10,000 Matching Annotations
  1. Aug 2024
    1. Reviewer #2 (Public Review):

      Summary:

      Here, the authors studied the molecular mechanisms by which the chemoreceptor cluster and flagella motor of Pseudomonas aeruginosa (PA) are spatially organized in the cell. They argue that FlhF is involved in localizing the receptors-motor to the cell pole, and even without FlhF, the two are colocalized. FlhF is known to cause the motor to localize to the pole in a different bacterial species, Vibrio cholera, but it is not involved in receptor localization in that bacterium. Finally, the authors argue that the functional reason for this colocalization is to insulate chemotactic signaling from other signaling pathways, such as cyclic-di-GMP signaling.

      Strengths:

      The experiments and data look to be high-quality.

      Weaknesses:

      However, the interpretations and conclusions drawn from the experimental observations are not fully justified in my opinion.

      I see two main issues with the evidence provided for the authors' claims.

      (1) Assumptions about receptor localization:

      The authors rely on YFP-tagged CheY to identify the location of the receptor cluster, but CheY is a diffusible cytoplasmic protein. In E. coli, CheY has been shown to localize at the receptor cluster, but the evidence for this in PA is less strong. The authors refer to a paper by Guvener et al 2006, which showed that CheY localizes to a cell pole, and CheA (a receptor cluster protein) also localizes to a pole, but my understanding is that colocalization of CheY and CheA was not shown. My concern is that CheY could instead localize to the motor in PA, say by binding FliM. This "null model" would explain the authors' observations, without colocalization of the receptors and motor.

      Verifying that CheY and CheA are colocalized in PA would be a very helpful experiment to address this weakness.

      (2) Argument for the functional importance of receptor-motor colocalization at the pole:

      The authors argue that colocalization of the receptors and motors at the pole is important because it could keep phosphorylated CheY, CheY-p, restricted to a small region of the cell, preventing crosstalk with other signaling pathways. Their evidence for this is that overexpressing CheY leads to higher intracellular cdG levels and cell aggregation.

      Say that the receptors and motors are colocalized at the pole. In E. coli, CheY-p rapidly diffuses through the cell. What would prevent this from occurring in PA, even with colocalization?

      Elevating CheY concentration may increase the concentration of CheY-p in the cell, but might also stress the cells in other unexpected ways. It is not so clear from this experiment that elevated CheY-p throughout the cell is the reason that they aggregate, or that this outcome is avoided by colocalizing the receptors and motor at the same pole.

      If localization of the receptor array and motor at one pole were important for keeping CheY-p levels low at the opposite pole, then we should expect cells in which the receptors and motor are not at the pole to have higher CheY-p at the opposite pole. According to the authors' argument, it seems like this should cause elevated cdG levels and aggregation in the delta flhF mutants with wild-type levels of CheY. But it does not look like this happened.

      Instead of varying CheY expression, the authors could test their hypothesis that receptor-motor colocalization at the pole is important for preventing crosstalk by measuring cdG levels in the flhF mutant, in which the motor (and maybe the receptor cluster) are no longer localized in the cell pole.

    1. Reviewer #2 (Public Review):

      Summary:<br /> A strong case is presented to establish that the endoplasmic reticulum carbohydrate binding protein malectin is an important factor for coronavirus propagation. Malectin was identified as a coronavirus nsp2 protein interactor using quantitative proteomics and its importance in the viral life cycle was supported by using a functional genetic screen and viral assays. Malectin binds diglucosylated proteins, an early glycoform thought to transiently exist on nascent chains shortly after translation and translocation; yet a role for malectin has previously been proposed in later quality control decisions and degradation targeting. These two observations have been difficult to reconcile temporally. In agreement with results from the Locher lab, the malectin-interactome shown here includes a number of subunits of the oligosaccharyltransferase complex (OST). These results place malectin in close proximity to both the co-translational (STT3A or OST-A) and post-translational (STT3B or OST-B) complexes. It follows that malectin knockdown was associated with coronavirus Spike protein hypoglycosylation.

      Strengths:<br /> Strengths include using multiple viruses to identify interactors of nsp2 and quantitative proteomics along with multiple viral assays to monitor the viral life cycle.

      Weaknesses:<br /> Malectin knockdown was shown to be associated with Spike protein hypoglycosylation. This was further supported by malectin interactions with the OSTs. However, no specific role of malectin in glycosylation was discussed or proposed.

      Given the likelihood that malectin plays a role in the glycosylation of heavily glycosylated proteins like Spike, it is unfortunate that only 5 glycosites on Spike were identified using the MS deamidation assay when Spike has a large number of glycans (~22 sites). The mass spec data set would also include endogenous proteins. Were any heavily glycosylated endogenous proteins hypoglycosylated in the MS analysis in Fig 5D?

      The inclusion of the nsp4 interactome and its partial characterization is a distraction from the storyline that focuses on malectin and nsp2.

    1. Reviewer #2 (Public Review):

      The study by Chen, Deng et al. aims to develop an efficient viral transneuronal tracing method that allows efficient retrograde tracing in the larval zebrafish. The authors utilize pseudotyped-rabies virus that can be targeted to specific cell types using the EnvA-TvA systems. Pseudotyped rabies virus has been used extensively in rodent models and, in recent years, has begun to be developed for use in adult zebrafish. However, compared to rodents, the efficiency of the spread in adult zebrafish is very low (~one upstream neuron labeled per starter cell). Additionally, there is limited evidence of retrograde tracing with pseudotyped rabies in the larval stage, which is the stage when most functional neural imaging studies are done in the field. In this study, the authors systematically optimized several parameters of rabies tracing, including different rabies virus strains, glycoprotein types, temperatures, expression construct designs, and elimination of glial labeling. The optimal configurations developed by the authors are up to 5-10 fold higher than more typically used configurations.

      The results are solid and support the conclusions. However, the methods should be described in more detail to allow other zebrafish researchers to apply this method in their own work.

      Additionally, some findings are presented anecdotally, i.e., without quantification or sufficient detail to allow close examinations. Lastly, there is concern that the reagents created by the authors will not be easily accessible to the zebrafish community.

      (1) The titer used in each experiment was not stated. In the methods section, it is stated that aliquots are stored at 2x10e8. Is it diluted for injection? Are all of the experiments in the manuscripts with the same titer?

      2) The age for injection is quite broad (3-5 dpf in Fig 1 and 4-6 dpf in Fig 2). Given that viral spread efficiency is usually more robust in younger animals, describing the exact injection age for each experiment is critical.

      (3) More details should be provided for the paired electrical stimulation-calcium imaging study. How many GC cells were tested? How many had corresponding PC cell responses? What is the response latency? For example, images of stimulated and recorded GCs and PCs should be shown.

      (4) It is unclear how connectivity between specific PC and GC is determined for single neuron connectivity. In other images (Figure 4C), there are usually multiple starter cells and many GCs. It was not shown that the image resolution can establish clear axon-dendritic contacts between cell pairs.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors of this manuscript aim to develop a novel animal model to accurately simulate the retinal ischemic process in retinal artery occlusion (RAO). A unilateral pterygopalatine ophthalmic artery occlusion (UPOAO) mouse model was established using silicone wire embolization combined with carotid artery ligation. This manuscript provided data to show the changes of major classes of retinal neural cells and visual dysfunction following various durations of ischemia (30 minutes and 60 minutes) and reperfusion (3 days and 7 days) after UPOAO. Additionally, transcriptomics was utilized to investigate the transcriptional changes and elucidate changes in the pathophysiological process in the UPOAO model post-ischemia and reperfusion. Furthermore, the authors compared transcriptomic differences between the UPOAO model and other retinal ischemic-reperfusion models, including HIOP and UCCAO, and revealed unique pathological processes.

      Strengths:

      The UPOAO model represents a novel approach for studying retinal artery occlusion. The study is very comprehensive.

      Weaknesses:

      Originally, some statements were incorrect and confusing. However, the authors have made clarifications in the revised manuscript to avoid confusion.

    1. Reviewer #2 (Public Review):

      Summary:

      In their work, the Authors study local mechanics in an invaginating epithelial tissue. The work, which is mostly computational, relies on the Cellular Potts model. The main result shows that an increased apical "contractility" is not sufficient to properly drive apical constriction and subsequent tissue invagination. The Authors propose an alternative model, where they consider an alternative driver, namely the "apical surface elasticity".

      Strengths:

      It is surprising that despite the fact that apical constriction and tissue invagination are probably most studied processes in tissue morphogenesis, the underlying physical mechanisms are still not entirely understood. This work supports this notion by showing that simply increasing apical tension is perhaps not sufficient to locally constrict and invaginate a tissue.

      Weaknesses:

      Although the Authors have improved and clarified certain aspects of their results as suggested by the Reviewers, the presentation still mostly relies on showing simulation snapshots. Snapshots can be useful, but when there are too many, the results are hard to read. The manuscript would benefit from more quantitative plots like phase diagrams etc.

    1. Reviewer #2 (Public Review):

      This paper describes the results of a set of complementary and convergent experiments aimed at describing roles for the non-selective cation channels NALCN and TRPC6 in mediating subthreshold inward depolarizing currents and action potential generation in VTA DA neurons under normal physiological conditions. In general, the authors have responded satisfactorily to reviewer comments, and the revised manuscript is improved.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper investigates the neural underpinnings of an interactive speech task requiring verbal coordination with another speaker. To achieve this, the authors recorded intracranial brain activity from the left hemisphere in a group of drug-resistant epilepsy patients while they synchronised their speech with a 'virtual partner'. Crucially, the authors were able to manipulate the degree of success of this synchronisation by programming the virtual partner to either actively synchronise or desynchronise their speech with the participant, or else to not vary its speech in response to the participant (making the synchronisation task purely one-way). Using such a paradigm, the authors identified different brain regions that were either more sensitive to the speech of the virtual partner (primary auditory cortex), or more sensitive to the degree of verbal coordination (i.e. synchronisation success) with the virtual partner (secondary auditory cortex and IFG). Such sensitivity was measured by (1) calculating the correlation between the index of verbal coordination and mean power within a range of frequency bands across trials, and (2) calculating the phase-amplitude coupling between the behavioural and brain signals within single trials (using the power of high-frequency neural activity only). Overall, the findings help to elucidate some of the left hemisphere brain areas involved in interactive speaking behaviours, particularly highlighting the high-frequency activity of the IFG as a potential candidate supporting verbal coordination.

      Strengths:

      This study provides the field with a convincing demonstration of how to investigate speaking behaviours in more complex situations that share many features with real-world speaking contexts e.g. simultaneous engagement of speech perception and production processes, the presence of an interlocutor, and the need for inter-speaker coordination. The findings thus go beyond previous work that has typically studied solo speech production in isolation, and represent a significant advance in our understanding of speech as a social and communicative behaviour. It is further an impressive feat to develop a paradigm in which the degree of cooperativity of the synchronisation partner can be so tightly controlled; in this way, this study combines the benefits of using pre-recorded stimuli (namely, the high degree of experimental control) with the benefits of using a live synchronisation partner (allowing the task to be truly two-way interactive, an important criticism of other work using pre-recorded stimuli). A further key strength of the study lies in its employment of stereotactic EEG to measure brain responses with both high temporal and spatial resolution, an ideal method for studying the unfolding relationship between neural processing and this dynamic coordination behaviour.

      Weaknesses:

      One major limitation of the current study is the lack of coverage of the right hemisphere by the implanted electrodes. Of course, electrode location is solely clinically motivated, and so the authors did not have control over this. However, this means that the current study neglects the potentially important role of the right hemisphere in this task. The right hemisphere has previously been proposed to support feedback control for speech (likely a core process engaged by synchronous speech), as opposed to the left hemisphere which has been argued to underlie feedforward control (Tourville & Guenther, 2011). Indeed, a previous fMRI study of synchronous speech reported the engagement of a network of right hemisphere regions, including STG, IPL, IFG, and the temporal pole (Jasmin et al., 2016). Further, the release from speech-induced suppression during a synchronous speech reported by Jasmin et al. was found in the right temporal pole, which may explain the discrepancy with the current finding of reduced leftward high-frequency activity with increasing verbal coordination (suggesting instead increased speech-induced suppression for successful synchronisation). The findings should therefore be interpreted with the caveat that they are limited to the left hemisphere, and are thus likely missing an important aspect of the neural processing underpinning verbal coordination behaviour.

      A further limitation of this study is that its findings are purely correlational in nature; that is, the results tell us how neural activity correlates with behaviour, but not whether it is instrumental in that behaviour. Elucidating the latter would require some form of intervention such as electrode stimulation, to disrupt activity in a brain area and measure the resulting effect on behaviour. Any claims therefore as to the specific role of brain areas in verbal coordination (e.g. the role of the IFG in supporting online coordinative adjustments to achieve synchronisation) are therefore speculative.

    1. Reviewer #2 (Public Review):

      Summary:

      Neurons in motor-related areas have increasingly been shown to carry also other, non-motoric signals. This creates a problem of avoidance of interference between the motor and non-motor-related signals. This is a significant problem that likely affects many brain areas. The specific example studied here is interference between saccade-related activity and slow-changing arousal signals in the superior colliculus. The authors identify neuronal activity related to saccades and arousal. Identifying saccade-related activity is straightforward, but arousal-related activity is harder to identify. The authors first identify a potential neuronal correlate of arousal using PCA to identify a component in the population activity corresponding to slow drift over the recording session. Next, they link this component to arousal by showing that the component is present across different brain areas (SC and PFC), and that it is correlated with pupil size, an external marker of arousal. Having identified an arousal-related component in SC, the authors show next that SC neurons with strong motor-related activity are less strongly affected by this arousal component (both SC and PFC). Lastly, they show that SC population activity patterns related to saccades and pupil size form orthogonal subspaces in the SC population.

      Strengths:

      A great strength of this research is the clear description of the problem, its relationship with the performed analysis, and the interpretation of the results. the paper is very well written and easy to follow.

      An additional strength is the use of fairly sophisticated analysis using population activity.

      Weaknesses:

      (1) The greatest weakness in the present research is the fact that arousal is a functionally less important non-motoric variable. The authors themselves introduce the problem with a discussion of attention, which is without any doubt the most important cognitive process that needs to be functionally isolated from oculomotor processes. Given this introduction, one cannot help but wonder, why the authors did not design an experiment, in which spatial attention and oculomotor control are differentiated. Absent such an experiment, the authors should spend more time explaining the importance of arousal and how it could interfere with oculomotor behavior.

      (2) In this context, it is particularly puzzling that one actually would expect effects of arousal on oculomotor behavior. Specifically, saccade reaction time, accuracy, and speed could be influenced by arousal. The authors should include an analysis of such effects. They should also discuss the absence or presence of such effects and how they affect their other results.

      (3) The authors use the analysis shown in Figure 6D to argue that across recording sessions the activity components capturing variance in pupil size and saccade tuning are uncorrelated. however, the distribution (green) seems to be non-uniform with a peak at very low and very high correlation specifically. The authors should test if such an interpretation is correct. If yes, where are the low and high correlations respectively? Are there potentially two functional areas in SC?

    1. Reviewer #2 (Public Review):

      Summary:

      Goal of the study. The authors tried to pinpoint the origins of transient and sustained responses measured at retinal ganglion cells (rgcs), which is the output layer of the retina. Response characteristics of rgcs are used to group them into different types. The diversity of rgc types represents the ability of the retina to transform visual inputs into distinct output channels. They find that the physical dimensions of bipolar cell's synaptic ribbons (specialized release sites/active zones) vary across the different types of cone on-bpcs, in ways that they argue could facilitate transient or sustained release. This diversity of release output is what they argue underlies the differences in on-rgcs response characteristics, and ultimately represents a mechanism for creating parallel cone-driven channels.

      Strengths:

      The major strengths of the study are the anatomical approaches employed and the use of the "glutamate sniffer" to assay synaptic glutamate levels. The outline of the study is elegant and reflects the strengths of the authors.

      Weaknesses:

      The major weakness is that the ambitious outline is not matched with a complete set of results, and the set of physiological protocols is disjointed, not sufficient to bridge the systems-level question with the presynaptic release question.

      Major comments on the results and suggestions.

      The ribbon model of release has been explored for decades and needs to be further adapted to systems-level work. The study under consideration by Kuo et al. takes on this task. Unfortunately, the experimental design does not permit a level of control over presynaptic/bpc behavior that is comparable to earlier studies, nor do they manipulate release in ways that test the ribbon model (i.e., paired recordings or Ribeye-ko). Furthermore, the data needs additional evaluation, and the presentation and interpretations should draw on published biophysical and molecular studies.

      To build a ribbon-centric context, consider recent literature that supports the assertion that ribbons play a role in forming AZ release sites and facilitating exocytosis. Reference Ribeye-ko studies. For example, ribbonless bpcs show an 80% reduction in release (Maxeiner et al EMBO J 2016), the ribbonless retina exhibits signaling deficits at the output layer (Okawa et al ...Rieke, ..Wong Nat Comm 2019), and ribbonless rods show an 80% reduction the readily releasable pool (RRP) of SVs (Grabner Moser, elife 2021). In addition, the authors could refer to whole-cell membrane capacitance studies on mammalian rods, cones, and bpcs, because the size of the RRP of SVs scales with the dimensions and numbers of ribbons (total ribbon footprint). For comparison, bipolars see the review by Wan and Heidelberger 2011. For a comparison of mammalian rods and cones, see, rods: Grabner and Moser (2021 eLife), Mueller.. Regus Leidig et al. (2019; J Neurosci) and cones Grabner ...DeVries (Nat Comm 2023). A comparison of cell types shows that the extent of release is (1) proportional to the total size of the ribbon footprint, and (2) less release is witnessed when ribbons are deleted (also see photo ablation studies by Snellman.... And Mehta..Zenisek, Nat Neurosci and Neuron).

      Ribbon morphology may change in an activity-dependent manner. The rod ribbon AZ has been reported to lengthen in the dark (Dembla et al 2020), and deletion of the ribbon shortens the length of the AZ (defined by Cav1,4 or RIM2); in addition, the Ribeye-ko AZs fail to change in size with light and dark conditioning. Furthermore, EM studies on rod and cone AZs in light and dark argue that the number of SVs at the base of the ribbon increases in the dark, when PRs are depolarized (see Figure 10, Babai et al 2016 JNeurosci). Lastly, using goldfish Mb1 on-bipolars, Hull et al (2006, J Neurophysio) correlated an increase in release efficiency with an increase in ribbon numbers, which accompanied daylight. >> When release activity is high, ribbon AZ length increases (Dembla, rods), the number of docked SVs increases (Babai, rods cones), and the number of ribbons increases (Hull, diurnal Mb1s).

      The results under review, Kuo et al., were attained with SBF-SEM, which has the benefit of addressing large-volume questions as required here, yet it achieves lower spatial resolution than what is attained with TEM tomography and FIB-EM. Ideally, the EM description would include SV size, and the density of ribbon-tethered SVs that are docked at the plasma membrane, because this is where the SVs fuse (additional non-ribbon release sites may also exist? Mehta ... Singer 2014 J Neurosci). Studies by Graydon et al 2011 and 2014 (both in J Neurosci), and Jean ... Moser et al 2018 (eLife) are good examples of quantitative estimates of SVs docking sites at ribbons. SBF-SEM does not allow for an assessment of SVs within 5 nm of the PM, but if the authors can identify the number of SVs that appear within the limit of resolution (10 to 15 nm) from the PM, then this data would be useful. Also, what dimension(s) of the large ribbons make them larger? Typically, ribbons are fixed in height (at least in the outer retina, 200 to 250 nm), but their length varies and the number ribbons per terminal varies. Is the larger ribbon size observed in type 6 bpcs do to longer ribbons, or taller ribbons? A longer ribbon likely has more docked SVs. An additional possibility is that more SVs are about the ribbon-PM footprint, either more densely packed and/or expanding laterally (see definitions in Jean....Moser, elife 2018).

      The ribbon literature given above makes the argument that ribbons increase exocytotic output, and morphological studies suggest that release activity enhances 1) ribbon length (Dembla) and 2) the density of SVs near the PM (Babai). These findings could lead one to propose that type 6 bpcs (inputs to On-sustained) are more active than type 5i (feed into On-transient). Here Kuo et al. show that the bpcs have similar Vm (measured from the soma) in response to light stimulation. Does Vm predict release? Not entirely as the authors acknowledge, because: Cav channel properties, SV availability, and negative feedback are all downstream of bpc Vm. The only experiment performed to test downstream factors focused on negative feedback from amacrines. The data presented in Figures 5C-F led me to conclude the opposite of what the authors concluded. My impression is that the T-ON rgc exhibits strong disinhibition when GABA-blockers are applied (the initial phase is greatly increased in amplitude and broadened with the drug), which contrasts with the S-On rgc responses that show a change in the amplitude of the initial phase but not its width (taus would be nice). Here and in many places the authors refer to changes in release kinetics, without implementing a useful description of kinetics. For instance, take the cumulative current (charge) in Figure 5C and fit the control and drug traces to arrive at taus, and their respective amplitudes, and use these values to describe kinetic phases. One final point, the summary in Figure 5D has a p: 0.06, very close to the cutoff for significance, which begs for more than an n = 5. Given that previous studies have shown that bpc output is shaped by immediate msec GABA feedback, in ways that influence kinetic phases of release (..Mb1 bipolars, see Vigh et al 2005 Neuron), more attention to this matter is needed before the authors rule out feedback inhibition in favor of ribbon size. If by chance, type 5i bpcs are under uniquely strong feedback inhibition, then ribbon size may result from less activity, not less output resulting from smaller ribbons.

      As mentioned above, the behavior of Cav channels is important here. This is difficult to address with voltage clamps from the soma, especially in the Vm range relevant to this study. Given that it has previously been modeled that the rod bpc to AII pathway adapts to prolonged depolarization of rbcs through downregulating Cav channel-mediated Ca2+ influx (Grimes ....Rieke 2014 Neuron), it seems important for Kou et al to test if there is a difference in Cav regulation between type 6 and 5i bpcs. Ca2+ imaging with a GCaMP strategy (Baden....Lagnado Current Biology, 2011) or filling the presynapse with Ca dyes (see inner hair cells: Ozcete and Moser, EMBO J 2020) would allow for the correlation of [Ca]intra with GluSnf signals (both local readouts).

      Stimulation protocol and presentation of Glutamate Sniffer data in Figure 6. In all of your figures where you state steady st as a % of pk amplitude, please indicate in the figure where you estimate steady state. Alternatively, if you take the cumulative dF/F signal, then you can fit the different kinetic phases. From the appearance of the data, the Sustained Glu signals look like square waves (Figure 6B ROI1-4), without a transient at onset, which is not predicted in your ribbon model that assumes different kinetic phases (1. depletion of docked SVs, and 2. refilling and repriming). The Transient responses (Figure 6B ROI5-8) are transient and more compatible with a depressing ribbon scheme. If you take the cumulative, for all of the On-S and compare it to all of the On-T responses, my guess is the cumulative dF/F will be 10 to 20 larger for the S-On. Would you conclude that bpc inputs to On-S (type 6) release 20-fold more SVs per 4 seconds on a per ribbon basis, and does the surface area of the type 6 bpcs account for this difference? From Figures 8B and D, the volume of the ribbon is ~2 fold greater for type 6 vs 5i, but the Surface Area (both faces of ribbon) is more relevant to your model that claims ribbon size is the pivotal factor. If making cumulative traces, and comparisons on an absolute scale is unfounded, then we need to know how to compare different observations. The classic ribbon models always have a conversion factor such as the capacitance of an SV or q size that is used to derive SV numbers from total dCm or Qcontent. See Kim ....et al von Gersdorff, 2023, Cell Reports. Why not use the Gaussian noise stimulus in Fig 6 as in Figure 1 and 2?

      Figure 7. What is the recovery time for mammalian cones derived from ribbon-based models? There are estimates from membrane capacitance studies. Ground squirrel cones take 0.7 to 1 sec to recover the ultrafast, primed pool of SVs when probed with a paired-pulse protocol (Grabner ...DeVries 2016, Neuron). Their off-bpcs take anywhere from under 0.2 sec to a second to recover, which is a combination of many synaptic factors (Grabner ...DeVries Nat Comm 2023). Rod On bpcs take over a second (Singer Diamond 2006, reviewed Wan and Heidelberger 2011). In Figure 7B, the recovery time is ~150 ms for the responses measured at rgcs. This brief recovery time is incompatible with existing ribbon models of release. Whole-cell membrane capacitance measurements would be helpful here.

      Experimental Suggestion: Add GABA blockers and see if type 5i bpc responds with more release (GluSniff) and prolonged [Ca2+] intra (GCaMP). Compare this to type 6 bpc behavior with GABA/gly blockers. This will rule in or out whether feedback inhibition is involved.

    1. Reviewer #2 (Public Review):

      Summary:

      This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of a memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during the expected test suggests a memory verification process, whereas the prolonged spatial bias during the unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

      Strengths:

      The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

      Weaknesses:

      Although analyses of neural signatures and saccade bias provided clear evidence regarding the dynamics of spatial attention, the link between these signatures and behavioral performance remains unclear. Given the novelty of this study in proposing a second stage of 'verification' of memory contents, it would be more informative to present evidence demonstrating how this verification process enhances memory performance.

    1. Reviewer #2 (Public Review):

      The authors investigate the role of near-infrared photosynthesis in primary production across three beachrock communities. This work is particularly pertinent as more cyanobacteria with far-red light acclimation capacities are discovered, underscoring the need to assess their contributions to primary production. However, the manuscript is currently very difficult to follow due to unclear correlations between the text and figures and the samples analyzed in the different experiments.. Additional explanations would also enhance clarity. For example, it would be beneficial for the authors to better define the three communities, as distinctions are not apparent. Another example is the pigment analysis, where the extinction coefficients for pigments vary in different solvents. Quantification by chromatography should use calibration curves for all pigments, not just Chl a, as is currently done. Pigments can be easily purified from cyanobacteria for this purpose.

    1. Reviewer #2 (Public Review):

      Summary:

      Morucci et al. tested the influence of linguistic prosody long-term priors in forming predictions about simple acoustic rhythmic tone sequences composed of alternating tone duration, by violating context-dependent short-term priors formed during sequence listening. Spanish and Basque participants were selected due to the different rhythmic prosody of the two languages (functor-initial vs. Functor final, respectively), despite a common cultural background. The authors found that neuromagnetic responses to casual tone omissions reflected the linguistic prosody pattern of the participant's dominant language: in Spanish speakers, omission responses were larger to short tones, whereas in Basque speakers, omission responses were larger to long tones. Source localization of these responses revealed this interaction pattern in the left auditory cortex, which the authors interpret as reflecting a perceptual bias due to acoustic cues (inherent linguistic rhythms, rather than linguistic content). Importantly, this pattern was not found when the rhythmic sequence entailed pitch, rather than duration, cues. To my knowledge, this is the first study providing neural signatures of a known behavioral effect linking ambiguous rhythmic tone sequence perceptual organization to linguistic experience.

      The conclusions of the study are well supported by the data. The hypotheses, albeit allowing alternative perspectives, are well justified according to the existing literature. Albeit with inconclusive results, additional analyses to test entrained oscillatory activity to the perceived rhythms have been performed, which adds explanatory power to the study.

      Strengths:

      (1) The choice of participants. The bilingual population of the Basque country is perfect for performing studies which need to control for cultural and socio-economic background while having profound linguistic differences. In this sense, having dominant Basque speakers as a sample equates that in Molnar et al. (2016), and thus overcomes the lack of direct behavioral evidence for a difference in rhythmic grouping across linguistic groups. Molnar et al. (2016)'s evidence on the behavioral effect is compelling, and the evidence on neural signatures provided by the present study aligns with it.

      (2) The experimental paradigm. It is a well designed acoustic sequence, which considers aspects such as gap length insertion, to be able to analyze omission responses free from subsequent stimulus-driven responses, and which includes a control sequence which uses pitch instead of duration as a cue to rhythmic grouping, which provides a stronger case for the differences found between groups to be due to prosodic duration cues.

      (3) Data analyses. Sound, state-of-the-art methodology in the event-related field analyses at the sensor and source levels.

      Weaknesses:

      (1) The main conclusion of the study reflects a known behavioral effect on rhythmic sequence perceptual organization driven by linguistic background (Molnar et al. 2016, particularly) and, thus, the novelty of the findings is restricted to neural activity evidence.

      (2) Although the paradigm is well designed, there are alternative views in formulating the hypotheses. For instance, one could argue that, according to predictive coding views, omission responses should be larger when the gap occurs at the end of the pattern, as that would be where stronger expectations are placed. However, the authors provide good justification based on previous literature for the expectation of larger omission responses at the downbeat of a rhythmic pattern.

    1. Reviewer #2 (Public Review):

      Summary:

      The phytopathogenic bacterium Pseudomonas syringae is comprised of many pathovars with different host plant species and has been used as a model organism to study bacterial pathogenesis in plants. Transcriptional regulation is key to plant infection and adaptation to host environments by this bacterium. However, researches have focused on limited number of transcription factors (TFs) that regulate virulence-related pathways. Thus, a comprehensive, systems-level understanding of regulatory interactions between transcription factors in P. syringae has not been achieved.

      This study by Sun et al performed ChIP-seq analysis of 170 out of 301 TFs in P. syringae pv. syringae 1448A and used this unique dataset to infer transcriptional regulatory networks in this bacterium. The network analyses revealed hierarchical interactions between TFs, various network motifs, and co-regulation of target genes by TF pairs, which collectively mediate information flow. As discussed, the structure and properties of the P. syringae transcriptional regulatory networks are somewhat different from those identified in humans, yeast, and E. coli, highlighting the significance of this study. Further, the authors made use of the P. syringae transcriptional regulatory networks to find TFs of unknown functions to be involved in virulence-related pathways. For some of these TFs, their target specificity and biological functions, such as motility and biofilm formation, were experimentally validated. Of particular interest is the finding that despite conservation of TFs between P. syringae pv. syringae 1448A, P. syringae pv. tomato DC3000, P. syringae pv. syringae B728a, and P. syringae pv. actinidiae C48, some of the conserved TFs show different repertoires of target genes in these four P. syringae strains.

      Strengths:

      This study presents a systems-level analysis of transcriptional regulatory networks in relation to P. syringae virulence and metabolism, highlights differences in transcriptional regulatory landscapes of conserved TFs between different P. syringae strains, and develops a user-friendly database for mining the ChIP-seq data generated in this study. These findings and resources will be valuable to researchers in the fields of systems biology, bacteriology, and plant-microbe interactions.

      Weaknesses:

      No major weaknesses were found, but some of the results may need to be interpreted with caution. ChIP-seq was performed with bacterial strains overexpressing TFs. This may cause artificial binding of TFs to promoters which may not occur when TFs are expressed at physiological levels. Another caution is applied to the interpretation of the biological functions of TFs during plant infection, as biological roles of the tested TFs are mostly based on in vitro experiments.

      This work advances our understanding of transcriptional regulation of virulence and metabolic pathways in plant pathogenic bacteria. Solid evidence for the claims is provided by computational analysis of newly generated data on the genome-wide binding of 170 transcription factors to their target genes, together with experimental validation of the biological functions of some of these transcription factors. The findings and resources from this study will be valuable to researchers in the fields of systems biology, bacteriology, and plant-microbe interactions.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors wanted to determine whether cis-acting factors of Sxl - two different Sxl promoters in somatic cells - regulate Sxl in a similar way in germ cells. They also wanted to determine whether trans-acting factors known to regulate Sxl in the soma also regulate Sxl in the germline.

      Regarding the cis-acting factors, they examine the Sxl "establishment promoter" (SxlPE) that is activated in female somatic cells by the presence of two X chromosomes. Slightly later in development, dosage compensation equalizes X chromosome expression in males and females and so X chromosomes can no longer be counted. The second Sxl promoter is the "maintenance promoter," (SxlPM), which is activated in both sexes. The mRNA produced from the maintenance promoter has to be alternatively splicing from early Sxl protein generated earlier in development by the PE. This leads to an autoregulatory loop that maintains Sxl expression in female somatic cells. The authors used fluorescent in situ hybridization (FISH) with oligopaints to determine the temporal activation of the PE or PM promoters. They find that - unlike the soma - the PE does not precede the PM and instead is activated contemporaneously or later than the PM - this is confusing with the later results (see below). Next, they generated transcriptional reporter constructs containing large segments of the Sxl locus, the 1.5 kb used in somatic studies, a 5.2 kb reporter, and a 10.2 kb. Interestingly the 1.5 kb reporter that was reported to recapitulate Sxl expression in soma and germline was not observed by the authors. The 5.2 kb reporter was observed in female somatic cells but not in germ cells. Only when they include an additional 5 kb downstream of the 5.2 kb reporter (here the 10.2 kb reporter) they did see expression in germ cells but this occurred at the L1 stages. Their data indicate that Sxl activity in the germ requires different cis-regulation than the soma and that the PE is activated later in germ cells than in somatic cells. The authors next use gene editing to insert epitope tags in two distinct strains in the hopes of creating an early Sxl and a later Sxl protein derived from the PE and PM, respectively. The HA-tagged protein from the PE was seen in somatic cells but never in the germline, possibly due to very low expression. The FLAG-tagged late Sxl protein is observed in L2 germ cells. Because the early HA-Sxl protein is not perceptible in germ cells, it is not possible to conclude its role in the germline. However, because late FLAG-Sxl was only observed in L2 germ cells and the PE was detected in L1, this leaves open the possibility that PE produces early HA-Sxl (which currently cannot be detected), which then alternatively splices the transcript from the PM. In other words, the soma and germline could have a similar temporal relationship between the two Sxl promoters. While I agree with the authors about this conclusion, the earlier work with the oligopaints leads to the conclusion that SE is active after PM. This is confusing.

      Next, the authors wanted to turn their attention to the trans-acting factors that regulate Sxl in the soma, including Sisterless A (SisA), SisB, Runt, and the JAK/STAT ligand Unpaired. Using germline RNAi, the authors found that only knockdown of SisA causes ovarian tumors, similar to the loss of Sxl, suggesting that SisA regulates Sxl (ie the PE) in both the soma and the germline. They generated a SisA null allele using CRISPR/Cas9 and these animals had ovarian tumors and germ cell-less ovaries. FISH revealed that sisA is activated in primordial germ cells in stages 3-6 before the activation of Sxl. They used CRISPR-Cas9 to generate an endogenously-tagged SisA and found that tagged SisA was expressed in stage 3-6 PCGs, which is consistent with activating PE in the germline. They showed that sisA is upstream of Sxl as germline depletion of sisA led to a significant decrease in expression from the 10.2 kb PE reporter and in SXL protein. The authors could rescue the ovarian tumors and loss of Sxl protein upon germline depletion of sisA by supplying Sxl from another protein (the otu promoter). These data indicate that sisA is necessary for Sxl activation in the germline. However, ectopic sisA in germ cells in the testis did not lead to ectopic Sxl, suggesting that sisA is not sufficient to activate Sxl in the germline.

      Strengths:

      (1) The genetic and genomic approaches in this study are top-notch and they have generated reagents that will be very useful for the field.

      (2) Excellent use of powerful approaches (oligo paint, reporter constructs, CRISPR-Cas9 alleles).

      (3) The combination of state of art approaches and quantification of phenotypes allows the authors to make important conclusions.

      Weaknesses:

      (1) Confusion in line 127 (this indicates that SxlPE is not activated before SxlPM in the germline) about PE not being activated before the PM in the germline when later figures show that PE is activated in L1 and late Sxl protein is seen in L2. It would be helpful to the readers if the authors edited the text to avoid this confusion. Perhaps more explanation of the results at specific points would be helpful.

    1. Reviewer #2 (Public Review):

      Summary: The investigators apply scRNA seq and bioinformatics to identify biomarkers associated with the DNFB-induced contact dermatitis in mice. The bioinformatics component of the study appears reasonable and may provide new insights regarding TH1 driven immune reactions in ACD in mice. However, the IF data and images of tissue sections are not clear and should be improved to validate the model.

      Strengths:<br /> The bioinformatics analysis.

      Weaknesses:<br /> The IF data presented in 4H, 6H, 7E and 7F are not convincing and need to be correlated with routine staining on histology and different IF markers for PDGFR. Some of the IF staining data demonstrates a pattern inconsistent with its target.

    1. Reviewer #2 (Public Review):

      Summary

      Based on i) the documented role of FMNL1 proteins in IS formation; ii) their ability to regulate F-actin dynamics; iii) the implication of PKCdelta in MVB polarization to the IS and FMNL1beta phosphorylation; and iv) the homology of the C-terminal DAD domain of FMNL1beta with FMNL2, where a phosphorylatable serine residue regulating its auto-inhibitory function had been previously identified, the authors have addressed the role of S1086 in the FMNL1beta DAD domain in F-actin dynamics, MVB polarization and exosome secretion, and investigated the potential implication of PKCdelta, which they had previously shown to regulate these processes, in FMNL1beta S1086 phosphorylation. They demonstrate that FMNL1beta is indeed phosphorylated on S1086 in a PKCdelta-dependent manner and that S1086-phosphorylated FMNL1beta acts downstream of PKCdelta to regulate centrosome and MVB polarization to the IS and exosome release. They provide evidence that FMNL1beta accumulates at the IS where it promotes F-actin clearance from the IS center, thus allowing for MVB secretion.

      Strengths

      The work is based on a solid rationale, which includes previous findings by the authors establishing a link between PKCdelta, FMNL1beta phosphorylation, synaptic F-actin clearance and MVB polarization to the IS. The authors have thoroughly addressed the working hypotheses using robust tools. Among these, of particular value is an expression vector that allows for simultaneous RNAi-based knockdown of the endogenous protein of interest (here all FMNL1 isoforms) and expression of wild-type or mutated versions of the protein as YFP-tagged proteins to facilitate imaging studies. The imaging analyses, which are the core of the manuscript, have been complemented by immunoblot and immunoprecipitation studies, as well as by the measurement of exosome release (using a transfected MVB/exosome reporter to discriminate exosomes secreted by T cells).

      Weaknesses

      The authors have satisfactorily addressed the weaknesses pointed out in my previous review.

    1. Reviewer #2 (Public Review):

      Animals constantly adjust behavior and physiology based on internal states. Hungry animals, desperate for food, exhibit physiological changes immediately upon sensing, smelling, or chewing food, known as the cephalic phase response (CPR), involving processes like increased saliva and gastrointestinal secretions. While starvation lowers body temperature, the mechanisms underlying how the sensation of food without nutrients induces behavioral responses remain unclear. Hunger stress induces changes in both behavior and physiological responses, which in flies (or at least in Drosophila melanogaster) leads to a preference for lower temperatures, analogous to the hunger-driven lower body temperature observed in mammals. In this manuscript, the authors have used Drosophila melanogaster to investigate the issue of whether taste cues can robustly trigger behavioral recovery of temperature preference in starving animals. The authors find that food detection triggers a warm preference in flies. Starved flies recover their temperature preference after food intake, with a distinction between partial and full recovery based on the duration of refeeding. Sucralose, an artificial sweetener, induces a warm preference, suggesting the importance of food-sensing cues. The paper compares the effects of sucralose and glucose refeeding, indicating that both taste cues and nutrients contribute to temperature preference recovery. The authors show that that sweet gustatory receptors (Grs) and sweet GRNs (Gustatory Receptor Neurons) play a crucial role in taste-evoked warm preference. Optogenetic experiments with CsChrimson support the idea that the excitation of sweet GRNs leads to a warm preference. The authors then examine the internal state's influence on taste-evoked warm preference, focusing on neuropeptide F (NPF) and small neuropeptide F (sNPF), analogous to mammalian neuropeptide Y. Mutations in NPF and sNPF result in a failure to exhibit taste-evoked warm preference, emphasizing their role in this process. However, these neuropeptides appear not to be critical for nutrient-induced warm preference, as indicated by increased temperature preference during glucose and fly food refeeding in mutant flies. The authors also explore the role of hunger-related factors in regulating taste-evoked warm preference. Hunger signals, including diuretic hormone (DH44) and adipokinetic hormone (AKH) neurons, are found to be essential for taste-evoked warm preference but not for nutrient-induced warm preference. Additionally, insulin-like peptide 6 (Ilp6) and Unpaired3 (Upd3), related to nutritional stress, are identified as crucial for taste-evoked warm preference. The investigation then extends into circadian rhythms, revealing that taste-evoked warm preference does not align with the feeding rhythm. While flies exhibit a rhythmic feeding pattern, taste-evoked warm preference occurs consistently, suggesting a lack of parallel coordination. Clock genes, crucial for circadian rhythms, are found to be necessary for taste-evoked warm preference but not for nutrient-induced warm preference.

      Strengths:

      A well-written and interesting study, investigating an intriguing issue. The claims, none of which to the best of my knowledge controversial, are backed by a substantial number of experiments.

      Weakness:

      The experimental setup used and the procedures for assessing the temperature preferences of flies is rather sparingly described. Additional details and data presentation would enhance the clarity and replicability of the study. I kindly request the authors to consider the following points: i) A schematic drawing or diagram illustrating the experimental setup for the temperature preference assay would greatly aid readers in understanding the spatial arrangement of the apparatus, temperature points, and the positioning of flies during the assay. The drawing should also be accompanied by specific details about the setup (dimensions, material, etc). ii) It would be beneficial to include a visual representation of the distribution of flies within the temperature gradient on the apparatus. A graphical representation, such as a heatmaps or histograms, showing the percentage of flies within each one-degree temperature bin, would offer insights into the preferences and behaviors of the flies during the assay. In addition to the detailed description of the assay and data analysis, the inclusion of actual data plots, especially for key findings or representative trials, would provide readers with a more direct visualization of the experimental outcomes. These additions will not only enhance the clarity of the presented information but also provide the reader with a more comprehensive understanding of the experimental setup and results. I appreciate the authors' attention to these points and look forward to the potential inclusion of these elements in the revised manuscript.

      Update: The revised manuscript now includes heatmaps showing the distribution of the flies across the temperature bins. As well as a schematic drawing of the behavioral setup.

    1. Reviewer #2 (Public Review):

      Summary:

      This study looks at sex differences in alcohol drinking behaviour in a well-validated model of binge drinking. They provide a comprehensive analysis of drinking behaviour within and between sessions for males and females, as well as looking at the calcium dynamics in neurons projecting from the anterior insula cortex to the dorsolateral striatum.

      Strengths:

      Examining specific sex differences in drinking behaviour is important. This research question is currently a major focus for preclinical researchers looking at substance use. Although we have made a lot of progress over the last few years, there is still a lot that is not understood about sex-differences in alcohol consumption and the clinical implications of this.

      Identifying the lateralisation of activity is novel, and has fundamental importance for researchers investigating functional anatomy underlying alcohol-driven behaviour (and other reward-driven behaviours).

      Weaknesses:

      Very small and unequal sample sizes, especially females (9 males, 5 females). This is probably ok for the calcium imaging, especially with the G-power figures provided, however, I would be cautious with the outcomes of the drinking behaviour, which can be quite variable.

      For female drinking behaviour, rather than this being labelled "more efficient", could this just be that female mice (being substantially smaller than male mice) just don't need to consume as much liquid to reach the same g/kg. In which case, the interpretation might not be so much that females are more efficient, as that mice are very good at titrating their intake to achieve the desired dose of alcohol.

    1. Reviewer #2 (Public Review):

      Summary:

      Identifying spatial subunits within the receptive field of retinal ganglion cells can help study spatial nonlinearities and upstream computations performed by the bipolar cells. The authors significantly accelerate the implementation of the previously proposed Spike Triggered semi-non-negative Matrix Factorization (STNMF) method to identify the subunits. The authors also propose a few method improvements - better initialization; new stability-based criteria for selecting the regularization strength, and hyperparameter selection across cell types.

      The authors then apply this new method to RGC populations in both the salamander retina and the macaque (marmoset) retina. The authors document the subunit sizes, numbers, and overlap across cell types. The neuroscience finding describes the anti-coordination of ON and OFF parasol receptive fields, but not for the corresponding subunits.

      Overall, the authors claim that a faster and more accurate method makes scale-up to large neuronal populations feasible.

      Strengths:

      - The paper is well-written, easy to read and the figures are clear. The limitations are also made clear.

      - The scientific findings are novel and seem to be well supported.

      - The claimed speed-up of the method is potentially important for practical applications to large populations. Each innovation of the method is well-supported.

      - This is a serious effort to improve the method and document the subunits in primate retina.

      Weaknesses:

      - The description of the method is confusing. Currently, the new method is described in the context of changes from existing methods. As someone who is not familiar with previous methods, it is very confusing to follow the details.

      - I think it will help a lot with clarity to have a concise flowchart/pseudocode to summarize the algorithm and separate it from a description of the main changes from previous methods.

      - Separate pseudocodes can be provided for the main method, initialization, regularization parameter selection using consensus, and identifying the regularization parameter across cell types.

      - While the new method clearly shows a drastic improvement compared to the previous method on a laptop, would it be possible to get the same improvement on the previous method if it was implemented with GPU (as is standard for most AI/ML algorithms)?

      - For the calculation of subunits across multiple cells, can you run multiple parallel jobs on the same computer? This may make some innovations unnecessary (like setting the same regularization strength across multiple cells).

      - There are two main innovations in this paper: the fast and approximate method, and analysis of subunit mosaics for primate RGCs. It would be helpful to include an analysis of the primate RGC subunits using the older, slower, but more exact method and show that the major scientific results can be reproduced. This would validate the new method in an end-to-end manner. While this may take a while to run, it may be helpful in the supplement.

      - It would be important to understand the data-efficiency of the method. The approximate method may deviate more from the exact method when the amount of data is limited.

      - Would it be possible to have a few steps of the exact method at the end to ensure that the solution truly optimizes the objective function?

      - Does the number of estimated subunits change with the number of observed spikes? If so, the estimates of subunit number/size must be interpreted with caution.

    1. Reviewer #2 (Public Review):

      Yang et al. investigated the role of miR-802 in the development of adipose tissue (AT) inflammation during obesity. The authors found miR-802 levels are up-regulated in the AT of mouse models of obesity and insulin resistance as well as in the AT of humans. They further demonstrated that miR-802 regulates the intracellular levels of TRAF3 and downstream activation of the NF-kB pathway. Ultimately, controlling AT inflammation by manipulating miR-802 affected whole-body glucose homeostasis, highlighting the role of AT inflammatory status in whole-body metabolism. The study provides solid evidence on the role of adipocyte miR-802 in controlling inflammation and macrophage recruitment. However, how lipid mobilization from adipocytes and how engulfment of lipid droplets by macrophages control inflammatory phenotype in these cells could be better explored. The findings of this study will have a great impact in the field, contributing to the growing body of evidence on how microRNAs control the inflammatory microenvironment of AT and whole-body metabolism in obesity.

    1. Reviewer #2 (Public Review):

      The manuscript by Tompary & Davachi presents results from two experiments, one behavior only and one fMRI plus behavior. They examine the important question of how to separate object memories (C1 and C2) that are never experienced together in time and become linked by shared predictive cues in a sequence (A followed by B followed by one of the C items). The authors developed an implicit priming task that provides a novel behavioral metric for such integration. They find significant C1-C2 priming for sequences that were learned 24h prior to the test, but not for recently learned sequences, suggesting that associative links between the two originally separate memories emerge over an extended period of consolidation. The fMRI study relates this behavioral integration effect to two neural metrics: pattern similarity changes in the medial prefrontal cortex (mPFC) as a measure of neural integration, and changes in hippocampal-LOC connectivity as a measure of post-learning consolidation. While fMRI patterns in mPFC overall show differentiation rather than integration (i.e., C1-C2 representational distances become larger), the authors find a robust correlation such that increasing pattern similarity in mPFC relates to stronger integration in the priming test, and this relationship is again specific to remote memories. Moreover, connectivity between the posterior hippocampus and LOC during post-learning rest is positively related to the behavioral integration effect as well as the mPFC neural similarity index, again specifically for remote memories. Overall, this is a coherent set of findings with interesting theoretical implications for consolidation theories, which will be of broad interest to the memory, learning, and predictive coding communities.

      Strengths:

      (1) The implicit associative priming task designed for this study provides a promising new tool for assessing the formation of mnemonic links that influence behavior without explicit retrieval demands. The authors find an interesting dissociation between this implicit measure of memory integration and more commonly used explicit inference measures: a priming effect on the implicit task only evolved after a 24h consolidation period, while the ability to explicitly link the two critical object memories is present immediately after learning. While speculative at this point, these two measures thus appear to tap into neocortical and hippocampal learning processes, respectively, and this potential dissociation will be of interest to future studies investigating time-dependent integration processes in memory.

      (2) The experimental task is well designed for isolating pre- vs post-learning changes in neural similarity and connectivity, including important controls of baseline neural similarity and connectivity.

      (3) The main claim of a consolidation-dependent effect is supported by a coherent set of findings that relate behavioral integration to neural changes. The specificity of the effects on remote memories makes the results particularly interesting and compelling.

      (4) The authors are transparent about unexpected results, for example, the finding that overall similarity in mPFC is consistent with a differentiation rather than an integration model.

      Weaknesses:

      (1) The sequence learning and recognition priming tasks are cleverly designed to isolate the effects of interest while controlling for potential order effects. However, due to the complex nature of the task, it is difficult for the reader to infer all the transition probabilities between item types and how they may influence the behavioral priming results. For example, baseline items (BL) are interspersed between repeated sequences during learning, and thus presumably can only occur before an A item or after a C item. This seems to create non-random predictive relationships such that C is often followed by BL, and BL by A items. If this relationship is reversed during the recognition priming task, where the sequence is always BL-C1-C2, this violation of expectations might slow down reaction times and deflate the baseline measure. It would be helpful if the manuscript explicitly reported transition probabilities for each relevant item type in the priming task relative to the sequence learning task and discussed how a match vs mismatch may influence the observed priming effects.

