.25.465706

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.25.465706: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Point mutations were identified in GISAID sequences as monitored by NEB Primer Monitor (primer-montor.neb.com), and 4 mutations reported in >10% of deposited sequences from >1 reporting location were chosen for LAMP screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LAMP</div><div>suggested: (LAMP, RRID:SCR_001740)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.25.465706
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.29.466408

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.29.466408: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the MUC1 ED, 5% mucin gels and a boric acid-Tris system were used as described previously45. α-MUC1-ED antibody 214D4 was used to detect MUC1 at a dilution of 1:1,000 in TSMT buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-MUC1-ED</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the CT of MUC1, 12% SDS-PAGE gel and α-MUC1-CT antibody CT2 was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-MUC1-CT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ACE2 detection, 10% SDS-PAGE gel and anti-ACE2 antibody (1:1,000, HPA000288, Sigma-Aldrich) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Sigma-Aldrich Cat# HPA000288, RRID:AB_1078160)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actin was detected using α-actin antibody (1:5,000; bs-0061R, Bioss).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used were α-mouse IgG secondary antibody (1:10,000; A2304, Sigma), α-Armenian hamster IgG (1:10,000; GTX25745, Genetex) and α-rabbit IgG (1:10,000; A4914, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: (Sigma-Aldrich Cat# A2304, RRID:AB_257993)</div></div><div style="margin-bottom:8px"><div>α-Armenian hamster IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Calu-3 cells (ATCC Catalog # HTB-55), HEK-293T (ATCC Catalog # CRL-3216) and BHK-21 cells (ATCC Catalog # CCL-10) cells were routinely grown in 25 cm2 flasks in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal calf serum (FCS) at 37°C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CCL-10, RRID:CVCL_1915)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection experiments with the authentic SARS-CoV-2 virus, Calu-3 cells were prepared as described above and inoculated with approximately 200 pfu of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dimensionality reduction was done using the Seurat Package42 in Rstudio (version 1.2.5019), starting with a principle component analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescent stainings were performed as described for SARS-CoV-2 stock production and scanned plates were analyzed using ImageQuant TL software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GraphPad Prism 9 software package was used for all statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 17, 19 and 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.29.466408
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.28.466298

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.28.466298: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 COVID-19 gene dataset construction: To construct the COVID-19 dataset, the COVID-19 curated geneset has been downloaded from the Comparative Toxicogenomics Database (CTD) (http://ctdbase.org/) [19] DisGeNET (a database of gene-disease associations) (https://www.disgenet.org/) [20] and the study of Gordon et al [21].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://ctdbase.org/</div><div>suggested: (Comparative Toxicogenomics Database, RRID:SCR_006530)</div></div><div style="margin-bottom:8px"><div>https://www.disgenet.org/</div><div>suggested: (DisGeNET, RRID:SCR_006178)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The common overlapping 248 genes COVID-19 and COPD genes were obtained from Venny tools (https://bioinfogp.cnb.csic.es/tools/venny/) [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://bioinfogp.cnb.csic.es/tools/venny/</div><div>suggested: (Venny 2.1, RRID:SCR_016561)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.4 Protein-protein network construction using Cytoscape: To construct a protein-protein interaction (PPI) network, the 248 common overlapping genes were input into the String app [23] in Cytoscape (v 3.8.0) [24] downloaded through the App manager option to build an interaction network.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Maximal Clique Centrality (MCC) algorithm is used in Cytohubba to calculate the top 10 ranked nodes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytohubba</div><div>suggested: (cytoHubba, RRID:SCR_017677)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Gene Ontology of top 10 common overlapping genes in COVID-19 and COPD: WebGestalt (WEB-based Gene SeT Analysis Toolkit) http://www.webgestalt.org/ [26] have been used to find the gene enrichments and gene ontology of the top 10 common overlapping genes in COVID-19 and COPD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene SeT Analysis Toolkit</div><div>suggested: (WebGestalt: WEB-based GEne SeT AnaLysis Toolkit, RRID:SCR_006786)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.6 Gene pathway analysis of top 10 common overlapping genes in COVID-19 and COPD: WebGestalt (WEB-based Gene SeT Analysis Toolkit) http://www.webgestalt.org/ has been used to find the gene pathway of the top 10 common overlapping genes in COVID-19 and COPD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebGestalt</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homosapiens have been used as the organism of interest, Over-Representation Analysis (ORA) have been selected for the method of interest, and for the functional database, the KEGG pathway has been selected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.28.466298
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.09.467693

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.09.467693: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sample collection and studies were performed in accordance with the UK Policy Framework for Health and Social Care Research and with specific Research Ethics Committee approval (REC 20/SC/0310).<br>IRB: Sample collection and studies were performed in accordance with the UK Policy Framework for Health and Social Care Research and with specific Research Ethics Committee approval (REC 20/SC/0310).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in milk prior to detection with specific antibodies: 1:1000 ACE2 rabbit (Abcam, Ab108209),1:5000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and plasmids: HEK293T-17 (ATCC, CRL-11268™), Calu-3 (ATCC, HTB-55™), A549-ACE2, Vero-E6, Vero-E6-TMPRSS2 and A549-ACE2 expressing the individual IFITM proteins were cultured in DMEM (Gibco) with 10% FBS (Invitrogen) and 200μg/ml Gentamicin (Sigma), and incubated at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 stable cell lines expressing ACE2 (pMIGR1-puro), and IFITMs (pLHCX) were generated and selected as described previously (Winstone et al., 2021)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Passage and titration of SARS-CoV-2: PHE England strain 02/2020 was propagated in Vero-E6-TMPRSS2 cells and titre was determined by plaque assay (Winstone et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 2.5 μg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes(Rihn et al., 2021) using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-hACE2-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated until signs of viral replication (syncytia formation) became visible (usually after 2-3 days), at which time the medium was collected (P0 stock) and used further as a source of rescued virus to infect VERO E6 cells to generate P1 and P2 stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Clinical Viral Isolates: Viruses were isolated on Vero.E6 cells (ATCC CRL 1586™) from combined naso-oropharyngeal swabs submitted for routine diagnostic testing by real-time RT-PCR and shown to be from the B.1.1.7 (alpha) variant by on-site whole-genome sequencing (Oxford Nanopore Technologies, Oxford, UK) (Pickering et al., 2021)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero.E6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral RNA levels in cells or supernatants were measured 48 hours after infection by RT-qPCR. siRNA knockdown of IFITM2: A549-ACE2 cells were reverse transfected using 20pmol of Non-targeting siRNA (D-001206-13-20) or IFITM2 siRNA (M-020103-02-0010) and 1μL of RNAi max (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 stable cell lines expressing ACE2 (pMIGR1-puro), and IFITMs (pLHCX) were generated and selected as described previously (Winstone et al., 2021)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMIGR1-puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a set of overlapping cDNA fragments representing the entire genomes of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) and the B.1.1.7 alpha variant were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc and Genewiz, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57-Kan</div><div>suggested: RRID:Addgene_123653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate Wuhan virus carrying the alpha variant spike, a mixture of the relevant synthetic cDNA fragments of the Wuhan and alpha variants was co-transformed with XhoI-BamHI-cut pEB2 into the Saccharomyces cerevisiae strain TYC1 (MATa, ura3-52, leu2Δ1, cyh2r, containing a knockout of DNA Ligase 4) (Gaida et al., 2011) that had been made competent for DNA uptake using the LiCl2-based Yeast transformation kit (YEAST1-1KT, Merck).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEB2</div><div>suggested: RRID:Addgene_104001)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were sequenced using Oxford Nanopore as previously described(da Silva Filipe et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.09.467693
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468037

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468037: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval and blood samples: This study was approved by the Ethics Committee of Shenzhen Third People’s Hospital, China (approval number: 2020-030).<br>Consent: All participants had provided written informed consent for sample collection and subsequent analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed, and HRP-conjugated goat anti-human IgG antibodies (ZSGB-BIO) were added and then incubated at 37 °C for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric analysis of RBD-specific memory B cells: Thawed PBMCs were stained with an antibody cocktail consisting of CD19- PE-Cy7, CD3-Pacific Blue, CD8-Pacific Blue, CD14-Pacific Blue, CD27-APC-H7, and IgG-FITC (all from BD Biosciences) to gate IgG+ memory B cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD27-APC-H7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two anti-His secondary antibodies separately labeled with APC and PE (Abcam) were both used to recognize the RBD bait and exclude nonspecific staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus-based neutralizing assay: SARS-CoV-2 pseudovirus was generated by cotransfection of HEK-293T cells with SARS-CoV-2 spike-expressing plasmid and an env-deficient HIV-1 backbone vector (pNL4-3.Luc.R-E-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T-hACE2 cells were subsequently added to the plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus-based neutralizing assay: SARS-CoV-2 pseudovirus was generated by cotransfection of HEK-293T cells with SARS-CoV-2 spike-expressing plasmid and an env-deficient HIV-1 backbone vector (pNL4-3.Luc.R-E-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1</div><div>suggested: RRID:Addgene_115809)</div></div><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50% inhibitory dilution (ID50) was calculated using GraphPad Prism 8.0 software by log (inhibitor) vs. normalized response - Variable slope (four parameters) model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric data were acquired on an Aria II flow cytometer (BD Biosciences) and analyzed using FlowJo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468037
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468025

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468025: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells (ATCC-CCL-81, obtained from LGC Standards) were seeded into the wells of a 96-well plate in Dulbecco’s Modified Eagle Medium - DMEM (Gibco, Carlsbad, California) with 2% fetal calf serum (PAN Biotech, Germany) and 1% penicillin/streptomycin (Gibco, Carlsbad, California) at a density of 5×103 cells well-1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MTT assay of D-CDP1 and D-CDP7 on Vero CCL-81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 value was calculated by plotting the initial velocity against various concentrations of the combined molecules using a dose-response curve in GraphPad Prism5 software (Tecan, Männedorf, Switzerland), and data are presented as mean ± SD. 4.6 Determination of inhibition mode: The inhibition mode was determined using different final concentrations of the inhibitors and substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed with GraphPad Prism software version 8 (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4GV5), the D-CDP1 was generated using the tleap in Amber.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber</div><div>suggested: (AMBER, RRID:SCR_016151)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The top four structures were downloaded and viewed by PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.17 Molecular Dynamics Analysis and Interaction Energy Calculation: MD results were analyzed using CPPTRAJ [53] tools for the AmberTools19 package [54].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AmberTools19</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468025
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.05.467537

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.05.467537: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was approved by the Ethical Approval Committee of Shandong Center for Disease Control and Prevention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Qualitative SARS-CoV-2 IgG detection: The IgG antibodies were detected using an indirect ELISA kit (Beijing Wantai Biological Pharmacy Enterprise Co, China)(15, 16) based on a recombinant nucleoprotein of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A serum sample with an OD value ≥cut-off OD value was considered to be an anti-N IgG antibody positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The TOM obtained was then clustered by dissimilarity between genes, and we performed hierarchical clustering to identify modules, each containing at least 30 genes (minModuleSize=30).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TOM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PPI network construction: The initial PPI network for the protein products of identified up and down regulated DEGs was constructed using the STRING Database(19) (STRING v11.5; https://string-db.org/), and then the network was visualized and analyzed with Cytoscape software(20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathway enrichment analysis: To be aware of the prospective functions of characteristic genes identified by the PPI network analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were identified using CluGO from Cytoscape software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Weighted Gene Co-expression Network Analysis (WGCNA): We constructed the co-expression network through WGCNA package(21) in R software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Weighted Gene Co-expression Network Analysis</div><div>suggested: (Weighted Gene Co-expression Network Analysis, RRID:SCR_003302)</div></div><div style="margin-bottom:8px"><div>WGCNA</div><div>suggested: (Weighted Gene Co-expression Network Analysis, RRID:SCR_003302)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes in significant modules were analyzed using cytoHubba and GeneMANIA in Cytoscape software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cytoHubba</div><div>suggested: (cytoHubba, RRID:SCR_017677)</div></div><div style="margin-bottom:8px"><div>GeneMANIA</div><div>suggested: (GeneMANIA, RRID:SCR_005709)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.05.467537
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.08.467715

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.08.467715: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: 4.5 Ethics approval: All participants provided written informed consents prior to starting the study.<br>IRB: Research protocols were approved and supervised (LDYYL-2020-24) by the Institutional Review Board of the First Hospital of Lanzhou University and conformed to the ethical guidelines of the 1975 Declaration of Helsinki.<br>IACUC: Research protocols were approved and supervised (LDYYL-2020-24) by the Institutional Review Board of the First Hospital of Lanzhou University and conformed to the ethical guidelines of the 1975 Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, qualified reads were aligned to the human genome by employing Bowtie2 v2.2.0 to remove host contamination, followed by de novo assembly to construct the contigs for each sample by respectively applying IDBA-UD v1.1.1 and Trinity v2.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div><div style="margin-bottom:8px"><div>IDBA-UD</div><div>suggested: (IDBA-UD, RRID:SCR_011912)</div></div><div style="margin-bottom:8px"><div>Trinity</div><div>suggested: (Trinity, RRID:SCR_013048)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">And then, the contigs were clustered to by CD-HIT v4.6.1 to obtain unigenes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-HIT</div><div>suggested: (CD-HIT, RRID:SCR_007105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, unigenes were aligned against the NCBI NR database to obtain the lowest common ancestor taxonomy of them with DIAMOND v 0.9.14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI NR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>DIAMOND</div><div>suggested: (DIAMOND, RRID:SCR_009457)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alpha diversity was calculated using QIIME v1.8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QIIME</div><div>suggested: (QIIME, RRID:SCR_008249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential bacterial taxa between groups were identified conducting Linear discrimination analysis (LDA) effect size (LEfSe) analysis, and taxon with an LDA◻>◻3.0-fold were considered significantly different.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LEfSe</div><div>suggested: (LEfSe, RRID:SCR_014609)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations of the study should be mentioned. First, this is a single-center study with a moderate sample size, which does not apply to all COVID-19 patients. The corresponding relationship between SARS-CoV-2 infection and intestinal flora dysbiosis should be validated in a larger cohort, including subgroups at different stages of the disease. Though several species that may be central players for COVID-19 progression were discussed and reviewed (Table S9 and S10), meta-analysis from current multicenter and different studies to obtain universal conclusions is urgently warranted [18, 31, 32, 34, 35, 44, 58]. Moreover, this study depicted the alterations between patients at different stages of COVID-19, while no specific assessment has been conducted on the changes in COVID-19 microbiota and functions over time. Albeit we tried to control the variation degree between COVID-19 patients and the healthy controls, the alternations of gut microbiota may be influenced by other confounding factors, such as lifestyle, dietary habits, underlying diseases, complications, and clinical management. Lastly, the disease stage of COVID-19 at the time of stool sample collection is uncertain and there is a lack of information on pre-infection stool samples. Collectively, this study further revealed alterations in the composition and function of active intestinal microflora in COVID-19 cases. Specific microbial biomarkers of COVID-19 patients were screened and correlated with clinical indica...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.08.467715
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.467990

