[Paragraph-level] PMCID: PMC6173734 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a pathogenic TP53 missense variant c.422G>A (p.Cys141Tyr) in the context of tumor development, indicating its contribution to tumor progression through the loss of heterozygosity and clonal biallelic loss of TP53.

Gene→Variant (gene-first): 7157:c.422G>A 7157:p.Cys141Tyr

Genes: 7157

Variants: c.422G>A p.Cys141Tyr

[Paragraph-level] PMCID: PMC7182441 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variant SLC6A14 affects amino acid transport and starvation, indicating that the blockade of its function alters molecular processes such as the expression of specific markers and the phosphorylation status of mTOR and S6 kinase. Oncogenic: The variant SLC6A14 is implicated in tumor behavior, as the study evaluates its role in colon cancer cell lines, suggesting that it contributes to tumor development or progression through its function in amino acid transport and mTOR signaling.

Gene→Variant (gene-first): 6198:S6

Genes: 6198

Variants: S6

[Paragraph-level] PMCID: PMC8453302 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The variant G292R in HER2 is associated with a complete response to pyrotinib treatment in a patient with metastatic cervical adenocarcinoma, indicating its correlation with therapy response. Oncogenic: The passage discusses the HER2 G292R variant in the context of a metastatic cervical adenocarcinoma, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): 2064:G292R

Genes: 2064

Variants: G292R

[Paragraph-level] PMCID: PMC7064492 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of MAP2K1 (p.K57N) mutations in patients with auricular AVM, indicating an association with the condition and suggesting its role in defining or confirming the disease. Oncogenic: The presence of the MAP2K1 (p.K57N) mutation in the tissue adjacent to the cartilage suggests that it may contribute to tumor development or progression in the context of the auricular AVM.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC4748120 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Diagnostic

Justification: Oncogenic: The passage describes how the A66dup variant contributes to tumor development by transforming the growth of primary myeloid progenitors and Ba/F3 cells, indicating its role in oncogenesis. Predictive: The passage mentions that K-Ras proteins with the A66dup variant are hypersensitive to MEK inhibition, suggesting a correlation with response to a specific therapy. Diagnostic: The discovery of the A66dup variant in a child with an atypical myeloproliferative neoplasm suggests its potential use in defining or classifying this disease.

Gene→Variant (gene-first): 5295:A66dup

Genes: 5295

Variants: A66dup

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the Ezh2Y641F mutation alters the molecular function of the enzyme, specifically its effect on H3K27me3 distribution, indicating a change in biochemical activity. Oncogenic: The context of the study involves analyzing the Ezh2Y641F mutation in melanoma cell lines, suggesting that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the Ezh2Y641F variant affects the H3K27me3 signal around the transcription start site and gene body, indicating an alteration in molecular function related to gene expression regulation. Oncogenic: The variant Ezh2Y641F is associated with changes in gene expression in cancer cell lines, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the Ezh2Y641F variant alters the distribution of H3K27me3, indicating a change in molecular function related to gene expression and chromatin modification.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the Ezh2Y641F variant alters the expression of numerous transcripts in B-cells and melanoma cells, indicating a change in molecular function related to gene expression. Oncogenic: The variant Ezh2Y641F is associated with melanoma cell lines derived from tumors, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 13

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the anti-tumor efficacy of EZH2 inhibitors and their effects on tumor growth inhibition in Ezh2Y641F/+ tumors, indicating a correlation with treatment response. Oncogenic: The variant Ezh2Y641F is implicated in tumor development, as it is studied in the context of autochthonous tumors in mice, suggesting its role in contributing to tumor progression.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the response of melanoma cell lines with the Y641F variant to various EZH2 inhibitors, indicating a correlation between the variant and sensitivity to treatment. Functional: The passage describes how the Y641F variant affects the potency of the JQEZ5 inhibitor, demonstrating that the variant alters the molecular function of EZH2 in the context of drug response.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the oncogenic effects of the B-RAFV600E and Ezh2Y641F mutations in the context of melanoma formation, indicating that these variants contribute to tumor development or progression. Functional: The passage describes how the presence of the Y641F mutation does not alter the expression of certain genes, suggesting that it may affect molecular or biochemical functions related to oncogenic pathways.

Gene→Variant (gene-first): 673:B-RAFV600E 2146:Y641F

Genes: 673 2146

Variants: B-RAFV600E Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the role of B-RafV600E and Ezh2Y641F in promoting melanoma, indicating that these variants contribute to tumor development or progression. Functional: The mention of B-Raf as a downstream effector of N-RAS signaling suggests that the variant B-RafV600E alters molecular function in the context of signaling pathways involved in melanoma.

Gene→Variant (gene-first): 673:B-RafV600E 2146:Y641F

Genes: 673 2146

Variants: B-RafV600E Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the Ezh2Y641F mutation cooperates with the B-RAFV600E mutation to accelerate tumorigenesis in melanoma, indicating that it contributes to tumor development. Functional: The passage implies that the Ezh2Y641F mutation alters the tumorigenic process in conjunction with B-RAFV600E, suggesting a change in molecular function related to tumor maintenance and formation.

Gene→Variant (gene-first): 673:B-RAFV600E 673:B-RafV600E 2146:Y641F

Genes: 673 2146

Variants: B-RAFV600E B-RafV600E Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the EZH2Y641F variant exhibits altered methylase activity, indicating that the variant affects molecular function. Oncogenic: The evidence suggests that the EZH2Y641F mutation contributes to tumor development, as demonstrated by the tumorigenesis observed in mice harboring this mutation.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646 2146:tyrosine to phenylalanine

Genes: 2146

Variants: Y641F Y646 tyrosine to phenylalanine

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the Ezh2Y641F variant contributes to tumor formation in B-cell lymphomas, indicating its role in tumor development and progression. Functional: The variant is associated with altered molecular function, specifically in the context of its cooperation with other genetic alterations to influence B-cell transformation and apoptotic resistance.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Prognostic

Justification: Oncogenic: The passage describes how the Ezh2Y641F variant contributes to the development of B-cell lymphoma in mice, indicating its role in tumor progression. Prognostic: The median survival of one year for mice with the Ezh2Y641F variant suggests a correlation with disease outcome, specifically survival, independent of therapy.

Gene→Variant (gene-first): 2146:Y641F

Genes: 2146

Variants: Y641F

[Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the Y641F mutation alters the expression of Ezh2 transcripts and leads to a gain-of-function effect, evidenced by the increase in H3K27me3 levels in B-cells, indicating a change in molecular function. Oncogenic: The Y641F mutation is described as equivalent to a common EZH2 missense mutation found in human cancers, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F

[Paragraph-level] PMCID: PMC7074098 Section: RESULTS PassageIndex: 9

Evidence Type(s): Prognostic

Justification: Prognostic: The passage discusses the correlation of BAP1 mutations and copy number variations with overall survival in cutaneous melanoma (CM), indicating that certain alterations are associated with better survival outcomes.

Gene→Variant (gene-first): 8314:E30K 8314:I643T 8314:L416F 8314:P629S 8314:R417M 8314:R59W 6490:S143N

Genes: 8314 6490

Variants: E30K I643T L416F P629S R417M R59W S143N

[Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 11

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of PIK3CA mutations, including E545K and H1047R, in patients with triple-negative breast cancer (TNBC), indicating their association with the diagnosis of invasive cancer. Oncogenic: The presence of PIK3CA mutations, specifically E545K and H1047R, in patients with invasive cancer suggests that these somatic variants contribute to tumor development or progression in the context of TNBC.

Gene→Variant (gene-first): 5290:E545K 5290:H1047R

Genes: 5290

Variants: E545K H1047R

[Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the PIK3CA mutation, including E545K, induces resistance to chemotherapy, indicating a correlation with treatment response. Oncogenic: The variant E545K is implicated in tumor development and progression, as evidenced by the experimental results showing increased tumor volume in the presence of this mutation.

