10,000 Matching Annotations
  1. Last 7 days
    1. On 2019-05-18 23:25:12, user Mary Witt wrote:

      Dear Authors,

      Could you explain if some relationship could be observed between this manuscript and the following reported animal model?<br /> "Generation of a novel, multi-stage, progressive, and transplantable model of plasma cell neoplasms"<br /> https://www.nature.com/arti...<br /> Kind regards,

      Mary Witt

    1. On 2019-05-17 22:43:24, user Douglas Porter wrote:

      This is the first author. Let me know if there is anything unclear in <br /> the protocol or there is any trouble with it. The method should really <br /> work as described out of the box pretty easily. I hope this is useful, <br /> especially to someone just starting out. There are many very excellent <br /> other CLIP protocols out there (eCLIP, iCLIP, PAR-CLIP, irCLIP), and this work is meant to provide its own particular usages (absolute <br /> quantification, ease of use, distinguishing RBPs, ect...), and insights.<br /> I hope it is helpful and you can contact me with any questions.

    1. On 2019-05-17 09:40:35, user Wouter De Coster wrote:

      Dear authors,

      Thank you for your interesting article. I would like to point you to an article which is worth discussing in this context: https://www.sciencedirect.c... <br /> Admittedly, I don't know much about machine learning but I am very enthusiastic about its application in large datasets in the context of genetics. However it seems that a better AUC is obtained using a more straightforward regression approach.

      Regards,<br /> Wouter De Coster

    1. On 2019-05-16 21:51:48, user Alberto Gonzalez wrote:

      Italy1 influence needs to be reviewed, specially after the last paper from Olalde suggesting that modern Spanish people are in between Basques and Southern Italians since the Roman period.

    1. On 2019-05-16 21:13:18, user Anasto wrote:

      So much wishful thinking in one paper. Lots of claims of ‘proof’ where no such thing was shown. Here’s a list from reading just the first half: <br /> - 16S for identification of an actinobacteria strain is like from the 1990s. We know more about ribosomal sequence diversity these days. <br /> - Sampling effort is weak. The insects were pooled? - likely mixing environmental microbes. Not replicated over time and space. Cannot make claims about symbiosis from bugs caught in two traps. <br /> - The chitin media seem to be super low nutrient. The strep was isolated because this media was used, not because the bacteria is biologically meaningful. Why did you not use any other method? <br /> - The sampling from the nests was not really replication. A contaminant would turn up in exactly the same pattern if sampled from insects and nest material from the same three tubes. <br /> - The supposedly “mutualistic” streptomyces was detected in trace amounts (a few CFUs form large chunks of material or pooled bug samples). Why believe that it is biologically relevant? <br /> - The putative closest relative strep on genbank is a common soil bacteria. Makes me think that this really is a contaminant. <br /> - No attempt to work with the fungus of one of the insects. It was not even isolated or confirmed. Any conclusion about that system is moot. <br /> - Using some artificial agar and sawdust goo for the nests. Bound to be totally different than dead wood, and support/select an unnatural set of microbes.<br /> - I pull this one out verbatim first because it sums it all… line 381: “The consistent isolation of this Nectria sp. suggests that it is vectored by the ambrosia beetles”. There is a hundred years of literature showing that you cannot infer a vector, not to mention a symbiont, from just occurrences in media. You cannot ignore a century of research and throw around these vague claims. Nectria is common in sick plants, and there is no evidence that it interacts with these bugs, other than simply living in the same substrate. What if the bacteria and the Nectria are simply in the same habitat as the bugs, and THAT’s why they are in the samples? You need environmental control samples.

      I stopped here – too many problems.

    1. On 2019-05-16 19:36:47, user Anuprita wrote:

      Hi,<br /> I'm a Master's student and for my final project I'm interested in this dataset.<br /> Can you please tell me how can I get access to the Supplementary table information. I'm specifically interested in the Supplementary Table 6 information. In the supplementary information provided I was unable to find the full information in the supplementary tables. Please help.<br /> Thank you in advance <br /> Regards<br /> Anuprita

    1. On 2019-05-15 21:09:37, user Adam Taranto wrote:

      This paper has got me thinking about what it means for a MITE to be "expressed" and if that is the same thing as not being suppressed/controlled.

      Unlike retrotransposons, TIR family DNA-transposons (and their non-autonomous derivatives - MITEs) do not have a transpositional RNA intermediate. Though active transposition of MITEs does require the expression of a cognate TPase from an intact parent element elsewhere in the genome, it does not follow that all RNA-seq reads mapping to MITEs are derived from such elements.

      I think there are plausible scenarios in which MITE sequences are transcribed but not themselves active.

      1) Transcripts mapping to MITEs are derived from TPase-transcripts in parent elements.

      Most TIR-family elements have internal Pol-II promoters for expression of their TPases. Transcripts from autonomous elements should map at least partially to an internal segment of a related MITE.

      This option and probably be ruled out as no autonomous forms of MITE-Undine were found in Zt. Further, it looks like "TEtranscripts" requires a TE to be fully contained within a transcript to be counted. In this case parent-element derived transcripts might be excluded anyway.

      2) MITEs are present in TE-rich regions and may be captured in retrotransposon transcripts.

      You report that MITE-Undine is present in gene-poor regions of the Zt genome. This is usually a good proxy for TE-richness in ascomycete genomes. The paper also mentions that LTR-retrotransposons are among the most abundant elements in Zt. LTRs contain intrinsic regulatory elements (i.e. PolII promoters) which drive their own expression and can become novel promoters for nearby genes / ncRNAs.

      If these MITEs are nested within or adjacent to the more abundant LTR-elements they might just be present in LTR-derived transcripts.

      3) MITEs may be over-represented in the UTRs of stress-induced genes.

      MITEs have a preference for inserting within open chromatin. MITEs require the expression of cognate TPases for transposition and TPases from autonomous TIR-element counterparts are often de-repressed under stress conditions. It would follow that MITEs may disproportionately find themselves inserted in the promoters of genes that are incidentally also highly expressed under stress conditions (or other chromatin that is accessible at that time).

      In this case, MITEs may appear to be "expressed" as they are transcribed as part of the UTR of stress-induced genes. This is likely the case for mimps in Fusarium spp. where they are common in the 5' UTRs of early effectors BUT have no observed effect on expression themselves.

      This might be less likely specifically for MITE-Undine as it seems to be highly "expressed" under all conditions and generally far from neighbouring genes.

      4) MITE-Undine elements may retain cis-regulatory functions.

      This would be pretty cool. Do you see transcripts initiating within these MITEs rather than just spanning the full MITE? Could this explain why MITE-Undine is highly expressed in Figure S5A-D?

      It would be nice to see a MITE-Undine reference sequence included in the manuscript.

    1. On 2019-05-15 20:39:34, user Annette Anderson wrote:

      Very interesting paper on a novel DCTN1 splice variant in bipolar disorder. This relates to our recent unpublished finding of a severely affected boy with autism where we have found a predicted pathogenic variant in him and his autistic mother in the same DCTN1 gene. However, in a different region of the gene, in the highly conserved binding region for the dynein intermediate chain. Thus, it is predicted that this likewise will also result in severe autophagy deficits. Could the author comment on our related finding as a significant proportion (25-30%) of autistic patients also have bipolar disorder?

    1. On 2019-05-15 19:30:18, user Kunal Dutta wrote:

      Dear Readers,

      In the spirit of this preprint server, we respectfully solicit any questions, comments or thoughts that would assist this line of research. Thank you all, sincerest regards,

      Kunal

    1. On 2019-05-15 17:33:18, user Joe Yeong wrote:

      We would like to share this good marker to the field as a preprint. Full paper is under review, with more patients, details and completed clinical info. Welcome any comments and validation!

    1. On 2019-05-15 11:05:14, user Guest wrote:

      It makes no sense that Tuscans have South Asian admixture, and no other study shows that. Something's wrong. And in Figure S9C, ALL of the European samples show almost as much non-European (mostly South Asian) admixture as the Afrikaners. That makes no sense either.

    1. On 2019-05-15 08:45:58, user M Parker wrote:

      Combining structural information with machine learning seems to be a powerful approach for predicting drug resistance, however this work seems to have essentially just replicated work that was published last year (https://doi.org/10.1164/rcc..., and replicated many of the same figures, with no real gain in performance or insight.

    1. On 2019-05-14 19:11:55, user Gary Brazzell wrote:

      We should not attribute the measured gains to respiratory muscle training (RMT) based on this study, but the study does do a nice job of quantifying the gains available through home health.

      A previous meta-analysis found that RMT alone was not better than wait list control groups.(1) However, COPD patients receiving lower extremity training only performed better on shortness of breath tests (1), and other studies have found that upper extremity training improves ventilator muscle recruitment.(2-5) Based on this evidence, it would be safer to say that the lower and upper extremity training in this study did more to ameliorate COPD symptoms than the RMT. Future investigations should compare home health with and without RMT to discern the usefulness of RMT. It is likely that shortening the rehab program to only its effective elements can improve adherence.

      References:<br /> 1. Salman G, Mosier M, Beasley B, et al. “Rehabilitation for patients with chronic obstructive pulmo-nary disease: meta-analysis of randomized controlled trials.” J Gen Intern Med. 2003: 18 (3): 213-21.<br /> 2. Celli B, Rassulo J, Make B. Dysynchronous breathing during arm but not leg exercise in patients with chronic airflow obstruction. N Engl J Med. 1986; 314: 1485-90.<br /> 3. Criner G, Celli B. Effect of unsupported arm exercise on ventilator muscle recruitment in patients with severe chronic airflow obstruction. Am Rev Respir Dis. 1988; 138: 856-61.<br /> 4. Martinez F, Couser J, Celli B. Respiratory response to arm elevation in patients with chronic air-flow obstruction. Am Rev Respir Dis. 1991; 143: 476-80.<br /> 5. Costi S, Crisafulli E, Antoni F, et al. Effects of unsupported upper extremity exercise training in patients with COPD – a randomized clinical trial. Chest. 2009; 136: 387-395.

    1. On 2019-05-14 17:12:51, user rpwnhlbi wrote:

      Not sure promoting private email addresses is worth the risk, even if they're more permanent. Too many examples of fake authors / reviewers involved in the publishing process as a result. ORCiD helps address this pretty well, but barring such verification, I'd always be skeptical of Gmail (etc) addresses as a journal editor or conference reviewer. I would indeed echo the recommendation for institutions to install forwarding services to departed faculty email accounts.

    1. On 2019-05-14 13:06:09, user John Wilson wrote:

      Dear Readers,

      In the spirit of this preprint server, we respectfully solicit any questions, comments or thoughts that would assist this line of research. Thank you all, sincerest regards,

      John

    1. On 2019-05-14 05:17:04, user Preeti Garai wrote:

      This manuscript from Garai et al. has been recently accepted for <br /> publication in PLOS Pathogens. Significant changes have been made to the <br /> preprint during the revision process and a link to the published article <br /> is forthcoming.

    1. On 2019-05-13 14:43:41, user Jan Janouškovec wrote:

      Hi, this looks quite useful and in line with earlier conclusion based on long Sanger-derived rDNA contigs. A couple very small suggestions about the apicomplexan part, even if this is not quite in the focus. You talk about resolving "neogregarines" as a group with the combined dataset but several papers before you have shown they are polyphyletic. Ascogregarina is not even a neogregarine and you can't really compare the poor sampling in your concatenated tree to Rueckert et al., 2011 or other publications. I'd consider avoiding the name altogether (they are all eugregarines, really). I would also not introduce gregarine as "paraphyletic" since this question is far from resolved. Of note, Simdyanov et al., 2017, Peer J, have done good work on comparing the resolution power of the 18S+28S concatenation over 18S alone in gregarines and all apicomplexans, including some <br /> relationships discussed in this paper; perhaps something to mention here too. Good luck.

    1. On 2019-05-11 17:36:32, user Luis Mauricio T.R. Lima wrote:

      Dear readers,<br /> I've noticed an error at lines 200-201 of the manuscript, where zinc content are inverted between control and intervention<br /> Please read "(38 mg/kg CONTROL vs 11 mg/kg INTERVENTION)". Throughout the manuscript and analytical certification (Supplemental Material) these data are stated correctly.

      Sorry for the inconvenience, thanks for comprehension.

      Best, Mauricio

    1. On 2019-05-11 15:09:48, user Yan Wong wrote:

      Hello, <br /> I am a graduate student from the University of Toronto and I was really amazed by the EWAS approach and findings of the study. I am very interested in reading more about the correlation between blood and brain methylation, but I was unable to find the related supplementary figures in the article. I am, therefore, writing to see if the supplementary figures and tables could be found anywhere on the BioRXiv website, or how I may find access to them? Thank you very much in advance.<br /> Yan

    1. On 2019-05-10 20:03:29, user Yichao Li wrote:

      The method in this paper: PWM -> TFM-pvalue -> k-mers -> intersect with dnase-seq -> assign score using chip-seq

      I think essentially, this process is given true / false labels defined by chip-seq, build a machine learning model using k-mers and dnase-seq. Then I think a machine learning model would beat the method stated in this paper.

      To better predict the effects of SNPs, first, you have to be able to accurately predict transcription factor binding sites (ENCODE-DREAM); otherwise, how can we believe the prediction of SNP effects are true? I think for this paper, it's missing this part.

    1. On 2019-05-10 06:28:34, user Milind Watve wrote:

      Our manuscript was rejected by a leading journal with comments by three reviewers. We expressed our desire that in the spirit of transparency of the review process, the reviewers’ comments and our responses should be allowed to be posted and made public. Two of the two reviewers and the journal editors agreed to the request and therefore we are posting their comments and our responses to them here. Although the journal editors consented to post them, on the advice of Biorxiv admin, we are keeping the journal, editors as well as reviewers anonymous. <br /> Rejection is a part of the game and we respect the editors’ decision. However, the reasons for rejection should be transparent so that readers can make their own judgment about the fairness of the editorial process. Transparency would make the review process more responsible and we express our full support to it. <br /> We thank the editors and all the three reviewers for their inputs. We would have been happier if reviewer 1 also agreed to post his comments.<br /> Milind


      Reviewer #1:<br /> Did not respond to the request for consent to post the comments.

