Hypothesis

10,000 Matching Annotations

Jun 2021
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.04.21258189

1
1. sciscore 08 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.21258189: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.1 Study population: This study was approved by the Alcala Pharmaceutical Inc. Institutional Review Board (IORG0010127) in consideration of the Code of Ethics of the World Medical Association (Declaration of Helsinki).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thirty-two volunteers took part in a whole blood finger-stick collection with simultaneous application of the specimen to the Healgen® or LYHER® COVID-19 IgG and IgM antibody rapid cassette. 2.2 Materials, collection and test kit components: Whole blood finger-sticks for Healgen® and LYHER® lateral flow rapid cassette testing were collected with kits containing 21G (2.2. mm depth) high flow safety lancets (One-Care®, Irvine, CA), alcohol prep pad, gauze and band-aids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3 donors who tested for positive for IgG and/or IgM COVID-19 antibodies also provided nasopharyngeal swabs for confirmation COVID-19 by RT-PCR (Nucleic acid amplification technique or NAAT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM COVID-19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test results indicate the presence of both IgM and IgG anti-SARS-CoV-2 antibodies (Fig 1c).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.04.21258189
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.04.21258316

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.21258316: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the University of Minnesota institutional review board ( STUDY 00011158).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">From Author: An equity analysis by sex was conducted within this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For COVID-19 negative cases , we collected cases and frontal images combined from: ( 1 ) 2011 – 2016 MIMIC-CXR12 ( random sample of 23,611 images); and ( 2 ) Open-I 2013 IU Chest X-Ray Collection13 ( random sample of 3,814 images).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power analysis and Statistical Considerations.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  For example, a recent review of 62 AI models for COVID-19 from biomedical imaging found significant limitations in AI models published to date and nearly all have been designated as having high bias.5 These biases include: the lack of external validation, lack of equity analysis by race and gender, lack of reporting patient demographics, inadequate number of images, lack of reporting of real-time performance, and the utilization of “unrealistic” training datasets which fail to represent the environment where the model will ultimately be deployed. Finally, albeit unlikely, it is possible that false positives by AI are actually patients with COVID-19 that had a negative PCR test despite being COVID-19 positive. The current sensitivity of rapid PCR testing varies significantly based on the viral load of a patient. Patients with viral load cycle threshold (Ct) levels < 25 have a sensitivity of 90%; however, in patients with lower viral loads (higher Ct) PCR sensitivity drops to 76%.31 A question raised by our findings is what is the performance bar for AI models in clinical decision diagnostic support? Does a model with an AUROC of 0.7 or 0.8 not add additional information that the clinician can integrate into decision making? Similar to how an elevated white blood cell count (AUROC 0.70-0.7532,33) in a patient with right lower quadrant tenderness adds diagnostic information towards a work-up for appendicitis. Our findings suggest that AI analysis of chest x-rays alone is not ade...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.04.21258316
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258129

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258129: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical Analysis: The sample size was based on a non-inferiority trial design, comparing a glove exposed to a sanitizing procedure to an unexposed control glove.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has some limitations. The gloves purchased in India were sourced from a single company, so they may not be representative of the variety available for purchase on the market. Additionally, since the recommended CDC and WHO protocols for disinfection of gloves/hand hygiene were strictly followed, the resulting exposures may have been longer or more physically abrasive to the gloves than real-life hand hygiene behaviors, which may be performed for less time or with less intensity than recommended. Finally, although the non-inferiority margin was selected based on the FDA guidance, evidence in the literature, and expert opinion, there is no standard accepted margin for increased risk of tears and leaks in medical examination gloves. In conclusion, wide variability was observed in the effect of disinfecting latex and nitrile medical examination gloves with repeated applications of ABHR, dilute bleach solution, and soap and water. The findings support the recommendation of glove disinfection with ten applications of dilute bleach solution in settings with severe PPE shortages. ABHR and soap and water had mixed effects depending on the glove type. Given this variability, appropriate guidance on extended glove use for HCWs may require testing to evaluate whether locally available glove options are compatible with locally available disinfectants. This study provides glove testing protocols that could reasonably be done by non-experts in a low-resource setting. Extended use ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258129
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258240

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258240: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258240
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258186

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258186: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258186
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258185

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258185: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials and Methods:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Methods</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258185
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.04.21258205

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.21258205: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.04.21258205
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.04.21257852

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.21257852: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.04.21257852
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258009

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258009: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was done using SPSS version 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has limitations. We only analyzed the records of the hospitalized patients; hence, we could not take into account any non-hospitalized COVID-19 patient with mild disease. Moreover, because of hospital bias, the proportion of severe cases is higher in W2 than W1. The primary reason for this being a change in the admission criteria from W1 to W2. In W1, the hospital had the policy of admitting all COVD-19 positive patients. However, with the rising number of cases and decreasing bed availability in W2, the hospital admits a predominating number of moderate and severe cases. In addition, the use of experimental therapies has appeared midway after the first wave in India, which is why their proportion of use is more in W2. In conclusion, the second wave of COVID has hit India hard and can overwhelm India’s healthcare infrastructure. Hypoxia and organ dysfunctions are more frequently reported in the second wave population, leading to higher ICU admissions and deaths, further overburdening the situation. Our data could be used to inform India’s population about the severity of this second wave so that people understand the nature of the situation and follow all the COVID-19 appropriate behaviors more strictly. The lessons learned from this fight are essential to prevent a third wave from entering any country. We should be better prepared in terms of testing, vaccination, and boosting our critical care sector.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258009
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258175

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258175: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Proteins migrate as a bands of the following molecular weights: S1-115-120 kDa; S2-80 kDa, NCP-45-47 kDa and RBD ∼40 kDa The sodium dodecylsulfate (SDS) gel electrophoresis and Western immunoblotting were carried out as described in our previous studies [8].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 154 subjects were involved in the study, 68 males and 86 females.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258175
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.04.447090

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.447090: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Virus stock generation and titer determination: SARS-CoV-2 strain UF-1 (GenBank accession number MT295464.1) was originally isolated from a COVID-19 patient at the University of Florida Health Shands Hospital via nasal swab (32) and manipulated in a Biosafety Level 3 (BSL3) laboratory at the Emerging Pathogens Institute under a protocol approved by the University of Florida Institutional Biosafety Committee.<br>Field Sample Permit: The sequencing was carried out at the Interdisciplinary Center for Biotechnology Research (ICBR; University of Florida) using a NovaSeq 6000 sequencer (Illumina).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To confirm knockdown, cell lysates prepared from knockdown and control cells were tested by western blotting with antibodies directed to CTSL (Invitrogen, BMS1032)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BMS1032</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stocks were prepared by infecting Vero E6 cells at MOI 0.01, centrifuging culture supernatants collected at 3 dpi for 5 mins at 1000 x g, and filtering through a 0.44 μm PVDF filter (Millipore) followed by a 0.22 μm PVDF filter (Restek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For both libraries, lentiviruses were produced in HEK293T cells by co-transfection of library plasmids together with the packaging plasmid psPAX2 (Addgene 12260) and envelope plasmid pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation of host factors in promoting viral infections: To validate selected host factors for their capacity to promote HCoV infection in vitro, we transduced HEK293T-hACE2 cells with lentivirus-packaged shRNAs targeting CTSL, CCZ1, or EDC4 (TRC Human shRNA Library collection) or the empty vector pLKO.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For both libraries, lentiviruses were produced in HEK293T cells by co-transfection of library plasmids together with the packaging plasmid psPAX2 (Addgene 12260) and envelope plasmid pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation of host factors in promoting viral infections: To validate selected host factors for their capacity to promote HCoV infection in vitro, we transduced HEK293T-hACE2 cells with lentivirus-packaged shRNAs targeting CTSL, CCZ1, or EDC4 (TRC Human shRNA Library collection) or the empty vector pLKO.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLKO.1</div><div>suggested: RRID:Addgene_13425)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sgRNA sequences from the library were assembled into a Burrows-Wheeler index using the Bowtie build-index function and reads were aligned to the index.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We submitted FastQ files to Gene expression omnibus (GSE: XXXXXX) and all CRISPR screen data to BioGRID ORCS database (https://orcs.thebiogrid.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification and testing inhibitors of host factors from CRISPR screens: Online databases and published literature were used to find small molecule inhibitors targeting a subset of top-scoring genes in the CRISPR screens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Online</div><div>suggested: (Globus Online, RRID:SCR_012284)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These percentages were compared to the values obtained from virus infected-cell cytotoxicity values by one-way ANOVA using GraphPad Prism version 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 and IC50 values were calculated by transforming inhibitor concentrations to log then using the non-linear fit with variable slope function (GraphPad Prism version 9) to determine best fit variables using the percent of maximum SARS-CoV-2 induced cytotoxicity measurements at each drug concentration performed in technical duplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.04.447090
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.04.447114

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.447114: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 100 units/mL penicillin, 100 mg/mL streptomycin, and 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Plasmids: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800) were obtained as gifts from Erick Procko and Matthew DeLisa, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-SARS-CoV-2-S-RBD-sfGFP</div><div>suggested: RRID:Addgene_141184)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide beacon sequences were ordered as gBlocks (IDT), and were amplified with overhangs for Gibson Assembly-mediated insertion into linearized pcDNA3-R4-uAb digested with HindIII and EcoRI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-R4-uAb</div><div>suggested: RRID:Addgene_101800)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence data was fitted to one site total binding with saturation curve in the Prism software using the following equation:
  
  where Y is the fraction of peptide beacon bound to target, Bmax is the maximum binding in units of Y, X is the concentration of target, Kd is the equilibrium dissociation constant in units of X, and NS is the slope of the non-linear regression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses was performed using the two-tailed Student’s t test, using the GraphPad software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.04.447114
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.03.446942

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.446942: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Biosafety (IBC) and Animal Care and Use (IACUC) committees.<br>Euthanasia Agents: For the body weight and survival studies, five-week-old female K18 hACE2 transgenic mice were infected intranasally with 105 PFU/animal following gaseous sedation in an isoflurane chamber.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five-week-old female K18 hACE2 transgenic mice were purchased from The Jackson Laboratory and maintained in the animal facility at Texas Biomed under specific pathogen-free conditions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence assay (IFA): Vero E6 cells (106 cells/well,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  To overcome this limitation, we established a rapid method based on a non-invasive measurement of Nluc expression. By using this in vivo imaging system, NAbs could be easily identified as early as 1 dpi and in a relative high throughput method. This was further supported by Nluc activity, viral titration, body weight changes and survival rate (Fig. 7), indicating our strategy provides a rapid in vivo screening method to identify NAbs against SARS-CoV-2. In the present work, we have documented a new strategy to generate replication-competent reporter rSARS-CoV-2 expressing higher levels of reporter gene than those previously described by substituting the viral ORF7a protein with the report gene. This novel strategy does not eliminate any viral gene and these new reporter-expressing rSARS-CoV-2 were genetically stable and replicated as efficiently as rSARS-CoV-2/WT both in vitro and in vivo, with comparable pathogenicity in K18 hACE2 transgenic mice. Notably, the robust levels of reporter gene expression of these new reporter-expressing rSARS-CoV-2 represent an excellent option to study viral pathogenesis, tissue tropism, and replication kinetics of SARS-CoV-2, including recently identified VoC.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 40, 43, 44 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.03.446942
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.03.447023

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.447023: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology (#2020/0004), and written informed consents were obtained from all participants.<br>Consent: This study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology (#2020/0004), and written informed consents were obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of serum SARS-CoV-2 IgG and IgM antibodies was evaluated by IgM/IgG antibody detection kit (Abbott Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 5 hours at 37 °C, the cells were stained with fluorochrome associated antibodies specific for surface molecules; next, the cells underwent fixation and permeabilization for intracellular staining with antibodies specific for the following intracellular proteins: IL-2, IL-4, IL-17A, IFN-γ and TNF-α.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4 , IL-17A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of serum SARS-CoV-2 IgG and IgM antibodies was evaluated by IgM/IgG antibody detection kit (Abbott Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed using a BD LSRFortessa X-20 (BD Biosciences), and data were analyzed with FlowJo V10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical data were analyzed using SPSS version 25.0 Statistical Software (Chicago, IL, USA),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, GraphPad Prism 8 software (GraphPad Software, La Jolla, California) or R software Version 4.0.2 (Institute for Statistics and Mathematics, Vienna, Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although our study confirms some findings and provides new data on the innate and adaptive immune landscape of patients with PS who have recovered from COVID-19 one year after discharge, we recognize limitations that might be overcome with larger sample sizes and matched control populations. Furthermore, there is a lack of understanding of the phenotype and function of immune cells from the lungs, which may directly participate in the formation of PS. Hence, the hierarchy of immunodominant circulating blood immune cells may not exactly reflect immunophenotypic features in the lungs. In summary, our study first shows significant differences in immunological characteristics between PPSs and NPSs one year after discharge. Although the detailed mechanisms by which cellular immunity participates in the development of PS remain to be investigated, our in-depth analysis of immunological profiling contributes to our understanding of the immunopathogenesis of COVID-19, facilitating the tailoring of more effective and proactive therapies for these patients.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 35. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.03.447023
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21257996

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21257996: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All data were collected after written informed consent from the patients or the corresponding guardians, and ethical permission was obtained from the Chattagram Maa-Shishu O General Hospital’s ERB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21257996
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258190

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258190: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This research was performed under a master retrospective protocol (MR 01) approved under expedited review by an external governing institutional review board (IntegReview/Advarra) and granted a waiver of informed consent.<br>Consent: This research was performed under a master retrospective protocol (MR 01) approved under expedited review by an external governing institutional review board (IntegReview/Advarra) and granted a waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The comparison group was randomly assigned a pseudo-baseline prior to matching that reflected equal distribution of the time interval from admission to transfusion as the CP group (Supplemental Materials, Pseudo-Baseline).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We were able to obtain Ortho Vitros serology signal to cut-off ratio (S/Co) data measuring total anti-SARS-CoV-2 antibodies from blood-bank suppliers for a subset of patients treated with CP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes Measures: Statistics: Human Participants and Study Approval: This study was supported by HCA Healthcare and conducted in accordance with US regulations, applicable ICH E6 international standards of Good Clinical Practice, and institutional research policies and procedures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCA Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matching and Covariates: A variety of patient characteristics were captured at baseline that were considered for matching criteria.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although we made substantial efforts to manage challenges of analyzing real-world data, there are limitations inherent in their use. These include the evolution of diagnosis and treatment during this pandemic as well as changes in medical documentation and coding related to COVID-19 across multiple facilities. We attempted to account for this by matching on calendar epochs, controlling for calendar date, and nesting on facility. Neither BMI nor smoking status could be included in our analyses due to unreliability and missingness, respectively. Incorporating days from symptom onset to transfusion, rather than days from admission, could more accurately identify optimal timing of CP transfusion. However, less than 10% of patients had clear reporting of symptom onset and, thus, we could not confidently execute analyses with symptom onset due to missingness. In addition, although concomitant medications were controlled for in all primary, secondary and subgroup analyses, they were treated as indicators during hospitalization rather than accounting for their timing with CP and dose. Future studies will be directed at evaluating medication interactions with CP and identifying optimal dosing and timing of concomitant medications. A challenge to retrospectively evaluating CP delivered in the community setting has been the evolution of treatment criteria and access to CP. The CP cohort was skewed to higher severity based on eligibility criteria for EAP enrollment criteria prior to appr...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258190
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257726

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257726: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257726
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258302

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258302: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: We obtained ethics approval from Public Health Ontario’s Research Ethics Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations include lacking data on vaccination, and potential index case misclassification. Although we inferred variants from their mutation profile, results among cases confirmed by whole genome sequencing were consistent. Substantially higher transmissibility associated with variants will make control of SARS-CoV-2 more difficult, reinforcing the urgent need to increase vaccination rates globally.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258302
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21257858

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21257858: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21257858
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.04.447130

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.447130: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.04.447130
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258184

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258184: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw RT-qPCR amplification data were loaded via a custom Python script (Supplementary Information) that determined CT based on a common threshold across all samples (50000 RFU) which delineated between amplified samples and non-amplified samples in control experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258184
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258097

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258097: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Sample collection: The study was performed in accordance with the declaration of Helsinki and the study protocol (“Jämförande studier av Covid-19 smitta och antikroppssvar i olika grupper i samhället”) was approved by the Ethical Review Board of Linköping, Sweden (Regionala etikprövningsnämnden, Linköping, DNR - 2020-06395).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.06.02.21258097v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258188

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258188: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave written informed consent before undergoing any study procedures.<br>Field Sample Permit: The study procedures for sample collection and those for analyses were approved by Chiba University Ethics Committee on February 24th, 2021 (No. HS202101-03) and April 21st, 2021 (No. HS202104-01), respectively.<br>IRB: The study procedures for sample collection and those for analyses were approved by Chiba University Ethics Committee on February 24th, 2021 (No. HS202101-03) and April 21st, 2021 (No. HS202104-01), respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This system allows for the quantitative detection of antibodies, predominantly IgG, aiming at the SARS-CoV-2 spike protein receptor-binding domain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein receptor-binding domain.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We recruited healthcare workers in Chiba University Hospital who were receiving the BNT162b2 mRNA COVID-19 vaccine (Pfizer, Inc., and BioNTech) in our hospital vaccination program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioNTech</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS version 23.0 (IBM, Armonk, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has some limitations. First, this is a single-center study in Japan with mostly Japanese subjects. Second, neutralizing antibody was not measured, although the assay we employed has been shown closely correlated with the titer of neutralizing antibody [12]. Third, most clinical information was collected with a questionnaire and cannot be verified. Nevertheless, we provide the largest data on antibody responses to the BNT162b2 mRNA COVID-19 vaccine in healthcare workers. Universally good responses demonstrated in our study further support the use of this vaccine in a wide range of populations and the predictive factors identified may help optimize the vaccination strategy and generate hypotheses for future studies.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258188
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258228

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258228: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical considerations: The protocol for the prospective cohort study exploring the effect of HIV and TB on the natural history and immune response to SARS-CoV-2 infection was approved by the Biomedical Research Ethics Committee of the University of KwaZulu-Natal (ref.<br>Consent: We obtained written informed consent from all participants.<br>Field Sample Permit: Specimen collection and laboratory testing: We collected nasopharyngeal swabs and blood specimens on day 6 (day of study enrolment), day 20, day 34, day 71, day 106, day 190, day 204, day 216 and day 233.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample analysis was performed using an Agilent High Pressure Liquid Chromatography (HPLC) system (Agilent Technologies, Santa Clara, CA) coupled to the AB Sciex 5500 (AB Sciex, Framingham, MA), triple quadrupole mass spectrometer equipped with an electrospray ionization (ESI) TurboIonSpray source.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 antibodies in the blood were measured using the Test-it CoV-2 IgM/IgG test kit (Lifeassay Diagnostics, Cape Town, South Africa), which detects IgM and IgG against the S1 subunit of spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV-1 viral load was measured using the Abbott m2000 RealTime assay (Abbott Laboratories, Abbott Park, IL) and CD4+ count using the BD FACSCanto™ (BD Biosciences, San Jose, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BD FACSCanto™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All mutations were confirmed visually with BAM files using Geneious software (Biomatters, Auckland, New Zealand).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of low frequency mutations, we used LoFreq v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LoFreq</div><div>suggested: (LoFreq, RRID:SCR_013054)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We annotated the variants using snpEff v4.523 and extracted them for additional processing and visualizing using SnpSift v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>snpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div><div style="margin-bottom:8px"><div>SnpSift</div><div>suggested: (SnpSift, RRID:SCR_015624)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258228
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258181

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258181: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258181
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258187

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258187: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data on weekly moving average of confirmed cases and deaths are used to estimate the contact rate (β), the proportion of the effective population (ω), the fraction of individuals infected that are deceased (g), and the initial conditions for all compartments, except for the susceptible ones which is set as S(t0) = ω · N − (E(t0) + O(t0) + U (t0) + R(t0)) + V1(t0) + V2(t0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>E(t0) + O(t0) + U (t0) + R(t0)) + V1(t0) + V2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: There are several limitations within our modeling framework that are important to address. Our models do not explicitly capture forms of social influence and individual level behavior which may influence virus spread. Our model assumed homogeneous host mixing which assumes that all participants have identical rates of contacts leading to disease transmission. To mitigate the restrictiveness of this assumption, we included the effective population parameter to our model, which allows for added flexibility in our assumed proportion of individuals susceptible to being infected due to different restrictions, openings, and social behavior. In addition, our model is time dependent allowing the estimated model parameters to vary according to historical data. However, our current model is unable to fully capture the dynamics with specific or localized restrictive measures, or super-spreader events. Another limitation is the absence of age and other risk factors, such as comorbidities, that may impact both infections and hospitalizations. Some of these aspects can be included, as well as more detailed transitions of the dynamics of the virus. However, for practical purposes, our transmission model has made a large number of simplifying assumptions mostly driven by the inability to access data with the appropriate spatio-temporal resolution and coverage. Another limitation in our model is our assumption of the infectivity rate, although currently based on historical data f...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258187
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258106

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258106: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bibliographic databases like MEDLINE (PubMed), Web of Science, and Cochrane database of systematic reviews were searched for all articles published till January 13, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Studies (1) any other type of lung inflammation apart from pneumonia or pneumonia as a consequence of any exposure or pneumonia existing with comorbid conditions, (2) no defined diagnostic criteria for pneumonia, and (3) genotypic data not in accordance with Hardy Weinberg equilibrium were excluded.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hardy</div><div>suggested: (HARDY, RRID:SCR_009107)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The population specific allele frequency data for rs2606345 was obtained from 1000genome browser [16] on March 08, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1000genome browser</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R version 3.4.2 (R Project for Statistical Computing) was used for statistical analyses and spatial analysis plots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As a caveat, induction of CYP1A1 would be expected to be protective. This interpretation could explain counterintuitive lower mortality in regions with higher ambient air pollution, since pollutants are known to be a powerful inducer of CYP1A1 gene expression [42]. The unexpected associations of smoking (induces CYP1A1 gene expression [43, 44] with COVID-19 severity [45] and death [46] could also be understood in this framework. It is clearly noted that both air pollution and smoking are extremely detrimental to health and overall increase respiratory as well as non-respiratory morbidity and mortality. To conclude, we find that CYP1A1 alleles are associated with CAP mortality, presumably via altered xenobiotic metabolism. We speculate that gene-environment interactions governing CYP1A1 expression may influence COVID-19 mortality. Towards this by-product of the main conclusion, we fully acknowledge there are several other factors like demographics (average age of population, population density, sex of a person, ethnic diversity, genetic variability), comorbidities (cardiovascular, cancer, and chronic respiratory diseases), socio-economic factors (GDP per capita, healthcare infrastructure), and political regime (Govt. isolation policies, social distancing, stringency index) that contribute to SARS-CoV-2 mortality and could be potential confounders. Further, the uncertainty of estimation of mortality, while the pandemic is still on, the limitations of the meta-analysis in itself...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258106
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.03.447021

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.447021: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S was detected using a rabbit anti-S2 subunit mouse monoclonal antibody (GeneTex, GTX632604;1:2000 dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2 subunit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseraddish peroxidase-linked goat anti-mouse IgG antibody (Proteintech, CHI, USA, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were permeabilized using PBS with 0.2% Triton X-100 for 15 min and blocked with 5% FBS (Gibco), followed by treatment with the primary antibody anti-SARS-CoV-2 NP (GeneTex GTX635678, USA) at a 1:500 dilution overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After six rinses with PBS, the cells were stained with DyLight 488-labeled antibody against rabbit IgG (KPL, Gaithersburg, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: HEK 293T, Vero E6, Caco-2, and BHK-21 cells were cultured in Dulbecco’s modified Eagle medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells transfected with pcDNA3.1-SARS-CoV-2 S (ct19), pcDNA3.1-SARS-CoV-2 S (wt), or pcDNA3.1-MERS-CoV S (ct16) for 48 h were infected with pseudotype VSV (described below), in which the G gene was replaced with the luciferase gene, at an MOI of 0.1 for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 h, the supernatants were filtered to remove the vaccinia virus and inoculated into BHK-21 cells that had been transfected with pCAGGS-VSV G 24 h previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drug-drug interactions of remdesivir with hits: Caco-2 cells were seeded at a density of 2.4×104 cells per well in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells transfected with pcDNA3.1-SARS-CoV-2 S (ct19), pcDNA3.1-SARS-CoV-2 S (wt), or pcDNA3.1-MERS-CoV S (ct16) for 48 h were infected with pseudotype VSV (described below), in which the G gene was replaced with the luciferase gene, at an MOI of 0.1 for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-MERS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 min, the cells were transfected with 11 μg of mixed plasmids with a 5:3:5:8:1 ratio of pVSVΔG-eGFP-GPC (pVSVΔG-Rluc to generate pseudotype VSV), pBS-N, pBS-P, pBS-G, and pBS-L.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVΔG-eGFP-GPC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSVΔG-Rluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-P</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 h, the supernatants were filtered to remove the vaccinia virus and inoculated into BHK-21 cells that had been transfected with pCAGGS-VSV G 24 h previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titer of the pseudotype virus was measured by infecting BHK-21 cells previously transfected with pCAGGS-VSV G and determined by plaque assay 24 hours post-infection (h.p.i).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-VSV G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All point mutants (D614G, K417N/E484K/N501Y/D614G) were made from pcDNA3.1-SARS-CoV-2 S (ct19) by using a fast mutagenesis system (Transgene Biotech), and mutations were confirmed by sequencing (Sangon, Shanghai).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membrane fusion assay: Vero E6 cells were co-transfected with pcDNA3.1-SARS-CoV-2S (ct19) (0.25 μg) and pEGFP-N1 (0.25 μg) by using lipo2000 in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEGFP-N1</div><div>suggested: RRID:Addgene_111933)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.03.447021
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258176

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258176: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Cleveland Clinic Institutional Review Board.<br>Consent: A waiver of informed consent and waiver of HIPAA authorization were approved to allow access to personal health information by the research team, with the understanding that sharing or releasing identifiable data to anyone other than the study team was not permitted without additional IRB approval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has its limitations. Because we did not have a policy of asymptomatic employee screening, previously infected subjects who remained asymptomatic might have been misclassified as previously uninfected. Given this limitation, one should be cautious about drawing conclusions about the protective effect of prior asymptomatic SARS-CoV-2 infection. It should be noted though, that 12% of the subjects classified as previously infected did not have a symptom onset date recorded, suggesting that at least some of those classified as previously infected might have been asymptomatic infections. It is reassuring that none of these possibly asymptomatically infected individuals developed COVID-19 during the duration of the study. The study follow-up duration was short, being only five months, but this was longer than published mRNA vaccine efficacy studies [1,2], and longer than the follow-up duration of the largest published vaccine effectiveness studies to date [3,4]. Median freedom from reinfection (time from initial infection until end of follow-up) in this study, for those previously infected, of almost 10 months, is consistent with findings in an earlier study that immunoglobulin G (IgG) to the spike protein remained stable over more than six months after an episode of infection [16]. Our study included no children and few elderly subjects, and the majority would not have been immunosuppressed. Data governance policies in our institution precluded us from obtaining detailed ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.06.01.21258176v2
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21257739