      (2) The choice of what regions of interest to include in the different sets of analyses could be better motivated. For example, even though briefly discussed in the intro, it remains unclear why the posterior but not the anterior hippocampus is of interest for the connectivity analyses, and why the main target is LOC, not mPFC, given past results including from this group (Tompary & Davachi, 2017). Moreover, for readers not familiar with this literature, it would help if references were provided to suggest that a predictable > unpredictable contrast is well suited for functionally defining mPFC, as done in the present study.

      (3) Relatedly, multiple comparison corrections should be applied in the fMRI integration and connectivity analyses whenever the same contrast is performed on multiple regions in an exploratory manner.

    1. Reviewer #2 (Public Review):

      Girardello et al investigated the composition of the molecular machinery of caveolae governing their mechano-regulation in migrating cells. Using live cell imaging and RPE1 cells, the authors provide a spatio-temporal analysis of cavin-3 distribution during cell migration and reveal that caveolae are preferentially localized at the rear of the cell in a stable manner. They further characterize these structures using electron tomography and reveal an organization into clusters connected to the cell surface. By performing a proteomic approach, they address the interactome of caveolin-1 proteins upon mechanical stimulation by exposing RPE1 cells to hypo-osmotic shock (which aims to increase cell membrane tension) or not as a control condition. The authors identify over 300 proteins, notably proteins related to actin cytoskeleton and cell adhesion. These results were further validated in cellulo by interrogating protein-protein interactions using proximity ligation assays and hypo-osmotic shock. These experiments confirmed previous data showing that high membrane tension induces caveolae disassembly in a reversible manner. Eventually, based on literature and on the results collected by the proteomic analysis, authors investigated more deeply the molecular signaling pathway controlling caveolae assembly upon mechanical stimuli. First, they confirm the targeting of ROCK1 with Caveolin-1 and the implication of the kinase activity for caveolae formation (at the rear of the cell). Then, they show that RhoGA ARHGAP29, a factor newly identified by the proteomic analysis, is also implicated in caveolae mechano-regulation likely through YAP protein and found that overexpression of RHoGA ARHGAP29 affects cell motility. Overall, this paper interrogated the role of membrane tension in caveolae located at the rear of the cell and identified a new pathway controlling cell motility.

      Strengths:

      Using a proximity-based proteomic assay, the authors reveal the protein network interacting with caveolae upon mechanical stimuli. This approach is elegant and allows to identify a substantial new set of factors involved in the mechano-regulation of caveolin-1, some of which have been verified directly in the cell by PLA. This study provides a compelling set of data on the interactions between caveolae and its cortical network which was so far ill-characterized.

      Weaknesses:

      The methodology demonstrating an impact of membrane tension is not precise enough to directly assess a direct role on caveolae at a subcellular scale, that is between the front and the rear of the cell. First, a better characterization of the "front-rear" cellular model is encouraged. Secondly, authors frequently present osmotic shock as "high membrane tension" stimuli. While osmotic shock is widely used in the field, this study is focused only on caveolae localized at the rear of cell and it remains unclear how the level of a global mechanical stimuli triggered by an osmotic shock could mimic a local stimuli. In the present case, it remains unknown the extent to which this mechanical stress is physiologically relevant to mimic mechanical forces applied at the rear of a migrating cell.<br /> Some images are not satisfying to fully support the conclusions of the article. At this stage, the lack of an unbiased quantitative analysis of the spatio-temporal analysis of caveolae upon well-defined mechanical stimuli is also needed. Cells on images, in particular Figure 1, are difficult to see. Signal-to noise ratio in different cell area could generate a biased. Since there is inconsistency between caveolae density and localization between Figures, more solid illustrations are needed along quantitative analysis.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors have taken their previous finding that arpin is important for epithelial junctions and extended this to endothelial cells. They find that the positive effects of arpin on endothelial junctions are not dependent on Arp2/3 activity but instead on suppression of actinomyosin contractility.

      Strengths:

      The study uses standard approaches to test each of the components in the model. The quality of the experimental work is good and the amount of experimental evidence is sufficient to support this straightforward story.

      Weaknesses:

      The major weakness is that the story is a simple extension of the previous work on arpin and junctions in epithelial cells. The additional information is that the effects are not via Arp2/3 directly, but instead through an increase in actinomyosin contractility. However, the connection between arpin and increased ROCK activity is not revealed.

    1. Reviewer #2 (Public Review):

      In the present study, Vora et al. elucidated the transcription factors downstream of the BMP pathway components Smad and Schnurri in C. elegans and their effects on body size. Using a combination of a broad range of techniques, they compiled a comprehensive list of genome-wide downstream targets of the Smads SMA-3 and SMA-9. They found that both proteins have an overlapping spectrum of transcriptional target sites they control, but also unique ones. Thereby, they also identified genes involved in one-carbon metabolism or the endoplasmic reticulum (ER) secretory pathway. In an elaborate effort, the authors set out to characterize the effects of numerous of these targets on the regulation of body size in vivo as the BMP pathway is involved in this process. Using the reporter ROL-6::wrmScarlet, they further revealed that not only collagen production, as previously shown, but also collagen secretion into the cuticle is controlled by SMA-3 and SMA-9. The data presented by Vora et al. provide in-depth insight into the means by which the BMP pathway regulates body size, thus offering a whole new set of downstream mechanisms that are potentially interesting to a broad field of researchers.

      The paper is mostly well-researched, and the conclusions are comprehensive and supported by the data presented. However, certain aspects need clarification and potentially extended data.

      (1) The BMP pathway is active during development and growth. Thus, it is logical that the data shown in the study by Vora et al. is based on L2 worms. However, it raises the question of if and how the pattern of transcriptional targets of SMA-3 and SMA-9 changes with age or in the male tail, where the BMP pathway also has been shown to play a role. Is there any data to shed light on this matter or are there any speculations or hypotheses?

      (2) As it was shown that SMA-3 and SMA-9 potentially act in a complex to regulate the transcription of several genes, it would be interesting to know whether the two interact with each other or if the cooperation is more indirect.

      (3) It would help the understanding of the data even more if the authors could specifically state if there were collagens among the genes regulated by SMA-3 and SMA-9 and which.

      (4) The data on the role of SMA-3 and SMA-9 in the regulation of the secretion of collagens from the hypodermis is highly intriguing. The authors use ROL-6 as a reporter for the secretion of collagens. Is ROL-6 a target of SMA-9 or SMA-3? Even if this is not the case, the data would gain even more strength if a comparable quantification of the cuticular levels of ROL-6 were shown in Figure 6, and potentially a ratio of cuticular versus hypodermal levels. By that, the levels of secretion versus production can be better appreciated.

      (5) It is known that the BMP pathway controls several processes besides body size. The discussion would benefit from a broader overview of how the identified genes could contribute to body size. The focus of the study is on collagen production and secretion, but it would be interesting to have some insights into whether and how other identified proteins could play a role or whether they are likely to not be involved here (such as the ones normally associated with lipid metabolism, etc.).

    1. Reviewer #2 (Public Review):

      Aybar-Torres and colleagues utilize common human STING alleles to dissect the mechanism of SAVI inflammatory disease. The authors demonstrate that these common alleles alleviate SAVI pathology in mice, and perhaps more importantly use the differing functionality of these alleles to provide insight into requirements of SAVI disease induction. Their findings suggest that it is residue A230 and/or Q293 that are required for SAVI induction, while the ability to induce an interferon-dependent inflammatory response is not. This is nicely exemplified by the AQ/SAVI mice that have an intact inflammatory response to STING activation, yet minimal disease progression. As both mutants seem to be resistant STING-dependent cell death, this manuscript also alludes to the importance of STING-dependent cell death, rather than STING-dependent inflammation, in the progression of SAVI pathology. I believe this manuscript makes some important connections between STING pathology mouse models and human genetics that would contribute to the field.

    1. Reviewer #2 (Public Review):

      (1) Regarding the results in Figure 2 and Figure 5: for the heatmaps in Fig.2F and Fig.2E, the overall activity pattern of D1 and D2 MSNs looks very similar, both D1 and D2 MSNs contains neurons showing decreasing or increasing activity during interval timing. And the optogenetic and pharmacologic inhibition of either D1 or D2 MSNs resulted in similar behavior outcomes. To me, the D1 and D2 MSN activities were more complementary than opposing. If the authors want to emphasize the opposing side of D1 and D2 MSNs, then the manipulation experiments need to be re-designed, since the average activity of D2 MSNs increased, while D1 MSNs decreased during interval timing, instead of using inhibitory manipulations in both pathways, the authors should use inhibitory manipulation in D2-MSNs, while using optogenetic or pharmacology to activate D1-MSNs. In this way, the authors can demonstrate the opposing role of D1 and D2 MSNs and the functions of increased activity in D2-MSNs and decreased activity in D1-MSNs.

      (2) Regarding the results in Figure 3 C and D, Figure 6 H and Figure 7 D, what is the sample size? From the single data points in the figures, it seems that the authors were using the number of cells to do statistical tests and plot the figures. For example, Figure 3 C, if the authors use n= 32 D2 MSNs and n= 41D1 MSNs to do the statistical test, it could make a small difference to be statistically significant. The authors should use the number of mice to do the statistical tests.

      (3) Regarding the results in Figure 5, what is the reason for the increase in the response times? The authors should plot the position track during intervals (0-6 s) with or without optogenetic or pharmacologic inhibition. The authors can check Figures 3, 5, and 6 in the paper https://doi.org/10.1016/j.cell.2016.06.032 for reference to analyze the data.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors developed a novel tool, SCellBOW, to perform cell clustering and infer survival risks on individual cancer cell clusters from the single-cell RNA seq dataset. The key ideas/techniques used in the tool include transfer learning, bag of words (BOW), and phenotype algebra which is similar to word algebra from natural language processing (NLP). Comparisons with existing methods demonstrated that SCellBOW provides superior clustering results and exhibits robust performance across a wide range of datasets. Importantly, a distinguishing feature of SCellBOW compared to other tools is its ability to assign risk scores to specific cancer cell clusters. Using SCellBOW, the authors identified a new group of prostate cancer cells characterized by a highly aggressive and dedifferentiated phenotype.

      Strengths:

      The application of natural language processing (NLP) to single-cell RNA sequencing (scRNA-seq) datasets is both smart and insightful. Encoding gene expression levels as word frequencies is a creative way to apply text analysis techniques to biological data. When combined with transfer learning, this approach enhances our ability to describe the heterogeneity of different cells, offering a novel method for understanding the biological behavior of individual cells and surpassing the capabilities of existing cell clustering methods. Moreover, the ability of the package to predict risk, particularly within cancer datasets, significantly expands the potential applications.

      Weaknesses:

      Given the promising nature of this tool, it would be beneficial for the authors to test the risk-stratification functionality on other types of tumors with high heterogeneity, such as liver and pancreatic cancers, which currently lack clinically relevant and well-recognized stratification methods. Additionally, it would be worthwhile to investigate how the tool could be applied to spatial transcriptomics by analyzing cell embeddings from different layers within these tissues.

    1. Reviewer #2 (Public Review):

      Summary:

      Zhixin and collaborators have investigated if the molecular pathways present in glia play a role in the proliferation, maintenance and differentiation of Neural Stem Cells. In this case, Drosophila Neuroblasts are used as models. Authors find that neuronal iron metabolism modulated by glial ferritin is an essential element for Neuroblast proliferation and differentiation. They show that loss of glial ferritin is sufficient to impact the number of neuroblasts. Remarkably, authors have identified that ferritin produced in the glia is secreted to be used as an iron source by the neurons. Therefore iron defects in glia have serious consequences in neuroblasts and likely vice versa. Interestingly, preventing iron absorption in the intestine is sufficient to reduce NB number. Furthermore, they have identified Zip13 as another regulator of the process. Evidence presented strongly indicates that the loss of neuroblasts is due to premature differentiation rather than cell death.

      Strengths:

      - Comprehensive analysis of the impact of glial iron metabolism in neuroblast behaviour by genetic and drug-based approaches as well as using a second model (mouse) for some validations.

      - Using cutting edge methods such as RNAseq as well as very elegant and clean approaches such as RNAi-resistant lines or temperature-sensitive tools

      - Goes beyond the state of the art highlighting iron as a key element in neuroblast formation as well as as a target in tumor treatments.

      Comments on latest version:

      The authors have successfully and convincingly addressed all comments from this reviewer. The modifications, changes and additions have increased the robustness of the results and clearly increased the readability of the manuscript.

      This reviewer also appreciates all the efforts and extra work conducted by the authors to finish in a reasonable time all the experiments suggested by all reviewers.

    1. Reviewer #2 (Public Review):

      The authors investigate the gene expression variation in a rice diversity panel under normal and saline growth conditions to gain insight into the underlying molecular adaptive response to salinity. They present a convincing case to demonstrate that environmental stress can induce selective pressure on gene expression, which is in agreement to their earlier study (Groen et al, 2020). The data seems to be a good fit for their study and overall the analytic approach is robust.

      (1) The work started by investigating the effect of genotype and their interaction at each transcript level using 3'-end-biased mRNA sequencing, and detecting a wide-spread GXE effect. Later, using the total filled grain number as a proxy of fitness, they estimated the strength of selection on each transcript and reported stronger selective pressure in a saline environment. However, this current framework relies on precise estimation of fitness and, therefore can be sensitive to the choice of fitness proxy.

      (2) Furthermore, the authors decomposed the genetic architecture of expression variation into cis- and trans-eQTL in each environment separately and reported more unique environment-specific trans-eQTLs than cis-. The relative contribution of cis- and trans-eQTL depends on both the abundance and effect size. I wonder why the latter was not reported while comparing these two different genetic architectures. If the authors were to compare the variation explained by these two categories of eQTL instead of their frequency, would the inference that trans-eQTLs are primarily associated with expression variation still hold?

      (3) Next, the authors investigated the relationship between cis- and trans-eQTLs at the transcript level and revealed an excess of reinforcement over the compensation pattern. Here, I struggle to understand the motivation for testing the relationship by comparing the effect of cis-QTL with the mean effect of all trans-eQTLs of a given transcript. My concern is that taking the mean can diminish the effect of small trans-eQTLs potentially biasing the relationship towards the large-effect eQTLs.

    1. Reviewer #2 (Public Review):

      Summary:

      The study by Ver Heul et al., investigates the consequences of RAG expression for type 2 innate lymphoid cell (ILC2) function. RAG expression is essential for the generation of the receptors expressed by B and T cells and their subsequent development. Innate lymphocytes, which arise from the same initial progenitor populations, are in part defined by their ability to develop in the absence of RAG expression. However, it has been described in multiple studies that a significant proportion of innate lymphocytes show a history of Rag expression. In compelling studies several years ago, members of this research team revealed that early Rag expression during the development of Natural Killer cells (Karo et al., Cell 2014), the first described innate lymphocyte, had functional consequences.

      Here, the authors revisit this topic, a worthwhile endeavour given the broad history of Rag expression within all ILCs and the common use of RAG-deficient mice to specifically assess ILC function. Focusing on ILC2s and utilising state-of-the-art approaches, the authors sought to understand whether early expression of Rag during ILC2 development had consequences for activity, fitness, or function. Having identified cell-intrinsic effects in vivo, the authors investigated the causes of this, identifying epigenetic changes associated with the accessibility genes associated with core ILC2 functions.

      The manuscript is well written and does an excellent job of supporting the reader through reasonably complex transcriptional and epigenetic analyses, with considerate use of explanatory diagrams. Overall I think that the conclusions are fair, the topic is thought-provoking, and the research is likely of broad immunological interest. I think that the extent of functional data and mechanistic insight is appropriate.

      Strengths:

      - The logical and stepwise use of mouse models to first demonstrate the impact on ILC2 function in vivo and a cell-intrinsic role. Initial analyses show enhanced cytokine production by ILC2 from RAG-deficient mice. Then through two different chimeric mice (including BM chimeras), the authors convincingly show this is cell intrinsic and not simply as a result of lymphopenia. This is important given other studies implicating enhanced ILC function in RAG-/- mice reflect altered competition for resources (e.g. cytokines).

      - Use of Rag expression fate mapping to support analyses of how cells were impacted - this enables a robust platform supporting subsequent analyses of the consequences of Rag expression for ILC2.

      - Use of snRNA-seq supports gene expression and chromatin accessibility studies - these reveal clear differences in the data sets consistent with altered ILC2 function.

      - Convincing evidence of epigenetic changes associated with loci strongly linked to ILC2 function. This forms a detailed analysis that potentially helps explain some of the altered ILC2 functions observed in ex vivo stimulation assays.

      - Provision of a wealth of expression data and bioinformatics analyses that can serve as valuable resources to the field.

      Weaknesses:

      - Lack of insight into precisely how early RAG expression mediates its effects, although I think this is beyond the scale of this current manuscript. Really this is the fundamental next question from the data provided here.

      - The epigenetic analyses provide evidence of differences in the state of chromatin, but there is no data on what may be interacting or binding at these sites, impeding understanding of what this means mechanistically.

      - Focus on ILC2 from skin-draining lymph nodes rather than the principal site of ILC2 activity itself (the skin). This may well reflect the ease at which cells can be isolated from different tissues.

      - Comparison with ILC2 from other sites would have helped to substantiate findings and compensate for the reliance on data on ILC2 from skin-draining lymph nodes, which are not usually assessed amongst ILC2 populations.

      - The studies of how ILC2 are impacted are a little limited, focused exclusively on IL-13 and IL-5 cytokine expression.

    1. Reviewer #2 (Public Review):

      Summary:

      Sarcomeres, the contractile units of skeletal and cardiac muscle, contract in a concerted fashion to power myofibril and thus muscle fiber contraction.

      Muscle fiber contraction depends on the stiffness of the elastic substrate of the cell, yet it is not known how this dependence emerges from the collective dynamics of sarcomeres. Here, the authors analyze the contraction time series of individual sarcomeres using live imaging of fluorescently labeled cardiomyocytes cultured on elastic substrates of different stiffness. They find that reduced collective contractility of muscle fibers on unphysiologically stiff substrates is partially explained by a lack of synchronization in the contraction of individual sarcomeres.

      This lack of synchronization is at least partially stochastic, consistent with the notion of a tug-of-war between sarcomeres on stiff sarcomeres. A particular irregularity of sarcomere contraction cycles is 'popping', the extension of sarcomeres beyond their rest length. The statistics of 'popping' suggest that this is a purely random process.

      Strengths:

      This study thus marks an important shift of perspective from whole-cell analysis towards an understanding of the collective dynamics of coupled, stochastic sarcomeres.

      Weaknesses:

      Further insight into mechanisms could be provided by additional analyses and/or comparisons to mathematical models.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript presents a novel and significant investigation into the role of SIRT4 For CCN2 expression in response to TGF-β by modulating U2AF2-mediated alternative splicing and its impact on the development of kidney fibrosis.

      Strengths:

      The authors' main conclusion is that SIRT4 plays a role in kidney fibrosis by regulating CCN2 expression via pre-mRNA splicing. Additionally, the study reveals that SIRT4 translocates from the mitochondria to the cytoplasm through the BAX/BAK pore under TGF-β stimulation. In the cytoplasm, TGF-β activated the ERK pathway and induced the phosphorylation of SIRT4 at Ser36, further promoting its interaction with importin α1 and subsequent nuclear translocation. In the nucleus, SIRT4 was found to deacetylate U2AF2 at K413, facilitating the splicing of CCN2 pre-mRNA to promote CCN2 protein expression. Overall, the findings are fully convincing. The current study, to some extent, shows potential importance in this field. 

      Weaknesses:

      (1) Exosomes containing anti-SIRT4 antibodies were found to effectively mitigate UUO-induced kidney fibrosis in mice. While the protein loading capacity and loading methods were not mentioned.

      (2) The method section is incomplete, and many methods like cell culture, cell transfection, gene expression profiling analysis, and splicing analysis, were not introduced in detail.

      (3) The authors should compare their results with previous studies and mention clearly how their work is important in comparison to what has already been reported in the Discussion section.

    1. Reviewer #2 (Public Review):

      Summary:

      The study by Xingsen Zhao et al on "A human forebrain organoid model reveals the essential function of GTF2IRD1-TTR-ERK axis for the neurodevelopmental deficits of Williams Syndrome" presents a forebrain organoid model for WS and has identified defects in neurogenesis. The authors have performed scRNAseq from these patients' derived forebrain organoids showing upregulation expression in genes related to cell proliferation while genes involved in neuronal differentiation were downregulated. The major findings presented in this study are an increase in the size of SOX2+ ventricular zone in WS forebrain organoids with an altered developmental trajectory and aberrant excitatory neurogenesis. The study also presents evidence that transthyretin (TTR) has a reduced expression in WS organoids, and its expression is regulated by the transcription factor -GTF2IRD1. The authors then go on identity mechanistic details of TTR function on MAPK/ERK pathway which has been known to be involved in brain development. Overall, this is a well-constructed study revealing the function of one of the key genes that is deleted in WS and provides novel insights into mechanisms underlying the abnormal neurogenesis in WS brain.

      Strengths:

      WS patients have neurocognitive disorders which most likely stem from defects in early neurodevelopment. This study has investigated a WS forebrain organoid model with scRNAseq and identified differences in cell proliferation and differentiation. This study has presented some new evidence regarding the function and regulation of TTR and its regulator GTF2IRD1 during brain development.

      Weaknesses:

      Though the evidence presented for the mechanism of action of TTR on the MAPK pathway is unclear and lacks depth. It would require identifying downstream targets of TTR and how it interacts with the MAPK pathway.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript explores the neuronal signals that underlie resistance vs resource-based models of cognitive effort. The authors use a delayed discounting task and computational models to explore these ideas. The authors find that the ACC strongly tracks value and time, which is consistent with prior work. Novel contributions include quantification of a resource-based control signal among ACC ensembles, and linking ACC theta oscillations to a resistance-based strategy.

      Strengths:

      The experiments and analyses are well done and have the potential to generate an elegant explanatory framework for ACC neuronal activity. The inclusion of local-field potential / spike-field analyses is particularly important because these can be measured in humans.

      Weaknesses:

      I had questions that might help me understand the task and details of neuronal analyses.

      (1) The abstract, discussion, and introduction set up an opposition between resource and resistance-based forms of cognitive effort. It's clear that the authors find evidence for each (ACC ensembles = resource, theta=resistance?) but I'm not sure where the data fall on this dichotomy.<br /> a. An overall very simple schematic early in the paper (prior to the MCML model? or even the behavior) may help illustrate the main point.<br /> b. In the intro, results, and discussion, it may help to relate each point to this dichotomy.<br /> c. What would resource-based signals look like? What would resistance based signals look like? Is the main point that resistance-based strategies dominate when delays are short, but resource-based strategies dominate when delays are long?<br /> d. I wonder if these strategies can be illustrated? Could these two measures (dLP vs ival tracking) be plotted on separate axes or extremes, and behavior, neuronal data, LFP, and spectral relationships be shown on these axes? I think Figure 2 is working towards this. Could these be shown for each delay length? This way, as the evidence from behavior, model, single neurons, ensembles, and theta is presented, it can be related to this framework, and the reader can organize the findings.

      (2) The task is not clear to me.<br /> a. I wonder if a task schematic and a flow chart of training would help readers.<br /> b. This task appears to be relatively new. Has it been used before in rats (Oberlin and Grahame is a mouse study)? Some history / context might help orient readers.<br /> c. How many total sessions were completed with ascending delays? Was there criteria for surgeries? How many total recording sessions per animal (of the 54?)<br /> d. How many trials completed per session (40 trials OR 45 minutes)? Where are there errors? These details are important for interpreting Figure 1.

      (3) Figure 1 is unclear to me.<br /> a. Delayed vs immediate lever presses are being plotted - but I am not sure what is red, and what is blue. I might suggest plotting each animal.<br /> b. How many animals and sessions go into each data point?<br /> c. Table 1 (which might be better referenced in the paper) refers to rats by session. Is it true that some rats (2 and 8) were not analyzed for the bulk of the paper? Some rats appear to switch strategies, and some stay in one strategy. How many neurons come from each rat?<br /> d. Task basics - RT, choice, accuracy, video stills - might help readers understand what is going into these plots<br /> e. Does the animal move differently (i.e., RTs) in G1 vs. G2?

      (4) I wasn't sure how clustered G1 vs. G2 vs G3 are. To make this argument, the raw data (or some axis of it) might help.<br /> a. This is particularly important because G3 appears to be a mix of G1 and G2, although upon inspection, I'm not sure how different they really are<br /> b. Was there some objective clustering criteria that defined the clusters?<br /> c. Why discuss G3 at all? Can these sessions be removed from analysis?

      (5) The same applies to neuronal analyses in Fig 3 and 4<br /> a. What does a single neuron peri-event raster look like? I would include several of these.<br /> b. What does PC1, 2 and 3 look like for G1, G2, and G3?<br /> c. Certain PCs are selected, but I'm not sure how they were selected - was there a criteria used? How was the correlation between PCA and ival selected? What about PCs that don't correlate with ival?<br /> d. If the authors are using PCA, then scree plots and PETHs might be useful, as well as comparisons to PCs from time-shuffled / randomized data.

      (6) I had questions about the spectral analysis<br /> a. Theta has many definitions - why did the authors use 6-12 Hz? Does it come from the hippocampal literature, and is this the best definition of theta?. What about other bands (delta - 1-4 Hz), theta (4-7 Hz); and beta - 13- 30 Hz? These bands are of particular importance because they have been associated with errors, dopamine, and are abnormal in schizophrenia and Parkinson's disease.<br /> b. Power spectra and time-frequency analyses may justify the authors focus. I would show these (y-axis - frequency, x-axis - time, z-axis, power).

      (7) PC3 as an autocorrelation doesn't seem the to be right way to infer theta entrainment or spike-field relationships, as PCA can be vulnerable to phantom oscillations, and coherence can be transient. It is also difficult to compare to traditional measures of phase-locking. Why not simply use spike-field coherence? This is particularly important with reference to the human literature, which the authors invoke.

    1. Reviewer #2 (Public Review):

      BTB domains are protein-protein interaction domains found in diverse eukaryotic proteins, including transcription factors. It was previously known that many of the Drosophila transcription factor BTB domains are of the TTK-type - these are defined as having a highly-conserved motif, FxLRWN, at their N-terminus, and they thereby differ from the mammalian BTB domains. Whereas the well-characterised mammalian BTB domains are dimeric, several Drosophila TTK-BTB domains notably form multimers and function as chromosome architectural proteins. The aims of this work were (i) to determine the structural basis of multimerisation of the Drosophila TTK-BTB domains, (ii) to determine how different Drosophila TTK-BTB domains interact with each other, and (iii) to investigate the evolution of this subtype of BTB domain.

      The work significantly advances our understanding of the biology of BTB domains. The conclusions of the paper are mostly well-supported, although some aspects need clarification:

      Hexameric organisation of the TTK-type BTB domains:<br /> Using cryo-EM, the authors showed that the CG6765 TTK-type BTB domain forms a hexameric assembly in which three "classic" BTB dimers interact via a beta-sheet interface involving the B3 strand. This is particularly interesting, as this region of the BTB domain has recently been implicated in protein-protein interactions in a mammalian BTB-transcription factor, MIZ1. SEC-MALS analysis indicated that the LOLA TTK-type BTB domain is also hexameric, and SAXS data was consistent with a hexameric assembly of the CG6765- and LOLA BTB domains.

      The data regarding the hexameric organisation is convincing. However, interpreting the role of specific regions of the BTB domain is difficult because the description of the molecular contacts lacks depth.

      Heteromeric interactions between TTK-type BTB domains:<br /> The authors use yeast two-hybrid assays to study heteromeric interactions between various Drosophila TTK-type BTB domains. Such assays are notorious for producing false positives, and this needs to be mentioned. Although the authors suggest that the heteromeric interactions are mediated via the newly-identify B3 interaction interface, there is no evidence to support this, since mutation of B3 yielded insoluble proteins.

      Evolution of the TTK-type BTB domains:<br /> The authors carried out a bioinformatics analysis of BTB proteins and showed that most of the Drosophila BTB transcription factors (24 out of 28) are of the TTK-type. They investigated how the TTK-type BTB domains emerged during evolution, and showed that these are only found in Arthropoda, and underwent lineage-specific expansion in the modern phylogenetic groups of insects. These findings are well-supported by the evidence.

    1. Reviewer #2 (Public Review):

      The manuscript by Xie and colleagues presents transcriptomic experiments that measure gene expression in eight different tissues taken from adult female and male mice from four species. These data are used to make inferences regarding the evolution of sex-biased gene expression across these taxa. The experimental methods and data analysis are appropriate; however, most of the conclusions drawn in the manuscript have either been previously reported in the literature or are not fully supported by the data.

      There are two ways the manuscript could be modified to better strengthen the conclusions.

      First, some of the observed differences in gene expression have very little to no effect on other phenotypes, and are not relevant to medicine or fitness. Selectively neutral gene expression differences have been inferred in previous studies, and consistent with that work, sex-biased and between-species expression differences in this study may also be enriched for selectively neutral expression differences. This idea is supported by the analysis of expression variance, which indicates that genes that show sex-biased expression also tend to show more inter-individual variation. This perspective is also supported by the MK analysis of molecular evolution, which suggests that positive selection is more prevalent among genes that are sex-biased in both mus and dom, and genes that switch sex-biased expression are under less selection at the level of both protein-coding sequence and gene expression.

      As an aside, I was confused by (line 176): "implying that the enhanced positive selection pressure is triggered by their status of being sex-biased in either taxon." - don't the MK values suggest an excess of positive selection on genes that are sex-biased in both taxa?

      Without an estimate of the proportion of differentially expressed genes that might be relevant for broader physiological or organismal phenotypes, it is difficult to assess the accuracy and relevance of the manuscript's conclusions. One (crude) approach would be to analyze subsets of genes stratified by the magnitude of expression differences; while there is a weak relationship between expression differences and fitness effects, on average large gene expression differences are more likely to affect additional phenotypes than small expression differences. Another perspective would be to compare the within-species variance to the between-species variance to identify genes with an excess of the latter relative to the former (similar logic to an MK test of amino acid substitutions).

      Second, the analysis could be more informative if it distinguished between genes that are expressed across multiple tissues in both sexes that may show greater expression in one sex than the other, versus genes with specialized function expressed solely in (usually) reproductive tissues of one sex (e.g. ovary-specific genes). One approach to quantify this distinction would be metrics like those used defined by [Yanai I, et al. 2005. Genome-wide midrange transcription profiles reveal expression-level relationships in human tissue specification. Bioinformatics 21:650-659.] These approaches can be used to separate out groups of genes by the extent to which they are expressed in both sexes versus genes that are primarily expressed in sex-specific tissue such as testes or ovaries. This more fine-grained analysis would also potentially inform the section describing the evolution/conservation of sex-biased expression: I expect there must be genes with conserved expression specifically in ovaries or testes (these are ancient animal structures!) but these may have been excluded by the requirement that genes be sex-biased and expressed in at least two organs.

      There are at least three examples of statements in the discussion that at the moment misinterpret the experimental results.

      The discussion frames the results in the context of sexual selection and sexually antagonistic selection, but these concepts are not synonymous. Sexual selection can shape phenotypes that are specific to one sex, causing no antagonism; and fitness differences between males and females resulting from sexually antagonistic variation in somatic phenotypes may not be acted on by sexual selection. Furthermore, the conditions promoting and consequence of both kinds of selection can be different, so they should be treated separately for the purposes of this discussion.

      The discussion claims that "Our data show that sex-biased gene expression evolves extremely fast" but a comparison or expectation for the rate of evolution is not provided. Many other studies have used comparative transcriptomics to estimate rates of gene expression evolution between species, including mice; are the results here substantially and significantly different from those previous studies? Furthermore, the experimental design does not distinguish between those gene expression phenotypes that are fixed between species as compared to those that are polymorphic within one or more species which prevents straightforward interpretation of differences in gene expression as interspecific differences.

      The conclusion that "Our results show that most of the genetic underpinnings of sex differences show no long-term evolutionary stability, which is in strong contrast to the perceived evolutionary stability of two sexes" - seems beyond the scope of this study. This manuscript does not address the genetic underpinnings of sex differences (this would involve eQTL or the like), rather it looks at sex differences in gene expression phenotypes. Simply addressing the question of phenotypic evolutionary stability would be more informative if genes expressed specifically in reproductive tissues were separated from somatic sex-biased genes to determine if they show similar patterns of expression evolution.

    1. Reviewer #2 (Public Review):

      This study utilized the LCMV Docile infection model, which induces chronic and persistent infection in mice, leading to T cell exhaustion and dysfunction. Through exogenous IL-2 fusion protein treatment during the late stage of infection, the researchers found that IL-2 treatment significantly enlarges the antigen-specific effector CD8 T cells, expanding the CXCR5-TCF1- exhausted population (Tex) while maintaining the size of the CXCR5+TCF1+ precursors of exhausted T cell population (Tpex). This preservation of the Tpex population's self-renewing capacity allows for sustained T cell proliferation and antiviral responses.

      The authors discovered a dual effect of IL-2 treatment: it decreases CXCR5 expression on Tpex cells, restricting their entry into the B cell follicle. This may explain why IL-2 treatment has little impact on overall viral control. However, this finding also suggests a potential application of IL-2 treatment for autoimmune diseases, as it can suppress specific immune responses within the B cell follicle. Using imaging-based approaches, the team provided direct evidence that IL-2 treatment shifts the viral load to concentrate within the B cell follicle, correlating with the observed decrease in CXCR5 expression.

      Further, the researchers showed that ectopic expression of constitutively active STAT5, downstream of IL-2 induced cytokine signaling, in P14 TCR transgenic T cells (specific for an LCMV epitope), drove the T cell population toward the CXCR5- Tex phenotype over the CXCR5+ Tpex cells in vivo. Additionally, abrogating Blimp1, upregulated by active IL-2-phosphorylated STAT5 signaling, restored the CXCR5+ Tpex population.

      Building on these results, the researchers used an engineered IL-2 fusion protein, ANV410, targeting the beta-chain of the IL-2 receptor CD122, which successfully replicated their earlier findings. Importantly, the Tpex-sustaining effect of IL-2 was only observed when treatment was administered during the late stage of infection, as early treatment suppressed Tpex cell generation. Immune profiling of SLE patients undergoing low-dose IL-2 treatment showed a similar reduction in the CXCR5+ Tpex cell population.

      This study provides compelling data on the physiological consequences of IL-2 treatment during chronic viral infection. By leveraging the chronic and persistent LCMV Docile infection model, the researchers identified the temporal effects of IL-2 fusion protein treatment, offering strategic insights for therapies targeting cancer and autoimmune diseases.

    1. Reviewer #2 (Public Review):

      In the revised manuscript, the authors tried to address some of my comments from the previous round of review. Notably, they have performed some additional ITC experiments where protein precipitation is not an issue to probe interactions between PARKIN and different domains. In addition, they have toned down some of the language in the text to better reflect their data and results. However, I still feel that the manuscript lacks some key answers regarding the relative interactions between p-PARKIN and different domains, as discussed in my previous review. A deeper dive into the underlying biophysical and biochemical features that drive these interactions is important to fully understand the importance of their work. However, this manuscript does provide some interesting potential insights into the mechanisms of PARKIN activation that could be useful for the field moving forward.

    1. Reviewer #3 (Public Review):

      Summary

      The high heterogeneity nature of α-synuclein (α-syn) fibrils posed significant challenges in structural reconstruction of the ex vivo conformation. A deeper understanding of the factors influencing the formation of various α-syn polymorphs remains elusive. The manuscript by Frey et al. provides a comprehensive exploration of how pH variations (ranging from 5.8 to 7.4) affect the selection of α-syn polymorphs (specifically, Type1, 2 and 3) in vitro by using cryo-electron microscopy (cryo-EM) and helical reconstruction techniques. Crucially, the authors identify two novel polymorphs at pH 7.0 in PBS. These polymorphs bear resemblance to the structure of patient-derived juvenile-onset synucleinopathy (JOS) polymorph and diseased tissue amplified α-syn fibrils. The revised manuscript more strongly supports the notion that seeding is a non-polymorph-specific in the context of secondary nucleation-dominated aggregation, underscoring the irreplaceable role of pH in polymorph formation.

      Strengths

      This study systematically investigates the effects of environmental conditions and seeding on the structure of α-syn fibrils. It emphasizes the significant influence of environmental factors, especially pH, in determining the selection of α-syn polymorphs. The high-resolution structures obtained through cryo-EM enable a clear characterization of the composition and proportion of each polymorph in the sample. Collectively, this work provides a strong support for the pronounced sensitivity of α-syn fibril structures to the environmental conditions and systematically categorizes previously reported α-syn fibril structures. Furthermore, the identification of JOS-like polymorph also demonstrates the possibility of in vitro reconstruction of brain-derived α-syn fibril structures.

      Weaknesses

      All my previous concerns have been resolved to my satisfaction.

    1. Reviewer #2 (Public Review):

      Summary:

      There is significant interest in characterizing the mechanisms by which genetic mutations linked to autoimmunity perturb immune processes. Pahl et al. collect information of dynamic accessible regions, genes, and 3D contacts in primary CD4+ T cell samples that have been stimulated ex vivo. The study includes a variety of analyses characterizing these dynamic changes. With TF footprinting they propose factors linked to active regulatory elements. They compare the performance of their variant mapping pipeline that uses their data versus existing datasets. Most compelling there was a deep dive into additional study of regulatory elements nearby the IL2 gene. Finally, they perform a pharmacological screen targeting several genes they suggest are involved in T cell proliferation.

      Strengths:

      - The work done characterizing elements at the IL2 locus is impressive.

      Weaknesses:

      - There are extensive studies performed on resting and activated immune cell states (CD4+ T cells and other cell types) and some at multiple time points or concentrations of stimuli that collect ATAC-seq and/or RNA-seq. Several analyses performed in published studies were similarly performed in this study. I expected the authors to at least briefly mention published studies and whether their conclusions generally agree or disagree. Are the same dynamic regulatory regions or genes identified upon T cell activation? Are the same TF footprints enriched in these dynamic regulatory elements? In the revision, I appreciate that the authors now include additional data from several studies that I had initially suggested for the purposes of nominating disease genes in their precision-recall analysis.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors aimed to elucidate the role of AARS2, an alanyl-tRNA synthase, in mouse hearts, specifically its impact on cardiac function, fibrosis, apoptosis, and metabolic pathways under conditions of myocardial infarction (MI). By investigating the effects of both deletion and overexpression of AARS2 in cardiomyocytes, the study aims to determine how AARS2 influences cardiac health and survival during ischemic stress.

      The authors successfully achieved their aims by demonstrating the critical role of AARS2 in maintaining cardiomyocyte function under ischemic conditions. The evidence presented, including genetic manipulation results, functional assays, and mechanistic studies, robustly supports the conclusion that AARS2 facilitates cardiomyocyte survival through PKM2-mediated metabolic reprogramming. The study convincingly links AARS2 overexpression to improved cardiac outcomes post-MI, validating the proposed protective AARS2-PKM2 signaling pathway.

      This work may have a significant impact on the field of cardiac biology and ischemia research. By identifying AARS2 as a key player in cardiomyocyte survival and metabolic regulation, the study opens new avenues for therapeutic interventions targeting this pathway. The methods used, particularly the cardiomyocyte-specific genetic models and ribosome profiling, are valuable tools that can be employed by other researchers to investigate similar questions in cardiac physiology and pathology.

      Understanding the metabolic adaptations in cardiomyocytes during ischemia is crucial for developing effective treatments for MI. This study highlights the importance of metabolic flexibility and the role of specific enzymes like AARS2 in facilitating such adaptations. The identification of the AARS2-PKM2 axis adds a new layer to our understanding of cardiac metabolism, suggesting that enhancing glycolysis can be a viable strategy to protect the heart from ischemic damage.

      Strengths:

      (1) Comprehensive Genetic Models: The use of cardiomyocyte-specific AARS2 knockout and overexpression mouse models allowed for precise assessment of AARS2's role in cardiac cells.

      (2) Functional Assays: Detailed phenotypic analyses, including measurements of cardiac function, fibrosis, and apoptosis, provided evidence for the physiological impact of AARS2 manipulation.

      (3) Mechanistic Insights: This study used ribosome profiling (Ribo-Seq) to uncover changes in protein translation, specifically highlighting the role of PKM2 in metabolic reprogramming.

      (4) Therapeutic Relevance: The use of the PKM2 activator TEPP-46 to reverse the effects of AARS2 deficiency presents a potential therapeutic avenue, underscoring the practical implications of the findings.

      Weaknesses:

      (1) Species Limitation: The study is limited to mouse and rat models, and while these are highly informative, further validation in human cells or tissues would strengthen the translational relevance.

      (2) Temporal Dynamics: The study does not extensively address the temporal dynamics of AARS2 expression and PKM2 activity during the progression of MI and recovery, which could offer deeper insights into the timing and regulation of these processes.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper from the Barford lab describes medium/high-resolution cryo-EM structures of three versions of the S. cerevisiae anaphase-promoting complex/cyclosome (APC/C):

      (1) the recombinant apo complex purified from insect cells,

      (2) the apo complex phosphorylated in vitro by cyclin-dependent kinase, and

      (3) an active APC/C-Cdh1-substrate ternary complex.

      The focus of the paper is on comparing similarities and differences between S. cerevisiae and human APC/C structures, mechanisms of activation by coactivator, and regulation by phosphorylation. The authors find that the overall structures of S. cerevisiae and human APC/C are remarkably similar, including the binding sites and orientation for the substrate-recruiting coactivator, Cdh1. In addition, the mechanism of Cdh1 inhibition by phosphorylation appears conserved across kingdoms. However, key differences were also observed that reveal divergence in APC/C mechanisms that are important for researchers in this field to know. Specifically, the mechanism of APC/C-Cdc20 activation by mitotic phosphorylation appears to be different, due to the absence of the key Apc1 autoinhibition loop in the S. cerevisiae complex. In addition, the conformational activation of human APC/C by coactivator binding was not observed in the S. cerevisiae complex, implying that stimulation of E2 binding must occur via a different mechanism in this species.

      Strengths:

      Consistent with the numerous prior cryo-EM structures of human APC/C from the Barford lab, the technical quality of the structure models is a major strength of this work. In addition, the detailed comparison of similarities and differences between the two species will be a very valuable resource for the scientific community. The manuscript is written very well and allows readers lacking expertise in cryo-EM to understand the important aspects of the conservation of APC/C structure and mechanism across kingdoms.

      Weaknesses:

      The lack of experimentation in this work to test some of the putative differences in APC/C mechanism (e.g. stimulation of E2 binding by coactivator and stimulation of activity by mitotic phosphorylation) could be considered a weakness. Nonetheless, the authors do a nice job explaining how the structure interpretations imply these differences likely exist, and this work sets the stage nicely for future studies to understand these differences at a mechanistic level. There is enough value in having the S. cerevisiae structure models and the comparison to the human structures, without any additional experimentation.

      The validation of APC/C phosphorylation in the unphosphorylated and hyperphosphorylated states is not very robust. Given the lack of significant effects of phosphorylation on APC/C structure observed here (compared to the human complex), this becomes important. A list of phosphorylation sites identified by mass spec before and after in vitro phosphorylation is provided but lacks quantitative information. This list indicates that a significant number of phosphorylation sites are detected in the purified APC/C prior to reaction with purified kinases. Many more sites are detected after in vitro kinase reaction, but it isn't clear how extensively any of the sites are modified. There is reason for caution then, in accepting the conclusions that structures of unphosphorylated and hyperphosphorylated APC/C from S. cerevisiae are nearly identical.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In this manuscript the authors examine the question of whether discrete action sequences and coarticulated continuous sequential actions can be produced from the same controller, without having to derive separate control policies for each sequential movement. Using modeling and behavioral experiments, the authors demonstrate that this is indeed possible if the constraints of the policy are appropriately specified. These results are of interest to those interested in motor sequences, but it is unclear whether these findings can be interpreted to apply to the control of sequences more broadly (see weaknesses below).

      Strengths:<br /> The authors provide an interesting and novel extension of the stochastic optimal control model to demonstrate how different temporal constraints can lead to either individual or coarticulated movements. The authors use this model to make predictions about patterns of behavior (e.g., in response to perturbations), which they then demonstrate in human participants both by measuring movement kinematics as well as EMG. Together this work supports the authors' primary claims regarding how changes in task instructions (i.e., task constraints) can result in coarticulated or separated movement sequences and the extent to which the subsequent movement goal affects the planning and control of the previous movement.

      Weaknesses:<br /> Although this work is quite interesting, it remains unknown whether there is a fundamental distinction between a coarticulated sequence and a single movement passing through a via point (or equivalently, avoiding an obstacle). The notion of a coarticulated sequence brings with it the notion of sequential (sub)movements and temporal structure, whereas the latter can really be treated as more of a constraint on the production of a single continuous movement. The authors suggest that these are not truly different kinds of movements at the level of a control policy, but this remains to be tested experimentally.

      It also remains unclear for the theory of optimal feedback control as a whole where and how the cost function and constraints are specified to guide the optimization process. That is, presumably there is the ability for higher-level or explicit description of these constraints, but how they then become incorporated into a control policy remains unclear. With regard to the kind of multi-target constraints proposed here, in typical sequence tasks, while some movements become coarticulated, people also tend to form chunks with distinct chunk boundaries. This presumably means that there is at least some specification of the sequential ordering of these chunks that must exist beyond the control policy and that multiple control policies may still be warranted to execute an entire sequence (otherwise the authors' model might suggest that people can coarticulate forever without needing to exhibit any chunk boundaries). Hence, while the authors fairly convincingly show that a single control policy can lead to separated or coarticulated movements given an appropriate set of constraints, their work does not speak to where or how those constraints are specified, nor to how longer sequences are controlled.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper addresses an important computational problem in learning and memory. Why do related memory representations sometimes become more similar to each other (integration) and sometimes more distinct (differentiation)? Classic supervised learning models predict that shared associations should cause memories to integrate, but these models have recently been challenged by empirical data showing that shared associations can sometimes cause differentiation. The authors have previously proposed that unsupervised learning may account for these unintuitive data. Here, they follow up on this idea by actually implementing an unsupervised neural network model that updates the connections between memories based on the amount of coactivity between them. The authors use their modeling framework to simulate three recent empirical studies, showing that their model captures aspects of these findings that are hard to account for with supervised learning.

      Overall, this is a strong and clearly described work that is likely to have a positive impact on computational and empirical work in learning and memory. While the authors have written about some of the ideas discussed in this paper previously, a fully implemented and openly available model is a clear advance that will benefit the field. It is not easy to translate a high-level description of a learning rule into a model that actually runs and behaves as expected. The fact that the authors have made all their code available makes it likely that other researchers will extend the model in numerous interesting ways, many of which the authors have discussed and highlighted in their paper.

      Strengths:

      The authors succeed in demonstrating that unsupervised learning with a simple u-shaped rule can produce results that are qualitatively in line with the empirical reports. In each of the three models, the authors manipulate stimulus similarity (following Chanales et al.), shared vs distinct associations (following Favila et al.), or learning strength (a stand-in for blocked versus interleaved learning schedule; following Schlichting et al.). In all cases, with hand-tuning of additional parameters, the authors are able to produce model representations that fit the empirical results, but that can't easily be accounted for by supervised learning. Demonstrating these effects isn't trivial and a formal modeling framework for doing so is a valuable contribution. Overall, the work is very thorough. The authors investigate many different aspects of the learning dynamics (learning rate, oscillation strength, hidden layer overlap etc) in these models and produce several key insights. Of particular value are their demonstrations that when differentiation occurs, it occurs very quickly and asymmetrically and results in anti-correlated representations, as well as the distinction between symmetric and asymmetric integration in their model. The authors thoroughly acknowledge the relative difficulty of producing differentiation in their models relative to integration, and are now more clear about why they don't necessarily view this as mismatch with the empirical data. The authors are also more clear about the complicated activation dynamics in their model and why critical ranges for some parameters can't be given -- the number of interacting parameters mean that there are many combinations that could produce the critical activation dynamics and thus the same result. Despite this complexity, the paper is very clearly written; the authors do a good job of both formally describing their model as well as giving readers a high level sense of how many of their critical model components work.

      Weaknesses:

      Though the u-shaped learning rule is essential to this framework, the paper doesn't do any formal investigation of this learning rule or comparison with other learning rules. The authors do have a strong theoretical interest in this rule as well as experimental precedent for testing this rule, which they now thoroughly discuss in the paper. Still, a stronger argument in support of the non monotonic plasticity hypothesis could have been made by comparing this learning rule to alternatives. Additionally, the authors' choice of strongly prewiring associations makes it difficult to think about how their model maps onto experimental contexts where associations are only weakly learned. However, the authors thoroughly acknowledge why this was necessary and discuss this limitation in the paper.

    1. Reviewer #2 (Public Review):

      The study by Link et al. advances our understanding of the actomyosin system in T. brucei, focusing on the role of TbMyo1, a class I myosin, within the parasite's endosomal system. Using a combination of biochemical fractionation, in vitro motility assays, and advanced imaging techniques such as correlative light and electron microscopy (CLEM), this paper demonstrates that TbMyo1 is dynamically distributed across early and late endosomes, the cytosol, is associated with the cytoskeleton, and a fraction has an unexpected association with glycosomes. Notably, the study shows that TbMyo1 can translocate actin filaments at velocities suggesting an active role in intracellular trafficking, potentially higher than those observed for similar myosins in other cell types. This work not only elucidates the spatial dynamics of TbMyo1 within T. brucei but also suggests its broader involvement in maintaining the complex architecture of the endosomal network, underscoring the critical role of the actomyosin system in a parasite that relies on high rates of endocytosis for immune evasion.