      Reviewer #2:

      The authors provide a systematic literature study on the question: “does insulin signaling decide glucose levels in the fasting steady state?”. The answer is a clear no. Although the overview looks solid - I am not an expert in all the literature on glucose homeostasis, so I cannot decide on that, really – the conceptual aspects of this study are rather weak. This may very well reflect the general weakness in conceptual thinking in biomedical sciences, but certainly the control engineers that build feedback control system for artificial pancreas applications will find the answer trivial. The authors use biologically fuzzy terminology, such as “drivers” and navigators”, CSS and TSS, and later r and K strategies, where terminology of control theory would be most appropriate. Not a single reference to control theory, where an integral feedback principle could explain much, if not all of the observations, it seems.

      Response: The reviewer appropriately captures the state of control theory and models by the words “much, if not all”. All the models of glucose homeostasis today explain only a small part of the demonstrated features of glucose homeostasis and of diabetes. The “much” is a very small fraction of reality and most models stop at explaining only some of the features. Not being able to explain a certain empirical finding does not immediately invalidate a model. However, a direct contradiction with empirical findings certainly raises questions about the model. The model suggested by the reviewer below is an excellent example of it.

      For illustration: if the CSS model that the authors use in the supplements is slightly modified by:

      dGlc/dt = (Gt+L) – K1 Glc – Ins_sens K2 ins<br /> dIns/dt = K3 Glc - d

      (so insulin removal is independent of the insulin level), then at steady state of this coupled system (where dGlc/dt = dIns/dt = 0):<br /> Glc_s = d/K3<br /> Ins_s = {(Gt+L) – K1/K3 d }/(Ins_sens K2)

      Thus, Glc at steady state is independent of insulin sensitivity, or glucose production or consumption. It is also said to be perfectly adapted to these parameters. So if Ins_sens is lower, Ins_s will be higher but glc_s remains the same: a perfect basis for the HOMA index!<br /> Only the experiments with reduced removal of Ins (parameter d) would be expected to have lower glucose, but of course this is a very very simple model of glucose homeostasis. Also poor synthesis of insulin by impaired beta cells would lower K3 and this may explain higher fasting glucose levels.

      Response: This is an interesting model and a perfect example of how in order to explain one empirical finding the model contradicts many others. Certainly the model accounts for hyperinsulinemia in response to insulin resistance without a change in glucose level. However, it does not explain the results of insulin degrading enzyme knockouts, which would decrease d and is thereby expected to increase glucose, but that does not happen in experiments. Further we simulated using this model to see whether the FG-FI correlation in the steady state would be different than during post glucose load dynamics. Even in this model the regression correlation parameters remain the same and only the range shifts upwards. Thus the model suggested by the reviewer does not account for the experimental and epidemiological results that we cite in this manuscript. <br /> The focus of our manuscript is to look at convergence of many sets of experiments and therefore suggesting a model that satisfies one but not others is not an appropriate solution. <br /> The other problem with the model suggested by the reviewer is that it makes an assumption of constant degradation rate of insulin independent of its standing concentration. Most biochemical decays are known to follow negative exponential. If you want to make an assumption deviant with the general pattern, you need a justification and validation for the assumption. In the case of insulin there is published literature on the half-life of insulin.So the baseline assumption should be that insulin degradation follows half-life dynamics and if you want to make any other assumption, you need convincing justification for it.<br /> So I am a bit puzzled. What is the point of this paper? Does anyone take CSS seriously, really? Again, I do not know all the literature but I am sure there are good models out there that can and do explain T2D and glucose homeostasis very well. <br /> Response: The whole point is that in existing there isn’t a model that does so. Believing that there are good models out there is not sufficient for the reviewer. If there is any kindly point it out specifically. <br /> Should ….(Journal name)…. fix a failure in the education of doctors? And if ….(journal name)… decide they want to do that, please teach them the right vocabulary and conceptual frame work, and properly cite the control theory literature!<br /> Response: We would be glad if control theory has a model that is compatible with all the empirical results pointed out in our manuscript. It is not enough for the reviewer to say that there are. Kindly point out specifically if there really are. As far as we know there aren’t any. But this manuscript is not an intended review of models, it rather lays out the set of experimental results and epidemiological patterns that any model of glucose homeostasis needs to explain. This set has been put together for the first time and that is the main contribution of the paper. Our central argument is that glucose homeostasis needs to take into account all these results TOGETHER. You cannot look at partial picture again and say there are models that are compatible with the partial picture. <br /> To the best of our knowledge, none of the existing models would explain all of them together. We are suggesting here that this is because the set of foundational assumptions of these models is not correct. We are suggesting what change might be needed in it. Building models with the new set of assumptions would certainly deserve a separate publication. Our manuscript is not intended to give the answer, we are defining the question in a broader perspective that has not been taken so far.

      Specific comments:<br /> 1. “The belief that this product (HOMA) reflects insulin resistance is necessarily based on the assumption that insulin signalling alone quantitatively determines glucose level in a fasting steady state.”<br /> I really do not get this. See the above simple model: many parameters determine the steady state levels, but if Ins_sens is lower (or L is higher by less insulin inhibition), steady state insulin is higher at the same glucose concentration, so HOMA makes perfect sense to me. Obviously, there can be other ways to change HOMA, but it is simple and effective in the clinic.<br /> Response: HOMA does make sense w.r.t the above model but as pointed out earlier this model has multiple flaws and unless we have a model that is compatible with all experimental and epidemiological results it is difficult to claim that HOMA makes sense.

      1. “There is a subtle circularity in the working definition of insulin resistance. Insulin resistance is blamed for the failure of normal or elevated levels of insulin to regulate glucose…. However, clinically insulin resistance is measured by the inability of insulin to regulate glucose. Such a measure cannot be used to test the hypothesis that insulin resistance leads to the failure of insulin to regulate glucose.”<br /> Sorry but the circularity is so subtle that I miss it. If the argument is that insulin regulation is impaired in insulin resistance (what’s in the name), people should measure the action of insulin, right? What is wrong here?<br /> Response: To explain the circularity in different words-<br /> (i) Insulin is unable to regulate glucose because the body has insulin resistance<br /> (ii) Insulin resistance is measured as the inability of insulin to regulate glucose<br /> (iii) Put (i) and (ii) together, it reads “insulin is unable to regulate glucose because of the inability of insulin to regulate glucose”<br /> Isn’t this circular enough or is more clarification needed?

      2. line 437: suddenly, “hysteresis” appears out of nowhere. What is this? Please explain properly if relevant, do you really think these poor doctors know what that is?<br /> Response: We agree and will revise the text here to explain the context without the word “hysteresis”.<br /> In brief, the comments by this reviewer are thought provoking and we learnt a lot while addressing them, but they leave us with a little bit of doubt about the soundness of his/her ideas about control theory. <br /> --

      Reviewer #3:

      This is a very interesting question, and a novel approach to addressing it. I have focussed primarily on the systematic review aspects.<br /> 1. The meta-analysis technique used is essentially "vote counting", and this is not recommended (see https://handbook-5-1.cochra... for reasons given in the reference.<br /> Response: Many many thanks to the reviewer for pointing this out. We read the link carefully to find that our analysis is very sound by these guidelines. It does not recommend vote counting in significant versus non-significant types of outcomes. But it clearly says, <br /> “To undertake vote counting properly the number of studies showing harm should be compared with the number showing benefit, regardless of the statistical significance or size of their results. A sign test can be used to assess the significance of evidence for the existence of an effect in either direction”<br /> This is precisely what we have done. So this comment validates our analysis and increases our confidence. Thanks once again. <br /> 2. I could find no mention of a PROSPERO registration - this is important<br /> Response: We agree and will improve during revision.<br /> 3. There is no attempt, as far as I can see, to address the possibility of publication bias<br /> Response: Publication biases are discussed already in the main text line 125-129, but we will elaborate more and also include in supplemental table 3.<br /> 4. The analysis is not reported in a way consistent with the PRISMA guidelines (although these relate to reviews of human data, they have lessons for animal reviews<br /> Response: We made our best attempts to follow PRISMA guidelines for animal experiment reviews as well. It would have been more useful if any inconsistency was specifically pointed out by the reviewer.<br /> 5. There is, as far as I can see, no assessment of risks of bias in the contributing animal studies<br /> Response: We agree and would be glad to improve on. <br /> 6. In my view, it is not enough to say that data will be made available on acceptance - part of peer review should be to ensure that it is made available in a form which is complete, comprehensible and useable, so it needs to be avaialble (even if only through a private link) at this stage.<br /> Response: That is certainly possible and will be done for the revised version.

      Regarding the animal experiments these should be reported according to the ARRIVE guidelines, and as far as I can see (I may have missed it, or you may have done it but not reported it) these were non randomised unblinded experiments without an a priori sample size calculation.<br /> Response: We see the importance of reporting these details for the primary experiments that we performed, but for the review and meta-analysis section we do not have control over what the authors did.<br /> In a nutshell, comments by all the three reviewers are a convincing reinforcement that our central argument is sound and strong. We agree with many of the refinement suggestions and look forward to publish a revised version soon.

    1. On 2019-05-09 13:51:49, user David Hoksza wrote:

      Very cool. But the overview of existing tools might might be missing ProtVista and more importantly MolArt, the tool integrating ProtVista and LiteMol tools into a single javascript plugin.

    1. On 2019-05-09 09:59:17, user Koen van den Dries wrote:

      The cartoons in Figure 1B and Supplementary Figure 1 seem to incorrectly depict the myosin IIB tension sensors (except for the S1 variant). The myosin IIB motor complex is composed of two myosin heavy chains which is why two modules should have been drawn if I am not mistaken. Same is true for the depicted point mutation and the N-terminal mTFP (which should be present at both heads in the dimer).

    1. On 2019-05-09 02:59:04, user Yanmei Huang wrote:

      Hi, Thanks for creating a very nice tool! One question: what is the definition of "Noise" and "Signal" in Figure 2 and Figure 3? How are they calculated?

    1. On 2019-05-07 14:12:56, user Zaved Hazarika wrote:

      Dear Marziyeh<br /> I have performed a similar work. However in our MD of ZnO NP in water (4nm,2838 atoms, Amber99sb ff), all same parameters considered, the ZnO NP is not getting stabilized over 100ns time. Can you kindly provide your raw data to cross check with ours?<br /> Regards<br /> Zaved Hazarika<br /> Research Scholar<br /> Dept.of MBBT,<br /> Tezpur University<br /> India<br /> email:zaved@tezu.ernet.in

    1. On 2019-05-07 09:32:09, user Daniel Blaese wrote:

      I'm not trying to be pedantic, but shouldn't the title be corrected to "Carbon monoxide dehydrogenases enhance bacterial survival by oxidizing atmospheric CO"? The organism of interest doesn't respire the CO either, it respires oxygen. It is obvious that the authors understand this difference (2nd sentence of the abstract) but I find it very strange to say the organism respires CO when it does not respire CO. Just like E. coli does not respire glucose during aerobic growth. Or am I missing something here?

    1. On 2019-05-07 01:17:57, user Keith Robison wrote:

      I've written a pair of analyses on this -- some key criticisms are the lack of technical detail and that the analysis of errors is much less detailed than desired. There's also the lack of specificity in the text as to which data was deposited publicly -- only the E.coli is available. Also, the phred quality scores are overestimated at the high end by perhaps as many as 5 points.<br /> Poking at Genapsys Preprint<br /> Genapsys' Base Caller: Mysterious, But Not Ideal?

    1. On 2019-05-04 18:37:34, user L. T. Fang wrote:

      Detailed documentation of the somatic mutation analysis can also be found at https://sites.google.com/vi.... That page is continuously maintained and updated to reflect the latest finding and version updates with regard to the somatic mutation "ground truth."<br /> Comments are welcome here.

    1. On 2019-05-02 09:03:06, user david morris wrote:

      "One is that you quote the AUC for only the best performing GRS. It ought to be obvious that you can't just try a number of different ways of getting the GRS and then only highlight the one which does best. (Especially as you applied it to three different datasets and only report the best of the three.)"<br /> REPLY: We highlight in the paper that a GRS using SNPs that pass p < 1E-05 consistently does best across all two-way training and test data sets. Few studies have compared this for the same disease in multiple GWAS. We are open about these tests in the paper and the take away message for this point was the likely polygenetic nature of SLE, however this was not the main result or the main point which was concerned with the GRS loading in renal patients.

      "Another concern is that you don't say how much the GRS improves the AUC compared with a predictor just derived from HLA."<br /> REPLY: The HLA or more widely the MHC does not do well when used as a region to form a GRS due to it being very difficult to derive a good model of association that agrees across multiple data. This is due to it not being well typed in terms of structural variation. In short it would be naïve to use the MHC in GRS without better coverage of the locus.

      "Also, in the methods section you suggest that the effect size for each SNP is derived from its original publication but subsequently it looks as though you have fitted your own effect sizes using a training set."<br /> REPLY: This is true for the GRS used in renal prediction (only published sle associated SNPs). We estimated effect sizes in training sets when looking at the GRS across multiple GWAS for SLE.

      "There are huge ancestry effects in SLE. How do you know you haven't just picked up a GRS for ancestry? (https://www.ncbi.nlm.nih.go... plus lots of other recent papers) "GRS has been showed to be predictive for several diseases including cardiovascular disease (AUC=0.81, 95%CI: 0.81-0.81)" - Um no, that is not the AUC for the GRS, as you point out later."<br /> REPLY: Agreed on last point, we need to clarify our take on that paper. This helps our argument that GRS for SLE does relatively well. The point on ancestry: the paper you refer to gives several reasons for the observation in Schizophrenia of the mean PRS differing between African and Europeans including that the PRS does indicate susceptibility to disease and that observed differences are due to negative selection, but does not have any evidence to settle on one explanation and like other papers on this issue is more a warning to consider these points, which we agree with, rather than dismiss results on PRS.

      "Finally, you suggest that the GRS might "assist early prediction of lupus nephritis in a clinical setting". I strongly doubt this is the case. What is the magnitude of this effect? What would be the clinical utility of such a predictor? (See https://www.nature.com/arti..."<br /> REPLY: Why do you strongly doubt this? We have found that the SLE GRS does segregate SLE Renal from SLE non-renal. We do not suggest this is ready for clinic now but that if this finding is real then better powered GWAS and clinical studies may be enlightening. The clinical utility should be obvious as renal SLE is a serious conditional.