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.467990: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The positive and negative sera were provided by a health center, with prior informed consent to the patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was washed with PBS-Tween 20 0.05% and incubated with peroxidase-conjugated anti-human IgG antibody (Sigma, USA) at a dilution of 1: 1000, in blocking buffer for 1 h at 37°C, and finally wash with PBS-Tween 20 0.05%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transformation and verification of the expression vector in E. coli: The plasmid pET20b-N (4ug) is resuspended in 100 uL of Megapure water and 5 ng is used to transform the E. coli Top10 (Invitrogen, USA) to maintain the plasmid and in the strain of E. coli BL21 (DE3) (Novagen, USA) for your expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET20b-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of protein N in E. coli cepa BL21 (DE3): The construction of the recombinant SARS-CoV-2 N protein in the pET20b vector encodes a protein of 667 amino acids with a weight of 51 kDa.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET20b</div><div>suggested: RRID:Addgene_50723)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.467990
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.467646

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.467646: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining reads were assembled de novo using MEGAHIT61 (version 1.2.6) deploying default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGAHIT61</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among the virus contigs described here, those likely associated with vertebrates, specifically vertebrate-specific viruses and vector-borne vertebrate viruses, were preliminarily identified based on the taxonomic lineage information of the blastx results and confirmed by phylogenetic analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>blastx</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To estimate the relative abundance of each virus species in each library, quality-trimmed reads were firstly mapped to the SILIVA database (www.arb-silva.de, version 132.1) using Bowtie2 (version 2.3.5.1)65 to remove reads associated with ribosomal RNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following sequence alignment, all ambiguous aligned regions were removed using TrimAL67 (version 1.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TrimAL67</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were then estimated for the sequence alignment of each family using the maximum likelihood method available in PhyML (version 3.1)68, employing the LG model of amino acid substitution and a subtree pruning and the regrafting (SPR) branch swapping algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.467646
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.01.466695

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.01.466695: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.01.466695
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.29.466418

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.29.466418: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of anti-Spike, anti-RBD and neutralizing IgG antibodies: Anti-Spike IgG were titrated by multiplex bead assay: Briefly, Luminex beads were coupled to the Spike protein as previously described (63) and added to a Bio-Plex plate (BioRad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike, anti-RBD and neutralizing IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beads were then washed and anti-NHP IgG-PE secondary antibody (Southern Biotech, clone SB108a) was added at a 1:500 dilution for 45 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NHP IgG-PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, detection antibody was added (MSD SULFO-TAGTM Anti-Human IgG Antibody) and then MSD GOLDTM Read Buffer B was added and plates read using a MESO QuickPlex SQ 120MM Reader.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody measurements after the second exposure to SARS-CoV-2. Fig. S5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Nucleocapsid and the Spike RBD domain (Genbank # NC_045512.2) were cloned and produced in E. Coli and CHO cells, respectively, as previously described (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EC50 value of each sample was determined using GraphPad Prism 8 and antibody titer was calculated as log (1/EC50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model parameters were estimated with the SAEM algorithm (Monolix® software version 2019R1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Monolix®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were generated using R version 3.6.1 and Excel 2016 and details on the statistical analysis for the experiments can be found in the accompanying figure legends.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of our study is that the prediction potential of our model relies on the range of the immune markers measured. However, our approach would allow a full exploitation of the data generated as in systems serology where non-neutralizing Ab functions, such as Ab-dependent cellular cytotoxicity (ADCC), Ab-dependent cellular phagocytosis (ADCP), Ab-dependent complement deposition (ADCD), and Ab-dependent respiratory burst (ADRB) are explored (38). The role of ADCC in natural infection has been previously shown (39), ADCD in DNA vaccine recipients (11) and with Ad26 vaccine (40). Here, we extended significantly these data by modelling the viral dynamic, showing that two other protein-based vaccines exert an additional effect on infected cell death which relied on the level of IgG anti-RBD binding antibodies especially for the CD40.RBD targeting vaccine. Measurements of other non-neutralizing Ab functions would probably also capture this additional effect. The next question after determining which marker is a valid mCoP is to define the concentration that leads to protection, looking for a threshold effect that will help to define an objective (10, 41). In the context of SARS-CoV-2 virus, several emerged variants are leading to a significant reduction of viral neutralization as measured by various approaches. However, a 20-fold reduction of viral neutralization might not translate in 20-fold reduction of vaccine efficacy (42). First, there are many steps between viral n...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2021.10.29.466418v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.25.465798

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.25.465798: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.25.465798
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.24.465626

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.24.465626: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the Stanford Institutional Review Board and all subjects gave written, informed consent.<br>Consent: The protocol was approved by the Stanford Institutional Review Board and all subjects gave written, informed consent.<br>Field Sample Permit: Sample preparation for Luminex: Supernatants from mock or infected SVC were collected after 24 hpi into low-binding protein collection tubes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This function generates an average module score by calculating the mean expression of each gene in the module corrected for expression of a random set of similarly expressing genes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: VeroE6 cells were obtained from ATCC and were mycoplasma free.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus and cell lines: The USA WA1/2020 strain of SARS-CoV-2 was obtained from BEI Resources, passaged in VeroE6 cells, and tittered by Avicel (FMC Biopolymer) overlay plaque assay on VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation of Remdesivir treatments in A549-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A standard curve for Ct values and genome copy numbers was obtained using pET21b+ plasmid with the N-gene inserts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET21b+</div><div>suggested: RRID:Addgene_92208)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment and preprocessing of scRNA-seq data: The quality of the raw FASTQ data was examined with FASTQC and then aligned (cell ranger count) to a custom genome including human genome (hg38) and the complete genome sequence of SARS-CoV-2 (2019-nCOV/USA-WA1/2020) (GenBank: MN985325.1) using the “Cell Ranger” software package v6.0.0 (10x Genomics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>Ranger”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, count matrices were merged and loaded into Seurat with SARS-CoV-2 counts removed and appended to the metadata.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps were generated using ComplexHeatmap, Seurat and pheatmap packages, Violin plots were generated using ggplot2, and dotplots were generated using the Seurat packages in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism version 9.1.0 (216) and R (4.0.4) were used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO and KEGG term enrichment for markers of C12 macrophages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data from scRNA-seq will be deposited with the Gene Expression Omnibus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. Our numbers of replicates were limited for some assays, such as the evaluation of cytokine secretion following infection of mature adipocytes. Nonetheless, we observed significant indications of inflammatory responses. It is possible that we were unable to fully wash input virus following infection of mature adipocytes due to the high lipid content, size, and fragility of the cells, falsely increasing the viral signal. However, our detection of sgRNA, the time-dependent increase in viral RNA accumulation that was inhibited by remdesivir, and the detection of SARS-CoV-2 RNA in autopsy samples all provide orthogonal support for true infection of adipocytes. Our autopsy studies were limited in number, and we were only able to perform confirmatory ISH on epicardium, not in the subcutaneous, omental, or pericardial fat due to limited autopsy tissue availability. All experiments were performed with the WA-01 strain of SARS-CoV-2 and no experiments with its variants were performed, and plaque assays to confirm viral production were not performed. As tissue donors were obese, an important area of future investigation will be to study the effects of SARS-CoV-2 infection on lean adipose tissue, as well as to study the adipose tissue of those with ‘long COVID’. Overall, here we provide evidence that two cell types within human adipose tissue are permissive to SARS-CoV-2 infection. This adds to data showing susceptibility of other tissues including hear...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.24.465626
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.23.465567

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.23.465567: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Ethics Committee for Animal Research of University of Sao Paulo (CEUA n° 7971160320 / 3147240820) and all efforts were made to minimize animal suffering.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Brain samples from SARS-CoV-2-infected and uninfected hamsters from two unrelated experiments were used herein (one performed with 15–16-week-old females and another with 18-week-old males).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Quantification was made using ImageJ software (NIH), where 5 to 10 randomly chosen visual fields per coverslip from three independent cultures were analyzed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After antigen retrieval (Tris/EDTA-Tween-20 buffer -10mM Tris, 1mM EDTA, 0.05% Tween 20, pH 9 - for 30 minutes at 95°C, followed by 20 minutes at room temperature), cells were permeabilized with 0.5% Triton-X100 in PBS for 10 minutes, blocked with blocking solution (5% donkey serum + 0.05% Triton X-100 in PBS) (Sigma-Aldrich) for 2 hours at room temperature and incubated with primary antibodies: GFAP (1:1000, Sigma-Aldrich), IBA1 (1:500, Abcam), and MAP2 (1:500, Sigma-Aldrich) diluted in blocking solution, overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IBA1</div><div>suggested: (ChromoTek Cat# smsG1Cys2-1, RRID:AB_2864263)</div></div><div style="margin-bottom:8px"><div>MAP2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inoculum was then added to the flask containing Vero cells and maintained for 1 hour at 37°C, following addition of fresh DMEM low glucose media supplemented with 2% FBS and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This virus was obtained from nasopharyngeal swabs from the first patient (HIAE01) to be diagnosed with COVID-19 in Brazil, isolated in Vero ATCC CCL-81 cells and quantified by using the Median Tissue Culture Infectious Dose (TCID50) assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero ATCC CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque-forming unit assay: For virus titration, Vero CCL81 cells were seeded in 24 well plates one day before the infection for adhesion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Label free quantitative analysis was obtained using the relative abundance intensity integrated in Progenesis software, using all peptides identified for normalization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Progenesis</div><div>suggested: (Progenesis QI, RRID:SCR_018923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generated images were loaded into Fiji software for further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mitochondrial analysis: For measurements of mitochondrial superoxide, the cells were stained with LIVE/DEAD™ Fixable Green (L34970; ThermoFisher®, 15 min) and MitoSOX™ Red mitochondrial superoxide indicator (M36008; ThermoFisher®; 2.5uM, 10 min).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher®</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were analyzed using a Accuri C6 Plus (BD Biosciences®) cytometer and data analyzed using FlowJo X software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences®</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification was made using ImageJ software (NIH), where 5 to 10 randomly chosen visual fields per coverslip from three independent cultures were analyzed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single Nuclei Transcriptomic Profile Analysis: Raw snRNA-seq data were obtained from frozen medial frontal cortex tissue from six post- mortem control and seven COVID-19 patients assessed herein were obtained from the dataset GSE159812 on NCBI GeneExpression Omnibus public databank.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI GeneExpression Omnibus</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(DEGs) corresponding to the Differentially Expressed Proteins (DEPs) from hamster brain proteomics and concordant fold-change were subjected to Gene Ontology analysis, performed through online database PANTHER using PANTHER Pathways dataset34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANTHER</div><div>suggested: (PANTHER, RRID:SCR_004869)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data was plotted and analyzed using the GraphPad Prism 8.0 software (GraphPad Software®, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.23.465567
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.22.465476

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.22.465476: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.22.465476
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.22.465481

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.22.465481: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Emory Institutional Review Board (IRB) under protocol numbers IRB00058507, IRB00057983 and IRB00058271.<br>Consent: Informed consent was obtained from the patients when they had decision making ability or from a legal authorized representative (LAR) if the patient was unable to provide consent.<br>Field Sample Permit: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer. 2.2 Virus and cells: African green monkey (Cercopithecus aethiops) kidney epithelial cells (Vero E6 cells; ATCC® CRL-1586™) were maintained in complete (c)DMEM containing: 1X DMEM supplemented with 25 mM HEPES, 2 mM L-glutamine,1 mM sodium pyruvate, 1X non-essential amino acids (NEAA), 1X antibiotic/antimycotic solution (all from Corning) and 10% heat-inactivated FBS (Gibco), unless indicated otherwise.<br>IACUC: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer. 2.2 Virus and cells: African green monkey (Cercopithecus aethiops) kidney epithelial cells (Vero E6 cells; ATCC® CRL-1586™) were maintained in complete (c)DMEM containing: 1X DMEM supplemented with 25 mM HEPES, 2 mM L-glutamine,1 mM sodium pyruvate, 1X non-essential amino acids (NEAA), 1X antibiotic/antimycotic solution (all from Corning) and 10% heat-inactivated FBS (Gibco), unless indicated otherwise.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV-2 spike RBD polyclonal antibody (Gentaur) at 1:3000 overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: (Leinco Technologies Cat# LT3000, RRID:AB_2893948)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed to remove excess antibody, then incubated with a secondary HRP-conjugated anti-human IgG for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were assayed at 1:500 dilutions (in assay buffer) and surveyed for anti-SARS-CoV-2 N or RBD antibodies by 1 h incubation on a plate shaker at 800 rpm in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Median fluorescent intensity (MFI) using combined or individual detection antibodies (i.e., anti-IgA, anti-IgG, or anti-IgM) was measured and the background value of assay buffer was subtracted from each serum sample result to obtain MFI minus background values (net MFI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3.3 TCID50 assays: Vero E6 cells were seeded in 96-well plates with 2 × 104 cells/well in 5% MEM 24 h prior to infection and checked to verify ≥80% confluency. 10-fold dilutions of stock SCV2-WA1 virus in serum-free MEM (100 μL) were incubated on Vero E6 monolayers in quadruplicates for 2 h absorption at 37°C without rocking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were collected and diluted in Opti-MEM™ to final concentrations of 1:100 the extraction solvent or 1% Triton X-100, and >100 FFU/mL SARS-CoV-2 per well for analysis by FRNA. 2.7 Inactivation for scRNA-seq (10X Genomics): SARS-CoV-2-infected Vero E6 cells (MOI 0.04 for 72 h) or Calu-3 cells (MOI 0.04 for 48 h) were encapsulated for scRNA-seq following the manufacturer’s protocol “Chromium Next GEM Single Cell V(D)J Reagent Kits v1.1 User Guide with Feature Barcode technology for Cell Surface Protein” (document number CG000208; 10X Genomics) targeting 20,000 and 10,000 cells, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Compound Discoverer 3.2 (ThermoFisher) was used to quantify peak areas and assign annotations based on a local library of reference standards or via matching metabolites to reference spectra in mzCloud (mzcloud.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mzCloud</div><div>suggested: (mzCloud, RRID:SCR_014669)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Splicing-aware aligner STAR (40) was used in FASTQ alignments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Complimentary (c)DNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™) per manufacturer’s instructions and diluted 1:5 in nuclease-free water, then 10 μL of diluted cDNA was used with the NEB Luna Universal Probe qPCR Mastermix (New England BioLabs®) following the manufacturer’s protocol and RT-qPCR performed in 384-well plates using a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems™)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>New England BioLabs®</div><div>suggested: (New England Biolabs, RRID:SCR_013517)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.22.465481
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.22.465294