      A key strength of the study is its exceptional rigor and successful integration of a wide array of sophisticated techniques, such as in vitro motility assays, and advanced imaging methods, e.g. CLEM. This combination of approaches underscores the study's comprehensive approach to examining the ultrastructural organization of the trypanosome endomembrane system. The application of functional data using inhibitors, such as latrunculin A for actin depolymerization, further strengthens the study by providing insights into the dynamics and regulatory mechanisms of the endomembrane system. This demonstrates how the actomyosin system contributes to cellular morphology and trafficking processes. Furthermore, the discovery of TbMyo1 localization to glycosomes introduces a novel aspect to the potential roles of myosin I proteins within the cell, particularly in the context of organelles analogous to peroxisomes. This observation not only broadens our understanding of myosin I functionality but also opens up new avenues for research into the cell biology of trypanosomatids, marking a significant contribution to the field.

      A significant initial weakness was the reliance on spatial association data to infer functional relationships without direct demonstration of biochemical activities in vivo. The authors have since addressed this by including new evidence from TbMyo1 RNAi cell lines and EM data that show the effects of TbMyo1 depletion on cellular ultrastructure. The authors' responses and additional data reinforce their initial conclusions and address previous concerns. Several new, elegant hypotheses are proposed in the discussion that warrant further investigation to fully understand TbMyo1's interactions and regulatory mechanisms in vivo.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to uncover which brain regions might support the continuous updating of semantic associations thereby showing a system of semantic plasticity. Using fMRI data from participants viewing thousands of natural scene images over 30 recording sessions, they hoped to establish how objects co-occuring with each other within images influences the semantic representations in the human brain that relate to those object concepts.

      Strengths:

      There is a lot to like about the paper. A major strength of the methods and results is the convincing demonstration of many of the results. This includes showing item representations in the ventral visual pathway and medial temporal lobes (MTL), as we would expect. They also show semantic effects - defined using the word co-occurrence vectors from word2vec, along the posterior and anterior ventral visual pathway and MTL - replicating various past studies. The authors use a creative approach to show that the item representations measured within each session are modulated by the co-occurrence structure in previous trials, becoming more closely related. And that item representations seem to subtly change over the course of the 30 sessions, in that they become less related to each other with increasing distance. However, the semantic effects within each session itself are claimed to remain unchanged.

      Weaknesses:

      This leads to what I see as a weakness in the study. The conclusions relate to semantic plasticity and the changes in semantic (associative) representations. The drift analyses do appear to show representational changes across the sessions, but this is based on the item representations. The inference is that this is due to an updating of knowledge about the associations each item has had with other items. Yet, in the same regions, the authors suggest that semantic associative effects, as tested using word2vec for each session, remain stable. Doesn't this seem to contradict the claims about semantic plasticity?

      Some of this is difficult to unpick as the semantic stability analysis using word2vec in each session is only very briefly mentioned, and the data is not shown (I would include it). So, at present, I feel they show evidence of representational changes but do not show evidence of what the nature of the change is. If the neural representations consistently reflect the long-term semantic associations (which is what word2vec captures), then how does this combine with the drift effects of item representations?

      Does it mean that the changes in item representations do not reflect semantic associative knowledge? And reflect some other non-specified type of information (perhaps as the participants are doing an image memory test).

      Another potential weakness is the robustness of the drift analysis itself. For the drift analysis, item representations in each session are compared to all other sessions and then averaged according to the number of intervening sessions. This means the data for item representation with a session difference of 1 will be based on 29 data points, a session difference of 2 on 28 data points ... and a session difference of 29 based on 1 data point. So there is a huge imbalance in the amount of data that goes into the analysis for the different numbers of intervening sessions. This leads me to wonder if it could impact the validity of the results. An alternative might be to use 1 datapoint for each session (or a suitable value, I imagine 5 would still give enough data to analyse drifts) and calculate drift, and then repeat this with different partitions of the data to see how stable it is, and if drift is reliably occurring. Alternatively, the analyses they use might have been used and validated previously.

      To be clear, I do think this is a very nice study and will have a positive impact on researchers interested in object processing, semantic knowledge, statistical learning, and schemas. But think there are some gaps between what the data shows evidence for, and the ultimate inferences made.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript, "Activation of Polycystin-1 Signaling by Binding of Stalk-derived Peptide Agonists", by Miao and coworkers. The autosomal dominant polycystic kidney disease (ADPKD) is a major form of polycystic kidney disease (PKD). To provide better treatment and avoid side effects associated with currently available options, the authors investigated an interesting GPCR, polycystin-1 (PC1), as a potential therapeutic target. In vitro and in silico studies were combined to identify peptide agonists for PC1 and to elucidate their roles in PC1 signaling. Overall, regarding the significance of the findings, this work described valuable peptide agonists for PC1 and the combined in vitro and in silico approach can be useful to study a complex system like PC1. However, the strength of the evidence is incomplete, as more experiments are needed as controls to validate the computational observations. The work appears premature.

      Strengths:

      (1) This work first described the experimental discovery of short peptides designed to mimic the stalk region of PC1, followed by computational investigation using docking and MD simulations. PC1 is a complex membrane protein and an emerging target for ADPKD, but it can be challenging to study. The knowledge and the peptide discovery can be valuable and useful to understand the mechanism and potential modulation of PC1.<br /> (2) The authors published the mechanistic study of PC1 and identified key interacting residues such as N3074-S3585 and R3848-E4078, using very similar techniques (PNAS 2022, 119(19), e2113786119). This work furthers this research by identifying peptides that are stalk mimics for PC1 activation.<br /> (3) Eight peptides were designed and tested experimentally first; three were computationally studied with docking and GaMD simulations to understand their mechanism (s).

      Weaknesses:

      (1) The selectivity of the peptides between PC1 and PC2 remains unknown in this revision.

      Overall, my comments were mostly addressed properly.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Djebar et al investigated the role and the underlying mechanism of the ciliary transition zone protein Rpgrip1l in zebrafish spinal alignment. They showed that rpgrip1l mutant zebrafish develop a nearly full penetrance of body curvature at juvenile stages. The mutant fish have cilia defects associated with ventricular dilations and loss of the Reissner fibers. Scoliosis onset and progression are also strongly associated with astrogliosis and neuroinflammation, and anti-inflammatory drug treatment prevents scoliosis in mutant zebrafish, suggesting a novel pathogenic mechanism for human idiopathic scoliosis. This study is quite comprehensive with high quality data, and the manuscript is well written, providing important information on how the ciliary transition zone protein functions in maintaining the zebrafish body axis straightness.

      Strengths:

      Very clear and comprehensive analysis of the mutant zebrafish.

    1. Reviewer #2 (Public Review):

      In this manuscript, the authors attempted to study mechanisms of transcription inhibition in cells treated with IR. They observed that unlike transcription inhibition induced by UV damage that depends on histone chaperone HIRA, IR induced transcription inhibition is independent on HIRA. Through a CRISPR/Cas9 screen, they identified protein neddylation is important for transcription inhibition. By sequencing nascent RNA, they observed that down-regulated transcripts upon IR treatment are largely highly transcribed genes including histone genes and rDNA.

      This study utilized comprehensive approaches to fill in knowledge gap of IR-induced transcription inhibition.

      Comments on current version:

      The revised manuscript largely addressed my concerns.

    1. Reviewer #2 (Public Review):

      Summary:

      In the manuscript by Oestreicher et al, the authors use patch-clamp electrophysiology, immunofluorescent imaging of the cochlea, auditory function tests, and single-unit recordings of auditory afferent neurons to probe the unique properties of calcium signaling in cochlear hair cells that allow rapid and sustained neurotransmitter release. The calcium binding proteins (CaBPs) are thought to modify inactivation of the Cav1.3 calcium channels in IHCs that initiate vesicle fusion, reducing the calcium-dependent inactivation (CDI) of the channels to allow sustained calcium influx to support neurotransmitter release. The authors use knockout mice of Cabp1 and Cabp2 in a double knockout (Cabp1/2 DKO) to show that these molecules are required for enabling sustained calcium currents by reducing CDI, enabling proper IHC neurotransmitter release. They further support their evidence by re-introducing Cabp2 using injection of AAV containing the Cabp2 sequence into the cochlea, which restores some of the auditory function and reduces CDI in patch-clamp recordings.

      Strengths:

      Overall the data is convincing that Cabp1/2 is required for reducing CDI in cochlear hair cells, allowing their sustained neurotransmitter release and sound encoding. Figures are well-prepared, recordings are careful and stats are appropriate, and the manuscript is well written. The discussion appropriately considers aspects of the data that are not yet explained and await further experimentation.

      Weaknesses:

      There are some sections of the manuscript that pool data from different experiments with slightly different conditions (wt data from a previous paper, different calcium concentrations, different holding voltages, tones vs clicks, etc). This makes the work harder to follow and more complicated to explain. However, the major conclusion, that that cabp1 and 2 work together to reduce calcium dependent inactivation of L-type calcium channels in cochlear inner hair cells, still holds and is well supported. Another minor weakness is that the authors used injections of AAV containing sequences for Cabp2, but do not present data from sham surgeries. In most cases, the improvement of hearing function with AAV injection is believable and should be attributed to the cabp2 function. However, in at least one instance (Figure 4B), the results of the AAV injection experiments may be overinterpreted - the authors show that upon AAV injection, the hair cells have a much longer calcium current recovery following a large, long depolarization to inactivate the calcium channels. Without comparison to a sham surgery, it is not known if this result could be a subtle result of the surgery or indeed due to the Cabp2 expression. The authors have added text acknowledging this, as appropriate.

    1. Reviewer #3 (Public Review):

      In this study, Wang and coworkers established a model of Drosophila-S. marcescens interactions and thoroughly examined host-microbe bidirectional interactions. They found that:

      (1) Drosophila larvae directly impact microbial aggregation and density;<br /> (2) Drosophila larvae affect microbial metabolism and cell wall morphology, as evidenced by reduced prodigiosin production and EPS production, respectively;<br /> (3) Drosophila larvae attenuate microbial virulence;<br /> (4) Drosophila larvae modulate the global transcription of microbes for adaptation to the host;<br /> (5) Microbial single-cell RNA sequencing (scRNA-seq) analysis revealed heterogeneity in microbial pathogenicity and growth;<br /> (6) AMPs are key factors controlling microbial virulence phenotypes.

      Taken together, they concluded that host immune factors such as AMPs are directly involved in the pathogen-to-commensal transition by altering microbial transcription.

      In general, in this revised version, I feel that the authors addressed all the points raised in the previous review process. Specifically, they demonstrated that sub-lethal doses of antibiotics such as kanamycin or ampicillin is sufficient to induce the virulence switch in S. marcescens. Furthermore, by testing IMD pathway mutant animals, they concluded that AMP plays a major role in the commensal-to-pathogen transition. In summary, I appreciate the authors' efforts, and I am satisfied with the revision.

    1. Reviewer #2 (Public Review):

      This study by Bell et al. focuses on understanding the roles of two alternatively spliced exons in the single Drosophila Cav2 gene cac. The authors generate a series of cac alleles in which one or the other mutually exclusive exons are deleted to determine the functional consequences at the neuromuscular junction. They find alternative splicing at one exon encoding part of the voltage sensor impacts the activation voltage as well as localization to the active zone. In contrast, splicing at the second exon pair does not impact Cav2 channel localization, but it appears to determine the abundance of the channel at active zones. Together, the authors propose that alternative splicing at the Cac locus enables diversity in Cav2 function generated through isoform diversity generated at the single Cav2 alpha subunit gene encoded in Drosophila.

      Overall this is an excellent, rigorously validated study that defines unanticipated functions for alternative splicing in Cav2 channels. The authors have generated an important toolkit of mutually exclusive Cac splice isoforms that will be of broad utility for the field, and show convincing evidence for distinct consequences of alternative splicing of this single Cav2 channel at synapses. Importantly, the authors use electrophysiology and quantitative live sptPALM imaging to determine the impacts of Cac alternative splicing on synaptic function. There are some outstanding questions regarding the mechanisms underlying the changes in Cac localization and function, and some additional suggestions are listed below for the authors to consider in strengthening this study. Nonetheless, this is a compelling investigation of alternative splicing in Cav2 channels that should be of interest to many researchers.

    1. Reviewer #2 (Public Review):

      Guan and colleagues address the question of how a single neuroblast produces a defined number of progeny, and what influences its decommissioning. The focus of the experiments are two well-studied RNA-binding proteins: Imp and Syp. The Authors find that these factors play an important role in determining the number of neurons in their preferred model system of VNC motor neurons coming from a single lineage (LinA/15) by separate functions taking place at specific stages of development of this lineage: influencing the life-span of the LinA neuroblast to control its timely decommissioning and functioning in the Late-born post-mitotic neurons to influence cell death after the appropriate number of progeny is generated. The post-mitotic role of Imp/Syp in regulating programmed-cell death (PCD) is also correlated with a specific code of key transcription factors that are suspected to influence neuronal identity, linking the fate of neuronal survival with its specification. This paper addresses a wide scope of phenotypes related to the same factors, thus providing an intriguing demonstration of how the nervous system is constructed by context-specific changes in key developmental regulators. The bulk of conclusions drawn by the authors are supported by careful experimental evidence, and the findings are a useful addition to an important topic in developmental neuroscience.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors present an interesting technique for analysis of diffusion magnetic resonance images (dMRI) using a sub-diffusion model of the diffusion process. They show that the results of their technique when fitted to dMRI with two diffusion times provide robust diffusion coefficient and kurtosis measures.

      Strengths:

      The measures provided by the sub-diffusion technique are robust and can be reliably estimated from short dMRI data acquisitions. This is potentially useful in application to clinical studies.

      Weaknesses:

      The authors do not fully demonstrate that their D* and K* measures are not affected by diffusion time. Potential limitations of the technique are not considered.

      This reviewer suggests that the paper would benefit from considerations of the limitations of the applied techniques. This would include consideration of:<br /> (i) The use of the sub-diffusion model in the simulation studies - there are circular arguments that should be considered.<br /> (ii) The time dependence of D* and K*. This is because the human data provided in Tables 3 and 4 (for Δ=19ms and Δ=49ms) seem to show that<br /> D* and K* are time dependent.

      With respect to the second point this reviewer acknowledges the authors' argument that when the fitting is performed over the higher dimensional space that includes multiple diffusion times then this leads to a more robust estimation of sub-diffusion measures. However, the authors only include two diffusion times in their in-vivo human analysis (Δ=19ms and Δ=49ms) so it is not possible for them to show here that different pairs of diffusion times lead to invariant D* and K* values. This is a limitation of the study as the authors show there is time dependence of D* and K* in tables 3 and 4 (when the model is fitted to single diffusion times). Potentially the larger apparent time dependence of K* in white matter compared to grey matter (tables 3 and 4) could lead to the tissue specific differences in root mean squared error shown in Figure 7.

      This reviewer requests that the authors discuss their results more clearly with respect to these potential limitations and include some discussion of their single (and multiple) diffusion time results (for D_SUB and K*) in comparison with the time dependent DKI literature.

    1. Reviewer #2 (Public Review):

      Summary:<br /> Replacing linezolid (L) with the preclinical development candidate spectinamide 1599, administered by inhalation, in the BPaL standard of care regimen achieves similar efficacy, reduces hematological changes and por-inflammatory responses.

      Strengths:<br /> The authors not only measure efficacy but also quantify histological changes, hematological responses and immune responses, to provide a comprehensive picture of treatment response and the benefits of the L to S substitution.

      The authors generate all data in two mouse models of TB infection, each reproducing different aspects of human histopathology.

      Extensive supplementary figures ensure transparency.

      Weaknesses:<br /> Articulation of objectives and hypotheses can be improved, as suggested below.

    1. Reviewer #2 (Public Review):

      Strengths:

      The experiments were well-designed and executed with meticulous control. The analyses of both behavioural and electrophysiological data align with the standards in the field.

      Weaknesses:

      Many of the findings appear to be subtle differences and incremental compared to previous literature, including the authors' own work. While incremental findings are not necessarily a problem, the manuscript lacks clear statements about the extent to which the dataset, analysis, and findings overlap with the authors' prior research. For example, one of the main findings, which suggests that V4 neurons exhibit larger visual responses in hit trials (as shown in Fig. 3), appears to have been previously reported in their 2017 paper.

      Furthermore, the manuscript does not explore potentially interesting aspects of the dataset. For instance, the authors could have investigated instances where monkeys made 'false' reports, such as executing saccades towards visual stimuli when no orientation change occurred, which allows for a broader analysis that considers the perceptual component of neural activity over pure sensory responses. Overall, lacking broad interest with the current form.

    1. Reviewer #2 (Public Review):

      Studying Apteronotus leptorhynchus (the weakly electric brown ghost knifefish), the authors provide evidence that 'chirps' (brief modulations in the frequency and amplitude of the ongoing wave-like electric signal) function in active sensing (specifically homeoactive sensing) rather than communication. Chirping is a behavior that has been well studied, including numerous studies on the sensory coding of chirps and the neural mechanisms for chirp generation. Chirps are largely thought to function in communication behavior, so this alternative function is a very exciting possibility that should have a great impact on the field.

      The authors provide convincing evidence that chirps may function in homeoactive sensing. In particular, the evidence showing increased chirping in more cluttered environments and a relationship between chirping and movement are especially strong and suggestive. Their evidence arguing against a role for chirps in communication is not as strong. However, based on an extensive review of the literature, the authors conclude, I think fairly, that the evidence arguing in favor of a communication function is limited and inconclusive. Thus, the real strength of this study is not that it conclusively refutes the communication hypothesis, but that it calls this hypothesis into question while also providing compelling evidence in favor of an alternative function.

      In summary, although the evidence against a role for chirps in communication is not as strong as the evidence for a role in active sensing, this study presents very interesting data that is sure to stimulate discussion and follow-up studies. The authors acknowledge that chirps could function as both a communication and homeactive sensing signal, and the language arguing against a communication function is appropriately measured. A given electrical behavior could serve both communication and homeoactive sensing. I suspect this is quite common in electric fish (not just in gymnotiforms such as the species studied here, but also in the distantly related mormyrids), and perhaps in other actively sensing species such as echolocating animals.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript reports a comparison of microbial traits and host response traits in a laboratory model of infected granuloma using Mtb strains from different lineages. The authors report increased bacillary growth and granuloma formation, inversely associated with T cell activation that is characterized by CXCL9, granzyme B, and TNF expression. They therefore infer that these T cell responses are likely to be host-protective and that the greater virulence of modern Mtb lineages may be driven by their ability to avoid triggering these responses.

      Strengths:

      The comparison of multiple Mtb lineages in a granuloma model that enables evaluation of the potential role of multiple host cells in Mtb control offers a valuable experimental approach to studying the biological mechanisms that underpin differential virulence of Mtb lineages that have been previously reported in clinical and epidemiological studies.

      Weaknesses:

      The study is rather limited to descriptive observations and lacks experiments to test causal relationships between host and pathogen traits. Some of the presentation of the data is difficult to interpret, and some conclusions are not adequately supported by the data.

    1. Reviewer #2 (Public Review):

      Choi et al. describe a new approach for enabling input-specific CRISPR-based genome editing in cultured cells. While CRISPR-Cas9 is a broadly applied system across all of biology, one limitation is the difficulty in inducing genome editing based on cellular events. A prior study, from the same group, developed ENGRAM - which relies on activity-dependent transcription of a prime editing guide RNA, which records a specific cellular event as a given edit in a target DNA "tape". However, this approach is limited to the detection of induced transcription and does not enable the detection of broader molecular events including protein-protein interactions or exposure to small molecules. As an alternative, this study envisioned engineering the reconstitution of a split prime editing guide RNA (pegRNA) in a protein-protein interaction (PPI)-dependent manner. This would enable location- and content-specific genome editing in a controlled setting.

      The authors explored three different design possibilities for engineering a PPI-dependent split pegRNA. First, they tried splitting pegRNA into a functional sgRNA and corresponding prime editing transRNA, incorporating reverse-complementary dimerization sequences on each guide half. This approach, however, resulted in low editing efficiency across 7 different designs with various complementary annealing template lengths (<2% efficiency). They also tried inserting a self-splicing ribozyme within the pegRNA, which produces a functional pegRNA post-transcriptionally. The incorporation of a split-ribozyme, dependent on a PPI, could have been used to reconstitute the split pegRNA in an event-controlled manner. However again, only modest levels of editing were observed with the self-splicing ribozyme design (<2%). Finally, they tried splitting the pegRNA at the repeat:anti-repeat junction that was used to join the original dual-guide system comprised of a crRNA and tracrRNA, into a single-guide RNA. They incorporated the prime editing features into the tracrRNA half, to create petracrRNA. Dimerization was initially induced by different complementary RNA annealing sequences. Using this design, they were able to induce an editing efficiency of ~28% (compared to 37% efficiency using a positive control epegRNA guide).

      Having identified a suitable split pegRNA system, they next sought to induce the reconstitution of the two halves in a PPI-dependent manner. They replaced the complementary RNA annealing sequences with two different RNA aptamers (MS2 and BoxB). MS2 detects the MCP protein, while BoxB detects the LambdaN protein. Close proximity between MCP and LambdaN would thus bring together the two split pegRNA halves, creating a functional pegRNA that would enable prime editing at a specific target site. They demonstrated that they could induce MCP-BoxB proximity by fusing them to different dimerizing protein partners: 1) constitutive epitope-nanobody/antibody pairs such as scFv/GCN4 or NbALFA/ALFA-Tag; 2) split-GFP; or 3) chemically-induced protein pairs such as FKBP/FRB or ABI/PYL. For all of these approaches, they could achieve between ~20-60% normalized editing efficiency (relative to positive control editing levels with epegRNA). Additional mutation of the linkers between the RNA and aptamers could increase editing efficiency but also increase non-specific background editing even in the absence of an induced PPI.

      Additional applications of this overall strategy included incorporating the design with different DNA base editors, with the most promising examples shown with the base editors CBE4max and ABE8. It should be noted that these specific examples used a non-physiological LambdaN-MCP direct fusion protein as the "bait" that induced reconstitution of the two halves of the guideRNA, rather than relying on a true induced PPI. They also demonstrated that the recently reported RADARS strategy could be incorporated into their system. In this example, they used an ADAR-guide-RNA to drive the expression of a LambdaN-PCP fusion protein in the presence of a specific target RNA molecule, IL6. This induced LambdaN-PCP protein could then reconstitute the split peg-RNAs to drive prime editing. To enable this last application, they replaced the MS2 aptamer in their pegRNA with the PP7 aptamer that binds the PCP protein (this was to avoid crosstalk with RADARS, which also uses MS2/MCP interaction). Using this strategy, they observed a normalized editing efficiency of around 12% (but observed non-specific editing of around 8% in the absence of the target RNA).

      Strengths:

      The strengths of this paper include an interesting concept for engineering guide RNAs to enable activity-dependent genome editing in living cells in the future, based on discreet protein-protein interactions (either constitutively, spatially, or chemically induced). Important groundwork is laid down to engineer and improve these guide RNAs in the future (especially the work describing altering the linkers in Supplementary Figure 3 - which provides a path forward).

      Weaknesses:

      In its current state, the editing efficiency appears too low to be applied in physiological settings. Much of the latter work in the paper relies on a LambdaN-MCP direction fusion protein, rather than two interacting protein pairs. Further characterizations in the future, especially varying the transfection amounts/durations/etc of the various components of the system, would be beneficial to improve the system. It will also be important to demonstrate editing at additional sites; to characterize how long the PPI must be active to enable efficient prime editing; and how reversible the reconstitution of the split pegRNA is.

    1. Reviewer #2 (Public Review):

      The authors address the question of differences in the development of the central complex (Cx), a brain structure mainly controlling spatial orientation and locomotion in insects, which can be traced back to the neuroblast lineages that produce the Cx structure. The lineages are called type-II neuroblast (NB) lineages and are assumed to be conserved in insects. While Tribolium castaneum produces a functional larval Cx that only consists of one part of the adult Cx structure, the fan-shaped body, in Drosophila melanogaster a non-functional neuropile primordium is formed by neurons produced by the embryonic type-II NBs which then enter a dormant state and continue development in late larval and pupal stages.

      The authors present a meticulous study demonstrating that type-II neuroblast (NB) lineages are indeed present in the developing brain of Tribolium castaneum. In contrast to type-I NB lineages, type-II NBs produce additional intermediate progenitors. The authors generate a fluorescent enhancer trap line called fez/earmuff which prominently labels the mushroom bodies but also the intermediate progenitors (INPs) of the type-II NB lineages. This is convincingly demonstrated by high-resolution images that show cellular staining next to large pointed labelled cells, a marker for type-II NBs in Drosophila melanogaster. Using these and other markers (e.g. deadpan, asense), the authors show that the cell type composition and embryonic development of the type-II NB lineages are similar to their counterparts in Drosophila melanogaster. Furthermore, the expression of the Drosophila type-II NB lineage markers six3 and six4 in subsets of the Tribolium type-II NB lineages (anterior 1-4 and 1-6 type-II NB lineages) and the expression of the Cx marker skh in the distal part of most of the lineages provide further evidence that the identified NB lineages are equivalent to the Drosophila lineages that establish the central complex. However, in contrast to Drosophila, there are 9 instead of 8 embryonic type-II NB lineages per brain hemisphere and the lineages contain more progenitor cells compared to the Drosophila lineages. The authors argue that the higher number of dividing progenitor cells supports the earlier development of a functional Cx in Tribolium.

      While the manuscript clearly shows that type-II NB lineages similar to Drosophila exist in Tribolium, it does not considerably advance our understanding of the heterochronic development of the Cx in these insects. First of all, the contribution of these lineages to a functional larval Cx is not clear. For example, how do the described type-II NB lineages relate to the DM1-4 lineages that produce the columnar neurons of the Cx? What is the evidence that the embryonically produced type-II NB lineage neurons contribute to a functional larval Cx? The formation of functional circuits could rely on larval neurons (like in Drosophila) which would make a comparison of embryonic lineages less informative with respect to understanding the underlying variations of the developmental processes. Furthermore, the higher number of progenitors (and consequently neurons) in Tribolium could simply reflect the demand for a higher number of cells required to build the fan-shaped body compared to Drosophila. In addition, the larger lineages in Tribolium, including the higher number of INPs could be due to a greater number of NBs within the individual clusters, rather than a higher rate of proliferation of individual neuroblasts, as suggested. What is the evidence that there is only one NB per cluster? The presented schemes (Fig. 7/12) and description of the marker gene expression and classification of progenitor cells are inconsistent but indicate that NBs and immature INPs cannot be consistently distinguished.

      The main difference between Tribolium and Drosophila Cx development with regard to the larval functionality might be that Drosophila type-II NB lineage-derived neurons undergo quiescence at the end of embryogenesis so that the development of the Cx is halted, while a developmental arrest does not occur in Tribolium. However, this needs to be confirmed (as the authors rightly observe).

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript describes a comprehensive analysis of signalling downstream of the chemokine receptor CCR7. A comprehensive dataset supports the authors' hypothesis that G protein and beta-arrestin signalling can occur simultaneously at CCR7 with implications for continued signalling following receptor endocytosis.

      Strengths:

      The experiments are well controlled and executed, employing a wide range of assays using - in the main - CCR7 transfectants. Data are well presented, with the authors' claims supported by the data. The paper also has an excellent narrative which makes it relatively easy to follow. I think this would certainly be of interest to the readership of the journal.

      Weaknesses:

      Since the authors show a differential enrichment of RhoGTPases by CCR7 stimulation with CCL19 versus CCL21, I think that they also need to show that the Gi/o coupling of HEK-292-CCR7-APEX2 cells to both CCL19 and CCL21 is not perturbed by the modification. Currently, the authors only show data for CCL19 signalling, which leaves the potential for a false negative finding in terms of CCL21 signalling being selectively impaired. This should be relatively easy to do and should strengthen the authors' conclusions.

      The authors conclude the discussion by suggesting that their findings highlight endosomal signalling as a general mechanism for chemokine receptors in cell migration. I think this is an overreach. The authors chose several studies of CXC chemokine receptors to support their argument that C-terminal truncation or mutation of the C-terminal phosphorylation sites impairs endocytosis and chemotaxis (refs 40-42). However, in some instances e.g. at the related chemokine receptor CCR4, C-terminal removal of these sites impairs endocytosis but promotes chemotaxis (Nakagawa et al, 2014); Anderson et al, 2020). I therefore think that either the final statement needs to be tempered down or the counterargument discussed a little.

      References:

      Anderson, C. A. et al. A degradatory fate for CCR4 suggests a primary role in Th2 inflammation. J Leukocyte Biol 107, 455-466 (2020).

      Nakagawa, M. et al. Gain-of-function CCR4 mutations in adult T cell leukaemia/lymphoma. Journal of Experimental Medicine 211, 2497-2505 (2014).

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Cozzolino et al. demonstrate that inhibition of the Mediator kinase CDK8 and its paralog CDK19 suppresses hyperactive interferon (IFN) signaling in Down syndrome (DS), which results from trisomy of chromosome 21 (T21). Numerous pathologies associated with DS are considered direct consequences of chronic IFN pathway activation, and thus hyperactive IFN signaling lies at the heart of pathophysiology. The collective interrogation of transcriptomics, metabolomics, and cytokine screens in sibling-matched cell lines (T21 vs D21) allows the authors to conclude that Mediator kinase inhibition could mitigate chronic, hyperactive IFN signaling in T21. To probe the functional outcomes of Mediator kinase inhibition, the authors performed cytokine screens, transcriptomic, and untargeted metabolomics. This collective approach revealed that Mediator kinases establish IFN-dependent cytokine responses at least in part through transcriptional regulation of cytokine genes and receptors. Mediator kinase inhibition suppresses cell responses during hyperactive IFN signaling through inhibition of pro-inflammatory transcription factor activity (anti-inflammatory effect) and alteration of core metabolic pathways, including upregulation of anti-inflammatory lipid mediators, which served as ligands for specific nuclear receptors and downstream phenotypic outcomes (e.g., oxygen consumption). These data provided a mechanistic link between Mediator kinase activity and nuclear receptor function. Finally, the authors also disclosed that Mediator kinase inhibition alters splicing outcomes.

      Overall, this study reveals a mechanism by which Mediator kinases regulate gene expression and establish that its inhibition antagonizes chronic IFN signaling through collective transcriptional, metabolic, and cytokine responses. The data have implications for DS and other chronic inflammatory conditions, as Mediator kinase inhibition could potentially mitigate pathological immune system hyperactivation.

      Strengths:

      (1) One major strength of this study is the mechanistic evidence linking Mediator kinases to hyperactive IFN signaling through transcriptional changes impacting cell signaling and metabolism.

      (2) Another major strength of this study is the use of sibling-matched cell lines (T21 vs D21) from various donors (not just one sibling pair), and further cross-referencing with data from large cohorts, suggesting that part of the data and conclusions are generalizable.

      (3) Another major strength of this study is the combined experimental approach including transcriptomics, untargeted metabolomics, and cytokine screens to define the mechanisms underlying suppression of hyperactive interferon signaling in DS upon Mediator kinase inhibition.

      (4) Another major strength of this study is the significance of the work to DS and its potential impact on other chronic inflammatory conditions.

      Weakness:

      (1) Genetic evidence linking the mentioned nuclear receptors to activation of an anti-inflammatory program upon Mediator kinase inhibition could improve the definition of the mechanism and overall impact of the work.

      (2) Page 5 states that "Mediator kinases broadly regulate cholesterol and fatty acid biosynthesis and this was further confirmed by the metabolomics data", but a clear mechanistic explanation was lacking. Likewise, the data suggest but do not prove, that altered lipid metabolites influence the function of nuclear receptors to regulate an anti-inflammatory program in response to Mediator kinase inhibition (p. 6), despite the fact the gene expression changes elicited by Mediator kinase inhibition tracked with downstream metabolic changes.

      (3) The figures are outstanding but dense.

      (4) Figure 6 (PRO-Seq). The authors refer to pro-inflammatory TFs (e.g. NF-kB/RelA). It is not clear whether the authors have specifically examined TF binding at enhancers or more broadly at every region occupied by the interrogated TFs?

    1. Reviewer #2 (Public Review):

      Summary:

      This paper investigates deep-sea bacteriophage systems which appear to employ a chronic replication mechanism that is induced or enhanced by polysaccharide addition. Some preliminary evidence for the potential role of auxiliary metabolic genes in aiding phage and/or host proliferation is also provided. The hypothesis being tested is fully supported with solid and convincing evidence and the findings are potentially generalizable with implications for our understanding of polysaccharide-mediated virus-host interactions and carbon cycling in marine ecosystems more broadly.

      Strengths:

      This paper synthesizes sequencing and phylogenic analyses of two Lentisphaerae bacteria and three phage genomes; electron microscopy imaging of bacterial/phage particles; differential gene expression analyses; differential growth curve analyses, and differential phage proliferation assays to extract insights into whether laminarin and starch can induce both host growth and phage proliferation. The data presented convincingly demonstrate that both host culture density and phage proliferation increase as a result having host, phage, and polysaccharide carbon source together in culture.

      Weaknesses:

      The AMG-centered elements of the article would be strengthened by more "mechanistic" experiments focusing on identifying "HOW" the polysaccharide processing, transport, and metabolism genes are being used by the phages to either directly increase viral infection/replication or else to indirectly do so by supporting the growth of the host (via mutualism). The concept of "selfishness" in bacterial systems and its potential role in viral life cycles could be more developed. Selfish bacteria are active throughout the water column of the ocean. ISME COMMUN. 3, 11 (2023) (see for instance https://doi.org/10.1038/s43705-023-00219-7) and such "selfish" bacteria sequester metabolizable polysaccharides in their periplasm to advantage (https://www.nature.com/articles/ismej201726). It is plausible that phages may be either hijacking such polysaccharide sequestration mechanisms to improve infectivity and ENTRY or else helping their hosts to grow and proliferate so they can reap the benefits of simply having more hosts to infect. The current work does not clearly distinguish between these two distinct mechanistic possibilities. The paper would be strengthened by a more detailed/clear discussion of this possibility.

    1. Reviewer #2 (Public Review):

      This work clarifies neural mechanisms that can lead to a phenomenology consistent with motor preparation in its broader sense. In this context, motor preparation refers to activity that occurs before the corresponding movement. Another property often associated with preparatory activity is a correlation with global movement characteristics such as reach speed (Churchland et al., Neuron 2006), reach angle (Sun et al., Nature 2022), or grasp type (Meirhaeghe et al., Cell Reports 2023). Such activity has notably been observed in premotor and primary motor cortices, and it has been hypothesized to serve as an input to a motor execution circuit. The timing and mechanisms by which such 'preparatory' inputs are made available to motor execution circuits remain however unclear in general, especially in light of the presence of a 'trigger-like' signal that appears to relate to the transition from preparatory dynamics to execution activity (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021).

      The preparatory inputs have been hypothesized to fulfill one or several (non-mutually-exclusive) possible objectives. Two notable hypotheses are that these inputs could be shaped to maximize output accuracy under regularization of the input magnitude; or that they may help the flexible re-use of the neural machinery involved in the control of movements in different contexts.

      Here, the authors investigate in detail how the former hypothesis may be compatible with the presence of early inputs in recurrent network models driving arm movements, and compare models to data.

      Strengths:

      The authors are able to deploy an in-depth evaluation of inputs that are optimized for producing an accurate output at a pre-defined time while using a regularization term on the input magnitude, in the case of movements that are thought to be controlled in a quasi-open loop fashion such as reaches.

      First, the authors have identified that optimal control theory is a great framework to study this question as it provides methods to find and analyze exact solutions to this cost function in the case of models with linear dynamics. The authors not only use this framework to get an exact assessment of how much pre-movement input arises in large recurrent networks, but also give insight into the mechanisms by which it happens by dissecting in detail low-dimensional networks. The authors find that two key network properties - observability of the readout's nullspace and limited controllability - give rise to optimal inputs that are large before the start of the movement (while the corresponding network activity lies in the nullspace of the readout). Further, the authors numerically investigate the timing of optimized inputs in models with nonlinear dynamics, and find that pre-movement inputs can also arise in these more general networks. The authors also explore how some variations on their model's constraints - such as penalizing the input roughness or changing task contingencies about the go cue timing - affect their results. Finally, the authors point out some coarse-grained similarities between the pre-movement activity driven by the optimized inputs in some of the models they studied, and the phenomenology of preparation observed in the brain during single reaches and reach sequences. Overall, the authors deploy an impressive arsenal of tools and a very in-depth analysis of their models.

      Oustanding questions that could lead to interesting follow-up work:

      Like all great pieces of research, this article makes it clear where current limitations lie and therefore opens up opportunities for future work.

      (1) Though the optimal control theory framework is ideal for determining inputs that minimize output error while regularizing the input norm or other simple input features, it cannot easily account for some other varied types of objectives - especially those that may lead to a complex optimization landscape. For instance, the reusability of parts of the circuit, sparse use of additional neurons when learning many movements, and ease of planning (especially under uncertainty about when to start the movement), may be alternative or additional reasons that could help explain the preparatory activity observed in the brain. It is interesting to note that inputs that optimize the objective chosen by the authors arguably lead to a trade-off in terms of other desirable objectives. Specifically, the inputs the authors derive are time-dependent, so a recurrent network would be needed to produce them and it may not be easy to interpolate between them to drive new movement variants. In addition, these inputs depend on the desired time of output and therefore make it difficult to plan, e.g. in circumstances when timing should be decided depending on sensory signals. Finally, these inputs are specific to the full movement chain that will unfold, so they do not permit reuse of the inputs e.g. in movement sequences of different orders. Of note, the authors have pointed out in the discussion how their framework may be extended in future work to account for some additional objectives, such as inputs' temporal smoothness or some strategies for dealing with go cue timing uncertainty.

      (2) Relatedly, if the motor circuits were to balance different types of objectives, the activity and inputs occurring before each movement may be broken down into different categories that may each specialize into their own objective. For instance, previous work (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021) has suggested that inputs occurring before the movement could be broken down into preparatory inputs 'stricto sensu' - relating to the planned characteristics of the movement - and a trigger signal, relating to the transition from planning to execution - irrespective of whether the movement is internally timed or triggered by an external event. The current work does not address which type(s) of early input may be labeled as 'preparatory' or may be thought of as a part of 'planning' computations, or whether these inputs may come from several different source circuits. Future research could investigate these questions using a different approach, for instance, by including structural constraints from brain architecture into a neural network model.

      (3) While the authors rightly point out some similarities between the inputs that they derive and observed preparatory activity in the brain, notably during motor sequences, there are also some differences. For instance, while both the derived inputs and the data show two peaks during sequences, the data reproduced from Zimnik and Churchland show preparatory inputs that have a very asymmetric shape that really plummets before the start of the next movement, whereas the derived inputs have larger amplitude during the movement period - especially for the second movement of the sequence. In addition, the data show trigger-like signals before each of the two reaches. Finally, while the data show a very high correlation between the pattern of preparatory activity of the second reach in the double reach and compound reach conditions, the derived inputs appear to be more different between the two conditions. Note that the data would be consistent with separate planning of the two reaches even in the compound reach condition, as well as the re-use of the preparatory input between the compound and double reach conditions. Therefore, different motor sequence datasets - notably, those that would show even more coarticulation between submovements - may be more promising for finding a tight match between the data and the author's inputs. In the future, further analyses in these datasets could help determine whether the coarticulation could be due to simple filtering by the circuits and muscles downstream of M1, planning of movements with adjusted curvature to mitigate the work performed by the muscles while permitting some amount of re-use across different sequences, or - as suggested by the authors - inputs fully tailored to one specific movement sequence that maximize accuracy and minimize the M1 input magnitude.

      (4) Though iLQR is a powerful optimization method to find inputs optimizing the author's cost function, it also has some limitations. First, given that it relies on a linearization of the dynamics at each timestep, it has a limited ability to leverage potential advantages of nonlinearities in the dynamics. Second, the iLQR algorithm is not a biologically plausible learning rule and does not account for biological constraints affecting the circuits that produce and process these inputs. Therefore, it might be difficult for the brain to learn to produce the inputs that it finds. Consequently, when observing differences between model and data, this can confound the question of whether it comes from a difference of assumed objective or a difference of optimization procedure or circuit implementation. It remains unclear whether using alternative algorithms with different limitations - for instance, using variants of BPTT to train a separate RNN to produce the inputs in question - could impact some of the results.

      (5) Under the objective considered by the authors, the amount of input occurring before the movement might be impacted by the presence of online sensory signals for closed-loop control. Even if the inputs include some sensory activity and/or the RNN activity could represent all general variables (e.g. sensory) whose states can be decoded from M1, the model does not currently include mechanisms that process imperfect (delayed, noisy) sensory feedback to adapt the output in a trial-specific manner. The information related to such sensory feedback cannot be anticipated, and therefore the related input would have to reach the motor cortex after preparation. Thus, it is an open question whether the objective and network characteristics suggested by the authors could also explain the presence of large preparatory activity before e.g. grasping movements that are thought to be more sensory-feedback-driven (Meirhaeghe et al., Cell Reports 2023).

      (6) More broadly, with the type of objectives that the authors assume the inputs fulfill, some M1 properties that lead to strong preparation - notably, limited readout controllability - may not be favorable for control in general, so it would be interesting if other objectives and assumptions could robustly lead to strong preparation under more general M1 properties.'

    1. Reviewer #2 (Public Review):

      Pyoverdines, siderophores produced by many Pseudomonads, are one of the most diverse groups of specialized metabolites and frequently used as model systems. Thousands of Pseudomonas genomes are available, but large scale analyses of pyoverdines are hampered by the biosynthetic gene clusters (BGCs) being spread across multiple genomic loci and existing tools' inability to accurately predict amino acid substrates of the biosynthetic adenylation (A) domains. The authors present a bioinformatics pipeline that identifies pyoverdine BGCs and predicts the A domain substrates with high accuracy. They tackled a second challenging problem by developing an algorithm to differentiate between outer membrane receptor selectivity for pyoverdines versus other siderophores and substrates. The authors applied their dataset to thousands of Pseudomonas strains, producing the first comprehensive overview of pyoverdines and their receptors and predicting many new structural variants.

      The A domain substrate prediction is impressive, including the correction of entries in the MIBiG database. Their high accuracy came from a relatively small training dataset of A domains from 13 pyoverdine BGCs. The authors acknowledge that this small dataset does not include all substrates, and correctly point out that new sequence/structure pairs can be added to the training set to refine the prediction algorithm. The workflow unfortunately cannot differentiate between different variants of Asp and OHOrn. To validate their predictions, they elucidated structures of several new pyoverdines, and their predictions performed well. The authors tested their workflow on Burkholderiales A domains and had good results, suggesting it can be used on other taxa. Skimming through the source code and data, the algorithm itself appears to be sound and a clear improvement over existing tools for pyoverdine BGC annotation.

      Predicting outer membrane receptor specificity is likewise a challenging problem and the authors have made a promising achievement by finding specific gene regions that differentiate the pyoverdine receptor FpvA from FpvB and other receptor families. Their predictions were not tested experimentally, but the finding that only predicted FpvA receptors were proximate to the biosynthesis genes lends credence to the predictive power of the workflow. The authors find predicted pyoverdine receptors across an impressive 468 genera, an exciting finding for expanding the role of pyoverdines as public goods beyond Pseudomonas. However, whether or not these receptors can actually recognize pyoverdines (and if so, which structures!) remains to be investigated.

      In all, the authors have assembled a rich dataset that will enable large scale comparative genomic analyses. This dataset could be used by a variety of researchers, including those studying natural product evolution, public good eco/evo dynamics, and NRPS engineering.

    1. Reviewer #2 (Public Review):

      Summary:

      One of the greatest challenges for the spliceosome is to be able to repress the many cryptic splice sites that can occur in both the intronic and exotic sequences of genes. Although many studies have focused on cryptic signals in introns (because of their common involvement in disease) the question still remained open as to the factors that repress cryptic exons in exons. Because exons are normally much shorter than introns, in many cases the problem does not exist. However, in human genes a significant proportion of exons can be considerably longer than the average 150 nt length and this raises the question of how cryptic splicing can be prevented in long exons. To address this question, the authors have focused on the possible role played by an ancient mammalian RBD protein called RBMX. Using a combination of high-throughput and classic splicing methodologies, they have shown that there is a class of RBMX-dependent ultra-long exons connected where the RBMX, RBMXL2 and RBMY paralogs have closely related functional activity in repressing cryptic splice site selection.

      Strengths:

      In general, the present work sheds light on what has been a rather understudied process in splicing research. The use of iCLIP and RNA-seq data has not only allowed to identify the long exons where cryptic splicing is prevented by the RBMX proteins but has also allowed to identify a network of genes mostly involved in genome stability and transcriptional control where these proteins seem to play a prominent role. This can therefore also shed additional information on the way splicing has shaped evolutionary processes in the mammalian lineage and will therefore be of interest to many researchers in this field.

      Weaknesses:

      There are no major weaknesses, although some specific aspects of the findings could be addressed more in-depth in the recommendations to authors.

    1. Reviewer #2 (Public Review):<br /> Summary:<br /> This study used a novel diffusion-weighted pseudo-continuous arterial spin labelling (pCASL) technique to simultaneously explore age- and sex-related differences in brain tissue perfusion (i.e., cerebral blood flow (CBF) & arterial transit time (ATT) - a measure of CBF delivery to brain tissue) and blood-brain barrier (BBB) function, measured as the water exchange (kw) across the BBB. While age- and sex-related effects on CBF are well known, this study provides new insights to support the growing evidence of these important factors in cerebrovascular health, particularly in BBB function. Across the brain, decline in CBF and BBB function (kw) and elevation in ATT was reported in older adults, after the age of 60 and more so in males compared to females. This was also evident in key cognitive regions including the insular, prefrontal, and medial temporal regions, stressing the consideration of age and sex in these brain physiological assessments.

      Strengths:<br /> Simultaneous assessment of CBF with BBB along with transit time and at the voxel-level helped elucidate the brain's vulnerability to age and sex-effects. It is apparent that the investigators carefully designed this study to assess regional associations of age and sex with attention to exploring potential non-linear effects.

      Weaknesses:<br /> It appears that no brain region showed concurrent CBF and BBB dysfunction (kw), based on the results reported in the main manuscript and supplemental information. Was an association analysis between CBF and kw performed? There is a potential effect of the level of formal education on CBF (PMID: 12633147; 15534055), which could have been considered and accounted for as well, especially for a cohort with stated diversity (age, race, sex).

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Peng et al., reported that 36THz high-frequency terahertz stimulation (HFTS) can suppress the activity of pyramidal neurons through enhancing the conductance of voltage-gated potassium channel. The authors also demonstrated the effectiveness of using 36THz HFTS for treating neuropathic pain.

      Strengths:

      The manuscript is well written and the conclusions are supported by robust results. This study highlighted the potential of using 36THz HFTS for neuromodulation.

      Weaknesses:

      More characterization of HFTS is needed, so the readers can have a better assessment of the potential usage of HFTS in their own applications.

    1. Reviewer #2 (Public Review):

      Summary:

      Cancer treatments are not just about the tumor - there is an ever-increasing need for treating pain, fatigue, and anhedonia resulting from the disease as patients are undergoing successful but prolonged bouts with cancer. Using an implantable oral tumor model in the mouse, Barr et al describe neural infiltration of tumors, and posit that these nerve fibers are transmitting pain and other sensory signals to the brain that reduce pleasure and motivation. These findings are in part supported by anatomical and transcriptional changes in the tumor that suggest sensory innervation, neural tracing, and neural activity measurements. Further, the authors conduct behavior assays in tumor-bearing animals and inhibit/ablate pain sensory neurons to suggest involvement of local sensory innervation of tumors in mediating cancer-induced malaise.

      Strengths:

      • This is an important area of research that may have implications for improving the quality of life of cancer patients.

      • The studies use a combination of approaches (tracing and anatomy, transcriptional, neural activity recordings, behavior assays, loss-of-function) to support their claims.

      • Tracing experiments suggest that tumor-innervating afferents are connected to brain nuclei involved in oral pain sensing. Consistent with this, the authors observed increased neural activity in those brain areas of tumor-bearing animals. It should be noted that some of these brain nuclei have also been implicated in cancer-induced behavioral alterations in non-head and neck tumor models.

      • Experiments are well-controlled and approaches are validated.

      • The paper is well-written and the layout was easy to follow.

      Weaknesses/Future Directions:

      • The main claim is that tumor-infiltrating nerves underlie cancer-induced behavioral alterations. While the studies are supportive of this conclusion, manipulations in the current study are non-specific, ablating all TRPV1 sensory neurons. A direct test would be to selectively inhibit/ablate nerve fibers innervating the tumor or mouth region.

    1. Reviewer #2 (Public Review):

      Summary

      The authors aimed to investigate the functionality of the GnRH (gonadotropin-releasing hormone) pulse generator in different mouse models to understand its role in reproductive physiology and its implications for conditions like polycystic ovary syndrome (PCOS). They compared the GnRH pulse generator activity in control mice, peripubertal androgen (PPA) treated mice, and prenatal androgen (PNA) exposed mice. The study sought to elucidate how androgen exposure affects the GnRH pulse generator and subsequent LH (luteinizing hormone) secretion, contributing to the pathophysiology of PCOS.

      Strengths

      (1) Comprehensive Model Selection: The use of both PPA and PNA mouse models allows for a comparative analysis that can distinguish the effects of different timings of androgen exposure.