    2. On 2019-04-28 15:26:27, user David Curtis wrote:

      I have a number of concerns about the AUC you quote. One is that you quote the AUC for only the best performing GRS. It ought to be obvious that you can't just try a number of different ways of getting the GRS and then only highlight the one which does best. (Especially as you applied it to three different datasets and only report the best of the three.) Another concern is that you don't say how much the GRS improves the AUC compared with a predictor just derived from HLA. Also, in the methods section you suggest that the effect size for each SNP is derived from its original publication but subsequently it looks as though you have fitted your own effect sizes using a training set. There are huge ancestry effects in SLE. How do you know you haven't just picked up a GRS for ancestry? (https://www.ncbi.nlm.nih.go... plus lots of other recent papers) "GRS has been showed to be predictive for several diseases including cardiovascular disease (AUC=0.81, 95%CI: 0.81-0.81)" - Um no, that is not the AUC for the GRS, as you point out later. Finally, you suggest that the GRS might "assist early prediction of lupus nephritis in a clinical setting". I strongly doubt this is the case. What is the magnitude of this effect? What would be the clinical utility of such a predictor? (See https://www.nature.com/arti...

    1. On 2019-05-01 21:54:01, user Brian DeVeale wrote:

      Awesome work! Perhaps the wrong forum, but it looks like the command for converting v2 objects to v3 is 'UpdateSeuratObject' in R and listed as 'UpgradeSeuratObject' in the FAQ on your website.

    1. On 2019-05-01 16:07:38, user Bert wrote:

      Interesting, but there is no evidence yet that there is actually a TonB-dependent (outer membrane) transporter that imports these compounds.

    1. On 2019-04-30 16:23:59, user JSRosenblum wrote:

      It's nice to see that the authors of this paper used our ERK5 inhibitor, AX15836. However, the conclusion they drew from its use do not agree with what I'd conclude. Here's what they wrote: "While AX15836 had no anti-proliferative effect on two-dimensional cultures over a short period (48 h), when cells were<br /> grown in 3-D cultures (colony forming assay), the IC50 of AX15836 on A375/211 cells was<br /> reduced from 62 uM to 6.7 uM, indicating that A375/211 cells were more sensitive to drug than A375 cells (Fig. 4D). "

      The compound is a low nM inhibitor of ERK5. What it is doing over the course of 2 days in 3D culture at 1000-times its ERK5 IC50 is quite likely to be derived from something other than ERK5 inhibition. The 9-fold increase in potency in these cells in 3D versus 2D culture is interesting, but likely not ERK5-derived.

      Finally, I'd suggest they see what a pure bromodomain inhibitor does in their system, for example JQ1.

    1. On 2019-04-29 17:55:26, user Charles Warden wrote:

      I hope we can find a way to get more comments on bioXriv, so that they could be discussed prior to submission to a peer reviewed-journal:

      https://www.nature.com/arti...

      I would much rather have a revised pre-print than a correction / retraction in a peer-reviewed paper.

      You can see any comments for an individual from their Disqus account, but I think this worked well in terms of keeping a friendly tone and asking questions that I think could improve reader understanding: https://www.biorxiv.org/con...

    1. On 2019-04-29 15:01:23, user xbdr86 wrote:

      Paper already published.

      Bofill-De Ros X, Kasprzak WK, Bhandari Y, Fan L, Cavanaugh Q, Jiang M, Dai L, <br /> Yang A, Shao TJ, Shapiro BA, Wang YX, Gu S. Structural Differences between<br /> Pri-miRNA Paralogs Promote Alternative Drosha Cleavage and Expand Target<br /> Repertoires. Cell Rep. 2019 Jan 8;26(2):447-459.e4. doi:<br /> 10.1016/j.celrep.2018.12.054. PubMed PMID: 30625327; PubMed Central PMCID:<br /> PMC6369706.

      https://www.cell.com/cell-reports/pdfExtended/S2211-1247(18)31984-3

    1. On 2019-04-26 22:15:24, user Joylynn Woodruff wrote:

      I'm curious as to the names of the specific birds that are migratory and threatened birds. The migratory path should include at least the area north of the Dallas/Ft. Worth area.

    1. On 2019-04-26 17:10:06, user Kristen Naegle wrote:

      From the UVA Systems Biology Journal club discussion of this paper 4/23/19

      We found this to be a really interesting paper with a timely machine learning method on a topic with a lot of room to advance. The authors do a great job motivating the needs in the field, based on limitations of existing methods. Specifically, it is exciting to see a method that seeks to learn globally from all kinases and to extract kinase features that shape kinase-substrate specificity. We found we could not completely understand some key features of the model and its use with the text as it stands and we hope our experience with this manuscript, as outlined below, will be of help to the authors.

      Models and model interpretation<br /> We had some confusion about the model as implemented, especially around whether certain aspects were used to make the model interpretable vs. what was in the model. <br /> 1. PSSMs: A major strength of the neural network approach is the ability to learn and encode conditional dependence between positions in the kinase and amongst positions in the substrate. However, as currently depicted in the approach, it seems that the final predictor relies on collapsing the RNN model into a PSSM and scoring substrates across RNN-derived PSSMs. If this is the case, it is unfortunate to rely on a scoring methodology that is incapable of incorporating conditional dependence between positions. It would be great if the paper could clarify the methodology and explore prediction results that avoid the PSSM as a primary scoring function. <br /> 2. Attention Matrix: The attention matrix is really interesting and has a lot of power to explore specificity determining positions. However, we were unclear about some of the details about the attention matrix, its use, and its presentation in this work:<br /> 2a. Is the feature selection process that determined the attention matrix values used in the final classifier? As written, we were unclear about this. On the one hand, performance as a function of forward feature selection was given. On the other hand, if there are ultimately only 15 kinase sequence features used, then it seems unlikely that that broad range of mutations lands in those features and would make it impossible to score differences as a result of kinase mutations. <br /> 2b. The attention matrix in Figure 2 appears to highlight more than 15 kinase features, and suggests there are family-specific kinase features. However, the text suggests there was a universal set of 15 kinase features. How these 15 were chosen was also under debate in terms of the effectiveness and resolution of the feature selection method. Given the intense growth in performance between 5 and 15 features, it seems it would be beneficial to increase the testing of performance at a higher resolution (1:15 features with one at a time addition).<br /> 2c. It was clearly stated how many features selected by DeepSignal overlapped with KinSpect and DoS, but it would also be nice to know how many KinSpect and DoS features were not identified by DeepSignal (set differences vs. set intersections). <br /> 3. Model Details: <br /> 3a. Is this a “deep” neural network - where are the layers of convolution? Are there hidden layers?<br /> 3b. What are the exact inputs to the model?<br /> 3c. How long is the sequence retained in the recurrent neural network? Is there a limit to how far back the LSTM considers? <br /> 3d. How is allostery incorporated in the model (e.g. as conditional dependence)? Long-range interactions not encoded in local sequence space would appear to be missed unless the entire sequence is considered throughout the recurrent neural network.

      Figure 3 and related methods:<br /> The choice of negative data is hard when the training set only contains positives. The authors used a method that is consistently used in the field. However, because it is a random draw and makes many assumptions about the draw (that there are not false negatives in the set), we felt it would be beneficial to test the robustness of conclusions drawn by repeating this analysis across many resamples of a negative set. This would help us understand the sensitivity or robustness of the conclusions to that particular selection of data. Additionally, it is not clear what model hyperparameters have been tuned to generate the precision-recall and AUROC analyses for the comparator predictors.

      Generalizability of learning on global kinases and training misbalance<br /> We were intrigued by the results in Figure 2E. We think this is a really interesting experiment to test applicability of a globally learned model. We noticed that the only tyrosine kinase in this batch (as a result we assume of being the only tyrosine kinase with more than 100 substrates annotated in the training set) was affected the most when predicted by a model of all kinases in that set, when compared to a single-kinase SRC model. We feel that may suggest that if a training set is predominantly skewed towards serine/threonine kinases that it will not produce the ideal model for tyrosine kinases. As tyrosine and serine/threonine signaling are separated both evolutionarily and physicochemically, it seems reasonable to make two models of kinase-substrate predictions and explore the results of those independently to assess whether the attention value matrices and performance differ greatly. We also wondered if data skew in Figure 2E analyses or more broadly could be a factor (perhaps it would be beneficial to add an analysis of the training data itself).

      Mutation analysis<br /> In addition to the confusion we noted earlier about how the attention value matrix and feature selection is wrapped back into the model and its effect on the ability to test mutational effects, we also wondered what the “false positive rate” was on determination of cancer genes as a function of kinase-substrate misregulation using DeepSignal. The authors focus on capturing known oncogenes (as a function of percent covered), but we wished to know how many total were predicted to be detrimental and whether this differed greatly between DeepSignal and MSM/D-PEM (i.e. both specificity and sensitivity). One representation that might be helpful is to display the total number of predicted cancer genes with the proportion of true highlighted in the subset.

      SH2 domain analysis<br /> As some of our members are very familiar with the problems with the published SH2 domain data (e.g. that they cannot be merged as there are disagreements, different types, and different scales), we understand why the authors chose to build individual models for each dataset. However, in the mutation analysis, it is unclear what final SH2 domain model they used and the authors do not provide the same level of detail on what was learned in the SH2 domain as they did for kinases. In addition to providing more clarity in the methods used for mutation analysis (as it relates to SH2 domains), it would likely be beneficial to do a sensitivity analysis in the outcomes about predicted oncogenic mutations as a result of isolating the kinase and SH2 domain components. Finally, although the paper used was cited, it would be helpful to describe in more detail exactly how an oncogene was determined for readers to better interpret the method and results provided here.

      Signed by:<br /> Kristen Naegle, Ben Jordan, Kevin Janes on behalf of the University of Virginia Systems Biology Journal Club (Journal Club of 4/23/19)

    1. On 2019-04-25 22:02:20, user Julio Retamales wrote:

      Good paper! A detail: in the second paragraph of the abstract it should read: "The green revolution gene". The "r" letter is lacking.... <br /> Thanks!

    1. On 2019-04-25 19:30:54, user Madhavi Adiga wrote:

      Hi, <br /> I'm Madhavi Adiga, just started my graduation in Pharmacology Dept. I'm interested in Tumour angiogenesis and I want to build my project in this field. As for the starter I proceeded with different tumor model system. While across searching I found this article, in which LLC subcutaneous tumor model system is being used. Several other studies shows injecting LLC cells with matrigel as substrate to minimize the variability in tumor size during the course of tumor growth. My question is, you started with low number of LLC cells to inject with and studied up to 16 days without using any solid substrate support as there may be chances of leakage into surrounding tissues rather than being confined to the injected place (as I think this may lead to variability between the groups we study), how this will be different from being used with a solid substrate (matrigel) as the solid substrate may give more support to tumor cells to grow in a confined region. Secondly, on what basis you took 16days as criteria to sacrifice mice? based on humane endpoint criteria? or did you do any growth curve study to select 16days? If you keep more time the knockout mice you used (s1pr1) develop more tumor? <br /> Please let me know as this may be helpful for me for my further studies.

    1. On 2019-04-25 15:28:19, user Pedro Madrigal wrote:

      Hi,

      Thank you very much for posting the ChIA-DropBox preprint. Unfortunately, it looks like the GitHub repositories mentioned in the preprint (see below) are not available.

      Best regards,<br /> Pedro


      Code availability<br /> The ChIA-DropBox data processing pipeline is publicly available at: https://github.com/TheJacks.... The ChIA-view visualization tool for multiplex interactions is publicly available at: https://github.com/TheJacks.... Both repositories contain README files with further details on how to get started using the software.

    1. On 2019-04-25 15:13:46, user John Lowrie wrote:

      Very good that there are studies to confirm the everyday findings of human rights workers over many years. The report does not venture in to the hows and whys nor what needs to be done to protect these young women (and by the way some boys and transsexuals). Families and local communities could and should do more, especially by facing up to the realities that all work away from home is likely to be risky, and not simply expect and take their hard-earned money. A recent study for Future Forum highlighted that such remittances may not be used wisely. (https://docs.voanews.eu/en-...

      There is a common deeply-embeded belief that older children, especially daughters, must make sacrifices for their families. (http://anorthumbrianabroad....:JtembqSkHCPXOa5FCUSSy5rFsLM "http://anorthumbrianabroad.blogspot.com/2016/12/more-to-peering-than-appears.html)")

      Beyond families and communities responsible action is needed from authorities instead of their active involvement in promoting the entertainment business. It is a fact that formal and informal permits and documents are needed and issued, and this is a lucrative form of income, thus encouraging rather than deterring the business. Quite often I have observed beer garden owners having to supply food and drink "on-the-house" to government officials as part of the deal.

      Finally the international beer companies own drinks companies or have interests in production and supply. Some advocate "responsible drinking" on product labels. None apply the same message for the workers who market them. They abrogate responsibility.

    1. On 2019-04-25 10:15:03, user Adam Selwith wrote:

      "we provide the phased 10X variant calls as supplemental data"<br /> You may say so, but there are two supplemental data files and both are about reads, not variants.

    1. On 2019-04-25 08:30:20, user °christoph wrote:

      this beats phage-mediated HGT by lengths, so to say! and just think of the amount of nucleotides the up-taking cell gets from the degraded strand. interesting study!

    1. On 2019-04-25 07:50:38, user Axel Thielscher wrote:

      The results shown in this paper should be contrasted with the findings published in: https://doi.org/10.1101/611962. There, the value and the limitations of intracranial recordings for validating electric field modeling for transcranial brain stimulation are also investigated in more detail.

    2. On 2019-04-23 09:00:52, user Axel Thielscher wrote:

      The results shown in this paper should be contrasted with the findings published in: https://doi.org/10.1101/611962.<br /> There, the value and the limitations of intracranial recordings for <br /> validating electric field modeling for transcranial brain stimulation <br /> are also investigated in more detail.

    1. On 2019-04-24 23:53:33, user Andrew Morgenthaler wrote:

      Very cool findings. I think Fig. 1 and Fig. 4 are particularly great, clearly demonstrating the effect synonymous mutations have on fitness and, as a result, on evolution. I wish there was a bit more convincing experimental evidence of the mechanisms by which synonymous mutations are increasing fitness. Why not do RT-qPCR to clearly show which genes in the operon are increasing their mRNA as a result of the mutation? Can you actually show using 5'-RACE that a new promoter is forming?