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21257739: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics: Study documents, including the protocol, demographic and health information form, interview guide, screener and informed consent form, received ethical approval from the New England Independent Review Board (study number: 1291666) prior to any contact with patients.<br>IRB: Ethics: Study documents, including the protocol, demographic and health information form, interview guide, screener and informed consent form, received ethical approval from the New England Independent Review Board (study number: 1291666) prior to any contact with patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A data-driven approach was adopted whereby transcripts were coded in ATLAS.ti software10 using an open, inductive, thematic coding approach.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATLAS.ti</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had some limitations. First, there was a time lapse between the onset of COVID-19 symptoms and the interview. Patients, on average, completed the interview 12 days after their positive diagnosis. Further studies could explore the symptom trajectory at an earlier stage of their COVID-19 experience, but challenges in recruitment made this difficult, such as the time between being tested and receiving the results, as well as restrictions on public spaces. Future studies may be able to overcome recruitment challenges with more readily available rapid testing. However, patients had vivid memories of their symptoms and provided detailed information on the experience. Second, the participants were not of a representative racial/ethnic background and therefore further research in a more diverse population is required. A final limitation was young average age; age is a documented risk factor for COVID-19 infection, and older patients have been disproportionately affected by COVID-19 symptoms.18 However, younger patients did report a range of symptoms and daily life impacts, emphasising the importance of infection prevention measures in younger adults.19 Further, the types of symptoms experienced by patients did not differ by participant age; further research should be conducted to confirm differentiation of symptoms by age groups. Additional research should also be conducted to explore the symptom experience quantitatively, including the long-term effects of COVID-19, throu...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21257739
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258242

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258242: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: COVAT study is an ongoing, pan-India, cross-sectional study that was approved by the ethical committee of Thakershy Charitable Trust, Ahmedabad, Gujarat, India.<br>Consent: Written informed consent were taken from all the participants who participated in this study, voluntarily.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG antibodies to SARS- CoV-2 directed against the spike protein (S-antigen, both S1 and S2 protein) were assayed with LIASON® S1/S2 quantitative antibody detection kit (DiaSorin Saluggia, Italy) using indirect chemiluminescence immunoassay (CLIA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Moreover, multiple logistic regression analysis was also conducted to find out whether any independent factors were associated with a blunted response to vaccine in anti-spike antibody generation following first dose of vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Software Version 22.0 for windows, SPSS Inc., Chicago, IL, USA, with Microsoft Word and Excel being used to generate graphs and tables.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, we also acknowledge several limitations. Firstly, in the present study, we have used a convenience sampling amounting to selection bias. A community-based study in a larger population with multi-stage sampling would be an ideal sampling method. Secondly, we used a binary logistic regression (to identify the predictors of non-response to vaccines) which primarily assumes linearity between the explanatory variable and the outcome variable, hence this model may miss out any predictor variable which may have non-linear relationship with the outcome variable. Thirdly, we have measured only anti-spike binding antibody and could not assess NAb and cell-mediated immune response such as Th-1 and Th-2 dependent antibody or cytokines (primarily due to the lack of standardized commercial labs in India). Fourth, we could not measure the baseline anti-spike antibody titre prior to the vaccination, because of logistic issue due to lockdown. Finally, two value of short-term anti-spike antibody as evaluated in this report may not necessarily predict the efficacy of vaccine, nor the absence of seropositivity confer failure of vaccine in absence of NAb and T-cell response assessment. In conclusion, this cross-sectional study after the completion of two doses of both vaccines suggests that both vaccines induce seropositivity to anti-spike antigen in 95% of SARS-COV-2 naïve and recovered individuals after 3-weeks. Whether any real difference in inducing immunogenicity exists between two ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258242
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21257591

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21257591: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: African green monkey kidney (VeroE6, ATCC® CRL 1586™) cells constitutively expressing TMPRSS2 (VeroE6/TMPRSS2 (11) obtained from NIBSC, UK) and human Caco-2 cells expressing ACE2 (Caco-2-ACE2; a kind gift from Dr Yohei Yamauchi, University of Bristol) were cultured in Dulbecco’s Minimal Essential Media with GlutaMAX (DMEM, Gibco™, ThermoFisher) containing 10% foetal bovine serum (FBS, Gibco) and 0.1mM non-essential amino acids (NEAA, Sigma Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sample was filtered through a 0.2 µm filter and added to VeroE6/TMPRSS2 cells cultured in Eagle’s Minimum Essential Media with GlutaMAX (MEM, Gibco™, ThermoFisher) containing 2% FBS, 0.1mM NEAA, penicillin (100 units/ml) and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were plotted using GraphPad Prism v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing at COG-UK sites was performed using a combination of Oxford Nanopore or Illumina platforms.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Library preparation and sequencing was performed for the majority of samples using the MinION platform (Oxford Nanopore, UK) with the nCoV-2019 sequencing protocol v3 (LoCost) (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21257591
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.04.447066

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.04.447066: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 32. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.04.447066
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21257987

1
1. sciscore 07 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21257987: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written consent and both the RECOVER and HEROES studies were reviewed and approved by the Institutional Review Boards at participating sites or under a reliance arrangement.<br>IRB: All participants provided written consent and both the RECOVER and HEROES studies were reviewed and approved by the Institutional Review Boards at participating sites or under a reliance arrangement.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted with SAS (version 9.4; SAS Institute) and R (version 4.0.2; R Foundation for Statistical Computing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study also has at least seven limitations. First, although our estimate of 81% VE for partial vaccination is similar to other reports 1,2,7,21,22, this estimate is based on a relatively brief period of follow-up (median of 19 days partially vaccinated versus 69 days fully vaccinated per participant). Second, we may have overestimated VE if we disproportionately failed to detect infections among vaccinated participants due to vaccine attenuation of viral RNA load or reductions in RT-PCR sensitivity due to self-collection and shipping of specimens 23. Third, the study has not completed genetic sequencing for all viruses. Fourth, due to the relatively small number of breakthrough infections observed, we could not differentiate attenuation effects associated with partial versus full vaccination. Similarly, sparse data reduced the precision of estimates, though the consistency of trends across measures affirms the direction of the overall effect. Fifth, due to sparse data and limited racial and ethnic diversity, we were also unable to fully examine or adjust for potential confounders of vaccine attenuation effects. Nonetheless, we stratified our participant recruitment to ensure a combination of participant characteristics by occupation, age, and sex; we did not observe consistent associations between socio-demographic, health, virus exposure, or PPE use with either vaccination status, viral RNA load, or illness duration. Sixth, febrile symptoms and illness duration were meas...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21257987
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258150

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258150: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Third, there are inherent limitations of observational data, however large the dataset. Fourth, some variables are based on patient self-report which can be inexact; for example it can be clearly seen in figure 1a that multiples of seven reported days from symptom onset to admission are overrepresented, suggesting reports in units of weeks. Fifth, one should refrain from overinterpreting data: some of the changes observed reflect adjustments in practice and logistics, combined pressure on health systems, more than actual effects of interventions. Sixth, resuscitation status and suitability for intensive care admission was not collected in our cohort. Implications of findings: Often, in high-income countries, patient outcomes are seen through the lens of individualized treatment provided at the clinician patient interface. This paper demonstrates that outbreak epidemiology has an important influence on patient outcomes – the patient journey from likelihood of admission, through to disposition and length of stay in hospital, and overall outcome, change over the course of a pandemic. There are various explanations for variability – systems may at times be overwhelmed and unable to provide the usual quality of care to their patients; patient behaviour may change depending on perceptions of the status of the outbreak and the performance of the healthcare system at a given time; clinician familiarity with management of patients may vary; and changes in transmissibility and virulenc...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04762628</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial Efficacy of Saisei Pharma Dietary Supplements MAF Caps…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258150
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258111

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258111: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258111
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21257981

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21257981: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Local Ethic Committee of University campus Bio-Medico of Rome (PAR 17.21 OSS) The dogs training plan was divided in two steps: first step of “specific conditioning” to Covid-19 VOCs, consisting in the association of the odour reserch and consequent reporting.<br>Consent: Sweat samples are collected by patients with the assistance of the healthcare staff (physician or nusery) instructing them about the procedure, after informed consent has been recovered.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Security company (Italy) one male and two females from three different breeds: Black German Shepherd, German Shepherd and Dutch Shepherd.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The different boxes were randomly positioned in a line-up from a minimum of four possibilities upwards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21257981
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258071

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258071: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Consent: The GWU Institutional Review Board determined that this project is not human subjects research because this is a surveillance project and not a systematic investigation designed to contribute to generalizable knowledge.<br>Consent: Nonetheless, all participants were asked to sign a consent form giving permission for viral testing, the disclosure of viral test results to the District of Columbia Department of Health as well as to student or employee health services, and the GWU Campus COVID Support Team (CCST).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258071
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258147

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258147: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inhaled budesonide: Cost per kilogram of budesonide dry powder API was estimated using the same methodology above, before accounting for the cost of inhaler devices ($3), additional transport costs, and a projected 20% API loss during formulation and filling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cost</div><div>suggested: (COST, RRID:SCR_014098)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258147
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258143

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258143: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258143
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258025

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258025: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Research Ethics: The study was reviewed and approved by the Oregon Health & Science University Institutional Review Board (IRB# 21230).<br>Consent: Informed consent was obtained from subjects on initiation of their participation in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 4 times with wash buffer, and 100µL (plasma) or 50 μL (LDA) of 1:3000 dilution of anti-human IgG-HRP (BD Pharmingen, 555788) detection antibody was added and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For subjects with low frequency of antigen-specific antibody secreting cells frequency was determined by number of positive wells divided by the total number of IgG positive secreting wells, multiplied by one million, giving a frequency per million PBMCs stimulated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, His-tagged VoC-RBD bearing lentivirus was produced in HEK 293-T cells and used to infect HEK 293-F suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293-T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis was done in Prism version 9.1.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Breakthrough infections and the emergence of VoC highlight the limitations of SARS-CoV-2 S specific plasma antibodies alone to recognize and protect against VoC, and work by our group and others, [9, 28-30] has shown that serum or plasma antibodies elicited by natural infection are less potent overall against several VoC. However, serologic studies do not capture the antibodies that will be secreted by MBCs when they are stimulated, expand, and differentiate into a new population of antibody secreting cells. Here we characterized the SARS-CoV-2 specific MBC derived antibodies, with three critical findings: 1) SARS-CoV-2 RBD specific MBCs can be detected in asymptomatic, seronegative, PCR-positive subjects, 2) MBC populations elicited following primary infection appear relatively stable over time, up to nearly one-year post-infection, and 3) the antibodies these MBCs are programmed to secrete recognize both parental and VoC RBDs at roughly equivalent frequencies. These results are consistent with MBC studies of other pathogens that show MBCs retain pathogen specific antibody diversity that is different from LLPC-derived Abs [11-12, 31]. Because of this additional line of antibody defense latent in SARS-CoV-2 specific MBCs, we contend there is reason for optimism regarding the capacity of vaccination, prior infection, and/or both, to limit disease severity and transmission of VoC as they inevitably emerge in the setting of ongoing transmission. The observation that the high ELI...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258025
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21257975

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21257975: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cohorts: Detection of SARS-CoV-2 IgM antibodies: CovIgM-Assay is an indirect ELISA for the determination of human IgM antibody class, which was optimized via checkerboard titration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2 IgG antibodies: The IgG antibodies were detected and quantified by using the CovIgG-Assay (20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It is an indirect ELISA for quantitative determination of human IgG antibody class, which was optimized by checkerboard titration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of our work is the limited number of subjects followed up after natural infection or after vaccination. However, due to the still limited data available on immune response to SARS-CoV-2 infection, previous reports have made great contribution with a similar number of subjects as on this study (16, 18, 19, 21). Our results contrast with a report describing a short persistence of the Nabs in plasma donors (22) but are in agreement with recent work indicating that neutralizing antibodies may persist longer (1, 5, 23). We were able to show a similar trend in our cohort with sustained neutralizing activity during the frame time of this study and highly relevant, despite of the significant decline in the IgG titers. In addition, we found some subjects with undetectable IgG (n=6) and IgG titers (n=11) while retain measurable percentage of neutralization, from 32 to 76 %, with the surrogate assay. This scenario has been described before suggesting that SARS-CoV-2 serologic assays may be less well suited for surveillance versus prediction of serum neutralization potency, which at the same time, facilitate the establishment of appropriate serologic correlates of protection against SARS-CoV-2 (24). Our results suggest that this approach should be also implemented in the context of vaccine efficacy evaluation at population level. From a technical point of view the discrepancies between samples without detectable antibodies but with neutralizing capabilities may be explaine...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21257975
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21255116

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21255116: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Immunisation and the collection of samples from sheep was carried out under Animals (Scientific Procedures) Act 1986 – Project License number PPL2797.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human serum and plasma samples containing antibodies against endemic human coronaviruses (HKU1, OC43, 229E, NL63) and other non-coronavirus related pathogens were also collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NL63</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antibodies: Humanised IgG recombinant antibodies SARS-CoV-1 RBD Antibody 1 (RAB0001), SARS-CoV-1 RBD Antibody 2 (RAB0003), SARS-CoV-2 RBD Antibody 1 (RAB0006) and SARS-CoV-2 RBD Antibody 2 (RAB0005) were supplied by Randox Laboratories Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAB0006</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample characterisation using SARS-CoV-2 IgG (RBD & NP) assay: SARS-Cov-2 RBD IgG antibody levels were measured using the SARS-CoV-2 IgG (RBD & NP) array kit (Randox Laboratories Ltd, EV4447) as per the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples with a % positivity (SP%) > 50% are reported as seropositive for SARS-CoV-2 RBD IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 neutralising antibodies if present, will bind RBD, inhibiting its ability to interact with ACE2 labelled horseradish peroxidase (ACE2 HRP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2 HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples with % inhibition > 50% are reported as seropositive for SARS-CoV-2 neutralising antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 neutralising antibodies.</div><div>suggested: (Abcam Cat# ab273074, RRID:AB_2847846)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One-hour post-infection, the inoculum was replenished with fresh growth medium and plates were incubated overnight after which the Vero-E6 cells were fixed and immunostained to visualise infected cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: The correlation between the SARS-CoV-2 Biochip pVNT and SARS-CoV-2 microneutralisation assay was calculated with Pearson’s correlation coefficients on MedCalc version 19.0.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This strategy, while worthwhile, has some limitations as such approaches cannot differentiate neutralising from non-neutralising antibodies and results obtained do not equate to protective immunity. Therefore, the SARS-CoV-2 Biochip pVNT test described in this study can positively impact current testing deficiencies in this area. ACE2 represents the primary receptor for viral entry into human cells and multiple studies have demonstrated that it is the RBD within the Spike protein of SARS-CoV-2 that interacts with ACE2 to precipitate viral entry15. During this study, we explored a pVNT format whereby ACE2 was immobilised on the Biochip surface and an alternative pVNT assay format whereby Spike RBD was immobilised on the Biochip surface. Good agreement in the detection of neutralising antibodies against SARS-CoV-2 was observed as demonstrated using recombinant neutralising antibodies and SARS-CoV-2 seropositive clinical samples. (Table 1A, 1B). The putative assay format whereby ACE2 is immobilized on Biochip surface requires a sample pre-incubation step where samples must be incubated off board with HRP labelled RBD prior to addition to ACE2 immobilized on the Biochip surface. This pre-incubation step is cumbersome with respect to manual immunoassay running, potentially increases the possibility of error due to increased immunoassay complexity and poses additional challenges with respect to achieving maximum throughput on automated immunoassay platforms. The alternative format ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21255116
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258128

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258128: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Boards of Hospital Israelita Albert Einstein and the São Paulo Health Department, protocol numbers 4.462.994 and 4.648.956, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The data was randomly split in two sets with a 2:1 ratio for training and testing, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Health care facilities were categorized as privet or public according to the National Registry of Health Care Facilities (CNES, in Portuguese), and was considered in the analyses as an indicator of health care access, since public health services are universally accessible, while only those with health insurance or high income have access to private services.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Portuguese</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed with the R software, version 3.6.3 [17], with the mgcv [18], ggplot2 [19] and viridis [20] packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Booth et al. [39] proposed a different strategy to predict deaths associated with COVID-19 employing molecular biomarkers measured in laboratory samples used for PCR tests; however, this approach presents limitations related to cost and availability of results in a timely manner, in addition a lower performance when compared to the model proposed by this study, with a C-statistic of 93%, sensitivity of 91% and specificity of 91%. Additional studies have focused only on the elderly or hospitalized individuals [40,41]. The model proposed by this study is a powerful response to support managers and other professionals in planning patient care, prioritizing more targeted and assertive strategies and actions, such as monitoring of positive cases with higher prediction of death, stewardship, and distribution of resources at different care levels, regions and cities, including different vulnerability contexts. Added to the risk factors highlighted in this study, many countries in the world are going through an economic, political and ethical crisis, including Brazil, with defective response, policies that go against social distancing, lack of country-level coordination, negationism, and neoliberal policies [42], which may affect the outcomes of this pandemic. Thus, the response to the pandemic in these settings must be challenged, and larger studies including these variables in the analyses are required, such as the need for interdisciplinary analyses [43–45], considering the clinic...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258128
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21257869

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21257869: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">13 Statistical analyses were performed using R version 3.6.3 with RStudio (R Core Team, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, our study also has limitations. The analysis is limited by the inability to control for unmeasured confounders especially in terms of missing comorbidity profiles and by right censoring of data. We were also unable to stratify by specific VOC lineage given lagging sequencing information, though the vast majority VOC cases are likely to be B.1.1.7. 11 Moreover, because data on ICU-related outcomes is likely to be underreported in the CCM dataset by ∼45% at the time of the analysis, ICU-related outcomes (i.e., ICU admission and ventilation/intubation) should be interpreted with caution. In conclusion, this study suggests that VOCs that that harbour the N501Y mutation, which confers greater infectivity, is also associated with more severe disease manifestations relative to earlier strains. Taken together, these findings suggest that compared to the previous phases of the pandemic, health systems will likely face increased demand for acute care hospital and ICU resources as VOCs predominate worldwide, especially in view of limited global vaccination coverage. Therefore, prompt vaccine roll-out particularly in regions with high incidence of VOC is warranted to reduce the global burden of COVID-19 going forward.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21257869
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258218

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258218: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study received ethical approval from the Wales Cancer Bank (WCB No. 21/004), the Newcastle & North Tyneside 2 Research Ethics Committee (IRAS ID: 294246) and Cardiff University School of Medicine Research Ethics Committee (SREC reference: SMREC 21/01).<br>Consent: All participants gave written, informed consent prior to inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of anti-SARS-CoV-2 RBD IgG Antibodies: An in-house direct ELISA was developed as previously described (16-19), with some modifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed three times with PBS-T then incubated (1 hour, room temperature) with secondary antibody (donkey anti-human IgG F(ab’)2-horseradish peroxidase (HRP); #709-036-149, Jackson ImmunoResearch, Ely, UK) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 709-036-149, RRID:AB_2340498)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-γ was quantified by extrapolating from the standard curve using Graphpad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: GraphPad Prism Version 9 was used for all statistical analyses of datasets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258218
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258172

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258172: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258172
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258062

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258062: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: We conducted a cross-sectional study about COVID-19 among the working-age population in Japan on December 22–26, 2020, under the CORoNaWork (Collaborative Online Research on the Novel-coronavirus and Work) Project [14].<br>IRB: The study was conducted according to the guidelines of the Declaration of Helsinki, and it was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (Approval number: R2-079).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance was defined as P <0.05. Stata/SE□16.1 (StataCorp, College Station, TX, USA) was used for the statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, there are several limitations in our study. First, the present study was conducted over the Internet, and the generalization of the results is thus unclear. However, to increase the external validity and reduce bias as much as possible, we defined the target population according to sex, job type, and region on the basis of COVID-19 incidence rate data. In addition, remote workers were the target population in this study; these individuals use the Internet daily, and some extent of generalizability is therefore guaranteed. Second, although there are several measurements of loneliness [27], in the present study, the presence of loneliness was assessed through a single question. However, this approach follows previous research that used a single item to measure loneliness [27]. Third, the causal relationship between remote work and the presence of loneliness is unknown because this was a cross-sectional study. Concerns have been raised about the existence of reverse causality in this relationship because, for example, certain workers might not choose to work remotely because they wish to avoid loneliness. However, during the COVID-19 pandemic, workers were not likely to be able to decide the frequency of telecommuting on their own, and the possibility of reverse causality is therefore probably low. In conclusion, among remote workers in Japan, we found that support from co-workers and support from supervisors were strongly associated with loneliness, and frequency of re...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258062
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21257759

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21257759: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The ADAPT study was approved by the St Vincent’s Hospital Research Ethics Committee (2020/ETH00964) and is a registered trial (ACTRN12620000554965).<br>Consent: All participants gave written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The aims of ADAPT are to evaluate a number of outcomes after COVID-19 relating to pathophysiology, immunology and clinical sequalae.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ADAPT</div><div>suggested: (ADAPT, RRID:SCR_006769)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were stored using REDCap electronic data capture tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For unsupervised analysis, the following FlowJo plugins were used: DownSample (v.3), TriMap (v.0.2), Phenograph (v.3.0) and ClusterExplorer (v.1.5.9) (all FlowJo LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TriMap</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ClusterExplorer</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phenograph plugin was then used to determine clusters of phenotypically related cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenograph</div><div>suggested: (Phenograph, RRID:SCR_016919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wilcoxon paired t test was used to analyse statistical data employing Prism 9.0 (GraphicPad, La Jolla, CA, USA) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RStudio version 1.2.1335 was used to generate correlograms utilizing corrplot package and Spearman’s rank-order correlation coefficient with an adjusted FDR <0.05. p values <0.05 were considered significant (*<0.05, **<0.01, ***<0.001, and ****<0.0001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our data does have some limitations. Firstly, although our long COVID ‘cases’ and controls were matched for two major characteristics (age and gender) it is possible that the differences observed reflect other key demographic or other factors between the groups. Secondly, although 7 of the 29 analytes were observed to be abnormally elevated, 22 of 29 were not (including key cytokines often implicated in chronic fatigue syndromes such as Pentraxin- 3(PTX3), TGF-β1, and IL-13)62,63. This suggests long COVID may be differentiated from other post viral fatigue syndromes, however, our results require validation in other cohorts of long COVID to ensure their replicability. Finally, our definition of ‘long COVID’ cases was internally set given the lack of international consensus regarding this and thus is not definitive. Nevertheless, the inclusion of three of the commonest persisting symptoms and the blinding of cases and controls from the laboratory scientists has helped to ensure the validity of our findings. Additional strengths of our study include the prospective protocol defined collection of samples and data and the establishment of an ADAPT–C cohort of individuals affected contemporaneously with other human coronaviruses to act as controls. In summary, taken together our data identifies a distinct but diffuse profile of elevated inflammatory cytokines in people with persisting symptoms post COVID-19 infection, the majority of whom had initial mild-moderate illness. This inf...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21257759
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21257804

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21257804: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board of the Perlmutter Cancer Center at NYU Langone Health reviewed and approved the study, which was conducted according to the Declaration of Helsinki and International Harmonization Guidelines for Good Practice.<br>Consent: All patients signed informed consent for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For virus neutralization assays, icSARS-CoV-2-mNG (isolate USA/WA/1/2020 expressing a mNeon Green reporter), was obtained from the UTMB World Reference Center for Emerging Viruses and Arboviruses(15) and amplified once in Vero E6 cells (ATCC CRL-1586) to generated a working stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We detected bound IgG, IgA and IgM using anti-human IgG-Alexa 488 (Jackson Immunoresearch catalog number 109-545-098), anti-human IgA-PE (Jackson Immunoresearch; catalog number 109-115-011) and anti-human IgM-DyLight405 (Jackson Immunoresearch; catalog number 709-475-073), diluted in PBS with 0.1 % Tween 20 and 1 % BSA to 1:800, 1:100 and 1:200 respectively, on a Yeti ZE5 Cell Analyzer (Bio-Rad) and analyzed the data using FlowJo (BD, version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21257804
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.03.21258293

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.21258293: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.03.21258293
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.03.446968

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.446968: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: De-identified human patient-derived apheresis collars (a by-product of platelet isolation) were obtained from the Crimson Biomaterials Collection Core Facility under approval obtained from the Institutional Review Board at Harvard University (#22470); informed written consent was not required.<br>Consent: De-identified human patient-derived apheresis collars (a by-product of platelet isolation) were obtained from the Crimson Biomaterials Collection Core Facility under approval obtained from the Institutional Review Board at Harvard University (#22470); informed written consent was not required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fixed samples were permeabilized in PBS containing 0.1% Triton X-100 and 1% Fetal Bovine Serum for 30 min at room temperature before filling the channels with staining buffer (1.5% BSA in PBS) containing primary antibodies directed against cleaved caspase-3 (Cell Signaling Technology, 9661S) or VE-cadherin (Thermo Fisher Scientific, 14-1449-82), and incubating them overnight at 4°C with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cleaved caspase-3 ( Cell Signaling Technology ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VE-cadherin</div><div>suggested: (Thermo Fisher Scientific Cat# 14-1449-82, RRID:AB_467495)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus infection of human Intestine Chips: OC43 virus (ATCC, VR-1558) was propagated in HCT-8 cells in RPMI with 3% horse serum at 34°C and quantified by TCID50 assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing libraries were demultiplexed using bcl2fastq (v2.20.0.422) with default settings (mask_short_adapter_reads = 10, minimum_trimmed_read_length = 10) on Cumulus14 (snapshot 4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Libraries were aligned using STAR implemented on Cumulus (snapshot 9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dimensionality reduction, cell clustering, and differential gene analysis were performed in Seurat v3.1 and differential gene expression analysis in Seurat v4.016,17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence imaging was performed using a confocal laser-scanning microscope (Leica SP5 X MP DMI-6000) and the images obtained were processed by Imaris software (Bitplane) and analyzed by Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Unpaired Student’s t-test was performed in GraphPad Prism using the Welch correction for different standard deviations and differences were considered statistically significant when *P<0.05, **P < 0.01, and ***P < 0.001.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.03.446968
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258086

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258086: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Sample collection: Infants, children and adolescents < 22 years of age presenting to Massachusetts General Hospital urgent care clinics or the hospital with COVID-19 as determined by PCR testing of nasal specimens (4/2020-4/2021) were offered enrollment in the Institutional Review Board-approved MGH Pediatric COVID-19 Biorepository (IRB # 2020P000955).<br>Consent: After informed consent, and assent when appropriate, was obtained verbally, a nasopharyngeal, oropharyngeal and/or anterior nares swab was obtained and placed in phosphate buffered saline.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For TCID50 measurements conducted in parallel, 25uL of the Spin-X flow-through was used to inoculate Vero-E6 cells in a 96w plate in the presence of 5ug/mL of polybrene (Santa Cruz Biotechnology) using 5-fold dilutions (5-1 to 5-6) and 4 repeats for each sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical data collection: Demographic and clinical factors were recorded through a combination of manual charts reviews and data extraction from electronic health records (EHR), then collected in a REDCap database [15] through the Partners Electronic Health Record Registry of Pediatric COVID-19 Disease (IRB # 2020P003588).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequence alignment was performed with MAFFT (multiple alignment using fast Fourier transform) [19]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Best-fit nucleotide substitution GTR+G+I was used for the datasets using model selection in IQ-Tree followed by maximum likelihood phylogenetic tree construction using IQ-Tree web server with 1000-bootstrap replicates [20].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-Tree</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis: All statistical analyses were performed using parametric comparisons in GraphPad Prism (Version 9.1.1), including Pearson correlation, ANOVA with multiple comparisons, and unpaired t test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258086
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258203

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258203: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.10 Data: We use cumulative infected and death data downloaded from the COVID19India website https://www.covid19india.org/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID19India</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258203
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258073

