Why fission yeast?

• Like most yeast, they have genomes that are easy to manipulate. Their genome easily undergo change in response to environmental factors and they easily uptake DNA up to a whole chromosome size. There also exists an extensive genetic engineering toolbox for yeast

• Yeast and mammals share a lot of homology because they share a common ancestor. There are many cellular pathways that are common to both.

• Lastly, the budding yeast genome contains one single rDNA cluster arranged as a linear array of 150–200 rDNA repeats on chromosome XII Fission yeast contain two rDNA arrays composed of 80–120 rDNA repeats located at the two ends of chromosome 3.

rDNA morphology digs deeper into how nucleolar organization changes:

rDNA organization in the nucleolus is not well understood. Therefore, how it influences nucleolar morphology is not understood.

Changes in ribosome biogenesis can be identified through structural changes in the nucleolus:

• Enlargement of the nucleolus can reflect increased ribosome biogenesis in cancer, as it supports the need for higher rates of proliferation

Other things that can signify changes in ribosome biogenesis: * Nucleolar structure * Presence of multiple nucleoli per nucleus (polynucleolarity) * Output of ribosomes

Stress-Activated MAPK Pathway * Name in Yeast: Hog1 pathway * Function: responds to osmotic and environmental stress * Mammalian ortholog: p38 MAPK pathway

Cell Integrity Pathway * Name in Yeast: Slt2/Mpk1 pathway * Function: maintains cell wall integrity and responds to extracellular stress such as heat, hypotonic shock, or membrane stress * Mammalian ortholog: ERK MAPK pathway - suspected because of similar roles in growth and stress response

Conserved cellular signaling pathways regulate RNA polymerase I to modulate ribosome biogenesis:

A cell would not want to go through the energy-intensive process of making ribosomes if there was not a need for them, so there are many cell signaling pathways that regulate RNA polymerase I in response to cellular stimuli. These are conserved between fission yeast and humans.

• TOR

• cAMP

• MAPK

• Cell Integrity Pathway

Ribosome biogenesis is energetically costly, so it should be well regulated:

Ribosome assembly requires large amounts of energy, so it is important to regulate several steps of the process.

A primary step of ribosome biogenesis is transcribing rDNA arrays into rRNA via RNA polymerase I. rRNA transcripts comprise 50%+ of all transcripts in a cell, so this is a very robust process.

GapR-GFP marks overtwisted DNA and can be used to study rDNA morphology:

GapR is a protein that binds to overtwisted DNA. It recruits a topoisomerase to release topological stress on DNA during transcription.

When tagged with GFP, it functions as a fluorescent marker and tracker (live cell imaging) of overtwisted DNA.

To identify overtwisted rDNA specifically, you can tag the nucleolus with a separate color and look at the merged fluorescent images of the nucleolus and overtwisted DNA. Alternatively, you could attach a nuclear localization sequence to GapR-GFP to primarily express it in the nucleus, increasing the probability of only marking rDNA.

Hypothesis

The morphology of rDNA arrays can reflect ribosome biogenesis.

What are rDNA arrays?

Many sections of a given genome contain repeats. In the case of rDNA, the repeats exist to produce large amounts of rRNA to meet the need of ribosomes in the cell.

Another example of repeats include satellite DNA which is found at centromeres. Long arrays of tandem repeats are coiled to provide a large surface area for the attachment of kinetochore proteins).

Fig 1.A finding:

GapR-GFP does not bind exclusively to rDNA, but also binds to bulk chromatin. However, it also accumulates in rDNA.

GapR-GFP is a valid live-cell marker for rDNA arrays, because it reliably lights up regions near or overlapping with the nucleolus, consistent with the known location of rDNA on chromosome 3.

Fig. 1 Goal:

Produce a marker that can quantify rDNA organization without interfering with it's function and works in live cells.

2:

When RPL is deleted from cells, their rDNA array is expanded. So, the rDNA is becoming more packed and the repeats are becoming stacked.

3:

When a cell doesn’t have enough ribosomal proteins (due to RPL deletion), it turns on important internal signaling pathways that are conserved across many organisms to try and compensate for the ribosome production problem.

1:

GapR-GFP helped them identify that the organization of rDNA changes with the cell cycle, glucose starvation, RNA pol1 inhibition, and TOR (cell growth) signaling.