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.22.465294: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After being blocked with 3% BSA in TBS buffer containing 0.05% Tween 20, the blot was probed with a human serum (1:1000 dilution) containing IgG to the SARS-CoV-2 nucleoprotein (NP) and with mouse anti-human GAPDH monoclonal antibody (G-9: Santa Cruz Biotechnology, Dallas, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleoprotein (NP)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen-antibody complexes were detected using peroxidase-conjugated goat anti-human or goat anti-mouse IgG (Sigma) and revealed using the enhanced chemiluminescence (ECL) system (Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human or goat anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, we screened 8721 Scopus-derived documents, referred to raloxifene, for the presence of at least one of the proteins/genes included in the Cytoscape-generated network; this allowed to isolate 600 papers, which were manually examined and annotated for enriched human gene ontology according to BiNGO v.3.5.0. Cells: African green monkey kidney Vero E6 cell line was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s Modified Eagle Medium</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (human, Caucasian, lung, adenocarcinoma) cell line was obtained from ATCC and maintained in Minimum Essential Medium (MEM; Gibco, Thermo-Fisher) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo-Fisher) at 37°C in a humidified atmosphere of 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A standard curve was generated by determination of copy numbers derived from serial dilutions (103-109 copies) of a pGEM T-easy vector (Promega, Madison, WI, USA) containing the receptor binding domain of the S gene (primers: RBD-F: 5’-GCTGGATCCCCTAATATTACAAACTTGTGCC-3’; RBD-R: 5’-TGCCTCGAGCTCAAGTGTCTGTGGATCAC-3’).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEM T-easy</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A list combining the two dataset was used as seeding for a BioGrid search by mean of Cytoscape v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGrid</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, we screened 8721 Scopus-derived documents, referred to raloxifene, for the presence of at least one of the proteins/genes included in the Cytoscape-generated network; this allowed to isolate 600 papers, which were manually examined and annotated for enriched human gene ontology according to BiNGO v.3.5.0. Cells: African green monkey kidney Vero E6 cell line was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s Modified Eagle Medium</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BiNGO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: The half-cytotoxic concentration (CC50) and the half-maximal inhibitory concentration (IC50) for raloxifene were calculated from concentration-effect-curves after non-linear regression analysis using GraphPad Prism8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical tests were performed using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04388683</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Inhaled Nitric Oxide for Preventing Progression in COVID-19</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.22.465294
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468057

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468057: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Lysates were sonicated using a tip sonicator with 3, 5 second bursts, at 70% power with chilling on ice between bursts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: A549-ACE cells were grown in RPMI1640 media with 10% FBS and 1% Pen/Strep and maintained free of mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">250uL of equalized lysate were then added to washed, antibody-conjugated protein A/G Dynabeads (2ug antibody conjugated to 15uL/15uL A/G dynabeads, resuspended in 50uL per IP) and IPs were rotated overnight at 4C in a final volume of 300uL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-conjugated protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slides were incubated in mouse primary antibody solution of anti SARS-CoV-2 nucleocapsid and rabbit anti-H3K9me3 antibody solution overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS-CoV-2 nucleocapsid</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div><div style="margin-bottom:8px"><div>anti-H3K9me3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then gently resuspended in 1 mL FACS buffer with a 1:500 dilution of anti-streptactin antibody and rotated at 4°C for 1 hour, protected from light.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-streptactin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and manual inspection was performed with Skyline10 (MacCoss Lab) and IPSA11. Antibodies: Data analysis and availability: Box and whisker plots show center line median, box limits for upper and lower quartiles, whiskers for 1.5x interquartile range, and points are outliers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IPSA11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549ACE2 cells: ACE expressing A549 cells were generated as previously described1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE cells were grown in RPMI1640 media with 10% FBS and 1% Pen/Strep and maintained free of mycoplasma.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK cells: HEK293T cells were cultured in DMEM (with 4.5 g/L glucose, L-glutamine and sodium pyruvate), 10% fetal bovine serum (Sigma Aldrich F2442-500ML), and 1% Penicillin-Streptomycin (Gibco 15140122) and maintained free of mycoplasma.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infections: SARS-CoV-2 (USA-WA1/2020 strain) was obtained from BEI and propagated in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RNA-sequencing analysis for HEK-293T cell experiments, GRCh38 assembly was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For PTM quantification, HEK cells and human lung tissue were imaged at a single z-plane and A549 cells were imaged with a z-stack through the nucleus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ATAC-sequencing analysis, alignments were performed with Bowtie2 (2.1.0)4 using the Hg38 genome using a ChIP-seq pipeline (https://github.com/shenlab-sinai/chip-seq_preprocess).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChIP-seq</div><div>suggested: (ChIP-seq, RRID:SCR_001237)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Orf8 ChIP-sequencing analysis, alignments were performed with Bowtie2 (2.1.0)4 using the Hg38 genome using a ChIP-seq pipeline (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Orf8 reads were mapped using NGS plot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were trimmed using TRIMMOMATIC (Bolger et al., 2014) with the options “ILLUMINACLIP:[adapter.fa]:2:30:10 LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:15”, and aligned to a hybrid hg38+C. floridanus (v7.5, RefSeq) genome assembly using bowtie2 v2.2.64 with the option “--sensitive-local”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TRIMMOMATIC</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignments with a mapping quality below 5 (using samtools) and duplicated reads were removed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STAR was used to generate bam files for subsequent TDF file generation using IGVtools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IGVtools</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all RNA-sequencing, reads were aligned using STAR (v2.6.1a) with default parameters and only uniquely mapped reads were retained for downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were counted towards human genes (GENCODE v35) and SARS-CoV-2 genes(WA-CDC-WA1/2020 MN985325.1 assembly) using featureCounts (v1.6.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data normalization and differential gene expression analysis was performed using DESeq2 R package (v1.26.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO enrichment analysis for differentially expressed genes was implemented using clusterProfiler R package (v3.14.3), using human genome annotation record in org.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis: Images were analyzed using Image J software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein alignment: To identify potential histone mimicry SARS-CoV-2 protein sequences were aligned to human histone protein sequences (H2A, H2B, H3.1,H3.2 H4, H2A.X, H2A.Z, macroH2A, and H3.3) using Multiple Sequence Comparison by Log-Expectation (MUSCLE) with default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A database search was performed using the human SwisProt sequence and Orf8 sequence with Proteome Discoverer 2.4 (Thermo Scientific) with the following search criteria: carboxyamidomethylation at cysteine residues as a fixed modification; oxidation at methionine, acetylation at lysine, mono-, di-, and tri-methylation at lysine residues as variable modifications; two maximum allowed missed cleavage; 10 ppm precursor MS tolerance; a 0.2 Da MS/MS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fiji was used for image analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468057
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266360

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266360: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both models were adjusted for the following potential confounders: annual average of ambient atmospheric particulate matter <2·5 µm in diameter (PM2·5) between 2000 and 2016, population density, poverty, education, proportions of White, proportions of male, proportion of population older than 65 years old, owner-occupied property, median house value, median household income, percentage of people under 65 years old without health insurance, prevalence of tobacco smoking, and obesity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study was subject to several limitations. First, ecologic study designs are vulnerable to the ecologic fallacy. Therefore, caution is required when interpreting the study results, especially when extrapolating population findings to the individual level. In addition, we cannot rule out the possibility of residual confounding even after controlling for numerous county-level and state-level covariates. Using COVID-19 reported cases may underestimate of the number of actual infections due to under-testing of asymptomatic patients. However, alternative estimates for cumulative incidence, such as seroprevalence26, also have limitations including sampling bias, test sensitivity and specificity, and the progress of the pandemic.27 Our analysis was not able to assess the impact of the three different vaccines currently available in the U.S., which likely had different efficacies. Although a detailed distribution of different variants in the U.S. was not available, we examined the associations before and after the Delta variant became the predominant strain. Therefore, our results represent the associations between vaccine rates overall and COVID-19 incidence and mortality in the U.S. for vaccines as actually deployed and SARS-CoV-2 variants as they circulated during the period of our analysis. The differential impact of rising population vaccination rates between before and after the spread of Delta variant might be due to the proportion of counties achieving >40% complete vaccin...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266360
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468737

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468737: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 nsp12, nsp10 and nsp7 gene were cloned into a modified pET-21b vector with the C-terminus possessing a 6×His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-21b</div><div>suggested: RRID:Addgene_132607)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp8 gene was cloned into the modified pET-32a vector with the N-terminus possessing a trx-His6-tag and PreScission Protease site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-32a</div><div>suggested: RRID:Addgene_120288)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp7-pET-21b plasmid was transformed into E. coli Rosetta-gami2 (DE3) and the transformed cells were cultured at 37 °C in LB with a final concentration of 100 μg/ml ampicillin and 25 μg/ml chloramphenicol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nsp7-pET-21b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp14 gene (nsp14-ExoN (residues 1–289)) was cloned into the modified pET-28b vector with the N-terminus possessing a MBP-tag and PreScission Protease site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28b</div><div>suggested: RRID:Addgene_47327)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR product was digested with Xho1 and BamH1 and ligated into pET-15b vector, and transformed into E-coli DH5α to obtain clones.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-15b</div><div>suggested: RRID:Addgene_108953)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468737
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.26.466002

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.26.466002: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The short-read sequences of Vero JCRB0111, Vero CCL-81, and Vero 76 were downloaded from a public database (DDBJ: PRJDB2865).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero JCRB0111</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired-end sequences of Vero E6 were determined using an Illumina HiSeq 2500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RNA-seq experiment data of Vero E6 TMPRSS2+ cells were downloaded from the public database (SRR13091741–SRR13091746) (Zhang et al. 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6 TMPRSS2+</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The single nucleotide variants (SNVs) and short indels (<50 bp) were called using VarScan 2 software (Koboldt et al. 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GTF format file downloaded from the Ensembl database was used for gene annotation (Chlorocebus_sabaeus.ChlSab1.1.86.gtf) and snpEFF software was used for annotating the effect of each genetic variation (Cingolani et al. 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div><div style="margin-bottom:8px"><div>snpEFF</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assignment for the gene function categories was performed using DAVID (Jiao et al. 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For evaluating the impact of missense variants, we used PROVEAN, SIFT, and PANTHER-PSEP (Choi et al. 2012; Choi and Chan 2015; Tang and Thomas 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PROVEAN</div><div>suggested: (PROVEAN, RRID:SCR_002182)</div></div><div style="margin-bottom:8px"><div>SIFT</div><div>suggested: (SIFT, RRID:SCR_012813)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RNA-seq reads were mapped to the reference genome using HISAT2 using the default parameters (Kim et al. 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Copy number variations and loss of heterozygosity: We used Control-FREEC software to identify copy number variations (CNVs) and loss of heterozygosity (LOH) (Boeva et al. 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Control-FREEC</div><div>suggested: (Control-FREEC, RRID:SCR_010822)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The f2 values were used as a genetic distance between two sublines and a neighbor-joining tree was constructed using MEGA X (Knyaz et al. 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.26.466002
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.465224

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.465224: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Placental tissue preparation and Immunohistochemistry: Ethics approval for the use of first trimester human placental tissues for research was obtained from the Human Ethics Committee at Monash Health (RES-19-0000-399A, Melbourne, Australia), all patients provided informed written consent.<br>Consent: Placental tissue preparation and Immunohistochemistry: Ethics approval for the use of first trimester human placental tissues for research was obtained from the Human Ethics Committee at Monash Health (RES-19-0000-399A, Melbourne, Australia), all patients provided informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then incubated with primary antibodies (ACE2, ab15438, Abcam,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human IgG1 antibodies were purified using Protein-A affinity chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of human antibody binding specificity by ELISA: 96-well flat-bottomed MaxiSorp plates were coated with 50 μl of 125 nM recombinant human or mouse ACE2 protein in PBS at room temperature for one hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human IgG secondary antibody (1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For affinity measurements against human ACE2, antibodies were loaded by submerging sensor tips for 200 s and then washed in kinetics buffer for 60 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies used in the study were: anti-HCG (ab9582, abcam, 1:200), anti-dsRNA (MABE1134, Merck, 1:200), anti-ACE2 (ab15348, abcam, 1:200), anti-GATA3 (MA1-028, Invitrogen, 1:100), and anti-HLA G (ab7759, abcam, 1:50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HCG</div><div>suggested: (Abcam Cat# ab9582, RRID:AB_296507)</div></div><div style="margin-bottom:8px"><div>anti-dsRNA ( MABE1134</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GATA3 ( MA1-028</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA G</div><div>suggested: (Abcam Cat# ab7759, RRID:AB_306053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used in the study (all 1:400) were Alexa Fluor 488 goat anti-mouse IgG1 (A21121, Invitrogen, Thermo Fisher Scientific)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: (Thermo Fisher Scientific Cat# A-21121, RRID:AB_2535764)</div></div><div style="margin-bottom:8px"><div>A21121</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Median TCID50 in supernatants were determined by 10-fold serial dilution in Vero cells and calculated using the Reed and Muench method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fabs from positive phage were reformatted into IgG1 expression plasmids and used for transient expression in Expi293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image Analysis/Cell Quantification: Cell quantification was performed using the particle analysis option of the ImageJ software (http://rsb.info.nih.gov/ij/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene expression analyses: Pre-processing RNA-seq: Raw next generation RNA sequencing (RNA-seq) reads were obtained in FASTQ format, and prior to demultiplexing the forward read FASTQ was trimmed with trimmomatic to 18 nucleotides (nt) (the targeted read length as described above) with the following parameters: SE -phred33 CROP:18 MINLEN:18 (Bolger et al., 2014)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were then mapped to a customised genome, composed of both GENCODE’s GRCh38.p13 and human SARS-CoV2 (RefSeq - NC_045512.2; see “Custom genome for mapping” below for further details), with STAR v2.5.2b (Dobin et al., 2013) and the parameters: --outSAMattributes All --alignIntronMax 1000000 --alignEndsType</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to library size normalisation, normalisation factors were calculated with EdgeR’s (v3.32.1) calcNormFactors function (Robinson et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hierarchical clustering was performed utilizing base R’s package stats (functions: dist and hclust), with the distance measure canberra and linkage method Ward.D.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hclust</div><div>suggested: (HCLUST, RRID:SCR_009154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dendrogram visualization was performed with dendexted v1.15.1 (parameter: k = 3) (Galili, 2015); 3D visualizations were performed with plotly v4.9.4.1 (Sievert, 2020); heatmap visualizations were performed with ComplexHeatmap v2.6.2 (Gu et al., 2016); all other visualizations were performed with ggplot2 v3.3.5 (Villanueva and Chen, 2019) and where required ggrepel v0.9.1 (Slowikowski et al., 2018)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene ontology and pathway analyses were performed with Metascape (http://metascape.org) (Zhou et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although, as demonstrated by our results, this infection model can be of great utility, there are limitations. For example, the decidua contains 10-20% of macrophages but we cannot model their effects in this system (Kreis et al., 2020, Manaster and Mandelboim, 2010). In the future, complex models that include immune cells could be used to enhance current models, as has been done with brain slice cultures and microglia from iPSC derived models (Grubman et al., 2021). Recent studies have reported that host cell factors such as ACE2, TMPRSS2 or cathepsins are vital for SARS-CoV-2 entry and could be utilized as potential therapeutic targets against infection (Dong et al., 2020, Hoffmann et al., 2020). We also reported that blocking viral infection through ACE2 blockade restores the functional phenotype in STs, similar to the rescue of function in lung and cardiac cells through the inhibition of ACE2 or TMPRSS2 activity (Huang et al., 2020, Hoffmann et al., 2021, Pei et al., 2020, Bojkova et al., 2020, Perez-Bermejo et al., 2021). More importantly, this in vitro derived placental model allowed us to generate a quick and effective system. We envision that our model will facilitate a deeper understanding of COVID-19 pathogenesis and will provide a platform for drug discovery and potential treatments.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 35, 19, 36 and 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.465224
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.26.465846