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258073: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Human B cell ImmunoSpot® assays: For enumeration of antibody-secreting cells (ASC), irrespective of their antigen specificity, cell suspensions were serially diluted 2-fold in duplicates, starting at 3 x 104 live cells/well, in round-bottom 96-well tissue culture plates (Corning, Sigma-Aldrich) and subsequently transferred into assay plates precoated with anti-Igκ/λ capture antibody contained in the human IgA/IgG/IgM Three-Color ImmunoSpot® kit (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Igκ/λ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 6XHis-tagged protein solutions at 10µg/mL in PBS (unless otherwise specified) were applied to EtOH pre-conditioned wells precoated overnight at 4°C with 10µg/mL (unless otherwise specified) anti-His tag antibody (Biolegend, San Diego, CA) and incubated overnight at 4°C to improve antigen absorption.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridomas: Murine B cell hybridoma lines secreting (IgG1, κ) monoclonal antibody (mAb) with reactivity against the hemagglutinin (HA) protein of the pandemic H1N1 (pH1N1) A/California/04/2009 (CA/09) influenza vaccine strain have been reported previously [70].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hemagglutinin ( HA</div><div>suggested: (GeneTex Cat# GTX127357, RRID:AB_2728683)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For enumeration of total ASC, irrespective of their antigen-specificity, ∼100 B cell hybridomas were input into wells precoated with anti-Igκ capture antibody contained in mouse B cell ImmunoSpot® kits (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specificity</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Igκ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridoma lines secreting mAb with reactivity against the Spike protein of SARS-CoV-2 were generated from DBA/2J mice (Jackson Laboratory, Bar Harbor, Maine, USA) that were immunized intraperitoneally with heat-inactivated SARS-CoV-2 virus antigen [71] (∼100µL of virus antigen/mouse) adjuvanted with alum hydroxide on day 0, day 21 and day 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DBA/2J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Prism 9, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258073
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258076

1
1. sciscore 06 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258076: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the NCDC Ethics Review Committee vide approval 2020/NERC/14.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Elecsys Anti-SARS-CoV-2 kit from Roche Diagnostics was used to detect antibodies to SARS-CoV-2 NucleoCapsid antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 NucleoCapsid antigen.</div><div>suggested: (Proteintech Cat# 28769-1-AP, RRID:AB_2881212)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were processed as per the CovidSeq (Illumina) protocol for sequencing on the NextSeq 550 (Illumina) instrument according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CovidSeq</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data generated in binary base call (BCL) format from NextSeq 550 was demultiplexed to FASTQ file using bcl2fastq v2.20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein annotation and modelling: In total of 8,477 SARS-CoV-2 genomes were annotated for amino-acid substitutions by SnpEff version 4.5 (Cingolani et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each chain was mutated for missense mutations using ChimeraX (Goddard et al., 2018) whereas deletions in each chain were introduced by employing Coot (Emsley et al, 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258076
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.02.446831

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.446831: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.02.446831
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.03.446959

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.03.446959: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HLA molecules were purified from lysates of EBV transformed homozygous cell lines by affinity chromatography by repeated passage over Protein A Sepharose beads conjugated with the W6/32 (anti-HLA-A, -B, -C) antibody, following separation from HLA-B and -C molecules by pre-passage over a B1.23.2 (antiHLA B, C) column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HLA-A, -B, -C</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antiHLA B</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following Huddelston et.al. (Huddleston et al., 2020) who used SANTA-SIM to simulate influenza A/H3N2 that has a yearly substitution rate approximately twice as high as SARS-CoV-2 [∼48,824 substitutions/year (https://nextstrain.org/flu/seasonal/h3n2/ha/2y?l=clock) vs. ∼24.5 substitution/year (https://nextstrain.org/ncov/global?l=clock)], we chose 400 generations/year, with the mutation rate per position per generation set to 2.04E-6 (yearly substitution rate/(generations in one year * genome size)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  LIMITATIONS AND FUTURE DIRECTIONS: Our analyses focused on class I molecules for which predictors are established to be more accurate in comparison with class II. HLA-C and non-classical HLA were not included in this study. Predictions were performed on the most common HLA class I alleles and rare HLA alleles were not included. Study has been performed using the GISAID dataset available in December 31st 2020, i.e. first year of the pandemic, before mass vaccination. Our epitope binding results rely on in silico predictions using a method that has been widely benchmarked, but is designed to predict peptide presentation rather than immunogenicity. Follow up experiments would need to be performed to further validate the proposed model. Priority follow up studies are 1) to investigate T cell response to SARS-CoV-2 mutants in large cohorts of B7 supertype-positive versus negative patients, and 2) to determine the direct role of APOBEC family proteins in modulation of SARS-CoV-2-specific T cell immunity. Moreover, this study lays the foundation to understand the evolutionary dynamics of pandemic viruses with a time 0 / no vaccine-induced immune pressure start point. Employing SARS-CoV-2 as model provides an opportunity in future studies to look at the dynamic of the relationship between mutational patterns and HLA-restricted T cell immunity in real-time. Kinetic analyses using the latest GISAID datasets, which now include 1.7M SARS-CoV-2 genomes as of May 2021, may lead to addition...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.03.446959
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446403

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446403: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446403
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.02.446468

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.446468: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Emory Institutional Review Board (IRB) under protocol numbers IRB00058507, IRB00057983 and IRB00058271.<br>Consent: Informed consent was obtained from the patients when they had decision making ability or from a legal authorized representative (LAR) if the patient was unable to provide consent.<br>Field Sample Permit: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.<br>IACUC: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell surface antibody-derived tag (ADT), encapsulation, and library generation: Leukocytes from whole blood and ETA samples were incubated with oligo-conjugated Ig-A/D/G/M for 10 mins at 4°C followed by the addition of Human TruStain FcX™ (BioLegend) and 10 min incubation at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Single-cell surface antibody-derived tag ( ADT) , encapsulation</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>library generation: Leukocytes from whole blood and ETA samples</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ADT reads were aligned to a feature reference file containing the antibody-specific barcode sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-specific barcode sequences .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero E6 cells were seeded in a 6-well plates (Falcon) with 5 x 105 cells/well in 5% DMEM 24 h prior to infection and checked to verify ≥80% confluency. 10-fold dilutions of virus, respiratory secretions, and/or scRNA-seq emulsion in serum-free DMEM (200 μL) were incubated on Vero E6 monolayers for 1 h absorption at 37°C with rocking at 15 min intervals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in ~4 mL FACS buffer, then resuspended in 200-1000 μL for acquisition using BD FACSDiva™ Software on the Emory Pediatric/Winship Flow Cytometry Core BD FACSymphony™ A5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with FlowJo™ v10.7 (FlowJo LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To recover neutrophils, scRNA-seq UMI count matrices were imported to R 4.0.2, and data analyses were performed using Seurat v4.042.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R package Slingshot was used to infer the trajectories of neutrophils recruited to the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Slingshot</div><div>suggested: (Slingshot, RRID:SCR_017012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.02.446468
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258124

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258124: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.2 Internal testing pipeline: The Study was approved by the ethical committee of the Canton of Bern (2020-00563).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A possible limitation is that we assumed an hospitalization rate of 2.5% throughout the epidemic, from which several model parameters are then estimated. Furthermore, we did not consider reinfections among the cohort of healthcare workers over the studied period, but they could be worth including in future models over longer periods where reinfection would be more likely. Although variations in the hospitalization rate and reinfections would lead to different parameters and in turn, case incidence outside and possibly inside the hospital, these do not affect the conclusions of our study regarding the effectiveness of preventive interventions. In summary, our study showed that frequent and widespread testing of pre- and asymptomatic healthcare workers is effective in detecting infections and preventing transmission between coworkers while optimising work output and cost-effectiveness.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04333862</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of Covid-19 Infection Rates in Healthcare Workers…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258124
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257063

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257063: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were limitations during the symptomatic clinical evaluation. The tests were conducted under controlled temperature and lighting conditions and interpreted by a limited pool of trained operators. Widespread community testing might occur under less-controlled conditions. Several point-of-care flex studies (see Supplementary Information) were performed to demonstrate that the INDICAID™ Rapid Test is robust under suboptimal conditions (i.e., extreme temperature and humidity, out-of-specification buffer addition, and variable result reading times). Additionally, self-collected samples were always collected first, which might have affected the amount of virus/antigen remaining for the subsequent operator-collected samples. While the sample collection order is not expected to drastically influence the reference test result, the effect of repeated sampling on the INDICAID™ Rapid Test has not been confirmed. Rapid antigen tests are expected to play an increasingly important role in COVID-19 testing programs. To our knowledge, our Dual-Track testing approach is one of the first widely coordinated efforts to integrate COVID-19 rapid antigen testing with rapid confirmatory RT-PCR testing in asymptomatic populations. Recently, the United States CDC proposed similar screening algorithms that incorporate routine rapid antigen testing for asymptomatic populations, followed by positive patient confirmation by RT-PCR [11]. The performance of the INDICAID™ COVID-19 Rapid Antigen Test make...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04904510</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluation of the INDICAID™ COVID-19 Rapid Antigen Test</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257063
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21256092

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21256092: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Centre, location AMC, the Netherlands and approved by the local ethical committee (NL 73281.018.20).<br>Consent: All individuals provided written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other proteins were produced in HEK293F cells (Invitrogen) maintained in Freestyle medium (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells expressing the SARS-CoV-2 receptor ACE2 were seeded in poly-L-lysine coated 96-wells plates and the next day triplicate serial dilutions of heat-inactivated serum samples were prepared, mixed 1:1 with SARS-CoV-2 pseudovirus, incubated for 1 h at 37°C and then added in a 1:1 ratio to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a gene encoding amino acids 1-1276, in which the furin cleavage site (amino acids 752-756) was replaced with a GGSGS sequence and amino acids at position 1067 and 1068 were mutated to prolines, was ordered and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mann-Whitney U-tests for unpaired comparisons, Wilcoxon matched-pairs signed rank test for paired comparisons and Spearman correlations were performed in GraphPad Prism 8.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis was performed in Matlab 9.6 (R2019a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21256092
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21257899

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21257899: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was however evaluated by the University of Southampton Ethics Committee (REF ERGO/61242) and approved as a service evaluation following Data Protection Impact Assessment and establishment of Data Sharing Agreements.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed in Python v3.9.4 (using pandas, seaborn, statsmodels).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  These findings must be understood in light of their limitations. CO@h was rapidly developed in response to the pandemic, and as a result, the improvement cycles were conducted at pace. PDSA quality improvement was conducted using evidence-based practice, where insights were provided by data professionals to clinicians. A multi-disciplinary team of healthcare professionals, QI personnel, and data scientists met frequently to discuss patient care, and CO@h efficacy. Operational improvements were implemented through these discussions to deliver continual improvement especially procedures relating to integrated services between conveyance, CO@h and hospitals. Formally, the distinct improvement cycles were as follows: (1) CO@h service pilots (1st wave of the pandemic: March 2020 to July 2020) including community COVID-19 assessment centres implemented without remote monitoring beyond paper diaries and phone, treating n=1600 suspected-COVID patients and escalating n=105 to hospital; and support by hospital Same Day Emergency Care and care homes telemedicine services (2) NHS Trust-wide implementation of CO@h (2nd wave of the pandemic: November 2020 to March 2021) with efficacy evaluation presented here. Finally, this service evaluation is for an integrated community care pathway and a single hospital trust, therefore generalisation is limited by population size and clinical setting.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21257899
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258074

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258074: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several study limitations to note. The goal of this study was not to find the most informative set of predictors of uptake, but rather to assess the relative strength of socio-demographic versus emotional determinants and better understand the role of recent emotions – possibly driven by the pandemic or government interventions – and their effect on the willingness to accept a COVID-19 vaccine. There therefore could be a set of questionnaire variables (see appendix) that explain more variance in the outcome than those stated and further research could examine these maximally informative variables. Uptake is also likely going to vary substantially within a country due to local factors and local clustering of demographics5, which is outside the scope of this study. Moreover, COVID-19 vaccine acceptance will likely change over time. Sub-national temporal monitoring would be useful to establish local hotspots of non-vaccinators and the demographic and emotional groups who are unlikely to vaccinate Moreover, the robust association found between national level vaccine confidence and intent to accept a COVID-19 vaccine indicates that previous high vaccine confidence could be an indicator of confidence in future COVID vaccines.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258074
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257583

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257583: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: End of December 2020 beginning of January 2021, the SARS-CoV-2 incidence in the population was very high and COVID-19 outbreaks were observed at several LTCF [2]. As a result, most of the COVID-19 events were observed during the start of the study, where a large proportion of the priority groups were unvaccinated. Therefore, it was important to account for calendar time in the estimation of the VE’s. In all priority groups, the second dose was administered at a median of 22-25 days after first dose, which did not allow sufficient time to observe the full effect of the first dose. With a high vaccine coverage as observed among LTCF and 85+, the unvaccinated group that is used for comparison becomes very small and include a selected population different from the majority. This implies that VE estimates in this setting should be interpreted with caution. In conclusion, across all five priority groups, the overall VE against COVID-19 infection >7 days after the second dose was 82%. It is encouraging that among the most vulnerable citizens and those with the highest risk of infection, we observed a high reduction in risk of infection when fully vaccinated with BNT162b2 mRNA. In addition, though COVID-19 related death in many priority groups are rare events following vaccination, over all COVID-19 related admissions and deaths were reduced by 93% and 94%, respectively.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257583
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257488

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257488: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All procedures involving human participants, collection and use of clinical samples and data were in accordance with ethical standards and approved by the human research ethics committee under license protocol number: 4051614; CAAE (certificate of presentation for ethical appreciation): 31984720300005091.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linear regression was performed using Prism software, version 9 (GraphPad Software, San Diego, CA, USA) leading to the equation: Y = -3.6383X + 38.771 and coefficient of correlation R2 = 0.9938 (Supplementary Figure S2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One of the main limitations for direct sample test by colorimetric RT-LAMP based on pH-sensing is the false positive results upon input sample addition (previous to amplification), due to naturally acidic samples (30,52). To prevent spurious amplification due to the presence of DNA from oral microbiome, food or host cells on primary samples, Bokelmann and cols (2021) treated samples with λ exonuclease that acts by preferentially digesting 5’-phosphorylated DNA leaving non-phosphorylated primers or LAMP products intact (30). Here we shown preliminary results on RNA extraction-free, pre-treatment free, primary 10x diluted hydrochloride guanidine-containing VTM nasopharyngeal samples directly accessed to compared colorimetric results. Three out of five RT-qPCR true positives directly accessed samples returned positive yellow output on colorimetric RT-LAMP for SARS-CoV-2 detection. This provides clues on the use of unextracted samples for massive COVID-19 testing campaigns with a trade-off on cost-benefits for limit of detection and test sensitivity. Most high and medium viral load samples will be detected on unextracted protocols. However, to meet RT-qPCR detection sensitivity levels, this requires some type of purification step and RNA concentration (11,24,31). We are currently observing rapid converging evolution of SARS-CoV-2 during COVID-19 pandemics worldwide. Several reports alert for the emergence of variants of concern and interests such the B.1.1.7, first detected in En...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257488
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.25.21257820

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.25.21257820: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had several limitations. First, the study design is a prospective cohort without strict inclusion criteria which allows for heterogeneity across the sample population. This was intentional as the GIM clinic is best suited for evaluating patients with symptoms across multiple systems. Second, the selection of patients with multiple symptoms increased the concentration of patients with PoCoS, as patients with limited symptoms suggestive of one organ system involvement or those with already identified post COVID end organ damage were directly triaged to the appropriate specialty, e.g. anosmia to ENT, pulmonary fibrosis to Pulmonology. This was also intentional as we had designed a treatment program directed at helping these individuals. Third, our population was 94% White/Caucasian, and involved no patients of Hispanic descent. This was unintentional and likely secondary to our local demographic and differences in health seeking behaviors. Therefore, future research in a more diverse population is warranted. Fourth, the standard lab panel was not ordered in all patients, which reflects referring provider preference or patient-specific clinical decisions. Because of these limitations, our study data may not be widely generalizable to all PASC patients but provides previously unreported insights into PoCoS and its likely immune dysregulation etiology.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.25.21257820
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257598

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257598: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A main limitation of our study that impacts representativeness of results is that our medical claims data does not cover Medicare and Medicaid health insurance programs. Medicare covers most aged and disabled population across the US, while Medicare covers a wider range of population including low-income beneficiaries covering 30% of US population [25]. Hence, our data misses some population groups in the US. Despite the limitation of the data, our findings provide important policy implications. There is a significant mental health cost for non-pharmaceutical interventions, especially interventions that are extended to a long duration of time with no expected time for lifting. Our results suggest that policymakers should take into consideration the mental health cost and ensure mental health treatment capacity. Furthermore, we showed that number of patients had dropped right after lockdowns and then progressively increased in June and July 2020, which suggest that people with mental health afflictions did not have the ability to seek care directly during restrictive lockdowns. Our results suggest that policy interventions should be accompanied with strategies that allow seeking psychiatric help despite restrictive lockdowns, in order to avoid the exacerbated effect of delayed mental health treatment.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257598
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21254851

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21254851: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board (IRB) at the Icahn School of Medicine at Mount Sinai (20-0327).<br>Consent: Given the extraordinary challenges posed by the COVID-19 pandemic for obtaining informed consent, and in consideration of the public health crisis, a delayed consent model was applied.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IL10RB shRNA treatment for 96 hours in MCF7 cells) is assessed and ranked for its ability to reverse the trait-associated imputed transcriptomes using a previously published method16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCF7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The STAR aligner v2.5.2a33 was used to align reads to the GRCh38 genome (canonical chromosomes only) and Gencode v25 annotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div><div style="margin-bottom:8px"><div>Gencode</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The module featureCounts34 from the Subread package v1.4.3-p135 was used to quantify genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Subread</div><div>suggested: (Subread, RRID:SCR_009803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RSeQC v2.6.136 and Picard v1.7737, were used to generate QC metrics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RSeQC</div><div>suggested: (RSeQC, RRID:SCR_005275)</div></div><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This shRNA GReX antagonism approach identifies IL10RB (21q22.11) as the most promising gene target and overcomes traditional limitations of GWAS and TWAS analyses in identifying key genes within a gene cluster. Based on existing approaches, IL10RB would not have been the top candidate for further investigation. First, the index SNP for COVID-19 susceptibility in 21q22.11, rs1305072857, falls within an intronic region of IFNAR2 (less than 24kbp from IL10RB). In addition, integrating genotype-gene expression datasets cannot identify the most likely causal gene in this locus since the index SNP is associated with gene expression changes of both IFNAR2 and IL10RB57. Similarly, the genes can only be partially prioritized with targeted individual imputation (Figure 3A; IFNAR2 is not associated with COVID-19 death but is associated with COVID-19 severity) and cannot be prioritized on TWAS based on summary statistics (Figure 2A) even when considering splicing58 due to co-regulation59 (Supplementary Figure 10). IL10RB is, in part, prioritized because it has a more uniform imputed transcriptional dysregulation across tissues (predominant down-regulation; Figure 2A, Supplementary Figure 11). On the other hand, IFNAR2 is expected to be up-regulated in some tissues and down-regulated in others58 (Figure 2A, Supplementary Figure 11), e.g. there is a consistent, predicted, down-regulation in adipose tissue and an opposing up-regulation in muscle tissue (Supplementary Figure 12). Unfortunate...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04343976</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Enrolling by invitation</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Pegylated Interferon Lambda Treatment for COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04354259</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Interferon Lambda for Immediate Antiviral Therapy at Diagnos…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04534673</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Pegylated Interferon Lambda for Treatment of COVID-19 Infect…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04344600</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Peginterferon Lambda-1a for the Prevention and Treatment of …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02554019</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Proof-of-Concept Study With BT063 in Subjects With Systemic …</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21254851
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258022

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258022: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consent was obtained prior to data collection and ethical approval was granted by the Psychiatry, Nursing and Midwifery Research Ethics Subcommittee at King’s College London (LRS-20/21-21336:COVID-19).<br>IRB: Consent was obtained prior to data collection and ethical approval was granted by the Psychiatry, Nursing and Midwifery Research Ethics Subcommittee at King’s College London (LRS-20/21-21336:COVID-19).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Interviews were conducted by FM and LW, who are both female researchers with training and experience of qualitative methods in health research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258022
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21258059

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21258059: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Eligibility Criteria: 2.3 Information Sources and Search Strategies: A comprehensive literature search was done using the search engines Pubmed, Google Scholar, Cochrane CENTRAL, and Web of Science database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pubmed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>Cochrane CENTRAL</div><div>suggested: (Cochrane Central Register of Controlled Trials, RRID:SCR_006576)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed and synthesized qualitatively using MS Excel PIVOT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MS Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The authors addressed this as a limitation for this study.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21258059
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446676

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446676: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Placental Samples: Placental tissues from SARS-CoV-2 positive women and controls were obtained at delivery at Weill Cornell-NY Presbyterian by the Department of Pathology and Laboratory Medicine at Weill Cornell Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 and A549 (adenocarcinomic human alveolar basal epithelial cell line)-ACE2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin and 100 μg/mL streptomycin, and maintained at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>cells</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM Non-essential amino acids, 1 mM sodium pyruvate and 10 mM HEPES using a passage-2 stock of virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(https://www.atcc.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.atcc.org/</div><div>suggested: (ATCC, RRID:SCR_001672)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2-N Forward 5’ CTCTTGTAGATCTGTTCTCTAAACGAAC 3’ Reverse 5’ GGTCCACCAAACGTAATGCG 3’ GAPDH Forward 5’ CATCACCATCTTCCAGGAGCGAGAT 3’ Reverse 5’ GAGGCATTGCTGATGATCTTGAGGC 3’ qRT-PCR graphs were generated using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clusters were washed once in MACS buffer, examined for viability with Trypan Blue (GIBCO) and plated onto Matrigel-coated 96-well dishes and μ-slide 8-well chamber slides (ibidi GmbH, Germany) at confluent density in DMEM/F12 supplemented with 10% FBS and penicillin/streptomycin/ fungizone, and were incubated at 37°C with 5% CO2 for 24 hours prior to infection with pseudovirus to allow for attachment, For infection with SARS-CoV-2, Sections of fresh chorionic villi (2g) were minced with sterile scalpels, digested in Accutase (Innovative Cell Technologies) for 7 min or isolated using a human umbilical cord dissociation kit (Millitenyi Biotec 130-105-737), and filtrated through a 100 μm cell strainer (Falcon) to obtain cell clusters of ∼50-100 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Millitenyi Biotec</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446676
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446677

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446677: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446677
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21257950

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21257950: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.8 Data analysis: All the figures were plotted using Excel 2016 (Microsoft)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21257950
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.02.446698

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.446698: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.02.446698
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.02.446813

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.446813: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific B Cell Sorting: Cells were stained and mixed with DNA-barcoded antigens and other antibodies, and then sorted using fluorescence activated cell sorting (FACS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (~2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 μL of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-encoding DNA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody, goat anti-human IgG conjugated to peroxidase, was added at 1:10,000 dilution in 1% milk in PBS-T to the plates, which were incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T, and bound ACE2 was detected using HRP-conjugated anti-mouse Fc antibody and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RTCA Method for Initial Screening of Antibody Neutralizing Activity: To screen for neutralizing activity in the panel of recombinantly expressed antibodies, we used a high-throughput and quantitative RTCA assay and xCelligence RTCA HT Analyzer (ACEA Biosciences) that assesses kinetic changes in cell physiology, including virus-induced cytopathic effect (CPE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CPE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An antibody was classified as fully neutralizing if it completely inhibited SARS-CoV-2-induced CPE at the highest tested concentration, while an antibody was classified as partially neutralizing if it delayed but did not fully prevent CPE at the highest tested concentration2, 22. Real-time Cell Analysis (RTCA) Neutralization Assay: To determine neutralizing activity of IgG, we used real-time cell analysis (RTCA) assay on an xCELLigence RTCA MP Analyzer (ACEA Biosciences Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>determine neutralizing activity of IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody expression, microscale transfection was performed (~1 mL per antibody) of CHO cell cultures using the Gibco ExpiCHO Expression System and a protocol for deep 96-well blocks (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of antibody) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque Reduction Neutralization Test (PRNT): The virus neutralization with live authentic SARS-CoV-2 virus (USA-WA1) was performed in the BSL-3 facility of the Galveston National Laboratory using Vero E6 cells (ATCC CRL-1586) following the standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) sequencing core at an appropriate target concentration for 10X Genomics library preparation and subsequent sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genomics</div><div>suggested: (UTHSCSA Genomics Core, RRID:SCR_012239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, synthesized antibody-encoding DNA (~2 μg per transfection) was added to OptiPro serum free medium (OptiPro SFM), incubated with ExpiFectamine CHO Reagent and added to 800 μL of ExpiCHO cell cultures into 96-deep-well blocks using a ViaFlo 384 liquid handler (Integra Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibodies, the inhibitory concentration at 50% (IC50) values were calculated in Prism software (GraphPad) by plotting the midway point between the upper and lower plateaus of the neutralization curve among dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryogenic Electron Microscopy (Cryo-EM): Motion correction, CTF estimation, particle picking, and 2D classification were performed using cryoSPARC v3.2.026.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ANOVA analysis was performed for neutralization potency comparisons using GraphPad Prism version 8.0.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.02.446813
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21258055

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21258055: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21258055
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21256946

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21256946: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21256946
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257743

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257743: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The research protocol for this study was approved by the NYU Langone Institutional Review Board (IRB).<br>Consent: Geo-positioning of COVID-19 survey respondents: Geographical information about survey respondents was derived from a subset of patients (N = 697) that provided consent to future contact within the online consent form.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Due to a survey administration error described below, complete data are available at a ratio of ∼2:1, females to males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A subset of questions were adapted from established Common Data Elements for mental health (NLM Disaster Management Resources COVID-19 and Perinatal Experiences (COPE) questionnaire, id:24224; https://osf.io/82rkj/, from the Williams Perceived Discrimination Scale,[13] and from the Fletcher measure of Perceived Relationship Quality.[14</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COPE</div><div>suggested: (COPE, RRID:SCR_009153)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study data were collected and managed using REDCap electronic data capture tools hosted at NYU Langone University.[15, 16] The measure was administered in English.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Technical Validation: Data assurance and quality checking were performed using R version 4.0.2 and Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257743
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21258010

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21258010: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patients (Figure 1): Eligible subjects were at least 18 years old, could provide informed consent, had pneumonia evidenced by chest X-ray or computerized tomography, and laboratory (reverse transcriptase-polymerase chain reaction) confirmed infection for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with at least one of the following: respiratory frequency ≥30/min, blood oxygen saturation ≤93% on room air, partial pressure of arterial oxygen to fraction of inspired oxygen ratio (PaO2/FiO2) <300, worsening of lung involvement defined as an increase in number and/or extension of pulmonary areas of consolidation, need for increased FiO2 to maintain stable oxygen saturation, or worsening oxygen saturation of >3% with stable FiO2.<br>IRB: Study approval: The study was approved by the institutional review board and written informed consent was received from participants or designees prior to inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">11 Statistics: Mean ferritin, CRP, and cytokine levels on Day 1 and the mean dynamic change on Day 3 and Day 14 were compared using pairwise ratio t-tests (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04425538</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase 2 Trial of Infliximab in Coronavirus Disease 2019 (C…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04593940</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Immune Modulators for Treating COVID-19</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21258010
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258140

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258140: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The CIS is a representative random sample survey of the population in England used to monitor trends in COVID-Individuals are invited take a COVID-19 test irrespective of whether they have symptoms or not, allowing an estimate of overall COVID-19 prevalence.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to our study. We do not account for all possible explanatory factors (e.g., deprivation, social distancing behaviours) that may explain occupational inequalities due to a lack of suitable data available for our analysis. Through focusing on work sector, rather than specific occupation or role, we may be limited how generalisable our findings are. For example, teaching and education would include both primary and secondary teachers who were expected to teach classes face-to-face and therefore have different exposures to University lecturers who could far easier adapt to work from home. The lack of specific occupation categories may therefore under-estimate the specific risks and inequalities faced across England. Finally, our analyses are association-based and do not explore potential causal pathways or mechanisms through how and why occupation influences COVID-19 risk. Future research should extend our analyses to consider the specific mechanisms that may explain, mediate or moderate risk.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258140
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257602