      (2) Detailed Methodology: The methods employed, such as photometry recordings and serial blood sampling, are robust and allow for precise measurement of GnRH pulse generator activity and LH secretion.

      (3) Clear Results Presentation: The experimental results are well-documented with appropriate statistical analyses, ensuring the findings are reliable and reproducible.

      (4) Relevance to PCOS: The study addresses a significant gap in understanding the neuroendocrine mechanisms underlying PCOS, making the findings relevant to both basic science and potentially clinical research.

      Weaknesses

      (1) Model Limitations: While the PNA mouse model is suggested as the most appropriate for studying PCOS, the authors acknowledge that it does not completely replicate the human condition, particularly the elevated LH response seen in women with PCOS.

      (2) Complex Data Interpretation: The reduced progesterone feedback and its effects on the GnRH pulse generator in PNA mice add complexity to data interpretation, making it challenging to draw straightforward conclusions.

      (3) Machine Learning (ML) Selection and Validation: While k-means clustering is a useful tool for pattern recognition, the manuscript lacks detailed justification for choosing this specific algorithm over other potential methods. The robustness of clustering results has not been validated.

      (4) Biological Interpretability: Although the machine learning approach identified cyclical patterns, the biological interpretation of these clusters in the context of PCOS is not thoroughly discussed. A deeper exploration of how these clusters correlate with physiological and pathological states could enhance the study's impact.

      (5) Sample Size: The study uses a relatively small number of animals (n=4-7 per group), which may limit the generalisability of the findings. Larger sample sizes could provide more robust and statistically significant results.

      (6) Scope of Application: The findings, while interesting, are primarily applicable to mouse models. The translation to human physiology requires cautious interpretation and further validation.

    1. Reviewer #2 (Public Review):

      Nichols et al studied the role of axon guidance molecules and their receptors and how these work as long-range and/or local cues, using in-vivo time-lapse imaging in C. elegans. They found that the Netrin axon guidance system works in different modes when acting as a long-range (chemotaxis) cue vs local cue (haptotaxis). As an initial context, they take advantage of the postembryonic-born neuron, PDE, to understand how its axon grows and then is guided into its target. They found that this process occurs in various discrete steps, during which the growth cone migrates and pauses at specific structures, such as the vSLNC. The role of the UNC-6/Netrin and UNC-40/DCC axon guidance ligand-receptor pair was then looked at in terms of its requirement for<br /> (1) initial axon outgrowth direction<br /> (2) stabilization at the intermediate target<br /> (3) directional branching from the sublateral region or<br /> (4) ventral growth from the intermediate target to the VNC.

      They found that each step is disrupted in the unc-6/Netrin and unc-40/DCC mutants and observed how the localization of these proteins changed during the process of axon guidance in wild-type and mutant contexts. These observations were further supported by analysis of a mutant important for the regulation of Netrin signaling, the E3 ubiquitin ligase madd-2/Trim9/Trim67. Remarkably, the authors identified that this mutant affected axonal adhesion and stabilization, but not directional growth. Using membrane-tethered UNC-6 to specific localities, they then found this to be a consequence of the availability of UNC-6 at specific localities within the axon growth path. Altogether, this data and in-vivo analysis provide compelling evidence of the mechanistic foundation of Netrin-mediated axon guidance and how it works step by step.

      The conclusions are well-supported, with both imaging and quantification of each step of axon guidance and localization of UNC-6 and UNC-40. Using a different type of neuron to validate their findings further supports their conclusions and strengthens their model. It's not yet known whether this model holds true for other ligand-receptor pairs, but the current work sets the stage for future analysis of other axon guidance molecules using time-lapse in-vivo imaging. There are still two outstanding questions that are important to address to support the authors' model and conclusions.

      (1) The results of UNC-6-TM expression at different locations are clear and support the conclusions but need to consider that there's no diffusible UNC-6 available. What would happen if UNC-6 is tethered to the membrane in an otherwise completely 'normal' UNC-6 gradient. Does the axon guidance ensue normally or does it get stuck in the respective site of the membrane tethered-UNC-6 and doesn't continue to outgrow properly? This is an important control (expression of the UNC-6-TM at the vSLNC or VNC in the wild type background) that would help clarify this question and gain a better insight into the separability of both axon guidance steps and the ability to manipulate these.

      (2) Axon guidance systems do not work in a vacuum and are generally competing against each other. For example, the SLT-1/Slit and SAX-3/ROBO axon guidance ligand-receptor pair is also required for PDE, and other post-embryonic neurons, axon guidance. It would be interesting to test mutants for these genes with the membrane tethered-UNC-6 to determine if the different steps of axon guidance are disrupted and if so, to what degree these are disrupted.

    1. Reviewer #2 (Public Review):

      The study by Setogawa et al. aims to understand the role that different striatal subregions belonging to parallel brain circuits have in associative learning and discrimination learning (S-O-R and S-R tasks). Strengths of the study are the use of multiple methodologies to measure and manipulate brain activity in rats, from microPET imaging to excitotoxic lesions and multielectrode recordings across anterior dorsolateral (aDLS), posterior ventral lateral (pVLS)and dorsomedial (DMS) striatum.

      The main conclusions are that the aDLS promotes stimulus-response association and suppresses response-outcome associations. The pVLS is engaged in the formation and maintenance of the stimulus-response association. There is a lot of work done and some interesting findings however, the manuscript can be improved by clarifying the presentation and reasoning. The inclusion of important controls will enhance the rigor of the data interpretation and conclusions.

    1. “Analysts need to be able to dissect exactly how the AI reached a particular conclusion or recommendation,” says Chief Business Officer Eric Costantini. “Neo4j enables us to enforce robust information security by applying access controls at the subgraph level.”

      “Analysts need to be able to dissect exactly how the AI reached a particular conclusion or recommendation,” “Neo4j enables us to enforce robust information security by applying access controls at the subgraph level.” Chief Business Officer Eric Costantini.

    1. Reviewer #2 (Public Review):

      In the current study, Li et al. developed a novel approach that aligns chronological age to a cross-species brain age prediction model to investigate the evolutionary effect. This method revealed some interesting findings, like the brain-age gap of the macaque model in predicting human age will increase as chronological age increases, suggesting an evolutionary alignment between the macaque brain and the human brain in the early stage of development. This study exhibits ample novelty and research significance. However, I still have some concerns regarding the reliability of the current findings.

      (1) Although the authors named their new method a "cross-species" model, the current study only focused on the prediction between humans and macaques. It would be better to discuss whether their method can also generalize to cross-species examination of other species (e.g., C. elegans), which may provide more comprehensive evolutionary insights. Also, other future directions with their new method are worth discussing.

      (2) Algorithm of prediction model. In the method section, the authors only described how they chose features, but did no description about the algorithm (e.g., supporting vector regression) they used. Please add relevant descriptions to the methods.

      (3) Sex difference. The sex difference results are strange to me. For example, in the second row of Figure Supplement 3A, different models show different correlation patterns, but why their Pearson's r is all equal to 0.3939? If they are only typo errors, please correct them. The authors claimed that they found no sex difference. However, the results in Figure Supplement 3 show that, the female seems to have poorer performance in predicting macaque age from the human model. Moreover, accumulated studies have reported sex differences in developing brains (Hines, 2011; Kurth et al., 2021). I think it is also worth discussing why sex differences can't be found in the evolutionary effect.

      Reference:<br /> Hines, M. (2011). Gender development and the human brain. Annual review of neuroscience, 34, 69-88.<br /> Kurth, F., Gaser, C., & Luders, E. (2021). Development of sex differences in the human brain. Cognitive Neuroscience, 12(3-4), 155-162.

    1. Reviewer #2 (Public Review):

      In "Multi-modal Neural Correlates of Childhood Psychopathology" Krebets et al. integrate multi-modal neuroimaging data using machine learning to delineate dissociable links to diverse dimensions of psychopathology in the ABCD sample. This paper had numerous strengths including a superb use of a large resource dataset, appropriate analyses, beautiful visualizations, clear writing, and highly interpretable results from a data-driven analysis. Overall, I think it would certainly be of interest to a general readership.

      That being said, I do have several comments for the authors to consider.

      - Out-of-sample testing: while the permutation testing procedure for the PLS is entirely appropriate, without out-of-sample testing the reported effect sizes are likely inflated.

      - Site/family structure: it was unclear how site/family structure were handled as covariates.

      - Anatomical features: I was a bit surprised to see volume, surface area, and thickness all evaluated - and that there were several comments on the correspondence between the SA and volume in the results section. Given that cortical volume is simply a product of SA and CT (and mainly driven by SA), this result may be pre-required.

      - Ethnicity: the rationale for regressing ethnicity from the data was unclear and may conflict with current best practices.

      - Data quality: the authors did an admirable job in controlling for data quality in the analyses of functional connectivity data. However, it is unclear if a comparable measure of data quality was used for the T1/dMRI analyses. This likely will result in inflated effect sizes in some cases; it has the potential to reduce sensitivity to real effects.

    1. Reviewer #2 (Public Review):

      This is, to my knowledge, the most scalable method for phylogenetic placement that uses likelihoods. The tool has an interesting and innovative means of using gaps, which I haven't seen before. In the validation the authors demonstrate superior performance to existing tools for taxonomic annotation (though there are questions about the setup of the validation as described below).

      The program is written in C with no library dependencies. This is great. However, I wasn't able to try out the software because the linking failed on Debian 11, and the binary artifact made by the GitHub Actions pipeline was too recent for my GLIBC/kernel. It'd be nice to provide a binary for people stuck on older kernels (our cluster is still on Ubuntu 18.04). Also, would it be hard to publish your .zipped binaries as packages?

      Thank you for publishing your source files for the validation on zenodo. Please provide a script that would enable the user to rerun the analysis using those files, either on zenodo or on GitHub somewhere.

      The validations need further attention as follows.

      First, the authors have not chosen data sets that are not well-aligned with real-world use cases for this software, and as a result, its applicability is difficult to determine. First, the leave-one-species-out experiment made use of COI gene sequences representing 253 species from the order Charadriiformes, which includes bird species such as gulls and terns. What is the reasoning for selecting this data set given the objective of demonstrating the utility of Tronko for large scale community profiling experiments which by their nature tend to include microorganisms as subjects? If the authors are interested in evaluating COI (or another gene target) as a marker for characterizing the composition of eukaryotic populations, is the heterogeneity and species distribution of bird species within order Charadriiformes comparable to what one would expect in populations of organisms that might actually be the target of a metagenomic analysis?

      Second, It appears that experiments evaluating performance for 16S were limited to reclassification of sequencing data from mock communities described in two publications, Schirmer (2015, 49 bacteria and 10 archaea, all environmental), and Gohl (2016; 20 bacteria - this is the widely used commercial mock community from BEI, all well-known human pathogens or commensals). The authors performed a comparison with kraken2, metaphlan2, and MEGAN using both the default database for each as well as the same database used for Tronko (kudos for including the latter). This pair of experiments provide a reasonable high-level indication of Tronko's performance relative to other tools, but the total number of organisms is very limited, and particularly limited with respect to the human microbiome. It is also important to point out that these mock communities are composed primarily of type strains and provide limited species-level heterogeneity. The performance of these classification tools on type strains may not be representative of what one would find in natural samples. Thus, the leave-one-individual-out and leave-one-species-out experiments would have been more useful and informative had they been applied to extended 16S data sets representing more ecologically realistic populations.

      Finally, the authors should describe the composition of the databases used for classification as well as the strategy (and toolchain) used to select reference sequences. What databases were the reference sequences drawn from and by what criteria? Were the reference databases designed to reflect the composition of the mock communities (and if so, are they limited to species in those communities, or are additional related species included), or have the authors constructed general purpose reference databases? How many representatives of each species were included (on average), and were there efforts to represent a diversity of strains for each species? The methods should include a section detailing the construction of the data sets: as illustrated in this very study, the choice of reference database influences the quality of classification results, and the authors should explain the process and design considerations for database construction.

    1. Reviewer #2 (Public Review):

      In this manuscript by Perez-Lopez et al., the authors investigate the role of the chemokine CCL28 during bacterial infections in mucosal tissues. This is a well-written study with exciting results. They show a role for CCL28 in promoting neutrophil accumulation to the guts of Salmonella-infected mice and to the lung of mice infected with Acinetobacter. Interestingly, the functional consequences of CCL28 deficiency differ between infections with the two different pathogens, with CCL28-deficiency increasing susceptibility to Salmonella, but increasing resistance to Acinetobacter. The underlying mechanistic reasons for this suggest roles for CCL28 in enhanced neutrophil antimicrobial activity, production of reactive oxygen species, and formation of extracellular traps. However, additional experiments are required to shore up these mechanisms, including addressing the role of other CCL28-dependent cell types and further characterization of neutrophils from CCL28-deficient mice.

    1. Reviewer #2 (Public Review):

      This work describes a novel bipotent differentiation capacity of human muscle progenitors marked by CD56 and CD29. In addition to previously well-known myogenic differentiation potential, the authors discovered these progenitors could also be induced into tenocyte-like cells. They describe the sorted CD56+/CD29+ cells not only differentiate into tenocytes in vitro; they were also able to engraft into injured tendons and repair damaged tendons when transplanted into nude mice. Human MuSC transplantation improved the locomotor function and physiological strength of the tendon-injured mice. The authors further observed that this bipotent differentiation potential was specific to human MuSC, the same cell population isolated from mice remains unipotent to myogenic differentiation and not capable of tenocytic differentiation.

      The discovery of the tenocyte differentiation potential of human CD56+/CD29+ MuSCs provides a potential cell therapeutic option for tendon injury. This work may have a significant clinical impact on improving treatment outcomes for patients suffering from tendon injury.

      Strength of the paper:

      Multimodal experimental approach using both in vitro and in vivo experiments provided strong proof for the differentiation capacity of the human MuSCs into tenocytes, and the potential clinical implication of these cells in the treatment of tendon injury in patients by in vivo transplantation assay. Using RNA sequencing to characterise the differentiated myocytic and tenocytic populations proved global expression profile data which have shown non-biased efficiency information to the in vitro differentiated cells.

      The comparison of differentiation potentials of human and mouse MuSCs is interesting and clinically meaningful. This work illustrates that animal studies may not always be clinically relevant in studying human diseases and treatment modalities.

      Weaknesses:

      scRNAseq assay using total mononuclear cell population did not provide meaningful insight that enriched knowledge on CD56+/CD29+ cell population. CD56+/CD29+ cells information may have been lost due to the minority identity of these cells in the total skeletal muscle mononuclear population, especially given the total cell number used for scRNAseq was very low and no information on participant number and repeat sample number used for this assay. Using this data to claim a stem cell lineage relationship for MuSCs and tenocytes may not convincing, as seeing both cell types in the total muscle mononuclear population does not establish a lineage connection between them.

      The TGF-b pathway assay uses a small molecular inhibitor of TGF-b to probe Smad2/3. The assay conclusion regarding Smad2/3 pathway responsible for tenocyte differentiation may be overinterpretation without Smad2/3 specific inhibitors being applied in the experiments.

    1. Reviewer #2 (Public Review):

      This manuscript offers significant insights into the impact of maternal obesity on oocyte methylation and its transgenerational effects. The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, to explore how high-fat diet (HFD)-induced obesity alters genomic methylation in oocytes and how these changes are inherited by subsequent generations. The findings suggest that maternal obesity induces hyper-methylation in oocytes, which is partly transmitted to F1 and F2 oocytes and livers, potentially contributing to metabolic disorders in offspring. Notably, the study identifies melatonin as a key regulator of this hyper-methylation process, mediated through the cAMP/PKA/CREB pathway.

      Strengths:

      The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, and provides convincing data.

      Weaknesses:

      The description in the results section is somewhat verbose. This section (lines 126~227) utilized transgenerational breeding experiments and methylation analysis to demonstrate that maternal obesity-induced alterations in oocyte methylation (including hyper-DMRs and hypo-DMRs) can be partially transmitted to F1 and F2 oocytes and livers. The authors should consider condensing and revising this section for clarity and brevity.

      There is a contradiction with Reference 3, but the discrepancy is not discussed. In this study, the authors observed an increase in global methylation in oocytes from HFD mice, whereas Reference 3 indicates Stella insufficiency in oocytes from HFD mice. This Stella insufficiency should lead to decreased methylation (Reference 33). There should be a discussion of how this discrepancy can be reconciled with the authors' findings.

    1. Reviewer #2 (Public Review):

      Summary:

      This work by Grogan and colleagues aimed to translate animal studies showing that acetylcholine plays a role in motivation by modulating the effects of dopamine on motivation. They tested this hypothesis with a placebo-controlled pharmacological study administering a muscarinic antagonist (trihexyphenidyl; THP) to a sample of 20 adult men performing an incentivized saccade task while undergoing electroengephalography (EEG). They found that reward increased vigor and reduced reaction times (RTs) and, importantly, these reward effects were attenuated by trihexyphenidyl. High incentives increased preparatory EEG activity (contingent negative variation), and though THP also increased preparatory activity, it also reduced this reward effect on RTs.

      Strengths:

      The researchers address a timely and potentially clinically relevant question with a within-subject pharmacological intervention and a strong task design. The results highlight the importance of the interplay between dopamine and other neurotransmitter systems in reward sensitivity and even though no Parkinson's patients were included in this study, the results could have consequences for patients with motivational deficits and apathy if validated in the future.

      Weaknesses:

      The main weakness of the study is the small sample size (N=20) that unfortunately is limited to men only. The generalizability and replicability of the conclusions remain to be assessed in future research with a larger and more diverse sample size and potentially a clinically relevant population. The EEG results do not shape a concrete mechanism of action of the drug on reward sensitivity.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors aimed to identify if and how magnesium affects the ability of two particular bacteria species to resist the action of antibiotics. In my view, the authors succeeded in their goals and presented a compelling study that will have important implications for the antibiotic resistance research community. Since metals like magnesium are present in all lab media compositions and are present in the host, the data presented in this study certainly will inspire additional research by the community. These could include research into whether other types of metals also induce multi-drug resistance, whether this phenomenon can be observed in other bacterial species, especially pathogenic species that cause clinical disease, and whether the underlying molecular determinants (i.e. enzymes) of metal-induced phenotypic resistance could be new antimicrobial drug targets themselves.

      Strengths:

      This study's strengths include that the authors used a variety of methodologies, all of which point to a clear effect of exogenous Mg2+ on drug resistance in the targeted species. I also commend the authors for carrying out a comprehensive study, spanning evaluation of whole cell phenotypes, metabolic pathways, genetic manipulation, to enzyme activity level evaluation. The fact that the authors uncovered a molecular mechanism underlying Mg2+-induced phenotypic resistance is particularly important as the key proteins should be studied further.

      Weaknesses:

      I believe there are weaknesses in the manuscript, however. The authors take for granted that the reader is familiar with all the assays utilized, and do not properly explain some experiments, and thus I highly suggest that the authors add a brief statement in each situation describing the rationale for each selected methodology (more details are in the private review to the authors). The Results section is also quite long and bogs down at times, and I suggest that the authors reduce its length by 10 to 20%. In contrast, the Introduction is sparse and lacks key aspects, for example, there should be mention of the study's main purpose and approaches, plus an introduction to the authors' choice of species and their known drug resistance properties, as well as the drug of choice (balofloxacin). Another notable weakness is that the authors evaluated Mg2+-induced phenotypic resistance only against two closely related species, and thus the generalizability of this mechanism of drug resistance is not known. The paper would be strengthened if the authors could demonstrate this type of phenotypic resistance in at least one more Gram-negative species and at least one Gram-positive species (antimicrobial susceptibility evaluations would suffice), each of which should be pathogenic to humans. Demonstrating magnesium-induced phenotypic drug resistance in the WHO Priority Bacterial Pathogens would be particularly important.

      In general, the conclusions drawn by the authors are justified by the data, except for the interpretation of some experiments. Importantly, this paper has discovered new antimicrobial resistance mechanisms and has also pointed to potential new targets for antimicrobials.

    1. Reviewer #2 (Public Review):

      I found the original paper to be of high quality and value. The revisions the authors have made (particularly with respect to the more cautious phraseology concerning the ability to track labelled proteins) are valuable additions. The other responses are well-argued and satisfactory to this reviewer.

    1. Reviewer #2 (Public Review):

      This is an interesting computational study addressing how salt affects the assembly of biomolecular condensates. The simulation data are valuable as they provide a degree of atomistic details regarding how small salt ions modulate interactions among intrinsically disordered proteins with charged residues, namely via Debye-like screening that weakens the effective electrostatic interactions among the polymers, or through bridging interactions that allow interactions between like charges from different polymer chains to become effectively attractive (as illustrated, e.g., by the radial distribution functions in Supplementary Information). However, this manuscript has several shortcomings: (i) Connotations of the manuscript notwithstanding, many of the authors' concepts about salt effects on biomolecular condensates have been put forth by theoretical models, at least back in 2020 and even earlier. Those earlier works afford extensive information such as considerations of salt concentrations inside and outside the condensate (tie-lines). But the authors do not appear to be aware of this body of prior works and therefore missed the opportunity to build on these previous advances and put the present work with its complementary advantages in structural details in the proper context. (ii) There are significant experimental findings regarding salt effects on condensate formation [which have been modeled more recently] that predate the A1-LCD system (ref.19) addressed by the present manuscript. This information should be included, e.g., in Table 1, for sound scholarship and completeness. (iii) The strengths and limitations of the authors' approach vis-à-vis other theoretical approaches should be discussed with some degree of thoroughness (e.g., how the smallness of the authors' simulation system may affect the nature of the "phase transition" and the information that can be gathered regarding salt concentration inside vs. outside the "condensate" etc.). Accordingly, this manuscript should be revised to address the following. In particular, the discussion in the manuscript should be significantly expanded by including references mentioned below as well as other references pertinent to the issues raised.

      (1) The ability to use atomistic models to address the questions at hand is a strength of the present work. However, presumably because of the computational cost of such models, the "phase-separated" "condensates" in this manuscript are extremely small (only 8 chains). An inspection of Fig.1 indicates that while the high-salt configuration (snapshot, bottom right) is more compact and droplet-like than the low-salt configuration (top right), it is not clear that the 50 mM NaCl configuration can reasonably correspond to a dilute or homogeneous phase (without phase separation) or just a condensate with a lower protein concentration because the chains are still highly associated. One may argue that they become two droplets touching each other (the chains are not fully dispersed throughout the simulation box, unlike in typical coarse-grained simulations of biomolecular phase separation). While it may not be unfair to argue from this observation that the condensed phase is less stable at low salt, this raises critical questions about the adequacy of the approach as a stand-alone source of theoretical information. Accordingly, an informative discussion of the limitation of the authors' approach and comparisons with results from complementary approaches such as analytical theories and coarse-grained molecular dynamics will be instructive-even imperative, especially since such results exist in the literature (please see below).

      (2) The aforementioned limitation is reflected by the authors' choice of using Dmax as a sort of phase-separation order parameter. However, no evidence was shown to indicate that Dmax exhibits a two-state-like distribution expected of phase separation. It is also not clear whether a Dmax value corresponding to the linear dimension of the simulation box was ever encountered in the authors' simulated trajectories such that the chains can be reliably considered to be essentially fully dispersed as would be expected for the dilute phase. Moreover, as the authors have noted in the second paragraph of the Results, the variation of Dmax with simulation time does not show a monotonic rank order with salt concentration. The authors' explanation is equivalent to stipulating that the simulation system has not fully equilibrated, inevitably casting doubt on at least some of the conclusions drawn from the simulation data.

      (3) With these limitations, is it realistic to estimate possible differences in salt concentration between the dilute and condensed phases in the present work? These features, including tie-lines, were shown to be amenable to analytical theory and coarse-grained molecular dynamics simulation (please see below).

      (4) In the comparison in Fig.2B between experimental and simulated radius of gyration as a function of [NaCl], there is an outlier among the simulated radii of gyration at [NaCl] ~ 250 mM. An explanation should be offered.

      (5) The phenomenon of no phase separation at zero and low salt and phase separation at higher salt has been observed for the IDP Caprin1 and several of its mutants [Wong et al., J Am Chem Soc 142, 2471-2489 (2020) [https://pubs.acs.org/doi/full/10.1021/jacs.9b12208], see especially Fig.9 of this reference]. This work should be included in the discussion and added to Table 1.

      (6) The authors stated in the Introduction that "A unifying understanding of how salt affects the phase separation of IDPs is still lacking". While it is definitely true that much remains to be learned about salt effects on IDP phase separation, the advances that have already been made regarding salt effects on IDP phase separation is more abundant than that conveyed by this narrative. For instance, an analytical theory termed rG-RPA was put forth in 2020 to provide a uniform (unified) treatment of salt, pH, and sequence-charge-pattern effects on polyampholytes and polyelectrolytes (corresponding to the authors' low net charge and high net charge cases). This theory offers a means to predict salt-IDP tie-lines and a comprehensive account of salt effect on polyelectrolytes resulting in a lack of phase separation at extremely low salt and subsequent salt-enhanced phase separation (similar to the case the authors studied here) and in some cases re-entrant phase separation or dissolution [Lin et al., J Chem Phys 152. 045102 (2020) [https://doi.org/10.1063/1.5139661]]. This work is highly relevant and it already provided a conceptual framework for the authors' atomistic results and subsequent discussion. As such, it should definitely be a part of the authors' discussion.

      (7) Bridging interactions by small ions resulting in effective attractive interactions among polyelectrolytes leading to their phase separation have been demonstrated computationally by Orkoulas et al., Phys Rev Lett 90, 048303 (2003) [https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.90.048303]. This result should also be included in the discussion.

      (8) More recently, the salt-dependent phase separations of Caprin1, its RtoK variants and phosphorylated variant (see item #5 above) were modeled (and rationalized) quite comprehensively using rG-RPA, field-theoretic simulation, and coarse-grained molecular dynamics [Lin et al., arXiv:2401.04873 [https://arxiv.org/abs/2401.04873]], providing additional data supporting a conceptual perspective put forth in Lin et al. J Chem Phys 2020 (e.g., salt-IDP tie-lines, bridging interactions, re-entrance behaviors etc.) as well as in the authors' current manuscript. It will be very helpful to the readers of eLife to include this preprint in the authors' discussion, perhaps as per the authors' discretion-along the manner in which other preprints are referenced and discussed in the current version of the manuscript.

    1. Reviewer #2 (Public Review):

      Individuals with chronic kidney disease often have dyslipidemia, with the latter both a risk factor for atherosclerotic heart disease and a contributor to progressive kidney disease. Prior studies suggest that oxidized LDL (oxLDL) may cause renal injury through the activation of the LOX1 receptor. The authors had previously reported that LOX1 and AT1 interact to form a complex at the cell surface. In this study, the authors hypothesize that oxLDL, in the setting of angiotensin II, is responsible for driving renal injury by inducing a more pronounced conformational change of the AT1 receptor which results in enhanced Gq signaling.

      They go about testing the hypothesis in a set of three studies. In the first set, they engineered CHO cell lines to express AT1R alone, LOX1 in combination with AT1R, or LOX1 with an inactive form of AT1R and indirectly evaluated Gq activity using IP1 and calcium activity as read-outs. They assessed activity after treatment with AngII, oxLDL, or both in combination and found that treatment with both agents resulted in the greatest level of activity, which could be effectively blocked by a Gq inhibitor but not a Gi inhibitor nor a downstream Rho kinase inhibitor targeting G12/13 signaling. These results support their hypothesis, though variability in the level of activation was dramatically inconsistent from experiment to experiment, differing by as much as 20-fold. In contrast, within the experiment, differences between the AngII and AngII/oxLDL treatments, while nominally significant and consistent with their hypothesis, generally were only 10-20%. Another example of unexplained variability can be found in Figures 1g-1j. AngII, at a concentration of 10-12, has no effect on calcium flux in one set of studies (Figure 1g, h) yet has induced calcium activity to a level as great as AngII + oxLDL in another (Figure 1i). The inconsistency of results lessens confidence in the significance of these findings. In other studies with the LOX1-CHO line, they tested for conformational change by transducing AT1 biosensors previously shown to respond to AngII and found that one of them in fact showed enhanced BRET in the setting of oxLDL and AngII compared to AngII alone, which was blocked by an antibody to AT1R. The result is supportive of their conclusions. Limiting enthusiasm for these results is the fact that there isn't a good explanation as to why only 1 sensor showed a difference, and the study should have included a non-specific antibody to control for non-specific effects.

      The authors then repeated similar studies using publicly available rat kidney epithelial and fibroblast cell lines that have an endogenous expression of AT1R and LOX1. In these studies, oxLDL in combination with AngiI also enhanced Gq signaling, while knocking down either AT1R or LOX1, and treatment with inhibitors of Gq and AT1R blocked the effects. Like the prior set of studies, however, the effects are very modest and there was significant inter-experimental variability, reducing confidence in the significance of the findings. The authors then tested for evidence that the enhanced Gq signaling could result in renal injury by comparing qPCR results for target genes. While the results show some changes, their significance is difficult to assess. A more global assessment of gene expression patterns would have been more appropriate. In parallel with the transcriptional studies, they tested for evidence of epithelial-mesenchymal transition (EMT) using a single protein marker (alpha-smooth muscle actin) and found that its expression increased significantly in cells treated with oxLDL and AngII, which was blocked by inhibition of Gq inhibition and AT1R. While the data are sound, their significance is also unclear since EMT is a highly controversial cell culture phenomenon. Compelling in vivo studies have shown that most if not all fibroblasts in the kidney are derived from interstitial cells and not a product of EMT. In the last set of studies using these cell lines, the authors examined the effects of AngII and oxLDL on cell proliferation as assayed using BrdU. These results are puzzling---while the two agents together enhanced proliferation which was effectively blocked by an inhibitor to either AT1R or Gq, silencing of LOX1 had no effect.

      The final set of studies looked to test the hypothesis in mice by treating WT and Lox1-KO mice with different doses of AngII and either a normal or high-fat diet (to induce oxLDL formation). The authors found that the combination of high dose AngII and a high-fat diet (HFD) increased markers of renal injury (urinary 8-ohdg and urine albumin) in normal mice compared to mice treated with just AngII or HFD alone, which was blunted in Lox1-KO mice). These results are consistent with their hypothesis. However, there are other aspects of these studies that are either inconsistent or complicating factors that limit the strength of the conclusions. For example, Lox1- KO had no effect on renal injury marker expression in mice treated with low-dose AngII and HFD. It also should be noted that Lox1-KO mice had a lower BP response to AngII, which could have reduced renal injury independent of any effects mediated by the AT1R/LOX1 interaction. Another confounding factor was the significant effect the HFD diet had on body weight. While the groups did not differ based on AngII treatment status, the HFD consistently was associated with lower total body weight, which is unexplained. Next, the authors sought to find more direct evidence of renal injury using qPCR of candidate genes and renal histology. The transcriptional results are difficult to interpret; moreover, there were no significant histologic differences between groups. They conclude the study by showing the pattern of expression of LOX1 and AT1R in the kidney by immunofluorescence and conclude that the proteins overlap in renal tubules and are absent from the glomerulus. Unfortunately, they did not co-stain with any other markers to identify the specific cell types. However, these results are inconsistent with other studies that show AT1R is highly expressed in mesangial cells, renal interstitial cells, near the vascular pole, JG cells, and proximal tubules but generally absent from most other renal tubule segments.

      In sum, this study tackles an important clinical issue and provides some in vitro evidence to support a mechanism whereby dyslipidemia could accelerate renal functional decline through activation of the AT1R/LOX1 complex by oxLDL and AngII.

      However, a very high degree of variability in the results, modest within-experiment differences, some internal inconsistencies that aren't explained, and the lack of compelling and strongly supportive in vivo results suggest this is still more a hypothesis than an established likely mechanism.

    1. Reviewer #2 (Public Review):

      Based on bioinformatics and expression analysis using mouse and human samples, the authors claim that the adhesion G-protein coupled receptor ADGRA3 may be a valuable target for increasing thermogenic activity and metabolic health. Genetic approaches to deplete ADGRA3 expression in vitro resulted in reduced expression of thermogenic genes including Ucp1, reduced basal respiration, and metabolic activity as reflected by reduced glucose uptake and triglyceride accumulation. In line, nanoparticle delivery of shAdgra3 constructs is associated with increased body weight, reduced thermogenic gene expression in white and brown adipose tissue (WAT, BAT), and impaired glucose and insulin tolerance. On the other hand, ADGRA3 overexpression is associated with an improved metabolic profile in vitro and in vivo, which can be explained by increasing the activity of the well-established Gs-PKA-CREB axis. Notably, a computational screen suggested that ADGRA3 is activated by hesperetin. This metabolite is a derivative of the major citrus flavonoid hesperidin and has been described to promote metabolic health. Using appropriate in vitro and in vivo studies, the authors show that hesperetin supplementation is associated with increased thermogenesis, UCP1 levels in WAT and BAT, and improved glucose tolerance, an effect that was attenuated in the absence of ADGRA3 expression.

      Overall, the data suggest that ADGRA3 is a constitutively active Gs-coupled receptor that improves metabolism by activating adaptive thermogenesis in WAT and BAT. The conclusions of the paper are partly supported by the data, but some experimental approaches need further clarification.

      (1) The in vivo approaches to modulate Adgra3 expression in mice are carried out using non-targeted nanoparticle-based approaches. The authors do not provide details of the composition of the nanomaterials, but it is highly likely that other metabolically active organs such as the liver are targeted. This is critical because Adgre3 is expressed in many organs, including the liver, adrenal glands, and gastrointestinal system. Therefore, many of the observed metabolic effects could be indirect, for example by modulating bile acids or corticosterone levels. Consistent with this, after digestion in the gastrointestinal tract, hesperetin is rapidly metabolized in intestinal and liver cells. Thus, hesperetin levels in the systemic circulation are likely to be insufficient to activate Adgra3 in thermogenic adipocytes/precursors. Overall, the authors need to repeat the key metabolic experiments in adipose-specific Adgra3 knockout/overexpression models to validate the reliability of the in vivo results. In addition, to validate the relevance of hesperetin supplementation for adaptive thermogenesis in BAT and WAT vivo, the levels of hesperetin present in the systemic circulation should be quantified.

      (2) Standard measurements for energy balance are not presented. Quantitative data on energy expenditure, e.g. by indirect calorimetry, and food intake are missing and need to be included to validate the authors' claims.

      (3) The thermographic images used to determine the BAT temperature are not very convincing. The distance and angle between the thermal camera and the BAT have a significant effect on the determination of the temperature, which is not taken into account, at least in the images presented.

      (4) The 3T3-L1 cell line is not an adequate cell culture model to study thermogenic adipocyte differentiation. To validate their results, the key experiments showing that ADGRA3 expression modulates thermogenic marker expression in a hesperetin-dependent manner need to be performed in a reliable model, e.g. primary murine adipocytes.

      (5) The experimental setup only allows the measurement of basal cellular respiration. More advanced approaches are needed to define the contribution of ADGRA3 versus classical adrenergic receptors to UCP1-dependent thermogenesis.

    1. Reviewer #2 (Public Review):

      Summary:

      This study uses an elegant design, using cross-decoding of multivariate fMRI patterns across different types of stimuli, to convincingly show a functional dissociation between two sub-regions of the parietal cortex, the anterior inferior parietal lobe (aIPL) and superior parietal lobe (SPL) in visually processing actions. Specifically, aIPL is found to be sensitive to the causal effects of observed actions (e.g. whether an action causes an object to compress or to break into two parts), and SPL to the motion patterns of the body in executing those actions.

      To show this, the authors assess how well linear classifiers trained to distinguish fMRI patterns of response to actions in one stimulus type can generalize to another stimulus type. They choose stimulus types that abstract away specific dimensions of interest. To reveal sensitivity to the causal effects of actions, regardless of low-level details or motion patterns, they use abstract animations that depict a particular kind of object manipulation: e.g. breaking, hitting, or squashing an object. To reveal sensitivity to motion patterns, independently of causal effects on objects, they use point-light displays (PLDs) of figures performing the same actions. Finally, full videos of actors performing actions are used as the stimuli providing the most complete, and naturalistic information. Pantomime videos, with actors mimicking the execution of an action without visible objects, are used as an intermediate condition providing more cues than PLDs but less than real action videos (e.g. the hands are visible, unlike in PLDs, but the object is absent and has to be inferred). By training classifiers on animations, and testing their generalization to full-action videos, the classifiers' sensitivity to the causal effect of actions, independently of visual appearance, can be assessed. By training them on PLDs and testing them on videos, their sensitivity to motion patterns, independent of the causal effect of actions, can be assessed, as PLDs contain no information about an action's effect on objects.

      These analyses reveal that aIPL can generalize between animations and videos, indicating that it is sensitive to action effects. Conversely, SPL is found to generalize between PLDs and videos, showing that it is more sensitive to motion patterns. A searchlight analysis confirms this pattern of results, particularly showing that action-animation decoding is specific to right aIPL, and revealing an additional cluster in LOTC, which is included in subsequent analyses. Action-PLD decoding is more widespread across the whole action observation network.

      This study provides a valuable contribution to the understanding of functional specialization in the action observation network. It uses an original and robust experimental design to provide convincing evidence that understanding the causal effects of actions is a meaningful component of visual action processing and that it is specifically localized in aIPL and LOTC.

      Strengths:

      The authors cleverly managed to isolate specific aspects of real-world actions (causal effects, motion patterns) in an elegant experimental design, and by testing generalization across different stimulus types rather than within-category decoding performance, they show results that are convincing and readily interpretable. Moreover, they clearly took great care to eliminate potential confounds in their experimental design (for example, by carefully ordering scanning sessions by increasing realism, such that the participants could not associate animation with the corresponding real-world action), and to increase stimulus diversity for different stimulus types. They also carefully examine their own analysis pipeline, and transparently expose it to the reader (for example, by showing asymmetries across decoding directions in Figure S3). Overall, this is an extremely careful and robust paper.

      Weaknesses:

      I list several ways in which the paper could be improved below. More than 'weaknesses', these are either ambiguities in the exact claims made, or points that could be strengthened by additional analyses. I don't believe any of the claims or analyses presented in the paper show any strong weaknesses, problematic confounds, or anything that requires revising the claims substantially.

      (1) Functional specialization claims: throughout the paper, it is not clear what the exact claims of functional specialization are. While, as can be seen in Figure 3A, the difference between action-animation cross-decoding is significantly higher in aIPL, decoding performance is also above chance in right SPL, although this is not a strong effect. More importantly, action-PLD cross-decoding is robustly above chance in both right and left aIPL, implying that this region is sensitive to motion patterns as well as causal effects. I am not questioning that the difference between the two ROIs exists - that is very convincingly shown. But sentences such as "distinct neural systems for the processing of observed body movements in SPL and the effect they induce in aIPL" (lines 111-112, Introduction) and "aIPL encodes abstract representations of action effect structures independently of motion and object identity" (lines 127-128, Introduction) do not seem fully justified when action-PLD cross-decoding is overall stronger than action-animation cross-decoding in aIPL. Is the claim, then, that in addition to being sensitive to motion patterns, aIPL contains a neural code for abstracted causal effects, e.g. involving a separate neural subpopulation or a different coding scheme? Moreover, if sensitivity to motion patterns is not specific to SPL, but can be found in a broad network of areas (including aIPL itself), can it really be claimed that this area plays a specific role, similar to the specific role of aIPL in encoding causal effects? There is indeed, as can be seen in Figure 3A, a difference between action-PLD decoding in SPL and aIPL, but based on the searchlight map shown in Figure 3B I would guess that a similar difference would be found by comparing aIPL to several other regions. The authors should clarify these ambiguities.

      (2) Causal effect information in PLDs: the reasoning behind the use of PLD stimuli is to have a condition that isolates motion patterns from the causal effects of actions. However, it is not clear whether PLDs really contain as little information about action effects as claimed. Cross-decoding between animations and PLDs is significant in both aIPL and LOTC, as shown in Figure 4. This indicates that PLDs do contain some information about action effects. This could also be tested behaviorally by asking participants to assign PLDs to the correct action category. In general, disentangling the roles of motion patterns and implied causal effects in driving action-PLD cross-decoding (which is the main dependent variable in the paper) would strengthen the paper's message. For example, it is possible that the strong action-PLD cross-decoding observed in aIPL relies on a substantially different encoding from, say, SPL, an encoding that perhaps reflects causal effects more than motion patterns. One way to exploratively assess this would be to integrate the clustering analysis shown in Figure S1 with a more complete picture, including animation-PLD and action-PLD decoding in aIPL.

      (3) Nature of the motion representations: it is not clear what the nature of the putatively motion-driven representation driving action-PLD cross-decoding is. While, as you note in the Introduction, other regions such as the superior temporal sulcus have been extensively studied, with the understanding that they are part of a feedforward network of areas analyzing increasingly complex motion patterns (e.g. Riese & Poggio, Nature Reviews Neuroscience 2003), it doesn't seem like the way in which SPL represents these stimuli are similarly well-understood. While the action-PLD cross-decoding shown here is a convincing additional piece of evidence for a motion-based representation in SPL, an interesting additional analysis would be to compare, for example, RDMs of different actions in this region with explicit computational models. These could be, for example, classic motion energy models inspired by the response characteristics of regions such as V5/MT, which have been shown to predict cortical responses and psychophysical performance both for natural videos (e.g. Nishimoto et al., Current Biology 2011) and PLDs (Casile & Giese Journal of Vision 2005). A similar cross-decoding analysis between videos and PLDs as that conducted on the fMRI patterns could be done on these models' features, obtaining RDMs that could directly be compared with those from SPL. This would be a very informative analysis that could enrich our knowledge of a relatively unexplored region in action recognition. Please note, however, that action recognition is not my field of expertise, so it is possible that there are practical difficulties in conducting such an analysis that I am not aware of. In this case, I kindly ask the authors to explain what these difficulties could be.

      (4) Clustering analysis: I found the clustering analysis shown in Figure S1 very clever and informative. However, there are two things that I think the authors should clarify. First, it's not clear whether the three categories of object change were inferred post-hoc from the data or determined beforehand. It is completely fine if these were just inferred post-hoc, I just believe this ambiguity should be clarified explicitly. Second, while action-anim decoding in aIPL and LOTC looks like it is consistently clustered, the clustering of action-PLD decoding in SPL and LOTC looks less reliable. The authors interpret this clustering as corresponding to the manual vs. bimanual distinction, but for example "drink" (a unimanual action) is grouped with "break" and "squash" (bimanual actions) in left SPL and grouped entirely separately from the unimanual and bimanual clusters in left LOTC. Statistically testing the robustness of these clusters would help clarify whether it is the case that action-PLD in SPL and LOTC has no semantically interpretable organizing principle, as might be the case for a representation based entirely on motion pattern, or rather that it is a different organizing principle from action-anim, such as the manual vs. bimanual distinction proposed by the authors. I don't have much experience with statistical testing of clustering analyses, but I think a permutation-based approach, wherein a measure of cluster robustness, such as the Silhouette score, is computed for the clusters found in the data and compared to a null distribution of such measures obtained by permuting the data labels, should be feasible. In a quick literature search, I have found several papers describing similar approaches: e.g. Hennig (2007), "Cluster-wise assessment of cluster stability"; Tibshirani et al. (2001) "Estimating the Number of Clusters in a Data Set Via the Gap Statistic". These are just pointers to potentially useful approaches, the authors are much better qualified to pick the most appropriate and convenient method. However, I do think such a statistical test would strengthen the clustering analysis shown here. With this statistical test, and the more exhaustive exposition of results I suggested in point 2 above (e.g. including animation-PLD and action-PLD decoding in aIPL), I believe the clustering analysis could even be moved to the main text and occupy a more prominent position in the paper.

      (5) ROI selection: this is a minor point, related to the method used for assigning voxels to a specific ROI. In the description in the Methods (page 16, lines 514-24), the authors mention using the MNI coordinates of the center locations of Brodmann areas. Does this mean that then they extracted a sphere around this location, or did they use a mask based on the entire Brodmann area? The latter approach is what I'm most familiar with, so if the authors chose to use a sphere instead, could they clarify why? Or, if they did use the entire Brodmann area as a mask, and not just its center coordinates, this should be made clearer in the text.

    1. Reviewer #2 (Public Review):

      Summary:

      The study links Alzheimer's disease (AD) with metabolic disorders through elevated Kallistatin levels in AD patients. Kallistatin-overexpressing mice show cognitive decline, increased Aβ and tau pathology, and impaired hippocampal function. Mechanistically, Kallistatin enhances Aβ production via Notch1 and promotes tau phosphorylation through GSK-3β activation. Fenofibrate improves cognitive deficits by reducing Aβ and tau phosphorylation in these mice, suggesting therapeutic potential in AD linked to metabolic syndromes.

      Strengths:

      This study presents novel insights into AD pathogenesis and provides strong evidence about the mechanistic roles of Kallistatin, and the therapeutic potential of fenofibrate in AD.

      Weaknesses:

      It was suggested that Kallistatin is primarily produced by the liver. The study demonstrates increased Kallistatin levels in the hippocampus tissue of AD mice. It would be valuable to clarify if Kallistatin is also increased in the liver of AD mice, providing a comprehensive understanding of its distribution in disease states.

      Does Kallistatin interact directly with Notch1 ligands? Clarifying this interaction mechanism would enhance understanding of how Kallistatin influences Notch1 signaling in AD pathology.

      Is there any observed difference in AD phenotype between male and female Kallistatin-transgenic (KAL-TG) mice? Including this information would address potential gender-specific effects on cognitive decline and pathology.

      It is recommended to include molecular size markers in Western blots for clarity and accuracy in protein size determination.

      The language should be revised for enhanced readability and clarity, ensuring that complex scientific concepts are communicated effectively to a broader audience.

    1. Reviewer #2 (Public Review):

      Cuevas et al. investigate the stimulus selectivity of surround-induced responses in the mouse primary visual cortex (V1). While classical experiments in non-human primates and cats have generally demonstrated that stimuli in the surround receptive field (RF) of V1 neurons only modulate activity to stimuli presented in the center RF, without eliciting responses when presented in isolation, recent studies in mouse V1 have indicated the presence of purely surround-induced responses. These have been linked to prediction error signals. In this study, the authors build on these previous findings by systematically examining the stimulus selectivity of surround-induced responses.

      Using neuropixels recordings in V1 and the dorsal lateral geniculate nucleus (dLGN) of head-fixed, awake mice, the authors presented various stimulus types (gratings, noise, surfaces) to the center and surround, as well as to the surround only, while also varying the size of the stimuli. Their results confirm the existence of surround-induced responses in mouse V1 neurons, demonstrating that these responses do not require spatial or temporal coherence across the surround, as would be expected if they were linked to prediction error signals. Instead, they suggest that surround-induced responses primarily reflect the representation of the achromatic surface itself.

      The literature on center-surround effects in V1 is extensive and sometimes confusing, likely due to the use of different species, stimulus configurations, contrast levels, and stimulus sizes across different studies. It is plausible that surround modulation serves multiple functions depending on these parameters. Within this context, the study by Cuevas et al. makes a significant contribution by exploring the relationship between surround-induced responses in mouse V1 and stimulus statistics. The research is meticulously conducted and incorporates a wide range of experimental stimulus conditions, providing valuable new insights regarding center-surround interactions.

      However, the current manuscript presents challenges in readability for both non-experts and experts. Some conclusions are difficult to follow or not clearly justified.

      I recommend the following improvements to enhance clarity and comprehension:

      (1) Clearly state the hypotheses being tested at the beginning of the manuscript.

      (2) Always specify the species used in referenced studies to avoid confusion (esp. Introduction and Discussion).

      (3) Briefly summarize the main findings at the beginning of each section to provide context.

      (4) Clearly define important terms such as "surface stimulus" and "early vs. late stimulus period" to ensure understanding.

      (5) Provide a rationale for each result section, explaining the significance of the findings.

      (6) Offer a detailed explanation of why the results do not support the prediction error signal hypothesis but instead suggest an encoding of the achromatic surface.

      These adjustments will help make the manuscript more accessible and its conclusions more compelling.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript presenting the discovery of a heparan-sulfate (HS) binding domain in monkeypox virus (MPXV) H3 protein as a new anti-poxviral drug target, presented by Bin Zhen and co-workers, is of interest, given that it offers a potentially broad antiviral substance to be used against poxviruses. Using new computational biology techniques, the authors identified a new alpha-helical domain in the H3 protein, which interacts with cell surface HS, and this domain seems to be crucial for H3-HS interaction. Given that this domain is conserved across orthopoxviruses, authors designed protein inhibitors. One of these inhibitors, AI-PoxBlock723, effectively disrupted the H3-HS interaction and inhibited infection with Monkeypox virus and Vaccinia virus. The presented data should be of interest to a diverse audience, given the possibility of an effective anti-poxviral drug. 

      Strengths:

      In my opinion, the experiments done in this work were well-planned and executed. The authors put together several computational methods, to design poxvirus inhibitor molecules, and then they test these molecules for infection inhibition.

      Weaknesses:

      One thing that could be improved, is the presentation of results, to make them more easily understandable to readers, who may not be experts in protein modeling programs. For example, figures should be self-explanatory and understood on their own, without the need to revise text. Therefore, the figure legend should be more informative as to how the experiments were done.

    1. Reviewer #3 (Public Review):

      Summary: Through a rigorous methodology, the authors demonstrated that within 11 different primates, the shape of the brain followed a universal scaling law with fractal properties. They enhanced the universality of this result by showing the concordance of their results with a previous study investigating 70 mammalian brains, and the discordance of their results with other folded objects that are not brains. They incidentally illustrated potential applications of this fractal property of the brain by observing a scale-dependant effect of aging on the human brain.