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.26.465846: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Its expression data were downloaded from GEO with code GSE65133 and its cell fractions were provided on the webpage of CIBERSORT [7].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CIBERSORT</div><div>suggested: (CIBERSORT, RRID:SCR_016955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Due to the original information loss of the processed single-cell expression profile, we just normalized raw counts of a certain gene with its maximum transcripts length obtained from BioMart [37].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioMart</div><div>suggested: (biomaRt, RRID:SCR_019214)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, to maintain the meaningful signature matrix, we decide to use MinMaxScaler() function provided by scikit-learn [39] to scale data into a range between 0 and 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RNA-Sieve, we used the python package provided by the author and used the default settings to deconvolve data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.26.465846
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.25.465646

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.25.465646: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Most of the human sera was collected from prospective bone marrow donors in Seattle with approval from the Human Subjects Institutional Review Board in the 1980s and were stored in the Infectious Disease Sciences Biospecimen Repository at the Vaccine and Infectious Disease Division of the Fred Hutch Cancer Center.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: None of the cell lines used were routinely tested for mycoplasma contamination</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h, virus inoculum was removed and cells were washed five times with DMEM prior addition of DMEM supplemented with anti-VSV-G antibody [Il-mouse hybridoma supernatant diluted 1 to 25 (v/v), from CRL-2700, ATCC] to minimize parental background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 h, the fusion-peptide-specific S2S8 monoclonal antibody was added at 1:250 dilution and incubated ON at 4°C with agitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2S8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, the membrane was washed three times with TBS-T and an Alexa Fluor 680-conjugated goat antihuman secondary antibody (1:50,000 dilution, Jackson ImmunoResearch, 109-625-098) was added and incubated during 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antihuman</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC: Human cells epithelial embryo (HEK293T, CRL-3216), Felis catus (CRFK, CCL-94), Canis familiaris epithelial kidney cells (MDCK, CCL-34), Canis familiaris tumor fibroblast cells (A-72, CRL-1542) and Sus scrofa pig testis fibroblast cells (ST, CRL-1746) or ThermoFisher Scientific: ExpiCHO cells and Expi293F™ cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus infections and neutralizations: For pseudotyped VSV infections and neutralizations, HEK293T cells were transfected with plasmids encoding for the different fulllength APN orthologs (flAPN) following the protocol described by (Eguia et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Genes used in this study were synthesized by GenScript, codon optimized for expression in mammalian cells, cloned into pcDNA3.1 (+) between KpnI and XhoI, in frame with a Kozak’s sequence to direct translation and with the signal peptide derived from the μ phosphatase: MGILPSPGMPALLSLVSLLSVLLMGCVAETGT (except for the full-length genes in which the original signal peptide was used).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 ( + )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 1AF10 Fab light and heavy sequences were obtained from Reguera et al., 2012 and cloned separately into pcDNA3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC: Human cells epithelial embryo (HEK293T, CRL-3216), Felis catus (CRFK, CCL-94), Canis familiaris epithelial kidney cells (MDCK, CCL-34), Canis familiaris tumor fibroblast cells (A-72, CRL-1542) and Sus scrofa pig testis fibroblast cells (ST, CRL-1746) or ThermoFisher Scientific: ExpiCHO cells and Expi293F™ cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The introduction of the desired mutation R to T was verified by sequencing purified plasmids by GENEWIZ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were plotted in Graphpad Prism (v.9.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad): cells alone without pseudovirus was defined as 0 % infection, and cells with virus only (no sera) was defined as 100 % infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D refinements were carried out using non-uniform refinement in cryoSPARC (Punjani et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CryoEM model building and analysis: UCSF Chimera (Pettersen et al., 2004) and Coot (Emsley et al., 2010) were used to fit atomic models (PDB 5SZS) into the cryoEM maps and Domain 0 was manually built.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.25.465646
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.08.467773

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.08.467773: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Mouse studies: Mouse studies were conducted at Murigenics (Vallejo, CA) under IACUC approved protocols.<br>IACUC: Mouse studies: Mouse studies were conducted at Murigenics (Vallejo, CA) under IACUC approved protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Balb/c mice (Envigo), 6–8 weeks old were used for all studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked for 1h in 5% skim milk in TBST and then probed with an anti-S2 mouse monoclonal antibody (GeneTex) at a 1:1000 dilution for 2h-overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were washed (0.05% Tween 20 in 1X TBS) and then probed with a Rabbit anti-Mouse HRP antibody (Bethyl labs) for 1h before washing and detection with a SuperSignal West Femto Maximum Sensitivity Substrate (Pierce).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A parallel blot using a mouse anti-actin antibody (Thermo Fisher) was used to ensure equivalent protein amounts per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracellular staining was performed in FACS buffer (PBS + 2% FBS + 2mM EDTA) with the following antibodies: CD4 (GK1.5, Biolegend), CD8 (53-6.7, BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular staining was then performed in permeabilization buffer with the following antibodies: IFNγ (XMG21.2, Invitrogen), TNFα (MP6-XT22, eBiosciences), IL2 (JES6-5H4, eBiosciences), IL4 (11B11, Biolegend), IL10 (JES5-16E3, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JES5-16E3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The intensity of the light being emitted is inversely proportional to the amount of anti-SARS-CoV-2 neutralizing Spike antibodies bound to the VSVΔG – Spike ΔCT particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 neutralizing Spike</div><div>suggested: (Creative Diagnostics Cat# CABT-CS064, RRID:AB_2891088)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated with anti-nucleocapsid protein primary antibody cocktail (clones HM1056 and HM1057) (EastCoast Bio, North Berwick, ME) for 60 minutes at 37°C (Battelle Memorial Institute, Patent Number 63/041,551 Pending, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed and the secondary antibody (goat anti-mouse IgG Horse Radish Peroxidase (HRP) conjugate; Fitzgerald, North Acton, MA) was added to the wells, and the plates were incubated for 60 minutes at 37°C1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed and incubated with 25 μL of 1 μg/mL SULFO-TAG labeled anti-species antibody (MSD), diluted in DPBS + 1% BSA (Sigma-Aldrich, St. Louis, MO), for 1 hour at room temperature on an orbital shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MSD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis: HEK293F cells seeded at 5e5 cells/mL were infected with an MOI of 1 IU/cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSVΔG virus was transduced in HEK293T cells previously transfected with the spike glycoprotein of the SARS-CoV-2 coronavirus (Wuhan strain) for which the last 19 amino acids of the cytoplasmic tail were removed (ΔCT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation of the serum/plasma-pseudotyped virus complex, the serum/plasma-pseudotyped virus complex was transferred to the plate containing Vero E6 cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Balb/c mice (Envigo), 6–8 weeks old were used for all studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence of a E1 (578-3404 bp)/E3 deleted virus (2,125-31,825 bp) was assembled into pUC19 from VR-594-derived and synthetic (SGI-DNA) fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC19</div><div>suggested: RRID:Addgene_50005)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pA68-E4d-Spike plasmids were linearized, purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pA68-E4d-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike sequences were PCR amplified and cloned into PacI/BstBI sites of a pUC02-VEE vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC02-VEE</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector generation: The ChAd68 nucleotide sequence was based on the wild-type sequence obtained by MiSeq (Ilumina sequencing) of virus obtained from the ATCC (VR-594).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of flow cytometry data was performed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed using the R programming language and graphed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03639714</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Personalized Neoantigen Cancer Vaccine</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03953235</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Personalized Cancer Vaccine Targeting Shared Ne…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04776317</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Chimpanzee Adenovirus and Self-Amplifying mRNA Prime-Boost P…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.08.467773
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.09.467911

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.09.467911: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA structural analyses: Different components of the RNAstructure software package (Reuter and Mathews 2010) along with other tools were used for secondary structure predictions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RNAstructure</div><div>suggested: (RNAstructure, RRID:SCR_017216)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure of the shortened main sequence was then predicted using ProbKnot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProbKnot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Compensatory Mutations Analysis of Long-range RNA-RNA interactions: Compensatory mutations within the multiple sequence alignments were investigated using the R-scape software package (Rivas, Clements et al. 2017, Rivas 2020, Rivas, Clements et al. 2020, Rivas and Eddy 2020), which analyzes covariation in nucleotide pairs in the population to infer possible compensatory mutations in an RNA base pair.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R-scape</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.09.467911
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266115

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266115: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Mary’s Hospital Research Ethics Committee (09/H0712/59).<br>Consent: All participants gave written, informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse IgG2a monoclonal anti-human ICAM-1 antibody (antibody R6.5) was produced from the hybridoma cells (ATCC HB-9580, mouse hybridoma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mouse IgG2a monoclonal anti-human ICAM-1 antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human ICAM-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To block ICAM-1, a receptor responsible for RV-A16 infection of HBECs, anti-ICAM-1 antibodies were added to the apical and basolateral compartment, 3h prior RV-A16 infection at the dose of 10ug/mL (Fig. S1A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ICAM-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein samples precipitated from the apical supernatants were analyzed with the use of goat anti-IL-1β antibodies (1:1000, R&D Systems, Minneapolis, USA), rabbit anti-caspase-1 (1:1000, Cell Signaling Technology, Danvers, USA), and HRP conjugated anti-goat (1:10,000, Santa Cruz Biotechnology, Santa Cruz, USA), and anti-rabbit (1:10,000, Jackson ImmunoResearch, West Grove, USA) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IL-1β</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-caspase-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, magnetized, and incubated with 10 μg of anti-ASC antibodies (Santa Cruz Biotechnology, Santa Cruz, USA) overnight at 4°C, followed by ASC immunoprecipitation with 100 μl of Protein A beads (Bio-Rad, Hercules, USA) for 2h in RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ASC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Co-IP samples and input (protein not bound to the beads) were collected and together with the cell lysates were further analyzed with the Western Blot protocol with the use of mouse anti-human RIG-I antibodies (1:200, Santa Cruz Biotechnology, Santa Cruz, USA) or rabbit anti-human MDA5 antibodies (1:1000, Abcam, Cambridge, UK) and HRP conjugated anti-mouse or anti-rabbit antibodies (1:10,000, Jackson ImmunoResearch, West Grove, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human RIG-I</div><div>suggested: (LSBio (LifeSpan Cat# LS-C19644-1000, RRID:AB_839891)</div></div><div style="margin-bottom:8px"><div>anti-human MDA5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, samples were incubated with the goat anti-mouse Alexa Fluor 488 (for ASC), and the goat anti-mouse Alexa Fluor 546 (for IL-1β and RIG-I) secondary antibodies at the concentrations of 1:2000 (Invitrogen, Waltham, USA) for 60 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RIG-I</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies for NLRP3 (5 µg/mL, mouse anti-NLRP3, Adipogen, San Diego, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NLRP3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies for IL-1β (10 μg/mL, mouse anti-IL1β, Abcam, Cambridge, UK),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IL1β</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, samples were incubated with the goat anti-rabbit Alexa Fluor 488 (for caspase-1), and the goat anti-mouse Alexa Fluor 546 (for IL-1β and RIG-I) secondary antibodies for 60 minutes in RT in the concentration of 1:1000 (Invitrogen, Waltham, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HeLa cells were infected with the virus serial dilutions from 10-2 to 10-8 in duplicates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Co-culture of electroporated BHK-21 cells with susceptible Vero E6 cells produced passage 0 of SARS-CoV-2 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6281, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Passage 0 was used to infect Vero E6 cells to generate passage 1 working stocks, which were used for all experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cell culture: THP-1-XBlue cells (Invivogen, San Diego, USA) were defrosted in 32 mL of RPMI-1640 medium (Sigma-Aldrich, St. Louis, USA) supplemented with the Penicillin/Streptomycin/Kanamycin, MEM vitamins, Na-Pyruvate/MEM Non-essential Amino Acid Solution and heat-inactivated FCS (cRPMI medium) in the 75cm2 T-flask, and cultured for 1 day in the humidified incubator at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>THP-1-XBlue</div><div>suggested: RRID:CVCL_X582)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene expression (5ng of cDNA/well) was assessed by RT-PCR using i) SYBR Green PCR Master Mix (ThermoFisher Scientific, Waltham, USA) for DDX58, IFNB, IFNL1, IL1B, MDA5, and ii) TaqMan assays for RV-A16 and SARS- CoV-2 Protein N, Protein S, ORF1AB detection (ThermoFisher Scientific, Waltham, USA) and was performed on the QuantStudio 7 Flex Real-Time PCR System (ThermoFisher Scientific, Waltham, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of the protein expression was performed in Fiji Software. 128 Briefly, an area of the peak of the protein of interest was measured in triplicates, and average was used to calculate the ratio between expression of the protein of interest and β-actin (protein/β-actin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mRNA expression data are publicly available at the Gene Expression Omnibus platform (https://www.ncbi.nlm.nih.gov/) under the accession number: GSE6114166.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/</div><div>suggested: (GENSAT at NCBI - Gene Expression Nervous System Atlas, RRID:SCR_003923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">05 calculated for the entire gene lists in each project using the edgeR R package130.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed probe was identified by the limma R package with empirical Bayes estimation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, top 100 genes upregulated after RV-A16 infection in the HBECs from control individuals and patients with asthma from GSE6114166 were analyzed for the enriched pathways using Metacore software version 20.3.70200</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metacore</div><div>suggested: (MetaCore, RRID:SCR_008125)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical comparison of protein expression between groups was performed with the Bioconductor limma package131.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, for Target 96 Inflammation panel data are presented as: i) heatmaps of curated signatures of inflammasome-mediated immune responses and antiviral responses (Supplementary Table S10) and ii) protein interactions and pathways analysis prepared using the STRING (version 11.0)132, and further processed with the Cytoscape software (version 3.8.2)133 (Supplementary Table S3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  An appropriate balance between activation of RIG-I epithelial inflammasome and subsequent IL-1β/IL-1 receptor (IL1R) signaling with RIG-I-dependent type I/III IFN responses should lead to the limitation of viral replication, efficient virus clearance and timely resolution of airway inflammation52. Indeed, we observed here that in the bronchial epithelium of healthy subjects at early time points during RV infection there was an activation of RIG-I inflammasome and inflammasome-mediated immune responses, together with efficient type I/III IFN and ISG-responses. Importantly all of these responses were actively inhibited or went back to the pre-infection state, already 4 days after in vivo infection. In contrast, in epithelium of patients with asthma, there was enhanced RIG-I inflammasome activation accompanied by augmented inflammasome/IL1R- mediated proinflammatory responses starting early after infection and still non-resolved in vivo 4 days after infection. Overactivation of epithelial RIG-I inflammasome and subsequent increases in mature IL-1β release might be at least partially responsible for the delayed and sustained type I/III IFN/ISG responses. We demonstrated this here by blocking caspase-1 with YVAD which led to an increase in IFN-β (IFNB) and RIG-I (DDX58) mRNA together with IFN-responsive chemokines such as CXCL10, CXCL11, CCL3, and CCL4. Our findings are in line with early observations showing that IL-1β is able to attenuate transcription and translation of type I ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266115
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21265186