1
1. sciscore 05 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257602: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: VirusWatch also included a programme of nasopharyngeal swab sample collection, and blood collection via venepuncture or fingerprick sampling in a subset of 10,000 participants (See appendix 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were carried out using Stata version 16 and RStudio version 3.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257602
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446640

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446640: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT047477574</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446640
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.02.446343

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.446343: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A working concentration of 1 μg/ml human ACE2 biotinylated antibody (R&D Systems, Minneapolis, MN) was prepared, and 100 μL of this solution was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins produced in human T293 cells were obtained as follows: Recombinant Human Angiotensin Converting Enzyme 2 (ACE2) (Cat # 230-30165; lot 04U06020TW) was purchased from RayBiotech (Peachtree Corners, GA,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T293</div><div>suggested: RRID:CVCL_T293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, 100 μL of the mixture was transferred to a semi-confluent culture of A549 human alveolar basal epithelial cells growing at a density of 20,000 cells/well in a 96-well white cell culture plate with a flat clear bottom.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: To determine the significance of changes in kinetic parameters of ACE2 binding to SARS-CoV-2 Spike or RBD mutants we have applied least-squares regression to the linearized Eadie-Hoffstee plot of the binding data, and determined the statistical significance of the difference between the slopes (i.e., KD’s) and between the intercepts (i.e., Bmax) using R or Stata statistical packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stata</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  It is a limitation of our study that we have not tested whether changes in spike conformation in response to ACE2 binding might also be occurring. Certainly infectivity enhancing mutations such as Mink [Y453F], UK [N501Y] and S.Africa [E484K] profoundly affect ACE2 binding kinetics. But whether RBD conformation intrinsically changes in response to ACE2 binding is a study for the future. An additional limitation of our study is that we have utilized a luc-loaded, SARS-CoV-2 pseudotyped virus as a test for biological activity rather than a native SARS-CoV-2 virus. However, it was only with a viral particle model that we could unambiguously demonstrate that cardiac glycosides inhibited viral entry. As mentioned above, ouabain itself has also been previously demonstrated to block infectivity by native SARS-CoV-2 virus, albeit in a green monkey Vero cell 22. Conclusion: Ouabain and digitoxin competitively inhibit ACE2 binding to the SARS-CoV-2 Receptor Binding Domain (RBD), and also block virus penetration into human lung cells. Clinical concentrations of cardiac glycosides are relatively safe for subjects with normal hearts, and it is therefore possible that these drugs could be repurposed for COVID-19 therapy.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.02.446343
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446639

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446639: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446639
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.02.21258209

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.02.21258209: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.02.21258209
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446009

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446009: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 4.5 In vivo experiments: All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of New York University Grossman School of Medicine.<br>Field Sample Permit: high-containment research facility under the responsibility of the Office of Science & Research and its Director of High-Containment Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six to 12-week old female C57BL/6J albino mice (B6(Cg)-Tyr<c-2J>/J,Cat#000058) and Hemizygous (B6(Cg)-Tg(K18-ACE2)2Prlmn/J; Cat#034860) (hACE2-Tg) mice expressing the human ACE2 receptor or non-carrier controls were purchased from Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After incubation, five fields were randomly selected in each well to count the number of fused and unfused cells under an inverted fluorescence microscope (Nikon Eclipse Ti-S)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and anti-rabbit hACE2 (Thermo Fisher,1:100) were applied overnight at 4 °C followed by incubation of appropriate secondary antibodies conjugated with fluorophores.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against mouse CD3, CD4, CD44, CD38, ICOS, OX40, CD62L, Perforin, Granzyme B and Tbet, CXCR5 were purchased from Biolegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (RayBiotech Cat# CS-11-0133, RRID:AB_1228052)</div></div><div style="margin-bottom:8px"><div>CD44</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD38</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ICOS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD62L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against mouse CD8a were purchased from BD Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorochrome-conjugated antibodies against CXCR3 and Ki67 were purchased from Thermofisher.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ki67</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies to SARS-CoV-2 spike (GTX, 1:1000) and p24 (Abcam, 1:1000) were added overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p24</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T/ACE2 cell line was obtained from BEI Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Helper and replicon RNAs were then electroporated into BHK cells and incubated at 37°C in αMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparing effector cells expressing SARS-CoV-2 spike, 293T cells were transiently co-transfected with pCDNA3.1-Spike and pMAX-GFP or with pMAX-GFP only as control, and applied onto 293T/ACE2 cells after 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.8 In vivo delivery of nLacZ-SARS-CoV-2 pseudotype and X-Gal histochemistry: Isoflurane-anesthetized 4-week-old young adult hACE2-Tg mice were dosed intranasally with a 70-μl volume of nLacZ-encoding lentiviral vector (titer 5.18×103 TU/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-Tg</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified T-cells from C57BL/6J immunized or control mice were plated at 6×105 cells/well in a Seahorse XF24 cell culture microplate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids carrying the replicon (pT7-SV-Spike) orT7-DMHelper RNAs were linearized with XhoI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pT7-SV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.3 Pseudotyped Lentivirus Production: SARS CoV-2 pseudotyped lentiviruses were produced by transfecting the 293T cells with the pLenti-Puro vectors (Addgene) expressing Luciferase or β-Galactosidase, with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-Puro</div><div>suggested: RRID:Addgene_39481)</div></div><div style="margin-bottom:8px"><div>pcDNa3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector, respectively (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparing effector cells expressing SARS-CoV-2 spike, 293T cells were transiently co-transfected with pCDNA3.1-Spike and pMAX-GFP or with pMAX-GFP only as control, and applied onto 293T/ACE2 cells after 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMAX-GFP</div><div>suggested: RRID:Addgene_16007)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis was performed on a LSR II machine (BD Bioscience) and data were analyzed using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were mapped to the reference genome (mm10) using the STAR aligner (v2.6.1d)[89].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mean read insert sizes and their standard deviations were calculated using Picard tools (v.2.18.20) (http://broadinstitute.github.io/picard).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The read count tables were generated using subread (v1.6.3)[90], (normalized based on their library size factors using DEseq2[91], and differential expression analysis was performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEseq2</div><div>suggested: (DESeq2, RRID:SCR_015687)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the downstream statistical analyses and generating plots were performed in R environment (v4.0.3) (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results of gene set enrichment analysis were generated by GSEA software[92; 93].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The network of Gene Ontology terms was generated by Enrichment Map in Cytoscape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional protein–protein functional associations used in this study for bar graphs were retrieved from STRING (http://www.string-db.org/, version 11)[94], a well-known public database on several collected associations between proteins from various organisms.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using GraphPad Prism 7, Adobe Photoshop and ImageJ Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software) to naïve mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 38, 44, 46, 47 and 49. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446009
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446181

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446181: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beam-induced motion and drift were corrected using MotionCor2 (24) and aligned dose-weighted images were used to calculate CTF parameters using CTFFIND4 (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CryoSPARC v2 (26) was used in all subsequent image processing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A combination of rigid body and real-space refinement in Phenix as well as iterative rounds of building in COOT (28) were used to improve the fit of the model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molprobity (29) was used to evaluate the model (Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism (Graphpad) was used to calculate significant differences using Dunnett’s T3 multiple corrections test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446181
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258110

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258110: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Qualitative data management was conducted using NVivo 10®: After obtaining institutional review board approval, we invited PICU physicians of KSUMC, who have been performing hybrid using Zoom®, to describe their experience through a qualitative focused group virtual meeting.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Qualitative data management was conducted using NVivo 10®: After obtaining institutional review board approval, we invited PICU physicians of KSUMC, who have been performing hybrid using Zoom®, to describe their experience through a qualitative focused group virtual meeting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NVivo</div><div>suggested: (NVivo, RRID:SCR_014802)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258110
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446571

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446571: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data manipulation was done using R and python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlations of the relative frequency change of HF mutations with the level of international travel controls and the relative number of daily flight departures: Analysis of Spearman correlations by region-month of the relative frequency change of HF mutations and the relative level of international travel controls or the relative number of daily flight departures were performed using R [38] and the packages ggplot2 [39] and ggpubr [40].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of the study: International travel controls obtained from OxCGRT are based on a semiquantitative criterion that embraces just 5 levels. Due to the variations in sociocultural and economic factors among different countries, this criterion does not have enough resolution to reveal small differences between countries on international movement controls policies. However, it allows us to have a general global vision at a regional level. Unfortunately, to our knowledge, there are few publicly available databases where we can obtain detailed data about international movement. The number of flight departures may not be the best indicator of how many people traveled, but it gave us an approximate. Although the methodology of normalization by cases alleviates the differences in the number of genomes sequenced by country, confidence in the calculation of relative frequencies of mutations is still low in regions with a low number of genomes sequenced. For example, a mutation with 0.5 relative frequency that comes from a sample of 15 genomes will have a confidence interval between 0.25 and 0.75; on the other hand, a sample of 150 genomes will generate a confidence interval between 0.58 and 0.42. Moreover, the number of cases is still subjected to bias due to for instance, the difference in the number of tests that each country performs.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446571
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446516

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446516: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: Nasopharyngeal/oropharyngeal swab samples and plasma samples were obtained from 11 hospitalized adults with PCR-confirmed SARS-CoV-2 infection enrolled in a prospective cohort study approved by the Biomedical Research Ethics Committee (BREC) at the University of KwaZulu-Natal (reference BREC/00001275/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus or antibody-donor cell mixtures were incubated for 1 hour at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-virus</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For staining of foci, a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with ACE2 antibody overnight at 4°C with rocking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed three times with DPBS and incubated with secondary antibody, goat anti-rabbit IgG Alexa Fluor 555 (Abcam ab150078) at a concentration of 4 μg/mL in an antibody staining solution made up of 1% Bovine Serum Albumin (Sigman-Aldrich) in DPBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Abcam Cat# ab150078, RRID:AB_2722519)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Vero E6 cells (ATCC CRL-1586, obtained from Cellonex in South Africa) were propagated in complete DMEM with 10% fetal bovine serum (Hylone) containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H1299 and H1299 subclones were propagated in complete RPMI with 10% fetal bovine serum containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids and and passaged every second day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293 (ATCC CRL-1573) cells were propagated in complete DMEM with 10% fetal bovine serum containing 1% each of HEPES, sodium pyruvate, L-glutamine, and non-essential amino acids and and passaged every second day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: ATCC Cat# CRL-1573, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell cloning to create H1299-ACE2 clones: The H1299-H2AZ clone with nuclear labelled YFP was constructed to overexpress ACE2 as follows: VSVG-pseudotyped lentivirus containing the human ACE2 was generated by co-transfecting 293T cells with the pHAGE2-EF1alnt-ACE2-WT plasmid along with the lentiviral helper plasmids HDM-VSVG, HDM-Hgpm2, HDM-tat1b and pRC-CMV-Rev1b using TransIT-LT1 (Mirus) transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 transduced H1299-H2AZ cells were then sub-cloned at the single cell density in 384-well plates (Greiner Bio-One) in conditioned media derived from H1299 confluent cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299-H2AZ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LVNA using focus forming assay: To quantify neutralization of virus either in cell-free or cell-to-cell infections, H1299-C7 cells were plated in an 96-well plate (Corning) at 30,000 target cells per well 1 day pre-infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299-C7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell cloning to create H1299-ACE2 clones: The H1299-H2AZ clone with nuclear labelled YFP was constructed to overexpress ACE2 as follows: VSVG-pseudotyped lentivirus containing the human ACE2 was generated by co-transfecting 293T cells with the pHAGE2-EF1alnt-ACE2-WT plasmid along with the lentiviral helper plasmids HDM-VSVG, HDM-Hgpm2, HDM-tat1b and pRC-CMV-Rev1b using TransIT-LT1 (Mirus) transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE2-EF1alnt-ACE2-WT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis of multinucleated H1299-ACE2 cells in time lapse microscopy images: Timelapse microscopy images were analysed using custom Matlab script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data generated in this way was graphed in R using the ggplot2 package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A caveat to our results is that we used a human cancer cell line, and modified it to express ACE-2. However, syncytia are a common feature of SARS-CoV-2 lung pathology [11, 12, 13], showing that the cell fusion mechanism of cell-to-cell spread operates in this environment. We used infected cells after they already expressed the SARS-CoV-2 spike protein on the cell surface, providing a target for neutralization. Despite this, there was no appreciable neutralization. Both the earlier D614G variant and the B.1.351 variant showed similar insensitivity of cell-to-cell spread in D614G and B.1.351 elicited plasma, indicating that the insensitivity of cell-to-cell spread to neutralization is not specific to the infecting variant or the elicited neutralizing antibodies. We have also verified previous observations about the drop in B.1.351 neutralization by non-B.1.351 elicited plasma in the H1299-ACE2 human lung cell system, as well as the cross-neutralization of D614G by B.1.351-elicited plasma. Interestingly, in these experiments, neutralization of B.1.351 by its matched plasma was weaker than neutralization of D614G by its matched plasma. Despite the overall weaker neutralization capacity, the B.1.351-elicited plasma could still effectively cross-neutralize, showing that cross-neutralization is not necessarily linked to absolute neutralization capacity. Like with other viruses, cell-to-cell spread of SARS-CoV-2 may prove to play a role in pathology and possibly persistence. Future ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446516
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446420

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446420: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus, Media and Cells: SARS-CoV-2 virus (USA-WA1/2020) was obtained from a patient with laboratory-confirmed COVID-19 in January 2020 in Washington, USA and inoculated in Vero 76 cells cultured in Minimum Essential Medium (MEM) (HyClone, Cytiva) supplemented with 2 % fetal bovine serum (FBS) (HyClone, Cytiva) and 50 μg/mL gentamicin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human influenza A virus strain, A/California/07/09 (H1N1) pdm09 (International Reagent Resource, IRR) was grown in Madin-Darby canine kidney (MDCK) cells with serum-free MEM (HyClone, Cytiva) containing 1 IU/mL of trypsin (Sigma), 1 μg/mL EDTA (Sigma) and gentamicin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446420
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446591

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446591: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: >UTR265 (nt 1-265 of SARS-CoV-2 genome) AUUAAAGGUUUAUACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAACUUUAAAAUCU GUGUGGCUGUCACUCGGCUGCAUGCUUAGUGCACUCACGCAGUAUAAUUAAUAACUAAUUACUGUCGUUGACAGGACACGAGUAA CUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACC GAAAGGUAAG Beamline support statements: This work is based upon research conducted at the Northeastern Collaborative Access Team beamlines at the Advanced Photon Source, which are funded by the National Institute of General Medical Sciences from the National Institutes of Health (P30 GM124165).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For sdAb-N3, a codon-optimized gene was synthesized (Integrated DNA Technologies) and inserted into pET22b.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET22b</div><div>suggested: RRID:Addgene_84863)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10006625; NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vectors 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was automatically indexed and reduced by the RAPD data-processing pipeline (https://github.com/RAPD/RAPD), which uses XDS (Kabsch, 2010) for indexing and integration, and the CCP4 programs AIMLESS and TRUNCATE (Winn et al., 2011) for scaling and structure-factor calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model, comprising three identical copies of a 1:1 N49-174:sdAb-C2 complex, was manually rebuilt in COOT and refined with phenix.refine (Table S2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Highly-mutated positions were graphed in Prism v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">9 (Graphpad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of sdAb-N interfaces was performed with PDBePISA (https://www.ebi.ac.uk/pdbe/pisa/), and graphed alongside N protein variation data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ebi.ac.uk/pdbe/pisa/</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound/unbound fractions were calculated in ImageJ (Schneider et al., 2012) and binding curves were calculated in Prism v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446591
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258118

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258118: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these limitations, the study provides an understanding of the transmission pattern to date and underlines the importance of epidemiological surveillance in countries affected by COVID-19. These data can be used for the planning and implementation of control measures. For this reason, surveillance and simple descriptive analysis should be continued as long as COVID-19 continues to spread. The data in this article are from 31 January 2021 and in the future the transmission of the disease is supposed to be considered again.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258118
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258040

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258040: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258040
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21255594

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21255594: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Study approvals: All mouse and primate studies were approved by the SingHealth Institutional Animal Care and Use Committee of the SingHealth Experimental Medicine Centre (SEMC).<br>IRB: The data associated with human transcriptional responses was approved by the SingHealth Combined Institutional Review Board (CIRB 2017/2374).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation here is the potential to only monitor transcriptional responses in the human blood, yet, our animal model data supports that there is expansion of MCs in the lung tissue as well. This is consistent with the observation in a murine model of H1N1 influenza infection where recruitment and maturation of MC progenitors in the lung was suggested to occur approximately 2 weeks after the infection(34). We also noted an unusually high density of MCs in damaged and hemorrhagic regions NHP lungs at 3 weeks post SARS-CoV-2 infection. Increased transcriptional upregulation of the chemokine CXCR2 in the blood of severe COVID human patients is also suggestive of MC precursor migration into lung, as was seen in the context of other diseases(42). Similarly, other studies have identified transcriptional signatures of granulocyte activation as well as increases in cells such as neutrophils, eosinophils and basophils and T cells in the blood or lung tissue itself in severe COVID-19(1, 6-8). As tissue-resident cells, MCs are considered sentinels and they can promote the trafficking of many of these cell types into tissues during both allergic and infection-induced inflammation(9, 12, 43). Aside from the lung-associated pathologies of COVID-19, some individuals also experience other hematological changes and cardiovascular events, including intra-vascular coagulation, endothelial damage with ischemic complications, the development of rashes that could be accentuated by damaged microva...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 15. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21255594
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258068

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258068: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, an initial limited search was undertaken in PubMed, using keywords and index terms related to COVID-19, SARA-CoV2, mucormycosis, and black fungus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A second search using all identified keywords and index terms was conducted in all included databases (PubMed, Scopus, Cochrane, Google scholar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div><div style="margin-bottom:8px"><div>Google scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gray literatures were located using Cochrane COVID-19 study register, bioRxiv, and medRxiv.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVIDENCE will be use to complete this scoping review (Covidence systematic review software, Veritas Health Innovation, Melbourne, Australia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVIDENCE</div><div>suggested: (Covidence, RRID:SCR_016484)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258068
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258079

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258079: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: Approval was obtained from the institutional review board (IRB) of the Hadassah-Hebrew University Medical Center before data extraction was performed.<br>Consent: The requirement for written informed consent was waived by the IRB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data obtained included: patient demographics (age and body mass index (BMI)); indication for IVF treatment (i.e. female/male factor, unknown infertility, and need for pre-implantation genetic diagnosis (PGD) or fertility preservation); follicle stimulating hormone (FSH) value; data regarding the IVF cycle (length of gonadotropin (GT) stimulation and total GT dose, estrogen level on the day before ovum pick up (OPU), the number of oocytes retrieved, the number of mature oocytes, the number of fertilized oocytes, the number and quality of embryos at day 3); and the time since the first dose of the vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">A sample size of 32 women (in the entire cohort) was required to detect a significant difference of 30% in the number of oocytes retrieved (probability of Type 1 error of 0.05 and 80% power).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were carried out using Excel 2013.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. The main one is the retrospective nature of the analysis of the PRE vaccine group. This carries an inherent selection bias and information bias due to the medical record coding. Another potential caveat is the relatively small sample size of the study population. Nevertheless, the sound methodology where each patient served as their own self-control strengthens the results and allows us to provide reliable answers to the questions raised regarding the effects of BNT162b2 vaccination on fertility. Finally, we included data on the pregnancy rate in a subgroup of the study sample (n=15). This is a small group but we included this data as it strengthens our findings showing no differences in IVF treatment parameters before and after vaccination and moreover it directly analyzes women’s fertility. There is an inherent bias in considering the pregnancy rate; couples whose previous ICSI cycle ended in pregnancy are less likely to return for another cycle. The mean interval between both OPU was 362 days. The impact of such a period of time on fertility differs depending on the age of the patient; namely, it is more significant in older women. However, no such fertility differences were seen in our study. If any such differences had in fact shown, we would expect reduced fertility of the POST group. Clearly, a larger study is warranted to validate these initial findings demonstrating that the BNT162b2 vaccination does not impact women’s fertility. In...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258079
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21257665

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21257665: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human clinical sample collection, RNA extraction, and SARS-CoV-2 detection: Negative nasopharyngeal swabs were acquired from healthy individuals with the approval of the Ethics Committee of our institute.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, 10000 data points could be extracted from the trajectory through a Python script named “distance.py” in the oxDNA analysis tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21257665
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21256718

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21256718: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon completion, the data captured by QuantStudio® 3 were further analyzed with the Design and Analysis software (version 2.4.3) by Thermo Fisher Scientific. 2.6 Statistical Analysis: All linear regression analysis on data obtained from Clarity Plus™ was performed on GraphPad Prism®</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21256718
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21257656

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21257656: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The limitations of our study are mainly based on its retrospective nature, although in both institutions there was a protocol for action against COVID-19 which would tend to unify management. This study is the first in our country to evaluate the incidence, risk factors, and prognosis associated with AKI in adults hospitalized for COVID-19. The epidemiological analysis of AKI incidence, degrees of affectation, requirement of ICU, MV and RRT can be useful for planning and allocating resources in the event of a possible new outbreak. The determination of AKI risk factors allows the early identification of the susceptible subjects. The analysis of complications and the impact associated with AKI, such as mortality and prolongation of hospital stay, reflect the importance of early diagnosis and adequate treatment. In conclusion, the incidence of AKI in hospitalized subjects due to active COVID-19 infection was 19%. The independent predictors of AKI were age, CKD history, neutrophil count, and MV. AKI was associated with bacterial superinfection, sepsis, respiratory distress syndrome, prolonged hospitalization days, higher ICU and MV requirement, and was also independently associated with higher in-hospital mortality.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21257656
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258018

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258018: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model overview: Covasim is an open-source agent-based model developed by the Institute for Disease Modeling with source code and documentation available at https://covasim.org.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covasim</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our modeling approach has several limitations. Although we explicitly account for the fact that individuals with some neutralizing antibodies from prior infection or vaccination are less likely to develop symptomatic or severe disease, we do not account for the possibility that the duration of disease may also be reduced or that secondary infections may have a reduced viral load, although there is some evidence to this effect (Gouma et al., 2021; Levine-Tiefenbrun et al., 2021). We do not model the emergence of new variants, although previous studies have attempted this for influenza (Bush et al., 1999; Gupta et al., 1998; Bedford et al., 2012; Koelle and Rasmussen, 2015; Wen et al., 2020) and similar approaches could possibly be applied for SARS-CoV-2. Our modeling approach relies on estimating a relationship between neutralizing antibodies and different correlates of protection, and the data used to establish these estimates are scarce and uncertain, especially for low levels of neutralizing antibodies. We do not specifically model cellular immune responses, although they are likely to also influence disease symptomaticity and severity (Tarke et al., 2021; McMahan et al., 2021). We have modeled antibody kinetics based upon studies of immune decay in patients up to 8 months after SARS-CoV-2 infection, using a two-part exponential decay. An alternative approach taken by (Pelleau et al., 2021) uses a mathematical model of the immunological process underlying the generation and...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258018
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21258041

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21258041: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21258041
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.25.21257730

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.25.21257730: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We used multivariable logistic regression models, adjusted for age (modelled as a continuous variable) and gender (male vs. female as reference group), to investigate symptoms associated with a) optimal (≥75%) patient-reported functional recovery at first presentation and b) patient-reported ability to return to full-time employment at first presentation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using Python 3.7.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our findings have several limitations. We report outcomes from a single centre, unlikely to be representative of the whole UK population. As post-COVID clinics are established around the UK and in other countries, prospective data collection and comparison will enable variations to be investigated. We used subjective symptom and functional status data, which may have self-reporting bias. We report real-world, clinical findings, therefore data regarding pre-morbid status, baseline characteristics, investigations and follow-up (particularly for patients with persistent disease for 12 months or more) are more limited than in dedicated research cohorts. NH patients were self-selecting whilst PH patients were included as part of routine follow-up. This selection bias precludes both making precise estimates of the burden of Long COVID amongst NH patients and also making comparisons between the NH patients and other patient groups. In our basic logistic regression models, we modelled age as a linear variable, which may have obscured true non-linear effects of age in these models. Our models were based on cross-sectional data at presentation to the clinic. Our findings have several implications for research and policy. First, we identify differences in longer-term effects of SARS-CoV-2 infection in PH versus individuals, supporting the existence of a number of different phenotypes of Long COVID. Further correlation of symptom clusters, functional impacts and diagnostic information is...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.25.21257730
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21257382

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21257382: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Committee permissions: This study has been approved by the Ethics Committees of Canton Ticino (Comitato Etico Cantonale, CE_TI_3807), according to the local Federal rules.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">26 package (SPSS Inc., Armonk, NY; USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study was burdened by limitations. First, it was a monocentric, observational, retrospective study, with a relatively small series of patients and a lack of direct comparison with a control group. However, a stronger evaluation of our method was supplied by its application to the two different waves of COVID-19 pandemic. Second, the two groups were not completely homogeneous, differing in male sex incidence, arterial hypertension rate and serum CRP values; however, none of these values was used as criteria for decision making during the Intensivist consultation. The values may possibly be interpreted as risk factors (18) for ICU admission, rather than predictor factors; moreover, the key-message concerning the absence of mortality in the ICU-refused group, whose classification criteria did not involve these non-homogeneous parameters, remains intact. Finally, we are unable to define whether the SpO2 cut-off of 85% was the absolute best criteria to identify patients needing ICU-admission; although our study suggests that the SpO2 92% threshold was unreliable in COVID-19 patients, it was not designed to specifically identify the best SpO2 threshold for ICU admission.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21257382
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257441

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257441: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Both studies were conducted at the Amsterdam University Medical Centers in the Netherlands and approved by the local ethical committee.<br>Consent: All individuals included in this study gave written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All S constructs were verified by Sanger sequencing and subsequently produced in HEK293F cells (ThermoFisher) and purified as previously described (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: HEK293T/ACE2 cells kindly provided by Dr. Paul Bieniasz (44) were seeded at a density of 20,000 cells/well in a 96-well plate coated with 50 μg/mL poly-L-lysine 1 day prior to the start of the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were added in a concentration of 20,000 cells/well and incubated for 72 h at 35°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were ordered as gBlock gene fragments (Integrated DNA Technologies) and cloned PstI/NotI in a pPPI4 expression vector containing a hexahistidine (his) tag with Gibson Assembly (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory concentration (IC50) and neutralization titers (ID50) were determined as the NAb concentration and serum dilution at which infectivity was inhibited by 50%, respectively using a non-linear regression curve fit (GraphPad Prism software version 8.3) (45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While our study aims to provide an overview of many different aspects of pre-existing immunity against VOC, there are some limitations. In this study, we present a vaccinee population that consists of primary health care workers that are generally of middle age, with only four (8%) participants being older than 60 (Table 1). However, we found no correlation between age and titers in convalescent patients against any of the VOC tested. Moreover, we have focused on the neutralization potential of immune sera and did not examine antibody effector functions which have been implicated previously in the control of SARS-CoV-2 infection (41). Similar to other studies, our convalescent and vaccinee sera samples were collected four to six weeks after infection and four weeks after vaccination (i.e. at the peak of immunity), respectively. While we present findings that may have implications for additional booster vaccines and the monitoring of VOC, we did not examine the aspect of waning antibody titers and how those might influence VOC binding and neutralization. Finally, we have merely examined an early line of defense against infection with SARS-CoV-2 (i.e. serum antibody levels), while we expect memory B cells to play an important part in re-infections with SARS-CoV-2 VOC. Indeed, swift re-activation of memory compartments may lead to reduced transmissibility, a milder course of disease and a more potent immune response. In conclusion, we observed a substantial reduction in binding ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257441
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258031