Problem:

Because ribosome production requires so much energy and resources, there must be cellular pathways that regulate ribosome biogenesis to ensure that production matches cellular needs.

Novel technique: GapR-GFP

They introduce a novel technique using GapR, an endogenous protein that binds to overtwisted DNA, that is tagged with GFP, allowing for the live tracking and marking of actively transcribed rDNA into rRNA.

Summary:

When certain RPLs are depleted from a cell, ribosome biogenesis is changed. To compensate, the cell activates various signaling pathways, such as MAPK signaling which is involved in transmitting stress signals, that change how ribosomes are made leading to a change in rDNA structure.

Major finding 4:

A genetic analysis to identify genes or proteins involved in Torin1 resistance identified: 1. MAPK: protein kinase involved in directing cellular responses from external stimuli to regulate cell proliferation, gene expression, mitosis, and apoptosis. 2. Pmk1: Mitogen-activated protein kinase that enables MAPK activity and RNA polymerase II-specific DNA-binding transcription factor binding activity.

Why are RPL mutants resistant to Torin1?

• Genetic Analysis

• They introduce a pool of Bioneer Deletion Collection strains to the RPL mutant yeast strain and produce a mixture of double mutants (RPL mutant + any of the gene deletions from the collection).

• Then, they select for double mutant cells that show resistance to Torin1 and identify a list of deleted genes that are enriched (i.e., more common) in the Torin1 resistant cells.
• Next, they identify patterns in this list of deleted genes. For example, if two deleted genes are involved in the same cellular function or located in the same complex, then they are likely contributing to the Torin1 resistance.
• Then, they experimentally validate any enriched genes with patterns. So, they would deleting one enriched gene in in the RPL mutant and see if the cells are infact resistant to Torin1.

Major finding 3:

Cells regulate ribosome biogenesis using RPLs and adjusts both rDNA transcription and sensitivity to TOR signaling.

So, regulation of ribosome biogenesis is not only dependant on TOR signaling.

Major finding 2:

They analyzed a collection of yeast strains, where each strain was missing one gene (Bioneer Deletion Collection). They found that certain deletions of genes encoding large ribosomal protein (RPL) led to a change in rDNA morphology.

This tells us that rDNA morphology reflect a cell’s ability to make ribosomes. When proteins necessary for ribosome biogenesis are depleted, rDNA morphology is changed in response.

Major finding 1:

Normal twisting versus overtwisting of rDNA (aka rDNA array morphology aka spatial organization of rDNA arrays) is variable throughout different cellular processes.

Some of the processes they looked at include: * Cell cycle events

Different parts of the cell cycle will require more or less ribosomes which will in turn affect how much rDNA is being transcribed into rRNA.

• Glucose starvation

Ribosome biogenesis requires significant energy. In glucose starvation, less ribosome biogenesis is expected to occur, thus less overtristing of rDNA will occur due to reduced rDNA transcription.

• RNA polymerase inhibition

Reduced RNA transcription aka reduced rDNA --> rRNA. If transcription cannot occur, then rDNA will not be overtwisted.

• TOR activation:

TOR is a Target Of Rapamycin protein kinase that regulates cell growth and metabolism. When active, cells are in "grow-mode" meaning that they have high energy reserves. Thus, we can assume that there will be more rDNA overtwisting due to increased ribosome biogenesis.

Question:

Can we use the morphology of rDNA as a readout of how much ribosome production is happening? How do cells adjusts it to ribosome production in real time?

Why do we care about rDNA morphology?

How rDNA is transcribed into rRNA plays an essential role in how much ribosome biogenesis occurs.

Gap in field

While we understand a lot about how the shape of the nucleolus changes with ribosome biogenesis, we have not studied how the condensation, modification status, or secondary structures, for example, of of ribosomal DNA is modulated to affect ribosome biogenesis.

Nucleolus is the location of ribosome production:

The nucleolus makes ribosomal RNA (rRNA), and it combines it with proteins (transported from the cytoplasm via a nuclear localization sequence) to build ribosomes.

How did we find out that ribosomes were made in the nucleolus? Scientists used radioactive labels that could track molecules inside cells. They labeled RNA and followed it, noticing that ribosomal RNA was always found in the nucleolus.

What is ribosome biogenesis?

