substrate (49). The contents were lyophilized and 250 III of membrane suspension (1.4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The [3H] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting.
1,617 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 J..ll of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 J..lg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 J..lg/ml tunicamycin). Each assay tube was prepared by adding 12.5 J..ll of 1% Chaps, 28 J..ll of 200 J..lM GDP-Man, 10 J..ll of GDP-[3H]Man (1 J..lCi) and 25 nmol of synthetic
-
Elongating mannosyl phosphate transferase (eMPT) assay45
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
-
Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry
-
mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
-
The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
-
Assembly of eDNA encoding dZP3-rG fusion protein by PCR
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
TheamountoftotalIgMandspecificantibovineY-globulin(BGG)antibodyinthefishplasmawasmeasuredbyanenzyme-linkedimmunosorbentassay(ELISA)asgiven byAaltonenetal.(1994)
-
Serumimmunoglobulin
-
Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1
-
Thisisanimportantenzymeinvolvedinthecitricacidcycle.Thehomogenatesofcontrolandeffluentexposedtissueswerepreparedin0.25MicecoldsucroseusingPotterElvehjemtypeglasshomogenizerandcentrifugedat3000rpmfor15min
-
Succinicdehydrogenase(SDH)(E.C.1.3.99.1
-
BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated
-
Redbloodcellcount(RBC
-
Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm
-
AerialRespiration
-
Thetapwaterusedforacclimationandexperimentationhadthefollowingaveragecharacteristics:temperature(28°-30°C),pH(7.2-7.4),dissolvedoxygen(7.8-8.0ppm),CO2(2.08mll'1),salinity(0.190gF1)hardness(154ppmasCaCCF?),alkalinity(68ppmasCaC03)andconductivity(0.56mMhos).
-
Physico-chemicalcharacteristicsoftapwater
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-
until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
-
Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
-
Capture-C
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
added and mixed by gently inverting the tube 4-6 times. The microfuge tubes were then centrifuged at 13,000 rpm for 10 min. QIAprep spin columns were placed in 2-ml collection tubes and the supernatant was applied to these columns. These were then centrifuged for 1 min and the flow-through was discarded. The Qiaprep columns were then washed by adding 0.75ml of buffer PE and centrifuged for 1 min. The flow-through was discarded and an additional centrifugation was given for another minute to remove traces of the wash buffer. The QIAprep columns were placed in a fresh 1.5ml microfuge tube. Finally, to elute out the DNA, 50pl of buffer EB (10mM Tris-Cl, pH 8.5) or RNase-DNase free water was applied to the center of each column and then centrifuged for 1 min after letting it stand for 1 min. The flow-through contained the DNA of interest.
-
Each single colony (white colonies, in case of blue-white screening), was inoculated individually in Sml Luria-Bertani (LB) medium with 100p.g/ml of ampicillin. The cultures were grown for 8-10 hours at 370C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN, U.K.). According to the manufacturer's directions, the pelleted bacterial cells were resuspended in 250pl of buffer P1 and transferred to a microfuge tube. 250pl of buffer P2 was then added and mixed gently by inverting the tube 4-6 times. Further, 350pl of buffer N3 was
-
Plasmid Minipreps:
-
32P-a-rUTP (3000Ci/mmol) was obtained from Perkin Elmer (California, USA).
-
Radioisotopes
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
and fixed with 100μl of fixative solution per well, for 10 minutes at room temperature. The cells were then washed twice with PBS and 100μl of staining solution was added to each well. The plate was kept at 37° C, until the color development.
-
4x103-5x103 cells were plated in 96 well plate, well. Cells were transfected with reporter plasmid 18 -24 hrs after plating. After 48 hrs, cells were washed once with PBS
-
Procedure:
-
1X PBS diluted in distilled water 1X fixative solution diluted in distilled water 2.4.12.3 Staining Solution25 μl Solution A 25 μl Solution B 25 μl Solution C 125 μl 20 mg/ml X-gal in DMF
-
Working Solutions:
-
20 mg/ml X-gal in dimethylformamide Solution A as 40 mM potassium ferricyanide. Solution B as 40 mM potassium ferrocyanide. Solution C as 200mM magnesium chloride. 10X fixative (20% formaldehyde; 2% glutaraldehyde in 10X PBS) 10X PBS as 0.017 M KH2PO4, 0.05 M Na2HPO4, 1.5 M NaCl, pH 7
.4
-
Stock Solutions:
-
Transient transfection of plasmid DNA in culture cells was performed using Lipofectamine 2000 according to manufacturer’s protocol. Briefly, forty million cells were seeded in a 35mm tissue culture dish, one day before transfection. Transfection was performed 18-24 hrs after seeding the cells. 4μg DNA was mixed in 50μl of Opti-MEM in one eppendorf tube. In another tube, 5μl of Lipofectamine 2000 was diluted in 50μl Opti-MEM and incubated at room temperature for 5 minutes. After five minutes, DNA and Lipofectamine 2000 were mixed together and complexes, incubated for 30 minutes at room temperature. Meanwhile, the adherent cells were washed twice with PBS and 1ml of Opti-MEM was added. 100μl of complexes were then added to each dish containing cells and medium. After 6hrs, the medium containing complexes was removed and complete medium was added and transgene expression was accessed 24-48 hrs after transfection
-
Transient transfections in adherent cells
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Trypsinization: The decolourized bands were dried in a vacuum dryer for 1 hr until the gel pieces were completely dry. 5 μl of 0.1 μg/μl trypsin and 25 μl of 25 mM NH4HCO3 (pH 8.0) were then added to the dried gel pieces. The tubes were sealed with parafilm and kept in a water bath at 37 ̊C, overnight. Care was taken that the gel pieces in the tubes did not dry up. If the gel pieces got dried, 25 μl of NH4HCO3 was added on top. Peptide extraction: A 1:1 mixture of ACN:5% TFA in water was added (30 μl) to overnight tryptic digests and kept for 30 min. The elutant was removed in a separate low binding tube. The extraction step was repeated once more. The elutant was then dried in a vacuum dryer (1-2 hr) and reconstituted in 5 μl of 25% ACN in 0.1% TFA
-
Destaining of gel bands: The protein bands of differentially expressed proteins were cut out from the gel and put in low binding microfuge tubes. 150 μl of 50:50 Acetonitrile:Ammonium bi carbonate pH 8.0 (NH4HCO3) was then added and kept under shaking for 30 min. Coloured liquid was discarded and the washing step repeated until the bands decolourised
-
Destaining of gel, trypsinization and peptide extraction
-