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258031: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258031
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21257945

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21257945: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21257945
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258011

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258011: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All study participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants who received a SARS-CoV-2 vaccine, treatment with possible anti-SARS-CoV-2 therapies within 30 days prior to enrollment, and women who were pregnant or breastfeeding were excluded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat inactivated 40x diluted specimen was incubated in the RBD-captured wells, and bound antigen detected using HRP conjugated anti-goat total (IgG, IgM and IgA) or individual antibody isotype on a microplate reader.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat total (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibody positive status was determined by a positive result on at least one of the following: total Ig, IgG, IgM, or IgA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ig, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A chi-squared test was used to compare inflammatory markers (D-dimer, CRP) by infectious virus status, and by antibody status.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D-dimer, CRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure viral RNA, qRT-PCR was performed on NP swabs using CDC primer/probe solution against the N1 region of the nucleocapsid gene (2019-nCoV_N1) at Covance CLS with Promega Maxwell for RNA extraction, manual plate build, and Quantstudio 12kflex for the 96 well qRT-PCR format (lower limit of quantification: 1,018 copies/mL).(17) To measure the presence of infectious virus in each NP swab, samples were cultured in Vero E6 cells similar to prior studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, VTM samples were thawed, diluted 1:1 in infection medium (MEM, 4% fetal bovine serum, 1X penicillin and streptomycin), and added in duplicate to Vero cell cultures plated 24hr prior.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(11) On 2 and 5 days post inoculation (dpi), culture positivity was determined by measuring viral RNA in heat inactivated culture medium by qRT-PCR using the Abbott m2000sp/rt quantitative SARS-CoV-2 RNA assay (limit of quantification: 100 copies/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Importantly, most outpatients with mild-to-moderate symptoms, even those in higher risk groups, have a relatively low probability of developing severe COVID-19 disease.(25–27) While this study describes novel links between virologic and immunologic factors associated with isolation of infectious virus, there are important limitations to consider, including representation. There were a large number of participants who identified as Latinx, yet there was an under-representation of African-Americans and Asian-Americans compared with the US burden of COVID-19.(28) Further, this study enrolled predominantly low risk outpatients with at least one symptom of COVID-19, which limits the study population to outpatients with mild-to-moderate COVID-19. Additional research is needed to understand the factors associated with infectious virus among asymptomatic individuals. While prior studies have demonstrated prolonged virus isolation in hospitalized individuals,(11,23,29) it remains important to identify the factors associated with progression to severe disease and infectious virus shedding in outpatients. Another limitation is that seropositivity is not synonymous with virus neutralization. We observed three antibody positive participants (each had IgM; two had IgG) with positive infectious virus culture, two of whom also had RNA levels above 6.0 log10 but neutralization titers were not available. We also explicitly acknowledge that a negative culture does not exclude the presence of in...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04405570</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Safety, Tolerability and Efficacy of Molnupiravir (EIDD-28…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258011
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446623

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446623: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Isolation and propagation of SARS-CoV-2: Human samples were obtained under the Helsinki University Hospital laboratory research permit 30 HUS/32/2018 § 16. Isolation of SARS-CoV-2 from a COVID-19 Briefly, a nasopharyngeal swab in 500 μl of Copan UTM® Universal Transport Medium was inoculated on Calu-3 cells (P1) and incubated for 1 h at 37°C, after which the inoculum was removed and replaced with Minimum Essential Medium supplemented with 2% FBS, L-glutamine, penicillin and streptomycin.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The media was changed in all cell types every 2 days and regularly tested for presence of mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H6021, Sigma-Aldrich), and Alexa 647 fluorescently labelled goat anti-rabbit antibody (Thermo Fisher, cat. A32733)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A32733, RRID:AB_2633282)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, viral NP was detected with an in house developed rabbit polyclonal antibody (31) counterstained with Alexa-647-conjugated goat anti rabbit secondary antibody, and nuclear staining done using Hoechst DNA dye.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti rabbit secondary antibody,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: VeroE6 (ATCC CRL-1586)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6, VeroE6+TMPRSS2, Caco-2, and Calu-3 cells were maintained in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BSR-T7 cells were derived from BHC cells (42) and grown in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BSR-T7</div><div>suggested: CCLV Cat# CCLV-RIE 0583, RRID:CVCL_RW96)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells stably expressing human ACE2 were generated by transduction with third generation lentivirus pLenti7.3/V5 DEST ACE2-EmGFP (prepared by the cloning facility Dream-Lab, Institute of Biotechnology, University of Helsinki, Helsinki, Finland; the expression of Emerald GFP is driven by the SV40 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In all experiment’s cells were kept at 37oC and 5% (for Vero, Vero+TMRPSS2, and Caco-2 cells) or 7% CO2 (for Calu-3 cells) and media was pre warmed to 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titers were determined by plaque assay in VeroE6+TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6+TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For statistical analysis of the data in Figures 2 B, C and Figure 4 each replicate titration was fitted separately using IgorPro to determine the EC550 for each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgorPro</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04446377</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of LAM-002A for the Prevention of Progression of COV…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04608266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">CAMOVID : Evaluation of Efficacy and Safety of Camostat Mesy…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04623021</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study Evaluating the Efficacy and Safety of CKD-314 (Nafab…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04418128</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Efficacy of Nafamostat Mesylate for COVID-19 Pneumo…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446623
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21257760

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21257760: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The presence of SARS-CoV-2 was detected using the Abbott RealTime SARS-CoV-2 assay (Abbott, Chicago, Illinois, United States of America) on a Abbott RealTime M2000rt, a qualitative multiplex real time PCR device that has FDA emergency use authorization for in vitro diagnostic use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each sample was barcoded using Native Barcoding Expansion 1-12 and 13-24 kits (EXP-NBD104 and EXP-NBD114, ONT, Oxford, United Kingdom) and sequencing performed on FLO-MIN006 (R9.4.1) flow cells using MinION MK1b, MinION MK1c and GridION sequencers (ONT, United Kingdom).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetics: Assembled SARS-CoV-2 genome sequences with 80% or more completeness and the Wuhan-Hu-1 isolate reference genome (Genbank reference MN908947.3) were submitted to a multiple sequence alignment with MAFFT v7.475 using parameters “--maxiterate 500”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting multiple sequence alignment was used to generate a maximum-likelihood phylogeny using MEGA X [7].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21257760
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21257971

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21257971: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Collection of serum and PBMC samples: Blood samples from individuals were obtained after recruitment of participants and written informed consent as approved by the ethics committee of Ulm university (99/21).<br>IRB: Collection of serum and PBMC samples: Blood samples from individuals were obtained after recruitment of participants and written informed consent as approved by the ethics committee of Ulm university (99/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell culture: Vero E6 (African green monkey, female, kidney; CRL-1586, ATCC, RRID:CVCL_0574) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS), 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Longitudinal antibody measurements were analyzed by means of a mixed linear regression model including a random intercept in order to account for the repeated measures structure of the underlying data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of antibody titers: IgG and IgA levels in serum were determined by anti-SARS-CoV-2 assay (Euroimmun), an ELISA which detects antibodies against the SARS-CoV-2 S1 spike domain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 assay ( Euroimmun)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture medium containing anti-VSV-G antibody (I1-hybridoma cells; ATCC no. CRL-2700) was then added to block residual VSV-G-containing particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (LSBio (LifeSpan Cat# LS-C51092-40, RRID:AB_1277788)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Without washing, cells were incubated with surface antibody cocktail (prepared in 1:1 of FACS buffer and brilliant staining buffer) for 30 minutes at room temperature with BV510-anti-human CD14 (clone M5E2), BV510-anti-human CD19 (clone HIB19),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BV510-anti-human CD14</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV510-anti-human CD19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Vero E6 (African green monkey, female, kidney; CRL-1586, ATCC, RRID:CVCL_0574) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS), 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T (human, female, kidney; ACC-635, DSMZ, RRID: CVCL_0063) cells were grown in DMEM with supplementation of 10% FCS, 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day after transfection of HEK293T cells to express the viral glycoprotein, they were inoculated with VSV*ΔG-FLuc and incubated for 1-2 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A replication-deficient VSV vector in which the genetic information for VSV-G was replaced by genes encoding two reporter proteins, enhanced green fluorescent protein and firefly luciferase (FLuc), VSV*ΔG-FLuc 24 (kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhäusern, Switzerland) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results are given as serum dilution resulting in 50% virus neutralization (NT50) on cells, calculated by nonlinear regression ([Inhibitor] vs. normalized response -- Variable slope) in GraphPad Prism Version 9.1.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Up to 100,000 live CD3+ T cells were acquired on a LSRFortessa flow cytometer (BD Biosciences), equipped with FACS Diva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the acquired data was performed using FlowJo software (version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were done by GraphPad Prism version 9.1.1 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com, R (version 4.0.1) and SAS (version 9.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21257971
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21257841

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21257841: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Coriolis air samples were collected into sterile cones containing 5mL of VTM, which was reduced to 3mL by evaporation during sample collection.<br>Consent: Moreover, as personal information was not being collected, the boards felt that patient consent was not required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus viability and titration: VeroE6 cells were seeded the day prior in 96-well plates to attain 80% confluence on the day of titrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data was tabulated in Excel spreadsheets and analyzed using SPSS version 27 (IBM corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  COVID-19 infection due to the novel SARS-CoV-2 virus has caused a global pandemic, with over 165 million cases reported worldwide, and over 3.4 million deaths at the time of this writing.[43] Furthermore, respiratory morbidity, activity limitation, and mental health conditions are prevalent, among other complications.[44] Previous studies have suggested aerosol transmission is occurring beyond close contact, as per evidence from super spreading events, transmission occurrences between adjacent rooms, viable virus measurements in air, and animal studies.[8] Our data suggests that SARS-CoV-2 RNA virus may be present at low levels in aerosols <10um in diameter, >2 m from COVID-19 patients in a variety of settings, but viable virus appears to be uncommon, as has been described elsewhere.[6] In classical terms, respiratory viruses have been considered to be spread by droplets. Large droplets (e.g., > 5 microns in diameter) were believed to contaminate the immediate environment of an infectious patient, including the air within 2m, leading to infection by direct deposition of virus onto mucosal surfaces. In addition, large droplets settle in the proximal (within 2m) environment, leading to fomite transmission where contaminated surfaces are contacted by another person prior to touching their face thereby acquiring infection. In classical terms, aerosol (or “airborne”) spread occurs via small droplets (e.g., < 5µm) that can remain suspended in air more than 2m from a patient, leadin...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21257841
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257871

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257871: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 13 The protocol was approved by the CUNY School of Public Health and Health Policy institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted in SAS 9.4 (SAS Institute Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257871
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446555

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446555: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect expression pattern or biotinylation pattern, the primary antibody, such as anti-V5 (Invitrogen, cat. No. R960-25, 1:5,000 dilution), was incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, secondary antibodies, namely mouse-HRP (Bio-rad, cat. No. 1706516, 1:3,000 dilution) and rabbit-HRP (Cell signaling, cat. No. 7074S, 1:3,000 dilution), or SA-HRP (Thermofisher, cat. No. 21126, 1:10,000 dilution) were incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit-HRP</div><div>suggested: (Carl Roth Cat# 4750, RRID:AB_2890006)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells and A549 cells were from Laboratory of Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtaining Secreted Proteins in Cell Culture Media: After biotin labeling of HEK293 cells expressing SEC61B-TurboID, cells were incubated with no FBS DMEM for 16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteome Digestion & Enrichment of Biotinylated Peptides: For mass sampling, HEK293T cells were split in three T75 flasks for triplicate samples per each condition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression Plasmids: Genes with epitope tag (i.e. V5, FLAG, HA, twin strep) were cloned into pCDNA3, pCDNA3.1, and pCDNA5 using digestion with enzymatic restriction sites and ligation with T4 DNA ligase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pCDNA5</div><div>suggested: RRID:Addgene_49428)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For transiently co-expressed two constructs, vPOI-GFP and TurboID-GBP, cells were grown at 70–80% confluence and transfected with wanted constructs using PEI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vPOI-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson correlation was conducted using image J software program (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, results of immunoblotting assay were obtained using ECL solution using GENESYS program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENESYS</div><div>suggested: (GeneSys, RRID:SCR_015770)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enlarged fluorescence images were fitted to the electron micrographs using the Image J BigWarp program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J BigWarp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Processing MS data and Identification of Proteins: All MS/MS data were searched using MaxQuant (version 1.5.3.30) with Andromeda search engine at 10 ppm precursor ion mass tolerance against the SwissProt Homo sapiens proteome database (20,199 entries, UniProt (http://www.uniprot.org/)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The imputation of protein intensity were conducted using Perseus software program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.06.01.446555
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21257992

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21257992: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21257992
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258008

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258008: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the university institutional review board.<br>Consent: Of the 1427 who provided informed consent, 884 were able to enroll during the study’s timeframe.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Race was asked as a ‘select all that apply’ (White, Black or African American, American Indian or Alaska Native, Asian, Native Hawaiian or other Pacific Islander, Some other race/write in); Latinx (yes, no); and Gender (female, male, gender nonconforming, trans male, trans female, different identity/write in).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants were 86% White; 11.7% Asian/Pacific Islander; 4.2% Black/African American; 7.8% Latinx; and 65% identifying as female.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Islander</div><div>suggested: (Islander, RRID:SCR_007758)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258008
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.06.01.21258138

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.21258138: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.06.01.21258138
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446136

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446136: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446136
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258122

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258122: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All multilevel regression models are implemented using JAGS version 4.3.0 (implemented via rjags26) and R version 4.0.3. 10,000 posterior samples (not including 2,000 for model burn-in) was sufficient for successful convergence and all posterior draws were well-mixed (see appendix).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JAGS</div><div>suggested: (rjags, RRID:SCR_017573)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Before drawing any conclusions from our study, it is important to note a number of limitations. Most obviously, our data consists of self-reports and, due to social desirability concerns, people may over-state their intention to do what the Government, health professions and media are heavily promoting. However, comparing those who either said they would definitely get vaccinated or were leaning towards it in a nationally representative survey of 16,820 UK adults conducted in October 202014 (two months before the first COVID-19 vaccination in the UK37) to the numbers of people who actually took up the offer of a first dose (to 30 April 2021), we find that the former is close to but actually a little lower than the latter (55-64-year-olds: 83·8% vs. 86·9%; 65-79-year-olds: 90·0% vs. 93·2%; Over 80s: 90·1% vs. 94·9%). In sum, without ruling it out, there is little evidence for a strong desirability effect, although previous underestimation could also point to a general increase in intent to vaccinate across the UK since vaccine rollout began. A second and related issue is that, even if it is accepted that our data reflect genuine intentions, these are still not the same as actual vaccination uptake. While we find that passports result in a net decrease in vaccination inclinations among those who are undecided, we have no way of knowing whether this is enough to tip anybody over into actually refusing the vaccine. Hence, we cannot be definitive about the real-world impact of int...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258122
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.29.21258056

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.21258056: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Their other limitations were short in time. It is possible that by targeting measures for a short time they had better adherence. It is also possible that vitamin D supple-mentation policies helped as well as low density lifestyle. One may also consider that these are relatively isolated countries with limited roaming, tourism, and international travel. Beyond Norway and Finland, lax lockdown policies could lead to people spending more time outdoors and receiving more UV radiation which could have improved vitamin D status. Looking at a broader perspective, there is no indication that strict long measures reduced mortality. The data suggests the opposite. Countries with the least restrictions fared best economically. Surprisingly, some of them also fared well in terms of mortality, even better than neighboring countries with similar social structures and more severe restrictions. Developing countries with little healthcare capabilities and limited ability to enforce restrictions tended to fare well. Countries with treatments, independent of the type of treatment, fared well. Does this mean that a placebo effect was in operation or is any treatment better than no treatment? The mortality rates in the USA, however, may have suffered from very high obesity rates. Norway and the northern European countries have less strict restrictions from the rest of Europe and, also, had lower mortality rates. Was this from the longer summer days and earlier cold winter? Egypt fared well despi...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.29.21258056
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.30.21258080

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.21258080: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the ethics committee of Eastern Switzerland (#2020-00502).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has limitations. First, residual confounding is possible. Yet, we have included multiple co-variables accounting for risk exposures and risk behaviours. Also, the fact that use of other PPE or universal respirator use among HCW performing AGPs (representing HCW with particularly risk-averse behaviour) were not associated with reduced seroconversion rate, supports our argument of a valid multivariable model with low risk of residual confounding. Second, the question about respirator use was asked in a questionnaire in January 2021, at a time when most SARS-CoV-2 positive participants had already had their infection. A positive test result could have led to a change in preferred mask type (in either direction). However, restricting the analysis to the time period close to the follow-up questionnaire showed similar or even stronger assocations compared to the full model. Third, we did not specifically ask about duration of contact to individual COVID-19 patients, although type of profession, work percentage, or involvement in AGP can be regarded as proxy for this potentially important variable. Fourth, although we included multiple institutions, settings, and geographical regions in our study, the generalizability of the results can be questioned due to the fact that participation in the study was non-mandatory. However, distribution of key variables (e.g. age, sex, profession) were similar between the total HCW population (from the largest participating institution) a...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.30.21258080
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257700

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257700: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all participants.<br>IRB: This study was approved in South Korea by the Korea Ministry of Food and Drug Safety (reference 20200261849) and the Institutional Review Board of Severance Hospital (IRB No. 4-2020-1220).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analyses were performed using IBM SPSS statistics and GraphPad Prism, version 8.4.1., and 95% CIs were calculated using the Clopper-Pearson method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04785144</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of a SARS-CoV-2 (COVID-19) V…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04445389</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of GX-19, a COVID-19 Prevent…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04715997</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of GX-19N, a COVID-19 Preven…</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT044445389</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257700
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21257367

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21257367: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21257367
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257908

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257908: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257908
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257929

1
1. sciscore 04 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257929: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257929
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257940

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257940: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257940
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.29.446300

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.446300: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C103A)-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(2) The pHLsec-Fc-Avi-6H vector contains the human immunoglobulin heavy constant gamma 1 (resi 101-330; UniProtKB code P01857) followed by an Avi tag that can be biotinylated by BirA ligases and a 6xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-Fc-Avi-6H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(3) The pHLsec-3C-mVenus-Avi-8H vector derived from pHLsec-mVenus-12H (Chang et al., 2015) was tagged with a C-terminally HRV-3C protease cleavage site followed by a mVenus fusion protein, an Avi tag and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mVenus-12H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(4) The pHL-N-AP-Myc-8H vector was constructed N-terminally with the human alkaline phosphatase (AP; resi 1-506; NCBI code NP_001623) followed by a Myc tag and finally a C-terminal 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHL-N-AP-Myc-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(5) The pHLsec-C-Myc-AP-8H vector contains a C-terminal Myc tag followed by the human AP (resi 18-506; NCBI code NP_001623) and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-C-Myc-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Lgr4LRR was constructed into the pHLsec-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD insert was grafted into the pHLsec-mMGD21-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mMGD21-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2ECD (resi 19-615), NBVHH-72, and NBH11-D4 were cloned into the pHLsec-AP-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-BirA-ER</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures of Tspan28 (CD81; PDB codes 1G8Q and 5TCX) were selected to generate an initial computational model of Tspan12EC2 with Modeller (Eswar et al., 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Notably, the structures of Tspan25 (CD53; PDB code 6WVG), and Tspan29 (CD9, PDB codes 6RLR and 6K4J) were not available during the HHpred search.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HHpred</div><div>suggested: (HHpred, RRID:SCR_010276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the protein design of Antibody Display Tspan12EC2, LAIR1 insert was removed from the model of MGD21 Fab fragment (PDB code 5NST) and the Tspan12EC2 model was docked into the MGD21 VH manually by using COOT (Emsley et al., 2010) and PyMOL Molecular Graphic System (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  At present, the limitations for selecting POI for Antibody Display such as protein shape and size remain unclear; further studies will be required to address these questions. Comparing with conventional Fc fusion proteins in which the POI is fused to the N terminus of Fc usually including the flexible hinge region, we reasoned that the Antibody Display, which grafts the POI onto the β-strands G and F of the heavy chain, provides several potential advantages: (1) design and production of a more conformationally constrained chimeric protein, (2) reduction of proteolysis with the POI inserted into a stable antibody Ig fold, and (3) extension of the current antibody engineering toolkit for generating bispecific and chimeric antibodies. Further studies will be needed to explore these potential advantages. An intriguing feature of using the Antibody Display for Tspan12EC2 is with a better yield of protein production than Tspan12EC2. Our functional assays demonstrated that Tspan12EC2 bound to Norrin directly, in agreement with previous genetic studies (Lai et al., 2017). As Tspan12 playing critical roles in CNS vascular development (Junge et al., 2009; Zhang et al., 2018) and tumorigenesis (Knoblich et al., 2014; Otomo et al., 2014), Tspan12EC2-AD may be a useful reagent for these studies. Moreover, Tspan proteins are well known for their important roles in regulating tumor migration, invasion and metastasis (Charrin et al., 2014; Hemler, 2014; Vences-Catalan and Levy, 2018). Antibo...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.29.446300
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446065

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446065: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Further ethics approvals were provided by the Mater Health Services Human Research Ethics Committee (Reference: HREC-15-MHS-52) and the University of Queensland Medical Research Review Committee (Reference:</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hepatocellular carcinoma patient samples: Liver tumour and non-tumour tissue were previously obtained from a HBV-positive patient (HCC32, male, 73yrs) who underwent surgical resection at the Centre Hepatobiliaire, Paul-Brousse Hospital, and made available for research purposes with approval from the French Institute of Medical Research and Health (Reference: 11-047).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Viral titration was determined by immuno-plaque assay (iPA), as previously described54.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection of HEK293T cells: HEK293T cells and African green monkey kidney cells (Vero E6) were maintained in standard Dulbecco’s Modified Eagle Medium (DMEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T viral infection was undertaken as follows: 3×106 HEK293T cells were seeded onto 6-well plates pre-coated with polylysine one day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">350-500ng of each prepared library was sequenced separately on one PromethION (Oxford Nanopore Technologies) flow cell (FLO-PRO002, R9.4.1 chemistry) (Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PromethION</div><div>suggested: (PromethION, RRID:SCR_017987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data were deposited in the Sequence Read Archive (SRA) under project PRJEB44816.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequence Read Archive</div><div>suggested: (DDBJ Sequence Read Archive, RRID:SCR_001370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ONT bioinformatic analyses: To call non-reference insertions with TLDR23, ONT reads generated here, by Zhang et al.29, and by our previous ONT study of human tissues23 (Supplementary Table 1) were aligned to the human reference genome build hg38 using minimap255 version 2.17 (index parameter: -x map-ont; alignment parameters: -ax map-ont -L -t 32) and samtools56 version 1.12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">fa were counted with samtools idxstats.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR primers for the HBV insertion 3’ junction (Fig. 2b and Supplementary Table 2) were designed with Primer3 using the reference genome and closest match HBV sequence (Genbank accession AB602818) as inputs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer3</div><div>suggested: (Primer3, RRID:SCR_003139)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446065
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446250

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446250: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this paper, we applied the viGEN pipeline that uses Bowtie2 aligner [28] to find the viruses detected in the two datasets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This gene matrix was input into a public online tool CIBERSORT [33].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CIBERSORT</div><div>suggested: (CIBERSORT, RRID:SCR_016955)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04634370</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fase I Clinical Trial on NK Cells for COVID-19</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446250
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.29.446267

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.446267: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell viability assays: The effect of SARS-CoV-2 NSP11 fibrils on cell viability was assessed in two different cell lines (SH-SY5Y neuroblastoma cells & HepG2 hepatocellular carcinoma cells) using a colorimetric assay that uses a reduction of a yellow tetrazolium salt MTT to purple formazan crystals by metabolically active cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SH-SY5Y</div><div>suggested: NCBI_Iran Cat# C611, RRID:CVCL_0019)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">t Mixture F-12 Ham (DMEM F-12) while HepG2 was maintained in Dulbecco’s modified Eagle’s medium (DMEM), both supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.29.446267
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257854

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257854: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of Kanto Central Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has limitations. Only users of the most popular social media/messenger app in Japan (“LINE”) could access Corowa-kun. Our results are not representative of those not using this platform or without access to the internet. Approximately three-fourths of participants were women. Only persons with Japanese literacy could answer the survey. Due to the study design—cross-sectional survey—we could not estimate the incidence of vaccine hesitancy. A hypothetical question (“Would you like to receive a COVID-19 vaccine when possible?”) was used because the COVID-19 vaccine was only available for healthcare professionals and for elderly people in a very limited area at the time that the survey was conducted. Finally, the survey answers may not translate into real-world actions by respondents due to other competing priorities and varying epidemiologic and societal conditions at the time a vaccine is available to them. [37] [38]
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257854
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257798

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257798: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 2.1 Ethical and biosafety statement: This work was approved by the Institutional Review Board and Institutional Biosafety Committee of Northern Illinois University (NIU) on August 12, 2020.<br>Consent: Informed consent was obtained with the signature of the volunteers.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257798
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257884

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257884: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: VeroE6/TMPRSS2 cells (JCRB1819) were purchased from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan).<br>IRB: Ethics approval: This study was performed in accordance with the Declaration of Helsinki and was approved by the ethical review board of the University of Toyama (approval No.: R2019167).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with the above expression vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells (JCRB1819) were purchased from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression plasmid for the truncated S protein of SARS-CoV-2, pCAG-SARS-CoV-2 S (Wuhan), was kindly provided by Dr. Shuetsu Fukushi, National Institute of Infectious Diseases, Japan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAG-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression plasmids for the truncated mutant S protein of SARS-CoV-2, pCAGG-pm3-SARS2-Shu-d19-B1.1.7 (B.1.1.7-derived variant), and pCAGG-pm3-SARS2-Shu-d19-B1.351 (B.1.351-derived variant), were constructed by PCR-based site-directed mutagenesis using cDNA as a template, which was obtained by chemical synthesis with optimisation for the humanised codon (Thermo Fisher Scientific, Waltham,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGG-pm3-SARS2-Shu-d19-B1.1.7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGG-pm3-SARS2-Shu-d19-B1.351</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S cDNA of SARS-CoV-2 was cloned into the pCAGGS-pm3 expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-pm3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using GraphPad Prism version 8.4.3 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The limitations of the current study are as follows. The efficacy of SARS-CoV-2 vaccination among people whose immunity may be unstable, such as children, elderly people, and individuals with underlying diseases, is unknown. It is still unknown how long immunity is maintained after vaccination. Therefore, we plan to conduct a follow-up study for the participants. Lastly, it is impossible to exclude possible participants who had already acquired immunity because sera prior to vaccination were not assessed. In conclusion, the BNT162b2 vaccine produced a sufficient level of antibodies with a neutralising effect against WT SARS-CoV-2 and emerging variants. Antibody induction can be affected by age and sex but is still induced to a sufficient level.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257884
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257879