      As a side note, I have no idea what you mean by a 39-3T mutation. Does that mean codon 39, third position in the codon? It would be nice to have your nomenclature explained in the text.

    2. On 2019-04-24 23:47:23, user Andrew Morgenthaler wrote:

      page 3, line 3 should say "...in the non-synonymous set that presumably produce truncated, non-functional protein." (remove the "a" before "produce")

    1. On 2019-04-24 17:21:50, user Enkelejda Miho wrote:

      Dear David,

      thank you for your comment (one year ago?), somehow this has gone unseen until now. It is great that you took the time to critically read this manuscript and give feedback. Your comments are interesting, even if some obviously address on-going and open discussions of the entire immunology community (e.g., CDR3 relevance vs. length, repertoire holes, biological stochasticity in B cell receptor generation, parallelism T and B cell repertoires).

      On the other hand, network parameters here are novel and the observations hold the potential to open further questions and prospectives, a further step in understanding and considering additional aspects. One specific side note: what we know through networks does help to plan/design synthetic repertoires following the observed distributions in CDR3 similarities as the simulation algorithm can be designed to satisfy the conditions.

      Thank you genuinely for the discussion.

      Enkelejda

    1. On 2019-04-24 11:57:00, user daniele marinazzo wrote:

      Thanks!

      My comments here

      https://pubpeer.com/publica...

      and pasted below

      %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%

      (partial) review for the preprint.

      Disclaimer - COI statement: Matteo Fraschini invited me as guest professor for two weeks in Cagliari in the summer of 2017, and we are regularly in contact, even if no collaboration is ongoing at the moment.

      %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%

      Dear colleagues,

      thanks for sharing this work. Here follow some ideas and comments.

      Let's start with a conceptual issue: from the evidence that PSD and network metrics are very much correlated, you " conclude that it may represent good practice to report the findings from the two approaches in conjunction to have a more comprehensive view of the results." One might argue that this should be even ore true for two methods that are not connected one to the other, rather than for two methods which mostly reflect the same thing.

      Now, one might want to argue why the two measures are correlated, and whether this is specific to the brain. I will provide some indications below.

      I will go through two steps:

      PLV and PSD are correlated (as also observed here A comparison of spectral magnitude and phase-locking value analyses of the frequency-following response to complex tones)<br /> PLV and network measures are correlated.<br /> Let's start with 1. As clearly stated in Phase locking value revisited: teaching new tricks to an old dog, by Bruña, Maestú, and Pereda " PLV in a given band is related to the average coherence in the frequency range encompassed by the band weighted by their relative amplitude ". In particular they propose a computationally efficient, but more importantly illuminating way to define PLV without using the Hilbert transform and phase extraction, coded in Matlab as

      [nc, ns, nt] = size(data); ndat = data ./ abs(data); plv = zeros(nc, nc, nt); for t = 1: nt     plv(:,:, t) = abs(ndat(:,:, t) * ndat(:,:, t)') / ns; end

      which makes the relation between PSD and PLV evident. From the code that I pull requested to your repository

      https://github.com/danielem...

      https://users.ugent.be/~dma...

      Now, you used unthresholded, weighted, undirected networks and compute Strength, Clustering Coefficient, and Betweenness Centrality on them.

      Even taking a random matrix as "network" it's evident that higher values of the entry correlate with Strength and Clustering Coefficient

      https://users.ugent.be/~dma...

      https://users.ugent.be/~dma...

      On the other hand the Betweenness Centrality is constant.

      https://users.ugent.be/~dma...

      This mainly reflects your finding, except from Betweenness Centrality, which is where one might argue that the nonrandom structure of the functional network is slightly more modulated.

      So, to summarize, the results reported on real EEG data reflect this simple associations, and that's a conforting confirmation.

      Then one might wonder how to interpret network measures when the links are statistical dependencies across brain areas. This is of course a topic which is much bigger than a paper :). But indeed the link with a more interpretable local measure is helpful.

      For the moment you could expand on what this association can tell us, and if we need network measures of this kind.

      Thanks!

    1. On 2019-04-24 09:07:25, user Johannes Soeding wrote:

      The parameters for the program were optimized on the same 54 genomes that were also used as test set. This is very problematic as it can give too optimistic results. You need a test set that is independent of the set used for optimisation.

    1. On 2019-04-24 07:25:00, user Ashish Kumar wrote:

      i wonder what is in between ITGA2 and ACLY .... what connects them ....,?<br /> what are the other metabolic pathways it activates on the expense of ITGA2 downregulation ?

    1. On 2019-04-24 07:15:16, user ST Sebastian wrote:

      The topic “theranostic potential” is very misleading to reviewers and readers. Theranostics means therapeutics plus diagnostics. The studies did not show any diagnostic function. Using MRI to monitor drug release from cornea implant is not practical.

    1. On 2019-04-23 20:08:21, user Andrew Whitehead wrote:

      I'm curious. Are there data indicating that these morphologies do/not emerge from habitat (e.g., temperature) -induced developmental plasticity? That is, are they heritable? Some of the studies cited (e.g., Sfakianakis et al) show that temperature induces alternate developmental trajectories. The article frames the objectives/data/conclusions within the context of evolution. Perhaps I'm missing something, but maybe the authors could consider whether some qualifying statements about the potential influence of temperature-induced developmental plasticity would be warranted?

    1. On 2019-04-23 16:25:12, user Carstenn wrote:

      Negavitve calories are so far I know, meant to be (meat)proteins which demands much energy to digest and which may be why some animals like the wolverine can eat so much compared to others who eat s more energyeconomic foods?

      LIzards are coldblooded, right? So they do not need energy to warm up as humans does, and therefore need warmt for digestion which is not be compared to humans, meaning, that humans need much more energy for digestion than lizards does, right?

      How then can this study on lizards be compared to humans eventhough their digestion may be similar to ours if their dependence on heat externally supplied is not?

    1. On 2019-04-23 07:01:05, user rahul saini wrote:

      Hey there,

      I want to plot SWNE on my custom dataset(Tabular data).<br /> Please let me know how to proceed?

      Thanks in advance

    1. On 2019-04-23 06:43:11, user Michael Alexanian wrote:

      Very nice study that highlights, in line with previous literature, the fascinating concept of developmental competence being primed in pluripotency before cell fate decision. We came up to similar observations characterizing Meteor, a pluripotency-specific enhancer that controls mesendoderm specification (Alexanian et al, 2017 - "A transcribed enhancer dictates mesendoderm specification in pluripotency"). The authors could discuss this study in the discussion when they mention two other important studies (Wang et al., 2015 and Kim et al., 2018).

    1. On 2019-04-23 04:08:55, user Protothelenella corrosa wrote:

      The foundation of this work is the fragmentation of these<br /> intact glycopeptides to detect informative product ions for confirmation of<br /> peptide sequence, glycosite and glycan composition. If these product ions are<br /> incorrectly annotated, they may provide false confidence of these glycopeptide<br /> characteristics. Accompanying this risk is the relatively niche technique of<br /> AI-ETD, which generates mass spectra containing many (>100) product ions.<br /> Certain assumptions, such as type of fragmentation mechanisms present (in this<br /> paper: b, c, y and z), allow the assignment of these product ions to<br /> glycopeptide fragments.

      In figure 1 A, the authors provide a panel of a glycopeptide<br /> MS2 mass spectrum, demonstrating 100% peptide sequence coverage. Examining the<br /> product ion spectrum for this single annotation, we observe over 1000 m/z<br /> values representing product ions ranging from m/z 144 to 1995, confirming that<br /> this spectrum is rich. However, this number of m/z values does not accurately<br /> reflect the true number of detected product ions due to the presence of<br /> isotopes. These can confound the correct assignment of the previously mentioned<br /> peptide backbone and glycan fragments.

      If we interrogate the same spectrum in Byonic using the data<br /> analysis files provided by the authors, there are multiple incorrect<br /> assignments of glycopeptide fragment ions to isotopic peaks instead of the<br /> monoisotopic peak. For the spectrum shown in Figure 1A, we found 15/75 (20%) of<br /> the product ion annotations to be incorrect due to this error (example shown<br /> below). In addition, we evaluated over 50 glycopeptide MS2 spectra and found<br /> this error to be consistently made.

      Resulting from these incorrect product ion assignments, the<br /> scores given in Byonic are artificially inflated. This error significantly<br /> impacts subsequent quality control filtering used by the authors especially<br /> score cutoffs. This error subsequently affects all figures in the manuscript as<br /> the number of identifications, and the quality of those identifications, is<br /> artificially high.

      Another important step in annotating product ions to<br /> glycopeptide fragments is to adequately assign theoretical glycopeptide<br /> fragments to the observed product ions. As alluded to above, a total of 1084<br /> m/z values were observed for the spectrum in Figure 1A and this is artificially<br /> inflated due to the isotope distributions for each glycopeptide fragment. If we<br /> deisotope the spectrum to the best of our ability, we reduce the total number<br /> by 70% to 372 m/z values with a total of 75 annotations. While we acknowledge<br /> that MS2 deisotoping likely does not remove all non-monoisotopic peaks, this<br /> leaves over 80% of all observed monoisotopic peaks unannotated for the MS2<br /> spectrum in Figure 1A.

      This significantly large number of unassigned product ions<br /> demonstrates that there are likely alternative fragmentation mechanisms<br /> occurring that have not been considered for spectrum annotation and/or scoring<br /> the given spectrum for its ability to describe the theoretical glycopeptide<br /> match. This is especially concerning because fragmentation events that have not<br /> been accounted for may be responsible for product ions annotated as simple<br /> b/c/y/z fragments due to their isomericity to these fragments.

      Reviewer 3 gave a more than reasonable critique highlighting some of these issues and the subsequent impact on localization.This resulted in the authors removing any statements regarding localization in glycopeptides with multiple sites. Despite these efforts, we do not believe that the authors have taken appropriate action to mitigate the impact of<br /> erroneous product ion annotation (~20%) or significantly lacking assignment of<br /> glycopeptide product ions (~80% unannotated monoisotopic peaks in MS2 spectra)<br /> and therefore request a re-analysis of all product ion assignment in this<br /> manuscript with these critiques in mind.

    1. On 2019-04-22 13:26:54, user Ranjan Nanda wrote:

      Is so little sample was used for extraction or could be a typo error!<br /> Line 94: " Around 0.1 to 0.2 mg of frozen faecal sample was used for DNA extraction."

    1. On 2019-04-20 18:51:44, user Hanka wrote:

      I'd just like to comment on the salary differences, since that received some publicity.

      I think your analysis is misleading due to grouping by European region and sample being not representative. It seems to me that your results get skewed due to high participation of researchers from countries with good postdoc salaries (UK, Sweden, Germany). For example, in France, touching 40k a year is not realistic. postdoc salary in CNRS (the largest research body in France) is about 32k. (Which actually is not such a bad salary for France.) But only 23 French postdocs participated in the survey, as opposed to 178 British or 162 Swedish. I think, if you really want to analyze by region, you'd better estimate the number of postdocs in each country and use a weighted metric. However, I do think it would be better to break the results down by countries, include some kind of normalization by purchasing power and also focus a bit more on net income as that can be quite different based on tax progression. Finally, your sample from Eastern European region is very small, only 36 postdocs in total. It would seem tricky to draw many conclusions about that region from so few replies. Don't you think?

    1. On 2019-04-19 20:47:05, user Stephanie Gogarten wrote:

      It will be interesting to see how much this can speed up current WGS analysis pipelines that rely on VCF!

      The reference to "Stilp et al." is incorrect, it should be listed as "Zheng et al.".

    1. On 2019-04-18 23:36:23, user Bhaskara Govinal wrote:

      The function of AT1G16220 (AtPP2C6) is unknown in Arabidopsis. It is nice to see the characterization of tomato ortholog of it for plant immunity. Although this gene is named as PP2C6 in the genome-wide analysis published by Xue et al.,2008, many other reviews (Schweighofer et al., 2004; Fuchs et al., 2013) did not name this PP2C to show its function remains unknown. Further, name PP2C6 may lead to future confusion as there are other two PP2Cs in the same Clade already called as PP2C6-6 and PP2C6-7. How about author naming this PP2C based on its immunity related function or interaction with kinases.

    1. On 2019-04-18 19:55:07, user UAB Bacteriology Journal Club wrote:

      Very interesting paper! We (the University of Alabama at Birmingham Bacterial Pathogenesis and Physiology Journal Club) read this paper this week, and wanted to share our comments and suggestions, in the hopes that they will be helpful to you. We had a great discussion, and definitely wanted thank you for posting it!

      Review of Limoli et al. “Interspecies signaling generated exploratory motility in Pseudomonas aeruginosa

      University of Alabama at Birmingham Bacterial Pathogenesis and Physiology Journal Club<br /> April 18, 2019

      Summary:<br /> In this work, Limoli et al. show that both type 4 pili and flagella are involved in a significant change in P. aeruginosa motility in the presence of S. aureus, in which P. aeruginosa are able to surround and disperse S. aureus microcolonies. They also report that this motility effect is modulated by the S. aureus Agr quorum sensing system and that the presence of S. aureus affects cyclic AMP levels in P. aeruginosa. Finally, they confirm that interspecies signaling occurs with both laboratory and clinical isolates of both bacterial species.

      This paper is fairly well-written, and explores an important and impactful topic. Understanding the molecular mechanisms of polymicrobial interactions is undeniably important. The microscopic movies illustrating changes in bacterial motility are powerful and compelling, and the authors do a good job of applying quantitative measures (e.g. Euclidean direction) to these otherwise qualitative observations. However, the second half of the manuscript is quite confusing, and the explorations of the role(s) of Agr and PilJ in Pseudomonas-Staphylococcus interactions lacked both depth and context. There were several instances of important conclusions that did not appear to be supported by the data presented, and in some cases the still images did not do a good job of representing the phenotypes observed in the movies (although we recognize that this is a significant challenge!).

      Overall, although it has some substantial weaknesses, we feel that this paper presents fascinating and important observations, and we recommend that, for publication, the authors focus on expanding either the Agr or cAMP/PilJ studies, saving the other for future papers. We hope the following detailed comments will be helpful:

      Major Comments:<br /> Figure 1 / Movies 1-3: Please explain (or at least cite!) why P. aeruginosa inhibits S. aureus growth. It is not clear what value the green and yellow “founder cell” markers add to Figure 1, or why the P. aeruginosa founder cell isn’t moving.