0.5-1 μg of DNA was used for each restriction enzyme digestion. 2-4 units of the restriction enzymes with the appropriate 10X buffers supplied by the manufacturers were used in a total reaction volume of 20 μl. The digestion was allowed to proceed for 6 h or 10min. (for FAST digest enzymes) at the temperature recommended by the manufacturer. The DNA fragments were visualized by ethidium bromide staining following electrophoresis on 1-1.5% agarose gels. Commercially available DNA size markers were run along with the digestion samples to compare with and to estimate the sizes of the restriction fragments
-
Restriction enzyme digestion and analysis
-
aStrain DH5α, MC4100 and MG1655 was from our laboratory stock collection. Strains described earlier include GJ3107, GJ3110, GJ3161, GJ3168, GJ3171 (Harinarayanan and Gowrishankar, 2003), and RS353 and RS445 (Chalissery et al., 2007). Strain GJ5147 is an Ilv+ derivative of GJ3073 (Chalissery et al., 2007). Strains GJ6504, GJ6509, GJ6511, GJ6516, GJ6520 and GJ6524 were constructed by S. Aisha (unpublished). Strains GJ5108, GJ5146, GJ5153 were constructed by K. Anupama (unpublished). b Genotype designations are as described in Berlyn (1998). cK7906 strain is described in Zheng and Friedman (1994). d MDS42 strain is as described in Posfai et al. (2006)
-
Table 2.1 : List of E. coli K-12 strains
-
Bacterial strains
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
In order to create a half and complete knockouts of CYP genes, a strategy of homologous recombination was employed whereby, the allele(s) in the genomic DNA is replaced by an engineered construct, leaving the other loci unaffected. Since Leishmania is an asexual organism, a two-step targeting protocol has to be followed targeting one allele at a time. The engineered construct contains a selection marker flanked on either side by sequences of the target allele and were generated as explained in 3.2.B.17. Leishmania donovani promastigotes were electroporated with the allelic replacement constructs as described above in section 3.2.A.6. 24 hrs post electroporation, selection antibiotic (Neomycin and/ or Hygromycin, as the case may be) was added to the electroporated cultures and scaled up as described above in 3.2.A.6. Clones generated were cultured and their genomic DNAs isolated. The presence of the replacement construct integrated into the genomic DNA was checked for by PCR using primers specific for the replacement construct (Table 3.6 & 3.7). Those clones which showed the presence of the replacement construct in the genomic DNA were assayed for the level of the respective CYP protein using western blotting as described above in 3.2.B.19 and 3.2.B.20
-
Generation of parasites with half and complete knock-out of CYP genes
-
Polymerase chain reaction (PCR) was used to amplify specific nucleotide sequences from e-DNA and genomic DNA derived from L. donovani. The reactions consisted of an initial denaturation at 94°C for 5 min, followed by 20-30 cycles of denaturation at 94 °C for 30", annealing at primer specific temperature for 45s, and extension at 72°C for 30s-2 min according to product size of the primer pair. A final extension at 72°C was performed for 10 min. The PCR products were resolved on 1-2 % agarose gel containing ethidium bromide and visualized under UV illumination as described later. The specific primer pairs, their Tms and the respective product sizes are listed in Table 3.1-3.7. For High-fidelity Taq polymerase (Invitrogen, Carlsbad, CA), extension was carried out at 68°C and MgS04 was added instead of MgCh in the reaction mix in accordance to the manufacturer's instructions.
-
Polymerase chain reaction
-
For in vitro infection studies; J774A.1 macrophages were plated on coverslips at the density of 1 X105 cells/ coverslip in a 6-well culture plate or at a density of 5 X 105 cells/well of a 6-well culture plate, and allowed to rest for 12-18 hrs. The cells were challenged with stationary phase parasites at a multiplicity of infection (MOl) of 1:10 for 6 hrs after which the excess unbound parasites were washed with phosphate buffered saline or plain medium and the macrophages incubated at 37°C for different time points. Infection was visualised by staining the cells with cell permeant nucleic acid stain Syto 11 (Molecular Probes, Eugene, OR) in the dark for 10 min and viewed under a Nikon Eclipse TE2000E fluorescence microscope (Nikon, Japan)
-
In vitro infection of J774A.l murine macrophages with L. donovani parasites
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Band intensities in gel autoradiograms were determined by densitometry with the aid of the Fujifilm Multi Gauge V3.0 imaging system.Equal areas of radioactive bands (preferably the unbound probe) were boxed and the PSL (Photostimulated luminescence) valueswere further considered. For Kd(dissociation constant)calculations, the values thus obtained for each lane were expressed as a percentage with respect to the PSL for the lane without any protein taken as 100%
-
Densitometry
-
5% glycerol)containing (i) 5′-end-labeled DNAfragmentof 1200 cpm radioactive count(ii) 1 μg each of bovine serum albumin andpoly(dIdC)(iii) the protein at the indicated monomer concentrations and (iv) when required,co-effectorsat specified concentrations. The reaction mixture was incubated at room temperature for 30-minsand the complexes were resolved by electrophoresis on a non-denaturing 5%polyacrylamide gel (39:1 acrylamide:bisacrylamide)in 0.5X TBE buffer pH8.3, at 12.5V/cm for 3 hrs at 18°C.The gels were then dried on a gel drier at 80°C for 45 minsand the radioactive bands were visualised with a Fujifilm FLA-9000 scanner.For DNA bending EMSA, co-effectors were not added in the binding reaction but at aconcentration of 0.1 mM in both the gel and running buffer
-
The DNA templates were obtained by PCR from E. coligenomic DNA. After 5-end labeling, the PCR fragments were purified by electroelution following electrophoresis on 6% native polyacrylamide gels (Sambrook and Russell,2001). EMSA reactions were performed in 20 μl reaction volume inEMSA binding buffer(10 mM Tris-Cl at pH 7.5, 1 mM EDTA, 50 mM NaCl, 5 mM dithiothreitol, and
-
Electrophoretic mobility shift assay (EMSA)
-
Primer extension analysis to map thetranscription start site was carried out as describedby Conway et al. (1987) and Rajkumari et al. (1997). 20 pmolof primer was labelled at its 5′-end with 32P-γ-ATP as described above. 106cpm equivalent of labelled primer was mixed with 10μg of total cellular RNA. Sodium acetate pH-5.5 was added to a final concentration of0.3 M and the nucleic acids were precipitated with ethanol, washed with 70% alcohol,air-dried and dissolved in hybridization buffer (9 mM Tris-Cl, pH-8 and 0.35 mMEDTA) and incubated overnight at 43ºC for annealing. Reverse transcriptase reactionwas performed by the addition of 5 mM MgCl2, 1 mMdNTP’s, 1 X RT buffer, highconcentration (10 units) of Superscript III Reverse Transcriptase (Invitrogen) to the mixture of annealedlabelled primer and RNA. The reaction was incubated at 43ºC for 1-hr following whichthe nucleic acids were precipitated with absolute alcohol and 0.3 M CH3COONa, pH-5.5. The precipitate was air dried and dissolved in water and gel-loading dye (95%formamide, 20 mM EDTA, 0.05% each of xylene cyanol and bromophenol blue) wasadded. The samples were heated at 90ºC for 2-min before loading on a 6% denaturingpolyacrylamide gel for electrophoreticresolution alongside a sequencingladder
-
Primer extension analysis
-
Oligonucleotides and PCR products were end labeled using phage T4-polynucleotidekinase (PNK, New England Biolabs) with 32P-γ-ATP. The radiolabelling reactionmixture (50 μl) contained 1 X of buffer provided by the company, 10 units of T4-PNKand 50 μCi of32P-γ-ATP. The reaction mix was incubated for 1-hr at 37ºC and thereaction was stopped by adding 10 μl of 0.5 M EDTA. The labeled oligonucleotides andDNA fragments were purifiedeither by the Qiagen PCR purification or nucleotide removal kit.Labelling efficiency was checked by scintillation counting
-
Radiolabelling of oligonucleotides and PCR products
-
Site directed mutagenesis of plasmid DNA was carried out by using QuikChange kit(Stratagene) with a pair of complementary oligonucleotide primers carrying thenecessary sequence modifications. In this process, the plasmid (around 20-100 ng)containing the fragment of DNA where nucleotidehas to be altered, was used astemplate and “linear PCR” of 20 cycles was set up using Pfu Turbo DNA polymerase toamplify the whole plasmid with extension time calculated according to a rate of 500-bp/min. The reaction mix was digested with DpnIfor 1-hr(to destroy the original inputplasmid DNA) following which it was transformed directly to a highly competent DH5cells. The mutated plasmid was confirmed by sequencing
-
Site directed mutagenesis
-
Automated DNA sequencing on plasmid templates or on PCR products was carried outwith dye terminator cycle sequencing kits from Perkin-Elmer on an automatedsequencer (model 377, Applied Biosystems), following the manufacturer’s instructions.Manual sequencing was achieved using the SequenaseVersion2.0 DNASequencing Kit from USB Corp. as described in manufacturer’s instructions and thesequencing reaction products were resolved by electrophoresis on a 6% sequencing gel
-
DNA sequencing
-
and a colourless upper aqueous phase. The upper aqueous phase in which RNA existsexclusively, was transferred to a fresh microfuge tube and RNA was precipitated byadding 0.5 ml of isopropyl alcohol for each ml of Trizol used. Samples were incubatedat 15 to 30ºC for 10-min and centrifuged at 12000 rpm for 10-min at 4ºC. RNA formeda gel like precipitate at the bottom of the tube. Supernatant was removed and RNA waswashed with 75% ethanol (by adding 1 ml of ethanol per ml of Trizolemployed). RNAcould be stored after this step in –20 or –70ºC for more than a year. RNA pellet was airdried for 15-to 30-min following which it was dissolved in nuclease free water. Theconcentrations and purity of RNA samples were determined spectroscopically as wellas by visual inspection on formaldehyde-agarose gel in MOPS buffer (Goodet al., 1996). Before loading onto the gel, RNA was mixed with loading buffer and heated at90ºC for 3-min
-
For isolation of RNA, cells were grown in minimal A medium supplemented with 0.2%glucose upto A600of 0.6. Cells were harvested by centrifugation and total RNA wasisolated by using Trizol (Invitrogen) according to manufacturer’s instructions. 1 ml ofTrizol was used to lyse cells equivalent of approximately 4 ml of overnight culture.Homogeneous lysis was achieved by gentle pipetting repeatedly. The homogenized samples were incubated at room temperature for 5-min to permit complete dissociationof nucleoprotein particles. Following homogenization, 0.2 ml of chloroform for each 1ml Trizol reagent was added and vigorously shaken with hand for 15-sec and incubatedfurther for 3-min at RT. It was then centrifuged at 12000 rpm for 10-min at 4ºC, whichseparates out the homogenate into lower phenol chloroform phase (red), an interphase
-
Isolation of total cellular RNA
-
require high fidelity,Taq DNA Polymerase from MBI Fermentas was used. However,for precise amplifications either Herculase Fusion or PfuDNA polymerasefrom Stratagene was used. Approximately, 10-20ng of plasmid or 100 to 200 ng ofchromosomal DNA was used as a template in a 50 μl reaction volume containing 200μM of each dNTP, 20 picomoleeach of forward and reverse primer and 1.5 units of DNA polymerase.In the case of colony PCR performed to examine multiple colonies for presence of the plasmid clones, E. coli cells from afreshly grown plate wereresuspended in 50 μl of sterile Milli-Q water to get a cell suspension (~109cells/ml)and 4 μl from this was usedas the source of DNA template. To verify various pMU575 clonesdescribed in this study, by colony PCR,the vector specific primer pairs JGJpMUF and JGJgalK were used. The expected amplicon for pMU575 alone is ~300-bp, while that carrying the cloned fragment would be >300-bp.For each PCR reaction, the samples were subjected to 30-cycles of amplification and the typical conditions were as follows (although there were slight alterations from one set of template/primerto another):The initial denaturation was carried out at 95°C for 4-min and the cycle conditionswere as given below:Annealing 45ºC to 50°C 1-minExtension 68°C (1-min/kb of DNA template to be amplified)Denaturation 95°C 1-minAfter 30 cycles of PCR, the final extension step was carried out again for 10-min at68°C
-
For amplification of short length (100-200-bp)DNA fragmentsor that do not
-
Polymerase chain reaction (PCR)
-
Molecular techniques
-
Gel-filtration chromatography was performed at room temperature on a BioLogic LP protein purification system (Biorad) with an in-house packed Sephadex G-100 column of size 1.5 X 43 cm; each protein sample was loaded in 0.8-ml volume, and the buffer used for chromatography was 20 mM Tris-Cl (pH 8) with 200 mM NaCl at a flow rate of 0.1 ml per min with 1.5-ml fractions being collected for analysis. Protein elution was detected by measurement of A295.The void volume, V0was determined using blue dextran (2X 106Daltons) and theelution parameter Kavfor each proteinwas calculated from elution volume Veand total bed volumeVtusing the equation:Kav= (Ve–V0)/(Vt–V0)Initially, acalibration curve was derived froma semilogarithmic plotof Kav of protein standardsalbumin (67 kDa), ovalbumin (43 kDa), chymotrypsinogen (25 kDa) and ribonuclease A (13 kDa) on the Y-axis against log10of their molecular masses on theX-axis. The Kavof the ArgPdproteins were calculated based on their elution volume and then the molecular masses were derived from the corresponding point on the calibration curve
-
Around 0.5 to 1 μg of DNA was regularly used for each restriction digestion. 2to 5units of restriction enzyme were used in the total reaction volume of 20 μl containing 2μl of the corresponding buffer supplied at 10 X concentration by the manufacturer. Thereaction was incubated for 2 hrs at the temperature recommended by the manufacturer.The DNA fragments were visualised by ethidium bromide staining after electrophoresison a 0.8 to 1% agarose gels. Commercially available DNA size markers were run alongwith the digestion samples to compare with and to estimate the sizes of the restrictionfragments
-
Restriction enzyme digestion and analysis
-
Thialysine or thiosine (S-Aminoethyl-L-cysteine)is a toxic analog of Lys. Strains were testedfor sensitivity/resistance to thialysine by streaking them on minimal A-glucose platessupplemented without and with100-200 μg/ml thialysine(Steffes et al., 1992)
-
Test for thialysine resistance
-
For testing ArgR+/–phenotype, the colonies werestreaked on minimal A-glucose plates containing uracil (40 μg/ml) and CAN(65 μg/ml). Uracil wasadded to the medium to sensitize an argR+strain to CAN. An argR+strain is inhibited at65 μg/ml CANon a uracil-containing plate, whereas on a plate without uracil, argR+would grow even at 700-800 μg/ml CAN. Uracil represses the carAB transcription, whichencodes the carbamoyl phosphate synthase enzyme (CarAB). This results in reducedamounts of carbamoyl phosphate, which is the common intermediate between pyrimidineand Arg biosynthetic pathways. Reduced carbamoyl phosphate levels would result indecreased flux through the Arg biosynthetic pathways. This in turn would result indecrease in Arg pools inside the cell. An argR mutant would be derepressed for the Argbiosynthetic pathway and is resistant even to 300 μg/ml CANin a uracil-containing plate
-
Test for ArgR+/–phenotype
-
Test for canavanine (CAN) sensitivity
-
CAN is a toxic analog of Arg and is an inhibitor of bacterial growth. Strains were tested for sensitivity/resistance to CAN by streaking them on minimal A-glucose platessupplemented withoutand with40 μg/ml CAN(or other concentrations as indicated) and 40 μg/ml uracil
-
The colonies to be tested were streaked on the surface of minimal A-glucose plates containing either 0.4-0.7 M NaCl with 1 mM glycine betaine, and incubated at 37oC. NaCl-tolerant strains grew toform single colonies in 36-60 hrs whereas NaCl-sensitive ones did not. As controls, MC4100 (WT) and other previously identified NaCl sensitive mutants were streakedfor comparison
-
NaCl-sensitivity testing
-
agar platesLac+colonies will appear dark pink colonies whereas Lac–will remain colourless
-
A. lacphenotype
-
Scoring for phenotypes
-
LB agarLB medium 1000 mlBacto-agar 15 gmZ broth (for P1 transduction)LB medium100 mlCaCl2(0.5 M) 0.5 mlZ agar (for P1 transduction)Z broth 100 mlBacto-agar0.75 gm
-
Amino acids when required, were added to a final concentration of 40 μg/ml. Whengrowth on other carbon sources was to be tested, glucose was substituted withappropriate sugar at 0.2%.Glucose-minimal A medium, pH 7.4This medium was same as Glucose-minimal A medium described above except for the difference in K2HPO4and KH2PO4which were as mentioned below:K2HPO414.0 gmKH2PO42.7 gmGlucose-minimal A medium, pH 5.8This medium was same as Glucose-minimal A medium described above except for the difference in K2HPO4andKH2PO4which wereas mentioned below:K2HPO41.5 gmKH2PO412.4 gmGlucose /Glycerol-minimal A 19 (18 or 17) amino acidmediumThis medium is essentially the same as glucose/glycerol-minimal A medium described above except that all 19 or 18 or 17 otherthan either Lys or Lys and Arg or Lys and Arg and His amino acids were added after autoclaving at a final concentration of 40μg/ml from autoclaved 4 mg/ml stock solutions.Minimal A agarIt contains 1.5% bacto-agar (Difco) in minimal A medium. The plates were pouredafter mixing double strength minimal A with 3% agarthat had been autoclaved separately.LB mediumTryptone 10.0 gmYeast Extract5.0 gmNaCl 10.0 gmWaterto1000 mlpH adjusted to 7.0 to 7.2 with 1 N NaOH
-
All media and buffers were sterilised by autoclaving at 121ºC for 15 mins. Mediaand buffers used in this study are given below:Glucose /Glycerol-minimal A mediumK2HPO410.5 gmKH2PO44.5 gm(NH4)2SO41.0 gmSodium citrate, 2H200.5 gmWater to 1000mlAfter autoclaving the following solutions were addedMgSO4(1M) 1 mlGlucose (20%) 10 mlOr Glycerol (80%)5 mlVitamin B1 (1%) 0.1 ml
-
Media
Tags
- Md-1-Md-4-Md-2-d
- Mt-4
- Md-4-Md-4-d
- Md-4-Md-7
- Md-4-Md-8-d
- Md-4-Md-6-d
- Md-4-Md-3-d
- Md-4-Md-6
- Md-3-Md-4-d
- Md-1-Md-4-Md-3
- Md-1-Md-4
- Mt-4-d
- Md-4-Md-1-d
- Md-1-Md-4-Md-4-d
- Md-1-Md-4-Md-1-
- Md-4-Md-5
- Md-1-Md-4-Md-1-d
- Md-4-Md-3
- Md-4-Md-5-d
- Md-4-Md-8
- Md-1-Md-4-Md-3-d
- Md-1-Md-4-Md-4
- Md-2-Md-4-d
- Md-4-Md-7-d
- Md-4
- Md-1-Md-4-Md-5-d
- Md-4-Md-2-d
- Md-1-Md-4-Md-5
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Log-phase yeastcells were collected, washed and suspendedin 10 mM Tris-HCl (pH 7.5) containing 50 mg/ml zymolyase-20T. Cell suspension was incubated at room temperature and absorbance was monitored at 600 nm every10mininterval. Initial absorbance of the cultures at 0 minwas normalized to 100%and the graph was plottedas%decrease in the absorbance with respect to time
-
Zymolyasedigestion assay
-
OD600of 0.5and transferred to a 1.5 ml microcentrifuge tube. Probe loading was carried out by adding freshly-prepared CFDA-SE solution (0.01 M stock in DMSO) tocell suspension to a final concentration of 160 μM. Cell suspension was mixed on vortex mixerfor 10 secand incubated at 37 ̊C for 1 hwith shaking at 300 rpmon thermo mixer.Cells were harvested, washed twice with 1 ml 50 mM CP buffer to remove unloaded probe,resuspendedin 250 μl CP buffer andwereincubated at 30 ̊C for 30 minwith shaking to recover from the stress induced during probe loading. Afterincubation,fluorescent intensitywasdetermined with spectrofluorophotometer (Varioskan flash-3001, Thermo Scientific) by excitation at 430 nm (pH-independent) and 490 nm (pH-dependent) with emission at 525 nm. Background fluorescence of the probe was removed by subtracting the fluorescence intensity of the probe in CP buffer from the fluorescence intensity of the probe-loaded cells
-
Intracellular pH(pHi)in yeast cells was determinedusing fluorescent 5,(6)-carboxyfluorescein diacetate succinimidyl ester (CFDA-SE; Molecular Probes) asdescribed previously (Bracey et al.1998). For pHiprobe estimation,YNB medium-grown log-phase cells were inoculatedin YNB, YNB-pH 2.0 or YNB medium supplemented with acetic acid and incubated at 30 ̊C for different time points.Log-phase C. glabratacells were harvested and washed twice with 50 mM citric-phosphate (CP) buffer (pH 4.0). Washed cells were resuspendedin 1ml 50 mM CP buffer to an
-
Measurementof intracellular pH (pHi)
-
stranded DNA. Final reaction volume was adjusted to 20 μl with DEPC-treated waterandamplificationreaction was carried out usingthese parameters: initial denaturation at 95 ̊C for 5 min followed by 40 cycles of denaturationat 95 ̊C for 30 sec, annealing at 55 ̊C-57 ̊C for 30 sec, elongation at 72 ̊C for 40 sec and final extension at 72 ̊C for 10 min. Transcript levelswerequantified with an end-point value known as Ct (cycle threshold). The Ctdefines the number of PCR cycles required forthe fluorescent signal of SYBR green dye to cross more than the background level. The Ctvalue isinversely proportional to the amount of nucleic acid product. Ctvalues were obtained during exponential phase of amplification and used forcalculation of relative-fold change in gene expression after normalization to Ctvalues ofeither housekeeping gene ACT1 (gene encoding actin)orTDH3 (gene encoding Gapdh)with the help of the following formula. Fold change in expression = 2-∆∆Ct∆∆Ct= ∆Cttreated -∆Ctuntreated∆Cttreated = Ctvalue forgene of interest under test/treatedcondition -Ctvalue forinternal controlgene(ACT1/TDH3) under test/treatedcondition∆Ctuntreated = Ctvalue forgene of interest under untreatedcondition -Ctvalue forinternal control (ACT1/TDH3)gene under untreatedcondition
-
Todeterminethe expression level of a specific gene, quantitative real-time polymerase chain reaction (qRT-PCR/qPCR)was performed oncDNA usinggene specific primers. Primers for qPCR weredesigned in such a way so as to get amplification products in a size range of 150 to 300 bp. Optimalprimer and cDNA concentrationswere standardized and qPCR was performed in ABI Prism 7000/7500 Real time PCR Machine (Applied Biosystems). Briefly, 0.4 μl cDNA was mixed with 0.1 to 0.2 picomolesof gene specific forward and reverse primers and 10 μl 2X MESA GREEN qPCR™Mastermix Plus containing SYBR green dye (Eurogentec) in awell of a96-well PCR plate (Axygen). SYBR green is a dye that specifically binds to double
-
Quantitative real-time polymerase chain reaction (qRT-PCR)
-
C. glabratastrains were grown overnighteither in YPDor YNBliquid mediumat 30 ̊C with shaking at 200 rpm. Cells were harvested and suspended in 1X PBS to a final OD600of 1.0.Five 10-fold serial dilutions of cell suspension wereprepared in PBS and3-4μlwasspotted on YPD/YNBplates containing various test compoundsusing a multi-channel pipette.Plates were incubated at 30 ̊C and growth profileswererecorded after2-4days
-
Serial dilution spot assay
-
10mM EDTA0.1% SDS 1 M ureaToluidine blue staining solution:0.05% Toluidine blue20% Methanol2% GlycerolSolution was prepared in H2O.Destaining solution for polyphosphate gels:20% Methanol2% GlycerolSolution was prepared in H2O.Spheroplast buffer:50 mM Potassium phosphate (pH 7.5)0.6M Sorbitol0.2 X YPD mediumPS(PIPES-Sorbitol)buffer:10 mM PIPES-KOH (pH 6.8)200mM Sorbitol1 X protease inhibitor cocktail (Roche Cat # 04693159001)**To be added fresh before use
-
Citric-Phosphate buffer:0.5 M citric acid0.5 M dibasic sodium phosphatepH was adjusted to 5.0 with phosphoric acid and filter-sterilized.MES/TEA buffer:1 mM MES(2-(N-morpholino)ethanesulfonic acid)pH was adjusted to pH 5.0 with TEA(triethanolamine).Plasma membrane suspension buffer:50 mM Tris-HCl(pH 7.5)0.1mM EDTA0.1 mM Dithiothreitol 20% GlycerolPolyphosphate extraction buffer:50 mM HEPES (pH 7.2)
-
Genomic DNAisolation buffersBuffer A:50 mM Tris-HCl10mM EDTA150 mM NaCl 1% Triton-X 1% SDSBuffer B:50 mM Tris-HCl (pH 7.5)10 mM EDTA1.1 M Sorbitol50 mM β-mercaptoethanol(To be added just before use
-
Other buffers
-
15% Acetic acidTris-Borate Saline(TBS):25 mM Tris150 mM NaClpH was adjusted to 7.4withHCl.This was prepared as 10 X stock solution and used at 1 X concentration.Blocking and wash buffers(PBS-T and TBS-T):5% Fat-free milk 0.1% Tween-20 Volume was made to 100 ml either with 1 X PBS(PBS-T)or 1 X TBS(TBS-T)
-
0.02% Bromophenol blue 2% DTT This was prepared as a 4 X stock solution and used at a 1 X concentration.SDS-PAGE running buffer:0.25 M Tris-HCl (pH 8.0) 1.92 M Glycine 1% SDS This was preparedas a 10 X stock solution and used at a 1 X concentration.Coomassie brilliant blue (CBB) staining solution:50% Methanol10% Acetic acid0.1% Coomassie brilliant blue-R250Western blotTransfer buffer:0.25 M Tris-HCl (pH 8.0) 1.92 M Glycine 1% SDS Thiswas preparedas a 10 X stock solution and used ata 1 X concentration.1X Transfer buffer (1litre):200 ml of methanol 100 ml of 10 X transfer buffer 700ml of waterPonceau 3S staining solution:0.25% Ponceau 3S40% Methanol
-
SDS-PAGE30% Acrylamidesolution29 g Acrylamide1 g Bis-acrylamideDissolved in 100 ml H2O.10% Sodium Dodecyl Sulfate (SDS):10 g SDS in 100 mlH2OResolving gel mix (12%) (15 ml): 4.89 ml H2O6 ml 30% acrylamide:bisacrylamide (29:1) mix3.8 ml 1.5 M Tris-HCl (pH 8.8) 150 μl 10% SDS 150 μl 10% APS 10 μl TEMEDStacking gel mix (3 ml):1.689 ml H2O500 μl 30% acrylamide:bisacrylamide (29:1) mix380 μl 1 M Tris-HCl (pH 6.8) 30 μl 10% SDS 30 μl 10% APS 10 μl TEMEDSDS loading buffer:130 mM Tris-HCl (pH 8.0) 20% (v/v)Glycerol 4.6% (w/v) SDS
-
Whole cell lysis buffer(Homogenizing buffer):50 mM Tris-HCl(pH 7.5)2 mM EDTA10 mM sodium fluoride*1 mM sodium orthovanadate*1 X protease inhibitor cocktail (Roche Cat # 04693159001)**To be added fresh before use
-
Protein isolation and SDS-PAGE(sodium dodecyl sulfate polyacrylamide gel electrophoresis)
-
Protein isolation and SDS-PAGE(sodium dodecyl sulfate polyacrylamide gel electrophoresis)
-
Buffer C:100 mM Tris-HCl (pH 7.5)10 mM EDTA10% SDSRNA isolation bufferAE buffer: 3 M Sodium acetate0.5 M EDTA(pH 8.0)Phenol:Chloroform:Isoamyl Alcohol (25:24:1)solution:25 volume of Phenol24 volume of Chloroform1 volume of Isoamyl alcholDNA sampleloading buffer:0.25% Bromophenol blue0.25% Xylene cyanol15% Ficoll
-
Genomic DNA and RNA isolation buffers
-
15 mM CaCl2.2H2O 250 mM KCl 55 mM MnCl2.4H2O pH was adjusted to 6.7 with 1 N KOH. MnCl2needsto beaddedseparately,drop by drop with stirring, tothe buffer. PIPES goes into solutionwhenpH is greater than 6.7. The solution, after pH adjustment to 6.7 was filter-sterilized and stored at -20ºC.Reagents for yeast transformation:1 M Lithium acetate (LiOAc)50% Polyethylene glycol10 mg/ml Carrier DNADimethylsulfoxide (DMSO)
-
INOUE transformation buffer:For bacterial DH5α ultra-competent cells preparation10 mM PIPES (free acid)
-
Transformation-related solutions
-
10 mM Tris-HCl (pH 8.0)1 mM EDTA Tris-Acetic acid EDTA (TAE) buffer:40 mM Tris base 0.5 M EDTApH was adjusted to 8.5 with glacial acetic acid.This was prepared as a 50 X stock solution and used at a 1 X concentration. Tris-Borate EDTA (TBE) buffer:90 mM Tris-borate 2 mM EDTA (pH 8.0) pH was adjusted to 8.3withHCl.This was prepared as a 10 X stock solution and used at a 1 X concentration.Both TAE and TBE were used asstandard gel electrophoresis buffers.HEPES buffer:This was used to prepare YNB medium of different pH.1M HEPESpH was adjusted to 7.5withNaOH.Bufferwas filter-sterilized and stored in an amber-coloured bottle. Citrate buffer(0.1M, pH 5.5):4.7 volume of 0.1 M Citric acid 15.4 volume of 0.1 M Sodium citrate
-
Phosphate-Buffered Saline (PBS):137 mM NaCl 2.7 mM KCl10 mM Na2HPO42 mM KH2PO4pH was adjusted to 7.3.This was prepared as a 10 X stock solution andused at a 1 X concentration.Tris-HCl buffer:0.5 M TrizmaBase pH was adjusted to7.6 using concentrated HCl.This was prepared as a 10 X stock solution andused at a 1 X concentration.Tris-EDTA (TE)buffer:
-
Common buffers
-
Buffersand solutions
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.inChapter 241
-
activated TLC silicagel-60plate and transferred to theTLC chamber. After the solvent had migratedupwards (1.5 cm fromthetop), TLC plate was removed, air dried behind perspex shield, wrapped with cling plastic wrap and was exposed to phophorimager screenfor 2 h. Phosphorimager screen was scanned usingaFugi-FLA 9000 scanner
-
To resolvephospholipids,a TLC chamber was prepared by pouring50 ml developing solution and sealing the chamber with aluminium foil so that developing solution can generate vapor. TLC silicagel-60plate(Merck)was incubated at 80ºCfor 4 h for activation. After 30 min of TLC chamber preparation, phospholipidsextracted from C. glabratacells werespotted at thebottom (1.5 cm fromthelowerend) of the
-
Seperation of phospholipids by thin layer chromatography(TLC)
-
PI-3kinase reaction was set up ina total volume of50μlin a 1.5 ml microcentrifuge tube as described below.PI-3 kinase reaction buffer = 25 μlSpheroplast lysate = 20 μl (equivalent to 10 μg protein)Sonicated phosphatidyl inositol = 5 μlReaction mix was incubated at 25ºC for 20 min and enzyme reaction was stopped by adding 80μlHCL (1N) solution. To extract phospholipids, 160 μl chloroform:methanol (1:1) was added to the reaction mix withcontinuous mixing. Organic phase containing phopholipidswas separated fromaqueous phase by centrifugation at 7,500g for 4 min at 4ºC and transferred to a new vial. Using vacuum evaporator apparatus, solvent was evaporated and phospholipidsweredissolved in 10 μl chloroform
-
PI-3 kinase reaction set up and phopsholipid extraction
-
10 mg phosphatidylinositol-sodium salt(from Glycine max)was dissolved in 2 ml chloroform to prepare a 5 mg/ml stock solution. This solution was prepared in a small glass vial aschloroformis known to reactwith polypropylene. Small aliquots of stock solution were madeand stored at -20ºC till further use. To avoid spillage due to vapor pressure, vials containing phosphatidylinositol-sodium salt solutionwereopened very carefully.To prepare sonicated phosphatidylinositolfor one PI-3 kinase reaction, 2 μlof the stock phosphatidylinositolsolution (10 μg) wastransferredtoanew1.5 ml microcentrifuge tube. Using vacuum evaporator apparatus, chloroformwas evaporated from the solution and phosphatidylinositol-sodium saltwas resuspended in 5 μl sonication buffer.For sonication, a total of 20 pulses, each of 30 sec with30 sec resting time weregiven on ice
-
Preparation and sonication of phosphatidylinositol-sodium salt solution
-
A single colonyof desired C. glabratastrainwas inoculated in YPD-liquid mediumand grown for 14-16 h. 50 μl overnight culture was inoculated inYPD-liquid mediumfor 4 h. Log-phase-grownyeast cells were harvested,washedwith PBSandwereinoculated atinitial OD600of 2 and 4,into YNB-dextrose and YNB-sodium acetate liquid medium,respectively.After 4 hincubation,yeast cells were harvested by centrifugation at 2,500g for 5 minand treated with 1.2 M zymolyasefor 1 hto obtain spheroplasts.Post zymolyase treatment, spheroplasts were resuspended in 100 μl resuspension bufferandanequal amount of 0.25 mm glass beadswasadded to lyse the spheroplasts. Using bead beater apparatus, spheroplasts were lysed and protein concentration in spheroplast lysateswas determined usingbicinchoninic acid assay (BCA) method and samples were stored at -20ºC till further use
-
Preparation of cell lysate
-
In vitroPI-3 kinase reactions wereset up to measure PI-3P synthesized as described earlier(Whitman et al., 1988)
-
Phosphatidyl inositol-3 kinase (PI-3 kinase assay)
-
Colony blot assay was performed to analyse secretion of carboxypeptidase Y(CPY)as described previously (Roberts et al., 1991). Single colony of a C. glabratastrain was inoculated in YPD medium andculture was grown till stationary phase. 0.1 OD600equivalent cellsfrom this culture were spotted on CAA medium,overlaidwith a nitrocellulose membrane and plate was incubated at30 ̊C for 18-20 h.Afterincubation, nitrocellulose membranewas washed with water to remove cells and membrane-bound CPYwas detected by immunoblotting with polyclonal anti-CPY antibody at a dilution of 1:10,000
-
Colonyblot assay
-
was washed three times with PBS to remove non-adherantC. glabratacellsand Lec-2 cells were lysed in 5% SDS. Lysates were transferred totubes containing scintillation fluidand radioactive counts obtained were considered as ‘output values’. Percentage adherence wasdetermined using following formula
-
Adherence of C. glabratacells toLec-2 epithelial cells wasmeasured as described previously(Cormack et al., 1999).Lec2cells were seeded ina 24-well tissue culture plate at a seeding density of 5X105cells per well and allowed to adhere for 12 h. After 12 h,medium supernatant was discarded by inverting the plate in a reservoir and cells were washed thrice with PBS. Lec2 cells were fixed in 3.7% para-formaldehyde for 15 minfollowed by 2 PBS washes. PBS containing antibiotics, penicillin and streptomycin,was added toeach well of the 24-well plate and Lec-2 cellswere stored at 4°C.For adherence measurement,strains were taken out either on YPD or CAA mediumandgrown at 30°C for 2 days. Single colony of a C. glabratastrain wasinoculated in 10 ml CAA medium ina 100 ml culture flaskand allowed to grow at 30°C for 16-20 h. 100 μlyeast culture wasreinoculated in fresh 5 ml CAA liquid medium in a 15 ml polypropylene tube. 200 μCi of S35(Met:Cys-65:25) INVIVO PROTWIN labelmix(JONAKI, India) was added to thetube and cultures were grown at 30°C for 16-20 h for radiolabeling of C. glabratacells. C. glabratacells from 1 ml culture were harvested and washed threetimes with PBS to remove residual S35(Met:Cys-65:25) labeling mix from medium supernatant. Next,cells were resuspended in 1 ml PBS. OD600was measured and cell suspensions of 0.5 OD600were prepared. PBS was aspirated out of the wells of 24-well plate containing fixed Lec-2 cells. 200 μl of S35(Met:Cys-65:25)-labeled C. glabratacell suspensions were added to each well. To determine the total amount of radioactivity present in labeled C. glabratacell suspension, 200 μl of S35(Met:Cys-65:25)-labeledC. glabratacell suspensions were transferred to a scintillation vial containing scintillation fluid. Radioactive counts present in this fraction were considered as ‘input values’. For measurement of yeast adherence to Lec-2 cells, plates were centrifuged at 1,000g for 5 min and incubated for 30 min at room temperature. Following incubation, each wel
-
Adherence assay
-
20 mg protein samples, isolated from RPMI-grown and macrophage-internalized yeast, were usedto measure KDAC activityusing HDAC Fluorimetric Assay/Drug Discovery Kit (EnzoLifeScience) as per manufacturer’s instructions
-
Lysine deacetylase (KDAC) activity measurement
-
For protein extraction, yeast cells were suspended in 50-100μl protein extraction buffer containing 320 mM (NH4)2SO4, 200 mM Tris-Cl (pH 8), 20 mM EDTA (pH 8), 10 mM EGTA (pH 8), 5 mM MgCl2, 1 mMDTT, 10% glycerol and protease inhibitorsand disrupted using glass beads.Cell lysate was centrifuged at 7,500g and4oC for 15 min. 30 μg of total protein was resolved on a 15% SDS-PAGE gelat 32 mA till the dye front reachedthe bottom. Resolved proteins were transferred to Hybond-P membrane at 350 mA for 1.5 h in the cold room.Transfer of the proteins was visually confirmed by examining marker’s lane and membranes wereincubated in a small box for 2 h in 5% fat free milkprepared in 1X TBST for blocking. Blocking solutions were discarded and primary antibody, appropriately diluted in 5% fat free milkprepared in 1X TBST,was added to the box containing membrane. After overnight incubation in primary antibody, membranes were washed thrice with 1X TBST for 10 min. Membranes wereincubated for 2 h inappropriate secondary antibodydiluted in 5% fat free milkprepared in 1X TBST. Blots were either developedby chemiluminescence based ECL-Plus western detection system orChemidocTMgel imagingsystem. CgGapdhwas used as a loading control. To exclude the possibility of any contribution of THP-1 proteins tocell extracts prepared frommacrophage-internalized yeast, two control experiments wereperformed. First, we probedthe blots with antibodies specific for mammalian tubulin and actin.As expected, we neitherdetectedanysignal for mammalian actin nor formammalian tubulin. In the second control experiment, we treated macrophage lysates with proteinase-K prior to the yeast pellet disruptionand probed yeast lysates for different histone modifications.This proteinase-K treatmentdid not alter the epigenetic signature of C. glabratacells.Together, these data indicate that yeast protein samples were devoid ofany mammalian protein contamination
-
Protein extraction and immunoblotting
-
homogenizedin 1 ml PBS and fungal burden was assessed by plating appropriate dilutions of tissue homogenate on YPD plates containing penicillin and streptomycinantibiotics (100units/mlpenicillin and 100μg/mlstreptomycin). All mice experiments were repeated twice with a set of 7-8 mice per strain in each experiment
-
Experiments involving mice were conducted at VIMTA Labs, Hyderabad.100 l YPD-grown C.glabratacellsuspension(4 X 107cells)was injected into female BALB/c mice (6-8 weeks old) through tail vein. Seven dayspost infection, mice weresacrificedand kidneys, liver,spleenand brainwere harvested. Organs were
-
Mouse infection assay
-
Experiments involving mice were conducted at VIMTA Labs Limited, Hyderabad in strict accordance withguidelines of The Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India. The protocol was approved by the Institutional Animal Ethics Committee (IAEC) of the Vimta Labs Ltd. (IAEC protocol approval number: PCD/OS/05). Procedures used in this protocol were designed to minimizeanimalsuffering
-
Ethics statement
-
Othermethods
-
After14-16 hincubation, hybridization buffer was decanted to a radioactive liquid waste container.Membraneswere washedtwice with 2X SSC (saline-sodium citrate) containing 0.1% SDS for 15 min at 55°C followed by two washes with 1X SSC containing 0.1% SDS for 15 min at room temperature. Post washes,membranes were rinsed with 1XSSC buffer at room temperature and exposed to phosphorimager screen for 2-3 h
-
Post-hybridization washes
-
Identified mutants were phenotypically characterized in 96-well plate format. Mutant cultures were grown in YPD medium for overnight, diluted 150-fold in PBS and 5 μl of cell suspension was spotted on different plates with a 96-pin replicator. Growth was recorded after 1-2 daysof incubation at 30°C
-
Phenotypic profiling
-
THP-1 monocytes were treated with phorbol myrsitylacetate (PMA) to differentiate them to macrophages(Tsuchiya et al., 1982). For PMA treatment, THP-1 cells grown upto 70-80% confluencewere harvested from the culture dishes at 1,000 rpm for 3 min. Harvested THP-1 cells were resuspended in 5-10 ml fresh and prewarmed complete RPMI medium. 100μlof thiscell suspensionwasappropriatelydilutedinPBS and numberof viable cells was determined by trypan blue stainingusing hemocytometer. Cell suspension was diluted with prewarmed RPMI medium to a final density of 106cells/ml. PMA was added to this THP-1 cell suspension to a final concentration of 16 nM and mixedwell.PMA-treated THP-1 cellswere seeded either in 24-well cell culture plate or culture dishes and transferred to the incubator set at 37°C and 5%CO2.After 12 hincubation, medium was replaced with fresh prewarmed medium and cells wereallowed to recover for 12 h
-
Treatmentof THP-1 monocytic cells with phorbol myrsityl acetate
-
Spheroplast resuspension buffer0.1M KCl15 mM HEPES (pH 7.5)3 mM Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid(EGTA)10% GlycerolPhosphatidylinositol sonication buffer10 mM HEPES (pH 7.5)1 mM EGTA PI3-kinase reaction buffer40 mM HEPES (pH 7.5)20 mM MgCl280 μM ATP5 μCi γ-P32ATPDeveloping solution for thin layer chromatography(120.2 ml)Chloroform –60 mlMethanol –47 mlAmmonia –4.4 mlWater –8.8 ml
-
Reagents for PI3-kinase assay
-
Table 2.4: List of the oligonucleotides used to confirm deletion of C. glabrataORFs
-
Table 2.3: List of the oligonucleotides used in the study
-
Table2.2: List of the antibodies used in the study
-
Table 2.1: List of strains and plasmidsused in the study
-
methanol, acetic acid, potassium dihydrogen orthrophosphate, dipotassium hydrogen phosphate, disodium hydrogen orthrophosphate, acetone and citric acid were purchased from Qualigen chemicals. Fluconazole was procured from Ranbaxy.Lysotracker-Red DND 99 and FM 4-64 were obtained from Molecular Probes. Hybond-N and Hybond-P membranes for nucleic acid and protein transfer, respectively, were purchased from Amersham Biosciences. SYBR-green kit for real-time PCR was procured from Eurogentech. Superscipt SS-III RT kit and Pfu polymerase were obtained from Invitrogen. Different restriction enzymes used for cloning and knock-out generation were purchased from New England Biolabs (NEB). High fidelity DNA Pfx polymerase waspurchased fromFinnzymes. Plasmid DNA purification, PCR purification, gel extraction and reaction clean up kits were procured from Qiagen.Medium components for C. glabrataand bacterial culture viz.,yeast extract, peptone, tryptone, cassamino acid hydrolysate, yeast nitrogen base, yeast nitrogen base without ammonium sulphate, yeast nitrogen base without ammonium sulphate and amino acids and yeast carbon basewere purchased from BD (Becton, Dickinson and Company, USA). Animal cell culture media RPMI-1640, DMEM and α-MEM were procured from Hyclone. Fetal bovine serum, glutamine and antibiotics for cell culture medium were obtained from Gibco-Invitrogen
-
Agarose, phenol, dimethyl sulphoxide (DMSO), sodium acetate, sodium chloride, sodium hydroxide, sodium carbonate, sodium bicarbonate, trizma base, sodium dodecyl sulphate (SDS), formamide, calcium chloride, ethylenediaminetetraacetic acid(EDTA), glycerol, polyethylene glycol, ficoll, diphenyleneiodinium (DPI), methyl methanesulphonate (MMS), camptothecin, hydroxyurea, ammonium persulphate, TEMED, acrylamide, bis-acrylamide, coomassie brilliant blue (CBB), chloroform, formaldehyde, glycine, lithium chloride, lithium acetate, menadione, isopropanol, phorbol myrsityl acetate (PMA), nuclease free water, wortmannin, bafilomycin-A, diethylpyrocarbonate (DEPC), orthrophenylenediamine (OPD), tween-20, acid washed glass beads, trypan blue, Taq DNA Polymease, trisodium citrate dihydrate and uracil were purchased from Sigma Chemicals. β-mercaptoethanol was obtained from GE Biosciences.Protease inhibitor tablets were procured from Roche. Dextrose, sucrose, agar, ammonium sulphate, potassium chloride, caffeine, magnesium chloride and sorbitol were obtained from Himedia.Hydrogen peroxide, hydrochloric acid, sulphuric acid,
-
Chemicals, kits and culture medium components
Tags
- Md-1-Md-4-d
- Md-4-Md-7-Md-2-d
- Md-3-Md-4
- Md-4-Md-4-d
- Md-4-Md-7-Md-2
- Md-4-Md-7
- Mt-6-Mt-4
- Md-4-Md-6-d
- Mt-4
- Md-4-Md-2
- Md-4-Md-3-d
- Md-4-Md-6
- Md-3-Md-4-d
- Md-1-Md-4
- Mt-6-Mt-4-d
- Mt-4-d
- Md-4-Md-1-d
- Md-4-Md-1
- Md-4-Md-7-Md-3-d
- Md-4-Md-3
- Md-4-Md-5-d
- Md-4-Md-4
- Md-4-Md-7-Md-4
- Md-4-Md-7-Md-1
- Md-2-Md-4
- Md-2-Md-4-d
- Md-4-Md-7-d
- Md-4
- Md-4-Md-7-Md-1-d
- Md-4-Md-2-d
- Md-4-Md-7-Md-4-d
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
The immunoblots were quantified by densitometry software ImageJ 1.17 developed by Wayne Rasband, NIH Bethesda, MD (http://rsb.info.nih.gov/nih-image).All experiments were done at least in triplicates and results were expressed as mean ±s.e.m. A two tailedStudent’s t-test was done in Graph pad to arrive at p values and differences were considered statistically significant when p-value was less than 0.05 (*p≤ 0.05), highly significant(**p≤ 0.01)andextremely significant (***p≤ 0.001)
-
Quantification of blots and statistical analysis
-
A total of 100-200ng of DNA was used in each ligation reaction. Vector to insert ratio of 1:3 to 1:5was maintained. The reaction volume was generally maintained at 10μl containing 1μl of 10X ligation buffer (provided by the manufacturer) and 0.05 Weissunit of T4-DNA ligase. The reaction was carried outat 16ºC for 14-to 16-hrs or at room temperature for 4hours
-
Ligation of DNA
-
Agarose gels were preparedby boiling appropriate amount of agarose in TAEbuffer. After dissolution, it was cooled and then poured in a casting tray containing a comb for desired number of wells. The gel was allowed to solidify and then shifted to horizontal electrophoresis tank containing TAE buffer. The DNA samples were mixed with appropriate volumes of 6X DNA loading dye, loaded on the gel andelectrophoresedat appropriate voltage and current conditions (generally 80 V,400 mA). The gel was stained in ethidium bromide solution(1 μg/ml)for 15-min at room temperature and visualisedby fluorescence under UV-light in a UV-transilluminator
-
Agarose Gel Electrophoresis
-
For preparation ofcellular homogenate from adherent cell culture, the medium was first removed and cells were washed with ice cold 1X PBS. The cells were then scraped in 1X PBS and pellet down by gentle centrifugation (4000 rpm for 2 minutes) at 40C. Cell lysis buffer was then added to the cell pellets and lysis was allowed for 30 minutes on a rotor at 4⁰C. Post lysis, cellswere centrifuged at 13000 rpm for 10min at 4°C. The pellet was discarded and supernatantwascollectedas cell homogenate
-
Extraction of total cellular protein
-
Binding Buffer (10X)
-
Blocking buffer: 2% BSA
-
Permeabilization buffer: 0.2% Triton X100
-
Fixative : 4% Formaldehyde
-
For Immunofluorescence
-
Running Buffer
-
Ethylene Glycol Tetraacetic acid (EGTA), pH 7.0ComponentsFinal concentrationFor 50 mlEGTA0.1M1.902gH2Oq.sThe pH is adjusted to 7.0 using 10M NaOH
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Wound healing assay(Liang et al., 2007) was employed to study the difference in migration rates ofprofilin-stable compared to parentalcells. Briefly, cells were cultured upto 90-95% confluent monolayer and a scratch was created through the cell monolayer with sterile needle. Cell debris was then removed by washing with PBS before adding the media. Images of the open gap created by this “wound” were then captured at three random locations immediately (0 h) and then at the same locations after regular interval using phase contrast microscopy untilthey are closed by migrating cells. Captured images were then used to quantify wound closure by the percentage change in the wound area per unit time and averaged for three locations for each experimental condition. During the course of the experiment, cells were maintained in 0.1% FBS containing DMEM media to ensure that wound closurewas due to the migration of cells rather thandivisonof cells
-
Wound healing assay
-
Extraction buffer
-
MTT reagent
-
For Cytotoxicity assays
-
6XEMSA sample loading dye
-
5X EMSA buffer
-
Native EMSA PAGE
-
10XBinding buffer
-
For Electrophoretic Mobility Shift Assay (EMSA)
-
For preparation of Ultra competent cells
-
Inoue buffer
-
6X DNA loading dye
-
Agarose gel
-
TAE
-
For DNA electrophoresis
-
Nuclear lysis buffer (without protease inhibitors
-
Cytoplasmic extraction buffer (without protease inhibitors)
-
For Cell fractionation
-
Blocking buffer: 2% BSA
-
Permeabilisation buffer: 0.2% Triton X100
-
4% Formaldehyde fixative
-
For Immunofluorescence(IF)
-
Stripping buffer
-
Blocking buffer
-
TBS-T
Tags
- Mt-4-Mt-1-Mt-6-Mt-1-d
- Mt-4-Mt-1-Mt-7-Mt-4-d
- Mt-4-Mt-1-Mt-4-Mt-2-d
- Mt-4-Mt-1-Mt-7-Mt-3-d
- Mt-4-Mt-1-Mt-8-Mt-1-d
- Md-4-d
- Mt-4-Mt-1-Mt-4-Mt
- Mt-4-Mt-1-Mt-6
- Mt-4-Mt-1-Mt-5-Mt-2-d
- Mt-4-Mt-1-Mt-4-Mt-1-d
- Mt-4-Mt-1-Mt-2-Mt-7-d
- Mt-4-Mt-1-Mt-5
- Mt-4-Mt-1-Mt-5-Mt-1-d
- Mt-4-Mt-1-Mt-7-Mt-1-d
- Mt-4-Mt-1-Mt-3-Mt-2-d
- Mt-4-Mt-1-Mt-5-Mt-3-d
- Mt-4-Mt-1-Mt-2-Mt-9-d
- Mt-4-Mt-1-Mt-3-Mt-3-d
- Mt-4-Mt-1-Mt-2-Mt-8-d
- Mt-4-Mt-1-Mt-8-Mt-2-d
- Md-4
- Mt-4-Mt-1-Mt-3-Mt-1-d
- Mt-4-Mt-1-Mt-8
- Mt-4-Mt-1-Mt-3
- Mt-4-Mt-1-Mt-7-Mt-2-d
- Mt-4-Mt-1-Mt-7
Annotators
URL
-