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21265186: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: In addition, a study protocol which covers the current work, was granted approval by the Ethics Committee of South-East Norway (28th June 2021, #240725).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The manual data collection done in the NCTT surveillance has some limitations and is resource-intensive. First, reporting outbreaks in the national outbreak system VESUV is mandatory. However, we are aware that not all outbreaks were notified, particularly during the transmission peaks throughout the study period. Secondly, the quality of information available through municipality websites and news media varied. During periods with high transmission, the reports may have been less accurate due to capacity challenges. Thirdly, some outbreaks were excluded due to missing information regarding the number of cases, whereas the majority occurred during and after the third wave. These factors may have led to an underreporting of outbreaks during the study period. However, as NIPH is regularly consulted by municipalities when they experience larger outbreaks, we believe the outbreaks we may have missed were mainly small, with limited need for comprehensive measures. In all, we believe that combining different data sources provided sufficient and adequate data to allow us to expand existing information regarding transmission and outbreak trends in schools and preschools during the academic year of 2020/2021.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21265186
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.465996

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.465996: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.465996
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.466206

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.466206: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethical Committee of Clinical Investigation of Galicia (CEIC ref.<br>Consent: Written informed consent was obtained for subjects before study inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After isolation, RNA amount and integrity was checked using TapeStation 4200 (Agilent), and DV200 values were calculated to both ensure that >50% of the of the RNA fragments were above 200nt and estimate the optimal sample input for the nCounter analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent</div><div>suggested: (Agilent Bravo NGS, RRID:SCR_019473)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GeNorm algorithm (38) implemented in the R package CrtlGene (39) was used to test for the most stable and optimal number of genes for normalization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeNorm</div><div>suggested: (geNORM, RRID:SCR_006763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data normalization was performed through a combined approach using both DESeq2 (40) and RUVSeq (41) as described in (42).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Volcano plots and heatmaps were built with EnhancedVolcano (43) and ComplexHeatmap (44) R packages, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphics were created using R (www.r-project.org) software and the ggplot2 package (45).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For GSEA we used all available molecular measurements (log2FC) from the genes included in the DE to detect coordinated changes in the expression of genes from same pathway.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were carried out using the Clusterprofiler (47) R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clusterprofiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We tested both the GO (Gene Ontology) and Reactome databases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microarray and RNA-seq data were downloaded from the public gene expression microarray repository Gene Expression Omnibus (GEO) under accession numbers: GSE64456 (49), GSE40012 (50), GSE42026 (51), GSE60244 (52), those also included in Thair et al. (23) as viral cohorts; and GSE72829 (53), GSE69529 (54).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we used Limma package (59) to detect DEG and calculate log2FC values between groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.466206
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266414

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.21266414: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Epidemiologic and population data: All epidemiologic data used in this analysis are publicly available and aggregated by geographic unit, municipality of residence not including identifiable individual information, eliminating the need for approval by an ethics committee, as there is no violation of confidentiality.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations of this study deserve attention. As all studies based on secondary data, our analysis may be biased due to the delay in reporting the first case or death of the municipality, which can affect the temporal dimension of the network analysis. However, if the delay occurred more in the smaller municipalities, the order of the diffusion has likely not been affected.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.11.16.21266414
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.25.465714

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.25.465714: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The KYODOKEN Institutional Animal Care and Use Committee approved the protocols for these studies (approval number 20200312) and monitored health conditions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">half-siblings—a 19-month-old male named “Puta” and a 19-month-old female named “Christy”—were immunized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blotted membranes were incubated overnight at 4°C with the C9 antibody or the C-terminally 6×His-tagged homodimer of nanobodies—the dilution ratios of P158, P334, and P543 were 1:5000, 1:1000, and 1:2500, respectively—in Tris-buffered saline (TBS, pH 7.4) containing 0.005% Tween 20 (TBST) and 5% skim milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C9</div><div>suggested: (LSBio (LifeSpan Cat# LS-C9-1000, RRID:AB_1276501)</div></div><div style="margin-bottom:8px"><div>P334</div><div>suggested: (Leinco Technologies Cat# P334, RRID:AB_2831621)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the case of nanobody-based blotting, after 3 washes with TBST, the membranes were incubated with 1:5000-diluted anti-His-tag antibody (MBL) in TBST containing 5% skim milk at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were soaked with 1:5000-diluted HRP-conjugated anti-rabbit or anti-mouse IgG secondary antibodies (GE Healthcare) in TBST containing 5% skim milk for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-6×His-tagged antibody-positive fractions were gathered and concentrated via VIVAspin 6 size exclusion columns (30,000-MWCO) to reach a volume under 0.5 ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6×His-tagged</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 3 washes with PBST, HRP-conjugated anti-alpaca VHH antibody (Jackson) at a dilution of 1:5000 was reacted at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-alpaca VHH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the cells were incubated with an anti-His antibody (Abcam) on ice for 30 min and then Alexa 647-conjugated anti-rabbit IgG (Dako).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBST, an appropriately diluted anti-His-tagged antibody and anti-C9-tagged antibody in blocking buffer were added and reacted at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tagged</div><div>suggested: (StressMarq Biosciences Cat# SPC-167, RRID:AB_2703750)</div></div><div style="margin-bottom:8px"><div>anti-C9-tagged</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK and K562 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM: Invitrogen) supplemented with 10% foetal bovine serum (FBS) and antibiotics (1% penicillin and streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus production: HIV-1-based SARS-CoV-2 spike pseudotyped virus was prepared as follows: LentiX-HEK293T cells were transfected using a polyethyleneimine transfection reagent (Cytiva) with plasmids encoding the C-terminally C9-tagged full-length SARS-CoV-2 spike variants (original, alpha, beta, and delta) and HIV-1 transfer vector encoding a luciferase reporter, according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LentiX-HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy analyses for cell staining: HEK cells were transiently transfected with plasmids encoding the C-terminally C9-tagged full-length SARS-CoV-2 spike variants using Lipofectamine 3000 (Thermo) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector of the SARS-CoV-2 S2 domain (residues 744-1213) was constructed by removing an N-terminal part of the extracellular domain of the SARS-CoV-2 spike (residues 31-743) and subcloned into the pcDNA3.1(+) vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 ( + )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized genes were subcloned in the pMES4 vector to express N-terminal PelB signal peptide-conjugated and C-terminal 6×His-tagged nanobodies into the bacterial periplasm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMES4</div><div>suggested: RRID:Addgene_98223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 was acquired from AddGene (plasmid #154983).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pWPI-IRES-Bla-Ak-ACE2-TMPRSS2</div><div>suggested: RRID:Addgene_154983)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">coli TG1 cells (Agilent Technologies Japan, Ltd., Tokyo, Japan) were transformed with the ligated plasmids under chilled conditions (Bio-Rad Laboratories, Inc., Hercules, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data of reads were trimmed of the adaptor sequence using cutadapt v1.1859, and low-quality reads were subsequently removed using Trimmomatic v0.3960.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining paired reads were merged using fastq-join61 and then translated to the amino acid sequences using EMBOSS v6.6.0.062.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBOSS</div><div>suggested: (EMBOSS, RRID:SCR_008493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, unique amino acid sequences in each library were counted using a custom Python script combining seqkit v0.10.163 and usearch v.1164.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM image processing and refinement: The images were processed using RELION 3.169.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were motion corrected using MotionCor270, and the contrast transfer functions (CTFs) were estimated using CTFFIND 4.171.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were imported and further processed with non-uniform refinement in cryoSPARC v3.2.072.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the models were manually fitted into the density using UCSF Chimera v1.1573 and modified in Coot v0.8.9.274, real space refinement was performed in PHENIX v1.19.175.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using UCSF Chimera73, ChimeraX77, and PyMOL v2.5.0 (Schrödinger, LLC, New York, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program refmac582 in the ccp4 suite83 and the program Phenix-refine75 were used for structural refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ccp4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.25.465714
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.16.468893

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.16.468893: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Cell culture conditions: All cell lines used for this study were obtained under appropriate material transfer agreements and approved by all involved institutional review boards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were tested for and shown to be devoid of mycoplasma contamination (Mycoplasma PCR Detection Kit from abm,</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, goat anti-rabbit (CST; 7074) or goat anti-mouse (CST; 7076) antibody was added, and the blot was incubated for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Assay Biotech Cat# B7076, RRID:AB_10684258)</div></div><div style="margin-bottom:8px"><div>anti-mouse ( CST; 7076</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG) mouse monoclonal antibody (Human TRA-1-85/CD147 MAb (Clone TRA-1-85)-MAB3159; R&D systems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human iPS cell-induced podocytes were pre-treated with serial dilutions of ACE2 antibody, BSG/CD147 antibody or both for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human colon epithelial (Caco-2) (ATCC, HTB-37) and human embryonic kidney (HEK 293T) (ATCC, CRL-3216</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 S-pseudotyped lentiviral particles: The S-pseudotyped lentiviral particles were generated by transfecting HEK 293T cells as illustrated in Figure 1C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Appropriate volumes of transfection mixture was used to transfect HEK 293Tcells in each flask and incubated in a 37 °C incubator with 5% CO2 for 6 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293Tcells</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 USA-WA1/2020 (BEI Resources; NR-52281) was propagated in Vero E6 cells at a MOI of 0.001 in DMEM supplemented with 2% FBS, 1X Penicillin/Streptomycin, 1 mM Sodium pyruvate and 1X Non-Essential Amino Acid (NEAA) at 37 °C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Spike envelope plasmid; Sinobiologicals – Cat #: VG40589-UT) and pLJM1-EGFP (reporter; Addgene plasmid #19319) in a ratio of 1:1:2 respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLJM1-EGFP</div><div>suggested: RRID:Addgene_19319)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus pseudotyped with the vesicular stomatitis virus spike G (pCMV-VSV-G; Addgene plasmid # 8454) was used as a positive control and the bald lentivirus having no coat was used as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">podocin (Abcam, ab50339); anti-SARS-CoV2 spike (ProSci, 3525); anti-SARS-CoV-2 N protein (Sinobiological, 40143-R019); VSV-G (Santa Cruz Biotechnology, sc-365019); Human/Mouse/Rat/Hamster ACE-2 (R&D systems, AF933), Human TRA-1-85/CD147 (R&D systems, MAB3195)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human induced pluripotent stem (iPS) cells cultured on Matrigel-coated plates were dissociated with warm enzyme-free dissociation buffer (Gibco, 13150-016) and centrifuged twice at 200xg for 5 min each in advanced DMEM/F12 (Gibco; 12634010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioGRID is an expansive database of experimentally verified protein-protein and genetic interactions as assembled and curated from tens of thousands of studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the raw expression data were normalized by robust multiarray averaging 58 and the Human Gene 2.0 ST Affymetrix array mapping obtained from the ENSEMBL mart database was used to map probe IDs to gene IDs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Gene</div><div>suggested: (Human Gene Connectome, RRID:SCR_002628)</div></div><div style="margin-bottom:8px"><div>ENSEMBL</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The podocyte transcriptomic data was analyzed using the Bioconductor packages, oligo (v3.11), biomaRt, and pd.hugene.2.0.st.59 The expression data for these proteins were then used to annotate a network visualization of these interactions on Cytoscape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all statistical analyses, the GraphPad Prism 9 software package was used (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 36. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.16.468893
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.07.467640

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.07.467640: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Test data: Our test data is 1,998 SARS-CoV-2 virus-human PPIs from the IntAct database as of July 17, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IntAct</div><div>suggested: (IntAct, RRID:SCR_006944)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All computations were done in Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also performed protein-protein association analyses from the STRING database (STRING v11.5) (Szklarczyk et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network visualization was done using Cytoscape (Shannon et al., 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of our approach is lack of confidence in prediction of the low evidence classes, EC1 and EC2. They do not possess any intrinsic unique properties associated with each evidence level, unlike EC3 for experiments-based or physical PPIs. Further investigation is needed to characterize and interpret each evidence class and identify important features for each class. Alternatively, multi-class labeling might be done in different ways with different thresholds for individual evidence classes. On the other hand, one could use our tool as a binary classifier for physical PPIs as we demonstrated with EC >= 3 vs. EC < 3, or build binary classifiers based on a single threshold for combined scores. Comparative analysis with binary classifiers is beyond the scope of this study. Another limitation in this work is a subjective choice of the 72 edge features as model features. A significant model improvement might be achieved by better feature engineering for both nodes and edges. In conclusion, our protein sequence-based multi-label classifiers are useful tools to provide different evidence or confidence levels for virus-human PPIs and applicable to virus-human interactomes for new virus species such as SARS-CoV-2.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.07.467640
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.05.467523

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.05.467523: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Vaccine-elicited sera were collected at the U.S. Food and Drug Administration with written consent under an approved Institutional Review Board (IRB) protocol (FDA IRB Study # 2021-CBER-045).<br>IRB: Vaccine-elicited sera were collected at the U.S. Food and Drug Administration with written consent under an approved Institutional Review Board (IRB) protocol (FDA IRB Study # 2021-CBER-045).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Donors were 18-73 years old with six males/four females.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Due to a confidentiality agreement with the manufacturers, neutralizing antibodies described are shown with blinded identification codes as follows: single neutralizing antibodies (nAbs A to R), combination of two neutralizing antibodies (cnAbs S to X), and polyclonal neutralizing antibodies (pnAbs III to IV).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-three therapeutic neutralizing antibodies against SARS-COV-2 spike protein were generously donated by different pharmaceutical companies for the U.S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.4. soluble ACE2 production: The production of His-tagged soluble ACE2 was performed in FreeStyle™ 293-F cells and purified using HisPur™ Ni-NTA Resin (Thermo Scientific) as described previously [31]. 2.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ACE2 neutralization assay, serially diluted recombinant human soluble ACE2 was incubated with indicated pseudovirus (~1×106 RLU / ml) for one hour at 37°C and 100 μl of pseudovirus and soluble ACE2 mixture was added to 293T-ACE2.TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2.TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-transfected/β-Gal ω subunit-expressing 293T cells were mixed with β-Gal α subunit-transfected/293T-ACE2.TMPRSS2 cells at 1:1 ratio to a total of 6 x 104 cells per well on a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cell lines: Codon-optimized full-length open reading frames of the S genes of SARS-COV-2 variants were cloned into pcDNA3.1(+) or pVRC8400 by GenScript (Piscataway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC8400</div><div>suggested: RRID:Addgene_63164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV gag/pol (pCMVΔR8.2), and Luciferase reporter (pHR’CMV-Luc) plasmids were obtained from the Vaccine Research Center (National Institutes of Health, Bethesda, MD) [28,29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHR’CMV-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviruses bearing the spike glycoprotein and packaging a firefly luciferase (FLuc) reporter gene were produced in 293T cells by co-transfection of 5μg of pCMVΔR8.2, 5μg of pHR’CMVLuc and 4μg of pcDNA3.1(+) or 0.5 ug of pVRC8400-encoding a codon-optimized spike gene with the desired substitutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔR8.2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Furin prediction score calculations: The prediction of furin-specific cleavage site in spike proteins were computed using the ProP 1.0 Server hosted at http://www.cbs.dtu.dk/services/ProP/ and the PiTou V3 software hosted at http://www.nuo-lan.net/reference.html. 2.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.cbs.dtu.dk/services/ProP/</div><div>suggested: (ProP Server, RRID:SCR_014936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics analysis: One-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons tests (variants compared to WT(D614G)), Mann-Whitney test for the comparison of two groups with unmatched pairs (Pfizer BNT162b2 compared to Moderna) and geometric mean titers (GMT) with 95% confidence intervals were performed using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.05.467523
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.13.468472