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257879: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Because data were de-identified, the Institutional Review Board of the University of Michigan Medical School exempted analyses from human subjects review.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses used SAS 9.4 (SAS Institute).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study also has limitations. First, despite strong indirect evidence, we cannot prove that COVID-19 hospitalizations in this study were mostly covered by plans with cost-sharing waivers. Second, if patients did not pay the amounts they were billed, the incidence of actual out-of-pocket spending would differ from the incidence estimated by this study. However, the amount billed to patients still illustrates the financial burden patients may face without cost-sharing waivers. Third, COVID-19 hospitalizations without the diagnosis code for confirmed COVID-19 (U017) were not included. However, hospitals rapidly started using this code during the first half of 2020.16 Finally, our database is not necessarily representative of all private and Medicare Advantage plans. However, most privately insured hospitalizations in our study were covered by preferred private organization plans, while most Medicare Advantage hospitalizations were covered by health maintenance organizations, consistent with the national distribution of plan type among privately insured and Medicare Advantage enrollees.13,17
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257879
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.445667

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.445667: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP) or anti-IgG from rabbit as a control (Cell Signaling, a gift from Dr. Mathias Munschauer, HIRI-HZI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transfer using Trans-Blot (Bio-Rad), nitrocellulose membranes were developed using the following primary antibodies: anti-His-tag (ab18184), anti-DDDDK (ab49763), anti-ALFA (FluoTag®-X2 anti-ALFA AlexaFluor 647), anti-ZC3HAV1 (Proteintech 16820-1-AP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ALFA</div><div>suggested: (Antibodies-Online Cat# ABIN125862, RRID:AB_11186338)</div></div><div style="margin-bottom:8px"><div>anti-ZC3HAV1</div><div>suggested: (Proteintech Cat# 16820-1-AP, RRID:AB_2728733)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used: IRDye® 800CW Goat anti-rabbit and IRDye® 680RD Donkey anti-Mouse (both LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nitrocellulose membranes were developed using anti-DDDDK primary (Abcam ab49763) and IRDye® 680RD donkey anti-mouse secondary antibody (LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DDDDK</div><div>suggested: (Abcam Cat# ab49763, RRID:AB_869428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the experiments, optical tweezers (OT) constructs were mixed with 4 μl of polystyrene beads coated with antibodies against digoxigenin (AD beads, 0.1% v/v suspension, Ø 1.76 μm, Spherotech), 10 μl of assay buffer (20 mM HEPES, pH 7.6, 300 mM KCl, 5 mM MgCl2, 5 mM DTT and 0.05% Tween) and 1 μl of RNase inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>digoxigenin</div><div>suggested: (Millipore Cat# AQ300D, RRID:AB_11212694)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC HTB-55) were cultured in MEM (Sigma) supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supernatant was used to transduce naïve Huh7 cells in the presence of 10 μg/ml polybrene (Merck Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was raised for two passages on Caco-2 cells (HZI Braunschweig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study the effect of ZAP-S on SARS-CoV-2 infection, Huh-7 cells were employed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were infected with 200000 pfu/ml, corresponding to an MOI of 0.03 at 24h post-infection, cell culture supernatants were collected and titrated by plaque assay on Vero E6 cells (ATCC CRL-1586).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polysome profiling analysis: A plasmid expressing ZAP-S N-terminally tagged with a His-tag was transfected into HEK293 cells using PEI, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check endogenous ZAP-S expression, HEK cells were transfected with a plasmid containing the same backbone and His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TFRC (NM_003234.4), ZAP (NM_024625.4) and ZNF346 (NM_012279.4) were placed in frame with the coding sequence for ECFP in pFlp-Bac-to-Mam (gift from Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFlp-Bac-to-Mam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-coding sequences were introduced by Golden Gate Assembly using AarI cut sites 69. pET-SUMO-GFP (gift from Prof. Utz Fischer, Julius-Maximilians-University, Würzburg, Germany) was used as the parental vectors for protein overexpression in E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-SUMO-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Optical tweezers constructs were based on the wild type SARS-CoV-2 frameshifting site (nucleotides 13475-13541) cloned into the plasmid pMZ_lambda_OT, which encodes for the optical tweezer handle sequences (2Kb each) flanking the RNA structure (130 nt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMZ_lambda_OT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-G envelope pseudo-typed lentivirus for the generation of stable cell lines was produced by co-transfection of each transfer plasmid with pCMVdR 8.91 71 and pCMV-VSV-G (gift from Prof. Weinberg, Addgene plasmid # 8454 72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAs were labeled at the 3’ end using pCp-Cy5 (Cytidine-5’-phosphate-3’-(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCp-Cy5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed with FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands corresponding to the –1 or 0-frame products, 58 kDa and 33 kDa respectively, on western blots of in vitro translations were quantified densitometrically using ImageJ software 74.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were plotted using GraphPad Prism 8.4.3 software. Microscopy: HEK293 cells were cultured on glass slides and transfected as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were plotted using Prism 8.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data are available in the main text, the supplementary materials as well as in Mendeley Data: DOI: 10.17632/c7rbxb86k2.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mendeley</div><div>suggested: (Mendeley Data, RRID:SCR_002750)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT811</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.445667
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.445871

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.445871: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: This study was approved by Temple University IRB (IRB #28021) and the informed consent forms were signed by all study subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of the study include the small sample size, with possible lack of representativeness, and the lack of live SARS-CoV-2 neutralization assays.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.445871
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446374

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446374: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Bat primary cells: M. myotis samples were collected in July 2020 from two bat colonies in Inca and Llucmajor on Mallorca (Balearic Islands, Spain) (agreement CEP 31/2020 delivered by the Ministry of the Environment and Territory, government of the Balearic Islands).<br>Euthanasia Agents: The bat was anesthetized with isofluranum (Piramal Enterprises Ltd.) and euthanized by quick decapitation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with goat pAB anti-hACE2-647 (1:100, FAB933R R&D Systems) and/or with antibodies recognizing the spike protein of SARS-CoV (anti-S, 1:1000, GTX632604 Genetex) or anti-S mAb10 (1 μg/ml, a kind gift from Dr. Hugo Mouquet, Institut Pasteur, Paris, France) and subsequently with secondary antibodies anti-human AlexaFluor-647 (1:1000, A21455 Thermo), anti-mouse AlexaFluor-488 (1:1000, A28175 Thermo) or Dylight488 (1:100, SA5-10166 Thermo) for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hACE2-647</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: (Acris Antibodies GmbH Cat# AP09205DL5-N, RRID:AB_2035586)</div></div><div style="margin-bottom:8px"><div>anti-human AlexaFluor-647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, cells were incubated with anti-goat Alexa488 (A-11055, Thermo Fisher Scientific) and anti-mouse Alexa555 (A21427, Thermo Fisher Scientific) secondary antibodies diluted 1:500 in AB buffer for 30 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Thermo Fisher Scientific Cat# A-11055, RRID:AB_2534102)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Innovative Research Cat# A21427, RRID:AB_1500655)</div></div><div style="margin-bottom:8px"><div>A21427</div><div>suggested: (Innovative Research Cat# A21427, RRID:AB_1500655)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: FLG-ID, FLG-R, FLN-ID, FLN-R and Tb1Lu cell lines (table 1) were maintained in equal volumes of Ham’s F12 and Iscove’s modified Dulbecco’s medium (IMDM, Gibco), supplemented with 10% FBS and 1% P/S (Gibco) in non-vented flasks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tb1Lu</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mm and Nn cell lines (table 1), as well as African green monkey Vero E6 cells (ATCC CRL-1586), human lung epithelial A549 cells (kind gift from Frédéric Tangy, Institut Pasteur, Paris) and human colorectal adenocarcinoma Caco TC7 cells (ATCC HTB-37), were maintained in DMEM (Gibco), supplemented with 10% FBS and 1% P/S in vented flasks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cleared supernatant was stored at −80°C and titrated on Vero E6 cells by using standard plaque assays to measure plaque-forming units per mL (PFU/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary cells were immortalized by transfection of pRSVAg1 plasmid expressing Simian Vacuolating Virus 40 large T antigen (SV40T) with lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol, expanded and cryopreserved.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSVAg1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All cells were maintained at 37°C in a humidified atmosphere with 5% CO2. Bat and A549 cells were modified to stably express hACE2 using the pLenti6-hACE2 lentiviral transduction as described previously [43].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti6-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome equivalent concentrations were determined by extrapolation from a standard curve generated from serial dilutions of the pcDNA3.1-hACE2 plasmid (addgene, 145033) or plasmids encoding a fragment of the RNA-dependent RNA polymerase (RdRp)-IP4 of SARS-CoV-2 or a fragment of the ACE2 genome of each bat species.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-hACE2</div><div>suggested: RRID:Addgene_145033)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were gel-purified (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel) and cloned into pCR-Blunt II-TOPO vectors using the Zero Blunt TOPO PCR Cloning Kit (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-Blunt II-TOPO</div><div>suggested: RRID:Addgene_29705)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired on an Attune NxT Flow Cytometer (Thermo Fisher) and data analyzed with FlowJo software v10 (TriStar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Graphical representation and statistical analyses were performed using GraphPad Prism Version 9.0.2 software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446374
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446386

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446386: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the transfer, the membrane was blocked in 1% Casein in PBS (Thermo Scientific) and stained using primary antibodies directed against SARS-CoV-2 S (1:1,000, Biozol, 1A9, #GTX632604), ACE2 (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, VSV-M (1:2,000, Absolute Antibody, 23H12, #Ab01404-2.0), V5-tag (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Cell Signaling, #13202), GAPDH (1:1,000, BioLegend, #631401) and Infrared Dye labelled secondary antibodies (1:20,000, LI-CORIRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 631401, RRID:AB_2247301)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney 293T cells purchased from American type culture collection (ATCC: #CRL3216) were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine (PANBiotech), 100 μg/ml streptomycin (PANBiotech) and 100 U/ml penicillin (PANBiotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoparticle production: To produce pseudotyped VSVΔG-GFP particles, 6*106 HEK 293 T cells were seeded 18 hours before transfection in 10 cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stem Cell Culture and Intestinal Differentiation: Human embryonic stem cell line HUES8 (Harvard University, Cambridge, MA) was used with permission from the Robert Koch Institute according to the “79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUES8</div><div>suggested: RRID:CVCL_B207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">α5β5 integrin blocking: Caco-2 cells were preincubated with the indicated amounts of α5β5 integrin Inhibitor ATN-161 (Sigma) for two hours and infected with 100 μl freshly produced VSVΔG-GFP pseudo particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05, six hours).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs: pCG_SARS-CoV-2-Spike-IRES_eGFP, coding the spike protein of SARS-CoV-2 isolate Wuhan-Hu-1, NCBI reference Sequence YP_009724390.1, was kindly provided by Stefan Pöhlmann (German Primate Center, 473 Göttingen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP and RaTG13-S (synthesized by Baseclear) was PCR amplified and subcloned into a pCG-IRES_eGFP expression construct using the restriction enzymes XbaI and MluI (New England Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicons were assembled with a modified pBeloBAC11 backbone, containing CMV and T7 promotors as well as the HDV ribozyme and bGH polyA signal, using the NEBuilder HiFi DNA Assembly Cloning Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assembled DNA was electroporated into E. coli GS1783 strain and resulting clones of pBelo-SARSARS-CoV-2 were confirmed by restriction digestion and next generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ΔS replicon system: HEK293 T cells were seeded in six well format and transfected with 3 μg pBelo-SARSCoV-2-dSpike-GLuc-K2 or pBelo-SARSCoV-2-dSpike-EGFP and 0.25 μg of each expression construct pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro, pCG-ACE2, pCAG-T7-RNA-polymerase and one pCG-vector encoding the spike protein of SARS-CoV-2, RaTG13 or the indicated mutant S respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-GLuc-K2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-T7-RNA-polymerase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-vector</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Organoids were imaged using the Cytation 3 cell imaging system and processed with Gen 5 and ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence logos were generated using R packages ggplot2 and ggseqlogo34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446386
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446476

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446476: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional categorization and analysis: We classified molecular risk factors into overlapping gene sets based on annotations of biological processes in the Gene Ontology database and pathways in the KEGG database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the clusterProfiler and enrichplot packages in R/Bioconductor for these analyses [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of our study include the lack of individual risk factors passing a stringent statistical threshold and no consideration of multivariate effects. Although our analysis identified marginal molecular risk factors passing the nominal P value cutoff, none had a significant FDR after correction for multiple comparisons, which disqualified them as prognostic markers. However, analysis using the aggregation of these risk factor genes discovered significantly enriched biological processes, with the best FDR<10-4 (Table 2). Therefore, we are confident that chronic ER stress and immune dysregulation in pre-existing health conditions increased risk of COVID- 19 mortality. Our analyses were based on univariate models, in which we examined the expression levels of each gene separately. Because multiple genes are dysregulated concurrently and a combination of them contributes to COVID-19 prognosis, a more realistic model should consider their combined effect. However, because the transcriptomics data were derived from individual patients and HRs of COVID-19 mortality were from summary statistics of an epidemiology study, we chose to use univariate models that are more straightforward to interpret. Our novel analytical approach integrates epidemiology data and omics data to discover molecular risk factors. While we focus on transcriptional regulation in this study, an immediate next step is to apply this approach to other molecular changes, including genetic variation, epigenetic...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446476
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.23.21257668

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.23.21257668: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was reviewed by the Mayo Clinic Institutional Review Board and determined to be exempt from human subjects research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis of SARS-CoV-2 Spike protein: Structural analyses and illustrations were performed in PyMOL (version 2.3.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral RNA was first manually extracted and purified from these clinical specimens using MagMAX™ Viral / Pathogen Nucleic Acid Isolation Kit (Life Technologies Corp.), followed by automated reverse transcription-PCR (RT-PCR) of viral sequences, DNA library preparation (including enzymatic shearing, adapter ligation, purification, normalization), DNA template preparation, and sequencing on the automated Genexus™ Integrated Sequencer (Life Technologies Corp.) with the Genexus™ Software version 6.2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genexus™</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are a few limitations of this study. First, the geographic distribution of sequences deposited in the GISAID database is not representative of the global population, with a majority of the sequences coming from the United States or the United Kingdom. Future genomic epidemiology studies would be improved by expanded sequencing efforts in other countries. Second, the identification of mutations associated with surges during early months of the pandemic is complicated by the relative paucity of whole genome sequencing data deposited during that time. Third, the publicly accessible genomic data is not linked to any phenotypic information (e.g., disease severity) or relevant medical histories (e.g., comorbidities and vaccination status). Thus, while we are able to identify correlations between mutational prevalence and case surges, we cannot determine whether particular mutations are associated with more severe disease or are observed more frequently than expected by chance in vaccinated individuals. While the latter shortcoming is partially addressed by our independent whole genome sequencing of virus isolated from COVID-19 cases with accessible longitudinal records (including previously vaccinated individuals), this analysis was limited by the small size of the cohort (n = 53) and the lack of corresponding antibody titer data. We plan to address this by performing more whole genome viral sequencing of SARS-CoV-2 from COVID-19 patients. Taken together, using genomic epidem...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.23.21257668
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.29.446272

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.446272: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-ACE2 antibody (Proteintech) was used at 1:2000 and anti-mouse HRP (Cell Signaling Technology) at 1:1000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP (Cell Signaling Technology)</div><div>suggested: (Cell Signaling Technology Cat# 5127, RRID:AB_10892860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 spike antibody (BEI Resources NR-52947) was used at 1:1000 and anti-rabbit HRP (Cell Signaling Technology) at 1:1000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP (Cell Signaling Technology)</div><div>suggested: (Cell Signaling Technology Cat# 5127, RRID:AB_10892860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: 293T, 293T-ACE2, A549-ACE2, Caco2, Huh-7 and Vero cells were cultured in Dulbecco’s modified Eagle’s medium with 4mM glutamate (DMEM; Sigma) and supplemented with 10% fetal calf serum (FCS; Sigma), 100 units/ml penicillin and 100μg/ml streptomycin (Sigma) at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture medium of Caco2 and Huh-7 was supplemented with 1x non-essential amino acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu3 cells were cultured in Minimal Essential medium supplemented with 2mM glutamate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus system: 293T cells seeded at 4×106 per 100mm dish were co-transfected with 6μg of a plasmid encoding MLV gag-pol, 8μg of the transfer vector encoding a luciferase reporter and 6μg of a plasmid encoding an empty vector, a viral envelope glycoprotein SARS-CoV-S, SARS-CoV-2-S, MERS-CoV-S or VSV-G using calcium phosphate (125mM CaCl2, 0.7mM Na2HPO4, 70mM sodium chloride, 25mM Hepes pH 7.05) (see Fig. 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 cells seeded at 25,000 cells per well of 96-well plates were pre-treated with 10μM of individual drugs, in duplicate, for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus system: 293T cells seeded at 4×106 per 100mm dish were co-transfected with 6μg of a plasmid encoding MLV gag-pol, 8μg of the transfer vector encoding a luciferase reporter and 6μg of a plasmid encoding an empty vector, a viral envelope glycoprotein SARS-CoV-S, SARS-CoV-2-S, MERS-CoV-S or VSV-G using calcium phosphate (125mM CaCl2, 0.7mM Na2HPO4, 70mM sodium chloride, 25mM Hepes pH 7.05) (see Fig. 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pharmacophoric features were calculated using AutoPH4 script (80) with holo conditions, and manually optimized for maximum performance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoPH4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Docking studies were performed using GOLD software version 2020.3.0 (81). in summary, 2D depicted structures of compounds were extracted from the PubChem database (82) and were compiled in a MOE database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed and graphs were plotted using Prism 9.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.29.446272
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.30.446357

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.446357: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.<br>Euthanasia Agents: Mice received 1 or 2 immunizations, 21 days apart, and were challenged with 1 x 104 PFU of SARS-CoV-2 (VIC01 isolate) 21 days after the final immunization via intranasal inoculation (20 μL total volume) while under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of BALB/c mice: Naïve 6-8 week old female BALB/c mice were randomly divided into 6 groups of 8 mice and vaccinated either via HD-MAP application or intradermal injection with 2 μg of SARS-CoV-2 S HexaPro, 2 μg of SARS-CoV-2 S HexaPro with the adjuvant QS21 (Desert King), or vehicle only control.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">A lung lobe and brain hemisphere from each animal was fixed in 10% neutral buffered formalin and processed for paraffin embedding and hematoxylin-eosin stained sections were examined by a veterinary pathologist blinded to the treatments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, relevant HRP-conjugated secondary antibodies were added (goat anti-mouse or anti-human, diluted 1:2000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum binding was detected using an HRP-linked goat anti-mouse secondary antibody and TMB substrate as discussed previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 80% acetone 14-16 hours post-infection and allowed to dry prior to plaque visualization with SARS-CoV-2 spike-specific mAbs CR3022 or S309 and IRDye 800CW-conjugated goat anti-human secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>anti-human secondary antibodies .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were purchased from the American Type Culture Collection (ATCC) (catalog: ATCC CRL-1586) and cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplicated with 10% fetal bovine serum (Bovogen, USA), penicillin (100 U/mL) and streptomycin (100 μg/mL) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal ethics and animals: Female BALB/c and K18-hACE2 transgenic mice were purchased from the Animal Resources Centre (Perth, Australia) and housed in pathogen-free conditions at the Australian Institute for Bioengineering and Nanotechnology or Griffith University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_154754)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism 9 software was used for statistical analysis and generation of graphs and figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.30.446357
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.29.445137

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.445137: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics statement and the role of the funding source: The study procedures, informed consent, and data collection documents were reviewed and approved by the WIRB-Copernicus Group Institutional Review Board (WCG IRB #202029060) and the University of Georgia.<br>IRB: Ethics statement and the role of the funding source: The study procedures, informed consent, and data collection documents were reviewed and approved by the WIRB-Copernicus Group Institutional Review Board (WCG IRB #202029060) and the University of Georgia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Exclusion criteria included being younger than 18 years old, weighing less than 110 lbs, being pregnant, being cognitively impaired, or having anemia or a blood-borne infectious condition such as hepatitis C or HIV.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the pre-vaccination timepoint, 20 of them were categorized as immunologically naïve to SARS-CoV-2, and reported no specific COVID-19 symptoms, never had a positive NAAT result, and tested negative for RBD-specific IgG antibodies with concentrations below our experimentally determined threshold of 1.139μg/mL [see under ROC analysis heading] (Table S1A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RBD-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 5 times with PBS/0.05% Tween20 and IgG antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-human IgG detection antibody (Southern Biotech, Birmingham, AL, USA) at a 1:4,000 dilution and incubated for 90 min at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linear regression and correlation analyses were applied to test the relationship between anti-RBD IgG antibody concentrations (ELISA) and VN endpoint titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum-virus mixture was then transferred to Vero E6 cells in 96-well cell culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using GraphPad Prism 9.1.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad 9.1.0, and statistical significance was represented by * p<0.05, ** p<0.01, *** p<0.001, and **** p<0.0001.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.29.445137
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.30.446322

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.30.446322: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written information regarding the study was provided to all participants; verbal consent for testing was obtained by care home managers from staff members and residents or their next of kin as appropriate.<br>IRB: Stored pre-pandemic samples from seven healthy individuals were used as controls, recruited under ethics number 11/LO/0421 approved by the ‘South East Coast - Brighton and Sussex Research Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two panels (surface and intranuclear) of monoclonal antibodies (mAbs) were used to phenotype global and antigen specific subsets (Table S2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen specific subsets ( Table S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, ELISpot plates were washed in filtered PBS supplemented with 0.5% Tween 20 (Merck) and incubated for four hours in the dark at room temperature with 1ug/ml goat anti-human IgG horse radish peroxidase antibody (Jackson Immunoresearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 Briefly, spike glycoprotein trimer (uncleaved spike stabilised in the prefusion conformation (GGGG substitution at furin cleavage site and 2P mutation)64 and RBD protein12 were cloned into a pHLsec vector containing Avi and 6xHis tags.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">28,30 Briefly, codon-optimised DNA fragments were cloned into mammalian expression vector pQ-3C-2xStrep to create plasmids, which were then transfected into Expi293F cells growing at 37 in 5% CO2 atmosphere using ExpiFectamine reagent (Thermofisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQ-3C-2xStrep</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on a Fortessa-X20 (BD Biosciences) and analysed using FlowJo (TreeStar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and statistics: Data were analysed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A caveat to our study is that we were only able to study circulating B cells, whilst additional recall responses may be compartmentalised within the mucosa. A recent study suggested mild infection can stimulate mucosal SARS-CoV-2-specific IgA secretion in the absence of circulating antibodies.58 The bias towards the retention of IgA+ spike/RBD-specific MBC in those who had lost all detectable serum nAb to live virus could therefore be reflective of a stronger mucosal response in these individuals. An increase in mucosal-homing IgA responses has been described as a feature of the ageing immune response,59 consistent with the older composition of our cohort. Alternatively, the relative preservation of IgA rather than IgG spike/RBD-specific MBC in those with the fastest waning nAb may simply reflect the recent observations that IgA dominates the early nAb response to SARS-CoV-2 infection,56 and may not decline as fast as the IgG response.9,60 Since our ELISpot assays did not measure the function of IgA isotype B cells, we may have under-estimated the full extent of residual SARS-CoV-2-specific responses, particularly in those with a more IgA-skewed response. In addition, several studies have shown that the magnitude of the MBC response to SARS-CoV-2 continues to increase beyond six months,9,23,50,61 again implying that we may have under-estimated the extent of recall potential in our cohort at five months. Future studies should also examine the preservation of non-spike-specific...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.30.446322
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21257910

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21257910: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Exposure instruments: We used single nucleotide polymorphisms (SNPs) as instruments in our Mendelian randomization analysis which have previously been identified as being associated with carnitine and acetyl-carnitine concentration measured in blood from 7,797 and 7,805 adults of European ancestry respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">34 A priori we planned to performed MR analyses on those outcomes that had power > 50%.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations of our analyses: Randomized controlled trials are expensive and are unethical where evidence of the treatment effect is weak, particularly if the drug in question has potential off target effects. In addition, trials take time and in the context of a global pandemic of a novel virus prioritization of the most promising treatments to take forward into trials is essential. Two sample Mendelian randomization analyses, such as the ones we have performed, can make use of large-scale data on common genetic variants from existing genome wide association studies,57 which means the analyses can be carried out quickly and can inform trials. In addition, using Mendelian randomization it is possible to look at effects of the treatment or exposure of interest with other outcomes using data from different GWAS to investigate whether they are on the causal pathway and to estimate any potential off-target effects. An important interpretive issue with Mendelian randomization is that genetic variants generally reflect variation in exposure over a lifetime so it is not possible to determine with certainty from our analyses the effect of short-term treatment with acetyl-carnitine and carnitine for the prevention of severe Covid19. Some of the effects we found with our secondary outcomes clearly occurred early in life (height) and are therefore very unlikely to be influenced by treatment of adults with carnitine. In addition, our analysis assumed a linear effect of the e...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21257910
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258007

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258007: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Proteinase K concentration optimisation: Nasopharyngeal swab samples from three COVID-19 positive individuals with informed consents were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Microsoft excel was used for statistical analysis and plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad prism 6 was also used for plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258007
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257993

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257993: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided informed consent and participated in the research online, under a protocol approved by the external AAHRPP-accredited IRB, Ethical & Independent Review Services (E&I Review).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the non-pseudoautosomal region of the X chromosome, males and females were phased together in segments, treating the males as already phased; the pseudoautosomal regions were phased separately.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participant genotype data were imputed using the Haplotype Reference Consortium (HRC) panel5, augmented by the Phase 3 1000 Genomes Project panel6 for variants not present in HRC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1000 Genomes Project</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257993
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258012

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258012: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed using MedCalc, R software with survival, survminer, lme4, and ggplot2 packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258012
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257946

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257946: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our article has several important limitations. First, our data are ecological in nature, only available at the level of county. Thus, we cannot use our analysis to infer behavior for any individual resident. Second, while the CDC reports making reasonable efforts to determine county of residence, certain reporting practices, such as reporting through retail pharmacies, federal facilities, or long-term care facilities may result in low vaccination coverage data. This has potential to add noise to our vaccination maps, especially in areas of high resident mobility or vaccination tourism. Third, although we produce accurate short-term forecasts, unforeseen factors such as discoveries of major adverse reactions, geopolitical events, natural disasters, and logistical breaks in the supply chain cannot be incorporated into our forecast, although these will certainly affect vaccination uptake. In fact, our longer-term forecast should only be considered as a counter-factual scenario if current trends hold.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257946
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257909

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257909: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To summarize, on December 11, 2020 a systematic search for systematic reviews was done in PubMed and Embase, with hand searches on preprint servers (search string in supplement).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations To our knowledge, since our rapid review published (13), this is the first systematic review primarily focused on estimating the isolated effect of age on the risk of COVID-19 disease severity, including case and in-hospital mortality, hospitalization, ICU admission, and intubation. It encompasses 70 primary studies with data from more than 400,000 participants and includes only studies adjusting for important age-related factors associated with COVID-19 disease severity (14). Adjusting for comorbidities allows to explicitly “factor out” the mediating effect of comorbidities in order to get the isolated effect of age, or the risk presented by a person of a given age who has no preexisting conditions. The results in this review should be considered in light of its limitations. For studies reporting age as a categorical value, since the age categories used in the studies could not be compared because of their heterogeneity, the median of the age category represented the age for the reported effect size. This procedure could have led to inaccuracies of the effect size. This was evident in that effect sizes increased when using finer age categories, indicating that the use of wide age categories most likely leads to an underestimation of the age effect. We reported the pooled effect sizes for studies using age as a continuous variable for the outcome in-hospital mortality. For the other outcomes we reported the pooled effect size for studies using catego...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257909
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257032

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257032: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257032
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257900

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257900: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257900
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446579