Individual processes involved in building ribosomes

What is nucleolar morphology?

Nucleolus: structure inside of the nucleus that is responsible for making ribosomes

Morphology = structure: shape, size, and appearance of the nucleolus

Overall, the authors are seeking an in depth molecular understanding of how DNA replication forks stall, restart, and how the DNA damage checkpoint leads to genome integrity.

They identified a mechanism for how fork stalling and restarting in vitro.

• They also found that by removing nucleotides from replication, DNA synthesis was quickly halted. However, CMG itself was not halted.
• When CMG continues, Okazaki fragments are still built, triggering the recruitment of:
• PCNA
• RFC
• DNA pol delta, epsilon
• These proteins halt DNA synthesis from starting and allow the DNA to be chewed up by nucleases.

When nucleases start chunkin the DNA up, this triggers the DNA damage checkpoint and fork progression is slowed.

The authors reconstitute DNA replication in vitro using budding yeast proteins to understand the molecular mechanisms of fork stalling, restarting, and stabilization by the DNA damage check point.

Any event that impedes replication fork progression (difficult to replicate sequences, conflicts with transcription machinery, and DNA damage) may result in incomplete genome replication.

These frequently lead to fork stalling, but rarely cause a failure to complete replication.When failures do happen the fork collapses leading to genome rearrangements, cell death and disease.

DNA damage activates three major checkpoints to halt the progression of the cell cycle.

• The G1/S checkpoint is activated in G1 cells to inhibit S-phase entry.
• The intra-S checkpoint is activated in S-phase cells to prevent the not-yet-activated origins from initiating DNA replication.
• The G2/M checkpoint is activated in G2 cells to inhibit the entry into mitosis.

The cell cycle checkpoints are triggered by protein phosphorylation that is readily reversible upon protein dephosphorylation so that cell cycle progression can resume after DNA lesions are repaired.

The authors wanted to start by directly impairing ubiquitylation of Mcm7. However this was not simple, because Mcm7 has multiple sites for possible ubiquitylation.

Figure 2EV shows the process of broadly finding regions of ubiquitylation sites on Mcm7.

Pannel A:

Their previous findings from 2020 show that the first lysine residue #29 on Mcm7 was the sole residue for ubiquitylation by SCF-Dia2 in vitro, even with Mrc1 present, which stimulates the formation of long ubiquitin chains on Mcm7.

However,

• E1 activates ubiquitin and transfers it to E2
• E2 is positioned close to the target by E3
• E3 transfers ubiquitin from E2 to the target

"Eukaryotic cells contain multiple versions of the E3 ubiquitin ligase known as the SCF (Skp1/cullin/F box), each of which is distinguished by a different F box protein that uses a domain at the carboxyl terminus to recognize substrates for ubiquitination. The F box protein Dia2 is an important determinant of genome stability in budding yeast"

Function of Rrm3 and Pif1 helicases.

Because Mcm7 cannot be ubiquitinated, CMG is constitutively bound to DNA, and will not be removed at any point in the cell cycle. This means that when the cell divides, it will divide it's DNA with CMG still loaded, and the next round of DNA replication will be impaired.

The authors mutated a region of the Mcm complex, specifically Mcm7, seemingly through a mutation at residue 10 from lysine to arginine, making it impossible to be ubiquitinated by SCF-Dia2.

Ubiquitnation leads to CMG unloading, via ubiquitylation, via disassembly by Cdc48/p97, so this mutation makes the CMG constitutively bound to DNA.

Cells with the Mcm7-10R mutation could not be ubiquitated and therefore CMG could not be disassembled.

However, this did not lead to cell death, because a secondary disassembly pathway using Rrm3 and Pif1 helicases was enacted.

Pif1 helicases may be responsible for CMG disassembly.

Without CMG disassembly, cells were not viable and the ability to ubiquitinate new helicases was lost? It seems.

Cells that have the MCM7-10R mutation will carry the CMG complex on their DNA into the next cell cycle. This helicase must be removed to make way for new helicases and further DNA replication.

The authors found that Rrm3 acts during S-phase to disassemble the CMG complexes from previous cell generations.

Orthologues are genes in different species that are related through evolution from a common ancestor and are expected to have similar functions.

Pif1 is a helicase responsible for the maintenance of nuclear and mitochondrial DNA in S. cerevisiae.