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.13.468472: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals that lost more than 25% of their initial body weight were euthanized in accordance with our animal ethics protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two groups of ferrets (5 female and 5 male ferrets in the vaccine group and 3 female and 3 male ferrets in the control group) were immunized intranasally with a single-dose 1×106 PFU of dNS1-RBD and CA04-WT virus respectively diluted in 1640 media to a final 500 μL volume.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated on a 10% gel, and then following transfer, blots were incubated with an anti-influenza A NP protein antibody 19C10 generated by our laboratory (1:1000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza A NP protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">and anti-V5 tag antibody (Thermo,1:5000) and visualized with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Invitrogen, 1:5000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on the ELISA results using a sandwich assay with anti-RBD monoclonal antibodies on both sides (Wantai, Beijing, China) and plaque assay results, serial passages 1 to 10 of purified vaccines were confirmed to be stable under current vaccine manufacturing conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD IgG measurements: RBD-specific antibody titers in serum samples collected from immunized animals with 1×106 PFU of vaccine were determined by indirect ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diluted sera (1:100) were successively diluted in a 2-fold series and applied to each well for 1 h at 37°C, followed by incubation with goat anti-mouse, anti-hamster or anti-human antibodies conjugated with HRP for 1 h at 37°C after 3 washes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were stained with murine antibodies for phenotype and activation (CD4 [clone GK1.5, APC/Cy7], CD8 [clone 53-6.7, PerCP/Cy5.5], CD11b [clone M1/70, PE], CD11c [clone N418, BV421],</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (Miltenyi Biotec Cat# 130-109-536, RRID:AB_2657974)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunohistochemical staining was performed by using a mouse monoclonal anti-SARS-CoV-2 N protein antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney cells (293T), African green monkey kidney epithelial cells (Vero E6), and Madin-Darby canine kidney cells (MDCK) were maintained in DMEM-high glucose (Sigma Aldrich, USA) supplemented with 10% low endotoxin FBS (Cegrogen Biotech, Germany) and penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and passage of dNS1-RBD viruses: Eight pHW2000 plasmids containing the DelNS1 segment and the other seven influenza virus genomic segments, together with an NS1 expression plasmid, pCX-CA04-NS1-Flag, which derived from the parental influenza virus A/California/04/2009(H1N1) (GenBank: MN371610.1-371617.1), were transfected into 293T cells and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 titration assay: Live virus titers in homogenized lung tissues and cell cultures were measured by the standard TCID50 method in Vero E6 cells seeded in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and infection of mice: BALB/c mice were immunized intranasally with 50 μL containing 1×106 PFU of the vaccine prepared as indicated above under isoflurane anesthesia, while the control group was administered CA04-WT or CA04-dNS1 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cellular immune response analyses of PBMCs, splenic lymphocytes, pulmonary lymphocytes and lymph node cells, C57BL/6 mice (6-8 weeks old) were immunized intranasally with 1×106 PFU of the vaccine by the one-dose or two-dose regimen as described above (10 animals in each group).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and infection of hACE2-KI/NIFDC mice: hACE2-KI/NIFDC mice (8-10 weeks old) were divided into three groups and treated intranasally with 1×106 PFU of the vaccine by gently adding 50 μL droplets of virus stock for the vaccine-immunized group (5 animals) at two time points (days 0 and 14), and then, the vaccine-immunized group and unvaccinated group (3 animals each) were challenged with 1×104 PFU of SARS-CoV-2 by the intranasal route 30 days post immunization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-KI/NIFDC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence encoding the RBD segment was then cloned into the NS1 deletion plasmid pHW2000-DelNS1 as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHW2000-DelNS1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and passage of dNS1-RBD viruses: Eight pHW2000 plasmids containing the DelNS1 segment and the other seven influenza virus genomic segments, together with an NS1 expression plasmid, pCX-CA04-NS1-Flag, which derived from the parental influenza virus A/California/04/2009(H1N1) (GenBank: MN371610.1-371617.1), were transfected into 293T cells and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHW2000</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCX-CA04-NS1-Flag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed by FlowJo V10.6.0 and GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assigned when P values were < 0.05 using GraphPad Prism 8.0 (GraphPad Software, Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.13.468472
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.14.468537

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.14.468537: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.14.468537
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.15.468283

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.15.468283: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.15.468283
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.12.468428

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.12.468428: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.12.468428
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.02.466971

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.02.466971: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data sources and curation: Previously published studies were used to verify the abundance of proteins that make up the N-end rule pathway in non-infected and SARS-CoV-2 infected groups: (i) Saccon et al42 (Calu-3, Caco-2, Huh7, and 293FT cell lines, proteomics); (ii) Nie et al43 (autopsy 7 organs, 19 patients, proteomics); (iii) Leng et al44 (lung tissue, 2 patients, proteomics); (iv) Qiu et al45 (lung tissue, 3 patients, proteomics); (v) Bojkova et</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To verify modulation of the N-end rule pathway in other viral infections, including MERS-CoV/SARS-CoV/H1N1 influenza virus/Respiratory syncytial virus (RSV), data from the following studies were evaluated: (viii) Zhuravlev et al49 (MRC-5, A549, HEK293FT, and WI-38 VA-13 cell lines, H1N1 influenza virus, transcriptomics), (ix) Li et al50 (A549 and 293T cell lines, H1N1 influenza virus, transcriptomics), (x) Krishnamoorthy et al51 (comparative among coronaviruses, transcriptomics), (xi) Ampuero et al52 (time course of RSV infection in the lung, transcriptomics), (xii) Besteman et al53 (RSV infected neutrophils, transcriptomics), and (xiii) Dave et al54 (RSV infected alveolar cell, proteomics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293FT</div><div>suggested: RRID:CVCL_6911)</div></div><div style="margin-bottom:8px"><div>VA-13</div><div>suggested: RRID:CVCL_A5CQ)</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kidney epithelial cell, African green monkey), Calu-3 (lung adenocarcinoma), Caco-2 (colorectal adenocarcinoma), and ACE2-A549 (lung carcinoma expressing ACE2 to gain cellular entry).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2-A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Vero CCL-81 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin-streptomycin, 4.5 g/L glucose, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1.5 g/L NaHCO3</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were cultured in DMEM medium supplemented with 20% FBS, 1% non-essential amino acids, 4.5 g/L glucose, 2 mM L - glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin-streptomycin and 1.5 g/L NaHCO3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were cultured in RPMI-1640 supplemented with 10% FBS, and 1% penicillin-streptomycin at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For comprehensive time course evaluation, Vero CCL-81 and Calu-3 cells were infected with SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics analysis: The tidyverse59, biostrings, and seqinr60 packages were used to map potentially arginylated proteins in the Homo sapiens and Chlorocebus sabaeus proteomes (downloaded in May 2021, https://www.uniprot.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.uniprot.org/</div><div>suggested: (Universal Protein Resource, RRID:SCR_002380)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The String database v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>String</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell RNA-seq re-analysis: Expression matrices were loaded into RStudio (v. 4.0.3) with the Seurat package66.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Metaboanalyst platform67 was used to evaluate differently regulated genes between cell clusters identified in the single-cell RNA-seq analysis. 4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metaboanalyst</div><div>suggested: (MetaboAnalyst, RRID:SCR_015539)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, San Diego, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoreactive bands were detected with the ChemiDoc XRS Imaging System equipment and protein quantification was performed using the ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were plotted using GraphPad Prism version 8.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.02.466971
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468168

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468168: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E. coli BL21-CodonPlus cells (Agilent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSFDuet-1</div><div>suggested: RRID:Addgene_165451)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E. coli BL21 (DE3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDFDuet-1</div><div>suggested: RRID:Addgene_15917)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E. coli Rosetta (DE3) (Novagen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pet28</div><div>suggested: RRID:Addgene_21766)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow-through was collected, concentrated by centrifugal filtration (Amicon), and loaded on a Superdex 200 Hiload 16/600 (Cytiva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amicon</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dose-fractionated movies were gain-normalized, drift-corrected, summed, and dose-weighted using MotionCor2 46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were sorted using two rounds of cryoSPARC 2D classification (N=100, where N equals the number of classes), resulting in 661,105 curated particles that were re-extracted with a boxsize of 320 px.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Locally refined maps were combined into an nsp132-RTC composite map using PHENIX ‘Combine Focused Maps’ 50,51, with resulting nominal resolution of 2.8 Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1), followed by masked RELION 3D classification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Local resolution calculations were generated using blocres and blocfilt from the Bsoft package 29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bsoft</div><div>suggested: (Bsoft, RRID:SCR_016503)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were inspected and modified in Coot 53.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulation structures shown in figures were rendered using PyMol (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quantification and statistical analyses for model refinement and validation were generated using MolProbity 65 and PHENIX 51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cryo-EM density maps and atomic coordinates have been deposited in the EMDataBank and Protein Data Bank as follows: nsp131-RTC (EMD-24431, 7RE2), nsp132-RTC (composite) (EMD-24430, 7RE1), (nsp132-RTC)2 (EMD-24432, 7RE3), nsp132-RTC (nsp13.1-apo) (EMD-24428, 7RDZ), nsp132-RTC (nsp13.1-engaged) (EMD-24427, 7RDY), nsp132-RTC (nsp13.1-swiveled) (EMD-24429, 7RE0), nsp132-RTC (1B-open) (EMD-24426, 7RDX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMDataBank</div><div>suggested: (EMDataResource.org, RRID:SCR_003207)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468168
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.10.468173

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.10.468173: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.1 Ethics statement: The use of human cells in this study was approved by the Research Ethical Committee of Haute-Garonne<br>Consent: Written informed consent was obtained from the donors under EFS contract N° 21/PVNT/TOU/INSERM01/2011-0059, according to French Decree N° 2007–1220 (articles L1243-4, R1243-61).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.6 Chemical products, Proteins, and Antibodies: PAM2CSK4, PAM3CSK4, LPS-RS were purchased from InvivoGen</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>LPS-RS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-TLR2 and anti-TLR4 monoclonal antibodies were obtained from eBioscience.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-TLR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TLR4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 5 further washes, the complexes TLR2-E-GST-anti-GST were labeled by 1 hour incubation at room temperature with 100 μl of anti-rabbit IgG antibodies coupled to horseradish peroxidase in PBS-tween 0.05% containing 5% non-fat milk (DAKOTA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Cells: Human embryonic kidney cell lines stably transfected with TLR2 (HEK-TLR2), TLR4 (HEK-TLR4) and HEK-TLR2-blue and control HEK cell line (HEK-null) were purchased from InvivoGen and cultured in DMEM supplemented with 10 % FCS, 1% of P/S and selections antibiotics according to the manufacturer’s instructions (InvivoGen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 and A549 cell lines were cultured in DMEM supplemented with 10% FCS and 1% of P/S. 2.3 Virus infection:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.11 Cell based biological assays: Primary human monocytes or macrophages cells (106 cells) or HEK-null, HEK-TLR2 or HEK-TLR4 cell lines (2,5. 105 cells) were plated in 24 well plates and treated by E protein or PAM3CSK4 and PAM2CSK2 as positive controls at the indicated concentrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-TLR4</div><div>suggested: RRID:CVCL_VI44)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To inhibit the binding of E protein to cell membrane TLR2, E protein (at 200ng/ml) was preincubated with rTLR2 (20 ng/ml) during 1 hour at RT, before being added to HEK-TLR2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-TLR2</div><div>suggested: RRID:CVCL_IM79)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using FACSCalibur (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSCalibur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.15 Statistical analyses: Statistical analysis was performed using GraphPad Prism software v.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 26. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.10.468173
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.03.467065

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.03.467065: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.03.467065
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.08.467648

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.08.467648: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Institutional Animal Care and Use Committees at the University of Colorado School of Medicine (Assurance Number A3269-01) and the University of Maryland School of Medicine (Assurance number D16-00125 (A3200-01)).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female BALB/c mice were purchased from The Jackson Laboratory. 6-8-week-old mice were immunized with WT PLPs (control), RBDSARS-PLPs, RBDMERS-PLPs, or hCoV-RBD PLPs preparations in 50 μl PBS via i.m. injection in the hind leg.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Slides were examined in a blinded fashion for total inflammation, periarteriolar, and peribronchiolar inflammation and epithelial cell denuding.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: SARS-CoV-2 and MERS-CoV RBD-specific antibody responses in mouse and human sera were measured by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ELISA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were removed, and wells were washed three times with PBS-T and probed with secondary antibodies diluted at 1:4000 in PBS-T; goat anti-mouse IgG-HRP (Southern Biotech, 1030-05)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following blocking and washing, wells were incubated for 1.5 h at room temperature with either chimeric human anti-SARS-CoV spike antibody clone CR3022 (Absolute Antibody, Ab01680) or mouse anti-MERS-CoV spike antibody clone D12 (Absolute Antibody, Ab00696) prepared in a 2-fold dilution series in PBS-T with a starting dilution of 1:200 and signal was developed as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MERS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 1% paraformaldehyde (PFA; Acros Organics, 416780030) and probed with 1 μg/mL of chimeric human anti-SARS-CoV spike antibody (CR3022, Absolute Antibody, Ab01680) in Perm Wash (1X PBS/0.1% saponin/0.1% BSA) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay: Vero E6 cells were seeded in 12-well plates one day prior to virus inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For virulent virus challenge, mice were anaesthetized by intraperitoneal injection with 50 μL of a mix of xylazine (0.38 mg/mouse) and ketamine hydrochloride (1.3 mg/mouse) diluted in PBS. Immunized BALB/c mice were inoculated intranasally (i.n.) with 104 PFU of SARS-CoV-2 MA10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of recombinant hCoV RBD proteins: A pCAGGS expression vector encoding the SARS-CoV-2 spike RBD was obtained from Dr. Florian Krammer</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A pTwist-CMV expression vector (Twist Biosciences Technology) encoding the MERS-CoV spike RBD was kindly provided by Dr. Peter S. Kim, Stanford University (83).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTwist-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantify SARS-CoV-2 subgenomic RNA, we extrapolated viral RNA levels from a standard curve using defined concentrations of a plasmid containing an amplified SARS-CoV-2 subgenomic fragment (pCR-sgN TOPO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-sgN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This amplicon was cloned into the pCR4 Blunt TOPO vector (Invitrogen, K2875J10), sequence confirmed, and used in a dilution series of defined gene copies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR4 Blunt TOPO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed in Fiji (85) and measurements were based on 100 particles with values reported as mean ± standard deviation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FRNT50 titers were calculated relative to a virus only control (no serum) set at 100%, using GraphPad Prism 9.1.2 (La Jolla, CA) default nonlinear curve fit constrained between 0 and 100%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical significance was assigned when P values were < 0.05 using Prism Version 9.1.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.08.467648
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.06.467547