Gene→Variant (gene-first): 5290:E545K

Genes: 5290

Variants: E545K

[Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the PIK3CA E545K mutation affects the sensitivity of TNBC cells to chemotherapy, specifically noting that cells with this mutation became less sensitive to the chemotherapeutic agent epirubicin. Oncogenic: The passage indicates that the PIK3CA E545K mutation promotes growth and inhibits apoptosis in TNBC cell lines, suggesting its role in tumor development and progression.

Gene→Variant (gene-first): 5290:E545K

Genes: 5290

Variants: E545K

[Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the PIK3CA mutation, including E545K, contributes to enhanced cell proliferation, reduced apoptosis, and increased aggressiveness in TNBC cells, indicating its role in tumor development or progression. Functional: The passage describes how the PIK3CA mutation alters the behavior of TNBC cells, specifically in terms of cell cycle progression and apoptosis, suggesting that the variant affects molecular or biochemical functions.

Gene→Variant (gene-first): 5290:E545K

Genes: 5290

Variants: E545K

[Paragraph-level] PMCID: PMC11272140 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the overall response rate (ORR) of patients with specific ROS1 mutations, including G2032R, in relation to treatment with taletrectinib, indicating a correlation with treatment response. Oncogenic: The presence of ROS1 resistance mutations, including G2032R, L2026M, S1986F, and G2101A, suggests that these somatic variants contribute to tumor development or progression, particularly in the context of resistance to crizotinib.

Gene→Variant (gene-first): 6098:G2032R 4914:G2101A 7294:L2026M 7294:S1986F

Genes: 6098 4914 7294

Variants: G2032R G2101A L2026M S1986F

[Paragraph-level] PMCID: PMC4868698 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutant PDX model to the treatment of a JAK1/2 inhibitor, ruxolitinib, indicating a correlation with response to therapy. Oncogenic: The JAK1S703I mutation is described as activating the JAK-STAT signaling pathway and driving cell proliferation, which suggests its contribution to tumor development or progression.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4239128 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's excellent response to dual therapy with dabrafenib and trametinib, indicating that the BRAF V600E mutation correlates with treatment response. Oncogenic: The BRAF V600E variant is described in the context of a poorly differentiated intrahepatic cholangiocarcinoma, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 12

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the correlation between the K27M-H3.3 mutation and overall survival in DIPG patients, indicating that patients with this mutation have significantly worse survival outcomes compared to those with wild-type tumors. Diagnostic: The K27M-H3.3 mutation is associated with the classification of DIPG patients, as it is mentioned that 69% of the patients carried this mutation, which is relevant for defining their disease status.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage discusses frequent focal copy number alterations in the K27M-H3.3 group, indicating that the K27M variant is associated with tumor development through specific genetic alterations. Diagnostic: The mention of the K27M-H3.3 group suggests that the K27M variant is used to classify or define a specific subtype of tumors, indicating its role in disease classification.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the K27M-H3.3 mutation in the context of DNA copy number alterations in tumors, indicating its role in tumor development or progression through the identification of specific chromosomal changes associated with this variant.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of the K27M variant in DIPG samples and its association with TP53 mutations, indicating its role in classifying or defining a subtype of disease. Oncogenic: The K27M variant is mentioned in the context of mutations found in DIPG samples, suggesting its contribution to tumor development or progression in this specific cancer type.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the association of the K27M-H3.3 mutation with ATRX mutations in DIPG samples, indicating its role in defining or classifying a subtype of disease. Oncogenic: The K27M-H3.3 mutation is mentioned in the context of its presence in GBM samples, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 3021:G34V/R 3021:K27M

Genes: 3021

Variants: G34V/R K27M

[Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The K27M mutation is identified as being present at diagnosis in DIPG samples, indicating its role in defining the disease subtype. Oncogenic: The K27M mutation contributes to tumor development in DIPG, as it is recurrently found in the samples analyzed, suggesting its role in tumor progression.

Gene→Variant (gene-first): 3021:G34V/R 3021:K27M

Genes: 3021

Variants: G34V/R K27M

[Paragraph-level] PMCID: PMC10524391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response rate and disease control rate of patients treated with osimertinib and selpercatinib, indicating that the variants mentioned (C797S, G12S, G810S, V600E) are associated with treatment response and resistance mechanisms. Oncogenic: The variants C797S, G12S, G810S, and V600E are described in the context of resistance mechanisms, suggesting their role in tumor development or progression in the setting of lung cancers.

Gene→Variant (gene-first): 1956:C797S 3845:G12S 5979:G810S 1956:T790M 673:V600E

Genes: 1956 3845 5979 673

Variants: C797S G12S G810S T790M V600E

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 26

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses resistance mechanisms related to specific variants, indicating their correlation with treatment response, particularly in the context of on-target and off-target resistance. Oncogenic: The variants mentioned are associated with resistance mechanisms that contribute to tumor development or progression, as they are involved in co-occurring resistance mechanisms in cancer cases.

Gene→Variant (gene-first): 1956:C797S 3845:G12S 5979:G810S 673:V600E 5979:V804E 5979:V804M

Genes: 1956 3845 5979 673

Variants: C797S G12S G810S V600E V804E V804M

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 25

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses hotspot mutations BRAF V600E and KRAS G12S being found in cases of off-target resistance, indicating that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 3845:G12S 673:V600E

Genes: 3845 673

Variants: G12S V600E

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 24

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses an acquired RET G810S mutation in the context of tumor progression, indicating that this somatic variant may contribute to tumor development or progression.

Gene→Variant (gene-first): 5979:G810S

Genes: 5979

Variants: G810S

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses resistance mutations that affect the engagement of therapeutic EGFR or RET kinases, indicating a correlation with resistance to specific therapies. Oncogenic: The variants mentioned (C797S, T790M, V804M/E, G810S) are described as resistance mutations that contribute to tumor progression by impacting kinase engagement, suggesting their role in oncogenesis.

Gene→Variant (gene-first): 1956:C797S 5979:G810S 1956:T790M 5979:V804M/E

Genes: 1956 5979

Variants: C797S G810S T790M V804M/E

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the presence of the EGFR T790M mutation in patients who had received prior EGFR-directed therapy, indicating a correlation with treatment response or resistance to osimertinib. Diagnostic: The mention of the EGFR T790M mutation being detectable at the time of study enrollment suggests its role in classifying or confirming the disease status in patients undergoing treatment.

Gene→Variant (gene-first): 1956:T790M

Genes: 1956

Variants: T790M

[Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage indicates that the variants L747S, L858R, and T790M are present in tumors, suggesting their role in tumor development or progression. Diagnostic: The presence of specific EGFR mutations, including L747S, L858R, and T790M, is used to classify the tumors, indicating their association with the disease.

Gene→Variant (gene-first): 1956:L747S 1956:L858R 1956:T790M

Genes: 1956

Variants: L747S L858R T790M

[Paragraph-level] PMCID: PMC3461408 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the identification of cancer-associated mutations p.His1047Leu and p.His1047Arg in PIK3CA, which are linked to a syndrome characterized by overgrowth, indicating that these somatic variants contribute to tumor development or progression. Functional: The passage describes how affected dermal fibroblasts showed enhanced phosphatidylinositol-3,4,5-trisphosphate (PIP3) generation and activation of downstream signaling, demonstrating that the variants alter molecular or biochemical function.

Gene→Variant (gene-first): 5290:p.His1047Arg 5290:p.His1047Leu

Genes: 5290

Variants: p.His1047Arg p.His1047Leu

[Paragraph-level] PMCID: PMC1952070 Section: RESULTS PassageIndex: 8

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage mentions the detection of single nucleotide polymorphisms (SNPs) and their association with specific exons, indicating their role in defining or classifying genetic variants. Predictive: The passage explicitly states that there was "no correlation between these alleles and gefitinib response," which implies that the variants were evaluated for their predictive value regarding treatment response.