Pif1 tightly couples ATP hydrolysis, single-stranded DNA translocation, and duplex DNA unwinding.

Figures 1-3 demonstrate that the presence of ssDNA during metaphase in 44% of yeast cells may suggest that there is no DNA synthesis occurring during mitosis in these cells.

As genes get further away from the telomere, their % under-replication decreases.

The GO terms were likely shown to also contribute to the finding that these are unessential genes?

Knock outs of genes being replicated after metaphase have no affect on the fitness.

The big fat yellow spot is genes not replicating late in mitosis. As you move to the right along the x-axis, these genes do replicate late in mitosis and have the same affect on fitness in WT as the other ones do.

Correlation: * Replication timing and mutations rates in yeast (& humans) * Distance to telomere and mutation rates in yeast

Finally, when they inhibit Cdk, chromatin bridges are resolved in MEN-defic. cells.

Cells arrested in metaphase had stalled replication relative to cells in metaphase that had Cdk inhibited.

Stable G-rich regions near telomeres are replicated later than the rest of the genome.

Regions with many stable G-rich regions, transposable elements, and fragile sites are not replicated as much in metaphase.

After release from G1, subtelomeric regions were more under-replicated than regions further away from telomeric regions.

As you move further from the telomere, the underreplicated DNA decreases.

??

The authors used DNA copy number to distinguish the reasoning behind DNA synthesis late in mitosis. They found that subtelomeric regions were more underreplicated in metaphase than in telophase.

The signs of DNA synthesis occurring in anaphase could be due to a number of possibilities: * Repair of replicated DNA * Replication of diverse genomic regions * Replication of specific genomic regions

I feel like we know it's not replicated DNA, because we see single stranded DNA being carried through anaphase.

Why do we care if it is diverse of specific regions? - we want to know what regions of DNA are being replicated.

Identification of single stranded DNA throughout anaphase in cells without MENS

Another protein they looked at was DNA polymerase delta and epsilon.

When knocked out, they saw that MEN reactivation caused bridge disappearance after actomyosin ring (green) contraction.

mCherry = bridges

MEN reactivation allowed the cells to resolve their anaphase bridges. However, topoisomerase did not play a role in this.

They wanted to identify what proteins were involved in the resolution of anaphase bridges.

They looked at topoisomerase, because this is the protein that helps fix intertwined sister chromatids - which may have been contributing to the bridges.

However, inhibition of this protein did not not affect the resolution of anaphase bridges.

They also saw that when the ATP analog was washed out from the reaction, the bridges resolved themselves. This was in cells that had cohesin present.

Men inhibition did affect the amount and longevity of chromatin bridges in anaphase. So, the authors next sought to identify if persistent cohesion (holds sister chromatids together) was the reason that these bridges were forming.

They did this by inhibiting both MEN and cohesion in one cell population, and then inhibiting only cohesion in another, and observing their affect on each other.

They saw that MEN bridges were stable in both cell populations throughout anaphase.

The authors next looked into the cohesion of sister chromatin, seeking to identify if the cohesion of sister chromatids led to the anaphase bridges.

They did this by mutating MEN using an ATP analog (NA-PP1), and by heat inactivating cohesin. They also reintroduced MEN to see if chromatin bridges were affected.

They compared the time it took for loci to separate and found that mutations to MEN components did not affect segregation of rDNA or Tel12R.

While MEN inhibition does affect the amount of longevity of chroamtin bridges during anaphase, it does not affect the segregation of difficult-to-replicate regions of DNA.

• 5-kb tetO array = allows for controlled expression of yellow fluorescent protein (YFP).

• This was inserted downstream to the telomere region.

• The spindle poles are marked with mCherry to identify cell cycle status and gain spatial reasoning.

Telomeres and rRNA are regions suspected to be more difficult to replicate, making them ideal for study during anaphase.

In panel a, the WT cells display chromatin bridges between 100 and 150 minutes from G1 release.

In the MEN mutants, chromatin bridges are sustained from 100 minutes to 200 minutes from G1 release, and the number of cells with chromatin bridges increases. This was the case for all MEN mutants.

MEN inhibiton delays resolution of chromatin bridges during anaphase.

The authors studied cells with and without MEN (responsible for inactivating Cdk at the end of mitosis).