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.06.467547: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A second approach uses a Python script (https://github.com/cris12gm/covid19/blob/master/getRandomSamples.py) to get random samples stratified by date.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.06.467547
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467378

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467378: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467378
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.03.467186

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.03.467186: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.03.467186
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467077

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467077: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Housing conditions and experimental procedures were approved by the ethics committee of animal experimentation of KU Leuven (license P065-2020).<br>Euthanasia Agents: On day 4 pi, animals were euthanized for sampling of the lungs and further analysis by i.p. injection of 500 μL Dolethal (200 mg/mL sodium pentobarbital, Vétoquinol SA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Syrian hamsters (Mesocricetus auratus) were purchased from Janvier Laboratories and kept per two in individually ventilated isolator cages (IsoCage N Bio-containment System, Tecniplast) at 21°C, 55% humidity and 12:12 day/night cycles.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All caretakers and technicians were blinded to group allocation in the animal facility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Group size was calculated on the independent t-test with an effect size of 2.0 and a power of 80% (effect size = deltamean/SD = 1 log10 decrease in viral RNA/0.5 log10), resulting in 5-6 animals/group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stocks were then grown on Vero E6 cells in (DMEM 2% FBS medium) and passaged two times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diluted compounds were then mixed with Vero E6-eGFP cells corresponding to a final density of 25,000 cells/well in 96-well blackview plates (Greiner Bio-One, Vilvoorde, Belgium; Catalog 655090).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-Dual™ hACE2-TMPRSS2 cells obtained by Invitrogen (Cat. a549d-cov2r) were cultured in DMEM 10% FCS (Hyclone) supplemented with 10 μg/ml blasticidin (Invivigen, ant-bl-05), 100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-Dual™ hACE2-TMPRSS2</div><div>suggested: RRID:CVCL_A7ZQ)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The simulation results were overlaid with the in vitro EC50 reported in Vero E6 cells and A549-ACE2TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsomal metabolic stability: Mouse liver microsomes (CD-1 male strain) were purchased from GIBCO.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: RRID:MGI:2686808)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The four variants were originally isolated in-house from nasopharyngeal swabs taken from travellers returning to Belgium (baseline surveillance) and were subjected to sequencing on a MinION platform (Oxford Nanopore) directly from the nasopharyngeal swabs 16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using GraphPad Prism 9 software (GraphPad, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data from the two studies were modelled simultaneously using nonlinear mixed-effects approach in NONMEM, v7.4</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NONMEM</div><div>suggested: (NONMEM, RRID:SCR_016986)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05047601</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Post-Exposure Prophylaxis Study of PF-07321332/Ritonavir i…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04575597</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy and Safety of Molnupiravir (MK-4482) in Non-Hospita…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467077
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.03.467182

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.03.467182: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: The protocol and procedures used in the studies with animals were reviewed and approved by the Laboratory Animal Welfare and Ethics Committee in Institute of Medical Biology, Chinese Academy of Medical Sciences, and Center of Laboratory Animal Sciences, Wuhan University (Wuhan, China), respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">36 female CAG-hACE2 transgenic mice, 5-6 weeks old, were divided into 4 groups, namely the negative control group(n=6), adjuvant control group(n=6), low-dose vaccine group (n=12) (4μg/dose) and high-dose vaccine group(n=12) (16μg/dose).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Twelve rhesus macaques were randomly divided into two groups, with 6 animals in each group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following blocking and incubation with serial dilutions of sera, anti-mouse IgG, IgG1, IgG2a HRP-conjugated antibody were used as secondary Abs and incubated for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunogenicity analysis of ReCOV in mice: Two groups of female BALB/c mice (n=10) were intramuscularly administrated 4µg or 8µg RECOV with BFA03 adjuvant in a two-dose regimen (D0/D21 interval), and two weeks after second dose, the levels of antigen specific IgG antibody, neutralizing antibody, cross-neutralization against the main prevalent variants and IgG2a/IgG1 ratio, were evaluated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction, expression and purification of SARS-CoV-2 NTD-RBD-foldon: To construct recombinant vector for expression of SARS-CoV-2 NTD-RBD-foldon in CHO-K1 cell, the fragment 1-541 of SARS-CoV-2 spike protein (strain Wuhan-1/2020) fused with foldon was codon-optimized and synthesized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For expression of NTD-RBD-foldon in CHO cell, the NTD-RBD-foldon gene was PCR amplifized and cloned separately into pWX039 and pWX040 vectors (WuXi Biologics), yielding expression plasmid pWX039-PR-Z-7323B and pWX040-PR-B-7323B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were added after 1 h and allowed to incubate for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunogenicity analysis of ReCOV in mice: Two groups of female BALB/c mice (n=10) were intramuscularly administrated 4µg or 8µg RECOV with BFA03 adjuvant in a two-dose regimen (D0/D21 interval), and two weeks after second dose, the levels of antigen specific IgG antibody, neutralizing antibody, cross-neutralization against the main prevalent variants and IgG2a/IgG1 ratio, were evaluated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fragment 1-541 of spike protein and foldon were fused together with a GSGSG linker and inserted into the backbone vector pWX4.1(WuXi Biologics), yielding plasmid pWX4.1-Pr-7323-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pWX4.1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pWX4.1-Pr-7323-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For expression of NTD-RBD-foldon in CHO cell, the NTD-RBD-foldon gene was PCR amplifized and cloned separately into pWX039 and pWX040 vectors (WuXi Biologics), yielding expression plasmid pWX039-PR-Z-7323B and pWX040-PR-B-7323B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pWX039</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pWX040</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pWX039-PR-Z-7323B</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pWX040-PR-B-7323B</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software) and comparison between groups was performed using a two-tailed nonparametric Mann-Whitney U t test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04818801</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Reactogenicity and Immunogenicity Study of ReCOV</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.03.467182
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.02.466984

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.02.466984: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed, incubated with an anti-M13 antibody-HRP conjugate (GE Healthcare, 27-9421-01), and developed with TMB substrate (KPL, KP-50-76-03), as described [31].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-HRP</div><div>suggested: (Bioworld Technology Cat# MB001H, RRID:AB_2857326)</div></div><div style="margin-bottom:8px"><div>27-9421-01</div><div>suggested: (GE Healthcare Cat# 27942101, RRID:AB_2616587)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudoviruses: HEK-293 cells (ATCC) were seeded in a 6-well plate at 3 × 105 cells/well in DMEM (ThermoFisher, 11995-065) supplemented with 10% FBS and 1% penicillin-streptomycin (Gibco, 15140122) and grown overnight at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 cells were co-transfected with 1 μg pNL4-3.luc.R-E- plasmid (luciferase expressing HIV-1 with defective envelop protein) (NIH AIDS Reagent Program, ARP2128) and 0.06 μg CMV-promoter driven plasmid encoding the S-protein using Lipofectamine™ 2000 transfection reagent (ThermoFisher, 11668027).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus infection assays: HEK293T cells stably over-expressing full-length human ACE2 protein were seeded in 96-well white polystyrene microplates (Corning, CLS3610) at 3 × 104 cells/well in DMEM (10% FBS and 1% penicillin-streptomycin) and were grown overnight at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 cells were co-transfected with 1 μg pNL4-3.luc.R-E- plasmid (luciferase expressing HIV-1 with defective envelop protein) (NIH AIDS Reagent Program, ARP2128) and 0.06 μg CMV-promoter driven plasmid encoding the S-protein using Lipofectamine™ 2000 transfection reagent (ThermoFisher, 11668027).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed by GraphPad Prism Version 8.4.3 (GraphPad Software, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.02.466984
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.12.468374

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.12.468374: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Housing and experimental infections of hamsters have been described (Boudewijns et al., 2020; Kaptein et al., 2020; Sanchez-Felipe et al., 2021) and conducted under supervision of the ethical committee of KU Leuven (license P050/2020 and P055/2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, 6 to 8 weeks old female Syrian hamsters (Mesocricetus auratus) were sourced from Janvier Laboratories and kept per two in individually ventilated isolator cages.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Histopathology: For histological examination, the lungs were fixed overnight in 4% formaldehyde, embedded in paraffin and tissue sections (5 μm) after staining with H&E scored blindly for lung damage (cumulative score of 1 to 3 each for congestion, intra-alveolar hemorrhage, apoptotic bodies in bronchial epithelium, necrotizing bronchiolitis, perivascular edema, bronchopneumonia, perivascular inflammation, peribronchial inflammation, and vasculitis) as previously established (Abdelnabi et al., 2021; Boudewijns et al., 2020) Blocking of viral transmission: Hamsters (N=6) were vaccinated with 104 PFU of vaccine once, were bled at day 21 and infected with delta variant with 1×105 TCID50, intranasally.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two hours later, the medium was replaced by medium containing anti-VSV-G antibody (I1-hybridoma, ATCC CRL-2700) to neutralize residual VSV-G input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Median tissue culture infectious doses (TCID50) were defined by titration as described (Abdelnabi et al., 2021; Boudewijns et al., 2020) using Vero E6 cells as substrate, except for VOC Delta, for which A549 cells were used for a more pronounced virus induced cytopathic effect (CPE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, depending on the plasmid background, BHK-21J cells (variant B.1/D614G) or HEK-293T cells (Beta, Gamma and Delta) were transfected with the respective SARS-CoV-2 protein expression plasmids, and one day later infected (MOI = 2) with GFP-encoding VSVΔG backbone virus (Whitt, 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gasthuisberg, Leuven) and characterized by direct sequencing using a MinION as described before (Boudewijns et al., 2020)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protective nAb levels were calculated using logistic regression analysis in GraphPad Prism (version 9) as described (van der Lubbe et al., 2021) Similarly, hamsters were vaccinated twice with 104 YF-S0* (N=24) or sham (N=16) at day 0 and day 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were performed using GraphPad Prism 9 software (GraphPad, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.12.468374
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.02.467026

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.02.467026: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunizations: Female BALB/c mice aged 6–8 weeks (Central Lab Animal) were intramuscularly immunized with 0.4 μg/ animal VP vaccine at week 0 and boosted with 12 μg/animal GX-19N, in a total volume of 50 μL PBS, into the tibialis anterior muscle with in vivo electroporation with the OrbiJector® system (SL VAXiGEN Inc.) at week 4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate virus-neutralization assay: Surrogate virus neutralization test (sVNT) analyzed the binding ability of RBD to ACE2 after neutralizing RBD with antibodies in serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reciprocal of the dilution resulting in a binding inhibition rate of 20% or more (PI20) was defined as the neutralizing antibody titer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PI20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISPOT plates were coated with purified anti-mouse IFN-γ capture antibody and incubated overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inactivated SARS-CoV-2 vaccine produced from Vero cells contains 4 μg of viral antigens and 0.225 mg of aluminum hydroxide adjuvant in a 0.5-mL dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_A5BG)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunizations: Female BALB/c mice aged 6–8 weeks (Central Lab Animal) were intramuscularly immunized with 0.4 μg/ animal VP vaccine at week 0 and boosted with 12 μg/animal GX-19N, in a total volume of 50 μL PBS, into the tibialis anterior muscle with in vivo electroporation with the OrbiJector® system (SL VAXiGEN Inc.) at week 4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccines: The COVID-19 DNA vaccine, consisting of GX-19 and GX-21 at a 1:2 ratio, was constructed by inserting the antigen genes of SARS-CoV-2 into the pGX27 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX27</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GX-19 (pGX27-SΔTM/IC) contains the SARS-CoV-2 spike (S) gene lacking the transmembrane (TM)/intracellular (IC) domain, and GX-21 (pGX27-SRBD-F/NP) is designed to express the fusion protein of the receptor binding domain (RBD) of the spike protein, the T4 fibritin C-terminal foldon (SRBD-Foldon), and the nucleocapsid protein (N).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX27-SΔTM/IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pGX27-SRBD-F/NP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analyses were performed using GraphPad Prism 7 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.02.467026
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.01.466865

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.01.466865: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Incubation with primary antibodies anti-SARS-CoV-2 rabbit membrane (M) protein (Rockland) (1:100) was performed for 2 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>primary antibodies anti-SARS-CoV-2 rabbit membrane (M) protein (Rockland)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 rabbit membrane (M) protein (Rockland)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antiviral activity was assessed by cytopathic effect (CPE) reduction assay on Vero E6 cells or by RT-qPCR on A549-hACE2 or Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative reverse transcription polymerase chain reaction (RT-qPCR): Viral particles were collected from virus-infected A549 hACE2 cell supernatants at 72 hours post infection (100 μL) and viral RNAs were isolated from the supernatants using the Quick RNA Viral 96 Kit (Zymo Research) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence and confocal microscopy infected cell imaging: A549-hACE2 cells seeded on glass coverslips were infected with SARS-CoV-2 at a MOI 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50% effective concentration (EC50 [the concentration required to inhibit virus-induced cell death by 50%]) and the 50% cytotoxic concentration (CC50) (the concentration that reduces the viability of uninfected cells to 50% of that of untreated control cells) were determined using 4-parameter nonlinear regression with GraphPad Prism v8.0, based on the following calculations: Data are mean ± sd of three biological replicates, each of which consisted of duplicate samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DAPI-stained nuclei surfaces were analyzed using ZEN software (Otsu threshold method) from a grid of 8×8 images taken at 20x magnification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For intensity analysis, cells were imaged as Z stack with 0.3 μm sections then Z projection images were processed for total intensity per cell using ImageJ/Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ/Fiji</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical tests were performed using Origin 8.5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Origin</div><div>suggested: (Origin, RRID:SCR_014212)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of this study: Our study is the first to examine antiviral parameters of macrocyclic lactones other than IVM on SARS-CoV-2, nevertheless the data we provide here are only in vitro data, and the recent developments encourage us to emphasize that they should therefore be taken cautiously, and that many steps are to be completed before any result can be translated into clinical practice. Clinical risk-benefit balance is not in favor of the use of any of these molecules at this early stage. In order to try to approach the pharmacokinetic parameters of the molecules concerned, we used the data available for avermectins and milbemycins, often obtained from animal data; which do not directly allow an extrapolation to humans. Nevertheless, the concordance of all the data suggesting the impossibility of reaching even an imperfect pharmacological target of Cmax:EC50 and therefore even less able to reach Cmin:EC90 seemed important to us to avoid inappropriate conclusions being reached drawn from these data. Next steps and conclusion: Altogether our results clearly show that none of these agents is suitable for human use for its anti-SARS-CoV-2 activity per se. Our data show that DOR, MIL, and SEL are not clinically relevant candidates. They are not approved for human use, and therefore should not be used, and there is no rationale in our data to conduct the extensive studies that this would require (toxicology, impurity profile, thorough ADME evaluation). Further steps could...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 32. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.01.466865
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.31.466677