Gene→Variant (gene-first): 7294:G/A NA:rs10251977 NA:rs17290643

Genes: 7294 NA

Variants: G/A rs10251977 rs17290643

[Paragraph-level] PMCID: PMC1952070 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the correlation of the L858R mutation with gefitinib response, indicating that it is associated with treatment sensitivity or resistance. Oncogenic: The L858R mutation is described as a somatic mutation found in tumor samples, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 1956:L858R 1956:T790M

Genes: 1956

Variants: L858R T790M

[Paragraph-level] PMCID: PMC5615879 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of KIT mutations in cases and specifies the types of mutations found in different exons, indicating their association with the disease. Oncogenic: The mention of KIT mutations contributing to tumor development is implied by their prevalence in cases, suggesting a role in cancer progression.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1509_1510insACCTAT 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 5156:c.1925A>G 3815:p.K558_V559delinsS 728378:p.K642R 728378:p.Q556E 3815:p.Q556dup 3815:p.Y503_F504insTY

Genes: 3815 728378 5156

Variants: Ala-Tyr c.1509_1510insACCTAT c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC9365372 Section: ABSTRACT PassageIndex: 9

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage indicates that the variant T790M is associated with favorable clinical efficacy of the therapy Abivertinib in patients, suggesting a correlation with treatment response. Diagnostic: The mention of patients with EGFR T790M+ NSCLC implies that the T790M variant is used to classify or define a specific subtype of non-small cell lung cancer.

Gene→Variant (gene-first): 1956:T790M

Genes: 1956

Variants: T790M

[Paragraph-level] PMCID: PMC9365372 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the evaluation of safety and efficacy of abivertinib in patients with the T790M mutation, indicating a correlation with treatment response in the context of non-small cell lung cancer. Diagnostic: The mention of the Thr790Met point mutation (T790M) being positive in patients with non-small cell lung cancer suggests its role in defining or classifying the disease subtype.

Gene→Variant (gene-first): 1956:T790M 1956:Thr790Met

Genes: 1956

Variants: T790M Thr790Met

[Paragraph-level] PMCID: PMC10082285 Section: ABSTRACT PassageIndex: 5

Evidence Type(s): Predictive, Diagnostic, Prognostic, Oncogenic

Justification: Predictive: The passage discusses the assignment of patients with EGFR-mutated NSCLC to receive osimertinib, indicating a correlation between the L858R variant and response to this specific therapy. Diagnostic: The mention of patients with EGFR-mutated NSCLC, specifically referencing the L858R variant, suggests its role in defining or classifying the disease subtype. Prognostic: The passage refers to disease-free survival (DFS) and overall survival as endpoints, indicating that the L858R variant may correlate with disease outcomes independent of therapy. Oncogenic: The context of the L858R variant being part of EGFR mutations in NSCLC implies its contribution to tumor development or progression, characteristic of oncogenic variants.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC9338780 Section: RESULTS PassageIndex: 4

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the correlation between the BRAF V600E mutation and the response to treatment, indicating that all patients with confirmed responses had BRAF V600E-mutant disease, which suggests a predictive relationship with therapy response. Diagnostic: The mention of "centrally confirmed BRAF V600E-mutant disease" indicates that the variant is used to classify or confirm a specific disease subtype, supporting its role as a diagnostic marker.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC9338780 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage states that 33 out of 36 patients had the BRAF V600E mutation confirmed, indicating its use in defining or confirming a disease subtype, specifically in the context of ATC (anaplastic thyroid carcinoma). Oncogenic: The BRAF V600E mutation is known to contribute to tumor development or progression, which aligns with the evidence type of oncogenic variants in cancer.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7294133 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Oncogenic, Predictive, Prognostic

Justification: Oncogenic: The variant V871I in the EPHB4 gene is described as contributing to increased proliferation, migration, and invasion properties in neuroblastoma cell lines, indicating its role in tumor development and progression. Predictive: The passage discusses the use of EPHB4 inhibitors that can rescue the phenotype driven by the variant V871I, suggesting a correlation with response to specific therapies. Prognostic: The passage mentions that higher EPHB4 expression is correlated with stage 4 neuroblastoma and poor overall survival, indicating a relationship between the variant and disease outcome.

Gene→Variant (gene-first): 2050:V871I

Genes: 2050

Variants: V871I

[Paragraph-level] PMCID: PMC3266695 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the presence of the BRAF(V600E) variant correlates with the clinical activity of RAF inhibitors in melanoma patients, indicating a relationship between the variant and treatment response. Oncogenic: The BRAF(V600E) variant is described as contributing to tumor development and progression, particularly in the context of its role in ERK signaling and the development of resistance mechanisms in melanoma.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC2848976 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic, Functional

Justification: Predictive: The passage discusses how BRAFV600E/K is targeted for therapy with the specific inhibitor PLX4032, indicating a correlation with treatment response. Oncogenic: BRAFV600E/K is described as a mutationally active tumor-specific kinase in melanomas, suggesting its role in tumor development or progression. Functional: The passage mentions that PLX4032 alters the activity of ERK1/2 in BRAFV600E/K cells, indicating a change in molecular function related to the variant.

Gene→Variant (gene-first): 673:BRAFV600E 4893:Q61L 673:V600E/K

Genes: 673 4893

Variants: BRAFV600E Q61L V600E/K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how activated FAK has a functional impact on BRAFWT melanoma cells, specifically noting changes in colony formation and cell motility in response to PLX4032, indicating alterations in molecular or biochemical function. Oncogenic: The mention of BRAFWT and BRAFV600E in the context of melanoma cells suggests that these variants are involved in tumor behavior, particularly in how they respond to treatment and their migratory capabilities, indicating a role in tumor development or progression.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effects of PLX4032 on melanoma cells, indicating a difference in response between BRAFWT and BRAFV600E cells, which suggests a correlation with treatment response. Oncogenic: The mention of BRAFV600E in the context of advanced melanoma cells implies that this somatic variant contributes to tumor development or progression, as it is associated with specific cellular behaviors in the study.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 21

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 4893:Q61L

Genes: 4893

Variants: Q61L

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of melanoma cells to the therapy PLX4032, indicating that the BRAFV600E variant is associated with a lack of activation of certain proteins in response to treatment, which suggests a predictive relationship regarding therapy response. Oncogenic: The mention of BRAFV600E in the context of melanoma cells implies its role as a somatic variant contributing to tumor development or progression, as it is a well-known oncogenic mutation in melanoma.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of BRAFV600E cells to PLX4032, indicating a correlation with treatment response. Oncogenic: The mention of BRAFV600E in the context of downregulation of FOS and the activation of ERK1/2 suggests that this somatic variant contributes to tumor behavior and progression.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the cellular responses to PLX4032 therapy and mentions the activation of downstream ERK targets in relation to the BRAFV600E variant, indicating a correlation with treatment response. Oncogenic: The BRAFV600E variant is implicated in the inhibition of p90RSK activation in melanoma cells, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the R89L variant of RAF1 alters its ability to bind Ras-GTP and its activation in response to PLX4032, indicating a change in molecular function. Oncogenic: The R89L variant is described in the context of its activation and role in signaling pathways, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 3726:R89L

Genes: 3726

Variants: R89L

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the activity of RAF1 kinase in relation to BRAFV600E and BRAFV600K variants, indicating that these variants alter the molecular function of RAF1, as evidenced by the observed kinase activity levels. Oncogenic: The mention of BRAFV600E and BRAFV600K in the context of non-detectable activity and their relationship to RAF1 activity suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 673:BRAFV600E 673:BRAFV600K

Genes: 673

Variants: BRAFV600E BRAFV600K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses the enzymatic activity of BRAF variants (BRAFV600E and BRAFV600K) and how their activity is altered by treatment with PLX4032, indicating a change in molecular function. Predictive: The mention of treatment with PLX4032 and its effect on the activity of BRAF variants suggests a correlation with response to therapy, indicating predictive evidence.

Gene→Variant (gene-first): 673:BRAFV600E 673:BRAFV600K

Genes: 673

Variants: BRAFV600E BRAFV600K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 8

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of melanoma cells with the BRAFV600E variant to the drug PLX4032, indicating a correlation with treatment sensitivity. Oncogenic: The BRAFV600E variant is implicated in the context of melanoma cells, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses changes in the phosphorylation state of ERK1/2 in response to treatment, indicating that the BRAFV600E variant alters the molecular function of these proteins in melanoma cells. Oncogenic: The mention of the BRAFV600E variant in the context of melanoma cells suggests that it contributes to tumor development or progression, as it is associated with changes in signaling pathways relevant to cancer.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effects of PLX4032 on BRAFV600E/K melanoma cells, indicating a correlation between the variant and response to the therapy, specifically in terms of ERK1/2 phosphorylation. Oncogenic: The mention of BRAFV600E/K in the context of melanoma cells suggests that these somatic variants contribute to tumor development or progression, as they are associated with the activation of the RAF-MEK-ERK pathway in cancer.

Gene→Variant (gene-first): 673:BRAFV600K 673:V600E/K

Genes: 673

Variants: BRAFV600K V600E/K

[Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of BRAF mutant melanoma cell strains, including those with the V600E mutation, to the drug PLX4032, indicating a correlation between the variant and response to therapy. Oncogenic: The V600E variant is mentioned in the context of BRAF mutations in melanoma cells, suggesting its role in tumor development or progression as part of the BRAF mutation profile.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC2670982 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predisposing, Oncogenic, Functional

Justification: Predisposing: The passage describes germline substitutions in the TIE2/TEK receptor that cause a rare inherited form of venous anomalies, indicating that these variants confer inherited risk for developing the disease. Oncogenic: The passage discusses somatic mutations in TIE2 that contribute to tumor development, specifically noting the identification of somatic mutations in lesions and their role in the etiology of sporadic venous malformations. Functional: The passage mentions that the L914F variant shows ligand-independent hyperphosphorylation and abnormal localization when overexpressed, indicating that it alters molecular function.

Gene→Variant (gene-first): 284:L914F 7010:R849W

Genes: 284 7010

Variants: L914F R849W

[Paragraph-level] PMCID: PMC2830973 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses the effects of the compound NSC114792 on the phosphorylation state of serine/threonine kinases, indicating that it alters molecular function related to these kinases.

Gene→Variant (gene-first): 207:serine/threonine

Genes: 207

Variants: serine/threonine

[Paragraph-level] PMCID: PMC2830973 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The variant JAK3V674A is described as an activating allele that can transform a lymphoid pro-B-cell line, indicating its role in tumor development or progression. Predictive: The passage discusses how treatment with the compound NSC114792 inhibits JAK3 activity and decreases the viability of BaF3-JAK3V674A cells, suggesting a correlation with response to therapy.

Gene→Variant (gene-first): 3718:V674A

Genes: 3718

Variants: V674A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 31

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the substitution of the lysine residue K13 alters the nuclear localization of PTEN, indicating a change in molecular function related to protein activity and localization.

Gene→Variant (gene-first): 2597:K13

Genes: 2597

Variants: K13

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 30

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the K48R mutation alters the molecular function of ubiquitin, affecting the localization and abundance of PTENL320S-GFP, indicating a change in biochemical activity.

Gene→Variant (gene-first): 5728:K48R

Genes: 5728

Variants: K48R

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 29

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variant Lys48 affects the molecular function of PTENL320S by influencing its nuclear localization, indicating a change in biochemical activity related to polyubiquitination.

Gene→Variant (gene-first): 5728:Lys48

Genes: 5728

Variants: Lys48

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants PTENT277A and PTENL320S alter the ability of the protein to interact with the C-terminal tail, indicating a change in molecular function.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the L320S variant alters the interaction of a protein at the membrane-bound regulatory interface, suggesting a change in molecular function.

Gene→Variant (gene-first): 4734:L320S

Genes: 4734

Variants: L320S

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants PTENT277A and PTENL320S alter the ubiquitination of the PTEN protein, indicating a change in molecular function related to protein stability.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants L320S and T277A alter the protein conformation and folding of PTEN, indicating a change in molecular function as demonstrated by the trypsin digestion assay.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the F273 and L320 variants interact and affect the localization and conformation of PTEN, indicating that these variants alter molecular function.

Gene→Variant (gene-first): 5295:F273 5295:F273A 5295:F273L 4734:L320 4734:L320F 4734:L320S

Genes: 5295 4734

Variants: F273 F273A F273L L320 L320F L320S

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the variants T277A and L320S alter the conformation of PTEN and promote ubiquitination, which suggests a change in molecular function.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the mutations T319A and T321A do not enhance protein stability or membrane localization of PTENL320S, indicating that these variants alter molecular function related to protein activity and localization.

Gene→Variant (gene-first): 4734:L320S 5728:T319 5728:T319A 5728:T321 5728:T321A

Genes: 4734 5728

Variants: L320S T319 T319A T321 T321A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the substitution of L320 to S affects the molecular function of PTEN, specifically its stability, localization, and phosphorylation status, indicating a change in biochemical function.

Gene→Variant (gene-first): 4734:L320 4734:L320A 4734:L320D 4734:L320E 4734:L320S

Genes: 4734

Variants: L320 L320A L320D L320E L320S

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the T277A and L320S mutations alter the molecular function of PTEN by blocking its membrane localization and decreasing its ability to reduce AKT phosphorylation, indicating a change in biochemical activity. Oncogenic: The passage suggests that the nuclear localization defects caused by the T277A and L320S mutations could affect PTEN function in suppressing tumor formation, indicating that these mutations contribute to tumor development or progression.

Gene→Variant (gene-first): 2597:K13R 4734:L320S 5728:T277A

Genes: 2597 4734 5728

Variants: K13R L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the L320S and T277A mutations alter the localization of the PTEN protein, which is a change in molecular function.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses how specific phosphorylation events at the T366 and S370 sites affect the stability of the PTEN protein, indicating that these variants alter molecular function.

Gene→Variant (gene-first): 4734:L320S 5728:S370 5728:S370A 5728:T366 5728:T366A

Genes: 4734 5728

Variants: L320S S370 S370A T366 T366A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the L320S variant decreases the stability of PTEN and its interactions with the plasma membrane, indicating an alteration in molecular function. Oncogenic: The context of the passage suggests that the variants, particularly L320S, contribute to tumor development or progression by affecting PTEN stability and function, which is relevant in cancer biology.

Gene→Variant (gene-first): 5728:C124S 2597:K13 2597:K13R 4734:L320S

Genes: 5728 2597 4734

Variants: C124S K13 K13R L320S

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the PTEN variants L320S and T277A alter the molecular function of PTEN, specifically its ability to suppress AKT phosphorylation and inhibit cell migration and proliferation. Oncogenic: The variants PTENL320S and PTENT277A are implicated in decreased activity to suppress key signaling pathways and cellular behaviors associated with tumor development and progression, indicating their role in oncogenesis.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants L320S and T277A were tested for their effect on enzymatic activity, specifically lipid phosphatase activity, indicating that they alter molecular function.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 4

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the L320S and T277A mutations in PTEN alter the steady state levels of the proteins and their localization, indicating a change in molecular function. Oncogenic: The context suggests that the mutations contribute to the alteration of PTEN function, which is implicated in tumor development or progression.

Gene→Variant (gene-first): 4734:L320S 5728:T277A

Genes: 4734 5728

Variants: L320S T277A

[Paragraph-level] PMCID: PMC4845427 Section: RESULTS PassageIndex: 29

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 861:A to I

Genes: 861

Variants: A to I

[Paragraph-level] PMCID: PMC4845427 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predisposing

Justification: Predisposing: The passage discusses germline RUNX1 alterations identified in pedigrees, indicating inherited risk for developing disease.

Gene→Variant (gene-first): 861:A to I

Genes: 861

Variants: A to I

[Paragraph-level] PMCID: PMC3483540 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage discusses the presence of somatic point mutations, specifically the C > A and T > G transversions, in lung cancers of smokers, indicating their contribution to tumor development or progression. Diagnostic: The differences in mutational spectrums between lung cancers of smokers and never-smokers suggest that these variants can be used to classify or define the disease based on smoking status.

Gene→Variant (gene-first): 2199:C > A 2199:T > G

Genes: 2199

Variants: C > A T > G

[Paragraph-level] PMCID: PMC3483540 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Diagnostic

Justification: Oncogenic: The passage discusses several somatic mutations, including those in EGFR, KRAS, NRAS, PIK3CA, BRAF, CTNNB1, and MET, which are identified as driver mutations contributing to lung adenocarcinoma, indicating their role in tumor development or progression. Diagnostic: The passage mentions that specific mutations in well-known cancer genes are associated with lung adenocarcinoma, suggesting that these variants can be used to classify or define the disease.

Gene→Variant (gene-first): 1499:D32G 22853:E555K 3845:G12C 3845:G12D 3845:G12S 3845:G12V 3845:G13C 3845:G13D 1956:G719A 5290:H1047R 1956:L858R 1499:M1124D 3845:Q61H 4893:Q61K 4893:Q61L 673:V600E

Genes: 1499 22853 3845 1956 5290 4893 673

Variants: D32G E555K G12C G12D G12S G12V G13C G13D G719A H1047R L858R M1124D Q61H Q61K Q61L V600E

[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the treatment of AML cells with BAY1436032 and its effects on DNA methylation, indicating a correlation between the IDH1R132H mutation and the response to this specific therapy. Functional: The passage describes how the IDH1R132H mutation affects DNA methylation patterns and gene expression, demonstrating an alteration in molecular function due to the variant.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the response of IDH1 mutant AML cells, including those with the R132H mutation, to the treatment with BAY1436032, indicating a correlation with therapy response. Functional: The passage describes how the R132H variant alters histone methylation levels, demonstrating a change in molecular function related to histone demethylation.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the treatment of PDX models with BAY1436032, indicating a correlation between the variant mutations and the response to this specific therapy. Oncogenic: The passage describes the presence of somatic mutations (p.D835del and p.Q61R) in AML cells that contribute to tumor development, as evidenced by their propagation in PDX models.

Gene→Variant (gene-first): 2322:p.D835del 4893:p.Q61R

Genes: 2322 4893

Variants: p.D835del p.Q61R

[Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of various IDH1R132 mutant proteins to the IDH1 inhibitor BAY1436032, indicating a correlation between the presence of these variants and the response to the therapy. Oncogenic: The variants mentioned (R132C, R132G, R132H, R132L, R132S) are associated with mutant IDH1 proteins that contribute to tumor development, as evidenced by their expression in patient-derived AML cells and their role in producing R-2HG.

Gene→Variant (gene-first): 3417:R132C 3417:R132G 3417:R132H 3417:R132L 3417:R132S 3418:R140Q

Genes: 3417 3418

Variants: R132C R132G R132H R132L R132S R140Q

[Paragraph-level] PMCID: PMC3973211 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Prognostic, Predictive, Oncogenic

Justification: Prognostic: The passage indicates that mutations at Arg248 and Arg282 positions are associated with shorter patient survival, suggesting a correlation with disease outcome independent of therapy. Predictive: The passage discusses the association of p53 mutations with resistance to several CYP3A4-metabolized chemotherapeutic drugs, indicating a correlation with treatment response. Oncogenic: The mention of p53 mutations contributing to gain of novel oncogenic functions and their association with cancer cell lines suggests that these somatic variants play a role in tumor development or progression.

Gene→Variant (gene-first): 7157:Arg248 7157:Arg282 7157:R282W

Genes: 7157

Variants: Arg248 Arg282 R282W

[Paragraph-level] PMCID: PMC4234187 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the introduction of a C118S mutation into the Kras allele and its effect on tumorigenesis, indicating that this somatic variant contributes to tumor development or progression. Functional: The passage describes how the thiol residue of cysteine 118 is involved in redox-dependent reactions that lead to Ras activation, suggesting that the C118S mutation alters molecular function related to protein activity.

Gene→Variant (gene-first): 4843:C118 4843:C118S 4843:cysteine 118

Genes: 4843

Variants: C118 C118S cysteine 118

[Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's lack of response to vinblastine treatment, indicating that the p.T599dup BRAF variant may be associated with resistance to this therapy. Oncogenic: The p.T599dup BRAF variant is mentioned in the context of tumor sequencing, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): NA:p.T599dup BRAF

Genes: NA

Variants: p.T599dup BRAF

[Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the identification of a BRAF p.T599dup mutation in a tumor specimen, indicating that this somatic variant contributes to tumor development or progression, specifically in the context of a low-grade glioma.

Gene→Variant (gene-first): 673:p.T599dup

Genes: 673

Variants: p.T599dup

[Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage describes how the BRAFV600E variant contributes to disordered vessel formation and recapitulates clinical features of vascular malformations, indicating its role in tumor development or progression. Predictive: The passage discusses the response of zebrafish with BRAFV600E to vemurafenib, an approved BRAF inhibitor, showing that the variant correlates with improved blood flow following targeted therapy.

Gene→Variant (gene-first): 673:BRAFV600E

Genes: 673

Variants: BRAFV600E

[Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 4

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants affect the 3D protein structure and stability of helix A in the MAP2K1 gene, indicating that they alter molecular function. Oncogenic: The variants are described as contributing to the destabilization of the conformation of the inactive state of the protein, which suggests a role in tumor development or progression.

Gene→Variant (gene-first): 5604:E62del NA:K57 5604:c.159_173del 5604:c.173_187del 5604:p.[K57N]

Genes: 5604 NA

Variants: E62del K57 c.159_173del c.173_187del p.[K57N]

[Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of pathogenic variants in patients with vascular malformations (VMs), indicating that these variants are used to classify or define the clinical phenotype associated with the disease. Oncogenic: The identified variant c.159_173del is described as contributing to the allelic spectrum of variants in the RAS/MAPK pathway, which is known to be involved in tumor development and progression, thus supporting its oncogenic potential.

Gene→Variant (gene-first): 5604:c.159_173del

Genes: 5604

Variants: c.159_173del

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage indicates that the presence of the BRAF V600E mutation correlates with poorer outcomes in patients with stage IV CRC, suggesting its role in prognosis independent of therapy. Oncogenic: The BRAF V600E mutation is associated with tumor development or progression, as indicated by its correlation with poorer prognosis in the context of cancer.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Prognostic

Justification: Diagnostic: The passage discusses the association of the BRAF V600E mutation with non-MSI tumors, indicating its role in classifying or defining a specific subtype of colorectal cancer. Prognostic: The passage mentions that miR-31 is being focused on as a candidate prognostic biomarker, suggesting a correlation with disease outcome in the context of tumors harboring the BRAF V600E mutation.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the evaluation of CRC specimens based on their BRAF V600E mutation status, which is used to classify the tumors into different subtypes with distinct genetic and clinical features. Oncogenic: The BRAF V600E mutation is mentioned in the context of tumor specimens, indicating its role in tumor development or progression in colorectal cancer.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that the BRAF V600E mutation is associated with colorectal cancers (CRCs), suggesting its role in defining or classifying a disease subtype. Oncogenic: The mention of the BRAF V600E mutation in the context of colorectal cancers implies that it contributes to tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the effect of different genotypes at the SNP (rs1122269) on the response to gemcitabine, indicating a correlation between the variant and treatment response. Functional: The passage describes how the SNP genotype affects CDH4 expression levels in response to gemcitabine exposure, indicating an alteration in molecular function.

Gene→Variant (gene-first): 1002:rs1122269

Genes: 1002

Variants: rs1122269

[Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Prognostic

Justification: Functional: The passage discusses the influence of SNPs (rs9637468 and rs4925193) on the expression of genes in a cis-manner, indicating that these variants alter molecular function related to gene expression. Prognostic: The mRNA expression levels of CDH4 were associated with overall survival (OS) of pancreatic cancer patients, suggesting that the variants may correlate with disease outcome independent of therapy.