The MEN complex inhibitis cdk to allow cells to finish DNA replication at the end of mitosis, during anaphase.

They next studied the division of chromosomes following initial seperation.

By marking two individual sister chromatids, they could track where they move throughout anaphase relative to each other. They observed sister chromatids collasping back into one position in late anaphase.

They believe this is nondisjunction.

Subtelomeres are composed of two regions: a telomere-proximal region and a telomere-distal region.

Components involved in the MEN

Q: how does Cdk activity, specifically the inhibition of Cdk at the end of mitosis, affect DNA synthesis?

High Cdk activity during metaphase (M checkpoint) stalls DNA replication at this point.

And the inhibition of Cdk during metaphase should allow for cells to move on in the cell cycle and replicate their DNA.

Rad9 = DNA damage response during G2

When the gene was knocked-out, the inhibition of nuclear division and chromatin bridges were abolished.

RAD9 = mediates stalled DNA rep.

If pol3 is required for both DNA synthesis and for nuclear division, then the two actions must be interdependent.

Selects for regions that evolve faster - may produce helpful mutations

Quantified in boxplots:

• Duration of chromatin bridges and time to divide nuclear contents was greater in cells with ssDNA.

Overall, figure 3 shows that 44% of cells have ssDNA during anaphase of mitosis. This seems to correlate with the slowing of cell cycle progression and an increase in the duration that chromosome bridges exist and the time for nuclear division.

In the 44% of cells that had ssDNA during anaphase, more chromatin bridges were observed.

GFP>single stranded DNA = can be associated with DNA synthesis mCherry>spindle poles = appear in prophase, breaks down in telophase

The arrows in panel a point to signs of single stranded DNA that persists during anaphase (anaphase is identified by appearance of red spindle poles).

44% of cells had single stranded DNA in anaphase

Was cytokinesis (metaphase into anaphase and so on) delayed by the inhibition of DNA synthesis?

mCherry is large compared to histones and can have side affects in experiments.

A RAD9 checkpoint gene knockout: * Abolished delays in nuclear division * Abolished chromatin bridge formation

Without RAD9, the bridges resolve quicker

You can see in panel a that the +HU cells took longer to fully divide and had chromatin bridges for longer than the -HU cells.

Disruption of DNA synthesis during mitosis 1. delayed nuclear and cell division 2. triggered longer lasting chromatin bridges

You need nucleotides to finish the division

Confirming that assychrons cells incorporated EdU at late metaphase and G1 as well

MET3pr-CDC20 cells utilize the methionine 3 (MET3) promoter to regulate the expression of the CDC20. This allows for the regulation of CDC20 expression based on the availability of methionine in the growth medium.

• When methionine is present, the MET3 promoter is inactive, and CDC20 expression is low.

• When methionine is absent, the MET3 promoter becomes active, leading to increased expression of CDC20.

Easiest to arrest in met

• GFP>single stranded DNA = associated with DNA synthesis

• mCherry>chromosomes

Inhibition of DNA synthesis does slow the progression of cells into cytokinesis.

Cytokinesis begins in anaphase and ends in telophase

Panel b * The number of +HU cells that divided over time was less than -HU cells

• The knock-out of RAD improved the number of +HU cells dividing.

Temperature Sensitive Mutants

Panel c

• The temperature-sensitive mutant of GINS showed a similar trend, to a lesser extent.

Panel d

• Mut Polα reduced division a little bit

• Mut Polε reduced division a lot

• Mut Polδ did not reduce division

Panel e

• Emphasis on Polε

Delays in nuclear and cell division varied among temperature-sensitive mutants:

• Polε mutant cells had the greatest affect

Cells were arrested in metaphase. They then released cells into anaphase with the following conditions: 1. ribonucleotide reductase inhibitor hydroxyurea 2. temperature sensitive-mutants of pol alpha, delta, epsilon, and GINS

• mCherry>chromatin = visualize bridges
• GFP>actomyosin ring = visualize cellular division

When DNA synthesis machinery was inhibited during M phase, both DNA synthesis and nuclear and cell division was inhibited.

To do this, they shut down DNA synthesis completely by inhibiting the catalytic subunit of pol δ (pol3).