      Figure 2 / Movie 4: The disassembly of S. aureus microcolonies is shown only in a single still image. This is an important result, and should certainly be included as part of a movie or other more in-depth data presentation. “Swift motion” is very confusing, and it is unclear what the authors mean precisely by this, since it doesn’t appear to have any relationship to speed of movement. The movie presented to illustrate this was difficult to find any movement at all in. We also wondered if there is any way to distinguish between “invasion” of an S. aureus microcolony by P. aeruginosa and “climbing” onto the microcolony (and therefore moving up out of the plane of focus), since S. aureus colonies are clearly 3-dimensional piles of cells. mKO is never defined (presumably it is a red fluorescent protein).

      Figure 3 / Moves 5 – 8: The wild-type and ∆flgK still images appear to be from the wrong movies (these two in particular seem to be swapped). We found several instances throughout the paper of still images which did not appear to match with movies, and this was very troubling. Please check carefully to make sure that they are showing what’s intended. It would be very helpful to have still images and movies with matching fields of view. The timescales for movies 5 – 8 are very short, and make it difficult to assess the changes in the overall motility phenotypes. It would be very useful if the authors would comment on why the ∆pilA ∆flgK mutant is unable to inhibit S. aureus growth. The labeling of statistical significance in Figure 3B is unconventional, and inconsistent with the use of lowercase letters as labels in other figures. Please be consistent and clear about what comparisons are being made in all figures. Finally, the motions illustrated in Figure 3C are not very clear, and at least one of the labeled cells (single cell with red arrow) does not appear to be in motion at all.

      Figure 4: The main concern with this figure was that neither twitching motility, sigB, nor Agr were introduced or explained in any detail. The rationale behind these experiments is not clear, and especially in the case of the very complex and well-studied Agr quorum sensing system, require much more information to understand the context and interpretation of these experiments. We were very curious as to why the authors did not directly test whether the Agr-dependent AIP signaling peptides are sensed by P. aeruginosa.

      Figure 5 / Movie 9: The data in Figure 5A show a much more significant effect for Agr than does Movie 9, although upon repeated viewings, we think we understand the difference between P. aeruginosa behavior in Movie 4 and Movie 9, which appears to be primarily a disassembly of the P. aeruginosa raft even at very long distances from the S. aureus microcolony. Is this what the authors mean by “avoidance”? The sentences describing these results, especially “some cells seemed to actively avoid the S. aureus colony all together”, were not clear and did not seem to be supported by the data presented. Figure 5B certainly needs a wild-type control, and a better explanation of how to interpret 5C would be appreciated.

      Figure 6: We were in general very confused by all of the results discussing PilJ and cAMP, and feel that the context, background, and interpretation of these experiments require much more explanation.

      Minor Comments:<br /> 1) In the title, we would recommend “stimulates” rather than “generates”.

      2) How has the polymicrobial nature of infections been clear since the 1600’s, when the germ theory of disease was established in the 1880s?

      3) Typo in motility results section: “Through 1.5% agar”.

      4) How close do P. aeruginosa need to be to S. aureus to experience a change in motility? Is this consistent with the known ability of small molecules / proteins to diffuse in agar?

      5) There was some concern with the use of area to measure S. aureus replication, since the S. aureus colonies appeared to be generally taller than the rafts of P. aeruginosa, which we interpreted to indicate that they were mounding up on top of one another as they divide.

      6) The twitching motility (under the agar) assay was unfamiliar to us, and we would have liked to see some experiments validating the relevance of this kind of motility to the single-cell microscopic observations the paper begins with

    1. On 2019-04-18 18:06:07, user Paul Schanda wrote:

      This is a really useful development. We have used FLYA ourselves and managed to assign a 12 x 39 kDa protein from solid-state NMR data in a fully automatic manner - the largest protein so far assigned in solids. About a year of manual work -- or a few hours with FLYA, leading to the identical result. (https://www.biorxiv.org/con...

      Having this tool now - finally - for methyl assignments is very welcome and I am sure it will boost solution-NMR of large proteins further.

    1. On 2019-04-16 18:20:04, user Charles Warden wrote:

      Hi,

      Thank you for sharing this preprint (and the code for analysis).

      I hope I am not overlooking something, but I had a few questions:

      1) I apologize, but I may be unclear about the experiment design. At first, I saw the “1,011 yeast isolates,” and guessed that you were doing an experiment for one generation for the 16 x 16 crosses (with 3-4 replicates each). However, I think I am supposed to be focusing on “13,950 individual recombinant haploid yeast segregants by crossing each parental strain to two different strains and collecting an average of 872 progeny per cross (Fig. 1, Supplementary Table 1).” Is there some sense of “generations” in the experiment, or are you looking for the effect of mutations in the parental strains in the original 16 x 16 crosses?

      2) If you are looking for inherited mutations (from the parental strain), should the minimum MAF for a given variant be closer to 6% (1/16) or 3% (1/32, for haploid segregates from diploid parents, if I remember the yeast biology right)? If so, I’m sorry, but I’m a little confused about the <1% (inherited / heritable) variants.

      3) If you have a novel mutation causing a more clear phenotype (such as an acquired somatic mutation that is selected for as resistance to your treatments?), are you testing additional crosses/replicates with that isolate (to see if you can reproduce the phenotype in other crosses/segregants that retain that mutation)? Or, does that have something to do with 100s of segregants per cross (for example, testing the phenotype for a multiple isolates at X weeks, 2X weeks, 3X weeks, etc.)?

      4) Is there an accession number for deposited data?

      5) Also, it probably doesn’t need to be said for the yeast readers, but I was admittedly almost confused by chrX in Figure 4 (but I eventually figured out that was the 10th chromosome).

      Thank you very much for taking time to review these questions, particularly from somebody who doesn’t perform an experiment like this on a regular basis.

      Best of luck with your lab’s projects!

      Sincerely,<br /> Charles

    1. On 2019-04-16 06:47:10, user Veranja Liyanapathirana wrote:

      Good piece of work but what about viruses that are equally imporimport to identify? Would your human depletion pipeline remove them? Is there a way to assess the quality of the samples to screen proper sputum samples as opposed to salivary ones that we often get to diagnostic labs inbuilt to this?

    1. On 2019-04-15 20:11:49, user Christos Gournas wrote:

      Very interesting work! And very consistent with our recent work on the Can1 Arg transporter of S. cerevisiae. We have recently published two stories about the substrate-induced endocytosis of Can1 (see below). In this work, we provide evidence that a substitution of E184 in TM3 by Gln (so E184Q) should block the transporter in an IF conformation. As the presence of Gin should mimic permanent protonation of E184, the results presented herein seem to be at the same direction with ours! I'm really excited !<br /> Gournas, C., Saliba, E., Krammer, E.-M., Barthelemy, C., Prévost, M., and André, B. (2017). Transition of yeast Can1 transporter to the inward-facing state unveils an α-arrestin target sequence promoting its ubiquitylation and endocytosis. Mol. Biol. Cell 28, mbc.E17-02-0104.

      Gournas, C., Gkionis, S., Carquin, M., Twyffels, L., Tyteca, D., and André, B. (2018). Conformation-dependent partitioning of yeast nutrient transporters into starvation-protective membrane domains. Proc. Natl. Acad. Sci. 115, E3145–E3154.

    1. On 2019-04-15 18:58:02, user Michael McLaren wrote:

      This looks like a very valuable resource for the community! Can you clarify the status of the data availability? The study identifier given in the manuscript does not seem to be currently available (https://www.ebi.ac.uk/ena/d.... Also, which of the non-human data will be available in the ENA and which is to be made available on request? Thanks!

    1. On 2019-04-15 09:40:53, user Albert Bondt wrote:

      Hi,<br /> Nice systematic approach!<br /> I hope you don't mind if I ask a few questions though...

      You say you avoid enrichment to avoid introducing a bias. However, you do perform reduction/alkylation, precipitation, and drying/reconstitution. These steps can also introduce a bias. While for IgG glycopeptides this is not required (check out the many papers by Manfred Wuhrer on IgG glycosylation, since 5 years or so also using a NanoBooster). So did you check whether these sample prep steps do not introduce a bias, or are required to avoid bias?

      Another issue is for Figure 3. While the peptide backbone of IgG2 and IgG3 Variant are identical, the glycosylation profile is different. Or did you use purified single subclasses (not clear from Materials and Methods)? In case of the latter, did you check the purity? IgG3 purification remains a major challenge, it is often contaminated with other subclasses.

    1. On 2019-04-14 11:24:46, user 宮田真人 wrote:

      Thank you for your interests on quick freeze, deep etch EM.<br /> We believe this method is really useful for PG studies.

      We have been studying about motility mechanisms of class Mollicutes.<br /> Recently, we got interests on the role of PG on survival and evolution, because class Mollicutes quit it by some reason.

      We hope we can do some contributions to PG field.<br /> Any comments are welcome. <br /> Makoto MIYATA

    1. On 2019-04-14 08:05:38, user Arpan Parichha wrote:

      I was thinking of using the SABER technique in our system and wanted use its multiplexing feature for our purpose. I am unable to use the oligominer pipeline. Can anybody tell me how to design the PER primers?

    1. On 2019-04-13 14:05:34, user Javier Forment wrote:

      The PDF of Data Supplement at Supplementary Material indicates that there exists a "Supplemental dataset 2: NbC gene-models database gff3 annotation". I cannot find that gff3 file anywhere. Could you please tell me what I'm doing wrong?

    1. On 2019-04-13 11:25:00, user Jingpeng Wu wrote:

      it would be better to explain how do you achieve the performance in the abstract. It took me some time to find it out, and it is still not quite clear for me.

    2. On 2019-04-12 16:08:41, user Jeffrey Stirman wrote:

      Really nice work! Good to see you expand into the cleared tissue imaging field. As part of the theoretical discussion, I might suggest you add a brief discussion about how the parameters of the camera rolling shutter (interline-interval and exposure) play a role in the axial resolution. Though it might add little in the beautiful videos and images you show, and is more important when using slightly lower NA illumination and lower magnification detection objectives (as is done in some turn-key systems) it would be a nice addition to this topic. Again, really nice work.

    1. On 2019-04-12 23:24:07, user Ally Warner wrote:

      Hello,

      If you have downloaded this paper and the dataset, please redownload the dataset. There have been a few updates and corrections.

      Thank you!

    1. On 2019-04-12 17:47:11, user Helder Maiato wrote:

      Dear Colleagues,

      I am very excited to share our latest research on the control of mitotic exit in metazoans with all of you. I appreciate all the tweets and all possible dissemination, but what I am really looking for is your opinion on our findings. Therefore, if you have something to say that can help us improve or challenge our data and their interpretation, please take a couple of minutes and post your comment!

      Cheers and I hope you enjoy reading it,

      Helder

      PS- and don't forget to look at the movies!

    1. On 2019-04-10 19:58:53, user Douglas wrote:

      Several papers available, but no citation here about some of the biggest crocodylomorphs: Purussaurus, Gryposuchus, Mourasuchus...

    1. On 2019-04-10 18:31:35, user P SM wrote:

      It would be good to include more information about the sequence runs in the hopes of more precisely localizing the source of the cross-contamination to a given stage of the sequence run.

      Currently the text states that they were all Illumina HiSeq 2000/2500 runs. But the HiSeq 2500 could run in one of two "modes" using either standard "High Output" or "Rapid" chemistry. "Rapid" chemistry could use either "on-board" or cBot clustering. On board clustering trafficked the contents of the run library pool to both lanes of the flow cell through fixed (non-disposable) tubing and this was known to be a source of run-to-run contamination as, to my knowledge, no bleach wash protocol was ever offered by Illumina for the 2500. Whereas high output chemistry pumped lane pools of libraries through disposable tubing while clustering them. This occurred on a separate instrument, called a cBot.

      For a large project of this sort, one might tacitly presume that the chemistry used would be High Output. But it is also mentioned in the text that dual indexing was used for this project. Dual indexing was not "native" to the 2000/2500 high output chemistry kits -- requiring the addition of custom primer for i7 indexing.

      If high output (cBot clustered) flow cells were used, then any lane-to-lane or run-to-run contamination detected would likely derive from processing prior to clustering.

      To my way of thinking the 1100 pound gorilla in the room is whether this cross-contamination is the result of index hopping -- a phenomenon largely ascribed to newer Illumina instruments that use patterned flowcell and x-amp clustering chemistry.

      Another possibility to consider would be whether Illumina's default mismatch=1 indexing was used <br /> during demultiplexing and if much of the contamination could be avoided by setting it to mismatch=0.

    1. On 2019-04-10 05:31:29, user Stephan Anagnostaras wrote:

      this looks really great. So it's one computer per box, and it looks like you recommend a pretty high end machine? Will it run OK on an i5 (like a high end laptop) or do you recommend a souped up desktop? And For the Kinect V2, I assume you also need to purchase the Windows connection kit (i.e., Kinect adapter for the extra power)? Sorry if I missed these somewhere in the paper.

    1. On 2019-04-09 19:33:24, user Antonio Salas wrote:

      The story disappeared from Medical Health News<br /> A comment by Medical Health News was added to the “News” (click on Tab “New”) on 26 March entitle “A Pushback on Paternal Mitochondrial DNA inheritance”. For some unknown reason, the original link:

      http://ct.moreover.com/?a=3...

      does not work anymore. Instead, the link now points to the main page or Medical Health News:

      http://www.medicalhealthnew...

      No idea on how this resource works, but it is noteworthy that some of the 'Best Hospital US' are linked to this web site. Just have a look on the web site.

      I tried to contact them by email to know if they noticed it (email is provided in their “Contact Us” link) but I got no response.

      Anyway, those interested in the original comment, just let you know that there is a copy in GenomeWeb:

      https://www.genomeweb.com/s...

    2. On 2019-04-05 10:02:09, user Antonio Salas wrote:

      In regard to our publication: Literature bias and OMIN

      I wonder if it is time to revise this entrance in OMIN on “Biparental mitochondrial DNA transmission”: https://www.omim.org/entry/....