      Strengths:<br /> - New hierarchical way of expressing cortical shapes at different scales derived from previous report through implementation of a coarse-graining procedure<br /> - Investigation of 11 primate brains and contextualisation with other mammals based on prior literature<br /> - Proposition of tool to analyse cortical morphology requiring no fine tuning and computationally achievable<br /> - Positioning of results in comparison to previous works reinforcing the validity of the observation.<br /> - Illustration of scale-dependance of effects of brain aging in the human.

      Weaknesses:<br /> - The notion of cortical shape, while being central to the article, is not really defined, leaving some interpretation to the reader<br /> - The organization of the manuscript is unconventional, leading to mixed contents in different sections (sections mixing introduction and method, methods and results, results and discussion...). As a result, the reader discovers the content of the article along the way, it is not obvious at what stages the methods are introduced, and the results are sometimes presented and argued in the same section, hindering objectivity.<br /> To improve the document, I would suggest a modification and restructuring of the article such that: 1) by the end of the introduction the reader understands clearly what question is addressed and the value it holds for the community, 2) by the end of the methods the reader understands clearly all the tools that will be used to answer that question (not just the new method), 3) by the end of the results the reader holds the objective results obtained by applying these tools on the available data (without subjective interpretations and justifications), and 4) by the end of the discussion the reader understands the interpretation and contextualisation of the study, and clearly grasps the potential of the method depicted for the better understanding of brain folding mechanisms and properties.

    1. Reviewer #3 (Public Review):

      In the manuscript titled "Structure and Evolution of Alanine/Serine Decarboxylases and the Engineering of Theanine Production," Wang et al. solved and compared the crystal structures of Alanine Decarboxylase (AlaDC) from Camellia sinensis and Serine Decarboxylase (SerDC) from Arabidopsis thaliana. Based on this structural information, the authors conducted both in vitro and in vivo functional studies to compare enzyme activities using site-directed mutagenesis and subsequent evolutionary analyses. This research has the potential to enhance our understanding of amino acid decarboxylase evolution and the biosynthetic pathway of the plant specialized metabolite theanine, as well as to further its potential applications in the tea industry.

    1. Reviewer #3 (Public Review):

      This is an interesting manuscript that builds off of this group's previous work focused on the interface between Hsf1, heat shock protein (HSP) mRNA production, and 3D genome topology. Here the group subjects the yeast Saccharomyces cerevisiae to either heat stress (HS) or ethanol stress (ES) and examines Hsf1 and Pol II chromatin binding, Histone occupancy, Hsf1 condensates, HSP gene coalescence (by 3C and live cell imaging), and HSP mRNA expression (by RT-qPCR and live cell imaging). The manuscript is well written, and the experiments seem well done, and generally rigorous, with orthogonal approaches performed to support conclusions. The main findings are that both HS and ES result in Hsf1/Pol II-dependent intergenic interactions, along with formation of Hsf1 condensates. Yet, while HS results in rapid and strong induction of HSP gene expression and Hsf1 condensate resolution, ES result in slow and weak induction of HSP gene expression without Hsf1 condensate resolution. Thus, the conclusion is somewhat phenomenological - that the same transcription factor can drive distinct transcription, topologic, and phase-separation behavior in response to different types of stress. While identifying a mechanistic basis for these results would be a tough task perhaps beyond the scope of this study, it would nevertheless be helpful to place these results in context with a series of other studies demonstrating across various organisms showing Hsf1 driving distinct activities dependent on the context of activation. Perhaps even more importantly, this work left out PMID: 32015439 which is particularly relevant considering that it shows that it is human HSF1 condensate resolution rather than simple condensate formation that is associated with HSF1 transcriptional activity - which are similar to the findings here with this particular dose of HS resulting in resolution and high transcriptional activity versus ES resulting in resolution failure and lower activity. It is also worth noting that the stresses themselves are quite different - ethanol can be used as a carbon source and so beyond inducing proteotoxic stress, the yeast are presumably adapting to this distinct metabolic state. Basically, it is not clear whether these differences are due to the dose of stress, versus we are looking at an early timepoint as ES initiates a genome-wide chromatin restructuring and gene expression reprogramming that goes beyond a response to proteotoxic stress. This reviewer is not suggesting a barrage of new experiments, but perhaps discussion points to contextualize results.

      Comments on latest version:

      The authors have addressed my concerns.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript titled "Identification of pharmacological inducers of a reversible hypometabolic state for whole organ preservation" reports the effects of delta opioid receptor activator SNC80 and its modified analog WB3 with ~1,000 times less delta opioid receptor binding activity on metabolic state.

      Strengths:

      This is an interesting study with potentially broad implications for organ preservation.

      Weaknesses:

      However, there are several limitations which raise concerns.

      (1) The authors developed an analog of a known delta opioid receptor activator SNC80 with three orders of magnitude lesser binding with the delta opioid receptor WB3. This will likely reduce the undesirable effects of SNC80 while preserving metabolic slowing needed for organ preservation. Yet, most experiments were done with SNC80, not the superior modification, WB3, shown in only a limited set of experiments, Figure 3.

      (2) The heart is one of the most challenging organs to preserve, and some experiments are done to establish the metabolic effects of SNC80. However, the biodistribution study, shown in Figure 2, conspicuously omitted the heart.

      (3) I do not understand the design of the electrophysiology and contractility experiments with the porcine hearts. How did you defibrillate the hearts after removal and establishing perfusion? Lines 173-175 on Page 7 state: "After defibrillation with epinephrine, the P and QRS waveforms were visible in ECGs from 3 of 4 SNC80-treated hearts (Table S1), suggesting that those hearts regain atrial and ventricular polarization." Please clarify. Defibrillation is done with an electric shock. Also, please show the ECG recordings to support your conclusions about "polarization." What did you mean by "polarization"? Depolarization? Repolarization? Or resting potential. To establish a normal physiological state, please show ECG waveforms and present data on basic ECG characteristics: heart rate, PQ and QT intervals, and P and QRS durations. I recommend perfusion of the porcine heart with WB3, not only SNC80.

      (4) Pathology data also raises concerns. The histology images shown in Figure 4f are not quantified, and they show apparently higher levels of tissue disruption in SNC80-treated tissue vs vehicle-treated. The test (lines 169-171) confirms this concern: "In some hearts treated with SNC80, greater waviness of muscle fibers was observed, possibly indicating a state of muscle contraction." It will be helpful to measure markers of apoptosis and necrosis and to apply TTC viability staining.

      (5) The apparent state of contracture suggests a higher degree of myocardial damage and a high intracellular calcium level in SNC80-treated hearts. The authors suggested that the sodium-calcium exchanger NCX is a possible target of SNC80 and could be responsible for the "hypometabolic state." However, NCX1 is critically important in the extrusion of cytosolic Ca2+ during the diastolic phase. Failure to remove excessive calcium and restore ionic homeostasis would lead to calcium overload and heart failure.

      (6) I am surprised the authors did not consider using the gold standard assay for measuring mitochondrial function in cells by the Seahorse Cell Mito Stress Test.

      Comments on revised version:

      I am satisfied with the revisions. The authors addressed major concerns with new data and/or provided satisfactory rebuttal.

    1. Reviewer #2 (Public Review):

      Summary:<br /> Mistri et al explore the role of SLAM-SAP signaling in the developmental programming of innate-like gd T cell subsets. Using proteo-genomics, they determined that abrogation of SLAM-SAP signaling altered that programming, reducing some IL-17 producing subsets, including a novel Vγ4 γδT1 subset, and diverting gdTCR-expressing precursors to the ab fate. Altogether, this is a very thorough, thoughtfully interpreted study that adds significantly to our understanding of the contribution of the SLAM-SAP pathway to lineage specification. A particularly interesting element is the role of SLAM-SAP in preventing gd17 progenitors from switching fates and adopting the ab fate.

      Comments on revised version:

      The authors have addressed the minor issues raised in the original submission.

    1. Reviewer #2 (Public Review):

      Summary:

      This work demonstrates that when E. coli cells divide, and division is not quite symmetric, the smaller cell has a higher growth rate than the larger cell at the beginning, but not the end, of the cell cycle. The authors then demonstrate that smaller cells have a higher ribosome concentration than larger cells, which is consistent with the idea that the two cells receive roughly equal numbers of ribosomes at division because, as they also observe, ribosomes are excluded by the nucleoid from the middle of the mother cell. The experimental observations are reproduced by a mathematical model that assumes growth is driven by ribosome concentration, with contributions from metabolism and active feedback.

      Strengths:

      The work provides strong evidence in support of the growing consensus that cells correct size fluctuations by modulating growth rate, within a cell cycle and on a single-cell basis. It also offers a plausible explanation for the correction mechanism by showing that ribosomes are excluded from the middle of a mother cell and have a higher concentration in the smaller daughter cell. The work is clearly written and benefits from a strong coupling between the experimental and modeling results. It provides a solid contribution to the field of single-cell bacterial growth control.

      Weaknesses:

      Although the results strongly suggest it, the work does not explicitly demonstrate (e.g. by direct perturbation) that higher ribosome concentration is the cause of the higher growth rate. Also, it is unclear why an active compensation mechanism is needed in the model, i.e., why size-dependent growth (via ribosome concentration) does not correct growth rate perturbations within a cell cycle automatically.

    1. Reviewer #2 (Public Review):

      Summary:

      This work describes the structure of Heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), a lysosomal membrane protein that catalyzes the acetylation reaction of the terminal alpha-D-glucosamine group required for degradation of heparan sulfate (HS). HS degradation takes place during the degradation of the extracellular matrix, a process required for restructuring tissue architecture, regulation of cellular function and differentiation. During this process, HS is degraded into monosaccharides and free sulfate in lysosomes.

      HGSNAT catalyzes the transfer of the acetyl group from acetyl-CoA to the terminal non-reducing amino group of alpha-D-glucosamine. The molecular mechanism by which this process occur has not been described so far. One of the main reasons to study the mechanism of HGSNAT is that multiple mutations spanning the entire sequence of the protein, such as, nonsense mutations, splice-site variants, and missense mutations lead to dysfunction that causes abnormal accumulation of HS within the lysosomes. This accumulation is a cause of mucopolysaccharidosis IIIC (MPS IIIC), an autosomal recessive neurodegenerative lysosomal storage disorder, for which there are no approved drugs or treatment strategies.<br /> This paper provides a 3.26A structure of HGSNAT, determined by single-particle cryo-EM. The structure reveals that HGSNAT is a dimer in detergent micelles, and a density assigned to acetyl-CoA. The authors speculate about the molecular mechanism of the acetylation reaction, map the mutations known to cause MPS IIIC on the structure and speculate about the nature of the HGSNAT disfunction caused by such mutations.

      Strengths:

      The paper describes a structure of HGSNAT a member of the transmembrane acyl transferase (TmAT) superfamily. The high-resolution of a HGSNAT bound to acetyl-CoA is important for our understanding of HGSNAT mechanism. The density map is of high-quality, except for the luminal domain. The location of the acetyl-CoA allows speculation about the mechanistic role of multiple residues surrounding this molecule. The authors thoroughly describe the architecture of HGSNAT and map the mutations leading to MPS IIIC.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper utilizes a neural network model to investigate how the brain employs an adaptive chunking strategy to effectively enhance working memory capacity, which is a classical and significant question in cognitive neuroscience. By integrating perspectives from both the 'slot model' and 'limited resource models,' the authors adopted a neural network model encompassing the prefrontal cortex and basal ganglia, introduced an adaptive chunking strategy, and proposed a novel hybrid model. The study demonstrates that the brain can adaptively bind various visual stimuli into a single chunk based on the similarity of color features (a continuous variable) among items in visual working memory, thereby improving working memory efficiency. Additionally, it suggests that the limited capacity of working memory arises from the computational characteristics of the neural system, rather than anatomical constraints.

      Strengths:

      The neural network model utilized in this paper effectively integrates perspectives from both slot models and resource models (i.e., resource-like constraints within a slot-like system). This methodological innovation provides a better explanation for the limited capacity of working memory. By simulating the neural networks of the prefrontal cortex and basal ganglia, the model demonstrates how to optimize working memory storage and retrieval strategies through reinforcement learning (i.e., the efficient management of access to and from working memory). This biologically plausible simulation offers a novel perspective on human working memory and potentially provides a novel explanation for the working memory difficulties observed in patients with Parkinson's disease and other disorders. Furthermore, the effectiveness of the model is validated through computational simulation experiments, yielding reliable and robust predictions.

      Weaknesses:

      The model employs a spiking neural network, which is relatively complex. Additionally, while this paper validates the effectiveness of chunking strategies used by the brain to enhance working memory efficiency through computational simulations, further comparison with related phenomena observed in cognitive neuroscience experiments on limited working memory capacity, such as the recency effect, is necessary to verify its generalizability.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Shore et al. investigate the consequent changes in excitability and synaptic efficacy of diverse neuronal populations in an animal model of juvenile epilepsy. Using electrophysiological patch-clamp recordings from dissociated neuronal cultures, the authors find diverging changes in two major populations of inhibitory cell types, namely somatostatin (SST)- and parvalbumin (PV)-positive interneurons, in mice expressing a variant of the KCNT1 potassium channel. They further suggest that the differential effects are due to a compensatory increase in the persistent sodium current in PV interneurons in pharmacological and in silico experiments. It remains unclear why this current is selectively enhanced in PV-interneurons.

      Strengths:

      (1) Heterozygous KCNT1 gain of function variant was used which more accurately models the human disorder.

      (2) The manuscript is clearly written, and the flow is easy to follow. The authors explicitly state the similarities and differences between the current findings and the previously published results in the homozygous KCNT1 gain of function variant.

      (3) This study uses a variety of approaches including patch clamp recording, in silico modeling and pharmacology that together make the claims stronger.

      (4) Pharmacological experiments are fraught with off-target effects and thus it bolsters the authors' claims when multiple channel blockers (TTX and VU170) are used to reconstruct the sodium-activated potassium current.

      Weaknesses:

      (1) This study mostly relies on recordings in dissociated cortical neurons. Although specific WT interneurons showed intrinsic membrane properties like those reported for acute brain slices, it is unclear whether the same will be true for those cells expressing KCNT1 variants, especially when the excitability changes are thought to arise from homeostatic compensatory mechanisms. The authors do confirm that mutant SST-interneurons are hypoexcitable using an ex vivo slice preparation which is consistent with work for other KCTN1 gain of function variants (e.g. Gertler et al., 2022). However, the key missing evidence is the excitability state of mutant PV-interneurons, given the discrepant result of reduced excitability of PV cells reported by Gertler et al in acute hippocampal slices.

    1. Reviewer #2 (Public Review):

      Summary:

      Complexin (Cplx) is expressed at nearly all chemical synapses. Mammalian Cplx comes in four different paralogs which are differentially expressed in different neurons or secretory cell types, either selectively or in combination with one or two other Cplx isoforms. Cplx binds with high affinity to assembled SNARE complexes and promotes evoked synchronous release. Cplx is assumed to preclude premature SV fusion by preventing full SNARE assembly, thereby arresting subsequent SNARE-driven fusion ("fusion-clamp" theory). The protein has multiple domains, the functions of which are controversially discussed. Cplx's function has been studied in a variety of model organisms including mouse, fly, worm, and fish with seemingly conflicting results which led to partly contradicting conclusions.<br /> Makee et al. study the function of mammalian Cplx2 in chromaffin cells by making use of Cplx2 ko mice to overexpress and functionally characterize mutant Cplx2 forms in cultured chromaffin cells. The main conclusion of the present study are:

      The hydrophobic character of the amphipathic helix in Cplx's C-terminal domain is essential for inhibiting premature vesicle fusion at a [Ca2+]i of several hundreds of nM (pre-flash [Ca2+]i). The Cplx-mediated inhibition of fusion under these conditions does not rely on expression of either Syt1 or Syt7.

      Slow-down of exocytosis by N-terminally truncated Cplx mutants in response to a [Ca2+]i of several µM (peak flash [Ca2+]i) occurs regardless of the presence or absence of Syt7 demonstrating that Cplx2 does not act as a switch favoring preferential assembly of the release machinery with Syt1,2 rather than the "slow" sensor Syt7.

      Cplx's N-terminal domain is required for the Cplx2-mediated increase in the speed of exocytosis and faster onset of exocytosis which likely reflect an increased apparent Ca2+ sensitivity and faster Ca2+ binding of the release machinery.

      Strengths:

      The authors perform systematic truncation/mutational analyses of Cplx2. They analyze the impact of single and combined deficiencies for Cplx2 and Syt1 to establish interactions of both proteins.<br /> State-of-the-art methods are employed: Vesicle exocytosis is assayed directly and with high resolution using capacitance measurements. Intracellular [Ca2+] is controlled by loading via the patch-pipette and by UV-light induced flash-photolysis of caged [Ca2+]. The achieved [Ca2+ ] is measured with Ca2+ -sensitive dyes.<br /> The data is of high quality and the results are compelling.

      Weaknesses:

      With the exception of mammalian retinal ribbon synapses (and some earlier RNAi knock down studies which had off-target effects), there is little experimental evidence for a "fusion-clamp"-like function of Cplxs at mammalian synapses. At conventional mammalian synapses, genetic loss of Cplx (i.e. KO) consistently decreases AP-evoked release, and generally either also decreases spontaneous release rates or does not affect spontaneous release, which is inconsistent with a "fusion-clamp" theory. This is in stark contrast to invertebrate (D. m. and C. e.) synapses where genetic Cplx loss is generally associated with a strong upregulation of spontaneous release.

      There are alternative scenarios explaining how Cplx may phenomenological "clamp" vesicle fusion rates without mechanistically assigning a "clamping" function to Cplx (Neher 2010, Neuron). In fact, changes in asynchronous release kinetics following conditioning AP trains observed at Cplx1 ko calyx of Held synapses do not favor a "fusion clamp" model (Chang et al., 2015, J.Neurosci.), while an alternative model, assigning Cplx the role of a "checkpoint" protein in SNARE assembly, quantitatively reproduces all experimental observations (Lopez et al., 2024, PNAS). It might be helpful for a reader to mention such alternative scenarios.

    1. Reviewer #2 (Public Review):

      In this manuscript, Rachubinski and colleagues provide a comprehensive clinical, immunological, and autoantibody assessment of autoimmune/inflammatory manifestations of patients with Down syndrome (DS) in a large number of patients with this disorder. These analyses confirm prior results of excess interferon and cytokine signals in DS patients and extend these observations to highlight early-onset immunological aberrancies, far before symptoms occur, as well as characterizing novel autoantibody reactivities in this patient population. Then, the authors report the interim analysis of an open-label, Phase II, clinical trial of the JAK1/3 inhibitor, tofacitinib, that aims to define the safety, clinical efficacy, and immunological outcomes of DS patients who suffer from inflammatory conditions of the skin. The clinical trial analysis indicates that the treatment is tolerated without serious adverse effects and that the majority of patients have experienced clinical improvement or remission in their corresponding clinical cutaneous manifestations as well as improvement or normalization of aberrant immunological signals such as cytokines.

      The major strength of the study is the recruitment and uniform, systematic evaluation of an impressive number of DS patients. Moreover, the promising early results from the tofacitinib clinical trial pave the way for analysis of a larger number of patients within the Phase II trial and otherwise, which may lead to improved clinical outcomes for affected patients. An inherent weakness of such studies is the descriptive nature of several parameters and the relatively small size of tofacitinib-treated DS patients. However, the descriptive nature of some of the correlative research analyses is of scientific interest and is useful to generate hypotheses for future additional (including mechanistic) work, and treatment of 10 DS patients in a formal clinical trial at interim analysis is not a trivial task for a disease like this. The manuscript achieves the aims of the authors and the results support their conclusions. The authors appropriately acknowledge areas that require more research and areas that are not well understood. The results are represented in a useful manner and statistical methods and analyses appear sound.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In this manuscript, the authors use the Drosophila model system to study the impact of mild head trauma on sex-dependent brain deficits. They identify Sex Peptide as a modulator of greater negative outcomes in female flies. Additionally, they observe that increased age at the time of injury results in worse outcomes, especially in females, and that this is due to chronic suppression of innate immune defense networks in mated females. The results demonstrate a novel signaling pathway that promotes age- and sex-dependent outcomes after head injury.

      Strengths:<br /> The authors have modified their previously reported TBI model in flies to mimic mild TBI, which is novel. Methods are explained in detail, allowing for reproducibility. Experiments are rigorous with appropriate statistics. A number if important controls are included. The work tells a complete mechanistic story and adds important data to increase our understanding of sex-dependent differences in recovery after TBI. The Discussion is comprehensive and puts the work in context of the field.

      Weaknesses: None<br /> The authors answered the following concerns, and I have no other concerns:<br /> A very minor weakness is that exact n values should be included in the figure legends. There should also be confirmation of knockdown by RNAi in female flies either by immunohistochemistry or qRT-PCR if possible.

    1. Reviewer #2 (Public Review):

      Wnt signaling is the name given to a cell-communication mechanism that cells employ to inform on each other's position and identity during development. In cells that receive the Wnt signal from the extracellular environment, intracellular changes are triggered that cause the stabilization and nuclear translocation of β-catenin, a protein that can turn on groups of genes referred to as Wnt targets. Typically these are genes involved in cell proliferation. Genetic mutations that affect Wnt signaling components can therefore affect tissue expansion. Loss of function of APC is a drastic example: APC is part of the β-catenin destruction complex, and in its absence, β-catenin protein is not degraded and constitutively turns on proliferation genes, causing cancers in the colon and rectum. And here lies the importance of the finding: β-catenin has for long been considered to be regulated almost exclusively by tuning its protein turnover. In this article, a new aspect is revealed: Ctnnb1, the gene encoding for β-catenin, possesses tissue-specific regulation with transcriptional enhancers in its vicinity that drive its upregulation in intestinal stem cells. The observation that there is more active β-catenin in colorectal tumors not only because the broken APC cannot degrade it, but also because transcription of the Ctnnb1 gene occurs at higher rates, is novel and potentially game-changing. As genomic regulatory regions can be targeted, one could now envision that mutational approaches aimed at dampening Ctnnb1 transcription could be a viable additional strategy to treat Wnt-driven tumors.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Zhang et al. examine neural activity in the motor cortex as monkeys make reaches in a novel target interception task. Zhang et al. begin by examining the single neuron tuning properties across different moving target conditions, finding several classes of neurons: those that shift their preferred direction, those that change their modulation gain, and those that shift their baseline firing rates. The authors go on to find an interesting, tilted ring structure of the neural population activity, depending on the target speed, and find that (1) the reach direction has consistent positioning around the ring, and (2) the tilt of the ring is highly predictive of the target movement speed. The authors then model the neural activity with a single neuron representational model and a recurrent neural network model, concluding that this population structure requires a mixture of the three types of single neurons described at the beginning of the manuscript.

      Strengths:

      I find the task the authors present here to be novel and exciting. It slots nicely into an overall trend to break away from a simple reach-to-static-target task to better characterize the breadth of how the motor cortex generates movements. I also appreciate the movement from single neuron characterization to population activity exploration, which generally serves to anchor the results and make them concrete. Further, the orbital ring structure of population activity is fascinating, and the modeling work at the end serves as a useful baseline control to see how it might arise.

      Weaknesses:

      While I find the behavioral task presented here to be excitingly novel, I find the presented analyses and results to be far less interesting than they could be. Key to this, I think, is that the authors are examining this task and related neural activity primarily with a single-neuron representational lens. This would be fine as an initial analysis since the population activity is of course composed of individual neurons, but the field seems to have largely moved towards a more abstract "computation through dynamics" framework that has, in the last several years, provided much more understanding of motor control than the representational framework has. As the manuscript stands now, I'm not entirely sure what interpretation to take away from the representational conclusions the authors made (i.e. the fact that the orbital population geometry arises from a mixture of different tuning types). As such, by the end of the manuscript, I'm not sure I understand any better how the motor cortex or its neural geometry might be contributing to the execution of this novel task.

      Main Comments:

      My main suggestions to the authors revolve around bringing in the computation through a dynamics framework to strengthen their population results. The authors cite the Vyas et al. review paper on the subject, so I believe they are aware of this framework. I have three suggestions for improving or adding to the population results:

      (1) Examination of delay period activity: one of the most interesting aspects of the task was the fact that the monkey had a random-length delay period before he could move to intercept the target. Presumably, the monkey had to prepare to intercept at any time between 400 and 800 ms, which means that there may be some interesting preparatory activity dynamics during this period. For example, after 400ms, does the preparatory activity rotate with the target such that once the go cue happens, the correct interception can be executed? There is some analysis of the delay period population activity in the supplement, but it doesn't quite get at the question of how the interception movement is prepared. This is perhaps the most interesting question that can be asked with this experiment, and it's one that I think may be quite novel for the field--it is a shame that it isn't discussed.

      (2) Supervised examination of population structure via potent and null spaces: simply examining the first three principal components revealed an orbital structure, with a seemingly conserved motor output space and a dimension orthogonal to it that relates to the visual input. However, the authors don't push this insight any further. One way to do that would be to find the "potent space" of motor cortical activity by regression to the arm movement and examine how the tilted rings look in that space (this is actually fairly easy to see in the reach direction components of the dPCA plot in the supplement--the rings will be highly aligned in this space). Presumably, then, the null space should contain information about the target movement. dPCA shows that there's not a single dimension that clearly delineates target speed, but the ring tilt is likely evident if the authors look at the highest variance neural dimension orthogonal to the potent space (the "null space")--this is akin to PC3 in the current figures, but it would be nice to see what comes out when you look in the data for it.

      (3) RNN perturbations: as it's currently written, the RNN modeling has promise, but the perturbations performed don't provide me with much insight. I think this is because the authors are trying to use the RNN to interpret the single neuron tuning, but it's unclear to me what was learned from perturbing the connectivity between what seems to me almost arbitrary groups of neurons (especially considering that 43% of nodes were unclassifiable). It seems to me that a better perturbation might be to move the neural state before the movement onset to see how it changes the output. For example, the authors could move the neural state from one tilted ring to another to see if the virtual hand then reaches a completely different (yet predictable) target. Moreover, if the authors can more clearly characterize the preparatory movement, perhaps perturbations in the delay period would provide even more insight into how the interception might be prepared.

    1. Reviewer #2 (Public Review):

      Summary:<br /> After manually labelling 144 human adult hemispheres in the lateral parieto-occipital junction (LPOJ), the authors 1) propose a nomenclature for 4 previously unnamed highly variable sulci located between the temporal and parietal or occipital lobes, 2) focus on one of these newly named sulci, namely the ventral supralateral occipital sulcus (slocs-v) and compare it to neighbouring sulci to demonstrate its specificity (in terms of depth, surface area, gray matter thickness, myelination, and connectivity), 3) relate the morphology of a subgroup of sulci from the region including the slocs-v to the performance in a spatial orientation task, demonstrating behavioural and morphological specificity. In addition to these results, the authors propose an extended reflection on the relationship between these newly named landmarks and previous anatomical studies, a reflection about the slocs-v related to functional and cytoarchitectonic parcellations as well as anatomic connectivity and an insight about potential anatomical mechanisms relating sulcation and behaviour.

      Strengths:<br /> - To my knowledge, this is the first study addressing the variable tertiary sulci located between the superior temporal sulcus (STS) and intra-parietal sulcus (IPS).<br /> - This is a very comprehensive study addressing altogether anatomical, architectural, functional and cognitive aspects.<br /> - The definition of highly variable yet highly reproductible sulci such as the slocs-v feeds the community with new anatomo-functional landmarks (which is emphasized by the provision of a probability map in supp. mat., which in my opinion should be proposed in the main body).<br /> - The comparison of different features between the slocs-v and similar sulci is useful to demonstrate their difference.<br /> - The detailed comparison of the present study with state of the art contextualises and strengthens the novel findings.<br /> - The functional study complements the anatomical description and points towards cognitive specificity related to a subset of sulci from the LPOJ<br /> - The discussion offers a proposition of theoretical interpretation of the findings<br /> - The data and code are mostly available online (raw data made available upon request).

      Weaknesses:<br /> - While the identification of the sulci has been done thoroughly with expert validation, the sulci have not been labelled in a way that enables the demonstration of the reproducibility of the labelling.

      The proposed methodology is convincing in identifying and studying the relationship between highly variable sulci and cognition. This improves our refined understanding of the general anatomical variability in the LPOJ and its potential functional/cognitive correlates. This work is important to the understanding of sulcal variability and its implications on functional and cognitive aspects.

      Comments on revised version:

      Thank you for the elegant and informative work.

    1. Reviewer #2 (Public Review):

      Summary:

      This study shows that when excitatory DREADD receptors are expressed in the ventral area of the cervical spinal cord containing phrenic motoneurons, the systemic administration of the DREADD ligand J60 increases diaphragm EMG activity without altering respiratory rate. The authors took a non-selective expression approach in wild-type mice, as well as a more selective Cre-dependent approach in Chat-Cre mice and Chat-Cre rats to stimulate cervical motoneurons in the spinal cord. This is a proof of principle study that supports the use of DREADD technology to stimulate the motor output to the diaphragm.

      Strengths:

      The strengths of the study lie in the use of both mice and rats and testing activation of diaphragmatic activity with multiple experimental approaches to show that diaphragm EMG and tidal volume are increased.

      Weaknesses:

      Weaknesses of the study consist in the lack of some important control experiments to consolidate the findings: a test of DREADD ligand effects in the absence of viral construct; repeated respiratory challenges within the same recording session in whole body plethysmographs that could compromise the behaving experiments; and lastly, a limited qualitative analysis of the histological data that does not allow for confirmation of expression in phrenic motoneurons.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to determine the role of Rtf1 in Cryptococcal biology, and demonstrate that Rtf1 acts independently of the Paf1 complex to exert regulation of Histone H2B monoubiquitylation (H2Bub1). The biological impact of the loss of H2Bub1 was observed in defects in morphogenesis, reduced production of virulence factors, and reduced pathogenic potential in animal models of cryptococcal infection.

      Strengths:

      The molecular data is quite compelling, demonstrating that the Rtf1-depednent functions require only this histone modifying domain of Rtf1, and are dependent on nuclear localization. A specific point mutation in a residue conserved with the Rtf1 protein in the model yeast demonstrates the conservation of that residue in H2Bub1 modification. Interestingly, whereas expression of the HMD alone suppressed the virulence defect of the rtf1 deletion mutant, it did not suppress defects in virulence factor production.

      Weaknesses:

      The authors use two different species of Cryptococcus to investigate the biological effect of Rtf1 deletion. The work on morphogenesis utilized C. deneoformans, which is well-known to be a robust mating strain. The virulence work was performed in the C. neoformans H99 background, which is a highly pathogenic isolate. The study would be more complete if each of these processes were assessed in the other strain to understand if these biological effects are conserved across the two species of Cryptococcus. H99 is not as robust in morphogenesis, but reproducible results assessing mating and filamentation in this strain have been performed. Similarly, C. deneoformans does produce capsule and melanin.

      There are some concerns with the conclusions related to capsule induction. The images reported in Figure B are purported to be grown under capsule-inducing conditions, yet the H99 panel is not representative of the induced capsule for this strain. Given the lack of a baseline of induction, it is difficult to determine if any of the strains may be defective in capsule induction. Quantification of a population of cells with replicates will also help to visualize the capsular diversity in each strain population.

      The authors demonstrate that for specific mating-related genes, the expression of the HMD recapitulated the wild-type expression pattern. The RNA-seq experiments were performed under mating conditions, suggesting specificity under this condition. The authors raise the point in the discussion that there may be differences in Rtf1 deposition on chromatin in H99, and under conditions of pathogenesis. The data that overexpression of HMD restores H2Bub1 by western is quite compelling, but does not address at which promoters H2Bub1 is modulating expression under pathogenesis conditions, and when full-length Rtf1 is present vs. only the HMD.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript expands the current bulk sequencing data deconvolution toolkit to include ATAC-seq. The EPIC-ATAC tool successfully predicts accurate proportions of immune cells in bulk tumour samples and EPIC-ATAC seems to perform well in benchmarking analyses. The authors achieve their aim of developing a new bulk ATAC-seq deconvolution tool.

      Strengths:

      The manuscript describes simple and understandable experiments to demonstrate the accuracy of EPIC-ATAC. They have also been incredibly thorough with their reference dataset collections and have been robust in their benchmarking endeavours and measured EPIC-ATAC against multiple datasets and tools. This tool will be valuable to the community it serves.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors identified a previously unrecognized organ interaction where limb immobilization induces thermogenesis in BAT. They showed that limb immobilization by cast fixation enhances the expression of UCP1 as well as amino acid transporters in BAT, and amino acids are supplied from skeletal muscle to BAT during this process, likely contributing to increased thermogenesis in BAT. Furthermore, the experiments with IL-6 knockout mice and IL-6 administration to these mice suggest that this cytokine is likely involved in the supply of amino acids from skeletal muscle to BAT during limb immobilization.

      Strengths:

      The function of BAT plays a crucial role in the regulation of an individual's energy and body weight. Therefore, identifying new interventions that can control BAT function is not only scientifically significant but also holds substantial promise for medical applications. The authors have thoroughly and comprehensively examined the changes in skeletal muscle and BAT under these conditions, convincingly demonstrating the significance of this organ interaction.

      Weaknesses:

      Through considerable effort, the authors have demonstrated that limb-immobilized mice exhibit changes in thermogenesis and energy metabolism dynamics at their steady state. However, The impact of immobilization on the function of skeletal muscle and BAT during cold exposure has not been thoroughly analyzed.

    1. Reviewer #2 (Public Review):

      Intrinsic properties of a neuron refer to the ion channels that a neuron expresses. These ion channels determine how a neuron responds to its inputs. How intrinsic properties link to behavior remains poorly understood. Medina and Margoliash address this question using the zebra finch, a well-studied songbird. Previous studies from their lab and other labs have shown that the intrinsic properties of adult songbird basal-ganglia projecting premotor neurons, are more similar within a bird than across birds. Across birds, this similarity is related to the extent of similarity in the songs; the more similar the song between two birds, the more similar the intrinsic properties between the neurons of these two birds. Finally, the intrinsic properties of these neurons change over the course of development and are sensitive to intact auditory feedback. However, the song features that relate to these intrinsic properties and the function of the within-bird homogeneity of intrinsic properties are unclear.

      In this manuscript, the authors address these two questions by examining the intrinsic properties of basal-ganglia projecting premotor neurons in zebra finch brain slices. Specifically, they focus on the Ih current (as this is related to rhythmic activity in many pattern-generating circuits) and correlate the properties of the Ih current with song features. They find that the sag ratio (a measure of the driving force of the Ih current) and the rebound area (a measure of the post-inhibitory depolarisation) are both correlated with the temporal features of the song. First, they show the presence of correlations between the length of the song motif and the length of the longest syllable (most often a harmonic stack syllable). Based on this, they conclude that longer song motifs are composed of longer syllables. Second, they show that HVCX neurons within a bird have more similar sag ratios and rebound areas than across birds. Third, the mean sag ratio and mean rebound areas across birds were correlated with the duration of the longest harmonic stack within the song. These two results suggest that IPs are correlated with the temporal structure of the song. To further test this, the authors used natural and experimental tutoring procedures to have birds that learned two different types of songs that only differed in length; the longer song had an extra harmonic stack at the end. Using these two sets of birds, the authors find larger sag ratios and higher firing frequencies in birds with longer songs. Fifth, they show that the post-inhibitory rebound area allows neurons to respond to excitatory inputs and produce spikes. Neurons with a larger rebound area have a larger time window for responding to excitatory inputs. Based on this, they speculate that HVCX neurons with larger rebound areas integrate over larger time windows. Finally, they make a network model of HVC and show that one specific model could explain sequence-specific bursting of HVCX neurons.

      Strengths

      The question being addressed is an interesting question and the authors use appropriate techniques. The authors find a new temporal structure within the song, specifically, they find that longer songs typically have more syllables and longer syllables. As far as I know, this has not been shown earlier. The authors build on existing literature to suggest that IPs of HVCX neurons are correlated with the temporal structure of songs.

      Weaknesses

      I have a number of concerns with the statistics and interpretation of the results, insufficient controls for one experiment, and the specifics of the model that affect the implications of these results. These concerns are listed in the recommendations for the authors.

    1. Reviewer #2 (Public Review):

      Summary:

      Hebin et al reported a fascinating story about antibiotic persistence in the biofilms. First, they set up a model to identify the increased persisters in the biofilm status. They found that the adhesion of bacteria to the surface leads to increased c-di-GMP levels, which might lead to the formation of persisters. To figure out the molecular mechanism, they screened the E.coli Keio Knockout Collection and identified the HipH. Finally, the authors used a lot of data to prove that c-di-GMP not only controls HipH over-expression but also inhibits HipH activity, though the inhibition might be weak.

      Strengths:

      They used a lot of state-of-the-art technologies, such as single-cell technologies as well as classical genetic and biochemistry approaches to prove the concept, which makes the conclusions very solid. Overall, it is a very interesting and solid story that might attract diverse readers working with c-di-GMP, persisters, and biofilm.

      Weaknesses:

      (1) Is HipH the only target identified by screening the E.coli Keio Knockout Collection?

      (2) Since the story is complicated, a diagrammatic picture might be needed to illustrate the whole story. And the title does not accurately summarize the novelty of this study.

      (3) The ratio of mVenus NB to mScarlet-I (R) negatively correlates with the concentration of c-di-GMP. Therefore, R -1 demonstrates a positive correlation with the concentration of c-di-GMP. Is this method validated with other methods to quantify c-di-GMP, or used in other studies?

      (4) References are missing throughout the manuscript. Please add enough references for every conclusion.

      (5) The novelty of this study should be clearly written and compared with previous references. For example, is it the first study to report the mechanism that the adhesion of bacteria to the surface leads to increased persister formation?

      (6) in vitro DNA cleavage assay. Why not use bacterial genomic DNA to test the cleaving of HipH on the bacterial genome?

      (7) C-di-gmp -HipH is not a TA, it does not fit in the definition of the TA systems. You can say C-di-gmp is an antitoxin based on your study, but C-di-gmp -HipH is not a TA pair.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Munday et al. presents real-time predictions of geographic spread during an Ebola epidemic in north-eastern DRC. Predictions were elicited from individual experts engaged in outbreak response and from two mathematical models. The authors found comparable performance between experts and models overall, although the models outperformed experts in a few dimensions.

      Strengths:

      Both individual experts and mathematical models are commonly used to support outbreak response but rarely used together. The manuscript presents an in-depth analysis of the accuracy and decision-relevance of the information provided by each source individually and in combination.

      Weaknesses:

      A few minor methodological details are currently missing.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors begin with the stated goal of gaining insight into the known repression of autophagy by Ezrin, a major membrane-actin linker that assembles signaling complexes on membranes. RNA and protein expression analysis is consistent with upregulation of lysosomal proteins in Ezrin-deficient MEFs, which the authors confirm by immunostaining and western blotting for lysosomal markers. Expression analysis also implicates EGF signaling as being altered downstream of Ezrin loss, and the authors demonstrate that Ezrin promotes relocalization of EGFR from the plasma membrane to endosomes. Ezrin loss impacts downstream MAPK/Akt/mTORC1 signaling, although the mechanistic links remain unclear. An Ezrin mutant Medaka fish line wa then generated to test Ezrin's role in retinal cells, which are known to be sensitive to changes in autophagy regulation. Phenotypes in this model appear generally consistent with observations made in cultured cells, though mild overall.

      Strengths:<br /> Data on the impact of Ezrin-loss on relocalization of EGFR from the plasma membrane are extensive, and thoroughly demonstrate that Ezrin is required for EGFR internalization in response to EGF.

      A new Ezrin-deficient in vivo model (Medaka fish) is generated.

      Strong data demonstrates that Ezrin loss suppresses Akt signaling. Ezrin loss also clearly suppresses mTORC1 signaling in cell culture, although examination of mTORC1 activity is notably missing in Ezrin-deficient fish.

      Weaknesses:<br /> LC3 is used as a readout of autophagy, however the lipidated/unlipidated LC3 ratio generally does not appear to change, thus there does not appear to be evidence that Ezrin loss is affecting autophagy in this study.

      The conclusion is drawn that Ezrin loss suppresses EGF signaling, however this is complicated by a strong increase in phosphorylation of the p38 MAPK substrate MK2. Without additional characterization of MAPK and Erk signaling, the effect of Ezrin loss remains unclear.

      Causative conclusions between effects on MAPK, Akt, and mTORC1 signaling are frequently drawn, but the data only demonstrate correlations. For example, many signaling pathways can activate mTORC1 including MAPK/Erk, thus reduced mTORC1 activity upon Ezrin-loss cannot currently be attributed to reduced Akt signaling. Similarly, other kinases can phosphorylate TSC2 at the sites examined here, so the conclusion cannot be drawn that Ezrin-loss causes a reduction in Akt-mediated TSC2 phosphorylation. In Figure 7, the conclusion cannot be drawn that retinal degeneration results from aberrant EGFR signaling.

      It is unclear why TSC1 is highlighted in the title, as there does not appear to be any specific regulation of TSC1 here.

      In Figure 1 the conclusion is drawn that there is an increase in lysosome number with Ezrin KO, however it does not appear that the current analysis can distinguish an increased number from increased lysosome size or activity. Similarly, conclusions about increased lysosome "biogenesis" could instead reflect decreased turnover.

      Immunoprecipitation data for a role for Ezrin as a signaling scaffold appear minimal and seem to lack important controls.

      In Figure 3A it seems difficult to conclude that EGFR dimerization is reduced since the whole blot, including the background between lanes, is lighter on that side.

      In Figure 6C specificity controls for the TSC1 and TSC2 antibodies are not included, but seem necessary since their localization patterns appear very different from each other in WT cells.

      In Figure 7 the signaling effects in Ezrin-deficient fish are mild compared to cultured cells, and effects on mTORC1 are not examined. Further data on the retinal cell phenotypes would strengthen the conclusions.

      In Figure 7F there appears to be more EGFR throughout the cell, so it is difficult to conclude that more EGFR at the PM in Ezrin-/- fish means reduced internalization.

    1. Reviewer #2 (Public Review):

      Summary:

      This study investigates in mice neural mechanisms generating sighs, which are periodic large-amplitude breaths occurring during normal breathing that subserve physiological pulmonary functions and are associated with emotional states such as relief, stress, and anxiety. Sighs are generated by a structure called the preBötzinger complex (preBötC) in the medulla oblongata that generates various forms of inspiratory activity including sighs. The authors have previously described a circuit involving neurons producing bombesin-related peptides Neuromedin B (NMB) and gastrin-releasing peptide (GRP) that project to preBötC neurons expressing receptors for NMB (NMBRs) and GRP (GRPRs) and that activation of these preBötC neurons via these peptide receptors generates sighs. In this study, the authors further investigated mechanisms of sigh generation by applying optogenetic and chemogenetic strategies to selectively activate the subpopulations of preBötC neurons expressing NMBRs and/or GRPRs, and a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs. The authors present convincing evidence that sigh-like inspirations can be evoked by photostimulation of the preBötC neurons expressing NMBRs or GRPRs. Photostimulation of SST neurons can independently evoke sighs, and chemogenetic inhibition of these neurons can abolish sighs. The results presented support the authors' conclusion that the preBötC neurons expressing NMBRs or GRPRs produce sighs via pathways to downstream SST neurons. Thus, these studies have identified some of the preBötC cellular elements likely involved in generating sighs.

      Strengths:

      (1) This study employs an effective combination of electrophysiological, transgenic, optogenetic, chemogenetic, pharmacological, and neuron activity imaging techniques to investigate sigh generation by distinct subpopulations of preBötC neurons in mice.

      (2) The authors extend previous studies indicating that there is a peptidergic circuit consisting of NMB and GRP expressing neurons that project from the parafacial (pF) nucleus region to the preBötC and provides sufficient input to generate sighs, since photoactivation of either pF NMB or GRP neurons evoke ectopic sighs in this study.

      (3) Convincing evidence is presented that sighs can be evoked by direct photostimulation of preBötC neurons expressing NMBRs and/or GRPRs, and also a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs.

      (4) The mRNA-expression data presented from in situ hybridization indicates that most preBötC neurons expressing NMBR, GRPR (or both) are glutamatergic and excitatory.

      (5) Measurements in slices in vitro indicate that only the NMBR-expressing neurons are normally rhythmically active during normal inspiratory activity and endogenous sigh activity.

      (6) Evidence is presented that activation of preBötC NMBRs and/or GRPRs is not necessary for sigh production, suggesting that sighs are not the unique product of the preBötC bombesin-peptide signaling pathway.

      (7) The novel conclusion is presented that the preBötC neurons expressing NMBRs and/or GRPRs produce sighs via the separate downstream population of preBötC SST neurons, which the authors demonstrate can independently generate sighs, whereas chemogenetic inhibition of preBötC SST neurons selectively abolishes sighs generated by activating NMBRs and GRPRs.

      Weaknesses:

      (1) While these studies have identified subpopulations of preBötC neurons capable of episodically evoking sigh-like inspiratory activity, mechanisms producing the normal slow sigh rhythm were not investigated and remain unknown.

      (2) Several key technical aspects of the study require further clarification to aid in interpreting the experimental results, including issues relating to the validation of the transgenic mouse lines and virally transduced expressions of proteins utilized for optogenetic and chemogenetic experiments, as well as justifying the optogenetic photostimulation paradigms used to evoke sighs.

    1. Reviewer #2 (Public Review):

      Summary:

      Exploring the DEP-MAP database and two drug-screen databases, the authors identify WSB2 as an interactor of several BCL2 proteins. In follow-up experiments, they show that CRL5/WSB2 controls NOXA protein levels via K48 ubiquitination following direct protein-protein interaction, and cell death sensitivity in the context of BH3 mimetic treatment, where WSB2 depletion synergizes with drug treatment.

      Strengths:

      The authors use a set of orthogonal methods across different model cell lines and a new WSB2 KO mouse model to confirm their findings. They also manage to correlate WSB2 expression with poor prognosis in prostate and liver cancer, supporting the idea that targeting WSB2 may sensitize cancers for treatment with BH3 mimetics.

      Weaknesses:

      The conclusions drawn based on the findings in cancer patients are very speculative, as regulation of NOXA cannot be the sole function of CRL5/WSB2 and it is hence unclear what causes correlation with patient survival. Moreover, the authors do not provide a clear mechanistic explanation of how exactly higher levels of NOXA promote apoptosis in the absence of WSB2. This would be important knowledge, as usually high NOXA levels correlate with high MCL1, as they are turned over together, but in situations like this, or loss of other E3 ligases, such as MARCH, the buffering capacity of MCL1 is outrun, allowing excess NOXA to kill (likely by neutralizing other BCL2 proteins it usually does not bind to, such as BCLX). Moreover, a necroptosis-inducing role of NOXA has been postulated. Neither of these options is interrogated here.

    1. Reviewer #2 (Public Review):

      The manuscript by Chen et al. describes how low levels of CPT1A in colorectal cancer (CRC) confer radioresistance by expediting radiation-induced ROS clearance. The authors propose that this mechanism of ROS homeostasis is regulated through FOXM1. CPT1A is known for its role in fatty acid metabolism via beta-oxidation of long-chain fatty acids, making it important in many metabolic disorders and cancers.

      Previous studies have suggested that the upregulation of CPT1A is essential for the tumor-promoting effect in colorectal cancers (CRC) (PMID: 32913185). For example, CPT1A-mediated fatty acid oxidation promotes colorectal cancer cell metastasis (PMID: 2999587), and repression of CPT1A activity renders cancer cells more susceptible to killing by cytotoxic T lymphocytes (PMID: 37722058). Additionally, inhibition of CPT1A-mediated fatty-acid oxidation (FAO) sensitizes nasopharyngeal carcinomas to radiation therapy (PMID: 29721083). While this suggests a tumor-promoting effect for CPT1A, the work by Chen et al. suggests instead a tumor-suppressive function for CPT1A in CRC, specifically that loss or low expression of CPT1A confers radioresistance in CRC. This makes the findings important given that they oppose the previously proposed tumorigenic function of CPT1A. However, the data presented in the manuscript is limited in scope and analysis.

      Major Limitations:

      (1) Analysis of Patient Samples

      - Figure 1D shows that CPT1A levels are significantly lower in COAD and READ compared to normal tissues. It would be beneficial to show whether CPT1A levels are also significantly lower in CRC compared to other tumor types using TCGA data.<br /> - The analysis should include a comparison of closely related CPT1 isoforms (CPT1B and CPT1C) to emphasize the specific importance of CPT1A silencing in CRC.<br /> - Figure 2 lacks a clear description of how IHC scores were determined and the criteria used to categorize patients into CPT1A-high and CPT1A-low groups. This should be detailed in the text and figure legend.<br /> - None of Figure 2B or 2C show how many patients were assigned to the CPT1A-low and CPT1A-high groups.

      (2) Model Selection and Experimental Approaches

      - The authors primarily use CPT1A knockout (KO) HCT116 cells and CPT1A overexpression (OE) SW480 cells for their experiments, which poses major limitations.<br /> - The genetic backgrounds of the cell lines (e.g., HCT116 being microsatellite instable (MSI) and SW480 not) should be considered as they might influence treatment outcomes. This should be acknowledged as a major limitation.<br /> - Regardless of their CPT1A expression levels, for the experiments with HCT116 and SW480 cells in Figure 3C-F, it would be useful to see whether HCT116 cells can be further sensitized to radiotherapy in overexpression and whether SW480 cells can be desensitized through CPT1A KO.<br /> - The use of only two CRC cell lines is insufficient to draw broad conclusions. Additional CRC cell lines should be used to validate the findings and account for genetic heterogeneity. The authors should repeat key experiments with additional CRC cell lines to strengthen their conclusions.

      (3) Pharmacological Inhibition

      Several studies have reported beneficial outcomes of using CPT1 pharmacological inhibition to limit cancer progression (e.g., PMID: 33528867, PMID: 32198139), including its application in sensitization to radiation therapy (PMID: 30175155). Since the authors argue for the opposite case in CRC, they should show this through pharmacological means such as etomoxir and whether CPT1A inhibition phenocopies their observed genetic KO effect, which would have important implications for using this inhibitor in CRC patients.

      (4) Data Representation and Statistical Analysis

      - The relative mRNA expression levels across the seven cell lines (Supplementary Figure 1C) differ greatly from those reported in the DepMap (https://depmap.org/portal/). This discrepancy should be addressed.<br /> - The statistical significance of differences in mRNA and protein levels between RT-sensitive and RT-resistant cells should be shown (Supplementary Figure 1C, D).

      Conclusion

      The study offers significant insights into the role of CPT1A in CRC radioresistance, proposing a tumor-suppressive function. However, the scope and depth of the analysis need to be expanded to fully validate these claims. Additional CRC cell lines, pharmacological inhibition studies, and a more detailed analysis of patient samples are essential to strengthen the conclusions.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript by Wei et al studies the role of ZFP36L1, an RNA-binding protein, in promoting PD-L1 expression in gastric cancer (GC). They used human gastric cancer tissues from six patients and performed H3K27ac CUT&Tag to unbiasedly identify SE specific for the infiltrative type. They identified an SE driving the expression of ZFP36L1 and immune evasion through upregulation of PD-L1. Mechanistically, they show that SPI1 binds to ZFP36L1-SE and ZFP36L1 in turn regulates PD-L1 expression through modulation of the 3'UTR of HDAC3. This mechanism of PD-L1 regulation in gastric cancer is novel, and ZFP36L1 has not been previously implicated in GC progression. However, the data presented are largely correlations and no direct proof is presented that the identified SE regulates ZFP36L1 expression. Furthermore, the effect of ZFP36L1 manipulation elicited a modest effect on PDL1 expression. In fact, several cell lines (XGC1, MNK45) express abundant ZFP36L1 but no PD-L1, suggesting the ZFP36L1 per se is not a key stimulant of PD-L1 expression as IFNg is. Thus, the central conclusions are not supported by the data.

      Strengths:

      Use of human GC specimens to identify SE regulating PD-L1 expression and immune evasion.

      Weaknesses:

      Major comments:

      (1) The difference in H3K27ac over the ZFP36L1 locus and SE between the expanding and infiltrative GC is marginal (Figure 2G). Although the authors establish that ZFP36L1 is upregulated in GC, particularly in the infiltrative subtype, no direct proof is provided that the identified SE is the source of this observation. CRISPR-Cas9 should be employed to delete the identified SE to prove that it is causatively linked to the expression of ZFP36L1.

      (2) In Figure 3C the impact of shZFP36L1 on PD-L1 expression is marginal and it is observed in the context of IFNg stimulation. Moreover, in XGC-1 cell line the shZFP36L1 failed to knock down protein expression thus the small decrease in PD-L1 level is likely independent of ZFP36L1. The same is the case in Figure 3D where forced expression of ZFP36L1 does not upregulate the expression of PDL1 and even in the context of IFNg stimulation the effect is marginal.

      (3) In Figure 4, it is unclear why ELF1 and E2F1 that bind ZFP36L1-SE do not upregulate its expression and only SPI1 does. In Figure 4D the impact of SPI overexpression on ZFP36L1 in MKN45 cells is marginal. Likewise, the forced expression of SPI did not upregulate PD-L1 which contradicts the model. Only in the context of IFNg PD-L1 is expressed suggesting that whatever role, if any, ZFP36L1-SPI1 axis plays is secondary.

      (4) The data presented in Figure 6 are not convincing. First, there is no difference in the tumor growth (Figure 6E). IHC in Figure 6I for CD8a is misleading. Can the authors provide insets to point CD8a cells? This figure also needs quantification and review from a pathologist.

    1. Reviewer #2 (Public Review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects. While the authors address an important question, more rigor is required to understand the full behavior of the model.

      Major Points

      (1) The authors compare DIPx to the winning method of the DREAm challenge, TAJI to show that from molecular features alone they retrain TAJI to create TAJI-M without the monotherapy data inputs. They mention that "of course, we could also use such data in DIPx...", but they never show the behaviour of DIPx with these data. The authors need to demonstrate that this statement holds true or else compare it to the full TAJI.

      (2) It would be neat to see how the DIPx feature importance changes with monotherapy input. For most realistic scenarios in which these models are used robust monotherapy data do exist.

      (3) In Figure 2, the authors compare DIPx and TAJI-M on various test sets. If I understood correctly, they also bootstrapped the training set with n=100 and reported all the model variants in many of the comparisons. While this is a nice way of showing model robustness, calculating p-values with bootstrapped data does not make sense in my opinion as by increasing the value of n, one can make the p-value arbitrarily small. The p-value should only be reported for the original models.

      (4) From Figures 2 and 3, it appears DIPx is overfit on the training set with large gaps in Spearman correlations between Test Set 2/ONeil set and Test Set 1. It also features much better in cases where it has seen both compounds. Could the authors also compare TAJI on the ONeil dataset to show if it is as much overfit?

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Guayasamin et al. show that early-life stress (ELS) can induce a shift in fear generalisation in mice. They took advantage of a fear conditioning paradigm followed by a discrimination test and complemented learning and memory findings with measurements for anxiety-like behaviors. Next, astrocytic dysfunction in the lateral amygdala was investigated at the cellular level by combining staining for c-Fos with astrocyte-related proteins. Changes in excitatory neurotransmission were observed in acute brains slices after ELS suggesting impaired communication between neurons and astrocytes. To confirm the causality of astrocytic-neuronal dysfunction in behavioral changes, viral manipulations were performed in unstressed mice. Occlusion of functional coupling with a dominant negative construct for gap junction connexin 43 or reduction in astrocytic calcium with CalEx mimicked the behavioral changes observed after ELS suggesting that dysfunction of the astrocytic network underlies ELS-induced memory impairments.

      Strengths:

      Overall, this well-written manuscript highlights a key role for astrocytes in regulating stress-induced behavioral and synaptic deficits in the lateral amygdala in the context of ELS. Results are innovative, and methodological approaches relevant to decipher the role of astrocytes in behaviors. As mentioned by the authors, non-neuronal cells are receiving increasing attention in the neuroscience, stress, and psychiatry fields.

      Weaknesses:

      I do have several suggestions and comments to address that I believe will improve the clarity and impact of the work. For example, there is currently a lack of information on the timeline for behavioral experiments, tissue collection, etc.

    1. The South Florida influencers, for instance, heard a rumor circulating that the government had put microchips in the coronavirus vaccine so it could track people.

      Notice that many fake news stories begin from a place of fear. This fear hijacks our brains and triggers fight or flight options in our system I circuitry and actively prevent the use of the rational parts of system II which would quickly reveal problems in the information.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors use a combination of transgenic animals, intersectional viruses, retrograde tracing, and ex-vivo slice electrophysiology to show that VTA projection neurons synapse locally. First, the authors injected a cre-dependent channelrhodopsin into the VTA of PV, SST, MOR, and NTS-Cre mice. Importantly, PV, SST, MOR, and NTS are molecular markers previously used to describe VTA interneurons. Imaging of known VTA target regions identified that these neurons are not localized to the VTA and instead project to the PFC, NAc, VP, and LHb. Next, the authors used an intersectional viral strategy to label projection neurons with both GFP (membrane localized) and Syn:Ruby (release sites). These experiments identified that VTA projection neurons also make intra-VTA synapses. Finally, the authors use a combination of optogenetics and ex-vivo slice electrophysiology to show that neurons projecting from the VTA to the NAc/VP/PFC also synapse locally. Overall, most of the conclusions seem to be well supported by the data.

      Strengths:

      Previous literature has described Pvalb, Sst, Oprm1, and Nts as selective markers of VTA interneurons. Here, the authors make use of cre driver lines to show that neurons defined by these genes are not interneurons and project to known VTA target regions. Additionally, the authors convincingly use intersectional viral approaches and slice electrophysiology to show that projection neurons synapse onto neighboring cells within the VTA

      Weaknesses:

      While the authors use several cre driver lines to identify GABAergic projection neurons, they then use wild-type mice to show that projection neurons synapse onto neighboring cells within the VTA. This does not seem to lend evidence to the idea that previously described "interneurons" are projection neurons that collateralize within the VTA.

    1. Reviewer #2 (Public Review):

      Summary:

      Franke et al. characterize the representation of color in the primary visual cortex of mice, highlighting how this changes across the visual field. Using calcium imaging in awake, head-fixed mice, they characterize the properties of V1 neurons (layer 2/3) using a large center-surround stimulation where green and ultra-violet colors were presented in random combinations. Clustering of responses revealed a set of functional cell-types based on their preference to different combinations of green and UV in their center and surround. These functional types were demonstrated to have different spatial distributions across V1, including one neuronal type (Green-ON/UV-OFF) that was much more prominent in the posterior V1 (i.e. upper visual field). Modelling work suggests that these neurons likely support the detection of predator-like objects in the sky.

      Strengths:

      The large-scale single-cell resolution imaging used in this work allows the authors to map the responses of individual neurons across large regions of the visual cortex. Combining this large dataset with clustering analysis enabled the authors to group V1 neurons into distinct functional cell types and demonstrate their relative distribution in the upper and lower visual fields. Modelling work demonstrated the different capacity of each functional type to detect objects in the sky, providing insight into the ethological relevance of color opponent neurons in V1.

      Weaknesses:

      It is unfortunate the authors were unable to provide stronger mechanistic insights into how color opponent neurons in V1 are formed.

      Overall, this study will be a valuable resource for researchers studying color vision, cortical processing, and the processing of ethologically relevant information. It provides a useful basis for future work on the origin of color opponency in V1 and its ethological relevance.

    1. Reviewer #3 (Public Review):

      Summary:<br /> Animals can evaluate food quality in many ways. In contrast to the rapid sensory evaluation with smell and taste, the mechanism of slow nutrient sensation and its impact on food choice is unexplored. The authors utilize C. elegans larvae and their bacterial food as an elegant model to tackle this question and reveal the detailed molecular mechanism to avoid nutrient-poor foods.

      Strength:<br /> The strength of this study is that they identified the molecular identities of the critical players in bacterial food and C. elegans using unbiased approaches, namely metabolome analysis, E. coli mutant screening, and RNA sequencing. Furthermore, they strengthened their findings by thorough experiments combining multiple methods such as genetics, fluorescent reporter analysis, and Western blot.

      Weakness:<br /> The major caveat of this study is the reporter genes; specifically, transcriptional reporters used to monitor the UPRER and immune responses in the intestine of C. elegans. However, their tissue-specific rescue experiments suggest that the genes in the UPRER and immune response function in the neurons. Thus, we should carefully interpret the results of the reporter genes. Another point to be aware of is that although they show that lack of carbohydrates elicits the response to "low-quality" food, carbohydrate supplementation with heat-killed E. coli was insufficient to support animal growth.

      Overall, this work provides convincing data to support their model. In the C. elegans field, the behaviors of larvae are not well studied compared to adults. This work will pose an interesting question about the difference between larvae and adults in nutrition sensing in C. elegans and provide a framework and candidate molecules to be studied in other organisms.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

      (1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      (6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      (7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

    1. Reviewer #2 (Public Review):

      Li and colleagues investigate the enzymatic activity-independent function of IDH1 in regulating erythropoiesis. This manuscript reveals that IDH1 deficiency in the nucleus leads to the redistribution of histone marks (especially H3K79me3) and chromatin state reprogramming. Their findings suggest a non-typical localization and function of the metabolic enzyme, providing new insights for further studies into the non-metabolic roles of metabolic enzymes. However, there are still some issues that need addressing:

      (1) Could the authors show the RNA and protein expression levels (without fractionation) of IDH1 on different days throughout the human CD34+ erythroid differentiation?

      (2) Even though the human CD34+ erythroid differentiation protocol was published and cited in the manuscript, it would be helpful to specify which erythroid stages correspond to cells on days 7, 9, 11, 13, and 15.

      (3) It is important to mention on which day the lentiviral knockdown of IDH1 was performed. Will the phenotype differ if the knockdown is performed in early vs. late erythropoiesis? In Figures 1C and 1D, on which day do the authors begin the knockdown of IDH1 and administer NAC and GSH treatments?

      (4) The authors validate that IDH1 regulates erythropoiesis in an enzymatic activity-independent manner by adding ROS scavengers or α-KG. Given the complexity of metabolic pathways, these two strategies may not suffice. Mutating the enzymatic active site could provide a clearer explanation for this point.

      (5) While the cell phenotype of IDH1 deficiency is quite dramatic, yielding cells with larger nuclei and multi-nuclei, the authors only attribute this phenotype to defects in chromatin condensation. Is it possible that IDH1-knockdown cells also exhibit primary defects in mitosis/cytokinesis (not just secondary to the nuclear condensation defect)?), given the function of H3K79Me in cell cycle regulation?

      (6) Why are there two bands of Histone H3 in Figure 4A?

      (7) Are the density and localization of histone modifications (not just H3K79me3) in Sg-NEG-IDH1 HuDEP2 cells similar to those in IDH1-shRNA erythroid cells compared to control cells?

      (8) Displaying a heatmap and profile plots in Figure 5A between control and IDH1-deficient cells will help illustrate changes in H3K79me3 density in the nucleus after IDH1 knockdown.

      (9) Are the distribution and intensity of H3K79me3 in primary healthy erythroid cells in the bone marrow similar to or distinct from those in AML and MDS cells? The authors could present at least one sample of healthy donor cells for comparison.

      (10) In Figure 7E, why are the bands of Luciferase-shRNA in the input and probe both light, while the bands of IDH1-shRNA are both dark? This suggests that the expression of KLF1 is much higher in IDH1-shRNA cells than in control cells. Therefore, this result may not strongly support the increased binding of KLF1 at the SIRT1 promoter after IDH1 knockdown.

    1. Reviewer #2 (Public Review):

      The authors present a computational methodology for de-biasing/denoising high-throughput genomic signals using optimal transport techniques, thus allowing disparate datasets to be merged and jointly analysed. They apply this methodology on liquid biopsy data and they demonstrate improved performance (compared to simpler bias-correcting approaches) for cancer detection using common machine learning algorithms. This is a theoretically interesting and potentially useful approach for addressing a very common practical problem in computational genomics.

      I have the following recommendations:

      (1) When comparing performance metrics between different approaches (e.g., tables 3 and 4), 95% confidence intervals should also be provided and a pairwise statistical test should be applied to establish whether the observed difference in each performance metric between the proposed method and the alternatives is statistically significant, thus justifying the claim that the proposed method offers an improvement over existing methodologies.

      (2) The commonly used center-and-scale and GC debias approaches presented by the authors are fairly simple. How does their methodology compare to more elaborate approaches, such as tangent normalisation (https://academic.oup.com/bioinformatics/article/38/20/4677/6678978) and robust PCA (https://github.com/mskilab-org/dryclean)?

      (3) What is the computational cost of the proposed methodology and how does it compare to the alternatives?

      (4) The proposed approach relies on a reference dataset, against which a given dataset is adapted. What are the implications for cross-validation experiments (which are essential for assessing the out-of-sample error of every methodology), particularly with regards to the requirement to avoid information leakage between training and validation/test data sets?

      In conclusion, this is an interesting and potentially useful paper and I would like to encourage the authors to address the above points, which hopefully will strengthen their case.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors investigated whether a salticid spider, Phidippus regius, recognizes other individuals of the same species. The authors placed each spider inside a container from which it could see another spider for 7 minutes, before having its view of the other spider occluded by an opaque barrier for 3 minutes. The spider was then either presented with the same individual again (habituation trial) or a different individual (dishabituation trial). The authors recorded the distance between the two spiders during each trial. In habituation trials, the spiders were predicted to spend more time further away from each other and, in dishabituation trials, the spiders were predicted to spend more time closer to each other. The results followed these predictions, and the authors then considered whether the spiders in habituation trials were generally fatigued instead of being habituated to the appearance of the other spider, which may have explained why they spent less time near the other individual. The authors presented the spiders with a different (novel) individual after a longer period of time (which they considered to be a long-term dishabituation trial), and found that the spiders switched to spending more time closer to the other individual again during this trial. This suggested that the spiders had recognized and had habituated to the individual that they had seen before and that they became dishabituated when they encountered a different individual.

      Strengths:

      It is interesting to consider individual recognition by Phidippus regius. Other work on individual recognition by an invertebrate has been, for instance, known for a species of social wasp, but Phidippus regius is a different animal. Importantly and more specifically, P. regius is a salticid spider, and these spiders are known to have exceptional eyesight for animals of their size, potentially making them especially suitable for studies on individual recognition. In the current study, the results from experiments were consistent with the authors' predictions, suggesting that the spiders were recognizing each other by being habituated to individuals they had encountered before and by being dishabituated to individuals they had not encountered before. This is a good start in considering individual recognition by this species.

      Weaknesses:

      The experiments in this manuscript (habituation/dishabituation trials) are a good start for considering whether individuals of a salticid species recognize each other. I am left wondering, however, what features the spiders were specifically paying attention to when recognizing each other. The authors cited Sheehan and Tibbetts (2010) who stated that "Individual recognition requires individuals to uniquely identify their social partners based on phenotypic variation." Also, recognition was considered in a paper on another salticid by Tedore and Johnsen (2013).

      Tedore, C., & Johnsen, S. (2013). Pheromones exert top-down effects on visual recognition in the jumping spider Lyssomanes viridis. The Journal of Experimental Biology, 216, 1744-1756. doi: 10.1242/jeb.071118

      In this elegant study, the authors presented spiders with manipulated images to find out what features matter to these spiders when recognizing individuals.

      Part of the problem with using two living individuals in experiments is that the behavior of one individual can influence the behavior of the other, and this can bias the results. However, this issue can be readily avoided because salticids are well known, for example, to be highly responsive to lures (e.g. dead prey glued in lifelike posture onto cork disks) and to computer animation. These methods have already been successful and helpful for standardizing the different stimuli presented during many different experiments for many different salticid spiders, and they would be helpful for better understanding how Phidippus regius might recognize another individual on the basis of phenotypic variation. There are all sorts of ways in which a salticid might recognize another individual. Differences in face or body structure, or body size, or all of these, might have an important role in recognition, but we won't know what these are using the current methods alone. Also, I didn't see any details about whether body size was standardized in the current manuscript.

      For another perspective, my thoughts turn to a paper by Cross et al.

      Cross, F. R., Jackson, R. R., & Taylor, L. A. (2020). Influence of seeing a red face during the male-male encounters of mosquito-specialist spiders. Learning & Behavior, 48, 104-112. doi: 10.3758/s13420-020-00411-y

      These authors found that males of Evarcha culicivora, another salticid species that is known to have a red face, become less responsive to their own mirror images after having their faces painted with black eyeliner than if their faces remained red. In all instances, the spiders only saw their own mirror images and never another spider, and these results cannot be interpreted on the basis of habituation/dishabituation because the spiders were not responding differently when they simply saw their mirror image again. Instead, it was specifically the change to the spider's face which resulted in a change of behavior. The findings from this paper and from Tedore and Johnsen can help give us additional perspectives that the authors might like to consider. On the whole, I would like the authors to further consider the features that P. regius might use to discern and recognize another individual.

    1. Reviewer #2 (Public Review):

      Summary:

      The present article by Tesler et al proposes a 3-population model of the striatum input-output function including the direct pathway (D1) striatal projection neurons (dSPNs), the indirect pathway (D2) striatal projection neurons (iSPNs), and the fast-spiking striatal interneurons. The authors derive a mean-field version of the model where the firing rate of each population follows the transfer function obtained from a spiking (AdEx) neuron model for each cell population. They report the response of the mean-field circuit to oscillatory inputs from the cortex, the effect of dopamine on dSPNs and iSPNs, and how a simple reinforcement learning rule at cortico-striatal synapses would adapt the model's output in the face of 2 distinct inputs.

      Strengths:

      The model is simple and easy to understand.

      Weaknesses:

      Feedforward inhibition from FSI and interconnections between dSPNs and iSPNs does not seem to have any significant impact on the input-output response of dSPNs and iSPNs to cortical inputs. Therefore, all of the results shown can be derived relatively easily from the basic knowledge we have about mean-field neuronal models and their responses to external inputs: all populations have an output that linearly follows the input. Concerning the reinforcement learning paradigm, showing that 2 distinct inputs can be associated with opposite outputs based on a tri-partite synaptic learning rule does not appear new either. As it is, it's unclear to me how this model contributes to new knowledge concerning striatal neuronal activity. Moreover, the assumptions made concerning the effect of dopamine and the synaptic plasticity rules appear rather simplistic and relatively outdated.

      Many of the goals set in the introduction do not appear met:

      "understanding and modelling the complex dynamics and functions of the striatum constitutes a very relevant and challenging task".<br /> I'm not sure if the authors aim to understand and model the complex dynamics of the striatum here: there are no complex dynamics that are revealed or explained in the model, as the dSPNs and iSPNs mainly appear to have a linear relationship to their inputs (with added noise) in 3 for example. I did not find any non-trivial dynamics highlighted in the presentation of the results either.

      "modelling and studying the functions of the striatum and its associated neuronal dynamics requires to investigate these cellular/microcircuits mechanisms, and how the small-scale mechanisms affect large-scale behavior"<br /> I also did not find a statement about the effect of cellular/microcircuit mechanisms on behavior or large-scale activity in the results or discussion. The effects of micro-circuits are rather transparent as dSPNs and iSPNs do not seem to differ from feedforward responses to cortical inputs.

      "existing mean-fields are based on generic models (sometimes inspired by cortical circuits) [7, 8], which do not consider the rich and specific cellular and synaptic variability observed along brain regions."<br /> The authors argue here that specific input-output relationships of striatal neurons may contribute to the circuit dynamics. However, the input-output they derive from a spiking neuron model (AdEx) in Figure 2, are very typical IF curves used in most mean-field models. Apart from a slight saturation effect at large rates (which is incorporated in many mean-field models and may not even be relevant here given the max firing of these cells), the I-F curve looks exactly like what is expected from the most basic rate model neuron with a rectifying transfer function in the presence of synaptic noise. What cellular or synaptic properties would the authors like to highlight here? Linking to molecular and cellular parameters, as advertised in the intro, seems much beyond the current achievements of the present model.

      "This approach permits an efficient transition between scales and, furthermore, it allows to explore the effects of cellular parameters at the network level, as we will show for the case of dopaminergic effects in the striatum."<br /> If the authors mean the excitation of D1 SPNS and the inhibition of D2 SPNs by dopamine, this statement seems slightly oversold. It's very well known that dopaminergic effects cannot simply be resumed by a change in excitability as it acts on non-linear currents and complex synaptic parameters. They model it as follows: "To model these effects of dopamine in dSPN cells we will assume the increase of excitability due to D1 activation in dPSNs can be described as an increase in the glutamatergic conductance (Qe in our model) together with the action of a depolarizing current" Which basically means an additional excitatory input and a depolarizing current. The expected effect on the firing rate of these 2 effects is rather simple and does not require circuit modelling I believe.

      This effect of dopamine is referred to in the discussion as: "This analysis allowed us to show how modifications at the cellular level can be incorporated within the mean-field model which can in turn predict and capture the emergent changes at the network level generated by them, and in addition has provided further validation to our model."<br /> Again, I don't see any emergent property or model validation here. Maybe the authors can be a bit more precise about what emergent property they refer to.

      "In addition it illustrates how changes at the cellular level can lead to emerging effects at the network level, which can be captured by the mean-field model"<br /> I did not find any description of 'emerging effects at the network level" in the results or discussion. Maybe the authors could elaborate on what they mean here.

      "shows the capabilities of the model to reproduce specific brain functions"<br /> The capacity of a network to associate stim A to a positive output and stim B to a negative one through reward-driven synaptic plasticity is rather well described and is a bit far from 'specific brain functions'. Concerning the discussion, it highlights how the model 'could be useful' rather than highlighting any strength of the model or relation to existing work. In particular, the (large) literature on circuit modelling in the striatum and BG circuits is not cited at all beyond self-citations, except in one book chapter (Houk et al, 1995) and one paper (Bogacz, 2020).

      "The RL model proposed can very easily be improved to capture more biologically complex scenarios"<br /> Why did the authors not implement such an 'easy' improvement?

    1. Reviewer #2 (Public Review):

      Summary:

      In the manuscript "Metabolic heterogeneity of colorectal cancer as a prognostic factor: insights gained from fluorescence lifetime imaging" by Komarova et al., the authors used fluorescence lifetime imaging and quantitative analysis to assess the metabolic heterogeneity of colorectal cancer. Generally, this work is logically well-designed, including in vitro and in vivo animal models and ex vivo patient samples. Although the key parameter (BI index) used in this study was already published by this group, it was shown that heterogeneity of patients' samples had associations with clinical characteristics of tumors. Additional samples from 8 patients were added to the data pool during the revision process, which is helpful and important for the conclusions that the authors are trying to draw. Overall, the revisions that the authors have made greatly strengthen this study.

      Strengths:

      (1) Solid experiments are performed and well-organized, including in vitro and in vivo animal models and ex vivo patient samples;

      (2) Attempt and efforts to build the association between the metabolic heterogeneity and prognosis for colorectal cancer.

      Weaknesses:

      (1) Although additional data acquired from 8 patients were collected, maybe more patients should be involved in the future for reliable diagnosis and prognosis.

    1. Reviewer #2 (Public Review):

      This work makes substantial progress towards understanding physical aspects of formation locomotion, notably the hydrodynamic stability of groups of flappers and the modifications to energy costs associated with flow interactions.

      Major strengths pertain to the fact that this topic is timely, interesting and complex, and the authors have advanced the understanding through their characterizations.

      The weaknesses may relate to the many idealizations employed in the simulations and models, which may raise questions about how to interpret their results and whether the outcomes hold generally. But given the complexity of the problem, simplifications are necessary. The authors have certainly provided a clear presentation with appropriate details and caveats that will help the reader extract the main messages and form their own conclusions.

      Overall, the work is a positive addition to the growing set of studies into schooling, flocking and related problems where unsteady flow interactions lead to interesting collective effects.

    1. Reviewer #2 (Public Review):

      A limitation in using SNPs to understand recent histories of genomes is their low mutation frequency. Tellier et al. explore the possibility of adding hypermutable markers to SNP based methods for better resolution over short time frames. In particular, they hypothesize that epimutations (CG methylation and demethylation) could provide a useful marker for this purpose. Individual CGs in Arabidopsis tends to be either close to 100% methylated or close to 0%, and are inherited stably enough across generations that they can be treated as genetic markers. Small regions containing multiple CGs can also be treated as genetic markers based on their cumulative methylation level. In this manuscript, Tellier et al develop computational methods to use CG methylation as a hypermutable genetic marker and test them on theoretical and real data sets. They do this both for individual CGs and small regions. My review is limited to the simple question of whether using CG methylation for this purpose makes sense at a conceptual level, not at the level of evaluating specific details of the methods. I have a small concern in that it is not clear that CG methylation measurements are nearly as binary in other plants and other eukaryotes as they are in Arabidopsis. However, I see no reason why the concept of this work is not conceptually sound. Especially in the future as new sequencing technologies provide both base calling and methylating calling capabilities, using CG methylation in addition to SNPs could become a useful and feasible tool for population genetics in situations where SNPs are insufficient.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Ziegler et al, entitled 'Structural characterization and dynamics of AdhE ultrastructure from Clostridium thermocellum: A containment strategy for toxic intermediates?" presents the atomic resolution cryo-EM structure of C. thermocellum AdhE showing that it show dominantly an extended form while E.coli AdhE shows dominantly a compact form. With comparative analysis of their C. thermocellum structure and the previous E.coli AdhE structure, they tried to reveal the mechanism by which C.thermocellum and E.coli show different dominant conformations. In addition, they also analyzed the substrate channel by comparative and computational approaches. Lastly, their computational analysis using CryoDRGN reveals conformational heterogeneity in the sample. Despite this the manuscript is very descriptive and does not provide a mechanistic understanding by which AdhE works, this work will provide structural frame works to further investigate the function and mechanism of AdhE dynamics.

      Strengths:

      This manuscript provides the first C. thermocellum (Ct) AdhE structure and comparatively analyzed this structure with E.coli AdhE.

      Weaknesses:

      This work is very descriptive and does not provide mechanistic understanding of the function and dynamics of AdhE.

    1. Reviewer #2 (Public Review):

      Summary:

      Peled et al identified HER2 mutations in connection with resistance to the anti-HER2 antibody Pertuzumab-mediated therapy. After constructing a yeast display library of Pertuzumab variants with 3.86×10^11 sequences for targeted screening of variant combinations in chosen 6 out of 14 residues, the authors performed experimental screening to obtain the clones that bind to HER2 WT and/or mutants (S310Y and S310F), and then combined new variations to obtain antibodies with a broad spectrum binding to both WT and two HER2 mutants. These are interesting studies of clinical impact and translational potential.

      Strengths:

      (1) Deep computational analyses of large datasets of clinical data provide useful information about HER2 mutations and their potential relevance to antibody therapy resistance.

      (2) There is valuable information analyzing the residues within or near the interface between the antigen HER2 and the Pertuzumab antibody (heavy chain).<br /> The experimental antibody library screening obtained 90+ clones from 3.86×10^11 sequences for further functional validation.

      Weaknesses:

      (1) There is lack of assessment for antibody variant functions in cancer cell phenotypes in vitro (proliferation, cell death, motility) or in vivo (tumor growth and animal survival). The only assay was the western blotting of phosphopho-HER3 in Figure 4. However, HER2 levels and phosphor-HER2 were not analyzed.

      (2) There is misleading impression from the title of computational engineering of a therapeutic antibody and the statement in the abstract "we designed a multi-specific version of Pertuzumab that retains original function while also bindings these HER2 variants" for a few reasons:

      a. The primary method used for variant antibody identification for HER2 mutant binding is rather traditional experimental screening based on yeast display instead of computational design of a multi-specific version of Pertuzumab.

      b. There is insufficient or lack of computational power in the antibody design or prioritization in choosing variant residues for the library construction of 3.86×1011 sequences. It seems random combinations from 6 residues out of 4 groups with 20 amino acid options.<br /> c. The final version of tri-binding variant is a combination of screened antibody clones instead of computation design from scratch.<br /> d. There is incomplete experimental evidence about the therapeutic values of newly obtained antibody clones.

      Comments on revised version:

      Two major comments remain and have not been well addressed. Comment 1 is expecting any cellular phenotypic analysis if not in vivo. Comment 2 requires some modifications to avoid overstating.

    1. Reviewer #2 (Public Review):

      This manuscript explores the utility of AlphaFold2 (AF2) and the author's own AF2-RAVE method for drug discovery. As has been observed elsewhere, the predictive power of docking against AF2 structures is quite limited, particularly for proteins like kinases that have non-trivial conformational dynamics. However, using enhanced sampling methods like RAVE to explore beyond AF2 starting structures leads to a significant improvement.

      Comments on revised version:

      I'm happy with the changes made.

    1. Reviewer #2 (Public Review):

      Vangl2, a core planar cell polarity protein involved in Wnt/PCP signaling, cell proliferation, differentiation, homeostasis, and cell migration. Vangl2 malfunctioning has been linked to various human ailments, including autoimmune and neoplastic disorders. Interestingly, it was shown that Vangl2 interacts with the autophagy regulator p62, and autophagic degradation limits the activity of inflammatory mediators, such as p65/NF-κB. However, the possible role of Vangl2 in inflammation has not been investigated. In this manuscript, Lu et al. describe that Vangl2 expression is upregulated in human sepsis-associated PBMCs and that Vangl2 mitigates experimental sepsis in mice by negatively regulating p65/NF-κB signaling in myeloid cells. Their mechanistic studies further revealed that Vangl2 recruits the E3 ubiquitin ligase PDLIM2 to promote K63-linked poly-ubiquitination of p65. Vangl2 also facilitated the recognition of ubiquitinated p65 by the cargo receptor NDP52. These molecular processes caused selective autophagic degradation of p65. Indeed, abrogation of PDLIM2 or NDP52 functions rescued p65 from autophagic degradation, leading to extended p65/NF-κB activity in myeloid cells. Overall, the manuscript presents convincing evidence for novel Vangl2-mediated control of inflammatory p65/NF-kB activity. The proposed pathway may expand interventional opportunities restraining aberrant p65/NF-kB activity in human ailments.

      IKK is known to mediate p65 phosphorylation, which instructs NF-kB transcriptional activity. In this manuscript, Vangl2 deficiency led to an increased accumulation of phosphorylated p65 and IKK also at 30 minutes post-LPS stimulation; however, autophagic degradation of p-p65 may not have been initiated at this early time point. Therefore, this set of data put forward the exciting possibility that Vangl2 could also be regulating the immediate early phase of inflammatory response involving the IKK-p65 axis - a proposition that may be tested in future studies.

    1. Reviewer #2 (Public Review):

      Summary:<br /> I believe the authors have done a wonderful job at dissecting a very complex topic, starting with basic building blocks of locomotion and introducing a powerful simulation approach to the exploring the landscape of growth and form in intelligent behavior.

      Strengths:<br /> This is a very original, timely, and robust piece of work that I believe can inspire further computational studies in evo-devo-etho.

      Weaknesses:<br /> More detail on the simulations and also greater clarity regarding the generalizability of their claims would improve the message and further studies.

    1. Reviewer #2 (Public Review):

      Panel 2N and 2O should have been done with and without SCRV treatment, so that the reader can assess whether SCRV induces additional IFN activation (on top of MDA5 and STING autoactivation). I would recommend the authors include a sentence in the text to explain that ectopic expression of MDA5 or STING (i.e. overexpression from a plasmid) induces autoactivation of these proteins. Therefore, the IFN induction that is seen in panel 2N is likely due to MDA5/STING overexpression. SCRV treatment may further boost IFN induction, but this cannot be assessed without the 'mock' conditions. This information will help the readers to interpret Fig. 2N and 2O correctly.

    1. Reviewer #2 (Public Review):

      The authors characterized the activity of the dorsal periaqueductal gray (dPAG) - basolateral amygdala (BLA) circuit. They show that BLA cells that are activated by dPAG stimulation are also more likely to be activated by a robot predator. These same cells are also more likely to display synchronous firing.

      The authors also replicate prior results showing that dPAG stimulation evokes fear and the dPAG is activated by a predator.

      Lastly, the report performs anatomical tracing to show that the dPAG may act on the BLA via the paraventricular thalamus (PVT). Indeed, the PVT receives dPAG projections and also projects to the BLA. However, the authors do not show if the PVT mediates dPAG to BLA communication with any functional behavioral assay.

      The major impact in the field would be to add evidence to their prior work, strengthening the view that the BLA can be downstream of the dPAG.

    1. Reviewer #2 (Public Review):

      Summary:<br /> This work identifies two variants in CAPSL in two generation familial exudative vitreoretinopathy (FEVR) pedigrees, and using a knockout mouse model, they link CAPSL to retinal vascular development and endothelial proliferation through the MYC pathway. Together, these findings suggest that the identified variants may be causative and that CAPSL is a new FEVR-associated gene.

      Strengths:<br /> The authors data provides compelling evidence that loss of the poorly understood protein CAPSL can lead to reduced endothelial proliferation in mouse retina and suppression of MYC signaling, consistent with the disease seen in FEVR patients. The paper is clearly written, and the data generally support the author's hypotheses.

      Weaknesses:<br /> (1) Both pedigrees described suggest autosomal dominant inheritance in humans, but no phenotype was observed in Capsl heterozygous mice. Additional studies would be needed to determine the cause of this disparity.

      (2) Additional discussion of the hypothesized functional mechanism of the p.L83F variant would have improved the manuscript. While the human genetic data is compelling, it remains unclear how this variant may effect CAPSL function. In vitro, p.L83F protein appears to be normally localized within the cell and it is unclear why less mutant protein was detected in transfected cells. Was the modified protein targeted for degradation?

      (3) Authors did not describe how the new crispr-generated Capsl-loxp mouse model was screened for potential off-target gene editing, raising the possibility that unrelated confounding mutations may have been introduced.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In their manuscript, Multi-dimensionality of tree communities structure host-parasitoid networks and their phylogenetic composition, Wang et al. examine the effects of tree diversity and environmental variables on communities of reed-nesting insects and their parasitoids. Additionally, they look for the correlations in community composition and network properties of the two interacting insect guilds. They use a data set collected in a subtropical tree biodiversity experiment over five years of sampling. The authors find that the tree species, functional, and phylogenetic diversity as well as some of the environmental factors have varying impacts on both host and parasitoid communities. Additionally, the communities of the host and parasitoid showed correlations in their structures. Also, the network metrices of the host-parasitoid network showed patterns against environmental variables.

      Strengths:<br /> The main strength of the manuscript lies in the massive long-term data set collected on host-parasitoid interactions. The data provides interesting opportunities to advance our knowledge on the effects of environmental diversity (tree diversity) on the network and community structure of insect hosts and their parasitoids in a relatively poorly known system.

      Weaknesses:<br /> To me, there are no major issues regarding the manuscript, though sometimes I disagree with the interpretation of the results and some of the conclusions might be too far-fetched given the analyses and the results (namely the top-down control in the system). Additionally, the methods section (especially statistics) was lacking some details, but I would not consider it too concerning. Sometimes, the logic of the text could be improved to better support the studied hypotheses throughout the text. Also, the results section cannot be understood as a stand-alone without reading the methods first. The study design and the rationale of the analyses should be described somewhere in the intro or presented with the results.

    1. Reviewer #2 (Public Review):

      Summary:

      This study examines how local DNA features around the amino acid permease gene GAP1 influence adaptation to glutamine-limited conditions through changes in GAP1 Copy Number Variation (CNV). The study is well motivated by the observation of numerous CNVs documented in many organisms, but difficulty in distinguishing the mechanisms by which they are formed, and whether or how local genomic elements influence their formation. The main finding is convincing and is that a nearby Autonomous Replicating Sequence (ARS) influences the formation of GAP1 CNVs and this is consistent with a predominate mechanism of Origin Dependent Inverted Repeat Amplification (ODIRA). These results along with finding and characterizing other mechanisms of GAP1 CNV formation will be of general interest to those studying CNVs in natural systems, experimental evolution, and in tumor evolution. While the results are limited to a single CNV of interest (GAP1), the carefully controlled experimental design and quantification of CNV formation will provide a useful guide to studying other CNVs and CNVs in other organisms.

      Strengths:

      The study was designed to examine the effects of two flanking genomic features next to GAP1 on CNV formation and adaptation during experimental evolution. This was accomplished by removing two Long Terminal Repeats (LTRs), removing a downstream ARS, and removing both LTRs and the ARS. Although there was some heterogeneity among replicates, later shown to include the size and breakpoints of the CNV and the presence of an unmarked CNV, both marker-assisted tracking of CNV formation and modeling of CNV rate and fitness effects showed that deletion of the ARS caused a clear difference compared to the control and the LTR deletion.

      The consequence of deletion of local features (LTR and ARS) was quantified by genome sequencing of adaptive clones to identify the CNV size, copy number and infer the mechanism of CNV formation. This greatly added value to the study as it showed that i) ODIRA was the most common mechanism but ODIRA is enhanced by a local ARS, ii) non-allelic homologous recombination (NAHR) is also used but depends on LTRs, and iii) de novo insertion of transposable elements mediate NAHR in strains with both ARS and LTR deletions. Together, these results show how local features influence the mechanism of CNV formation, but also how alternative mechanisms can substitute when primary ones are unavailable.

      Weaknesses:

      The CNV mutation rate and its effect on fitness are hard to disentangle. The frequency of the amplified GFP provides information about mutation rate differences as well as fitness differences. The data and analysis show that each evolved population has multiple GAP1 CNV lineages within it, with some being unmarked by GFP. Thus, estimates of CNV fitness are more of a composite view of all CNV amplifications increasing in frequency during adaptation. Another unknown but potential complication is whether the local (ARS, LTR) deletions influence GAP1 expression and thus the fitness gain of GAP1 CNVs. The neural network simulation-based inference does a good job at estimating both mutation rates and fitness effects, while also accounting for unmarked CNVs. However, the model does not account for the population heterogeneity of CNVs and their fitness effects. Despite these limitations of distinguishing mutation rate and fitness differences, the authors' conclusions are well supported in that the LTR and ARS deletions have a clear impact on the CNV-mediated evolutionary outcome and the mechanism of CNV formation.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors aim to address the clinical challenge of treating endometriosis, a debilitating condition with limited and often ineffective treatment options. They propose that inhibiting KMO could be a novel non-hormonal therapeutic approach. Their study focuses on:<br /> • Characterising KMO expression in human and mouse endometriosis tissues.<br /> • Investigating the effects of KMO inhibitor KNS898 on inflammation, lesion volume, and pain in a mouse model of endometriosis.<br /> • Demonstrating the efficacy of KMO blockade in improving histological and symptomatic features of endometriosis.

      Strengths:

      • Novelty and Relevance: The study addresses a significant clinical need for better endometriosis treatments and explores a novel therapeutic target.<br /> • Comprehensive Approach: The authors use both human biobanked tissues and a mouse model to study KMO expression and the effects of its inhibition.<br /> • Clear Biochemical Outcomes: The administration of KNS898 reliably induced KMO blockade, leading to measurable biochemical changes (increased kynurenine, increased kynurenic acid, reduced 3-hydroxykynurenine).

      Weaknesses:

      • Limited Mechanistic Insight: The study does not thoroughly investigate the mechanistic pathways through which KNS898 affects endometriosis. Specifically, the local vs. systemic effects of KMO inhibition are not well differentiated.<br /> • Statistical Analysis Issues: The choice of statistical tests (e.g., two-way ANOVA instead of repeated measures ANOVA for behavioral data) may not be the most appropriate, potentially impacting the validity of the results.<br /> • Quantification and Comparisons: There is insufficient quantitative comparison of KMO expression levels between normal endometrium and endometriosis lesions, and the systemic effects of KNS898 are not fully explored or quantified in various tissues.<br /> • Potential Side Effects: The systemic accumulation of kynurenine pathway metabolites raises concerns about potential side effects, which are not addressed in the study.

      Achievement of Aims:

      • The authors successfully demonstrated that KMO is expressed in endometriosis lesions and that KNS898 can induce KMO blockade, leading to biochemical changes and improvements in endometriosis symptoms in a mouse model.

      Support of Conclusions:

      • While the data supports the potential of KMO inhibition as a therapeutic strategy, the conclusions are somewhat overextended given the limitations in mechanistic insights and statistical analysis. The study provides promising initial evidence but requires further exploration to firmly establish the efficacy and safety of KNS898 for endometriosis treatment.

      Impact on the Field:

      • The study introduces a novel therapeutic target for endometriosis, potentially leading to non-hormonal treatment options. If validated, KMO inhibition could significantly impact the management of endometriosis.

      Utility of Methods and Data:

      • The methods used provide a foundation for further research, although they require refinement. The data, while promising, need more rigorous statistical analysis and deeper mechanistic exploration to be fully convincing and useful to the community.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In agriculture, nitrogen fertilizers are used to allow for optimum growth and yield of crops. The use of these fertilizers has a large negative impact on the environment and climate. In this report McMahon et al. have inoculated maize seeds with a nitrogen fixing bacterium: Gluconacetobacter diazotrophicus. It has been demonstrated before that nitrogen fixed by this bacterium can be incorporated in a plant. In this study the spatial distribution of the incorporated nitrogen was revealed using NanoSIMS. The nitrogen was strongly enriched in the chloroplasts and especially the stromal region where the Calvin-Benson cycle enzymes are located.

      Strengths:<br /> The topic is very interesting as nitrogen supply is of great importance for agriculture. The study is well designed, and the data convincingly show enrichment of 15N (fixed by the bacterium) in the chloroplasts.

      Weaknesses:<br /> Some of the data that is discussed is not presented in the (supplement) of the paper. First, in the abstract it is mentioned "help explain the observation of enhanced growth rates in plants containing this nitrogen fixing bacterium". It is unclear if this refers to literature or to this study. Either, it should be mentioned in the introduction, or the data should be shown in the paper. Second, it is mentioned that the chloroplast had a significantly higher nitrogen isotope ratio value compared to the nuclei and the xylem cell walls. Please provide the numbers of the ratios (preferably also an image of the xylem cell wall) and the type of statistical analysis that has been performed.

      The paper could benefit from a more in-depth analysis of why the nitrogen isotope ratio is higher in the chloroplast. It seems to be correlated with the local nitrogen abundance, did the authors plot the two against each other? What would it mean if it is correlated? What minimal nitrogen concentration/signal should there be to make a reliable estimate of the ratio? Does the higher ratio mean that the turnover rate of the Calvin-Benson cycle enzymes is higher than for other proteins?

      For the small structures that could be the nitrogen fixing bacteria the 15N enrichment is up to 270x the natural ratio. Does this mean that 100% (270*0.0036=1) of their nitrogen is fixed from the provided atmosphere?

      Could one also provide the absolute ratio in the chloroplasts? It would be nice if the authors discuss, based on their data, the potential of using nitrogen fixing bacteria to provide nitrogen to crops.

    1. Reviewer #2 (Public Review):

      Fuchs et al. propose a framework for action recognition based on pose estimation. They integrate functions from DeepLabCut and MMAction2, two popular machine-learning frameworks for behavioral analysis, in a new package called ASBAR.

      They test their framework by

      - Running pose estimation experiments on the OpenMonkeyChallenge (OMC) dataset (the public train + val parts) with DeepLabCut.

      - Annotating around 320 image pose data in the PanAf dataset (which contains behavioral annotations). They show that the ResNet-152 model generalizes best from the OMC data to this out-of-domain dataset.

      - They then train a skeleton-based action recognition model on PanAf and show that the top-1/3 accuracy is slightly higher than video-based methods (and strong), but that the mean class accuracy is lower - 33% vs 42%. Likely due to the imbalanced class frequencies. This should be clarified. For Table 1, confidence intervals would also be good (just like for the pose estimation results, where this is done very well).

    1. Reviewer #1 (Public Review):

      This is a very relevant study, clearly with the potential of having a high impact on future research on the evolution of chemical defense mechanisms in animals. The authors present a substantial number of new and surprising experimental results, i.e., the presence in low quantities of alkaloids in amphibians previously deemed to lack these toxins. These data are then combined with literature data to weave the importance of passive accumulation mechanisms into a 4-phases scenario of the evolution of chemical defense in alkaloid-containing poison frogs.

      In general, the new data presented in the manuscript are of high quality and high scientific interest, the suggested scenario compelling, and the discussion thorough. Also, the manuscript has been carefully prepared with a high quality of illustrations and very few typos in the text. Understanding that the majority of dendrobatid frogs, including species considered undefended, can contain low quantities of alkaloids in their skin provides an entirely new perspective to our understanding of how the amazing specializations of poison frogs evolved. Although only a few non-dendrobatids were included in the GCMS alkaloid screening, some of these also included minor quantities of alkaloids, and the capacity of passive alkaloid accumulation may therefore characterize numerous other frog clades, or even amphibians in general.

      While the overall quality of the work is exceptional, major changes in the structure of the submitted manuscript are necessary to make it easier for readers to disentangle scope, hypotheses, evidence and newly developed theories.

    1. Reviewer #2 (Public Review):

      Summary:

      Yamawaki et al., conducted a series of neuroanatomical tracing and whole-cell recording experiments to elucidate and characterise a relatively unknown pathway between the endopiriform (EN) and CA1 of the ventral hippocampus (vCA1) and to assess its functional role in social and object recognition using fibre photometry and dual vector chemogenetics. The main findings were that the EN sends robust projections to the vCA1 that colateralise to the prefrontal cortex, lateral entorhinal cortex, and piriform cortex, and these EN projection neurons terminate in the stratum lacunosum-moleculare (SLM) layer of distal vCA1, synapsing onto GABAergic neurons that span across the Pyramidal-Stratum Radiatum (SR) and SR-SML borders. It was also demonstrated that EN input disynaptically inhibits vCA1 pyramidal neurons. vCA1 projecting EN neurons receive afferent input from the piriform cortex, and from within EN. Finally, fibre photometry experiments revealed that vCA1 projecting EN neurons are most active when mice explore novel objects or conspecifics, and pathway-specific chemogenetic inhibition led to an impairment in the ability to discriminate between novel vs. familiar objects and conspecifics.

      This is an interesting mechanistic study that provides valuable insights into the function and connectivity patterns of afferent input from the endopiriform to the CA1 subfield of the ventral hippocampus. The authors propose that the EN input to the vCA1 interneurons provides a feedforward inhibition mechanism by which novelty detection could be promoted. The experiments appear to be carefully conducted, and the methodological approaches used are sound. The conclusions of the paper are supported by the data presented on the whole.

      However, some aspects of methodology and data interpretation will need to be clarified and further evidence provided to enhance the utility of the data to the rest of the field.

      The authors used dual retrograde tracing and observed that the highest percentage (~30%) of vCA1 projecting EN cells also projected to the PFC. They then employed an intersectional approach to show the presence of collaterals in other cortical areas such as the entorhinal cortex and piriform cortex in addition to the PFC. However, they state that 'Projection to prefrontal cortex was sparse relative to other areas, as expected based on the retrograde labeling data' (referring to Figure 2K) and subsequently appear to dismiss the initial data set indicating strong axonal projections to the PFC.

      Since this is a relatively unknown connection, it would be helpful if some evidence/discussion is provided for whether the EN projects to other subfields (CA3, DG) of the ventral hippocampus. This is important, as the retrograde tracer injections depicted in Figure 1B clearly show a spread of the tracer to vCA3 and potentially vDG and it is not possible to ascertain the regional specificity of the pathway.

      The vCA1 projecting EN cells appear to originate from an extensive range along the AP axis. Is there a topographical organization of these neurons within the vCA1? A detailed mapping of this kind would be valuable.

      Given this extensive range in the location of vCA1 EN originating cells, how were the targets (along the AP axis) in EP selected for the calcium imaging?

      The vCA1 has extensive reciprocal connections with the piriform cortex as well, which is in close proximity to the EN. How certain are the authors that the chemogenetic targeting was specific to the EN-vCA1 connection?

      Raw data for the sociability and discrimination indices should be provided so that the readers can gain further insight into the nature of the impairment.

      Line 222: It is unclear how locomotor activity informs anxiety in the behavioral tests.

      Figure 7 title; It is stated that activity of EN neurons 'predict' social/object discrimination performance. However, caution must be exercised with this interpretation as the correlational data are underpowered (n=5-8). Furthermore, the results show a significant correlation between calcium event ratios and the discrimination index in the social discrimination test but not the object discrimination test.

      While both male and female mice were included in the anatomical tracing and recording experiments, only male mice were used for behavioral tests.

  2. Jul 2024
    1. Reviewer #2 (Public Review):

      Summary:

      The paper considers a recurrent network with neurons driven by external input. During the external stimulation predictive synaptic plasticity adapts the forward and recurrent weights. It is shown that after the presentation of constant stimuli, the network spontaneously samples the states imposed by these stimuli. The probability of sampling stimulus x^(i) is proportional to the relative frequency of presenting stimulus x^(i) among all stimuli i=1,..., 5.

      Methods:

      Neuronal dynamics:

      For the main simulation (Figure 3), the network had 500 neurons, and 5 non-overlapping stimuli with each activating 100 different neurons where presented. The voltage u of the neurons is driven by the forward weights W via input rates x, the inhibitory recurrent weights G, are restricted to have non-negative weights (Dale's law), and the other recurrent weights M had no sign-restrictions. Neurons were spiking with an instantaneous Poisson firing rate, and each spike-triggered an exponentially decaying postsynaptic voltage deflection. Neglecting time constants of the postsynaptic responses, the expected postsynaptic voltage reads (in vectorial form) as

      u = W x + (M - G) f (Eq. 5)

      where f =; phi(u) represents the instantaneous Poisson rate, and phi a sigmoidal nonlinearity. The rate f is only an approximation (symbolized by =;) of phi(u) since an additional regularization variable h enters (taken up in Point 4 below). The initialisation of W and M is Gaussian with mean 0 and variance 1/sqrt(N), N the number of neurons in the network. The initial entries of G are all set to 1/sqrt(N).

      Predictive synaptic plasticity:

      The 3 types of synapses were each adapted so that they individually predict the postsynaptic firing rate f, in matrix form

      ΔW ≈ (f - phi( W x ) ) x^T<br /> ΔM ≈ (f - phi( M f ) ) f^T<br /> ΔG ≈ (f - phi( M f ) ) f^T but confined to non-negative values of G (Dale's law).

      The ^T tells us to take the transpose, and the ≈ again refers to the fact that the ϕ entering in the learning rule is not exactly the ϕ determining the rate, only up to the regularization (see Point 4).

      Main formal result:

      As the authors explain, the forward weight W and the unconstrained weight M develop such that, in expectations,

      f =; phi( W x ) =; phi( M f ) =; phi( G f ) ,

      consistent with the above plasticity rules. Some elements of M remain negative. In this final state, the network displays the behaviour as explained in the summary.

      Major issues:

      Point 1: Conceptual inconsistency

      The main results seem to arise from unilaterally applying Dale's law only to the inhibitory recurrent synapses G, but not to the excitatory recurrent synapses M.

      In fact, if the same non-negativity restriction were also imposed on M (as it is on G), then their learning rules would become identical, likely leading to M=G. But in this case, the network becomes purely forward, u = W x, and no spontaneous recall would arise. Of course, this should be checked in simulations.

      Because Dale's law was only applied to G, however, M and G cannot become equal, and the remaining differences seem to cause the effect.

      Predictive learning rules are certainly powerful, and it is reasonable to consider the same type of error-correcting predictive learning rule, for instance for different dendritic branches that both should predict the somatic activity. Or one may postulate the same type of error-correcting predictive plasticity for inhibitory and excitatory synapses, but then the presynaptic neurons should not be identical, as it is assumed here. Both these types of error-correcting and error-forming learning rules for same-branches and inhibitory/excitatory inputs have been considered already (but with inhibitory input being itself restricted to local input, for instance).

      Point 2: Main result as an artefact of an inconsistently applied Dale's law?

      The main result shows that the probability of a spontaneous recall for the 5 non-overlapping stimuli is proportional to the relative time the stimulus was presented. This is roughly explained as follows: each stimulus pushes the activity from 0 up towards f =; phi( W x ) by the learning rule (roughly). Because the mean weights W are initialized to 0, a stimulus that is presented longer will have more time to push W up so that positive firing rates are reached (assuming x is non-negative). The recurrent weights M learn to reproduce these firing rates too, while the plasticity in G tries to prevent that (by its negative sign, but with the restriction to non-negative values). Stimuli that are presented more often, on average, will have more time to reach the positive target and hence will form a stronger and wider attractor. In spontaneous recall, the size of the attractor reflects the time of the stimulus presentation. This mechanism so far is fine, but the only problem is that it is based on restricting G, but not M, to non-negative values.

      Point 3: Comparison of rates between stimulation and recall.

      The firing rates with external stimulations will be considerably larger than during replay (unless the rates are saturated).

      This is a prediction that should be tested in simulations. In fact, since the voltage roughly reads as<br /> u = W x + (M - G) f,<br /> and the learning rules are such that eventually M =; G, the recurrences roughly cancel and the voltage is mainly driven by the external input x. In the state of spontaneous activity without external drive, one has<br /> u = (M - G) f ,<br /> and this should generate considerably smaller instantaneous rates f =; phi(u) than in the case of the feedforward drive (unless f is in both cases at the upper or lower ceiling of phi). This is a prediction that can also be tested.

      Because the figures mostly show activity ratios or normalized activities, it was not possible for me to check this hypothesis with the current figures. So please show non-normalized activities for comparing stimulation and recall for the same patterns.

      Point 4: Unclear definition of the variable h.<br /> The formal definition of h = hi is given by (suppressing here the neuron index i and the h-index of tau)

      tau dh/dt = -h if h>u, (Eq. 10)<br /> h = u otherwise.

      But if it is only Equation 10 (nothing else is said), h will always become equal to u, or will vanish, i.e. either h=u or h=0 after some initial transient. In fact, as soon as h>u, h is decaying to 0 according to the first line. If u is >0, then it stops at u=h according to the second line. No reason to change h=u further. If u<=0 while h>u, then h is converging to 0 according to the first line and will stay there. I guess the authors had issues with the recurrent spiking simulations and tried to fix this with some regularization. However as presented, it does not become clear how their regulation works.

      BTW: In Eq. 11 the authors set the gain beta to beta = beta0/h which could become infinite and, putatively more problematic, negative, depending on the value of h. Maybe some remark would convince a reader that no issues emerge from this.

      Added from discussions with the editor and the other reviewers:

      Thanks for alerting me to this Supplementary Figure 8. Yes, it looks like the authors did apply there Dale's law for both the excitatory and inhibitory synapses. Yet, they also introduced two types of inhibitory pathways converging both to the excitatory and inhibitory neurons. For me, this is a confirmation that applying Dale's law to both excitatory and inhibitory synapses, with identical learning rules as explained in the main part of the paper, does not work.

      Adding such two pathways is a strong change from the original model as introduced before, and based on which all the Figures in the main text are based. Supplementary Figure 8 should come with an analysis of why a single inhibitory pathway does not work. I guess I gave the reason in my Points 1-3. Some form of symmetry breaking between the recurrent excitation and recurrent inhibition is required so that, eventually, the recurrent excitatory connection will dominate.

      Making the inhibitory plasticity less expressive by applying Dale's law to only those inhibitory synapses seems to be the answer chosen in the Figures of the main text (but then the criticism of unilaterally applying Dale's law).

      Applying Dale's law to both types of synapses, but dividing the labor of inhibition into two strictly separate and asymmetric pathways, and hence asymmetric development of excitatory and inhibitory weights, seems to be another option. However, introducing such two separate inhibitory pathways, just to rescue the fact that Dale's law is applied to both types of synapses, is a bold assumption. Is there some biological evidence of such two pathways in the inhibitory, but not the excitatory connections? And what is the computational reasoning to have such a separation, apart from some form of symmetry breaking between excitation and inhibition? I guess, simpler solutions could be found, for instance by breaking the symmetry between the plasticity rules for the excitatory and inhibitory neurons. All these questions, in my view, need to be addressed to give some insights into why the simulations do work.

      Overall, Supplementary Figure 8 seems to me too important to be deferred to the Supplement. The reasoning behind the two inhibitory pathways should appear more prominently in the main text. Without this, important questions remain. For instance, when thinking in a rate-based framework, the two inhibitory pathways twice try to explain the somatic firing rate away. Doesn't this lead to a too strong inhibition? Can some steady state with a positive firing rate caused by the recurrence, in the absence of an external drive, be proven? The argument must include the separation into Path 1 and Path 2. So far, this reasoning has not been entered.

      In fact, it might be that, in a spiking implementation, some sparse spikes will survive. I wonder whether at least some of these spikes survive because of the other rescuing construction with the dynamic variable h (Equation 10, which is not transparent, and that is not taken up in the reasoning either, see my Point 4).

      Perhaps it is helpful for the authors to add this text in the reply to them.

    1. Reviewer #3 (Public Review):

      Summary: The authors investigate the effect of high concentrations of the lipid aldehyde trans-2-hexadecenal (t-2-hex) in a yeast deletion strain lacking the detoxification enzyme. Transcriptomic analyses as global read out reveal that a large range of cellular functions across all compartments are affected (transcriptomic changes affect 1/3 of all genes). The authors provide additional analyses, from which they built a model that mitochondrial protein import caused by modification of Tom40 is blocked.

      Strengths:<br /> Global analyses (transcriptomic and functional genomics approach) to obtain an overview of changes upon yeast treatment with high doses of t-2-hex.

      Weaknesses:<br /> The use of high concentrations of t-2-hex in combination with a deletion of the detoxifying enzyme Hfd1 limits the possibility to identify physiological relevant changes. From the hundreds of identified targets the authors focus on mitochondrial proteins, which are not clearly comprehensible from the data. The main claim of the manuscript that t-2-hex targets the TOM complex and inhibits mitochondrial protein import is not supported by experimental data as import was not experimentally investigated. The observed accumulation of precursor proteins could have many other reasons (e.g. dissipation of membrane potential, defects in mitochondrial presequence proteases, defects in cytosolic chaperones, modification of mitochondrial precursors by t-2-hex rendering them aggregation prone and thus non-import competent). However, none of these alternative explanations have been experimentally addressed or discussed in the manuscript.<br /> Furthermore, many of the results have been reported before (interaction of Tom22 and Tom70 with Hfd1) or observed before (TOM40 as target of t-2-hex in human cells).

    1. Reviewer #3 (Public Review):

      Summary:

      In this manuscript, the authors extend previous work on the role of predator interference in species coexistence. Previous theoretical work (for example, using the Beddington-DeAngelis model) has shown that predator interference allows for multiple predators to coexist on the same prey. While the Beddington-DeAngelis has been influential in theoretical ecology, it has also been criticized at times for several unusual assumptions, most critically, that predators interfere with each other regardless of whether they are already engaged in another interaction. There has been considerable work since then which has sought either to find sets of assumptions that lead to the B-D equation or to derive alternative equations from a more realistic set of assumptions (Ruxton et al. 1992; Cosner et al. 1999; Broom et al. 2010; Geritz and Gyllenberg 2012). This paper represents another effort to more rigorously derive a model of predator interference by borrowing concepts from chemical reaction kinetics (the approach is similar to previous work: Ruxton et al. 1992). The main point of difference is that the model in the current manuscript allows for 'chasing pairs', where a predator and prey engage with one another to the exclusion of other interactions, a situation Ruxton et al. (1992) do not consider. While the resulting functional response is quite complex, the authors show that under certain conditions, one can get an analytical expression for the functional response of a predator as a function of predator and resource densities. They then go on to show that including intraspecific interference allows for the coexistence of multiple species on one or a few resources, and demonstrate that this result is robust to demographic stochasticity. This work provides additional support for the idea that predator interference allows multiple predators to persist with a shared resource.

      Strengths:

      I appreciate the effort to rigorously derive interaction rates from models of individual behaviors. As currently applied, functional responses (FRs) are estimated by fitting equations to feeding rate data across a range of prey or predator densities. In practice, such experiments are only possible for a limited set of species. This is problematic because whether a particular FR allows stability or coexistence depends on not just its functional form, but also its parameter values. The promise of the approach taken here is that one might be able to derive the functional response parameters of a particular predator species from species traits or more readily measurable behavioural data.

      Weaknesses:

      The main weakness of this paper is that while it is technically sound, it doesn't change the fundamental intuition gained from more phenomenological models of predator interference: as one species becomes more common, it limits its own growth (manifested by less time spent searching for/handing resources due to interference), such that it does not exclude the existence of a competitor species. However, given the authors use a different model formulation that has been used in past studies, it suggests that predator interference will likely tend to promote coexistence regardless of some of the technical details in how it is formulated in a model.

      The formulation of chasing-pair engagements assumes that prey being chased by a predator are unavailable to other predators. While this may hold in some predator-prey, it does not hold for many others, perhaps limiting some results' generality.

      Summary:

      The manuscript by Kang et al investigates how the consideration of pairwise encounters (consumer-resource chasing, intraspecific consumer pair, and interspecific consumer pair) influences the community assembly results. To explore this, they presented a new model that considers pairwise encounters and intraspecific interference among consumer individuals, which is an extension of the classical Beddington-DeAngelis (B-D) phenomenological model, incorporating detailed considerations of pairwise encounters and intraspecific interference among consumer individuals. Later, they connected with several experimental datasets.

      Strengths:

      They found that the negative feedback loop created by the intraspecific interference allows a diverse range of consumer species to coexist with only one or a few types of resources. Additionally, they showed that some patterns of their model agree with experimental data, including time-series trajectories of two small in-lab community experiments and the rank-abundance curves from several natural communities. The presented results here are interesting and present another way to explain how the community overcomes the competitive exclusion principle.

      Weaknesses:

      The authors did a great job of satisfactorily addressing each of my concerns raised in the previous round. I did not detect additional weaknesses.

    1. Reviewer #2 (Public Review):

      The neural dynamics underlying decision-making have long been studied across different species (e.g., primates and rodents) and brain areas (e.g., parietal cortex, frontal eye fields, striatum). The key question is to what extent neural firing rates covary with evidence accumulation processes as proposed by evidence accumulation models. It is often assumed that the evidence-accumulation process at the neural level should mirror the evidence-accumulation process at the behavioral level. The current paper shows that the neural dynamics of three rat brain regions (the FOF, ADS, and PCC) all show signatures of evidence accumulation, but in distinct ways. Especially the role of the FOF appears to be distinct, due to its dependence on early evidence compared to the other regions. This sheds new light and a new interpretation of the role of the FOF in decision-making - previously, it has been described as a region encoding the choice that is currently being committed to; this new analysis suggests it is instead strongly influenced by early evidence.

      A major strength of the paper is that the results are achieved through joint modelling of the behavioral and neural data, combined with information on the physical stimulus at hand. Joint models were shown to provide more information on the underlying processes compared to behavioral or neural models alone. Especially the inclusion of the neural data seemed to have greatly improved the quality of inferences. This is a key contribution that illustrates that the sophisticated modelling of multiple sources of data at the same time, pays off in terms of the quality of inferences. Yet, it should be added here, that due to the nature of the task, the behavioral data contained only choices, and not response times, which tend to contain more information regarding the evidence accumulation process than choice alone. It would be interesting to additionally discuss how choice decision times can be modeled with the proposed modelling framework.

      A main limitation of the paper is that it does not appear to address a seemingly logical follow-up question: If these three brain regions individually accumulate evidence in distinct manners, how do these multiple brain regions then each contribute to a final choice? The joint models fit each region's data separately, so how well does each region individually 'explain' or 'predict' behavior, and how does the combined neural activity of the regions lead to manifest behavior? I would be very interested in the authors' perspectives on these questions.

      There are some remaining questions regarding the specific models used, that I was hoping the authors could clarify. Specifically, in equations 10-11, I was wondering to what extent there might be a collinearity issue. Equation 10 proposes that the firing rates of neurons can vary across time due to two mechanisms: (1) The dependence of the firing rate on the accumulated evidence, and (2) a time-varying trial average (as detailed in Equation 11). If firing rates of the neuron indeed covary with the accumulated evidence and therefore increase across time, how can the effects of mechanisms 1 and 2 be disentangled? Relatedly, the independent noise models model each neuron separately and thereby include many more parameters, each informed by less data. Is it possible that the relatively poor cross-validation of the independent noise model may be a consequence of the overfitting of the independent noise model?<br /> Another related question is how robust the parameter recovery properties of these models are under a wider range of data-generating parameter settings. I greatly appreciate the inclusion of a parameter recovery study (Figure S1C) using a single synthetic dataset, but it could be made even stronger by simulating multiple datasets with a wider range of parameter settings. Such a simulation study would help understand how robust and reliable the estimated parameters of all models are. Similarly, it would be helpful if also the \theta_{y} parameters are shown, which aren't shown in Figure S1C.

      An aspect of the paper that initially raised confusion with me is that the models fit on the choice data and stimulus information alone, make different predictions for the evidence accumulation dynamics in different regions (e.g., Figure 5A, 6A) and also led to different best-fitting parameters in different regions (Figure S9A). It took me a while to realize that this is due to the data being pooled across different rats and sessions - as such, the behavioral choice data are not the same across regions, and neither is the resulting fit models. This could easily be clarified by adding a few notes in the captions of the relevant figures.

      Combined, this manuscript represents an interesting and welcome contribution to an ongoing debate on the neural dynamics of decision-making across different brain regions. It also introduced new joint modelling techniques that can be used in the field and raised new questions on how the concurrent activity of neurons across different brain regions combined leads to behavior.

    1. Reviewer #2 (Public Review):

      Summary:

      Schmidlin & Apodaca et al. aim to distinguish mutants that resist drugs via different mechanisms by examining fitness tradeoffs across hundreds of fluconazole-resistant yeast strains. They barcoded a collection of fluconazole-resistant isolates and evolved them in different environments with a view to having relevance for evolutionary theory, medicine, and genotype-phenotype mapping.

      Strengths:

      There are multiple strengths to this paper, the first of which is pointing out how much work has gone into it; the quality of the experiments (the thought process, the data, the figures) is excellent. Here, the authors seek to induce mutations in multiple environments, which is a really large-scale task. I particularly like the attention paid to isolates with are resistant to low concentrations of FLU. So often these are overlooked in favour of those conferring MIC values >64/128 etc. What was seen is different genotype and fitness profiles. I think there's a wealth of information here that will actually be of interest to more than just the fields mentioned (evolutionary medicine/theory).

      Weaknesses:

      Not picking up low fitness lineages - which the authors discuss and provide a rationale as to why. I can completely see how this has occurred during this research, and whilst it is a shame I do not think this takes away from the findings of this paper. Maybe in the next one!

      In the abstract the authors focus on 'tradeoffs' yet in the discussion they say the purpose of the study is to see how many different mechanisms of FLU resistance may exist (lines 679-680), followed up by "We distinguish mutants that likely act via different mechanisms by identifying those with different fitness tradeoffs across 12 environments". Whilst I do see their point, and this is entirely feasible, I would like a bit more explanation around this (perhaps in the intro) to help lay-readers make this jump. The remainder of my comments on 'weaknesses' are relatively fixable, I think:

      In the introduction I struggle to see how this body of research fits in with the current literature, as the literature cited is a hodge-podge of bacterial and fungal evolution studies, which are very different! So example, the authors state "previous work suggests that mutants with different fitness tradeoffs may affect fitness through different molecular mechanisms" (lines 129-131) and then cite three papers, only one of which is a fungal research output. However, the next sentence focuses solely on literature from fungal research. Citing bacterial work as a foundation is fine, but as you're using yeast for this I think tailoring the introduction more to what is and isn't known in fungi would be more appropriate. It would also be great to then circle back around and mention monotherapy vs combination drug therapy for fungal infections as a rationale for this study. The study seems to be focused on FLU-resistant mutants, which is the first-line drug of choice, but many (yeast) infections have acquired resistance to this and combination therapy is the norm.

      Methods: Line 769 - which yeast? I haven't even seen mention of which species is being used in this study; different yeast employ different mechanisms of adaptation for resistance, so could greatly impact the results seen. This could help with some background context if the species is mentioned (although I assume S. cerevisiae). In which case, should aneuploidy be considered as a mechanism? This is mentioned briefly on line 556, but with all the sequencing data acquired this could be checked quickly?

      I think the authors could be bolder and try and link this to other (pathogenic) yeasts. What are the implications of this work on say, Candida infections?

    1. Reviewer #2 (Public Review):

      In this work, Kashefi et al. investigate the planning of sequential reaching movements and how the additional information about future reaches affects planning and execution. This study, carried out with human subjects, extends a body of research in sequential movements to ask important questions: How many future reaches can you plan in advance? And how do those future plans interact with each other?

      The authors designed several experiments to address these questions, finding that information about future targets makes reaches more efficient in both timing and path curvature. Further, with some clever target jump manipulations, the authors show that plans for a distant future reach can influence plans for a near future reach, suggesting that the planning for multiple future reaches is not independent. Lastly, the authors show that information about future targets is acquired parafoveally--that is, subjects tend to fixate mainly on the target they are about to reach to, acquiring future target information by paying attention to targets outside the fixation point.

      The study opens up exciting questions about how this kind of multi-target planning is implemented in the brain. As the authors note in the manuscript, previous work in monkeys showed that preparatory neural activity for a future reaching movement can occur simultaneously with a current reaching movement, but that study was limited to the monkey only knowing about two future targets. It would be quite interesting to see how neural activity partitions preparatory activity for a third future target, given that this study shows that the third target's planning may interact with the second target's planning.

      [Editors' note: The authors fully addressed the reviewers' comments on the original manuscript.]

    1. Reviewer #2 (Public Review):

      Summary:

      Numerous studies by the authors and other groups have demonstrated an important role for HIV gene expression kidney cells in promoting progressive chronic kidney disease, especially HIV associated nephropathy. The authors had previously demonstrated a role for protein kinase R (PKR) in a non-HIV transgenic model of kidney disease (Okamoto, Commun Bio, 2021). In this study, the authors used innovative techniques including bulk and single nuclear RNAseq to demonstrate that mice expressing a replication-incompetent HIV transgene have prominent dysregulation of mitochondrial gene expression and activation of PKR and that treatment of these mice with a small molecule PKR inhibitor ameliorated the kidney disease phenotype in HIV-transgenic mice. They also identified STAT3 as a key upstream regulator of kidney injury in this model, which is consistent with previously published studies. Other important advances include identifying the kidney cell types that express the HIV transgene and have dysregulation of cellular pathways.

      Strengths:

      Major strengths of the study include the use of a wide variety of state-of-the-art molecular techniques to generate important new data on the pathogenesis of kidney injury in this commonly used model of kidney disease and the identification of PKR as a potential druggable target for the treatment of HIV-induced kidney disease. The authors also identify a potential novel cell type within the kidney characterized by high expression of mitochondrial genes.

      Weaknesses:

      Though the HIV-transgenic model used in these studies results in a phenotype that is very similar to HIV-associated nephropathy in humans, the model has several limitations that may prevent direct translation to human disease, including the fact that mice lack several genetic factors that are important contributors to HIV and kidney pathogenesis in humans. Additional studies are therefore needed to confirm these findings in human kidney disease.

    1. Reviewer #2 (Public Review):

      Summary:

      Most polymerases and nucleases use two or three divalent metal ions in their catalytic functions. The family of His-Me nucleases, however, use only one divalent metal ion, along with a conserved histidine, to catalyze DNA hydrolysis. The mechanism has been studied previously but, according to the authors, it remained unclear. By use of time resolved X-ray crystallography, this work convincingly demonstrated that only one M2+ ion is involved in the catalysis of the His-Me I-PpoI 19 nuclease, and proposed concerted functions of the metal and the histidine.

      Strengths:

      This work performs mechanistic studies, including the number and roles of metal ion, pH dependence, and activation mechanism, all by structural analyses, coupled with some kinetics and mutagenesis. Overall, it is a highly rigorous work. This approach was first developed in Science (2016) for a DNA polymerase, in which Yang Cao was the first author. It has subsequently been applied to just 5 to 10 enzymes by different labs, mainly to clarify two versus three metal ion mechanisms. The present study is the first one to demonstrate a single metal ion mechanism by this approach.<br /> Furthermore, on the basis of the quantitative correlation between the fraction of metal ion binding and the formation of product, as well as the pH dependence, and the data from site specific mutants, the authors concluded that the functions of Mg2+ and His are a concerted process. A detailed mechanism is proposed in Figure 6.<br /> Even though there are no major surprises in the results and conclusions, the time-resolved structural approach and the overall quality of the results represent a significant step forward for the Me-His family of nucleases. In addition, since the mechanism is unique among different classes of nucleases and polymerases, the work should be of interest to readers in DNA enzymology, or even mechanistic enzymology in general.

      Weaknesses:

      Two relatively minor issues are raised here for consideration by the authors:

      p. 4, last para, lines 1-2: "we next visualized the entire reaction process by soaking I-PpoI crystals in buffer....". This is a little over-stated. The structures being observed are not reaction intermediates. They are mixtures of substrates and products in the enzyme-bound state. The progress of the reaction is limited by the progress of soaking of the metal ion. Crystallography is just been used as a tool to monitor the reaction (and provide structural information about the product). It would be more accurate to say that "we next monitored the reaction progress by soaking...."

      p. 5, beginning of the section. The authors on one hand emphasized the quantitative correlation between Mg ion density and the product density. On the other hand, they raised the uncertainty in the quantitation of Mg2+ density versus Na+ density, thus they repeated the study with Mn2+ which has distinct anomalous signals. This is a very good approach. However, still no metal ion density is shown in the key figure 2A. It will be clearer to show the progress of metal ion density in a figure (in addition to just plots), whether it is Mg or Mn.

      Revised version: The authors have properly revised the paper in response to both questions raised in the weakness section. The first issue is an important clarification for others working on similar approaches also. For the second issue, the metal ion density is nicely shown in Fig. S4 now.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript entitled "Decoupling of the Onset of Anharmonicity between a Protein and Its Surface Water around 200 K" by Zheng et al. presents a neutron scattering study trying to elucidate if at the dynamical transition temperature water and protein motions are coupled. The origin of the dynamical transition temperature has been debated for decades, specifically its relation to hydration.

      The study is rather well conducted, with a lot of effort to acquire the perdeuterated proteins, and some results are interesting.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The manuscript by Zhu et al. describes phenotypes associated with the loss of the gene ifc using a Drosophila model. The authors suggest their findings are relevant to understanding the molecular underpinnings of a neurodegenerative disorder, HLD-18, which is caused by mutations in the human ortholog of ifc, DEGS1.<br /> The work begins with the authors describing the role for ifc during fly larval brain development, demonstrating its function in regulating developmental timing, brain size, and ventral nerve cord elongation. Further mechanistic examination revealed that loss of ifc leads to depleted cellular ceramide levels as well as dihydroceramide accumulation, eventually causing defects in ER morphology and function. Importantly, the authors showed that ifc is predominantly expressed in glia and is critical for maintaining appropriate glial cell numbers and morphology. Many of the key phenotypes caused by the loss of fly ifc can be rescued by overexpression of human DEGS1 in glia, demonstrating the conserved nature of these proteins as well as the pathways they regulate. Interestingly, the authors discovered that the loss of lipid droplet formation in ifc mutant larvae within the cortex glia, presumably driving the deficits in glial wrapping around axons and subsequent neurodegeneration, potentially shedding light on mechanisms of HLD-18 and related disorders.

      Strengths:<br /> Overall, the manuscript is thorough in its analysis of ifc function and mechanism. The data images are high quality, the experiments are well controlled, and the writing is clear.

      Weaknesses:<br /> (1) The authors clearly demonstrated a reduction in number of glia in the larval brains of ifc mutant flies. What remains unclear is whether ifc loss leads to glial apoptosis or a failure for glia to proliferate during development. The authors should distinguish between these two hypotheses using apoptotic markers and cell proliferation markers in glia.

      (2) It is surprising that human DEGS1 expression in glia rescues the noted phenotypes despite the different preference for sphingoid backbone between flies and mammals. Though human DEGS1 rescued the glial phenotypes described, can animal lethality be rescued by glial expression of human DEGS1? Are there longer-term effects of loss of ifc that cannot be compensated by the overexpression of human DEGS1 in glia (age-dependent neurodegeneration, etc.)?

      (3) The mechanistic link between the loss of ifc and lipid droplet defects is missing. How do defects in ceramide metabolism alter triglyceride utilization and storage? While the author's argument that the loss of lipid droplets in larval glia will lead to defects in neuronal ensheathment, a discussion of how this is linked to ceramides needs to be added.

      (4) On page 10, the authors use the words "strong" and "weak" to describe where ifc is expressed. Since the use of T2A-GAL4 alleles in examining gene expression is unable to delineate the amount of gene expression from a locus, the terms "broad" and "sparse" labeling (or similar terms) should be used instead.

    1. Reviewer #2 (Public Review):

      Summary:

      This theoretical paper examines genetic drift in scenarios deviating from the standard Wright-Fisher model. The authors discuss Haldane's branching process model, highlighting that the variance in reproductive success equates to genetic drift. By integrating the Wright-Fisher model with the Haldane model, the authors derive theoretical results that resolve paradoxes related to effective population size.

      Strengths:

      The most significant and compelling result from this paper is perhaps that the probability of fixing a new beneficial mutation is 2s/V(K). This is an intriguing and potentially generalizable discovery that could be applied to many different study systems.

      The authors also made a lot of effort to connect theory with various real-world examples, such as genetic diversity in sex chromosomes and reproductive variance across different species.

      Weaknesses:

      One way to define effective population size is by the inverse of the coalescent rate. This is where the geometric mean of Ne comes from. If Ne is defined this way, many of the paradoxes mentioned seem to resolve naturally. If we take this approach, one could easily show that a large N population can still have a low coalescent rate depending on the reproduction model. However, the authors did not discuss Ne in light of the coalescent theory. This is surprising given that Eldon and Wakeley's 2006 paper is cited in the introduction, and the multiple mergers coalescent was introduced to explain the discrepancy between census size and effective population size, superspreaders, and reproduction variance - that said, there is no explicit discussion or introduction of the multiple mergers coalescent.

      The Wright-Fisher model is often treated as a special case of the Cannings 1974 model, which incorporates the variance in reproductive success. This model should be discussed. It is unclear to me whether the results here have to be explained by the newly introduced WFH model, or could have been explained by the existing Cannings model.

      The abstract makes it difficult to discern the main focus of the paper. It spends most of the space introducing "paradoxes".

      The standard Wright-Fisher model makes several assumptions, including hermaphroditism, non-overlapping generations, random mating, and no selection. It will be more helpful to clarify which assumptions are being violated in each tested scenario, as V(K) is often not the only assumption being violated. For example, the logistic growth model assumes no cell death at the exponential growth phase, so it also violates the assumption about non-overlapping generations.

      The theory and data regarding sex chromosomes do not align. The fact that \hat{alpha'} can be negative does not make sense. The authors claim that a negative \hat{alpha'} is equivalent to infinity, but why is that? It is also unclear how theta is defined. It seems to me that one should take the first principle approach e.g., define theta as pairwise genetic diversity, and start with deriving the expected pair-wise coalescence time under the MMC model, rather than starting with assuming theta = 4Neu. Overall, the theory in this section is not well supported by the data, and the explanation is insufficient.

    1. Reviewer #2 (Public Review):

      The study presented by Paoli et al. explores temporal aspects of neuronal encoding of odors and their perception, using bees as a general model for insects. The neuronal encoding of the presence of an odor is not a static representation; rather, its neuronal representation is partly encoded by the temporal order in which parallel olfactory pathways participate and are combined. This aspect is not novel, and its relevance in odor encoding and recognition has been discussed for more than the past 20 years.

      The temporal richness of the olfactory code and its significance have traditionally been driven by results obtained based on electrophysiological methods with temporal resolution, allowing the identification and timing of the action potentials in the different populations of neurons whose combination encodes the identity of an odor. On the other hand, optophysiological methods that enable spatial resolution and cell identification in odor coding lack the temporal resolution to appreciate the intricacies of olfactory code dynamics.

      (1) In this context, the main merit of Paoli et al.'s work is achieving an optical recording that allows for spatial registration of olfactory codes with greater temporal detail than the classical method and, at the same time, with greater sensitivity to measure inhibitions as part of the olfactory code.

      The work clearly demonstrates how the onset and offset of odor stimulation triggers a dynamic code at the level of the first interneurons of the olfactory system that changes at every moment as a natural consequence of the local inhibitory interactions within the first olfactory neuropil, the antennal lobe. This gives rise to the interesting theory that each combination of activated neurons along this temporal sequence corresponds to the perception of a different odor. The extent to which the corresponding postsynaptic layers integrate this temporal information to drive the perception of an odor, or whether this sequence is, in a sense, a journey through different perceptions, is challenging to address experimentally.

      In their work, the authors propose a computational approach and olfactory learning experiments in bees to address these questions and evaluate whether the sequence of combinations drives a sequence of different perceptions. In my view, it is a highly inspiring piece of work that still leaves several questions unanswered.

      (2) In my opinion, the detailed temporal profile of the response of projection neurons and their respective probabilities of occurrence provide valuable information for understanding odor coding at the level of neurons transferring information from the antennal lobes to the mushroom bodies. An analysis of these probabilities in each animal, rather than in the population of animals that were measured, would aid in better comprehending the encoding function of such temporal profiles. Being able to identify the involved glomeruli and understanding the extent to which the sequence of patterns and inhibitions is conserved for each odor across different animals, as it is well known for the initial excitatory burst of activity observed in previous studies without the fine temporal detail, would also be highly significant.

      In my view, the computational approach serves as a useful tool to inspire future experiments; however, it appears somewhat simplistic in tackling the complexity of the subject. One question that I believe the researchers do not address is to what extent the inhibitions recorded in the projection neurons are integrated by the Kenyon cells and are functional for generating odor-specific patterns at that level.

      Lastly, the behavioral result indicating a difference in conditioned response latency after early or delayed learning protocol is interesting. However, it does not align with the expected time for the neuronal representation that was theoretically rewarded in the delayed protocol. This final result does not support the authors' interpretation regarding the existence of a smell and an after-smell as separate percepts that can serve as conditioned stimuli.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In "Speech-induced suppression and vocal feedback sensitivity in human cortex", Ozker and colleagues use intracranial EEG to understand audiomotor feedback during speech production using a speech production and delayed auditory feedback task. The purpose of the paper is to understand where and how speaker induced suppression occurs, and whether this suppression might be related to feedback monitoring. First, they identified sites that showed auditory suppression during speech production using a single word auditory repetition task and a visual reading task, then observed whether and how these electrodes show sensitivity to auditory feedback using a DAF paradigm. The stimuli were single words played auditorily or shown visually and repeated or read aloud by the participant. Neural data were recorded from regular- and high-density grids from the left and right hemisphere. The main findings were:<br /> • Speaker induced suppression is strongest in the STG and MTG, and enhancement is generally seen in frontal/motor areas except for small regions of interest in dorsal sensorimotor cortex and IFG, which can also show suppression.<br /> • Delayed auditory feedback, even when simultaneous, induces larger response amplitudes compared to the typical auditory word repetition and visual reading tasks. The authors presume this may be due to effort and attention required to perform the DAF task.<br /> • The degree of speaker induced suppression is correlated with sensitivity to delayed auditory feedback, and is strongest for ~200 ms of delayed auditory feedback.<br /> • pSTG (behind TTS) is more strongly modulated by DAF than mid-anterior STG

      Strengths:<br /> Overall, I found the manuscript to be clear, the methodology and statistics to be solid, and the findings mostly quite robust. The large number of participants with high density coverage over both the left and right lateral hemispheres allows for a greater dissection of the topography of speaker induced suppression and changes due to audiomotor feedback. The tasks were well-designed and controlled for repetition suppression and other potential caveats.

      Weaknesses:<br /> I am happy with the changes the authors made in response to my first round of comments.

      The authors addressed my comments relating to plotting relative to the onset of articulation in Figure 1 and also addressed whether the amount of suppression varies according to more interfering delayed auditory feedback (though the correlations between sensitivity and suppression are a little noisy, they are positive). Finally, I am also satisfied with the inclusion of more group data in Figure 4.

    1. Reviewer #2 (Public Review):

      Summary:

      The study tries to connect energy metabolism with immune tolerance during bacterial infection. The mechanism details the role of pyruvate transporter expression via ERRalpha-PGC1 axis, resulting in pro-inflammatory TNF alpha signalling responsible for acquired infection tolerance.

      Strengths:

      Overall, the study is an excellent addition to the role of energy metabolism during bacterial infection. The mechanism-based approach in dissecting the roles of metabolic coactivator, transcription factor, mitochondrial transporter and pro-inflammatory cytokine during acquired tolerance towards infections indicates a detailed and well-written study. The in vivo studies in mice nicely corroborate with the cell line-based data, indicating the requirement for further studies in human infections with another bacterial model system.

      Weakness:

      Revised version doesn't have much weakness as authors have performed some of the critical experiments to answer the concerns. Moreover, authors promted that a few concerns like public data sets, etc are out of scope of this work or they will perform such experiments in future.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors investigated how neuronal activity and metrics of plasticity using local electrical stimulation in the GPi were different between Parkinson's disease and dystonia patients.

      Strengths:

      The authors achieved their aims of comparing the dynamics related to stimulation induced metrics of plasticity in GPi between dystonia and PD, which has not been previously explored. These results could directly inform DBS protocols to improve treatment. The methods are clearly described and results are strong with measurements from a large population of patients for each disease group, and with distinct findings for each group. These results also may help provide insight as to the differences in terms of dynamics of therapeutic stimulation effects in the different disease groups.

      Weaknesses:

      After the revisions, the discussion contains many more details and comparisons to relevant literature, which will be helpful for readers to appreciate the importance of the results. The conclusion could have been strengthened as well, as it seems to be a very general summary of their findings without consideration of their clinical implications and importance. However, this may be a minor issue.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The work by Klaassen & Rasch investigates the influence of word learning difficulty on sleep-associated consolidation and reactivation. They elicited reactivation during sleep by applying targeted memory reactivation (TMR) and manipulated word learning difficulty by creating words more similar (easy) or more dissimilar (difficult) to our language.<br /> In one group of participants, they applied TMR of easy words and in another group of participants, they applied TMR of difficult words (between-subjects design).<br /> They showed that TMR leads to higher memory benefits in the easy compared to the difficult word group. On a neural level, they showed an increase in spindle power (in the up-state of an evoked response) when easy words were presented during sleep.

      Strengths:<br /> The authors investigate a research question relevant to the field, that is, which experiences are actually consolidated during sleep. To address this question, they developed an innovative task and manipulated difficulty in an elegant way.

      Overall, the paper is clearly structured, results and methods are described in an understandable way. The analyses approach is solid.

      Weaknesses:<br /> (1) Sample size<br /> For a between-subjects design, the sample size is too small (N = 22). The main finding (also found in the title "Difficulty in artificial word learning impacts targeted memory reactivation") is based on an independent samples t-test with 11 participants/group.<br /> The authors explicitly mention the small sample size and the between-subjects design as a limitation in their discussion. Nevertheless, making meaningful inferences based on studies with such a small sample size is difficult.

      (2) Choice of task<br /> Even though the task itself is innovative, there would have been tasks better suited to address the research question. The main disadvantage the task and the operationalisation of memory performance (d') have is that single-trial performance cannot be calculated. Consequently, choosing individual items for TMR is not possible.<br /> Additionally, TMR of low vs. high difficulty is conducted between subjects (and independently of pre-sleep memory performance) which is a consequence of the task design.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper reports that mechanical stress from egg accumulation is a biological stimulus that drives the formation of extruded vesicles from the neurons of C. elegans ALMR touch neurons. Using powerful genetic experiments only readily available in the C. elegans system, the authors manipulate oocyte production, fertilization, embryo accumulation, and egg-laying behavior, providing convincing evidence that exopher production is driven by stretch-dependent feedback of fertilized, intact eggs in the adult uterus. Shifting the timing of egg production and egg laying alters the onset of observed exophers. Pharmacological manipulation of egg laying has the predicted effects, with animals retaining fewer eggs having fewer exophers and animals with increased egg accumulation having more. The authors show that egg production and accumulation have dramatic consequences to the viscera, and moving the ALMR process away from eggs prevents the formation of exophers. This effect is not unique to ALMR but is also observed in other touch neurons, with a clear bias toward neurons whose cell bodies are adjacent to the filled uterus. Embryos lacking an intact eggshell with reduced rigidity have impaired exopher production. Acute injection into the uterus to mimic the stretch that accompanies egg production causes a similar induction of exopher release. Together these results are consistent with a model where stretch caused by fertilized embryo accumulation, and not chemical signals from the eggs themselves or egg release, underlies ALMR exopher production seen in adult animals.

      Strengths:

      Overall, the experiments are very convincing, using a battery of RNAi and mutant approaches to distinguish direct from indirect effects. Indeed, these experiments provide a model generally for how one would methodically test different models for exopher production. The source and factors influencing exopher production had previously been unclear. This study addresses how and when they form in the animal using physiologically meaningful manipulations. The stage is now set to address at a cellular level how exophers like these are made and what their functions are.

      Weaknesses:

      Not many. The experiments are about as good as could be done. Some of the n's on the more difficult to work strains or experiments are comparatively low, but this is not a significant concern because the number of different, complementary approaches used. The microinjection experiment is very interesting, and the authors have added additional details on how these experiments were conducted in the revised manuscript. The authors have now included data from strains bearing a single-copy transgene that expresses mKate2 in the same neurons, showing that induced egg accumulation drives a similar degree of exopher production. This indicates that exposers seen are generated in response to specific biological conditions and not merely an artifact of mCherry protein over-expression.

    1. Reviewer #2 (Public Review):

      Kwon et al. used several conditional KO mice for the deletion of ric8a or app in different cell types. Some of them exhibited pial basement membrane breaches leading to neuronal ectopia in the neocortex.

      They first investigated ric8a, a Guanine Nucleotide Exchange Factor for Heterotrimeric G Proteins. They observed the above-mentioned phenotype when ric8a is deleted from microglia and neural cells (ric8a-emx1-cre or dual deletion with cre combination cx3cr1 (in microglia) and nestin (in neural cells)) but not in microglia alone or neural cells alone (whether it is in CR cells (ric8a-Wnt3a-cre), post-mitotic neurons (nex-cre or dlx5/6-cre), or in progenitors and their progeny (nestin-cre or foxg1-cre). They also show that ric8a KO mutant microglia cells stimulated in vitro by LPS exhibit an increased TNFa, IL6 and IL1b secretion compared to controls (Fig 2). They therefore injected LPS in vivo and observed the neuronal ectopia phenotype in the ric8a-cx3cr1-cre (microglial deletion) cortices at P0 (Fig 2). They suggest that ric8a KO in neuronal cells mimics immune stimulation (but we have no clue how ric8a KO in neural cells would induce immune stimulation).

      The authors then turned their attention on APP. They observed neuronal ectopia into the marginal zone when APP is deleted in microglia (app-cxcr3-cre) + intraperitoneal LPS injection (they did not show it, but we have to assume there would not be a phenotype without the injection of LPS) (Fig 3). (The phenotype is similar but not identical to ric8a-cx3cr1-cre + LPS. They suggest that the reason is because they had to inject 3 times less LPS due to enhanced immune sensitivity in this genetic background but it is only a hypothesis). After in vitro stimulation by LPS, app mutant microglia show a reduced secretion of TNFa and IL6 but not IL1b (this is the opposite to ric8a-cx3cr1-cre microglia cells) while peritoneal macrophages in culture show increased secretion of TNFa, IL1, IL6 and IL23 (fig 3 and Suppl. Fig 9).

      Amyloid beta (Ab) being one of the molecules binding to APP, the authors showed that Ab40 monomers (they did not test Ab40 oligomers) partially inhibit cytokines (TNFa, IL6, IL1b, MCP-1, IL23a, IL10) secretion in vitro by microglia stimulated by LPS but does not affect secretion by microglia from app-cx3cr1-cre (tested for TNFa, IL6, IL1b, IL23a, IL10) (Fig 4, Suppl fig 10) (but still does it in aplp2-cx3cr1-cre) and does not affect secretion by ric8a-cx3cr1-cre microglia (tested for TNFa and IL6 but still suppress IL1b) (Therefore here is another difference between app and ric8a KO microglia).

      The authors injected inhibitors of Akt or Stat3 in the ric8a-emx1-cre cortex and found it suppressed neuronal ectopia (Fig 5, Suppl fig 11). It is not clear whether it suppresses immune stimulation from neuronal cells or immune reaction from microglia cells.

      Finally, the authors examined the activities of MMP2 and MMP9 in the developing cortex using gelatin gel zymography. The activity and protein levels of MMP9 but not MMP2 in the ric8a-emx1-cre cortex were claimed significantly increased (Fig 5, Suppl fig 12). Unfortunately, they did not show it in the app-cx3cr1-cre +LPS mouse. They make a connection between ric8a deletion and MMP9 but unfortunately do not make the connection between app deletion and MMP9, which is at the center of the pathway claimed to be important here). Then they injected BB94, a broad-spectrum inhibitor of MMPs or an inhibitor specific for MMP9 and 13. They both significantly suppress the number and the size of the ectopia in ric8a mutants (Fig5).

      After reading the manuscript, I still do not know how ric8a in neural cells is involved in the immune inhibition. Is it through the control of Ab monomers? In addition, the authors did not show in vivo data supporting that Ab monomers are the key players here. As the authors said, this is not the only APP interactor. Finally, I still do not know how ric8a is linked to APP in microglia in the model.

      While several of the findings presented in this manuscript are of potential interest, there are a number of shortcomings. Here are some suggestions that could improve the manuscript and help substantiate the conclusions:

      (1) As the title suggests it, the focus is on Ab and APP functions in microglia. However, the analysis is more focused on ric8a. The connection between ric8a and APP in this study is not investigated, besides the fact that their deletion induces somewhat similar but not identical phenotypes. Showing a similar phenotype is not enough to conclude that they are working on the same pathway. The authors should find a way to make that connection between ric8a and app in the cells investigated here.

      (2) This would help to show the appearance of breaches in the pial basement membrane leading to neuronal ectopia; to investigate laminin debris, cell identity, Wnt pathway for app-cxcr3-cre + LPS injection as you did for ric8a-emx1-cre.

      (3) As a control, this would help to show that app-cxcr3-cre without the LPS injection does not display the phenotype.

      (4) This would help to show the activity and protein levels of MMP9 and MMP2 and perform the rescue experiments with the inhibitors in the app-cx3cr1-cre cortex +LPS.

      (5) Is MMP9 secreted by microglia cells or neural cells?

      (6) The in vitro evidence indicates that one of the multiple APP interactors, ie Ab40 monomers, is less effective in suppressing the expression of some cytokines by microglia cells mutants for ric8a (TNFa and IL6 but still suppress IL1b) or APP (TNFa, IL6, IL1b, IL23a, IL10) when compared to WT. But there are other interactors for APP. In order to support the claim, it seems crucial to have in vivo data to show that Ab40 monomers are the molecules involved in preventing the breach in the pial basement membrane.

      (7) In order to claim that this is specific to Ab40 monomers and not oligomers, it is necessary to show that the Ab40 oligomers do not have the same effect in vitro and in vivo. Also, an assay should be done to show that your Ab preparations are pure monomers or oligomers.

      (8) Most of the cytokine secretion assays used microglia cells in culture. Two results draw my attention. Ric8a deletion increases TNFa and IL6 secretion after LPS stimulation in vitro on microglia cells while app deletion decreases their secretion. Then later, papers show that the decrease in IL1b induced by Ab on microglia cells is prevented by APP deletion but not ric8a deletion. Those two pieces of data suggest that ric8a and APP might not be in the same pathway. In addition, the phenotype from app-cxcr3-cre + LPS injection and ric8a-cxcr3-cre + LPS injection are not exactly the same. It could be due to the level of LPS as the author suggests or it might not be. More experiments are needed to prove they are in the same pathway.

      (9) How do the authors reconcile the reduced TNFa and IL6 secretion upon stimulation of app mutant microglia with the model where app is attenuating immune response in vivo? Line 213 says that microglia exhibit attenuated immune response following chronic stimulation but I don't know if 3 hours of LPS in vitro is a chronic stimulation.

      (10) Line 119: In their model, the authors suggest that there is a breach in pial basement membrane but that the phenotype is different from the retraction of the radial fibers due to reduced adhesion. So, could the author discuss to what substrate the radial fibers are attached to, in their model where the pial surface is destroyed?

      (11) The authors should show that the increased cytokine secretion observed in vitro is also happening in vivo in ric8a-emx1-cre compared to WT mice and compared to ric8a-nestin-cre mice. Or when app is deleted in microglia (app-cxcr3-cre) + LPS injection compared to WT mice +LPS.

      (12) The authors injected inhibitors of Akt or Stat3 in the ric8a-emx1-cre cortex and found that it suppressed neuronal ectopia (Fig 5, Suppl fig 11). Does it suppress immune stimulation from neuronal cells or immune reaction from microglia cells?

      (13) Fig 5 and Supplementary fig 12: Please show a tubulin loading control in Fig 5i as you did in suppl fig 12 d (gel zymography). Please provide a gel zymography showing side by side Control, mutant and mutant +DM/S3I treatment. The same request for the MMP9 staining. Please provide statistics for control vs mutant for suppl fig 12c and d.

      (14) Please provide the name and the source of the MMP9/13 inhibitor used in this study.

      (15) The results show that deletion of ric8a in microglia and neural cells induced pia membrane breaches but no phenotype is apparent in ric8a deletion in microglia or neural cells alone. Then, the results showed that intraperitoneal injection of LPS induced the phenotype in ric8a-cxcr3-cre mutants. It would be beneficial as a control supporting the model to show that the insult induced by LPS injection does not induce the phenotype in the ric8a-foxg1-cre mice.

    1. Reviewer #2 (Public Review):

      Summary: This manuscript describes the creation and curation of a collection of genetic driver lines that specifically label small numbers of neurons, often just a single to handful of cell types, in the central nervous system of the fruit fly, Drosophila melanogaster. The authors screened over 77,000 split hemidriver combinations to yield a collection of 3060 lines targeting a range of cell types in the adult Drosophila central nervous system and 1373 lines characterized in third-instar larvae. These genetic driver lines have already contributed to several important publications and will no doubt continue to do so. It is a truly valuable resource that represents the cooperation of several labs throughout the Drosophila community.

      Strengths:<br /> The authors have thoughtfully curated and documented the lines that they have created, so that they may be maximally useful to the greater community. This documentation includes confocal images of neurons labeled by each driver line and when possible, a list of cell types labeled by the genetic driver line and their identity in an EM connectome dataset. The authors have also made available some information from the other lines they created and tested but deemed not specific or strong enough to be included as part of the collection. This additional resource will be a valuable aid for those seeking to label cell types that may not be included in the main collection.

      Weaknesses:<br /> None, this is a valuable set of tools that took many years of effort by several labs. This collection will continue to facilitate important science for years to come.

    1. Reviewer #2 (Public Review):

      Rodent studies of claustrum are complicated by the tube-like shape of this nucleus. As such, judicious viral strategies alone or in combination with existing Cre driver lines (Egr2, Gnb4, Slc17a6, and Tbx21) represent the current gold standard for claustrum structure and function investigation. Any improvement in tools that would allow better genetic access to the claustrum are always desired, as with any nucleus in brain. This paper describes the expression pattern of the gene Smim32 and characterization of new mouse transgenic lines expressing Cre/Flp recombinase driven by the Smim32 promoter. The authors should be applauded for the work to develop these new tools presented in the study. Overall, the strengths of the paper lie in the development of new mouse lines that are well-characterized in comparison to other molecular markers of the claustrum. Weaknesses lie in poor anatomical definitions of the claustrum (and endopiriform nucleus). Smim32 expression is used to define claustrum anatomical boundaries, rather than first using several structural, molecular, and connectivity lines of evidence to define the claustrum anatomically and then to assess whether Smim32 expression fits within this anatomical definition. Another major weakness is the fact that Cre/Flp expression driven by the Smim32 promoter is present in non-claustrum regions, including the neighboring cortex, striatum, and endopiriform nucleus as well as the more distant thalamic reticular nucleus. Despite this, the conclusion of the study, as communicated by the authors, is that selective interrogation of the claustrum is now possible with these Smim32-based tools. Therefore, the data do not support the claims and conclusions.

      Very concerning is problematic language in the abstract and introduction sections that diminish the impact of several published studies (not cited) that have led to important findings regarding claustrum function. The authors Create an argument that all the research performed thus far on the claustrum is unreliable because targeting the structure has been sub-optimal. This is definitely not the case for several studies from multiple labs. If investigators new to the claustrum were to read this paper, they would conclude that all previous data hold little-to-no value and that using these tools set forth the possibility, at long last, to solve claustrum structural and functional queries. Here is an example from the abstract of the problematic language: "However, research on the CLA has been challenging due to difficulties in specifically and comprehensively targeting its neuronal populations. In various cases, this limitation has led to inconsistent findings and a lack of reliable data." (no references cited). Since Smim32 driven recombinase (in 61 or 62lrod) is not exclusively expressed in the claustrum, it is not clear how Smim32 is an advantage over possible Nr4a2 or, the more selective, GNB4 Cre driver lines. Taken together, the goal of the study as articulated in the Introduction: "Our goal was here to generate genetic tools capable of targeting the majority of mouse CLA projection neurons without affecting other brain cell populations, or tissues outside the brain" has not been met and, therefore, the conclusion of the study based on the data "With these genetic tools in hand, the comprehensive targeting and functional probing of the densely connected CLA is now possible" is unfortunately also unmet.

      The manuscript does convincingly show that Smim32 targets excitatory neurons in the claustrum as evidenced by exclusive overlap of Smim32 expression with Vglut2 and not GAD (fig 1 and suppl fig 1). Additionally, the manuscript provides sufficient evidence that neurons in the claustrum area expressing Smim32 further co-express a number of other molecular markers of claustrum, including Nr4a2 (fig1), Lxn, Gnb4, and Oprk1 (fig 2), and Slc17a6 (suppl fig 1). The authors further show that Smim32 is not co-expressed with molecular markers of layer VI cortex like Ctgf and Rprm (fig 2). However, by limiting the line of evidence to molecular expression, the study fails to escape the limitations of molecular markers, which cannot by themselves be used to define the anatomical boundary of the claustrum. The expression of several of these markers in the neighboring endopiriform nucleus, including Smim32, is evidence that using molecular markers as a sole indicator of the anatomy of the claustrum is not warranted.

      While the anatomical boundaries of the claustrum remain somewhat debated, several standards have emerged to delineate claustrum boundaries. These include immunoreactivity against Gng2 (or PV, especially in rat) to indicate claustrum or against Crym to counter-indicate claustrum. In addition, injection of retrograde tracers into the anterior cingulate cortex or retrosplenial cortex, for example, results in selective targeting of (large) subpopulations of claustrum neurons that help define claustrum location. Further targeting of neurons projecting to the anterior insula or thalamus has been used to delineate the boundaries of what some consider the claustrum shell and others consider the deep layers of the insula. The use of any of these approaches to delineate the claustrum anatomy should be used to describe the spatial distribution of Smim32 and Cre or FlpO in the transgenic lines.

      The manuscript provides a description of Smim32 promoter-driven tdTomato in the three transgenic Cre lines during development. This shows strong expression in claustrum and not in surrounding regions. However, as the claustrum borders are not distinct without markers, the anatomical boundary of claustrum for this analysis is deemed arbitrary - an issue that is exacerbated when looking at the developing brain where atlases are less precise and boundaries of the claustrum are ill-defined.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors previously demonstrated that anterior-located a-Wave neurons (neuromeres A1-A3) extend axons anteriorly to connect to circuits inducing backward locomotion, while p-Wave axon (neuromeres A4-A7) project posteriorly to promote forward locomotion in Drosophila larvae. In the manuscript, the authors aim to determine the molecular mechanisms involved in wiring the segmentally homologous Wave neurons distinctively and thus are functionally different in modulating forward or backward locomotion. The genetic screen focused on Wnt/Fz-signaling due to its known anterior-to-posterior guidance roles in mammals and nematodes.

      Strengths:

      Knock-down (KD) DFz2 with two independent RNAi-lines caused ectopic posterior axon and dendrite extension for all a- and p-Wave neurons, with a-Wave axon extending into regions where p-Wave axons normally project. Both behavioral assays (optogenetic stimulation of all Wave neurons or tactile stimuli on heads using a von Frey filament) show that backward movement is reduced or absent and that the speed of evoked fast-forward locomotion is increased. This demonstrates that altered projections of Wave do alter behavior and the DFz2 KD phenotype is consistent with the potential aberrant wiring of a-Wave neurons to forward locomotion-promoting circuits instead of to backward locomotion-promoting circuits.

      The main conclusion, that Wnt/Fz-signaling is essential for the guidance of Wave neurons and in diversifying their protection pattern in a segment-specific manner, is further supported by the results showing that DFz2 gain of function causes shortening of a-Wave but not p-Wave axon extensions towards the posterior end and that KD of DFz4 causes axonal shortening only in A6-p-Wave neurons but does not affect dendrites or processes of other Wave neurons. A role for ligand Wnt4 is demonstrated by results indicating that WNT4 mutants' posterior extension of a-Wave axons was elongated similar to DFz2 KD animals and p-Wave axon extension towards the posterior end was shortened similar to DFz2 KD animals. Finally, a DWnt4 gradient decreasing from the posterior (A8) to the anterior end (A2), similar to that described in other species, is supported by analyses of DWnt4 gene expression (using Wnt4 Trojan-Gal4) and protein expression (using antibodies). In contrast, DFz2 receptor levels seemed to decrease from the anterior (A2) to the posterior end (A5/6). Together the results support the conclusion that opposing Wnt/Fz ligand-receptor gradients contribute to the diversification of Wave neurons in a location-dependent manner and that DFz2 and DFz4 have opposing effects on axon extension.

      Weaknesses:

      Wave axon and dendrite projections are not exclusively determined by Wnt4, DFz2, and DFz4, and are likely to involve other Fz receptors, Wt ligands, and other types of receptor-ligand signaling pathways. This is in part supported by the fact that Wnt4 loss of function also resulted in phenotypes that do not mimic DFz2 KD or DFz4 KD (Figures 3D, E, and F) and that other Fz/Wnt mutants caused wave neuron phenotypes (Figure 1-supplement 2, D+E). This is not a weakness per se, since it doesn't affect the main conclusion of the manuscript. However, the description and analyses of the data in particular for Figure 1-supplement 2 D should be clarified in the legend. The number within the bars and the asterisks are not defined. It's presumed they refer to numbers of animals assessed and the asterisk next to DFz2 and DFz4 indicate statistically significant differences. However, only one p-value is provided in the legend. It is also unclear if p-values for the other mutants have not been determined or are non-significant. At least for mutants like Corin, which also exhibit altered axon projections, the p-values should be provided.

      Figure 4 D, F. The gradient for Wnt4 was determined by comparison of expression levels of other segments to A8 but the gradient for DFz2 was by comparison to A2 and the data supports opposing gradients. However, for DFz2 (Figure 4, F) it seems that the gradient is bi-directional with the lowest being in A5 and increasing towards A2 as well as A8. Analysis should be performed in reference to A8 as well to determine if it is indeed bi-directional. While such a finding would not affect the interpretation of a-Wave neurons, it may impact conclusions about p-Wave neuron projections.

      As discussed above, the DFz2 KD phenotypes are consistent with the potential aberrant wiring of a-Wave neurons to forward locomotion-promoting circuits instead of to backward locomotion-promoting circuits. However, since the axon and dendrites of a-Wave and p-Wave are affected the actual dendritic and axonal contributions for the altered behavior remain elusive. The authors certainly considered a potential contribution of altered dendrite projection of a-Wave neurons to the phenotype and their conclusion that altered axonal projections are involved is supported by the optogenetic experiment "bypassing" sensory input (albeit it seems unlikely that all Wave neurons are activated simultaneously when perceiving natural stimuli). However, the author should also consider that altered perception and projection of p-Wave neuron may directly (e.g. extended P-wave axon projections increase forward locomotion input thereby overriding backward locomotion) or indirectly (e.g. feedback loops between forward and backward circuits) contribute to the altered behavioral phenotypes in both assays. It is probably noteworthy that the more complex behavioral alterations observed with mechanical stimulation are likely to also be caused by altered dendritic projections.

      Presynaptic varicosities of a-Wave neurons in DFz2 KD animals are indicated by orange arrows in Figure 1. However, no presynaptic markers have been used to confirm actual ectopic synaptic connections. At least the authors should more clearly define what parameters they used to "visually" define potential presynaptic varicosities. Some arrows seem to point to more "globular structures" but for several others, it's unclear what they are pointing at.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript examines the role of the dopamine receptor, Dop1R2, in memory formation. This receptor has complex roles in supporting different stages of memory, and the neural mechanisms for these functions are poorly understood. The authors are able to localize Dop1R2 function to the vertical lobes of the mushroom body, revealing a role in later (presumably middle-term) aversive and appetitive memory. In general, the experimental design is rigorous, and statistics are appropriately applied. While the manuscript provides a useful tool, it would be strengthened further by additional mechanistic studies that build on the rich literature examining the roles of dopamine signaling in memory formation. The claim that Dop1R2 is involved in memory formation is strongly supported by the data presented, and this manuscript adds to a growing literature revealing that dopamine is a critical regulator of olfactory memory. However, the manuscript does not necessarily extend much beyond our understanding of Dop1R2 in memory formation, and future work will be needed to fully characterize this reagent and define the role of Dop1R2 in memory.

      Strengths:

      (1) The FRT lines generated provide a novel tool for temporal and spatially precise manipulation of Dop1R2 function. This tool will be valuable to study the role of Dop1R2 in memory and other behaviors potentially regulated by this gene.

      (2) Given the highly conserved role of Dop1R2 in memory and other processes, these findings have a high potential to translate to vertebrate species.

      Weaknesses:

      (1) The authors state Dop1R2 associates with two different G-proteins. It would be useful to know which one is mediating the loss of aversive and appetitive memory in Dop1R2 knockout flies.

      (2) It would be interesting to examine 24hr aversive memory, in addition to 24hr appetitive memory.

      (3) The manuscript would be strengthened by added functional analysis. What are the DANs that signal through Dop1R. How do these knockouts impact MBONs?

      (4) Also in Figure 2, the lobe-specific knockouts might be moved to supplemental since there is no effect. Instead, consider moving the control sensory tests into the main figure.

      (5) Can the single-cell atlas data be used to narrow down the cell types in the vertical lobes that express Dop1R2? Is it all or just a subset?

    1. Reviewer #2 (Public Review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, they provide convincing evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing valuable guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. I have some suggestions on how to improve the clarity and completeness of the paper.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. (I have some suggestions for how the authors could push this understanding further.) It is not easy to find the right balance between biologically detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      Weaknesses:

      (1) The fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state. I think the authors should have emphasized this limitation more strongly and possibly included some additional analyses to show that their conclusions extend to the chaotic dynamical regimes in which cortical circuits often live.

      (2) The authors could have discussed -- even somewhat speculatively -- how SST interneurons fit into this picture. Their absence from this modelling framework stands out as a missed opportunity.

      (3) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important consideration.

    1. Reviewer #2 (Public Review):

      Summary:

      This study, based on their previous findings that TFH cells can be converted into TR1 cells, conducted a highly detailed and comprehensive epigenetic investigation to answer whether TR1 differentiation from TFH is driven by epigenetic changes. Their evidence indicated that the downregulation of TFH-related genes during the TFH to TR1 transition depends on chromatin closure, while the upregulation of TR1-related genes does not depend on epigenetic changes.

      Strengths:

      A significant advantage of their approach lies in its detailed and comprehensive assessment of epigenetics. Their analysis of epigenetics covers chromatin open regions, histone modifications, DNA methylation, and using both single-cell and bulk techniques to validate their findings. As for their results, observations from different epigenetic perspectives mutually supported each other, lending greater credibility to their conclusions. This study effectively demonstrates that (1) the TFH-to-TR1 differentiation process is associated with massive closure of OCRs, and (2) the TR1-poised epigenome of TFH cells is a key enabler of this transdifferentiation process. Considering the extensive changes in epigenetic patterns involved in other CD4+ T lineage commitment processes, the similarity between TFH and TR1 in their epigenetics is intriguing.

      They performed correlation analysis to answer the association between "pMHC-NP-induced epigenetic change" and "gene expression change in TR1". Also, they have made their raw data publicly available, providing a comprehensive epigenomic database of pMHC-NP-induced TR1 cells. This will serve as a valuable reference for future research.

      Weaknesses:

      A major limitation is that this study heavily relies on a premise from the previous studies performed by the same group on pMHC-NP-induced T-cell responses. This significantly limits the relevance of their conclusion to a broader perspective. Specifically, differential OCRs between Tet+ and naïve T cells were limited to only 821, as compared to 10,919 differential OCRs between KLH-TFH and naïve T cells (Figure 2A), indicating that the precursors and T cell clonotypes that responded to pMHC-NP were extremely limited. This limitation should be clearly discussed in the Discussion section.

      This article uses peak calling to determine whether a region has histone modifications, claiming that the regions with histone modifications in TFH and TR1 are highly similar. However, they did not discuss the differences in histone modification intensities measured by ChIP-seq. For example, as shown in Figure 6C, IL10 H3K27ac modification in Tet+ cells showed significantly higher intensity than KLH-TFH, while in this article, it may be categorized as "possessing same histone modification region". This will strengthen their conclusions.

      Last, the key findings of this study are clear and convincing, but some results and figures are unnecessary and redundant. Some results are largely a mere confirmation of the relationship between histone marks and chromatin status. I propose to reduce the number of figures and text that are largely confirmatory. Overall, I feel this paper is too long for its current contents.

    1. Reviewer #3 (Public Review):

      (1) Throughout the manuscript, hMT+ connectivity with the frontal cortex has been treated as an a priori hypothesis/space. However, there is no such motivation or background literature mentioned in the Introduction. Can the authors clarify the necessity of functional connectivity? In other words, can BOLD activity of hMT+ in the localizer task substitute for functional connectivity between hMT+ and the frontal cortex?

      (2) There is an obvious mismatch between the in-text description and the content of the figure:

      "In contrast, there was no correlation between BDT and GABA levels in V1 voxels (figure supplement 1a). Further, we show that SI significantly correlates with GABA levels in hMT+ voxels (r = 0.44, P = 0.01, n = 31, Figure 3d). In contrast, no significant correlation between SI and GABA concentrations in V1 voxels was observed (figure supplement 1b)."

      (3) The authors' response to my previous round of review indicated that the "V1 ROIs" covered a substantial amount of V3 (32%). Therefore, it would no longer be appropriate to call these "V1 ROIs". I'd suggest renaming them as "Early Visual Cortex (EVC) ROIs" to be more accurate. Can the authors justify why choosing the left hemisphere for visual intelligence task, which is typically believed to be right lateralized?

      (4) "Small threshold" and "large threshold" are neither standard descriptions, and it is unclear what "small threshold" refers to in the following figure caption. Additionally, the unit (ms) is confusing. Does it refer to timing?

      "(f) Peason's correlation showing significant negative correlations between BDT and small threshold."

      (5) In the response letter, the authors mentioned incorporating the neural efficiency hypothesis in the Introduction, but the revised Introduction does not contain such information.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript uses cell lines representative of germ line cells, somatic cells and pluripotent cells to address the question of how the endocrine disrupting compound BPS affects these various cells with respect to gene expression and DNA methylation. They find a relationship between the presence of estrogen receptor gene expression and the number of DNA methylation and gene expression changes. Notably, PGCLCs do not express estrogen receptors and although they do have fewer changes, changes are nevertheless detected, suggesting a nonconical pathway for BPS-induced perturbations. Additionally, there was a significant increase in the occurrence of BPS-induced epimutations near EREs in somatic and pluripotent cell types compared to germ cells. Epimutations in the somatic and pluripotent cell types were predominantly in enhancer regions whereas that in the germ cell type was predominantly in gene promoters.

      Strengths:

      The strengths of the paper include the use of various cell types to address sensitivity of the lineages to BPS as well as the observed relationship between the presence of estrogen receptors and changes in gene expression and DNA methylation.

      Weaknesses:

      The weakness, which has been addressed by the authors, includes the fact that exposures are more complicated in a whole organism than in an isolated cell line.

    1. Reviewer #2 (Public Review):

      Summary:

      Kan et al. present the discovery of oxydifficidin as a potential antimicrobial against N. gonorrhoeae, including multi-drug resistant strains. The authors show the role of DedA flippase-assisted uptake and the specificity of RplL in the mechanism of action for oxydifficidin. This novel mode of action could potentially offer a new therapeutic avenue, providing a critical addition to the limited arsenal of antibiotics effective against gonorrhea.

      Strengths:

      This study underscores the potential of revisiting natural products for antibiotic discovery of modern-day-concerning pathogens and highlights a new target mechanism that could inform future drug development. Indeed there is a recent growing body of research utilising AI and predictive computational informatics to revisit potential antimicrobial agents and metabolites from cultured bacterial species. The discovery of oxydifficidin interaction with RplL and its DedA-assisted uptake mechanism opens new research directions in understanding and combating antibiotic-resistant N. gonorrhoeae. Methodologically, the study is rigorous employing various experimental techniques such as genome sequencing, bioassay-guided fractionation, LCMS, NMR, and Tn-mutagenesis.

      Weaknesses:

      The scope is somewhat narrow, focusing primarily on N. gonorrhoeae. This limits the generalizability of the findings and leaves questions about its broader antibacterial spectrum. Moreover, while the study demonstrates the in vitro effectiveness of oxydifficidin, there is a lack of in vivo validation (i.e., animal models) for assessing pre-clinical potential of oxydifficidin. Potential SNPs within dedA or RplL raise concerns about how quickly resistance could emerge in clinical settings.

    1. Reviewer #2 (Public Review):

      Summary:

      Directional migration is an integral aspect of sprouting angiogenesis and requires a cell to change its shape and sense a chemotactic or growth factor stimulus. Kondrychyn I. et al. provide data that indicate a requirement for zebrafish aquaporins 1 and 8, in cellular water inflow and sprouting angiogenesis. Zebrafish mutants lacking aqp1a.1 and aqp8a.1 have significantly lower tip cell volume and migration velocity, which delays vascular development. Inhibition of actin formation and filopodia dynamics further aggravates this phenotype. The link between water inflow, hydrostatic pressure, and actin dynamics driving endothelial cell sprouting and migration during angiogenesis is highly novel.

      Strengths:

      The zebrafish genetics, microscopy imaging, and measurements performed are of very high quality. The study data and interpretations are very well-presented in this manuscript.

      Weaknesses:

      Some of the findings and interpretations could be strengthened by additional measurements and further discussion. Also, a better comparison and integration of the authors' findings, with other previously published findings in mice and zebrafish would strengthen the paper.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors used 2-photon Ca2+-imaging to study the activity of ventral tegmental area (VTA) and locus coeruleus (LC) axons in the CA1 region of the dorsal hippocampus in head-fixed male mice moving on linear paths in virtual reality (VR) environments.

      The main findings were as follows:<br /> - In a familiar environment, activity of both VTA axons and LC axons increased with the mice's running speed on the Styrofoam wheel, with which they could move along a linear track through a VR environment.<br /> - VTA, but not LC, axons showed marked reward position-related activity, showing a ramping-up of activity when mice approached a learned reward position.<br /> - In contrast, activity of LC axons ramped up before initiation of movement on the Styrofoam wheel.<br /> - In addition, exposure to a novel VR environment increased LC axon activity, but not VTA axon activity.

      Overall, the study shows that the activity of catecholaminergic axons from VTA and LC to dorsal hippocampal CA1 can partly reflect distinct environmental, behavioral and cognitive factors. Whereas both VTA and LC activity reflected running speed, VTA, but not LC axon activity reflected the approach of a learned reward and LC, but not VTA, axon activity reflected initiation of running and novelty of the VR environment.

      I have no specific expertise with respect to 2-photon imaging, so cannot evaluate the validity of the specific methods used to collect and analyse 2-photon calcium imaging data of axonal activity.

      Strengths:

      (1) Using a state-of-the-art approach to record separately the activity of VTA and LC axons with high temporal resolution in awake mice moving through virtual environments, the authors provide convincing evidence that activity of VTA and LC axons projecting to dorsal CA1 reflect partly distinct environmental, behavioral and cognitive factors.

      (2) The study will help a) to interpret previous findings on how hippocampal dopamine and norepinephrine or selective manipulations of hippocampal LC or VTA inputs modulate behavior and b) to generate specific hypotheses on the impact of selective manipulations of hippocampal LC or VTA inputs on behavior.

      Weaknesses:

      (1) The findings are correlational and do not allow strong conclusions on how VTA or LC inputs to dorsal CA1 affect cognition and behavior. However, as indicated above under Strengths, the findings will aid the interpretation of previous findings and help to generate new hypotheses as to how VTA or LC inputs to dorsal CA1 affect distinct cognitive and behavioral functions.

      (2) Some aspects of the methodology would benefit from clarification.<br /> First, to help others to better scrutinize, evaluate and potentially to reproduce the research, the authors may wish to check if their reporting follows the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines for the full and transparent reporting of research involving animals (https://arriveguidelines.org/). For example, I think it would be important to include a sample size justification (e.g., based on previous studies, considerations of statistical power, practical considerations or a combination of these factors). The authors should also include the provenance of the mice. Moreover, although I am not an expert in 2-photon imaging, I think it would be useful to provide a clearer description of exclusion criteria for imaging data (see below, Recommendations for the authors).<br /> Second, why were different linear tracks used for studies of VTA and LC axon activity (from line 362)? Could this potentially contribute to the partly distinct activity correlates that were found for VTA and LC axons?<br /> Third, the authors seem to have used two different criteria for defining immobility. Immobility was defined as moving at <5 cm/s for the behavioral analysis in Fig. 3a, but as <0.2 cm/s for the imaging data analysis in Fig. 4 (see legends to these figures and also see Methods, from line 447, line 469, line 498)? I do not understand why, and it would be good if the authors explained this.

      (3) In the Results section (from line 182) the authors convincingly addressed the possibility that less time spent immobile in the novel environment may have contributed to the novelty-induced increase of LC axon activity in dorsal CA1 (Fig. 4). In addition, initially (for the first 2-4 laps), the mice also ran more slowly in the novel environment (Fig. 3aIII, top panel). Given that LC and VTA axon activity were both increasing with velocity (Fig. 1F), reduced velocity in the novel environment may have reduced LC and VTA axon activity, but this possibility was not addressed. Reduced LC axon activity in the novel environment could have blunted the novelty-induced increase. More importantly, any potential novelty-induced increase in VTA axon activity could have been masked by decreases in VTA axon activity due to reduced velocity. The latter may help to explain the discrepancy between the present study and previous findings that VTA neuron firing was increased by novelty (see Discussion, from line 243). It may be useful for the authors to address these possibilities based on their data in the Results section, or to consider them in their Discussion.

      (4) Sensory properties of the water reward, which the mice may be able to detect, could account for reward-related activity of VTA axons (instead of an expectation of reward). Do the authors have evidence that this is not the case? Occasional probe trials, intermixed with rewarded trials, could be used to test for this possibility.

      REVIEW OF THE REVISED MANUSCRIPT<br /> I thank the authors for their responses addressing some of the weaknesses I raised in my original comments.

      Regarding their clarification of some methodological issues [Point 2) above], I have a few additional comments:<br /> - I appreciate that the authors clearly state the sample sizes contributing to the data. However, sample size justifications (e.g. based on previous studies, considerations of statistical power, practical considerations or a combination of these factors) are still lacking.<br /> - It is good that the authors have now clearly indicated how many mice they excluded due to lack of GCaMP expression or due to failure to reach the behavioral criteria. They also indicated that they discarded some of the collected datasets, based on the visual assessment of imaging sessions and the registration metrics output by suite2p. I appreciate that this may be common practice (although I am not using 2-photon imaging myself). However, I note that to minimize the risk of experimenter bias and improve reproducibility, it would be preferable to have more clearly defined quantitative criteria for such exclusions.<br /> - The authors clarified in their response why they used two different linear tracks for their studies of VTA and LC axon activity. I would encourage them to include this clarification in the manuscript. From the authors' response, I understand that they chose the different track lengths to facilitate comparison to previous studies involving LC and VTA axon recordings. However, given that the present paper aimed to compare LC and VTA axon recordings, the use of different track lengths for LC and VTA axon recordings remains a limitation of the present paper.

    1. Reviewer #3 (Public Review):

      Nitta et al. use a fly model of autosomal dominant optic atrophy to provide mechanistic insights into distinct disease-causing OPA1 variants. It has long been hypothesized that missense OPA1 mutations affecting the GTPase domain, which are associated with more severe optic atrophy and extra-ophthalmic neurologic conditions such as sensorineural hearing loss (DOA plus), impart their effects through a dominant negative mechanism, but no clear direct evidence for this exists particularly in an animal model. The authors execute a well-designed study to establish their model, demonstrating a mitochondrial phenotype and optic atrophy measured as axonal degeneration. They leverage this model to provide the first direct evidence for a dominant negative mechanism for 2 mutations causing DOA plus by expressing these variants in the background of a full hOPA1 complement.

      Strengths of the paper include well-motivated objectives and hypotheses, and overall solid design and execution. There is a thorough discussion of the interpretation and context of the findings. The results technically support their primary conclusions with minor limitations. First, while only partial rescue of the most clinically relevant metric for optic atrophy in this model is now acknowledged, the result nevertheless hamstrings the mechanistic experiments that follow. Second, the results statistically support a dominant negative effect of DOA plus-associated variants, yet the data show a marginal impact on axonal degeneration for these variants. In added experiments, the ability of WT hOPA1 and I382M but not 2708del, D438V or R445H to rescue ROS levels or mitophagy in the context of dOPA1 knockdown serves to support axonal number as a valid measure of mitochondrial function in this context. However, the critical experiment demonstrating a dominant negative effect was performed in the context of expressing WT hOPA1 along with a pathogenic variant, in which no differences in ROS, COXII expression or mitophagy were seen. This makes it difficult to conclude that the dominant negative effect of D438V and R445H on axon number is related to mitochondrial function.

      As an animal model of DOA that may serve for rapid assessment of suspected OPA1 variants, the results overall support utility of this model in identifying pathogenic variants but not in distinguishing haploinsufficiency from dominant negative mechanisms among those variants. The impact of this work in providing the first direct evidence of a dominant negative mechanism is under-stated considering how important this question is in development of genetic treatments for dominant optic atrophy.

      Comments on revised version:

      The authors have addressed the comments in my initial review. Through these modification and those related to the comments from the other reviewers, the manuscript is strengthened.

      Comments on author responses to each of the reviews:

      Reviewer 1:

      Interpretation of data has been appropriately reorganized in the discussion.

      Quantified mitochondria in the model show no difference in number. There is reduced size and structural abnormalities on electron microscopy.

      Application of mito-QC revealed increased mitophagy.

      Regarding partial rescue of axonal number in the mutant model, statistical significance between control and rescue is still not depicted in Figure 4D. Detailing possible explanations for this has been addressed in the discussion. However, only partial rescue of the most clinically relevant metric for optic atrophy in this model hamstrings subsequent mechanistic experiments that follow.

      Discussion regarding variant I382M has been improved.

      While reviewer 1's concerns about axonal number as a biomarker for OPA1 function are valid, it is worth noting that this is the most clinically relevant marker in the context of DOA. That said, I agree that the mechanistic DN/HI studies needed support using other measures of mitochondrial function, and the authors have done this. The ability of WT hOPA1 and I382M but not 2708del, D438V or R445H to rescue ROS levels or mitophagy in the context of dOPA1 knockdown serves to support axonal number as a valid measure of mitochondrial function in this context. However, the critical experiment demonstrating a dominant negative effect was performed in the context of expressing WT hOPA1 along with a pathogenic variant, in which no differences in ROS, COXII expression or mitophagy were seen. This makes it difficult to conclude that the (marginal) DN effect of D438V and R445H on axon number is related to mitochondrial function, and serves as a minor weakness of the paper.

      Which exons are included in the transcript, and therefore, which isoforms are expressed in the model, has been addressed.

      Reviewer 2:

      The authors have addressed the need to include greater methodological details.

      Language concerning the clinical utility of the model in informing treatment decisions has been appropriately modified. As pointed out by Reviewer 1, additional studies were needed to better establish the potential clinical utility of this model in screening DOA variants. The authors have completed those experiments, and the results overall support utility of this model in identifying pathogenic variants but not in distinguishing HI/DN mechanisms among those variants.

      Reviewer 3:

      The author has addressed the partial rescue effect as above.

      The authors have not modified the text to acknowledge the marginal effect sizes in the critical experiment of the study that demonstrates a DN effect. Statistically, the results indeed support a dominant negative effect of DOA plus-associated variants, yet the data show a marginal impact on axonal degeneration for these variants. This remains a weakness of the study.

    1. Reviewer #2 (Public Review):

      In this manuscript, Cai et al use a combination of mouse transgenic lines to re-examine the question of the embryonic origin of telencephalic oligodendrocytes (OLs). Their tools include a novel Flp mouse for labelling mature oligodendrocytes and a number of pre-existing lines (some previously generated by the last author in Josh Huang's lab) that allowed combinatorial or subtractive labelling of oligodendrocytes with different origins. The conclusion is that cortically-derived OLs are the predominant OL population in the motor and somatosensory cortex and underlying corpus callosum, while the LGE/CGE generates OLs for the piriform cortex and anterior commissure rather than the cerebral cortex. Small numbers of MGE-derived OLs persist long-term in the motor, somatosensory and piriform cortex.

      Strengths:

      The strength and novelty of the manuscript lie in the elegant tools generated and used. These have enabled the resolution of the issue regarding the contribution of different telencephalic progenitor zones to the cortical oligodendrocyte population.

      Comments on latest version:

      The revised manuscript by Cai et al has addressed all the issues raised. I have some minor comments:

      Figure 2: The y axis in figure 2L should be the same as the y axis in 2M to make the contribution to Mo and SS more clear.

      Figure 3: Although this is clear in the figure, A an B should be labelled as classical model and new model to help the reader understand immediately what the two figures show.

      Suppl Fig 2: It is not clear what 1-7 represent. It should be made clear in the legend which areas have been pooled into the different bins. The X axis should be labelled.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Otero-Coronel and colleagues use a combination of acoustic stimuli and electrical stimulation of the tectum to study MSI in the M-cells of adult goldfish. They first perform a necessary piece of groundwork in calibrating tectal stimulation for maximal M-cell MSI, and then characterize this MSI with slightly varying tectal and acoustic inputs. Next, they quantify the magnitude and timing of FFI that each type of input has on the M-cell, finding that both the tectum and the auditory system drive FFI, but that FFI decays more slowly for auditory signals. These are novel results that would be of interest to a broader sensory neuroscience community. By then providing pairs of stimuli separated by 50ms, they assess the ability of the first stimulus to suppress responses to the second, finding that acoustic stimuli strongly suppress subsequent acoustic responses in the M-cell, that they weakly suppress subsequent tectal stimulation, and that tectal stimulation does not appreciably inhibit subsequent stimuli of either type. Finally, they show that M-cell physiology mirrors previously reported behavioural data in which stronger stimuli underwent less integration.

      The manuscript is generally well-written and clear. The discussion of results is appropriately broad and open-ended. It's a good document. Our major concerns regarding the study's validity are captured in the individual comments below. In terms of impact, the most compelling new observation is the quantification of the FFI from the two sources and the logical extension of these FFI dynamics to M-cell physiology during MSI. It is also nice, but unsurprising, to see that the relationship between stimulus strength and MSI is similar for M-cell physiology to what has previously been shown for behavior. While we find the results interesting, we think that they will be of greatest interest to those specifically interested in M-cell physiology and function.

      Strengths:

      The methods applied are challenging and appropriate and appear to be well executed. Open questions about the physiological underpinnings of M-cell function are addressed using sound experimental design and methodology, and convincing results are provided that advance our understanding of how two streams of sensory information can interact to control behavior.

      Weaknesses:

      Our concerns about the manuscript are captured in the following specific comments, which we hope will provide a useful perspective for readers and actionable suggestions for the authors.

      Comment 1 (Minor):

      Line 124. Direct stimulation of the tectum to drive M-cell-projecting tectal neurons not only bypasses the retina, it also bypasses intra-tectal processing and inputs to the tectum from other sources (notably the thalamus). This is not an issue with the interpretation of the results, but this description gives the (false) impression that bypassing the retina is sufficient to prevent adaptation. Adding a sentence or two to accurately reflect the complexity of the upstream circuitry (beyond the retina) would be welcome.

      Comment 2 (Major):

      The premise is that stimulation of the tectum is a proxy for a visual stimulus, but the tectum also carries the auditory, lateral line, and vestibular information. This seems like a confound in the interpretation of this preparation as a simple audio-visual paradigm. Minimally, this confound should be noted and addressed. The first heading of the Results should not refer to "visual tectal stimuli".

      Comment 3 (Major):

      Figure 1 and associated text.

      It is unclear and not mentioned in the Methods section how phasic and tonic responses were calculated. It is clear from the example traces that there is a change in tonic responses and the accumulation of subthreshold responses. Depending on how tonic responses were calculated, perhaps the authors could overlay a low-passed filtered trace and/or show calculations based on the filtered trace at each tectal train duration.

      Comment 4 (Minor):

      Figure 3 and associated text.<br /> This is a lovely experiment. Although it is not written in text, it provides logic for the next experiment in choosing a 50ms time interval. It would be great if the authors calculated the first timepoint at which the percentage of shunting inhibition is not significantly different from zero. This would provide a convincing basis for picking 50ms for the next experiment. That said, I suspect that this time point would be earlier than 50m s. This may explain and add further complexity to why the authors found mostly linear or sublinear integration, and perhaps the basis for future experiments to test different stimulus time intervals. Please move calculations to Methods.

      Comment 5 (Major):

      Figure 4C and lines 398-410.<br /> These are beautiful examples of M-cell firing, but the text suggests that they occurred rarely and nowhere close to significantly above events observed from single modalities. We do not see this as a valid result to report because there is insufficient evidence that the phenomenon shown is consistent or representative of your data.

    1. Reviewer #3 (Public Review):

      In their article "The Geometric Basis of Epithelial Convergent<br /> Extension", Brauns and colleagues present a physical analysis of drosophila axis extension that couples in toto imaging of cell contours (previously published dataset), force inference, and theory. They seek to disentangle the respective contributions of active vs passive T1 transitions in the convergent extension of the lateral ectoderm (or germband) of the fly embryo.

      The revision made by the authors has greatly improved their work, which was already very interesting, in particular the use of force inference throughout intercalation events to identify geometric signatures of active vs passive T1s, and the tension/isogonal decomposition. The new analysis of the Snail mutant adds a lot to the paper and makes their findings on the criteria for T1s very convincing.

      About the tissue scale issues raised during the first round of review. Although I do not find the new arguments fully convincing (see below), the authors did put a lot of effort to discuss the role of the adjacent posterior midgut (PMG) on extension, which is already great. That will certainly provide the interested readers with enough material and references to dive into that question.

      I still have some issues with the authors' interpretation on the role of the PMG, and on what actually drives the extension. Although it is clear that T1 events in the germ band are driven by active local tension anisotropy (which the authors show but was already well-established), it does not show that the tissue extension itself is powered by these active T1s. Their analysis of "fence" movies from Collinet et al 2015 (Tor mutants and Eve RNAi) is not fully convincing. Indeed, as the authors point out themselves, there is no flow in Tor mutant embryos, even though tension anisotropy is preserved. They argue that in Tor embryos the absence of PMG movement leaves no room for the germband to extend properly, thus impeding the flow. That suggests that the PMG acts as a barrier in Tor mutants - What is it attached to, then? The authors also argue that the posterior flow is reduced in "fenced" Eve RNAi embryos (which have less/no tension anisotropy), to justify their claim that it is the anisotropy that drives extension. However, previous data, including some of the authors' (Irvine and Wieschaus, 1994 - Fig 8), show that the first, rapid phase of germband extension is left completely unaffected in Eve mutants (that lack active tension anisotropy). Although intercalation in Eve mutants is not quantified in that reference, this was later done by others, showing that it is strongly reduced. Similarly, the Cyto-D phenotype from Clement et al 2017, in which intercalation is also strongly reduced, also displays normal extension.

    1. Reviewer #2 (Public Review):

      Summary:

      The study reported by Trutti et al. uses high-field fMRI to test the hypothesized involvement of subcortical structure, particularly striatum, in WM updating. Specifically, participants were scanned while performing the Reference Back task (e.g., Rac-Lubashevsky and Kessler, 2016), which tests constructs like working memory gate opening and closing and substitution. While striatal activation was involved in substitution, it was not observed in gate opening. This observation is cited as a challenge to cortico-striatal models of WM gating, like PBWM (Frank and O'Reilly, 2005).

      Strengths:

      While there have been prior fMRI studies of the reference back task (Nir-Cohen et al., 2020), the present study overcomes limitations in prior work, particularly with regard to subcortical structures, by applying high-field imaging with a more precise definition of ROIs. And, the fMRI methods are careful and rigorous, overall. Thus, the empirical observations here are useful and will be of interest to specialists interested in working memory gating or the reference back task specifically.

      Weaknesses:

      I am less persuaded by the more provocative points regarding the challenge it presents to models like PBWM, made in several places by the paper. As detailed below, issues with conceptual clarity of the main constructs and their connection to models, like PBWM, along with some incomplete aspects of the results, make this stronger conclusion less compelling.

      (1) The relationship of the Nir-Cohen et al. (2020) task analysis of the reference back task, with its contrasts like gate opening and closing, and the predictions of PBWM is far from clear to me for several reasons.

      First, contrasts like gate opening and gate closing make strong finite state assumptions. As far as I know, this is not an assumption of PBWM, certainly not for gate opening. At a minimum, PBWM is default closed because of the tonic inhibition of cortico-thalamic dynamics by the globus pallidus. Indeed, this was even noted in the discussion of this paper, which seems to acknowledge this discrepancy, but then goes on to conclude that they have challenged the PBWM model anyway.

      Second, as far as I know, PBWM emphasizes go/no-go processes around constructs of input- and output-gating, rather than state shifts between gate opening and closing. While this relationship is less clear in reference back, substituting task-relevant items into working memory does appear to be an example of input gating, as modeled by PBWM. Thus, it is not clear to me why the substitution contrast would not be more of a test of input gating than the gate opening contrast, which requires assumptions that are not clear are required by the model, as noted above.

      Third, PBWM relies on striatal mechanisms to solve the problem of selective gating, inputting, or outputting items in memory while also holding on to others. Selective gating contrasts with global gating, in which everything in memory is gated or nothing. The reference back task is a test of global gating. It is an important distinction because non-striatal mechanisms that can solve global gating, cannot solve selective gating. Indeed, this limitation of non-striatal mechanisms was the rationale for PBWM adding striatum. The connectivity of the striatum with the cortex permits this selectivity. It is not clear that the reference back task tests these selective demands in the first place. That limitation in this task was the rationale behind the recent Rac-Lubashevsky and Frank (2022) paper using the reference back 2 procedure that modifies the original reference back for selective gating.

      So, if the primary contribution of the paper is to test PBWM, as suggested by the first line of the abstract, then it is not clear that the reference back task in general, or the gate opening contrast in particular, is the best test of these predictions. Other contrasts (substitution), or indeed, tasks (reference back 2) would have been better suited.

      (2) In general, observations of univariate activity in the striatum have been notoriously variable in the context of WM. Indeed, Chatham et al. (2014) who tested working memory output gating - notably in a direct test of the predictions of PBWM - noted this variability. They too did not observe univariate activation in the striatum associated with selective output gating. Rather they found evidence of increased connectivity between the striatum and cortex during selective output gating. They argued that one account of this difference is that striatal gating dynamics emerge from the balance between the firing of both Go and NoGo cell populations that decide whether to gate or not. It is not always clear how this balance should relate to univariate activation in the striatum. Thus, the present study might also test cortico-striatal connectivity, rather than relying exclusively on univariate activation, in their test of striatal involvement in these WM constructs.

      (3) It is concerning that there was no behavioral cost for comparison switch vs. repeat trials. This differs from with prior observations from the reference back (e.g., Nir-Cohen et al., 2020), and in general, is odd given the task switch/cue interpretation component. This failure to observe a basic behavioral effect raises a concern about how participants approached this task and how that might differ from prior reports of the reference back. If they were taking an unusual strategy, it further complicates the interpretation of these results and the implications they hold for theory.

      In summary, the present observations are useful, particularly for those interested in the reference back task. For example, they might call into question verbal theories and task analyses of the reference back task that tie constructs like gate-opening to striatal mechanisms. However, given the ambiguities noted above, the broader implications for models like PBWM, or indeed, other models of working memory gating, are less clear.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors designed an EEG experiment to investigate how listeners use temporal structure to optimise sensory detection. Listeners heard 2 seconds of noise and had to detect a faint tone in one of 3 temporal locations (equally spaced in time). In a minority of trials, no tone was presented. Focussing on these 'no tone' trials, the authors show that the EEG 'temporally tracks' the expected tone locations. This temporal tracking behaviour is also shown in a recurrent neural network trained on the same task. The authors interpret these findings as evidence of neural gain control in the service of sequential temporal anticipation.

      Strengths:

      The study uses an elegant experimental design and sophisticated EEG analyses. It is striking how clear the neural signatures are (of sequential expectation in the absence of sensory input). A further strength is the use of neural network modelling to elucidate the possible neural computations.

      Weaknesses:

      My first major comment concerns the theoretical implications of the study. An account based on gain control and temporal anticipation seems highly plausible. But are there other plausible accounts that the current data argue against? Or are there specific versions of gain control / temporal anticipation theories that the data supports and others that the data doesn't support? To develop the manuscript, I think the authors could relate their results in a more specific way to existing accounts, outlining not only what accounts their results favor but also which accounts their data falsify. In doing so I think the study will have a stronger influence on shaping the field.

      My second major comment concerns the consistent lag that is observed between tone location and neural/model responses. This would seem to be inconsistent with an anticipation account, which would instead predict zero or a negative lag. This should be discussed. While I agree the decrease in response magnitude that occurs with tone location is inconsistent with expectation violation, the positive lag that is observed seems more consistent with expectation violation than temporal anticipation/gain control.

      My third major comment is a suggestion to present some further analyses that I think will be informative. First is reporting more extensively the ERP results. This currently appears in one of the panels but there are no statistical tests reported in the main text and only the tone present data is shown. Given that expectation violation has been observed most consistently with ERPs, is there evidence of this in the 'no tone' trials and if so, does it correlate over participants with the power modulation effect or rate of false alarms? Doing this analysis will possibly be informative for assessing the plausibility of different functional accounts of the data e.g. expectation violation/prediction error. My second suggestion is to report the tone present trial data. When the tone is for example presented in the first location, does the response during tone locations 2 and 3 get suppressed? And does the same occur in the neural network model? If so, this would speak to a highly dynamic form of gain control (if the gain control account is correct).

    1. Reviewer #2 (Public Review):

      Summary:

      Spargo and colleagues present an analysis of the shared genetic architectures of Schizoprehnia and several late-onset neurological disorders. In contrast to many polygenic traits for which global genetic correlation estimates are substantial, global genetic correlation estimates for neurological conditions are relatively small, likely for several reasons. One is that assortative mating, which will spuriously inflate genetic correlation estimates, is likely to be less salient for late-onset conditions. Another, which the authors explore in the current manuscript, is that some loci affecting two or more conditions (i.e., pleiotropic loci) may have effects in opposite directions, or shared loci are sparse, such that the global genetic correlation signal washes out.

      The authors apply a local genetic correlation approach that assesses the presence and direction of pleiotropy in much smaller spatial windows across the genome. Then, within regions evidencing local genetic correlations for a given trait pair, they apply fine-mapping and colocalization methods to attempt to differentiate between two scenarios: that the two traits share the same causal variant in the region or that distinct loci within the region influence the traits. Interestingly, the authors only discover one instance of the former: an SNP in the HLA region appearing to confer risk for both AD and ALS. This is in contrast to six regions with distinct causal loci, and twenty regions with no clear shared loci.

      Finally, the authors have published their analysis pipeline such that other researchers might easily apply the same techniques to other collections of traits.

      Strengths:<br /> - All such analysis pipelines involve many decision points where there is often no clear correct option. Nonetheless, the authors clearly present their reasoning behind each such decision.<br /> - The authors have published their analytic pipeline such that future researchers might easily replicate and extend their findings.

      Weaknesses:<br /> - The majority of regions display no clear candidate causal variants for the traits, whether shared or distinct. Further, despite the potential of local genetic correlation analysis to identify regions with effects in opposing directions, all of the regions for causal variants were identified for both traits evidenced positive correlations. The reasons for this aren't clear and the authors would do well to explore this in greater detail.<br /> - The authors very briefly discuss how their findings differ from previous analyses because of their strict inclusion for "high-quality" variants. This might be the case, but the authors do not attempt to demonstrate this via simulation or otherwise, making it difficult to evaluate their explanation.

      These concerns were addressed in the revised version of this manuscript.

    1. Reviewer #2 (Public Review):

      Steinemann, Stine, and their co-authors studied the noisy accumulation of sensory evidence during perceptual decision-making using Neuropixels recordings in awake, behaving monkeys. Previous work has largely focused on describing the neural underpinnings through which sensory evidence accumulates to inform decisions, a process which on average resembles the systematic drift of a scalar decision variable toward an evidence threshold. The additional order of magnitude in recording throughput permitted by the methodology adopted in this work offers two opportunities to extend this understanding. First, larger-scale recordings allow for the study of relationships between the population activity state and behavior without averaging across trials. The authors' observation here of covariation between the trial-to-trial fluctuations of activity and behavior (choice, reaction time) constitutes interesting new evidence for the claim that neural populations in LIP encode the behaviorally-relevant internal decision variable. Second, using Neuropixels allows the authors to sample LIP neurons with more diverse response properties (e.g. spatial RF location, motion direction selectivity), making the important question of how decision-related computations are structured in LIP amenable to study. For these reasons, the dataset collected in this study is unique and potentially quite valuable. This revised manuscript addresses a number of questions regarding analyses which were unclear in the original manuscript, and as a result the study is a strong contribution toward our understanding of neural mechanisms of decision making.