However, this depletion inhibited nuclear division :/

• When S phase checkpoint is not triggered, cancer cells complete any unfinished DNA replication during early mitosis.
• If cancer cells can do this, maybe healthy cells can too.
• Yeast mutants can get past this checkpoint and enter mitosis with unreplicated DNA.

Question: does mitotic DNA synthesis occur in healthy yeast cells?

During G1, a cell contains high levels of nucleotides. This is because G1 is the growth phase, where it prepares everything it needs to DNA replication in S phase, and subsequent cell division in M phase.

In panel C, they looked at cell morphology 1. After metaphase arrest 2. After metaphase release

They stained for the nucleolus and the nuclear envelope.

• DAPI>chromosomes, shows how condensed chromosomes are
• GFP>nucleolus = breaks down in prophase
• mCherry>nuclear envelope = prometaphase

Cells in G1 had higher EdU incorporation than those in metaphase.

This suggests that mitotic DNA synthesis occurs between metaphase and G1 - maybe anaphase.

The authors arrested cells in metaphase, incorporated EdU, then released.

They then arrested again in G1.

EdU incorporation was measured: 1. 1 hr into metaphase 2. Following G1 arrest

Budding yeast mutants have been able to enter mitosis without complete DNA replication, suggesting that the S phase checkpoint was left untriggered.

Thus, these are candidates for the study of MiDAS.

In the event that replication stress does not trigger S phase checkpoints, cancer cells have been observed to complete DNA replication during early mitosis.

If cancer cells can do this, maybe healthy cells can too.

DAPI staining may elucidate cell cycle stage based on chromosome condensation status. Thus, the researchers can look at EdU incorporation in relation to chromosome condensation.

Suggests that MiDAS is occurring after metaphase

The nucleolus takes up 25% of a cell's nucleus. It is a region of the nucleus responsible for the synthesis of ribosomal RNA (rRNA), which is a building block of ribosomes, and the synthesis of ribosomes themselves.

Mitochondria evolved from bacteria that were engulfed by nucleated ancestral cells. Thus, mitochondria have their own genomes, as well as their own machinery for making RNA and organelle proteins.

What is meant by a "pusle"? Do they add EdU for only 60 minutes, then was residual EdU out?

Reasoning/question

4′,6-diamidino-2-phenylindole (DAPI) is a blue-fluorescent DNA stain that exhibits fluorescence upon binding to AT regions of double stranded DNA, allowing you to count chromosomes.

https://www.youtube.com/watch?v=0BqJ58ZiWwA

Canonically, during S phase of the cell cycle, all of a cell's DNA is replicated with the assistance of a protein complex called a replisome.

DNA replication must be highly accurate, as this newly synthesized DNA will be passed onto progeny cells and is necessary for cell survival.

In this instance temporal relates to time.

The accuracy of DNA replication is ensured through the separation of DNA replication and division of chromosomes in time. Furthermore, once a cell is dividing, there are mechanisms in place to ensure that one copy of each chromosome is allocated to each new cell.

DNA synthesis that occurs during chromosome segregation has been shown to increase mutation rates of DNA near telomeres

Subtelomeric regions

One specific mutation being observed is the gain of multiple copies of a given piece of DNA, or the loss of that piece of DNA all together. Aneuploidy is a type of copynumber variation.

DNA replication has been observed outside of S-phase, and as late as anaphase in mitosis. This contradicts the previous sentence in which DNA replication occurs separate from cellular division in order to ensure faithful replication and segregation.

It is unclear why this may be occurring in 20-40% of yeast cells not experiencing replicative stress.

Replicative stress can manifest from a number of things.

Misincorporation of ribonucleotides, secondary DNA structures, conflicts between replication and transcription machinery, insufficiency of essential replication factors, common fragile sites, or chromosome inaccessibility can all cause replicative stress.

Replication stress leads to the appearance of stalled replication forks. Stalled replication forks produce physical changes to DNA that induce checkpoint signals. For example, the minichromosome maintenance (MCM) helicase continues unwinding the DNA and generates some excess single stranded DNA (ssDNA).

Resources

• https://www.nature.com/scitable/topicpage/recovering-a-stalled-replication-fork-14436634/
• https://en.wikipedia.org/wiki/DNA_replication_stress#:~:text=DNA%20replication%20stress%20refers%20to,in%20a%20stalled%20replication%20fork.
• https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7948514/

When cells divide, they must first replicate all of their DNA, to be passed onto progeny cells.

