4 Matching Annotations
  1. Jul 2018
    1. On 2017 Nov 17, Xinlai Cheng commented:

      Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

      sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

      we can also provide you our established cell line. Let me know if you want


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

  2. Feb 2018
    1. On 2017 Nov 17, Xinlai Cheng commented:

      Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

      sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

      we can also provide you our established cell line. Let me know if you want


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.