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446579: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of the Study: While in this work, we obtained evidence that SARS-CoV-2 spike more efficiently mediates cell-to-cell transmission than the SARS-CoV spike, a direct comparison using authentic viruses of both, especially in primary human lung and airway epithelial cells, is needed. As an initial step toward this goal, we have attempted to apply rVSV-GFP-SARS-CoV-2 and rVSV-GFP-SARS-CoV to human primary bronchial and nasal epithelial cell cultures, but the efficiency of spread for both viruses was too low to draw any conclusion. Although in this work, we examined roles of ACE2 and endosomal proteases in cell-to-cell transmission vs. cell-free infection, how other host cofactors, including TMPRSS2, modulate this process will need to be investigated. Ultimately, we must determine the role, if any, of cell-to-cell transmission of SARS-CoV-2 in disease progression and pathogenesis in COVID-19 patients.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 60. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

ncbi.nlm.nih.gov/pmc/articles/PMC8183005/
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.06.01.446491

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.06.01.446491: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Subjects: All protocols used for subject recruitment, enrollment, blood collection, sample processing and immunological assays with human samples were approved by the Northwestern University Institutional review board (STU00212583).<br>Consent: All participants voluntarily enrolled in the study by signing an informed consent form after receiving detailed information of the clinical study.<br>IACUC: All mouse experiments with BL2 agents were performed with approval from the Northwestern University Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were purchased from Jackson laboratories (approximately half males and half females) and housed at the Northwestern University Center for Comparative Medicine (CCM) or the University of Illinois at Chicago (UIC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-specific ELISA (SARS-CoV-2 spike, RBD, nucleocapsid; SARS-CoV- 1 spike; OC43 spike): Antigen-specific total antibody titers were measured by ELISA as described previously (Dangi et al., 2020; Palacio et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific total</div><div>suggested: (George Fu Gao; Chinese Academy of Sciences; Beijing; China Cat# Z3L1, RRID:AB_2725798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with wash buffer followed by addition of secondary antibody conjugated to horseradish peroxidase, goat anti-mouse IgG (Southern Biotech) diluted in blocking solution (1:1000) at 100 µl/well were added and incubated for 60 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with fluorescently-labelled antibodies against CD44 (IM7 on Pacific Blue), CD8α (53- 6.7 on PerCP-Cy5.5), IFNγ (XMG1.2 on APC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8α</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescently-labelled antibodies were purchased from BD Pharmingen, except for anti-CD44 (which was from Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD44</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (MA10) was propagated and tittered on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus propagation: OC43 was propagated in an 80-90% confluent monolayer of HCT-8 cells (ATCC® CCL-244™) in T175 flasks at a multiplicity of infection (MOI) of 0.01 diluted in 5 mL of RPMI supplemented with 2% FBS, 1% penicillin/streptomycin, and 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus neutralization assays: A SARS-CoV-2 pseudovirus was generated by transfection of HEK-293T cells with a pCAGGS vector expressing the SARS-CoV-2 spike glycoprotein (BEI resources, NIAID, NIH: NR-52310).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers were measured by infecting HEK-293T-hACE2 cells and counting GFP foci under a fluorescence microscope after 24 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice, vaccinations, infections and challenges: 6-8-week-old C57BL/6, BALB/c, A/J, Ifnar1-/- mice (on a C57BL/6 background) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A/J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ifnar1-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector pCAGGS containing the SARS-related coronavirus 2, Wuhan-Hu-1 spike glycoprotein gene (soluble, stabilized), NR-52394 and receptor binding domain (RBD), NR-52309.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected by phlebotomy using BD Vacutainer 10mL tubes containing sodium heparin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Vacutainer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry samples were acquired with a Becton Dickinson Canto II or an LSRII and analyzed using FlowJo (Treestar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TCR analyses were performed using the scRepertoire package30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scRepertoire</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Prism (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of our study is that we only evaluated heterologous immune protection at an early time post-vaccination or post-infection, and it is possible that cross-protective immunity declines over time. Future studies will determine whether cross-reactive antibodies are produced by plasma cells, or short-lived plasmablasts, which tend to be highly mutated and cross-reactive21, 22. In summary, we show that coronavirus vaccines and coronavirus infections can confer protection against other coronaviruses. These findings provide a framework for the rational design of universal coronavirus vaccines, and present the first definitive demonstration of heterologous immune protection following coronavirus vaccination or infection.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2021.06.01.446491v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.27.446089

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.446089: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Each donor provided signed written informed consent for the use of their blood-derived products for future research and all experimental protocols were approved by the ethical standards of the institutional research committee – the Ethics Committee of the University Hospital Motol in Prague, and performed in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.<br>IRB: Each donor provided signed written informed consent for the use of their blood-derived products for future research and all experimental protocols were approved by the ethical standards of the institutional research committee – the Ethics Committee of the University Hospital Motol in Prague, and performed in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microblot array: The collected donors’ sera were analyzed for the presence of multiple antigen-specific antibodies using Microblot-Array COVID-19 IgG, IgA, or IgM kits (TestLine Clinical Diagnostics, Brno, Czech Republic).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG, IgA, and IgM antibodies against the following antigens were determined: SARS-CoV-2 spike glycoprotein receptor-binding domain (RBD) and S2 domain (S2), SARS-CoV-2 nucleocapsid protein (NCP), E protein (EP), and papain-like protease (PLP), Middle East respiratory syndrome-related coronavirus (MERS-CoV) spike glycoprotein S1 subunit (S1), SARS-CoV NCP, human coronavirus 229E (HuCoV 229E) NCP, human angiotensin-converting enzyme (ACE-2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike glycoprotein receptor-binding domain ( RBD )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein ( NCP)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MERS-CoV ) spike glycoprotein S1 subunit ( S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were transferred to a V-bottom 96-well plate (Nalgene) and stained as described [29] with live/dead fixable stain and the following antibodies: CD4-PE-Cy7 and CD8-Alexa Fluor 700 (Exbio, Prague, Czech Republic), CD3-PerCP-Cy5.5, TNFα-APC, and IFNγ-PE (Becton Dickinson, Franklin Lakes, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8-Alexa</div><div>suggested: (MBL International Cat# D271-A64, RRID:AB_10794611)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were analyzed by FACSAria II (Becton Dickinson, Heidelberg, Germany) and the data processed by FlowJo software (Tree Star, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The means of values±SEM were calculated from the indicated sample size (n) using GraphPad Prism 6 (GraphPad Software, La Jolla, CA) and the statistical significance (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001) between two groups of samples determined by Wilcoxon matched-pair signed-rank tests and between three or more groups the statistical significance was determined by matched-pair 1-way ANOVA with Dunn’s post test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 29 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.27.446089
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257844

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257844: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using SAS 9.4 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Our study has several limitations. Firstly, our analysis was conducted on a country-level basis to estimate the vaccination efficacy, which should be seen as less precise method compared to analysis of individual-level data, as previously noted. However, given the range of included countries, our results shed light on the problem of vaccination effectiveness from a broader perspective and investigate the effect of vaccination across societies, considering variability of vaccination coverage through time and between countries. Secondly, the quality of data on variants distribution varied between countries and was low for some of them, therefore, results of the exploratory analysis should be treated with cautious. To limit bias and avoid fluctuations, we employed methods of interpolation and smoothing. Countries with limited data were excluded. Thirdly, the set of covariates used in the multivariate analysis can be assessed as non-exhaustive. We decided to consider factors which were previously assessed as significantly impacting the risk of severe illness or mortality from COVID-19 in the literature.50-53 Finally, we were not able to consider other new SARS-CoV-2 VOCs, except B.1.1.7, in the current analysis, which was due to their limited spread in Europe as of April 2021. It rises a need for further research on this topic in the future. Conclusions: This study confirms a strong effectiveness of COVID-19 vaccination based on real-life public data, in terms of pro...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257844
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257862

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257862: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were several limitations in this study. One limitation was the lack of data on superspreading events that occurred in each state (for example, within prisons46 and nursing homes,47 as well as in religious settings, schools and sport camps, and social events48). Many of the counties located in both Arkansas and Kentucky contained large prison populations. The counties of Lincoln, Arkansas and Elliot, Kentucky, both contain county correctional facilities and prisons.37,49 The reason for the unstable Rt in these counties may stem from disease amplification in prison outbreaks rather than community spread. However, it is difficult to pinpoint certain related outbreaks, and there is limited county-level data specific to correctional facilities. Additionally, there were 1,755 unknown county-level cumulative cases in Arkansas. These cases were included in our state-level data analysis, but they were excluded from the Delta, non-Delta, and county-level hot spots analyses. Kentucky had all county-level data and all reported cases were used in all analyses. This study observed that both Arkansas and Kentucky, as well as the respective regions, had an extensive spread of COVID-19, since both states maintained a median Rt above 1. The direction of the trend of the Rt estimates were reflected by the implementation of preventative measures and their subsequent relaxation as the pandemic progressed. This study was able to examine the changing transmission potential of COVID-19 over ti...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257862
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257836

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257836: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We then discuss limitations of our study arising from model errors, uncertainty in the factors driving the resurgence in Karnataka, policy changes in response to the local circumstances, and vaccine supply constraints. 4.1 Discussion of the results: The significant second surge has highlighted widespread susceptibility in early 2021. This could be due to waning immunity, or limited spread of the first wave, or novel variants, or a combination thereof. An expedited, effective, and equitable vaccine campaign remains the only feasible pathway to controlling COVID-19 in India. Given supply constraints and India’s population size, tools for designing efficient vaccination campaigns are essential. In this paper, we developed a model (using serosurvey data and on-the-ground datasets) to study vaccination allocation strategies and the interplay of vaccination capacity and NPIs in achieving sufficient immunity levels. The main messages of this work are the following: Our model makes use of several real-time data sources – population data, age-distribution, age-stratified contact rates, disease progression data, confirmed case trajectories across units, seroprevalence data, time series of tests conducted, vaccination time-series, and efficacy of vaccines. Our compartmental ODE model used patches that where made up of age and unit stratifications. We modelled mobility across subunits to be independent of age. A future extension could be to use age-stratified mobility data. There are man...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257836
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257861

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257861: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257861
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257934

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257934: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257934
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257967

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257967: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The output of the calculators and tools featured on this website has been audited for accuracy against the output produced by a number of established statistics packages, including SPSS and Minitab.1 The test applied was Chi square test of independence and the significance level was set at .05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257967
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257937

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257937: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was coded, fitted, and analyzed using MATLAB R2019a [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. Model estimations are contingent on the validity and generalizability of input data. While current available natural history and epidemiological evidence was used to justify model assumptions and parameter values, our understanding of this infection is still evolving. Data on SARS-CoV-2 seroprevalence in the Lebanese population are lacking. The level of prior exposure to the infection plays an important role in this analysis and will affect estimates of vaccine impact. We assumed that 20% had been exposed to the infection on January 1,2021, a sensible estimate based on triangulation of available local data, including the cumulative number of confirmed infections and deaths and routine clinical antibody testing data. We assumed that both natural and vaccine-induced immunity last for one year, as suggested by available data [21-24]. However, these two important parameters remain unknown. If they prove to be less than the assumed one year, the impact of the vaccine will be reduced. The model did not prioritize vaccination based on age, since younger individuals in the workforce are currently being vaccinated through the private sector. Given that the highest risk elderly population (>70 years) did receive the vaccine first, our estimates for the impact of vaccination are conservative and the number of averted disease cases and deaths may be higher than the ones reported in our study. Finally, analyses were conducted at a national level, whereas v...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257937
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257973

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257973: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the ethics committee of the London School of Hygiene & Tropical Medicine Reference number 21795.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The code and data used to conduct these analyses are found at: https://github.com/amygimma/comix_uk_summary_analysis Data will be available to download through the Socrates social contact tool website and Zenodo: http://www.socialcontactdata.org/socrates-comix/</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zenodo</div><div>suggested: (ZENODO, RRID:SCR_004129)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: The survey is conducted online, using a quota-based sample of individuals who have agreed to participate in marketing surveys. This recruitment method is biased towards people with access to the internet and who may be reached by banner ads, email campaigns, and social media advertisements. Participants only received guidance through the text in the questionnaires, and may interpret questions differently. This may be especially evident in the reporting of group contacts. Responses are also subject to recall bias, which may under- or over-estimate contacts depending on the nature of the contacts. Additionally, due to child protection concerns and age-dependent ability to complete the survey, children’s contacts are collected through a parent acting as a proxy for a child, which may lead to inaccurate reporting. Mean contacts are sensitive to a few participants who report many contacts, which we have addressed by assigning all reports of over 50 contacts to 50 contacts. Further research is needed to create standardised methods for analysing highly dispersed contact data, although a standardised approach may not be feasible as it may be context dependent. CoMix in context: The CoMix survey contributes to the growing study of social contacts and their implication in disease transmission. Studies prior to the COVID-19 pandemic provide a baseline of contacts in several countries which have been used to project estimates of contacts in other countries [26,27]. Many surv...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257973
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257944

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257944: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Eligible patients were adults aged 18 or older referred to the post-COVID-19 outpatient clinic who provided written informed consent for participation in a research registry and collection of their clinical data.<br>IRB: The study was approved by the institutional review board of the University of Iowa.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Qualitative CT image analysis was performed by an experienced, blinded radiologist (P.N.).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism or R statistical software (http://www.r-project.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>http://www.r-project.org</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: This is single center study, and thus the generalizability of our findings may be limited. Furthermore, we only evaluated symptomatic patients, and therefore cannot comment on the prevalence of lung function and imaging abnormalities among all COVID-19 survivors. Longitudinal assessment will be required to determine whether PASC-fSAD improves over time, or whether it leads to persist or progressive lung disease. Conclusions: Our study demonstrates that patients with PASC have a high prevalence of long-lasting air trapping by imaging, regardless of the initial severity of infection. Air trapping is often missed with spirometry but can be detected using inspiratory and expiratory CT imaging and plethysmography. Studies aimed at determining the natural history of PASC-fSAD and the biological mechanisms that underlie these findings are urgently needed in order to identify therapeutic and preventative interventions.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257944
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257936

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257936: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has some limitations. Since we used household transmission data in our analyses, the generation time for transmission outside the household may differ from our estimates. Future extensions to our approach may account for the possibility that more than one household member was infected in the same primary infection event or the potential for multiple sequential introductions of the virus into a household [37]. Allowing for multiple introductions may shorten estimates of the generation time, although any effect will dependent significantly on the community prevalence and the number of contacts that household members have with individuals in the community. In contrast, accounting for potential co-primary infections is likely to lead to higher estimates of the generation time. Other further work may include exploring heterogeneity in the generation time distribution between individuals and/or households with different characteristics. This could involve, but is not limited to, estimating the generation time distribution for individuals of different age, sex and ethnicity. In summary, we have inferred the SARS-CoV-2 generation time distribution in the UK using household data and two different transmission models. A key output of this research is one of the only estimates of the SARS-CoV-2 generation time outside Asia. Another crucial feature of our analysis is that it was based on data from beyond the first few months of the pandemic. Since this research suggests that th...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.05.27.21257936v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257954

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257954: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are limitations in the present study. First, we could not examine the actual vaccination behaviors of people who were nudged. It was reported that an increase in motivation does not always lead to an actual change in behaviors [37,38,39]. Whether motivation causes behavioral change is an important topic for future investigation. Second, although we identified an effective nudge message for young people with prosocial and empathetic orientation, we still do not have an effective way to nudge young people who have proself orientation. This too is worth future study. The third limitation is cultural differences regarding the majority. Because higher in-group conformity is known for Japanese people [40], it is necessary to examine whether messages emphasizing the majority is generally effective for young people in other cultures. Fourth, we did not include a direct question about the degree to which the participants perceived themselves to be at risk for COVID-19, although the perception of risk was reported as an important factor for determining vaccination attitudes [1,8,9]. We believe that the usual preventive attitudes against COVID-19 reflected risk perceptions and were strongly related to a willingness or refusal to be vaccinated (Tables 1 and 2). Fifth, we did not directly assess the trust of the information source about vaccines or the vaccines themselves. It was reported that this trust affects the willingness to be vaccinated [16,41]. However, we believe that the ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257954
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257938

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257938: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257938
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.27.446014

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.446014: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: SARS-CoV-2 specific antibody testing: ELISAs were conducted as previously described 30,74.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Umbilical cord blood was also collected at the time of birth from infants born to healthy mothers at GSTT prior to the COVID-19 pandemic (until 1st Jan 2020), hence their mothers were not infected with SARS-CoV-2 at any time during their pregnancy, termed the Non SARS-CoV-2 Exposed (NSE) group (REC Approval No. 17/LO/0641).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">N-specific monoclonal antibody), CR3022 (0.2 µg/ml)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data analysis: Raw FCS files were analysed using FlowJo (v10.6.2, BD) and the gating strategies are included in Extended Data Fig. 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism (v9.0) was also utilised to generate scatter plots for cytokines and the antibody heatmap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.27.446014
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446149

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446149: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trajectory analysis (analysis of root-mean-square fluctuations (RMSF), analysis of contacts (always with distance criterion of ≤5 Å between any pair of atoms; total fraction of contacts for residue pairs), measurement of interatomic distances, calculation of linear interaction energy (electrostatic and van der Waals interactions) was performed using the Amber tool cpptraj (37).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber</div><div>suggested: (AMBER, RRID:SCR_016151)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics and display: Statistical analyses were performed with GraphPad Prism (version 8.0.0 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com) and statistical tests were applied as indicated below the figure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots were created in GraphPad and Gnuplot (version 5.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Gnuplot</div><div>suggested: (Gnuplot, RRID:SCR_008619)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 8 and 16. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446149
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446155

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446155: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Donors provided written informed consent (Ethical approval: PV4780).<br>Euthanasia Agents: After 30 min mice were sacrificed by cervical dislocation and tissue samples were collected as described.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse model: C57Bl/6 mice of both sexes were anesthetized by intraperitoneal injection of ketamine (120 μg/g BW) and xylazine (16 μg/g BW in saline, 10 μl/g BW) and 50 μl ChAdOx1 nCov-19 vaccine were intradermally injected into the dorsal region.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse model: C57Bl/6 mice of both sexes were anesthetized by intraperitoneal injection of ketamine (120 μg/g BW) and xylazine (16 μg/g BW in saline, 10 μl/g BW) and 50 μl ChAdOx1 nCov-19 vaccine were intradermally injected into the dorsal region.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Design of primers and probe for digital PCR: PCR primers and probes were designed with Primer Express version 3.0.1 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Express</div><div>suggested: (Primer Express, RRID:SCR_014326)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446155
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446204

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446204: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000, Abcam GR268234-50), nd mouse antiFLAG M2 (1:1000, Sigma-Aldrich SLBT7654), rabbit anti-RPS2 (1:2000, Bethyl labs A303-794A-M), rabbit anti-RPS3 (1:500, Proteintech 11990-1-AP), rabbit anti-RPS24 (1:1000, Bethyl labs A303-842A-T), rabbit anti-RACK1 (1:1000, Bethyl labs A302-545A), HRP goat anti-mouse IgG (1:10,000 SouthernBiotech 1031-05) and HRP goat anti-rabbit IgG (1:10,000 SouthernBiotech 4030-05).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Vinculin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antiFLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RPS2</div><div>suggested: (Thermo Fisher Scientific Cat# A303-794A-M, RRID:AB_2781471)</div></div><div style="margin-bottom:8px"><div>anti-RPS3</div><div>suggested: (Proteintech Cat# 11990-1-AP, RRID:AB_2180758)</div></div><div style="margin-bottom:8px"><div>anti-RPS24</div><div>suggested: (Thermo Fisher Scientific Cat# A303-842A-M, RRID:AB_2781505)</div></div><div style="margin-bottom:8px"><div>anti-RACK1</div><div>suggested: (Antibodies-Online Cat# ABIN223360, RRID:AB_10849103)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (SouthernBiotech Cat# 4030-05, RRID:AB_2687483)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfections: HEK293T cells were grown in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum (Peak Serum) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ribosome purification: HeLa cell extract was prepared as described previously52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full-length nsp1 was synthesized as a gene fragment from Integrated DNA technologies (IDT) and cloned into the EcoR1 restriction site of pGEX-6P-2 (GE healthcare) using in-fusion cloning (TakaraBio).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6P-2</div><div>suggested: RRID:Addgene_131146)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A T7 promoter upstream of the human β-globin 5’ UTR or the SARS-CoV-2 leader fused to a nano luciferase (HBB-nLuc and CoV-2 leader-nLuc, respectively) was synthesized by Twist Bioscience then subcloned by in-fusion cloning into an EcoRI site in a pUC57 destination vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57</div><div>suggested: RRID:Addgene_40306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CoV-2 nsp1 was subcloned into the NotI site of pCDNA4-3X-FLAG-Halo using in-fusion cloning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA4-3X-FLAG-Halo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Truncation mutants Δ118-180 and Δ1-117 were PCR amplified from the parental vector pCDNA4-3x-FLAG-Halo-nsp1 and cloned as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA4-3x-FLAG-Halo-nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CoV-2-leader nLuc sequence was synthesized by IDT and similarly cloned into the pLJM1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLJM1</div><div>suggested: RRID:Addgene_73031)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the GFP cotransfection experiments, 1×106 cells were seeded into each well of a 6-well plate and transfected the next day with 100 ng of pCDNA-GFP and 900 ng of the indicated pCDNA4-3X-FLAG-Halo-nsp1 construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA-GFP</div><div>suggested: RRID:Addgene_160697)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the luciferase assays, 4.5×104 cells were seeded into each well of a 96-well plate and transfected the next day with 10 ng of HBB-nLuc or CoV2L-nLuc and 25 ng of the indicated C-terminally 3xFLAG tagged nsp1 (pCDNA4-nsp1-3xFLAG) construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA4-nsp1-3xFLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfections were carried out using PolyJet™ (SignaGen labs) according to the manufacturer’s DNA transfection protocol and cells were harvested 24 hr post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PolyJet™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunoprecipitations, cell pellets were lysed in 1 mL of lysis buffer (Buffer A) containing 20mM Tris-KOH pH 7.5, 150mM KOAc, 5mM MgCl2, 5% glycerol, 1X HaltTM protease inhibitor cocktail (ThermoFisher), 1mM DTT (Danville Scientific) and 0.5% NP-40 (Danville Scientific) and placed on a rotating wheel for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446204
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446020

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446020: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446020
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446159

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446159: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Mice experiments have been performed in the conventional animal facilities of the University of Bordeaux (France) (approval number of B-33-036-917), with the approval of institutional guidelines determined by the local Ethical Committee of the University of Bordeaux and in conformity with the Ministry for Higher Education and Research and the French Committee of Genetic Engineering (approval number n °17621 -V5-2018112201234223).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies and IF dilutions were used in this study; mouse monoclonal Ab anti-SARS-CoV-2-N clone 3G9 (this study, 1:500), rabbit monoclonal Ab anti-human Cytokeratin 5 (Abcam, ab52635, 1:200), rabbit polyclonal Ab anti-human Acetylated tubulin (Cell Signaling, D20G3, 1:200), rabbit polyclonal Ab anti-human ACE2 (Abcam, ab15348, 1:50)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human Cytokeratin 5 ( Abcam ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human Acetylated tubulin ( Cell Signaling , D20G3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (Abcam Cat# ab15348, RRID:AB_301861)</div></div><div style="margin-bottom:8px"><div>ab15348</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used in this study; cross absorbed Donkey anti-mouse Alexa Fluor 488 or 647 (Life technologies, A212020/A31571, 1:300) and cross absorbed Donkey anti-rabbit Alexa Fluor 594 (Life technologies, A31573, 1:300) as well as Alexa-Fluor 594 labeled phalloidin (Invitrogen, 1:500)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-31571, RRID:AB_162542)</div></div><div style="margin-bottom:8px"><div>A212020/A31571</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-31573, RRID:AB_2536183)</div></div><div style="margin-bottom:8px"><div>A31573</div><div>suggested: (Molecular Probes Cat# A-31573, RRID:AB_2536183)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cell lines: Vero E6 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal calf serum (FCS) and gentamicin (50μg/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was done using Image J software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 24, 32, 35 and 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446159
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.27.445991

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.445991: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All human subjects activities were approved by the Institutional Review Board at the University of Memphis under protocol 4316, and subjects provided informed consent prior to enrollment.<br>Consent: All human subjects activities were approved by the Institutional Review Board at the University of Memphis under protocol 4316, and subjects provided informed consent prior to enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As we have previously described 88, this procedure results in a highly pure (> 85%) population of classical monocytes, with depletion of intermediate and non-classical monocytes due to the presence of an anti-CD16 antibody in the cocktail.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma samples were analyzed in duplicate at 10× (ACE2) or 10,000× (CRP) using commercial DuoSet matched-antibody reagent kits (R&D Systems) according to manufacturer’s instructions and assessed against a standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.27.445991
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.27.445500

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.445500: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.27.445500
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257916

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257916: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257916
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257713

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257713: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of this study is that we only possess prior patient information from previous discharge summaries at UHS, and, hence only have patient histories for 55% of our recorded attendances. Including patient histories from their non-emergency and routine treatment would enable even more predictive early warning modelling.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257713
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257774

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257774: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To be able to grasp potential daily differences among contents, a sample was selected by stratified random sampling proportioned to the daily number of tweets.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collected via software developed by a researcher in Python programming language using open-source libraries and Twitter Application Programming Interface (API) (12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A number of potential limitations need to be considered in our research. We actually conducted the content analysis in Turkish then translated to English. The meaning of the original tweets and the misspellings may be lost in translation. Also, this research included tweets in a specific time period as during the delivery of the first batch of vaccines to Turkey. On the other hand, it doesn’t include the time during vaccination. Our research is also limited by our keywords. Since we collected the tweets by our keywords, we might not catch complex versions of the vaccine’s name. Finally, our research was limited to Twitter. In conclusion, it is well known that vaccine hesitancy and anti-vaccination attitudes may negatively affect the population’s health, especially during a pandemic, and contents of the social media is an important source of early information about such attitudes. Analysis of the social media message contents may be helpful for health managers to identify the major issues and also to organize the preventive measures.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257774
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257835

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257835: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of this analysis is that we do not have any indication regarding the date of the infection or of the symptom onset. This uncertainty prevents us from analyzing more mechanistic models with nonlinear mixed-effect models [10]. However, since we the nature of the virus causing the infection is unlikely to affect the number of days between infection and screening, we do not expect our assumption that the lowest Ct value corresponds to the peak viral load to introduce biases. Furthermore, the variant assessment for V2/V3 should be treated with caution because it only relies on the N501Y mutation. However, the assessment of the V1 variant is robust. Combining longitudinal Ct data and sequencing data [19] could be a way to improve the resolution of the analyses. Another future extension of this approach will be to combine Ct data with serological data analyse the immune evasion properties of V2 and V3 variants [5, 6].
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04653844</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">RT-PCR Database Analysis for COVID-19 Infections and Re-infe…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257835
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257834