Eukaryotic cells replicate their genome with significantly high accuracy.

1. The recombinant Pap31 antigen is added to the well and incubated, allowing for Pap31 to adhere to the well.
2. The patient sample is then added to the well and incubated, allowing for binding of existing antibodies to Pap31.
3. A secondary antibody, against IgG and IgM, are bound to an enzyme, and then are added and incubated to bind to the primary antibody.
4. The well is then filled with a substrate that will react with the enzyme and lead to a color change. The intensity of this color change is measured via optical density and correlated to antigen concentration.

"Microtiter plates (96 well) were coated overnight at 4°C with antigens diluted in PBS, blocked with 0.5% boiled casein for 1 h, and rinsed twice with PBS for 5 min each time. Linbro U plates (catalog no. U 76-311-05; ICN, Costa Mesa, Calif.) were used for assays with rabbit sera, while Microtest III tissue culture plates (Falcon catalog no. 3072) were employed with human sera. Patient sera were diluted 1:400 in PBS with control protein extracts (20 μg/ml) purified from E. coli BL21 by a procedure identical to that used for purifying r56 (fractions collected at 21 to 32 min pooled from gradients equivalent to Fig. ​Fig.2),2), preabsorbed for about 1 h at room temperature, and then added to the ELISA plates. The plates were incubated for 1 h at room temperature and washed four times with 0.1% Triton X-100 in PBS. Peroxidase-conjugated mouse anti-human IgG (Fc specific) (Accurate Chemical and Scientific Corp., Westbury, N.Y.) diluted 1:8,000 and goat anti-human IgM (mu chain specific) (Kirkegaard & Perry) diluted 1:1,000 were added. After 1 h of incubation at room temperature, the plates were washed four times with 0.1% Triton X-100 in PBS and the last wash was with PBS only before the addition of the 2,2′-azinobis(3-ethylbenzthiazoline sulfonic acid) (ABTS) substrate (Kirkegaard & Perry). Optical densities at 405 nm (OD405) were measured after 15 min of incubation at room temperature. Rabbit sera were diluted 1:250 with PBS only. All procedures were the same as for detection of human antibodies except that rabbit sera were not preabsorbed with protein preparations from BL21 and peroxidase-conjugated goat anti-rabbit IgG (Kirkegaard & Perry) diluted 1:2,000 was used."

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC95611/

"Primers for rPap31 were designed according to the ATCC strain 35685 (KC583) sequence determined by L. Hendrix. The sequence has just been submitted to GenBank (accession number DQ207957) (forward primer: gcagcatatgttatgatcccgcaagaaata; reverse primer: ctaaaggcacaaccacaacgcattcttaag). The rPap31 gene segment was amplified using the genomic DNA of a local strain HOSP 800–09 as the template. PCR product was inserted between the NdeI and EcoRI sites of the expression vector pET24a (pET24a-pap31). The rPap31 protein was expressed in E. coli BL21 (DE3) after induction with 1 mM IPTG. The Pap31 gene segment in pET24a was recloned by GenWay Biotech Incorporated (San Diego, CA) to attach a T7 tag to the N-terminus of the rPap31 gene insert. The rPap31 was expressed as an inclusion body, which was washed and solubilized with 8 M urea in the presence of 1% Triton X-100 and 2 mM DTT in 50 mM Tris HCl, pH 8.0. The polypeptide was refolded by dialysis against 0.1 mM EDTA/12% glycerol in 50 mM Tris-HCl, pH 8.0, at 4°C. The refolded protein was further purified using the T7-tag affinity column in the presence of 2 M urea."

https://nyaspubs.onlinelibrary.wiley.com/doi/10.1196/annals.1355.045

Statistic of the ROC curve used in the interpretation and evaluation of a biomarker, which defines the maximum potential effectiveness of a biomarker.

Youden's J Statistic (J)

$$ \sum (sensitivity + specificity)-1$$

• Sensitivity: true positive rate
• Specificity: true negative rate

It outputs a value between -1 and 1, which can then be turned into a percentage.

• -1: test preforms opposite to it's intended function
• 1: test preforms exactly as it's intended function

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2515362/ https://www.youtube.com/watch?v=wMRFteWbfX0

In this paper, the authors produced recombinant Pap31 to capture antibodies against b. bacilliformis in an ELISA assay.