      Note that the references introduced by Ada Hamosh in this entrance are biased (technically: literature bias). As we described in our present publication (BioRxiv) the study by Schwartz & Vissing in New Eng J Med (2002) and Kraytsberg et al. (2004) in Science were e.g. questioned in our previous publication: Bandelt et al. (2005) entitle “More evidence for non-maternal inheritance of mitochondrial DNA?” published in the J Med Genet (2005) which is not cited in the OMIN entrance...

      Other critical views to the PNAS paper were also omitted in this OMIN entrance e.g. Lutz-Bonengel and Parson (PNAS; 2019)

      Making the message short: Unfortunately, an article questioning a breakthrough finding (generally published in a high-rank journal) generally receives less attention than the original breakthrough article (even if it is demonstrated to be wrong). Let's be confident in science to provide the proper evidence with the pass of the time. It is however grateful if the authors facilitate this task. Thus, from our article posted in BioRxiv: “Aiming to facilitate such independent validation, we were unsuccessful in obtaining key biological samples from the authors of Luo et al. (2018), because they denied our request for blood samples”. When a dogma is challenged, the authors should be prepare to facilitate validation of their findings by other institutions/researcher. It would be worth for journals to demand from authors these facilities.

    3. On 2019-03-28 10:51:32, user Hansi Weißensteiner wrote:

      Dear Charles,

      Thanks for your comments / questions! Exactly, we prepared Figure 1 in order to show our concerns in this regard.

      1) A very good point! However as the data for the first generations were only inferred based on the mixtures in the subsequent generations it is not clear if one member of the first generation already had a mixed haplotype. <br /> 2) Thats exactly one of our main concerns:<br /> "An interesting consequence of this “molecular surgery” mechanism would<br /> be to preclude the progressive lineal accumulation of an undefined number of<br /> haplotypes through generations; e.g. without this mechanism, III-6 should carry a<br /> combination of three haplotypes (H1a1+R0a1+U5b1d1c) instead of the two<br /> reported (R0a1+U5b1d1c)."

      best Hansi

    4. On 2019-03-26 23:36:25, user Charles Warden wrote:

      Thank you for positing this.

      I think Figure 1 is very helpful. Would it be fair to say these are causes for concern in the Luo et al. 2018 paper?

      1) In all 3 examples, both members of the pair at the top of the family tree have one mitochondrial haplotype. Since one of them should have the hypothetical nuclear factor, shouldn't that individual have a mixed haplotype (if that was the true cause)?

      2) Likewise, shouldn't individuals with the nuclear factor show increased mixing after each generation? In other words, you show 2 mixed haplotypes for each example in Figure 1, but I thought it seemed odd that only one of the 2 previously mixed haplotypes gets inherited in the next generation (I would expect the number of mixed haplotypes to increase with each generation).

    1. On 2019-04-09 18:13:53, user Peter-Bram 't Hoen wrote:

      Very interesting article on the tissue- and age-dependence of skewed X-inactivation. Results are largely in line with our recently published paper: https://www.nature.com/arti.... Here we used RNA-seq data from blood of trios to quantify degree of skewing of X-inactivation. In this paper, we explain that the observed skewing pattern is likely to be caused by stochastic nature of the X-inactivation process at an embryonic stage where only a limited number of precursor cells gives rise to the cell population in a given tissue. This explains correlation between fat and skin (common precursor cells), and no correlation between fat / skin and blood. It also may explain why the degree of skewing differs between tissues, as the size of the pool of precursor cells at the stage of X-inactivation may differ between tissues. We have not detected the age-dependent effect, likely because we included mostly individuals <55 years of age.

      Peter A.C. 't Hoen, Radboud University Medical Center Nijmegen, The Netherlands<br /> Twitter: @pacthoen

    1. On 2019-04-08 12:20:56, user David Rosenkranz wrote:

      This is a cool system to study PIWI/piRNA biology from the evolutionary point of view. Very interesting work! But don't these animals - like hamsters - have a piwil3 paralog? I thought piwil3 was lost somewhere on the lineage to muridae, which of course not rules out an independent loss in the squirrel clade.

    1. On 2019-04-07 13:55:08, user Ankita Jha wrote:

      It is interesting. Under regulation of Tc-fog and Tc-mist you mention like Drosophila,ventral tissue specification is under Toll signaling. Is it really known? Ventral specification in Drosophila is under Twist Snail regulation but Toll signaling controls Ectoderm specification under Eve-Runt control. Role of fog in blastoderm formation is widely conserved, Even in Drosophila early dsRNA (high conc) injections lead to severe defects.

    1. On 2019-04-07 05:15:35, user Devang Mehta wrote:

      The authors claim in the title to have identified biological pathways associated with household income. It's worth noting that the word pathway appears only in the title (and not in any of the 30-odd pages following it). In the actual paper, they do not seem to show, or claim to show any causal link (or even association?) between a biological pathway (at least as defined in other biological systems) and income.

    1. On 2019-04-06 13:02:19, user sandeep chakraborty wrote:

      Gene-therapy will finally fail-after causing immense harm.

      https://sanchakblog.wordpre...

      Because after the DSB, one cant control what happens - sometimes the vector (the viral bit, the nuclease, etc) <br /> integrates, and almost always there are translocations.

      And as this paper shows, there is immune response from the Cas9 epitopes.

      Here, for the RNA-seq they did:<br /> "We transfected the cells with plasmids encoding Cas9-β2 or WT-Cas9 and<br /> 14nt gRNAs against two different endogenous genes (TTN and MIAT). qRT-PCR analysis<br /> showed that this variant successfully led to target gene expression (Fig. 3D-F). To further<br /> characterize Cas9-β2 specificity, we performed genome-wide RNA sequencing after targeting<br /> Cas9-β2 or WT-Cas9 to the MIAT locus for transcriptional activation."

      The RNA-seq data has lots of Cas9 reads, which one can explain away by episomal expresson of the protein, instead of being integrated

      However, I show that there are several reads which include both the genome and the Cas9.

      Here is one

      SRR8478262.475917.1 475917 length=75<br /> ACTGATGAGACCTATTGCATTGACAACGAGGCAGATAATTTTCAGCAGATCGTGGTATGTGCCCAGGGAGGCGTT

      https://uploads.disquscdn.c...

      The first 32 nucleotides match to the human genome, <br /> and the rest 42 encodes encodes the exact 14 aa NASLGTYHDLLKII from Cas9

      So, all the expressed Cas9 might actually be the integrated Cas9, and not coming from the plasmid.

      Here is a table showing reads with Cas9 reads

      https://uploads.disquscdn.c...

      Here is a list of other sequences that have both Cas9 and the genome.

      SEQLOCALADDGENE.FA1218<br /> ACGATCTCCCCGGTTTCGCCGTTTGTCTCGATCAGAGGCCGGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATC<br /> SEQLOCALADDGENE.FA1552<br /> ACTGATGAGACCTATTGCATTGACAACGAGGCAGATAATTTTCAGCAGATCGTGGTATGTGCCCAGGGAGGCGTT<br /> SEQLOCALADDGENE.FA1768<br /> AGAAGGAAATTAGTGATGATGAGGCAGAGGAAGAGAAAGAGCACGATATCTTCCAGAATGTCCTCGTTTTCCTC<br /> SEQLOCALADDGENE.FA2841<br /> AGGGCATTGGCCACACCAGCCACCACCTTCTGATATTTGGAGGGCAGGGCCAGTTCGTTTCCCTTCTGCAGTTCG<br /> SEQLOCALADDGENE.FA3598<br /> ATCATCTTGTTCTTATAATTATTGCAAGTGAGGTTAGAGAATAGGCCACGGTGGGGCTGTCGAAGCCGCCGTACT<br /> SEQLOCALADDGENE.FA3616<br /> ATCCAGCGAAACCACAGCCAAGGGAACGGGCTGGTGTATCTTCTTCTGGCGGTTCTCTTCAGCCGGGTGGCCTCG<br /> SEQLOCALADDGENE.FA6798<br /> CCACAAACAGCTGTTTCTGCTCATTATCCTCGGGGGAGGCTCCGAGCCTGTCAGCAGGGAGATGGTGGGGTCCTC<br /> SEQLOCALADDGENE.FA8576<br /> CCCGGTTCTTGTCGCTTCTGGTCAGCACCTTGTTGTCGACTTGAGGACACCGGTGGTGACCAGGCGCTTGATGGT<br /> SEQLOCALADDGENE.FA13925<br /> CGGTGATCTTGCTCTTGCTCCTTTCGATGGTCAGGGCAGGTTCTTATCGAAGTTGGTCATCCGCTCGATGAAGCT<br /> SEQLOCALADDGENE.FA14375<br /> CGTCCTTGCTCAGCTGCAGTTTGGCATCCTCGGCCAGGTCGAAGCCCGGGGCCCTCTCAGACCTCACCACACGCG<br /> SEQLOCALADDGENE.FA15719<br /> CTCCTCCTGAGCCTTCCCCTGACCGCCTGCCTCCCAGTCGTCGAACAGGTGGGCATAGGTTTTCAGCCGTTCCTC<br /> SEQLOCALADDGENE.FA17000<br /> CTGAGTTCGGCATCAATATGGTGACCTCCCGGGAGTGCCGGGTTTCCACCAGCTGTCTCTTGATGAAGCCGGCCT<br /> SEQLOCALADDGENE.FA17971<br /> CTTCAGAAACCCCTTGGCCAAGTAAGCTGTGGGCAGGGCGATCATCTTCCGCACGTCGTACACCTTGTAGTCGCC

    1. On 2019-04-06 05:52:40, user Jonathan Gressel wrote:

      Great tour de force. Now all that is needed is genetic confirmation: the backcross from an R X S cross to the S should have near 100% R individuals, instead of the Mendelian 50%. Worth finding out as it has implications vis a vis the rate of spread of R through a population - even one no longer treated with glyphosate.

    1. On 2019-04-05 15:09:06, user Chris Penkett wrote:

      In the abstract you say "... spectrum representing *in*tolerance to inactivation..." but at least twice in the paper you say "... spectrum of tolerance to inactivation..." which sounds more correct to me.

    1. On 2019-04-05 13:16:47, user EVAHPI Research Group wrote:

      A very exciting finding from our group! The protozoa Giardia intestinalis is capable to produce two extracellular vesicles that differ in size and phenotypical effect.

    1. On 2019-04-05 12:59:59, user Dasapta Erwin Irawan wrote:

      Dear authors,<br /> Thank you for sharing the paper. I am currently working on a similar case here in Indonesia. I am interesting to learn more on the dataset and R code, where can I find them?

    1. On 2019-04-05 12:32:04, user mbriand wrote:

      Dear Connor,<br /> First of all we would like to thank you for your time and thoughtful reading of the work. Your advices will definitely improve the manuscript, especially the clarity. We have addressed your comments in full, point-by-point.

      I'm sorry that I have to report several flawed assumptions in your method paper which affect the overall conclusion of your work. You can of course ignore this comment, but please keep in mind that the below points are crucial and ultimately affect how your study will be accepted, used and cited in the scientific community. The below points hold true regardless of whether or not you succeed with the publication in one or the other journal.<br /> Our goal is not to publish our work in a peer-reviewed journal but rather share the proposed method with the scientific community through this preprint.

      1) line 26: average nucleotide identity is not the "method of choice" and it is not the "gold standard" as you also claim further below. <br /> We have change “method of choice” and “gold-standard” to “widely employed method”<br /> That is, if the authors had carefully studied the literature, especially the paper introducing the term OGRI (doi: 10.1099/ijs.0.054171-0), they would have learned that digital DDH (doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120) is another important method in the field that was shown to outperform several ANI implementations (doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). How come that crucial methods with partly over 1000 citations are overlooked resulting in such plainly false statements?<br /> We apologize for the oversight. Our goal was not to provide an extensive literature overview of the overall genome relatedness indices (OGRI) that could be employed for comparing genomes sequences. Although Genome Blast Distance Phylogeny (GBDP) is off course a valuable OGRI for assessing relatedness between bacterial genome sequences, we feel that ANI is more frequently employed than GBDP. Nevertheless, we have added GBDP in the introduction and discussion sections.

      2) line 31: if the authors want to propose a new method for species delineation, they have to provide evidence that the method correlates well with datasets of empirical DDH. <br /> There has been a misunderstanding. We did not intend to propose a new method for species delineation. This is clearly mentioned in the discussion section “it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera. Indeed, since population dynamics, lifestyle and location impact molecular evolution, it is somewhat illusory to define a fixed threshold for species delineation”. Here we only proposed a quick, simple and effective technique for studying relationships between genomic sequences. Systematicians can decide whether or not this method could be useful for classification of groups of micro-organisms.

      3) line 55: "Average nucleotidic identity (ANI) is nowadays the mostly acknowledged OGRI for assessing relatedness between genomic sequences." -> This is utterly wrong (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Did no one check the literature before submitting the work?<br /> See our previous answer to point 1.

      4) line 63: calculation time is a secondary criterion. The primary criterion is whether or not the species delineation method is sound from a methodological perspective and whether or not it correlates well with conventional DDH. In the age of multicore processors, cloud computing, and high throughput computing clusters, the question whether a method takes 1, 2 or 3 seconds is rather negligible. An emphasis on speed and simplicity is indeed counterproductive unless the authors show that their method outperforms existing methods in the field via the previously mentioned optimality criterion.<br /> We respectfully disagree with this comment. First of all, our k-mer based approach resulted in a 500-fold decrease of computing time in comparison to ANI (0.002 second versus 1 second). More importantly, access to cloud computing or high performance computer cluster is unfortunately not yet universal. It may be of interest to provide the opportunity to everyone to calculate relationships between genomic sequences. This could for instance decrease the number of wrongly labelled genome sequences in public databases.

      5) line 66: That the authors' method is faster than e.g. ANI is obvious because they operate on k-mers and not on raw sequence data, that way reducing complexity. But is a reduction in complexity what we want, i.e., discarding the information provided by the full sequences and the resulting alignments? <br /> We partially agree with this comment. Using short k-mer (k < 10) could indeed result in a low number of unique k-mer per genome sequence. However, when length increases, the number of unique k-mer per genome sequence is drastically enhanced. For instance, 5.6 millions of unique 15-mers are produced on average for a genome sequence of 6 Mb. In addition, alignment free method based on k-mer composition avoids some potential biases inherent in alignment methods. We also believe that providing different strategies aiming at deciphering genomics relatedness may help researchers to reinforce their conclusions.

      6) line 90: How can benchmark dataset restricted to a single genus (Pseudomonas) be valid for establishing a universal method for the species delineation in Bacteria and Archaea??? What if your method works well for Pseudomonas but not so for, say, Burkholderia? <br /> As stated in the discussion section we claimed that « it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera”. We performed the same analysis with a set of Burkholderia genome sequences available (n=2,228). As we are not expert in this field, we are happy to share with you our results (Burkholderia KI-S circlepack). You can then decide whether or not this result is in agreement with the current taxonomy of Burkholderia ?

      7) line 95: At the core of the authors' method is the percentage of shared k-mers between two respective genome sequences. However, earlier studies already reported a significantly lower performance of methods based on maximal unique matches (which is a special case of a k-mers). Moreover, why don't the authors discuss that the k-mer approach doesn't allow for any filtering by e-value or any other statistical criterion (as BLAST does)?<br /> We disagree with this comment. See answer to point 5. Moreover, to our opinion a presence of a string of length k (k-mer) between two genome sequence is exact (presence or absence). In contrast a percentage of identity filtered by an e-value is a proxy.

      8) line 132: Again, the authors claim that ANIb is a the best method for genome-based species delineation. That is simply not true (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Apart from that you have to compare to empirical DDH data, not ANI values. The latter only results in an increased level of indirection and and increased risk for an error of propagation.<br /> We have soften this statement. In addition this is reported in the discussion section « Whether full genome sequences should represent the basis of taxonomic classification is an ongoing debate between systematicians”

      9) line 187: Again, no, ANIb is not the current "gold standard" (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Apart from being misleading, the term "gold standard" can only apply to conventional DDH to which all novel in silico methods have to compare to (see above).<br /> Gold standard has been removed from the text.

      10) line 217: Apart from the problems mentioned above, the authors claim that the approach could provide a rapid complementary approach for bacterial classification. But how can it be complementary if it is not universal because it was only validated against a Pseudomonas dataset? In line 198 even state: "[...] it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera [...]". If at all, the scientific community needs a universal tool, not a tool totally detached from DDH (see above) and only valid for a specific genus.<br /> See answer to point 6

      11) Language is not good. Authors should consider proof-reading by a native speaker<br /> We have done our best (as non native speaker) to correct typographical and grammatical errors in the manuscript. We also tracked and corrected terminological inconsistencies. The article has now been proofread by a native English speaker. See acknowledgment section.

      12) some typos I found (not complete list):<br /> line 62: NBCI -> NCBI<br /> line 55: nucleotidic -> nucleotide<br /> line 138: "genomes sequences" -> genome sequences<br /> line 143: "is closed to" -> is close to<br /> line 228: "Finer-grained ..." -> A more fine-grained<br /> Thank-you, we fixed the typos.

    2. On 2019-03-29 15:33:20, user mbriand wrote:

      Dear Connor,

      First of all we would like to thank you for your time and thoughtful reading of the work. Your advices will definitely improve the manuscript, especially the clarity. We have addressed your comments in full, point-by-point.<br /> I'm sorry that I have to report several flawed assumptions in your method paper which affect the overall conclusion of your work. You can of course ignore this comment, but please keep in mind that the below points are crucial and ultimately affect how your study will be accepted, used and cited in the scientific community. The below points hold true regardless of whether or not you succeed with the publication in one or the other journal.<br /> Our goal is not to publish our work in a peer-reviewed journal but rather share the proposed method with the scientific community through this preprint.

      1) line 26: average nucleotide identity is not the "method of choice" and it is not the "gold standard" as you also claim further below. <br /> We have change “method of choice” and “gold-standard” to “widely employed method”<br /> That is, if the authors had carefully studied the literature, especially the paper introducing the term OGRI (doi: 10.1099/ijs.0.054171-0), they would have learned that digital DDH (doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120) is another important method in the field that was shown to outperform several ANI implementations (doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). How come that crucial methods with partly over 1000 citations are overlooked resulting in such plainly false statements?<br /> We apologize for the oversight. Our goal was not to provide an extensive literature overview of the overall genome relatedness indices (OGRI) that could be employed for comparing genomes sequences. Although Genome Blast Distance Phylogeny (GBDP) is off course a valuable OGRI for assessing relatedness between bacterial genome sequences, we feel that ANI is more frequently employed than GBDP. Nevertheless, we have added GBDP in the introduction and discussion sections.

      2) line 31: if the authors want to propose a new method for species delineation, they have to provide evidence that the method correlates well with datasets of empirical DDH. <br /> There has been a misunderstanding. We did not intend to propose a new method for species delineation. This is clearly mentioned in the discussion section “it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera. Indeed, since population dynamics, lifestyle and location impact molecular evolution, it is somewhat illusory to define a fixed threshold for species delineation”. Here we only proposed a quick, simple and effective technique for studying relationships between genomic sequences. Systematicians can decide whether or not this method could be useful for classification of groups of micro-organisms.

      3) line 55: "Average nucleotidic identity (ANI) is nowadays the mostly acknowledged OGRI for assessing relatedness between genomic sequences." -> This is utterly wrong (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Did no one check the literature before submitting the work?<br /> See our previous answer to point 1.

      4) line 63: calculation time is a secondary criterion. The primary criterion is whether or not the species delineation method is sound from a methodological perspective and whether or not it correlates well with conventional DDH. In the age of multicore processors, cloud computing, and high throughput computing clusters, the question whether a method takes 1, 2 or 3 seconds is rather negligible. An emphasis on speed and simplicity is indeed counterproductive unless the authors show that their method outperforms existing methods in the field via the previously mentioned optimality criterion.<br /> We respectfully disagree with this comment. First of all, our k-mer based approach resulted in a 500-fold decrease of computing time in comparison to ANI (0.002 second versus 1 second). More importantly, access to cloud computing or high performance computer cluster is unfortunately not yet universal. It may be of interest to provide the opportunity to everyone to calculate relationships between genomic sequences. This could for instance decrease the number of wrongly labelled genome sequences in public databases.

      5) line 66: That the authors' method is faster than e.g. ANI is obvious because they operate on k-mers and not on raw sequence data, that way reducing complexity. But is a reduction in complexity what we want, i.e., discarding the information provided by the full sequences and the resulting alignments? <br /> We partially agree with this comment. Using short k-mer (k < 10) could indeed result in a low number of unique k-mer per genome sequence. However, when length increases, the number of unique k-mer per genome sequence is drastically enhanced. For instance, 5.6 millions of unique 15-mers are produced on average for a genome sequence of 6 Mb. In addition, alignment free method based on k-mer composition avoids some potential biases inherent in alignment methods. We also believe that providing different strategies aiming at deciphering genomics relatedness may help researchers to reinforce their conclusions.

      6) line 90: How can benchmark dataset restricted to a single genus (Pseudomonas) be valid for establishing a universal method for the species delineation in Bacteria and Archaea??? What if your method works well for Pseudomonas but not so for, say, Burkholderia? <br /> As stated in the discussion section we claimed that « it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera”. We performed the same analysis with a set of Burkholderia genome sequences available (n=2,228). As we are not expert in this field, we are happy to share with you our results (http://catalogue-cfbp.inra....:BkMTu0psyHbwvUKCvzHA3fbk2UA "http://catalogue-cfbp.inra.fr/ki-s_circ/circ_burkho.html)"). You can then decide whether or not this result is in agreement with the current taxonomy of Burkholderia ?

      7) line 95: At the core of the authors' method is the percentage of shared k-mers between two respective genome sequences. However, earlier studies already reported a significantly lower performance of methods based on maximal unique matches (which is a special case of a k-mers). Moreover, why don't the authors discuss that the k-mer approach doesn't allow for any filtering by e-value or any other statistical criterion (as BLAST does)?<br /> We disagree with this comment. See answer to point 5. Moreover, to our opinion a presence of a string of length k (k-mer) between two genome sequence is exact (presence or absence). In contrast a percentage of identity filtered by an e-value is a proxy.

      8) line 132: Again, the authors claim that ANIb is a the best method for genome-based species delineation. That is simply not true (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Apart from that you have to compare to empirical DDH data, not ANI values. The latter only results in an increased level of indirection and and increased risk for an error of propagation.<br /> We have soften this statement. In addition this is reported in the discussion section « Whether full genome sequences should represent the basis of taxonomic classification is an ongoing debate between systematicians”

      9) line 187: Again, no, ANIb is not the current "gold standard" (see doi: 10.1186/1471-2105-14-60 and 10.4056/sigs.531120). Apart from being misleading, the term "gold standard" can only apply to conventional DDH to which all novel in silico methods have to compare to (see above).<br /> Gold standard has been removed from the text.

      10) line 217: Apart from the problems mentioned above, the authors claim that the approach could provide a rapid complementary approach for bacterial classification. But how can it be complementary if it is not universal because it was only validated against a Pseudomonas dataset? In line 198 even state: "[...] it is likely that the percentage of shared k-mers has to be adapted when investigating other bacterial genera [...]". If at all, the scientific community needs a universal tool, not a tool totally detached from DDH (see above) and only valid for a specific genus.<br /> See answer to point 6

      11) Language is not good. Authors should consider proof-reading by a native speaker<br /> We have done our best (as non native speaker) to correct typographical and grammatical errors in the manuscript. We also tracked and corrected terminological inconsistencies. The article has now been proofread by a native English speaker. See acknowledgment section.

    1. On 2019-04-05 07:17:21, user Able Lawrence wrote:

      How relevant is a 3 ng/ml lower Vitamin D blood level in the real world. <br /> What is the point of heritability study that does not take into account skin colour and latitude and consequently access to UV light. How much would genetic factors add to a model that includes skin pigmentation and latitude.

    1. On 2019-04-03 16:41:34, user Ariane Nunes Alves wrote:

      This is a very nice paper! I loved it!

      I have some comments:<br /> - for figures 2, 3 and 4: I did not like the representation of the data in the y axis. It is a bit hard to make comparisons for different tracers with different diffusion rates. Maybe you could change it to deltaL/L0, or Dtrans/(Dtrans at infinite dilution);<br /> - it would be nice to know the fraction of occupied volume for the amount of crowder you used in the experiments;<br /> - I saw figure S5, and I am not convinced that charges do not play a role in the enhancement in the transport of tracers. What are the net charges of the tracer particles and of the crowder? If charge really does not affect the enhancement in the transport of tracers, this contradicts the results of ref. 15 in the main paper. You could discuss possible reasons for such contradiction in the discussion.

    1. On 2019-04-01 18:29:51, user Stefan Stender wrote:

      Thank you for sharing this interesting work. One question: MARC1 p.Arg200Ter appears to be about 70-fold more common in Ashkenazi Jewish than in European populations: https://gnomad.broadinstitu...<br /> Do the 5 principal components of ancestry used in the analysis account for this?

    1. On 2019-04-01 06:21:39, user Veronica Hoad wrote:

      We read with interest your paper and would like to comment about ‘screening of blood for the presence of papillomavirus sequences until such time that it can be proven that<br /> the presence of HPV does not pose a risk.’ Given finite resources, blood services are increasingly using risk based decision making<br /> that balances safety, supply and affordability. Three key factors determine the<br /> blood safety risk for a particular infectious agent: the evidence of<br /> transfusion-transmission, the prevalence of infectious viremia among donors,<br /> and the severity of infection in transfusion recipients. For an infectious<br /> agent to be transfusion-transmissible, the agent must be present in the blood<br /> of donors who are asymptomatic/minimally symptomatic, retain viability after<br /> routine blood processing and storage, be in a state capable of causing<br /> infection via transfusion and present at a level higher than minimal infectious<br /> dose, and there needs to be a population of susceptible blood transfusion<br /> recipients (Ginzburg, Kessler et al. 2013).<br /> Many infectious agents have been found to be detectable in asymptomatic blood donors (Welch, Maclaran et al. 2003,Hudnall, Chen et al. 2008), but this finding is not synonymous with transfusion-transmissibility given that infectious virions must be present and<br /> the infectious agent must also survive modern blood storage techniques<br /> including leucodepletion of blood components. Like your study, there are other<br /> published animal models that have demonstrated transfusion-transmission of<br /> infectious agents in direct unprocessed blood (Brooks, Merks et al. 2007,<br /> Silva, Vieira-Damiani et al. 2016). <br /> However, this is not sufficient evidence to recommend blood donor screening in humans which must consider the three key factors as well as health economics and an operational assessment.<br /> Veronica C.Hoad, Claire E. Styles, Iain B. Gosbell, Australian Red Cross Blood Service.

      References<br /> Brooks, J. I., H. W. Merks, J. Fournier, R. S. Boneva and P. A. Sandstrom (2007). "Characterization of blood-borne transmission of simian foamy virus." Transfusion 47(1): 162-170.<br /> Ginzburg, Y., D. Kessler, S. Kang, B. Shaz and G. P. Wormser (2013). "Why has<br /> Borrelia burgdorferi not been transmitted by blood transfusion?" Transfusion 53(11): 2822-2826.<br /> Hudnall,S. D., T. Chen, P. Allison, S. K. Tyring and A. Heath (2008). "Herpesvirus<br /> prevalence and viral load in healthy blood donors by quantitative real-time<br /> polymerase chain reaction." Transfusion 48(6): 1180-1187.<br /> Silva, M. N., G. Vieira-Damiani, M. E. Ericson, K. Gupta, R. Gilioli, A. R. de<br /> Almeida, M. R. Drummond, B. G. Lania, K. de Almeida Lins, T. C. Soares and P.<br /> E. Velho (2016). "Bartonella henselae transmission by blood transfusion in<br /> mice." Transfusion 56 (6Pt 2): 1556-1559.<br /> Welch,J., K. Maclaran, T. Jordan and P. Simmonds (2003). "Frequency, viral<br /> loads, and serotype identification of enterovirus infections in Scottish blood<br /> donors." Transfusion 43(8):1060-1066.

    1. On 2019-03-31 17:00:07, user naomipenfold wrote:

      I'm happy to see more work investigating how preprints fit in with the process of disseminating and evaluating science. Thank you for sharing the current results as a preprint.

      I have some questions about this current work:

      1) How does quality of reporting affect integrity of science? For example, do we know if adherence to reporting guidelines improves likelihood that the science is sound and useful to others?

      2) Did the evaluators perceive lower statistical reporting in published versions as helpful to the science (e.g. removing over-reporting to make more concise and clear) or unhelpful (e.g. constraining full results to simpler less detailed statements)?

      3) I note it's hard to tell at what stage work has been preprinted: the v1<br /> here may not be truly the first version submitted to any journal. How likely is it that the preprints with embedded figures had already gone through a round of journal-led peer review?

      4) Does this survey pick up any change in conclusion between preprint and publication? (Not that I can see from your Qs or scope.) Do you plan to address this in the next batch of preprint-published pairs mentioned at the end of this preprint?

      In the next phase, looking at published versions of the preprints in the sample here:

      5) Would it help to also be able to refer to any published review reports for any of these preprint-published pairs, where available?

      6) Is the methodology for this next phase available in advance?

      And finally, separate to the results presented here and purely out of interest: what did the team learn by experiencing this survey process? For example: how difficult was information to find in preprints versus publications [your subjective Qs at the end of the survey]? What was it like managing a collaborative evaluation project?

      Many thanks in advance for your consideration.

      Disclosure: I am Associate Director for ASAPbio, a non-profit advocating for greater transparency in research communication, including through preprints.

    2. On 2019-03-26 21:12:48, user Charles Warden wrote:

      Interesting study - it caught my eye that the impact factor was not significantly correlated with the overall reporting score ("ρ=-0.07, p=0.52; Figure 2C"). I think this is true, but I don't believe I've seen anybody show that before.

    1. On 2019-03-31 00:38:04, user Gokul Rajan wrote:

      Nice work. :) It's really interesting that the microbes were necessary for this learning task; but isn't it an overstatement to call them sufficient for cognition?

    1. On 2019-03-29 14:31:31, user S. Biffo wrote:

      Nice work, from what I understood upon a fast reading. I have a couple of observations, one more phylosophical than a critic, the other is a question. Point one, in order to really know that modified RACK1 leads to a functional ribosome one should really do a knock-in mouse. We did not expect that in mice RACK1 loss, due to an hypomorphic allele was lethal, to the point that we could not rescue it in the p53 -/- background and we could not even arrive to the MEFs! In other terms, since people describe "ribosomal heterogeneity" in animal organs, I think that in vitro studies can be misleading when dealing with a property of ribosomes that we may suspect "perhaps" relevant in vivo. The other is a question, man proteomic studies identify Tyr phosphorylation of RACK at Y52. In your study, is p-Y52 likely to play a role in the off-rate? Bye, bye and thanks for posting it (Biffo)

    1. On 2019-03-29 13:30:35, user Steve Jay wrote:

      This study does important work of challenging a prevalent concept that has not been conclusively proven. Hopefully it will be published and circulated so the field can reinforce or refute the conclusions to further clarify the overall understanding of exosome biogenesis.

    2. On 2019-03-28 19:21:25, user Sónia Melo wrote:

      One of the best discussions I've ever seen in a paper. An unbiased approach that questions a paradigm with data. "...one cannot help but wonder whether the prevailing paradigm is based on anything more than a circular argument in which exosomes are believed to arise by endosomal budding for the sole reason that exosomes have been defined in that manner."<br /> Hope to see this out there soon!

    1. On 2019-03-28 22:49:04, user vered Raz wrote:

      nice work. I suggest reading our recent paper in iSCENCE - comparable results in a model for aged skeletal muscles. Deacetylation Inhibition Reverses PABPN1-Dependent Muscle Wasting

    1. On 2019-03-27 23:43:44, user Arie Horowitz wrote:

      Dear authors,<br /> May I provide some feedback?<br /> 1. The experimental data is sparse relative to the sophistication of the model.<br /> 2. Ex-vivo and in vivo (in zebrafish) testing of the predictions of the model would obviously <br /> increase the physiological significance of the study.<br /> 3. VE-cadherin may translocate from cell junctions without the formation of a physical gap. <br /> Visualization of f-actin would be a more robust evidence of gaps.<br /> 4. The videos are not accessible on this website.

      Best regards

    1. On 2019-03-27 21:04:10, user Adi Lavy wrote:

      I would like to thank the authors for publishing the supplementary tables, and point out that the samples from Rifle CO are actually of sediments and groundwater, not soil. This is thoroughly described in the numerous publications that came out from the Rifle site (and were not cited in the current manuscript).

    2. On 2019-03-24 18:26:10, user Adi Lavy wrote:

      Could the authors please publish Supplementary Tables 1-2 mentioned in the text, as there is no information as to which samples were actually used in this study?

    3. On 2019-03-22 19:43:57, user Jill Banfield wrote:

      The dark side of disrespectful use of “public data”: JGI and PNNL publishing sequences collected from “public” datasets that they do not understand. Prominent, apparently, are Rifle sequences from aquifer sediments. These are not soil samples. Likely also included are sequences from the many datasets generated by students and postdocs in my lab (one of JGI’s largest metagenomics users – no more!), some from soil, some from sediments. The team are advocates for “public data” – clearly for good reason: JGI declare all data public upon generation!! It should be noted that my collaborators and I supervise numerous students working on as yet unpublished manuscripts on phage in soil. These JGI sequenced datasets are (were?) likely central to their thesis research. That we were not even notified is a disgrace and the product speaks for itself.

    1. On 2019-03-27 19:49:57, user Andrew Johnson wrote:

      Nice work. A few minor comments: <br /> 1) the 1st report of IQGAP2 rare variant association with MPV was Ref. 49 - comment is that this was an Exome chip study rather than GWAS<br /> 2) rare variants in KALRN first reached genome-wide significance for MPV in Gieger et al., 2011 PMID 22139419 (not currently cited here), subsequently replicated in Eicher et al. Ref 49 and then Astle et al. Ref 29

    1. On 2019-03-27 15:55:29, user Xinwei Cao wrote:

      In this manuscript and the 2017 Genome Research paper by de Pretis et al., you suggest that the amount of Pol II may be limited. Is there a way to measure whether this is indeed the case?

    1. On 2019-03-27 13:58:58, user Bjarni Halldórsson wrote:

      This paper was discussed in our journal club and this is a summary of our discussion.

      The authors provide a method and an implementation for multi-individual assembly from short and long read data. The general idea is interesting, but it is not clear too how large pedigrees the method will scale in practice.

      Comments raised:<br /> 1) Pedigree graph is a confusing terminology, pedigrees are generally represented with graphs.<br /> 2) “The terminology bubble is drawn from Garg et al. (2018)” - the terminology bubble has been used since at least ~2000.<br /> 3) Referring to the Arabidopsis data as real data is odd as only one of the individuals in the trio has real data.<br /> 4) Comparing the error rate of the method with the rate of recombination and gene conversions it is clear that most of the detected “recombinations” are not recombinations but switches in haplotype phasing, a terminology used in previous publications.<br /> 5) Not penalizing haplotype switches in multiallelic variants will eventually bias the method to assigning switches to those.<br /> 6) During Illumina assembly it would be better to label the reads with the individual they come from to avoid false positive paths.<br /> 7) The description of bubble chain construction is not accurate. The authors talk about computing a coverage of every pair of nodes or bubbles in every alignment path when it is in fact only done for every pair of consecutive nodes/bubbles in an alignment.<br /> 8) It would be really interesting to see this applied to human data. The authors most likely would have if their method practically scaled to those sizes, so our assumption is that the method does not scale to human data.

    1. On 2019-03-27 12:42:22, user Abhishek Dutta wrote:

      The current version of the paper does not come with the figures? I mean some of us may just click on the current version and not look at the older version that contained them. Just a minor inconvenience.

    1. On 2019-03-26 20:29:36, user Vincent Denef wrote:

      We read and discussed this preprint as part of an upper-level microbial ecology class at the University of Michigan (EEB 446, Winter 2019) that I am teaching and below I am posting some of the thoughts the students had after reading the preprint:

      1. General thoughts. Brito (2019) poses the question, “Do we exchange oral and gut commensals with our closest family and friends?” in order to understand the impact of routine interpersonal contacts in shaping the microbiome composition. Addressing this question is important because the gut microbiome is so impactful to the normal health of humans, any information about how it is affected is important and useful, although the students would have liked to see a more explicit explanation of how knowledge of transmission impacts how we understand how microbiomes are shaped, function, and affect human health. The structure of the study focused on isolated, non-industrialized communities. This enabled the authors to focus in on interpersonal interactions while reducing potential influences of external factors. However, it also makes it challenging to relate findings to other communities that are industrialized. While this is acknowledged in the study, they felt that this should be treated as a case-study and the data should not be used to draw conclusions between other populations and geographic regions.

      2. They had some thoughts regarding the authors’ definition of 'transmission'. Brito et al. loosely define transmission by shared inferred genotypes. Their work provides insight into the correlation of community patterns for individuals in a household or family unit. As it is difficult to determine the exact mechanism for transmission, the approach used allowed the authors to identify trends in oral and gut microbiome similarities across individuals without understanding how or why this might be. Yet, this does mean they can’t necessarily rule out similar environmental factors among close family members to lead to similar ecological selection rather than transmission, thus there is a risk of overinterpreting correlative data.

      3. Use of social network data. Some students had some suggestions regarding the methodology used for social network construction and wondered if other analyses of the network structure could have been added to gain deeper insights. Specifically, within the social networks constructed, simplified approaches of defining an individual and establishing a single connection and then utilizing that network for analysis is very broad in nature and only skims the surface with respect to extracting information from a social network. Understanding centrality measures of individuals within the village i.e., degree of individuals tied to, geodesic betweenness (how often is an individual on the shortest path to another individual), closeness of an individual (how easily can they reach other actors within the network), and eigenvector measures (how well-connected are individuals that an individual is connected to) would all have allowed for a stronger utilization of microbiome sample data for the usage of predictive models. Each of these different centrality measures come with an attributable value associated with the strength of centrality. After determination of centrality measure values for each individual, correlation of network centrality values and similarity in both oral and gut microbiome compositions could be measured.

      4. Ethical concerns. Student questions: Did the participants in this study give consent, and furthermore, did they have informed consent about the study that they were taking part in? There were also questions whether the exact form used to gain informed consent could be shared to preempt any of these concerns readers may have. Further questions they had were whether the participants in this study will benefit in any way from the knowledge obtained in this study? Also, one student group wondered whether knowing about the microbiota composition of certain populations could help drug companies target certain populations with certain products?

      5. Other methodological, interpretation, or presentation concerns. The students wondered why they inferred the amount of years couples were married based on the age of their oldest children. It’s interesting why they didn’t just ask the couple how long they had been married also it’s not always true that children are directly related to amount of time lived together. Another question related to the data availability section, where they didn’t quite understand why the authors discuss mislabeling of a sample in the database. Could they change the database to reflect this labeling issue?

    1. On 2019-03-26 18:30:02, user Charles Warden wrote:

      I thought it was really cool that there was a link to a blog post describing this article.

      Is that automatic? Or, do you need to do something to link blog posts to pre-prints?

    1. On 2019-03-26 10:44:33, user Maju wrote:

      I have a problem with the presented Admixture analysis (fig. 2): where does the extra "pink" of Yamna come from, when in EHG is much lower and it is absent in Caucasus/West Asia? To me that looks like a horrible artifact. I was searching for the full Admixture run to check how that "pink artifact" is formed but I don't see it anywhere; the full or at least with more K-value columns is nowhere to be seen, there's no rationale for why only K=10 was used even. So, sadly enough, my impression is that there has been cherry-picking of data and that's not acceptable.

    2. On 2019-03-21 18:40:10, user R. Rocca wrote:

      In "Online Table 1" samples I12220, I12221 and I12222 are lebled as males, but column "AI" shows mtDNA haplogroups (U5a2b3, U5a2a1, U5a2a1)

    1. On 2019-03-25 23:31:03, user Eric A Brenner wrote:

      The most popular normalization method for scRNA-seq data I've seen is to normalize to 10,000, not to 1 million. That does make an important difference, does it not?

    1. On 2019-03-25 18:28:16, user Jen Anderson wrote:

      Interesting paper on an important and timely topic. It adds to the discussion of how best to generate a mutant using modern genome editing methods. You may be interested in checking out our publication in PLOS genetics, "mRNA processing in mutant zebrafish lines generated by chemical and CRISPR-mediated mutagenesis produces unexpected transcripts that escape nonsense-mediated decay". After finding two instances of nonsense-associated alternative splicing which skipped an exon but retained reading frame, we became interested in exon symmetry and asked whether zebrafish exons were symmetrical at a higher frequency than expected by random chance (across all coding genes) and found that zebrafish coding exons 2–10 had a 5.1% and 7.2% increase over chance (33.33%) in exons divisible by 3 (p-value < 2.2e-16). https://journals.plos.org/p...

    1. On 2019-03-25 13:42:56, user Nischalan Pillay wrote:

      Really thought provoking piece of work. A limitation in the arena of cancer evolution studies is the restriction to SNVs and Indels. The model will likely be more complex once structural variation is accounted for. @jnkath @robjonhnoble @dominik_burri have provided a good starting point from which to build!

    1. On 2019-03-25 01:12:27, user Sid.Byrareddy wrote:

      Thanks much for the comment. We will upload supplementary and will cite work of Gavin Screaton during revision of the paper.

    1. On 2019-03-23 17:02:07, user Robert Policastro wrote:

      Hello,

      Seurat reports the average fold change using natural log. In the methods you state the reported fold change from Seurat as log2. It might be worth it to double check whether the Seurat fold changes reported were indeed converted to log2, or whether the natural logs were actually considered..

      Cheers

    1. On 2019-03-23 13:45:18, user Elizabeth Sherman-Elvy wrote:

      Interesting approach to consider how adverse social conditions (incivility, rudeness, lack of proper attention, disdain from caregivers and medical practitioners) contribute to health outcomes. More attention needs to be paid to these very real but intangible factors.

    1. On 2019-03-21 18:38:41, user richard charles garratt wrote:

      Those of you interested in the Trimble Lab´s latest results may also want to take a look at REPOSITIONING SEPTINS WITHIN THE CORE PARTICLE by Mendonca et al. which was deposited in BioRxiv on the same day. The hexamer is shown to be 267762 rather than 762267.