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257834: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study is conformed to Helsinki’s Declaration and was approved by the ethics committee Milano Area 3 (register number 249-13052020).<br>Consent: An informed consent was provided by the enrolled participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The estimated size of the validation sample for a one-sample two-sided mean test was 351 to achieve 80% power if the mean difference between C-statistics 0.03 with standard deviation 0.20, and the type I error 0.05 were assumed.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the analyses were performed using Stata Statistical Software Release 15 (StataCorp. 2017, College Station, TX: StataCorp LLC) and R (R Core Team 2018, R Foundation for Statistical Computing, Vienna, Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. First, it was developed by using a case-control design and case analysis and data collection were retrospective and unblinded. However, since hard outcome and predictors like the detection of SARS-CoV-2 genome in the nasopharyngeal swab and age were used, a limited impact of bias on predictions may be assumed. Secondly, predictors like communal living and history of contact with a person diagnosed of SARS-CoV-2 infection were unmeasured, even though their relevance for diagnostic predictions has been still to be determined. Finally, the discriminatory ability of the models makes the overall performance still suboptimal and its implementation to calculate the individual risk of infection should not be used without additional investigations. However, it could be considered to evaluate the spatial allocation of the patients while awaiting the result of the nasopharyngeal swab, which is still the current reference standard for the diagnosis of SARS-Cov-2 infection. In conclusion, the development and validation of these models showed that prediction tools based on clinical findings like history of fever, age, and oxygen saturation at presentation may be accurate and robust to identify patients at high risk for a diagnosis of SARS-CoV-2 infection. Future external validation studies should be considered to evaluate if such models will be also robust to variable outcome prevalence, particularly in low proportions of infection, and to search for add...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257834
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257096

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257096: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All patients provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Objectives and Oversight: This phase 3, randomized, double-blind, multicenter, placebo-controlled study is evaluating a single intravenous infusion of sotrovimab 500 mg for the prevention of progression of mild/moderate Covid-19 in high-risk, nonhospitalized patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculations were based on a group sequential design with two interim analyses to assess both futility due to lack of efficacy or profound efficacy.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Safety Assessments: Safety endpoints included adverse events, serious adverse events, and adverse events of special interest, defined as infusion-related reactions (including hypersensitivity reactions), immunogenicity testing for anti-drug antibodies, and evaluation of antibody-dependent enhancement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-drug</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-dependent enhancement.</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This interim report has three major limitations. First, with only three hospitalizations in the sotrovimab group, it is not possible to determine which patient or disease characteristics might be associated with sotrovimab treatment failure. Second, the safety dataset was moderate in size (430 patients) and thus a rare (much less than 1%) adverse event may not have been observed, though one would not be expected as sotrovimab was derived from an antibody isolated from a recovered SARS-CoV patient, has minimal engineering, and targets a viral epitope (not a host epitope). Third, secondary and exploratory endpoint analyses are excluded from this interim report since the study is ongoing; such analyses are needed to further determine the potential additional benefits of sotrovimab. This study has two key scientific and medical ramifications, beyond demonstrating the therapeutic value of sotrovimab. First, the results indicate that a non–receptor-binding motif binding antibody, which does not directly block the ACE2 receptor interaction, can be clinically therapeutic, and suggests a role for other receptors.27 Second, as sotrovimab has potent effector function, the absence of safety signals and profound efficacy strongly suggest that effector function is neither detrimental nor associated with antibody-dependent enhancement.26 In fact, preclinical models of Covid-19 suggest that its potent effector function may be beneficial.13,14 In conclusion, results from this interim analysis...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04545060</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">VIR-7831 for the Early Treatment of COVID-19 in Outpatients</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257096
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21254613

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21254613: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21254613
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.29.443900

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.29.443900: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Research protocol was approved and performed in accordance with Scripps Research IACUC Protocol #20-0003.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, yeast cells were stained with FITC-conjugated chicken anti-C-Myc antibody (Immunology Consultants Laboratory, CMYC-45F), AF405-conjugated anti-V5 antibody (made in house), and streptavidin-APC (Invitrogen, SA1005) in 1:100 dilution for 20 min at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-C-Myc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SA1005</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the neutralization assay, antibody samples were serially diluted with complete DMEM medium (Corning, 15-013-CV) containing 10% FBS (Omega Scientific, FB-02), 2 mM L-Glutamine (Corning, 25-005-Cl), and 100 U/mL of Penicillin/Streptomycin (Corning, 30-002-C).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>25-005-Cl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, alkaline phosphatase-conjugated goat anti-human IgG Fcy secondary antibody (Jackson ImmunoResearch, 109-055-008) was added in 1:1000 dilution and incubated for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal study: Groups of twelve 6-8 week old Syrian hamsters were put into 6 treatment groups who each received an intraperitoneal (i.p.) infusion of either 10 mg, 2 mg, 0.5 mg, or 0.125 mg per animal of the eCR3022.7 monoclonal antibody or 10 mg per animal of the parental CR3022 monoclonal antibody or 10 mg per animal of an anti-dengue isotype matched control antibody (Den3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dengue isotype matched control</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Den3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast cells were firstly spun down and washed with PBS/1% BSA, then incubated with biotinylated SARS-CoV-2 RBD or S or HEK cell membrane protein at several non-depleting concentrations respectively for at least 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the mixture was transferred onto HEK 293T cells (ATCC, CRL-3216) in a 10 cm2 culture dish (Corning, 430293).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, 50 μL of Hela-hACE2 cells were added at 10,000 cells/well onto each well of the plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 neutralization assay: Vero E6 cells were seeded in 96-well half-well plates at approximately 8000 cells/well in a total volume of 50 μL complete DMEM medium the day prior to the addition antibody and virus mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEp2 epithelial cell polyreactive assay: Reactivity to human epithelial type 2 (HEp2) cells was determined by indirect immunofluorescence on HEp2 slides (Hemagen, 902360) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEp2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homogenized organs were titrated 1:10 over 6 steps and layered over Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The libraries were displayed on the surface of yeast as molecular Fab using the pYDSI vector, a yeast display vector containing the bidirectional Gal1-10 promoter that was based on the design of a previously described vector (Wang et al., 2018), omitting the leucine-zipper dimerization domains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYDSI</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 12.5 μg of MLV gag/pol backbone (Addgene, 14887), 10 μg of MLV-CMV-Luciferase plasmid, and 2.5 μg of SARS-CoV-2-d18 spike plasmid were incubated with transfection reagent Lipofectamine 2000 (Thermo Fisher, 11668027) following manufacturer’s instructions for 20 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MLV-CMV-Luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the heavy and light chains were cloned into phCMV3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired FASTQs were checked for sequence quality using the FastQC package (FastQC v0.11.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Merged reads with full sequence identity were clustered using VSEARCH (v2.15.1) (Rognes et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSEARCH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pacbio sequencing: Long Amp Taq Polymerase (New England Biolabs) was used to PCR amplify Plasmid DNA after sort 4 according to manufacturer’s protocol with the following primers: First round PCR products were purified with SPRI beads (Beckman Coulter) and 10 uL of purified PCR product was used in a second round of index PCR with the following primers: DNA sample was again purified with SPRI beads, then submitted to GeneWiz, where a PacBio SMRTbell amplicon library was prepared per the manufacturer’s protocol and sequenced on the PacBio Sequel platform with v3.0 chemistry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence data that support the findings in this study are available at the NCBI Sequencing Read Archive (www.ncbi.nlm.nih.gov/sra) under BioProject number PRJNAXXXXXX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequencing Read Archive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python code will be available on github.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50 values were calculated using “One-Site Fit LogIC50” regression in GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, we plotted a standard curve of serially diluted virus (3000, 1000, 333, 111, 37, 12, 4, 1 PFU) versus RLU using four-parameter logistic regression (GraphPad Prism 8.0) below:
  
  (y: RLU, x: PFU, a,b,c and x0 are parameters fitted by standard curve) To convert sample RLU into PFU, use the equation below: (if y < a then x = 0)
  
  Percentage neutralization was calculated by the following equation:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (Emsley et al., 2010) and PHENIX (Adams et al., 2010), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 26. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.29.443900
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257548

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257548: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Oro-nasopharyngeal swab collection and SARS-CoV-2 PCR testing: A sequential oropharyngeal and nasopharyngeal sampling with each single swab was performed.<br>Consent: All participants were provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the nasopharyngeal sampling, Cobas PCR Media swabs sample kit and 3D printed swab were used in the same nostril in a randomized order.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257548
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257890

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257890: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical considerations: The survey was approved by the San Antonio Abad del Cusco National University ethics committee (#007-2020-CBI-UNSAAC).<br>Consent: All the survey participants were well-versed on the study intentions and were required to consent before the enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We surveyed general public who were adults of both genders aged 20 to 70 years in five districts of Cusco, Peru with high-risk COVID-19 transmission according to the Epidemiological Alert AE- 017-2020 (44).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">It was determined that a minimum sample size of 1,530 was necessary to achieve a minimum percentage difference of 2.5% (49.0% versus 51.5%), a statistical power of 80%, and a confidence level of 95% (data not shown).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes and Covariates: The survey (Annex 1) included 11 questions, 5 were demographic questions, 2 were related to the use of medicinal plants as preventive or treatment of respiratory symptoms related to COVID-19, 2 were related to the diagnosis of COVID-19 in themselves and the close environment (family and friends), and the last 2 questions related to the medicinal plants were used and to what respiratory symptom(s) they were used for.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was done in STATA version 14</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257890
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.31.446421

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.446421: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse immunization, B-cell enrichment and hybridoma generation: Mouse immunizations were performed at Abveris (Canton, MA) in accordance with all IACUC protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 receptor blocking activity was interrogated by forming an antibody:S1 protein complex on the chip surface in a sequential format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody:S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma cells exhibiting on-Beacon binding profiles of interest were exported for immunoglobulin sequence capture and analysis with the Geneious Biologics software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious Biologics</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.31.446421
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21257989

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21257989: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A SARS-CoV-2 viral stock (1.5 × 103 TCID50/mL) was exposed to the UV-doses reported in Table 1 and an in vitro infection assay was performed on 1×105 Vero E6 cells grown on a 13mm glass coverslip (0.17mm thickness) as described in the previous section.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">By using a motorized stage (Mad City Labs GmbH, Schaffhauserstrasse, CH), mosaic of 6×6 fields of views were collected and then stitched using the Image Stitching ImageJ plugin27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting large fields of view (approx. 3mm of side) were then scaled by a factor 0.25 in FiJi28 and then imported in Matlab for image analysis using a custom-written routine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using two-way ANOVA test by GRAPHPAD PRISM version 5 (Graphpad software, La Jolla, Ca, USA), and p-values of 0.05 or less were considered to be significant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21257989
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257860

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257860: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: 2.1 Study design and sample collection: Following written informed consent, heparinized blood samples from hemodialysis patients were taken before start of dialysis using the vascular access which was either an arterio-venous fistula or a central venous catheter or by venipuncture from health care workers (control).<br>IRB: 2.2 Ethics statement: The study was approved by the Internal Review Board of Hannover Medical School (MHH, approval number 8973_BO-K_2020).<br>Field Sample Permit: 2.10 Role of the funders: This work was financially supported by the Initiative and Networking Fund of the Helmholtz Association of German Research Centers (grant number SO-96), the EU Horizon 2020 research and innovation program (grant agreement number 101003480 - CORESMA) and the State Ministry of Baden-Württemberg for Economic Affairs, Labor and Tourism (grant numbers FKZ 3-4332.62-NMI-67 and FKZ 3-4332.62-NMI-68).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As subsequent antibody testing was negative for SARS-CoV-2 IgG, this patient received BNT162b2 and was not excluded from our study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected following a 45 min incubation at 21°C with R-phycoerythrin labeled goat-anti-human IgG (Jackson ImmunoResearch Labs, United Kingdom, Cat# 109-116-098, Lot# 148837, RRID: AB_2337678, used at 3 µg/mL) or IgA (Jackson ImmunoResearch Labs, Cat# 109-115-011, Lot# 143454, RRID: AB_2337674, used at 5 µg/mL) as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R-phycoerythrin labeled goat-anti-human IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 109-115-011, RRID:AB_2337674)</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>detected: (Jackson ImmunoResearch Labs Cat# 109-116-098, RRID:AB_2337678)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were exported from Rstudio and then edited using Inkscape (Inkscape 0.92.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div><div style="margin-bottom:8px"><div>Inkscape</div><div>suggested: (Inkscape, RRID:SCR_014479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-processing of data such as matching sample metadata and collecting results from multiple assay platforms was performed in Excel 2016.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. While we have a reasonable sample size (81 dialysis patients), which is similar or even larger compared to several other studies (12, 13, 25), our control group is not age- and gender-matched. In addition, we evaluated only one of the currently approved SARS-CoV-2 vaccines with samples from a single dialysis center and did not perform in-depth immune phenotyping or assessment of SARS-CoV-2 responsive T-cell frequencies. We also lack paired saliva and plasma samples pre- and post first dose to characterize B- and T-cell response kinetics or assess potential cross-reactivity of endemic CoV antibodies in immunocompromised individuals across the dosing scheme. However, all of our samples were collected at the same time and following an identical dosing regimen, allowing us to make a direct comparison between our two groups of interest (dialyzed versus non-dialyzed). Additionally, the lack of previously infected samples within our study groups, means we are studying only the vaccine-induced response. Taken together, we provide robust evidence that a completed two-dose regimen of BNT162b2 elicits both antibody and T-cell responses in patients on maintenance dialysis towards the SARS-CoV-2 B.1 isolate. Future studies are needed to assess the lifespan and long-term kinetics of the vaccination response. As neutralization is reduced in dialyzed patients towards all VoCs examined, our data also highlights the need to monitor if infection with SARS-CoV-...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257860
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257931

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257931: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study also has several limitations. First, we did not directly measure the proportions of cases that effectively isolated and contacts that correctly quarantined. In the absence of data suggesting otherwise, we assumed cases and contacts fully comply with isolation and quarantine guidance they received via their interactions with health departments. As such, our results may overestimate the absolute impact of CICT (and underestimate the effectiveness of NPIs), with our lower effectiveness results likely approximating real impacts more closely. Our conclusions, however, regarding the relative influence of CICT measures are not affected by this limitation. Additionally, our maximum estimates of effectiveness offer insight into the potential benefits from high public compliance with quarantine guidance. Nevertheless, there is obvious need for additional research to improve our understanding of the actual efficacy of isolation and quarantine, based on public compliance, the role of health departments in motivating such, as well as practical limitations (e.g., inadequate sick leave, caregiving responsibilities). Lastly, we do not know whether Exposure Notification (EN) Apps (i.e., smartphone-enabled contact tracing apps) were utilized by locations during the observation period we analyzed, and if so, how their use would have affected our results. A second limitation is we assumed that the effectiveness of CICT and NPIs remained constant over a 60-day period. Since we were abl...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257931
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257868

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257868: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Testing was performed at variable times following symptom onset, Ethical approval for this study was granted by Biotechnology Research Center Bioethics committee and informed consent was taken from all participants.<br>Consent: Testing was performed at variable times following symptom onset, Ethical approval for this study was granted by Biotechnology Research Center Bioethics committee and informed consent was taken from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted sample was applied on a cassette and allowed to react with a monoclonal anti-SARS-CoV-2 antibody, after a 15-30-min incubation, for the presence or absence of bands and its intensity following antigen-antibody reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Sensitivity, specificity, positive and negative predictive values and accuracy were calculated using MedCalc online statistical software (“MedCalc’s Diagnostic test evaluation calculator,” n.d.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. First, the sample size was small for each individual antigen test kit. Second, because the data was collected prospectively based on presence of symptoms or history of contact with infected patient, it was difficult to select patients with different Ct values in enough size. However, if we assumed that the performance of all antigen kits was similar, the data would reliable enough to give credible results. Antigen testing performance is mostly affected by symptoms duration, viral load, manufacturing company, operator experience and qualification. In addition, new SARS-COV-2 variants may alter the performance especially with spike proteins targeted antigen tests (Li et al., 2020; Mahase, 2020). In conclusion, rapid antigen tests have high sensitivity and specificity in early disease when patients present before 7 days of symptom onset. Patients are encouraged to test as soon as they get COVID-19 related symptoms within 1 week and to seek medical advice within 24 hrs. if they develop disturbed smell/taste. The use of rapid antigen tests is important for controlling COVID-19 pandemic and reducing burden on molecular diagnostic laboratories.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257868
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257952

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257952: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data were subjected to QC analyses using the FastQC tool (version 0.11.9) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mRNA-seq read quality control was done using Trimmomatic15 (version 0.36) and STAR RNA-seq16 (version STAR 2.5.4a) using 150 bp paired-end mode was used to align the reads (hg19).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: The findings in this report are subject to several limitations. Our study focused on hospitalized patients in a specific geographic area. Our study focused on elderly patients with limited comparison to younger individuals. We have investigated the effect of the BNT162b vaccine but not of any other vaccine.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.27.21257952
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.28.21258006

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.21258006: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was conducted in compliance with the protocol and ethical approval was obtained from the institutional ethical committee (CTRI/2020/05/025494).<br>Consent: Before taking the survey, the respondents signed a consent document stating that they had provided their informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analyzed using the latest version of SPSS software (Version 23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.28.21258006
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446163

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446163: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Near infra-red (NIR) secondary antibodies, IRDye® 680RD Goat anti-mouse (abcam; ab216776) and IRDye® 800CW Goat anti-rabbit (abcam; ab216773) were subsequently used to probe membranes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was isolated by inoculating 100 μL of neat swab material onto Vero cells, incubating at 37°C for 1 h before replacing with growth media supplemented with 1x penicillin/streptomycin and 1x amphotericin B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolates were passaged a further two times in Vero E6-ACE2-TMPRSS2 cells (17), the supernatant clarified by centrifugation and concentration for western blot analysis viruses by centrifuging in an Amicon® Ultra-15 Centrifugal Filter Unit followed by an Amicon® Ultra-0.5 Centrifugal Filter Unit with 50 kDa exclusion size.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446163
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446179

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446179: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy: HEK293T cells were seeded on an 18 mm diameter coverslip and transiently transfected with the constructs mentioned above (Results and Fig. 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was subcloned in the pFastBac1 (for Sf9 expression) and pEG-BM (for HEK293 expression) vectors and baculovirus was generated according to the bac-to-bac baculovirus expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEG-BM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Colors were added to signals post-acquisition using default look-up tables in Fiji software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electrophysiology: Whole-cell patch clamp recordings were performed using an EPC-10 amplifier and Patchmaster software (HEKA Elektronik; Lambrecht/Pfalz, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Patchmaster</div><div>suggested: (Patchmaster, RRID:SCR_000034)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although several articles and preprints in the past year74,79–84 have reported simulations of this structure, a review of their results shows similar limitations, with abbreviated timescales,80–82 reliance on secondary-structure restraints,74 elevated RMSDs,74,80 and/or dewetting in the absence of electric fields.74 Instability of the open structure may reflect underdetermination of the starting protein or membrane models, unresolved interactions with the C-terminal or other domains, or other factors yet to be identified. Taken together, we have shown that recombinantly expressed full-length E protein from SARS-CoV-2 is capable of independent multimerization, possibly as a tetrameric or smaller species. We also confirmed that the protein localizes intracellularly, similar to its predecessor from SARS-CoV, with no evidence of ion channel properties at the cell surface. Our coarse-grained simulations further support a role for the E protein in viral budding, as the presence of the protein bends the surrounding membrane. Reduction of intracellular Ca2+ in E-protein-transfected cells may further promote viral replication. However, our atomistic simulations and permeation calculations based on previously reported NMR structures resulted in unstable proteins incapable of Ca2+ conduction. We emphasize the importance of using high-resolution structural data obtained from a full-length protein to gain detailed molecular insight of the E protein, and enable future drug-screening effort...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446179
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.31.21258081

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.31.21258081: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional Review Board (IRB) approval was given by the Sheba Medical Center’s IRB (7156/20).<br>Consent: Written informed consent was received from each participating individual before recruitment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: A randomized controlled, double blinded trial to evaluate the effectiveness of ivermectin in reduction of viral shedding among mild to moderate COVID-19 patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: A randomized controlled, double blinded trial to evaluate the effectiveness of ivermectin in reduction of viral shedding among mild to moderate COVID-19 patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In-Vitro cultures: Positive samples were stored at -80°C and were thawed for culturing on Vero E6 cells at 37°C for seven days, as detailed in the Supplementary methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As the authors mentioned in their limitations, reduction in the viral load or viral shedding better reflects the anti-viral activity of the drug rather than longevity of symptoms[23]. Peer reviewed randomized control trials from Bangladesh support our finding of faster viral clearance in the ivermectin group, and in a small RCT from Spain, treatment with ivermectin showed a tendency toward faster viral clearance.[24, 25] One may wonder about the public health benefit of treating mild patients since shortening the period of relatively mild symptoms may not merit a mass drug administration of ivermectin to the large population of non-hospitalized patients. However, inducing faster viral clearance and therefore reducing the time until the patient reaches a state of being non-infectious have an extremely important public health impact. Taking the two composites; Ct values above 30 and negative cultures, leads to almost 90% non-infectious status at day four (one day after ending treatment) among ivermectin users []. From the public health point of view, it may shorten isolation time, which can serve as a major relief of the economic and social burden. Our study has several limitations. First, the sample size was relatively small, and was designed to look for differences in viral load, but not for clinical deterioration and prevention of hospitalization. The second limitation was that drug therapy was not physically observed by investigators. Finally, our study was conducted among ...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT044297411</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04429711</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ivermectin vs. Placebo for the Treatment of Patients With Mi…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.31.21258081
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.27.21257889

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.27.21257889: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ArcMap 10.7 was used for geospatial analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArcMap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">11 The SVI has been applied to research on COVID-19 in the U.S.,12,13,14 and has been adapted into other metrics such as Snyder and Parks’ socio-ecological vulnerability index,15 and the Pandemic Vulnerability Index developed for the NIH by Marvel and colleagues.16 In this study, we used the SVI and its component “themes” as proxies for the various forms of social, economic, and political marginalization that are historically embedded and spatially heterogeneous across the U.S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Marvel</div><div>suggested: (Marvel , RRID:SCR_017621)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: We identified several limitations of our study. First, we relied on national data reported by thousands of localities, which inevitably introduced bias. Many cases and deaths were geographically non-specific, or specific to geographies that were not classified under the U.S. county system. For example, the majority of the state of Utah was not represented in this study because the reported data were not specific to county-level geographies. Furthermore, our results are likely biased by underreporting of cases by localities and states; in addition, we were unable to account for disparities in testing that would differentially deflate incidence estimates. We likely also underestimated mortality, based on studies showing significant underreporting of COVID-19 mortality in the U.S.26 Secondly, our county-level analysis is subject to ecological bias; observations of county-level CI and CFR are unable to fully capture individual or even community-level disease transmission phenomena. This bias could have been reduced with data at the ZIP code or census tract levels, which were not publicly available because of ethical and welfare concerns with COVID-19 data privacy. Third, the variable sizes of U.S. counties may have negatively impacted the validity of Getis-Ord Gi* hot spot analysis,27 though the optimization algorithms performed in OHSA may have helped to account for this problem. Fourth, SVI is a composite metric, and it does have advantages in assessing many differ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.05.27.21257889v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.28.446200

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.28.446200: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse strains: The animal’s experimental procedures were carried out with mixed groups (males and females) of mice aged 6 to 7 weeks and received the approval of the Ethical Committee for Animal Experimentation of the Universidade Federal de Minas Gerais (UFMG) (process No. 190/2020).<br>Euthanasia Agents: MHV-3 infection: Mice were lightly anesthetized with an intraperitoneal injection of ketamine (50 mg/kg): xylazine (5 mg/kg) and received an intranasal inoculation of 30 μl sterile saline solution loaded or not (Mock controls) with MHV-3 at different concentrations (3×101 to 3×104 PFU).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse strains: The animal’s experimental procedures were carried out with mixed groups (males and females) of mice aged 6 to 7 weeks and received the approval of the Ethical Committee for Animal Experimentation of the Universidade Federal de Minas Gerais (UFMG) (process No. 190/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The inflammation-mediated injury in mouse lungs was determined by a pathologist (C.M.Q.J) blinded to the experiment, by employing a scoring system encompassing: (i) airway inflammation (up to 4 points); (ii) vascular inflammation (up to 4 points); (iii) parenchyma inflammation (up to 5 points); and general neutrophil infiltration (up to 5 points) (40).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following permeabilization in PBS / 0,5% Triton X-100, the cryosections were incubated for 1 h in the blocking solution (PBS containing 5% goat serum and 5 μg/mL mouse BD Fc Block™) and then labeled overnight at 4°C with the APC-conjugated rat anti-mouse CD45 antibody (1:100 dilution, BD Pharmingen, cat No. 559864).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1×106 cells were blocked with mouse BD FC block™ (5 μg/mL, BD Pharmingen, Cat No. 553141) and then stained using fluorescent-labeled monoclonal antibodies as follows: Ly6G-BV421 (1:200, BioLegend, Cat No. 127627); CD45-FITC (1:200</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ly6G-BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pre-synaptic and post-synaptic terminals were stained using the monoclonal anti-synaptotagmin antibody (1:250 dilution, Developmental Studies Hybridoma Bank; cat No. 3H2 2D7) and the tetramethylrhodamine-conjugated α-bungarotoxin (1:1000 dilution; Invitrogen, cat No. T1175), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-synaptotagmin</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-46358, RRID:AB_1090909)</div></div><div style="margin-bottom:8px"><div>α-bungarotoxin</div><div>suggested: (Thermo Fisher Scientific Cat# B35451, RRID:AB_2617152)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, viruses and plaque assay: Vero E6 (ATCC® CRL-1586), L929 (ATCC® CCL-1), and Calu-3 (ATCC® HTB-55) cells were cultured under a controlled atmosphere (37aC, 5% CO2) in high glucose DMEM (Vero and L929) or MEM (Calu-3) supplemented with 7% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The levels of IL-6 (cat. No. DY206), IL-8 (cat. No. DY208) and TNF-α (cat. No. DY210) were quantified in the supernatants from uninfected and SARS-CoV-2-infected Calu-3 cells by ELISA (R&D Systems), following manufacturer’s instructions, and results are expressed as n-fold relative to uninfected cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type C57BL/6 (Central Animal House of the UFMG) and TNF receptor Knockout mice (TNFRp55-/-, Jackson Laboratories, stock No. 002818) were housed in individually ventilated cages placed in an animal care facility at 24 ± 2 °C on a 12-h light/ 12-h dark cycle, receiving ad libitum access to water and food.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On the fourth-day post infection, mice were euthanized, the dataloggers were collected and the body temperature readings of each animal were downloaded and analyzed (SubCue software, Calgary, AB, Canada).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The acquisition was carried out in a BD FACSCanto II cell analyzer and analyzed using FlowJo software (Tree Star, Ashland, OR)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As well as other animal models already proposed for COVID-19 study, the MHV-3 model also has its limitations. One of them is the difference in the host cell receptor used for viral entry. MHV-3 uses the CEACAM-1 receptor (32) whereas SARS-CoV-2 uses ACE2 (33), which may preclude studies of viral entry or drugs that act on this stage of the replication cycle. Another important limitation is the strong viral tropism towards liver cells and the impairment of the function of this organ in late time of infection. However, our results demonstrating significant lung damage and impairment of pulmonary functions following the first days after infection make our model quite useful to study coronavirus-associated lung inflammation and injury.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 35 and 37. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.28.446200
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.26.21257849

1
1. sciscore 03 Jun 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.26.21257849: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the University of the Witwatersrand Human Research Ethics Committee (Reference 150808) and the US Centers for Disease Control and Prevention relied on local clearance (IRB #6840).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study population: We conducted a prospective study on a randomly selected household cohort in a rural (Agincourt, Ehlanzeni District, Mpumalanga Province) and an urban (Jouberton, Dr Kenneth Kaunda District, North West Province) community as part of the PHIRST-C study (a Prospective Household study of SARS-CoV-2, Influenza, and Respiratory Syncytial virus community burden, Transmission dynamics and viral interaction in South Africa).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed in Stata 14 (StataCorp, College Station, Texas, USA), using six age groups: pre-school (<5 years), primary school (5-12 years), secondary school (13-18 years), young adults (19-34 years), adults (35-59 years) and older adults (≥60 years) who are prioritised for SARS-CoV-2 vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.26.21257849

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL