On 2016 Nov 23, Sin Hang Lee commented:

Thanks for the clarification.

On 2016 Nov 21, Steven M Callister commented:

In our report, we correctly state that the 142 bp segments of our amplified products had 100% homology with B. miyamotoi. However, the reader is also correct that our analyses did not include the entire amplified 145 bp seqment, since we did not include the complete primer sequences. As the reader stated, there is indeed one mismatch when the primer sequences are included. However, there is still >99% homology with the B. miyamotoi CP006647.2 sequence, so the oversight does not change the legitimacy of our conclusion. As an additional point, we have also since sequenced the entire glpQ from a human patient from our region positive by PCR for B. miyamotoi, and found 100% homology with the CP006647.2 glpQ sequence.

On 2016 Nov 15, Sin Hang Lee commented:

To the Editors: Jobe and colleagues [1] used polymerase chain reaction (PCR) to amplify a 142-bp fragment of a borrelial glycerophosphodiester phosphodiesterase (glpQ) gene in the blood samples of 7 patients. The sequences of the PCR primers were 5′-GATAATATTCCTGTTATAATGC-3′ (forward) and 5′-CACTGAGATTTAGTGATTTAAGTTC-3′ (reverse), respectively. The DNA sequence of the PCR amplicon was reported to be 100% homologous with that of the glpQ gene of Borrelia miyamotoi LB-2001 (GenBank accession no. CP006647.2) in each case. However, the database entry retrieved from GenBank accession no. CP006647.2 shows a 907293-base complete genome of B. miyamotoi which contains a 145-nucleotide segment in the glpQ gene starting with sequence GACAATATTCCTGTTATAATGC and ending with sequence GAACTTAAATCACTAAATCTCAGTG (position 248633 to 248777) matching the binding sites of the PCR primers referenced above with one-base mismatch (C) at the forward primer site. Because there is at least one base mismatch and a 3-base difference between the size of the PCR amplicon and the length of the defined DNA sequence entered in the GenBank database, the amplicon reported by the authors cannot be “100% homologous with that of B. miyamotoi LB-2001”. The authors should publish the base-calling electropherogram of the 142-bp PCR amplicon for an open review. Perhaps, they have uncovered a novel borrelial species in these 7 patients. References 1. Jobe DA, Lovrich SD, Oldenburg DG, Kowalski TJ, Callister SM. Borrelia miyamotoi infection in patients from upper midwestern United States, 2014–2015. Emerg Infect Dis. 2016 Aug. http://dx.doi.org/10.3201/eid2208.151878 Sin Hang Lee, MD Milford Molecular Diagnostics Laboratory Milford, CT Shlee01@snet.net

On 2016 Nov 15, Sin Hang Lee commented:

To the Editors: Jobe and colleagues [1] used polymerase chain reaction (PCR) to amplify a 142-bp fragment of a borrelial glycerophosphodiester phosphodiesterase (glpQ) gene in the blood samples of 7 patients. The sequences of the PCR primers were 5′-GATAATATTCCTGTTATAATGC-3′ (forward) and 5′-CACTGAGATTTAGTGATTTAAGTTC-3′ (reverse), respectively. The DNA sequence of the PCR amplicon was reported to be 100% homologous with that of the glpQ gene of Borrelia miyamotoi LB-2001 (GenBank accession no. CP006647.2) in each case. However, the database entry retrieved from GenBank accession no. CP006647.2 shows a 907293-base complete genome of B. miyamotoi which contains a 145-nucleotide segment in the glpQ gene starting with sequence GACAATATTCCTGTTATAATGC and ending with sequence GAACTTAAATCACTAAATCTCAGTG (position 248633 to 248777) matching the binding sites of the PCR primers referenced above with one-base mismatch (C) at the forward primer site. Because there is at least one base mismatch and a 3-base difference between the size of the PCR amplicon and the length of the defined DNA sequence entered in the GenBank database, the amplicon reported by the authors cannot be “100% homologous with that of B. miyamotoi LB-2001”. The authors should publish the base-calling electropherogram of the 142-bp PCR amplicon for an open review. Perhaps, they have uncovered a novel borrelial species in these 7 patients. References 1. Jobe DA, Lovrich SD, Oldenburg DG, Kowalski TJ, Callister SM. Borrelia miyamotoi infection in patients from upper midwestern United States, 2014–2015. Emerg Infect Dis. 2016 Aug. http://dx.doi.org/10.3201/eid2208.151878 Sin Hang Lee, MD Milford Molecular Diagnostics Laboratory Milford, CT Shlee01@snet.net