Gene→Variant (gene-first): 1002:rs1122269 1002:rs4925193 NA:rs9637468

Genes: 1002 NA

Variants: rs1122269 rs4925193 rs9637468

[Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Prognostic

Justification: Predictive: The passage discusses the association of the SNPs rs9637468 and rs4925193 with overall survival (OS) in the context of gemcitabine treatment, indicating their potential as genetic biomarkers for predicting response to therapy. Prognostic: The passage mentions that the SNPs are associated with overall survival (OS) outcomes, suggesting that they may correlate with disease outcome independent of therapy.

Gene→Variant (gene-first): 1002:rs4925193 NA:rs9637468

Genes: 1002 NA

Variants: rs4925193 rs9637468

[Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses trends of the SNPs being associated with drug response (gemcitabine IC50 values) and mentions pharmacogenomic effects on gemcitabine during pancreatic cancer treatment. Diagnostic: The SNPs are described as influencing disease risk in pancreatic cancer, indicating their potential role in classifying or associating with the disease.

Gene→Variant (gene-first): NA:rs10979372 1002:rs1122269 NA:rs1374679 57554:rs7515290

Genes: NA 1002 57554

Variants: rs10979372 rs1122269 rs1374679 rs7515290

thats HARD (hitting) - discussed in class - Nick: new-ish concept

[Paragraph-level] PMCID: PMC6333965 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of specific mutations in PIK3CA and CDKN2A, indicating their association with patient populations, which suggests their role in defining or classifying disease subtypes. Oncogenic: The mention of TP53 inactivating mutations (R209Q/W, R243W/Q) causing cell cycle deregulation implies that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 5290:E545K 7157:R209Q/W 7157:R243W/Q 1029:R58X

Genes: 5290 7157 1029

Variants: E545K R209Q/W R243W/Q R58X

[Paragraph-level] PMCID: PMC3997489 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the prevalence of the K27M mutation in DIPG, indicating its association with this specific disease, which supports its use as a biomarker for classification. Oncogenic: The K27M mutation is described as part of the unique genetic make-up of DIPG, suggesting its contribution to tumor development or progression in this specific cancer type.

Gene→Variant (gene-first): 3021:K27M

Genes: 3021

Variants: K27M

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predictive, Prognostic, Oncogenic

Justification: Predictive: The passage discusses the positive selection of the ESR1 Y537S mutation through treatment and its association with resistance to fulvestrant, indicating a correlation with treatment response. Prognostic: The exploratory analysis of progression-free survival comparing patients with a Y537S mutation at day 1 to those who acquired it by the end of treatment suggests a correlation with disease outcome, independent of therapy. Oncogenic: The evidence presented indicates that the ESR1 Y537S mutation contributes to tumor development or progression, particularly in the context of promoting resistance to treatment.

Gene→Variant (gene-first): 5728:Y537S

Genes: 5728

Variants: Y537S

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 15

Evidence Type(s): Predictive

Justification: Predictive: The mention of "Selection of ESR1 Y537S on treatment" suggests that the variant is associated with treatment response or resistance, indicating its predictive nature regarding therapy outcomes.

Gene→Variant (gene-first): 5728:Y537S

Genes: 5728

Variants: Y537S

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the acquisition of PIK3CA mutations, including E542K, E545K, H1047L, and H1047R, in patients during treatment, indicating that these somatic variants contribute to tumor development or progression. Functional: The validation of acquired PIK3CA mutations using ddPCR and the mention of their allele fraction estimation suggest that these variants alter molecular or biochemical function, supporting their functional impact in the context of cancer.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047L 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047L H1047R

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The Q257X mutation is described as part of RB1 aberrations that are likely to result in abrogated Rb function, indicating its contribution to tumor development or progression in the context of resistance to therapy. Predictive: The emergence of RB1 aberrations, including the Q257X mutation, is discussed in relation to the treatment with palbociclib plus fulvestrant, suggesting a correlation with resistance to this specific therapy.

Gene→Variant (gene-first): 5925:Q257X

Genes: 5925

Variants: Q257X

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the selection of a subclone featuring the FGFR2 p.K569E mutation during treatment with palbociclib plus fulvestrant, indicating a correlation with resistance to therapy. Oncogenic: The FGFR2 p.K569E mutation is described as an activating mutation that contributes to the development of a resistant subclone, suggesting its role in tumor progression.

Gene→Variant (gene-first): 2263:D538G 2099:Q75E 2263:p.K569E

Genes: 2263 2099

Variants: D538G Q75E p.K569E

[Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the presence of RB1 mutations, including p.Q257X and p.N519fs, in a resistant subclone during treatment with palbociclib plus fulvestrant, indicating a correlation with treatment resistance. Oncogenic: The RB1 mutations are described as contributing to the development of a resistant subclone, suggesting their role in tumor progression and resistance to therapy.

Gene→Variant (gene-first): 5925:p.N519fs 5925:p.Q257X

Genes: 5925

Variants: p.N519fs p.Q257X

[Paragraph-level] PMCID: PMC8203843 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how IDH1 mutations, specifically R132H, induce sensitivity to PARP inhibitors, indicating a correlation with treatment response. Oncogenic: The context implies that the IDH1 R132H mutation contributes to tumor behavior, particularly in the context of glioma and its interaction with ATRX mutations.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC7086303 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the G598V mutation influences the sensitivity of BTSC cultures to the EGFR inhibitor afatinib, indicating a correlation with treatment response. Oncogenic: The G598V mutation is described as an activating mutation in the context of EGFR, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 1956:G598V

Genes: 1956

Variants: G598V

[Paragraph-level] PMCID: PMC5021039 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response rates of various EGFR mutations, including E709K, G719X, L858R, and L861Q, to targeted therapies such as gefitinib and erlotinib, indicating their correlation with treatment sensitivity. Oncogenic: The passage mentions that somatic mutations in the EGFR gene, including the variants listed, are present in lung adenocarcinomas and contribute to tumor development, which supports their classification as oncogenic.

Gene→Variant (gene-first): 1956:E709K 1956:G719X 1956:L858R 1956:L861Q 1956:S768I

Genes: 1956

Variants: E709K G719X L858R L861Q S768I

[Paragraph-level] PMCID: PMC4378307 Section: RESULTS PassageIndex: 7

Evidence Type(s): Prognostic

Justification: Prognostic: The passage indicates that the G12D and G12S subtypes of KRAS mutations are associated with poor prognosis in progression-free survival (PFS) and overall survival (OS), respectively, which correlates with disease outcomes independent of therapy.

Gene→Variant (gene-first): 3845:G12D 3845:G12S

Genes: 3845

Variants: G12D G12S

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 19

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effectiveness of the irreversible EGFR inhibitor CL-387,785 in inhibiting colony formation and autophosphorylation in cells expressing the L858R variant, indicating a correlation with treatment response. Oncogenic: The L858R variant is described in the context of its role in transformation assays, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the correlation between the presence of activating EGFR mutations, including G719S, L747_E749del A750P, and L858R, and clinical responses to gefitinib or erlotinib, indicating their sensitivity to these therapies. Oncogenic: The passage describes the ability of the mentioned EGFR mutations to promote anchorage-independent growth in cell lines, which is indicative of their role in tumor development or progression.

Gene→Variant (gene-first): 1956:G719S 1956:L747_E749del A750P 1956:L858R

Genes: 1956

Variants: G719S L747_E749del A750P L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the mutant EGFR leads to the constitutive activation of the serine/threonine kinase Akt, indicating an alteration in molecular function related to cell survival signaling pathways.

Gene→Variant (gene-first): 207:serine/threonine

Genes: 207

Variants: serine/threonine

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage describes how the L858R mutant EGFR alters molecular function by activating STAT signaling pathways and increasing STAT3-dependent gene expression, as demonstrated through immunoblotting and reporter assays. Oncogenic: The L858R variant is associated with transformed NIH-3T3 cells, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the L858R variant of EGFR alters the molecular function of Shc binding and phosphorylation, indicating a change in biochemical activity associated with the mutant protein. Oncogenic: The L858R variant is described as contributing to constitutive activation of EGFR, which is associated with tumor development or progression, as evidenced by the downstream signaling alterations observed in the study.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the L858R variant alters the molecular function of EGFR, specifically its autophosphorylation activity in response to EGF stimulation, indicating a change in biochemical function. Oncogenic: The L858R variant is associated with tumor development, as it is mentioned in the context of a lung adenocarcinoma cell line, suggesting its role in cancer progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the mutant forms of EGFR (L858R, G719S, L747_E749del A750P, and D770_N771insNPG) contribute to enhanced anchorage-independent growth in hTBE cells, indicating their role in tumor development or progression. Functional: The passage discusses the expression levels of the deletion and insertion mutants (L747_E749del A750P and D770_N771insNPG) and their ability to form colonies in soft agar, suggesting alterations in molecular function related to tumorigenesis.

Gene→Variant (gene-first): 1956:D770_N771insNPG 1956:G719S 1956:L747_E749del A750P 1956:L858R 3265:V12

Genes: 1956 3265

Variants: D770_N771insNPG G719S L747_E749del A750P L858R V12

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses how the EGFR variants A750P, D770_N771insNPG, L747_E749del, L858R, and G719S contribute to tumor development, as evidenced by their ability to form colonies in soft agar and exhibit loss of contact inhibition in NIH-3T3 cells.

Gene→Variant (gene-first): 1956:A750P 1956:D770_N771insNPG 1956:E749del 1956:G719S 1956:L858R

Genes: 1956

Variants: A750P D770_N771insNPG E749del G719S L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes how the L858R and G719S EGFR variants contribute to tumor development, as evidenced by their ability to transform NIH-3T3 cells and form tumors in immunocompromised mice. Functional: The passage indicates that the expression of the EGFR point mutants (L858R and G719S) in NIH-3T3 cells caused loss of contact inhibition, suggesting that these variants alter the molecular function of the EGFR protein.

Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

Genes: 1956

Variants: D837A G719S L858R

[Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the ability of the G719S and L858R mutations to transform NIH-3T3 cells, indicating that these somatic variants contribute to tumor development. Functional: The passage describes how the mutations G719S and L858R alter the ability of EGFR to induce colony formation in soft agar, demonstrating a change in molecular function related to tumorigenesis.

Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

Genes: 1956

Variants: D837A G719S L858R

[Paragraph-level] PMCID: PMC2970593 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage indicates that the L858R mutation is an activating mutation that is responsive to erlotinib, suggesting a correlation with treatment response. Oncogenic: The mention of the L858R mutation as an activating mutation implies its contribution to tumor development or progression, consistent with oncogenic behavior.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 9

Evidence Type(s): Prognostic, Diagnostic, Oncogenic

Justification: Prognostic: The passage indicates that patients with the K27M mutation in histone H3 have worse overall survival compared to patients with no histone mutations, suggesting a correlation between the variant and disease outcome. Diagnostic: The K27M mutation is associated with specific tumor histologies and is used to classify patients into different groups based on their histone mutation status, indicating its role in defining disease subtypes. Oncogenic: The K27M mutation in histone H3 is described as contributing to tumor development, as it is found in a significant proportion of tumors and correlates with specific tumor characteristics.

Gene→Variant (gene-first): 90:K27M

Genes: 90

Variants: K27M

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 8

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 90:K27M

Genes: 90

Variants: K27M

[Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 7

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses overall survival rates for patients with and without leptomeningeal spread, indicating that the presence of the K27M mutation correlates with worse survival outcomes. Oncogenic: The K27M variant is mentioned in the context of tumor spread and is associated with specific tumor types (GBM), suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 90:K27M 5290:p.Glu545Gly 90:p.Gly328Val

Genes: 90 5290

Variants: K27M p.Glu545Gly p.Gly328Val

[Paragraph-level] PMCID: PMC7467277 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses somatic copy number alterations (CNAs) and specifically mentions a segment on chromosome 8 that exhibits deletion, indicating a potential role in tumor development or progression.

Gene→Variant (gene-first): NA:chr8:208343-27992852

Genes: NA

Variants: chr8:208343-27992852

[Paragraph-level] PMCID: PMC4654747 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage discusses how mutations in histone H3, specifically K27M and K27I, contribute to tumor development and progression in diffuse intrinsic pontine glioma (DIPG), indicating their role as somatic variants driving distinct oncogenic programs. Predictive: The K27M mutation is associated with a lack of clinical response to radiotherapy and earlier relapse, suggesting that this variant correlates with treatment resistance and impacts patient outcomes.

Gene→Variant (gene-first): 3021:K27I 3021:K27M 126961:lysine-to-isoleucine

Genes: 3021 126961

Variants: K27I K27M lysine-to-isoleucine

[Paragraph-level] PMCID: PMC6843359 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the response of patients with the S310F mutation to trastuzumab and pertuzumab treatments, indicating a correlation between the variant and treatment response. Functional: The passage describes how the S310F mutation alters the ability of the HER2 receptor to form homodimers or heterodimers and its interaction with EGFR, demonstrating a change in molecular function.

Gene→Variant (gene-first): 2064:G309A 2064:G309E 2064:S310 2064:S310F 2064:S310Y

Genes: 2064

Variants: G309A G309E S310 S310F S310Y

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 25

Evidence Type(s): Predictive, Prognostic

Justification: Predictive: The passage discusses the response of patients with a T790M mutation to osimertinib treatment, indicating a correlation between the variant and treatment response. Prognostic: The passage mentions progression-free survival (PFS) and overall survival (OS) in relation to the T790M mutation, suggesting a correlation with disease outcome independent of therapy.

Gene→Variant (gene-first): 1956:T790M

Genes: 1956

Variants: T790M

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 24

Evidence Type(s): Predictive, Diagnostic, Oncogenic, Functional

Justification: Predictive: The passage discusses the T790M mutation in the context of resistance to EGFR-TKI therapy and its correlation with treatment response, particularly with osimertinib. Diagnostic: The T790M mutation is mentioned as a resistance mutation detected in patients with acquired resistance to EGFR-TKI therapy, indicating its role in classifying the disease state. Oncogenic: The T790M mutation is described as a resistance mutation that contributes to tumor progression in patients undergoing treatment, indicating its role in cancer development. Functional: The passage implies that the T790M mutation alters the response to therapy, suggesting a change in molecular function related to drug resistance mechanisms.

Gene→Variant (gene-first): 1956:G719C 1956:T790M 673:V600E 1956:c.2155G>T 1956:p.G719C 7157:p.R248W

Genes: 1956 673 7157

Variants: G719C T790M V600E c.2155G>T p.G719C p.R248W

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses patients with sensitizing driver mutations receiving targeted therapy, indicating a correlation between the presence of these mutations (including E709A and G719S) and the response to treatment. Oncogenic: The mention of E709A and G719S as part of a complex EGFR mutation suggests that these somatic variants contribute to tumor development or progression, particularly in the context of the patient's advanced disease stage.

Gene→Variant (gene-first): 1956:E709A 1956:G719S

Genes: 1956

Variants: E709A G719S

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 13

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the classic V600E mutation was detected in patients, suggesting its role in tumor development or progression, particularly in the context of BRAF mutations.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 11

Evidence Type(s): Diagnostic, Predictive, Oncogenic

Justification: Diagnostic: The variant c.2527G>A; p.V843I is associated with lung cancer, as indicated by its reporting in the COSMIC databank and its presence in a patient with NSCLC. Predictive: The passage states that the mutation does not confer sensitivity to EGFR-TKIs, indicating a lack of response to this specific therapy. Oncogenic: The variant is described as "activating from a biological point of view," suggesting it contributes to tumor development or progression in lung cancer.

Gene→Variant (gene-first): 1956:c.2527G>A 1956:p.V843I

Genes: 1956

Variants: c.2527G>A p.V843I

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Diagnostic, Oncogenic

Justification: Predictive: The passage indicates that the patient showed stable disease on erlotinib, suggesting a correlation between the variant and response to therapy. Diagnostic: The variant is mentioned in the context of being previously described in lung samples, indicating its association with a specific disease subtype (lung cancer). Oncogenic: The variant is discussed in relation to a patient with stage IV lung cancer, suggesting its potential role in tumor development or progression.

Gene→Variant (gene-first): 1956:c.2543C>T 1956:p.P848L

Genes: 1956

Variants: c.2543C>T p.P848L

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's treatment with erlotinib and mentions early progression after disease stabilization, indicating a correlation between the variant and treatment response. Oncogenic: The variant is associated with a patient who has stage IIIA SCC, suggesting that it may contribute to tumor development or progression in the context of lung cancer.

Gene→Variant (gene-first): 1956:c.2258T>C 1956:p.P753L

Genes: 1956

Variants: c.2258T>C p.P753L

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's progressive disease on 2nd line EGFR-TKI therapy with gefitinib, indicating a lack of response to the treatment associated with the variant. Oncogenic: The variant c.2203G>A; p.G735S is mentioned in the context of lung cancer, suggesting it may contribute to tumor development or progression.

Gene→Variant (gene-first): 1956:c.2203G>A 1956:p.G735S

Genes: 1956

Variants: c.2203G>A p.G735S

[Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the BRAF mutation V600E is classified as an oncogenic driver mutation, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 28

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the association between the rs1801018 variant and response to different treatments, indicating a correlation with treatment sensitivity.

Gene→Variant (gene-first): 596:(AUC) of 39 596:rs1801018

Genes: 596

Variants: (AUC) of 39 rs1801018

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 26

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the study of BCL2 spatial expression patterns in relation to paclitaxel resistance, indicating a potential correlation between the 21 T > C variant and treatment response. Functional: The passage describes an immunofluorescence assay that assesses the localization patterns of the BCL2 variant, indicating an alteration in molecular function related to protein localization.

Gene→Variant (gene-first): 596:21 T > C

Genes: 596

Variants: 21 T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 25

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the variant 21 T > C leads to higher BCL2 expression, which is associated with resistance to the therapy paclitaxel. Oncogenic: The variant 21 T > C is implicated in contributing to tumor behavior by leading to increased expression of BCL2, which is associated with resistance to treatment, indicating a role in tumor progression.

Gene→Variant (gene-first): 596:21 T > C

Genes: 596

Variants: 21 T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 24

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage indicates that the presence of the 21 T > C variant correlates with increased abundance of transcripts when treated with paclitaxel, suggesting a relationship with treatment response. Functional: The mention of increased abundance of transcripts implies that the 21 T > C variant alters molecular function, likely affecting gene expression in response to paclitaxel.

Gene→Variant (gene-first): 596:21 T > C

Genes: 596

Variants: 21 T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the in vitro sensitivity to paclitaxel in relation to the 21 T > C variant, indicating that this variant may influence the response to the therapy. Functional: The variant is shown to alter the stability of the BCL2 transcript, which may lead to higher protein levels, indicating a change in molecular function.

Gene→Variant (gene-first): 596:21 T > C

Genes: 596

Variants: 21 T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the 21 T > C variant may regulate the transcriptional activity of the BCL2 gene, indicating an alteration in molecular function as evidenced by the increase in BCL2 mRNA levels in lymphocytes.

Gene→Variant (gene-first): 596:21 T > C 596:C instead of a T

Genes: 596

Variants: 21 T > C C instead of a T

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the + 21 T > C substitution alters BCL2 protein levels, indicating a change in molecular function due to the variant. Oncogenic: The context of the study involves ovarian cancer patients, and the variant is associated with increased BCL2 protein levels, which can contribute to tumor development or progression.

Gene→Variant (gene-first): 596:+ 21 T > C 596:C instead of a T

Genes: 596

Variants: + 21 T > C C instead of a T

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional

Justification: Functional: The passage indicates that changing T to C at a specific location alters protein levels, which demonstrates a change in molecular function.

Gene→Variant (gene-first): 596:T to C

Genes: 596

Variants: T to C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the T > C variant alters the stability of BCL2 mRNA transcripts, indicating a change in molecular function.

Gene→Variant (gene-first): 596:T > C

Genes: 596

Variants: T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional

Justification: Functional: The passage discusses how sequence modifications of BCL2 variants affect transcript stability and expression levels, indicating that the variants alter molecular function.

Gene→Variant (gene-first): 596:+21 C 596:+21 T 728378:+23 C > T 596:T > C

Genes: 596 728378

Variants: +21 C +21 T +23 C > T T > C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The variant C to T alters the molecular function by stabilizing the BCL2 RNA secondary structure, as indicated by the in vitro analysis.

Gene→Variant (gene-first): 596:C to T

Genes: 596

Variants: C to T

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the C > T change in BCL2 alters the mRNA structural ensemble, indicating that the variant affects molecular function related to RNA structure.

Gene→Variant (gene-first): 596:+ 21 T > C 728378:+ 23 C > T 596:C > T 596:T > C 596:T at position 21

Genes: 596 728378

Variants: + 21 T > C + 23 C > T C > T T > C T at position 21

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the T > C variant alters the RNA secondary structure of BCL2, which is a change in molecular function.

Gene→Variant (gene-first): 596:T >C

Genes: 596

Variants: T >C

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses how the variant rs1801018 correlates with patient resistance to paclitaxel, indicating its predictive value for treatment response. Diagnostic: The variation is associated with the classification of patients based on their treatment response, helping to define which patients are likely to respond to single or multiple lines of therapy.

Gene→Variant (gene-first): 596:T instead of a C 596:rs1801018

Genes: 596

Variants: T instead of a C rs1801018

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that the variant + 21 T > C is associated with resistance to paclitaxel, which correlates the variant with treatment response.

Gene→Variant (gene-first): 596:+ 21 T > C 596:C to a T

Genes: 596

Variants: + 21 T > C C to a T

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic

Justification: Diagnostic: The variant rs6070697 is discussed in the context of its distribution among treatment groups and its presence in both patients and controls, indicating its association with the study population and suggesting a role in defining or classifying the patient cohort.

Gene→Variant (gene-first): 81027:rs6070697

Genes: 81027

Variants: rs6070697

[Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 2

Evidence Type(s): Predictive

Justification: Predictive: The passage states that the T > C variation at position 21 of the BCL2 sequence predicts response to paclitaxel, indicating a correlation with treatment response.

Gene→Variant (gene-first): 596:T > C variation at position 21

Genes: 596

Variants: T > C variation at position 21

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 26

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses common founder mutations such as BRCA2:c.5946delT and BRCA1:c.68_69delAG, indicating their association with neopeptides that are likely presented in the population, which relates to defining or classifying a disease. Oncogenic: The mention of pathogenic mutations and their associated neoantigens suggests that these variants contribute to tumor development or progression, as they are described as potential tumor antigens.

Gene→Variant (gene-first): 672:c.5266dupC 675:c.5946delT 672:c.68_69delAG

Genes: 672 675

Variants: c.5266dupC c.5946delT c.68_69delAG

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of pathogenic missense mutations, specifically mentioning the BRCA1:p.C61S and p.M1I mutations, in the context of their association with disease, indicating their role in defining or confirming a disease subtype. Oncogenic: The passage refers to the BRCA1:p.C61S and p.M1I mutations as pathogenic, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.

Gene→Variant (gene-first): 672:p.C61S 672:p.M1I

Genes: 672

Variants: p.C61S p.M1I

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 675:c.7355delA

Genes: 675

Variants: c.7355delA

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.

Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

Genes: 672 675

Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R