- Jul 2018
-
europepmc.org europepmc.org
-
On 2017 Nov 17, Xinlai Cheng commented:
Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:
sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc
we can also provide you our established cell line. Let me know if you want
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2017 Nov 15, Nirajkumar Makadiya commented:
Hi,
What sgRNA sequences were used in the KO cell line generation?
Thank you!
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
- Feb 2018
-
europepmc.org europepmc.org
-
On 2017 Nov 15, Nirajkumar Makadiya commented:
Hi,
What sgRNA sequences were used in the KO cell line generation?
Thank you!
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY. -
On 2017 Nov 17, Xinlai Cheng commented:
Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:
sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc
we can also provide you our established cell line. Let me know if you want
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-