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.31.466677: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">employed BioMek i7 liquid handling workstations (Beckman Coulter Life Sciences, Indianapolis, IN) and MANTIS automated liquid handlers (FORMULATRIX, Bedford, MA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioMek</div><div>suggested: (BioMek NXp NXp, RRID:SCR_019720)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">; samtools version 1.11 (http://www.htslib.org, last accessed October 27, 2021) for sequence and file manipulation(34); and iVar version 1.2.2 (https://github.com/andersen-lab/ivar/releases, last accessed October 29, 2021) for primer trimming and variant calling(35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All SARS-CoV-2 consensus genomes are deposited in GISAID and raw reads submitted to NCBI’s Short Read Archive (BioProject Number: PRJNA776532)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Short Read Archive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study limitations: The study has several limitations: The RPLN samples tested were from only one State in the USA, and the sampling was not uniform within the State. However, while the generalizability of our findings remains to be tested, we see no reason why this scenario has also not already played out in other regions with large deer populations with opportunities for contact with humans. Another limitation of our study was that RPLN samples tested were all from 2020 and early 2021, representing the early part of the pandemic before the global dissemination of the highly successful Alpha and Delta variants. Hence, surveillance efforts with robust longitudinal sampling approaches are urgently needed to determine whether deer will become long-term reservoirs for SARS-CoV-2 and potentially assume a role as generators of novel variant viruses that may repeatedly re-emerge in humans or spillover to other animal hosts. Concluding comments: To help predict or prevent the emergence of the next pandemic and control infectious diseases with pandemic and panzootic potential, a better understanding of the human–animal molecular and ecological interface and its relevance to infection transmission dynamics is essential (9). Thus, we call for an urgent need to implement a more proactive and robust “One Health” approach to better understand the ecology and evolution of SARS-CoV-2 in deer and other free-living species.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.31.466677
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.31.466651

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.31.466651: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sample collection, preparation, and storage: All studies were approved by the Institutional Review Board of Washington University in St Louis.<br>IRB: Sample collection, preparation, and storage: All studies were approved by the Institutional Review Board of Washington University in St Louis.<br>Consent: Written consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For selection, where a clone spanned both the GC and LNPC compartments, and/or multiple time points, a compartment and a timepoint were first randomly selected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-human IgG (H+L) antibody (Jackson ImmunoResearch, 109-035-088, 1:2500) was used to detect monoclonal antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-088, RRID:AB_2337584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-Human IgG Fcγ fragment (Jackson ImmunoResearch, 109-035-190, 1:1500), HRP-conjugated goat anti-human serum IgA α chain (Jackson ImmunoResearch, 109-035-011, 1:2500), and HRP-conjugated goat anti-human IgM (Caltag, H15007, 1:4000) were used to detect plasma antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human serum IgA α chain</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-011, RRID:AB_2337580)</div></div><div style="margin-bottom:8px"><div>anti-human IgM (Caltag, H15007</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, a mammalian cell codon-optimized nucleotide sequences coding for the soluble version of S (GenBank: MN908947.3, amino acids 1-1,213) including a C-terminal thrombin cleavage site, T4 fold trimerization domain and hexahistidine tag was cloned into the mammalian expression vector pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">V(D)J gene annotation and genotyping: Initial germline V(D)J gene annotation was performed on the preprocessed BCRs using IgBLAST v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.17.138 with IMGT/GENE-DB release 202113-239.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/GENE-DB</div><div>suggested: (IMGT/GENE-DB, RRID:SCR_006964)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCR analysis: BCR analysis was performed in R v4.1.0 with visualization performed using base R, ggplot2 v3.3.544, and GraphPad Prism v9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clonal overlap between B cell compartments was visualized using circlize v.0.4.1345.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees for S+ clones containing BMPCs were constructed on a by-participant basis using IgPhyML v1.1.346 with the HLP19 model47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgPhyML</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene annotation on human reference chromosomes and scaffolds in Gene Transfer Format (‘gencode.v32.primary_assembly.annotation.gtf’) was downloaded (2021-06-02) from GENCODE v3252, from which a biotype (‘gene_type’) was extracted for each feature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control was performed as follows on the aggregate gene expression matrix consisting of 360,803 cells and 36,601 features using SCANPY v1.7.253 and Python v3.8.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A potential limitation to our analyses of S-binding clones is that our selection strategy may have excluded some low-abundance or low-affinity S-specific clones. Nonetheless, we were able to account for 45% and 67% of all GC B cell and LNPC clones, respectively identified by scRNA-seq. This is the first study to provide direct evidence for the induction of antigen-specific BMPCs by an mRNA-based vaccine in humans. Notably, none of the 11 participants from whom post-vaccination bone marrow specimens were examined had a history of SARS-CoV-2 infection. BMPCs that recognized contemporary seasonal influenza virus vaccine antigens and diphtheria/tetanus vaccine antigens were present at frequencies roughly 10- and 2-fold greater than those against SARS-CoV-2 S, respectively. This is likely due to both the greater number of antigenic targets contained in the former vaccines and the repeated exposures to influenza and tetanus/diphtheria vaccine antigens our study participants likely experienced in comparison to the initial exposure to the novel SARS-CoV-2 S antigen. There are some epitopes within the S protein that are conserved between human seasonal coronaviruses and SARS-CoV-228,29. Cross-reactive B cells targeting these epitopes participate in PB and GC B cell responses to SARS-CoV-2 vaccination6,30. It is unlikely, however, that a substantial proportion of the SARS-CoV-2 S+ BMPCs we observed six months after immunization were part of a pre-existing pool of BMPCs, as in a previou...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.31.466651
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.29.466519

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.29.466519: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Drain sample collection and characterization: The floor meat processing drain biofilms were collected following the previously described protocol [14]and were generously provided for this study by Drs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.29.466519
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.466163

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.466163: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal Immunizations, sample collection: All rhesus macaque experiments were approved by the Institutional Animal Care and Use Committee at Bioqual (Rockville, Maryland), an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International accredited facility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nine Chinese rhesus macaques, five males and four females roughly 4 years of age (weights ranging from 4.48kg-8.50kg) were randomized prior to immunization and received one or two injections at 1mg per dose of INO-4800, at weeks 0 and 4 by intradermal electroporation (ID-EP) administration using the CELLECTRA 2000® Adaptive Constant Current Electroporation Device with a 3P array (Inovio Pharmaceuticals).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nine Chinese rhesus macaques, five males and four females roughly 4 years of age (weights ranging from 4.48kg-8.50kg) were randomized prior to immunization and received one or two injections at 1mg per dose of INO-4800, at weeks 0 and 4 by intradermal electroporation (ID-EP) administration using the CELLECTRA 2000® Adaptive Constant Current Electroporation Device with a 3P array (Inovio Pharmaceuticals).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry: Thawed, cryopreserved PBMCs were assessed to determine the frequency of circulating T follicular helper (Tfh) using a panel which included the following antibodies: CD3 (BD Biosciences; clone SP34-2), CD4 (BD Biosciences; clone L200), CXCR5 (eBioscience; clone MU5UBEE), and PD-1 (BioLegend; clone EH12.2H7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PD-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the extent of which neutralizing antibodies are present in the sera, CHO cells stably expressing ACE2 (ACE2-CHOs – Creative Biolabs) were used as target cells at 10,000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final sequence was subcloned into the pGX0001 vector (BamHI/XhoI) and synthesized (Genscript, Piscataway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX0001</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization titers (ID50) were calculated using GraphPad Prism 8 and defined as the reciprocal serum dilution that is reduced by 50% compared to the signal in the infected control wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD Celesta flow cytometer and analysed using FlowJo software version 10.7 (Treestar Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.466163
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.26.465946

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.26.465946: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PubMedBERT was pre-trained from scratch with corpus developed from PubMed articles and it consistently outperformed all the other BERT models in most biomedical natural language processing tasks (5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.26.465946
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.466024

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.466024: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Limma [53] was then used to conduct differential expression analysis for each node as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 PBMC single-cell RNA-seq data can be downloaded from the European Genome-Phenome Archive (EGA) and ArrayExpress database using the accession number: EGAS00001004571 and E-MTAB-9357.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArrayExpress</div><div>suggested: (ArrayExpress, RRID:SCR_002964)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NSCLC dataset can be downloaded from the Gene Expression Omnibus under the accession number GSE176021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.466024
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.10.27.466055

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.10.27.466055: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pooled libraries were subsequently loaded in a 300-cycle sequencing cartridge and deep se-quencing was performed on an Illumina MiSeq platform</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing raw data were checked for quality using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and then analyzed with the specifically designed software SOPHiA GENETICS’ SARS-CoV-2 Panel (SOPHiA GENETICS, Lausanne, Switzerland)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole genome sequences were aligned with MAFFT (FF-NS-2 algorithm) using default parameters [33].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment was manually curated with Aliview [34] to remove artifacts at the ends and within the alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Aliview</div><div>suggested: (AliView, RRID:SCR_002780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pymol mutagenesis wizard was used to model Q675H and D614G for both wild-type (wt) and mutant systems [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.10.27.466055
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.05.467458

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.05.467458: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The BioInflame study was approved by the ethics committee of the Charité - Universitätsmedizin Berlin (EA2/030/09) and the University Medical Center Marburg (55/17).<br>Consent: All blood donors were at least 18 years of age and provided written informed consent for use of their blood samples for scientific purposes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunosuppressed, pregnant and HIV-positive patients were excluded from the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 C1 + A7 antibody or FLAG antibody (Table S8), as described by Tawk et al. (45) and added to the diluted lysate, followed by rotation at 4 °C over-night.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice with BD Pharmingen Stain Buffer (Cat. No. 554656) and labelled cell suspensions were pooled and incubated with oligo-labelled AbSeq antibodies directed against CD206 (Cat. No. 940068), CD163 (Cat. No. 940058) and HLA-DR (Cat. No. 940010) for 30 minutes on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD206</div><div>suggested: (BD Biosciences Cat# 940068, RRID:AB_2875959)</div></div><div style="margin-bottom:8px"><div>CD163</div><div>suggested: (BD Biosciences Cat# 940058, RRID:AB_2875949)</div></div><div style="margin-bottom:8px"><div>HLA-DR</div><div>suggested: (BD Biosciences Cat# 940010, RRID:AB_2875901)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP1 and Hek293T cells were purchased from ATCC and cultured in RPMI 1640 (Thermo Fisher), 10 % FCS, 1% penicillin/streptomycin solution (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transduction: HEK293T cells were co-transfected with lentiviral vector, pseudotyping- and helper-plasmid (pVSVG and psPAX2) using lipofectamine 2000 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control cells were generated using a pX458 vector with scrambled gRNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pX458</div><div>suggested: RRID:Addgene_101731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transduction: HEK293T cells were co-transfected with lentiviral vector, pseudotyping- and helper-plasmid (pVSVG and psPAX2) using lipofectamine 2000 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVG</div><div>suggested: RRID:Addgene_85140)</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After pre-processing of BD Rhapsody scRNA-seq data, read counts were loaded into the R (v3.6.3) environment and further analyzed using the Seurat package (v3.1.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1A) were obtained through NCBI Sequence Read Archive (datasets ERR030888-ERR030903)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Sequence Read Archive</div><div>suggested: (NCBI Sequence Read Archive (SRA, RRID:SCR_004891)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads in fastq-format were quality-trimmed and mapped to the human GRCh38 reference (GENCODE), using the CLC genomics workbench.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hierarchical clustering was done using Cluster 3.0 (Eisen lab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cluster</div><div>suggested: (Cluster, RRID:SCR_013505)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For pathway enrichment analysis and induced network analysis ConsensusPathDB (48) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ConsensusPathDB</div><div>suggested: (ConsensusPathDB, RRID:SCR_002231)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other plots were generated using GraphPad Prism, Excel or BoxPlotR (http://shiny.chemgrid.org/boxplotr/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BoxPlotR</div><div>suggested: (BoxPlotR, RRID:SCR_015629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence conservation was determined using NCBI BLASTN and the major species reference genome, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTN</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BLAST hits with ≥ 20 complementary nucleotides located within a genomic range of max.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.05.467458
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.11.04.467274

1
1. sciscore 19 Nov 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.11.04.467274: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies are reviewed and approved by the Institutional Animal Care and Use Committee at UTMB and are conducted according to the National Institutes of Health guidelines.<br>Euthanasia Agents: Immunohistochemistry: Hamsters were euthanized using a high-flow rate of CO2 followed by thoracotomy at each time point to collect samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiments: Six-week-old female Syrian golden hamsters were purchased from Charles River.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Three regions were randomly selected, with the regions being at least 100 μm apart, and the averaged values were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: To prevent arbitrary analysis, all data were randomly and blindly analyzed by two trained human operators.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were incubated for 12 hr in a solution containing the following primary antibodies: olfactory marker protein (OMP, goat polyclonal, 1:5000 dilution; Wako Chemicals), SARS-CoV-2 Nucleocapsid antibody (rabbit polyclonal, 1:100; Sino Biological), anti-Iba1 (rabbit polyclonal, 1:300; Wako), anti-Iba1 for paraffin section (rabbit polyclonal, 1:300; Wako), anti-Iba1 (goat polyclonal, 1:300; Abcam), anti-NQO1 (rabbit polyclonal, 1:300; Cell Signaling), anti-NQO1 (goat polyclonal, 1:300; Abcam), and anti-GFAP antibody (mouse monoclonal, 1:500; Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Bio X Cell Cat# BE0359, RRID:AB_2894778)</div></div><div style="margin-bottom:8px"><div>anti-Iba1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NQO1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GFAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected by incubation for 1 hr with a solution containing the following secondary antibodies; goat anti-rabbit Fluor 488, goat anti-mouse Fluor 568, donkey anti-goat Alexa Fluor 488, and donkey anti-rabbit Alexa Fluor 568 (1:200; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-11036, RRID:AB_10563566)</div></div><div style="margin-bottom:8px"><div>anti-mouse Fluor 568, donkey anti-goat Alexa Fluor 488, and donkey anti-rabbit Alexa Fluor 568</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (USA/WA-1/2020) was propagated in Vero E6 cells with DMEM supplemented with 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, binary images were overlapped onto the original images and the densities were automatically measured using ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R (https://www.r-project.org/) and custom-written Python scripts were used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.11.04.467274

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL