On 2017 Nov 17, Xinlai Cheng commented:

Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

we can also provide you our established cell line. Let me know if you want

On 2017 Nov 15, Nirajkumar Makadiya commented:

Hi,

What sgRNA sequences were used in the KO cell line generation?

Thank you!

On 2017 Nov 15, Nirajkumar Makadiya commented:

Hi,

What sgRNA sequences were used in the KO cell line generation?

Thank you!

On 2017 Nov 17, Xinlai Cheng commented:

Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

we can also provide you our established cell line. Let me know if you want