The goal is to detect this antibody using a method that yields similar sensitivity and specificity to IFA (the standard diagnostic tool for Carrion's), but is more affordable.

IgM antibodies are produced against an antigen in the early stages of infection and are detectable after four to seven days.

IgG antibodies are produced seven to 14 days after infection, and are detectable for months and even years, depending upon the antigen and the individual.

What Testing for IgG and IgM Reveals

• Positive IgM and Negative IgG: recent or acute infection

• Positive IgG and Negative IgM: a past infection

• Positive IgM and Positive IgG: ongoing infection

• Negative IgM and Negative IgG: no current or past infection

Their findings from 302 samples

• Positive IgM and Negative IgG: 34

• Positive IgG and Negative IgM: 103

• Positive IgM and Positive IgG: 22

• Negative IgM and Negative IgG: 143

The authors then compared an ELISA for recombinant Pap31 antigen and the detection of antibodies specific to B. bacilliformis.

Figures 1 and 2 and Table 1 are a proof of concept, designed to confirm that the authors could accurately and specifically detect IgG and IgM antibodies from patient serum samples using OD readings as a diagnostic tool.

In Table 1, the mean optical density (OD) from ELISA assays is measured.

The table is split into IgG and IgM results.

Findings

• IgG positive patient samples had a higher OD than IgG negative patient samples. The same trend was observed in IgM positive and negative samples.

• Patients who were positive for either IgG or IgM have higher OD readings than patients who were negative for either IgG or IgM.

This table shows that an ELISA-based assay is able to differentiate between individuals with and without IgG or IgM antibodies with statistical significance. This table tells us the disease state of a given patient.

Indirect ELISA 1. The patient sample is added to a well and incubated, allowing for any antigens to adhere to the well. 2. Then, a primary antibody designed to specifically bind to a given antigen (Pap31) is added to the solution and incubated.<br /> 3. A secondary antibody, bound to an enzyme, is then added and incubated to bind to the primary antibody. 4. The well is then filled with a substrate that will react with the enzyme and lead to a color change. The intensity of this color change is correlated to antigen concentration.

Optical Density (OD)

OD values measure the amount of light absorbed by a sample. Higher OD values generally indicate a higher concentration of antibodies or a stronger reaction.

Their findings on OD from IFA assays

Patient samples that were positive for IgG or IgM had higher OD values than patient samples that were negative for IgG or IgM.

This indicates that the positive patient samples have higher antibody concentrations, and likely higher Pap31 concentrations. This result can be used to support the diagnostic accuracy of the IFA test.

This plot tells us the sensitivity of the ELISA assays preformed in these experiments. It will tell us how often the result, whether positive or negative, was correct.

Here is how it works

A receiver operating characteristic curve plots true positive rate (TPR) against false positive rate (FPR) at each threshold setting. A threshold is a value that determines whether a prediction is classified as positive or negative.

• TPR: This measures the proportion of actual positives that are correctly identified by the mode

• FPR: This measures the proportion of actual negatives that are incorrectly classified as positive

Without MUS81, POLD3 and POLD4 is not recruited as efficiently.

Relationship between POLD3 and MUS81 and how they may function to regulate DNA replication factors at CFSs.

POLD3 nor POLD4 are not necessary for MUS81, POLD1 or PCNA recruitment to chromatin.

Subcellular fractionation analysis is used to separate and isolate different organelles or subcellular components from a cell, including chromatin.

U2OS cells are a type of human osteosarcoma cell line. Osteosarcoma is a type of bone cancer. U2OS cells were derived from a 15-year-old female with osteosarcoma and have been extensively used in biomedical research.

Question: how late in S phase does replication of CFSs under stress occur?

Major findings: 1. Replicative-stress-induced DNA synthesis can occur after entry into mitosis, but only before prometaphase. 2. Mitotic DNA synthesis occurs primarily at CFSs.

Experiments: EdU incorporation to detect new DNA synthesis under three conditions: stress, cell cycle step, location on chromosomes.

MUS81 likely helps recruit POLD3, POLD4 during mitosis.

New mitotic DNA synthesis occurs via the POLD3 subunit of POLδ.

POLD3 is required for reduction of DNA damage, anaphase bridges.

Reintroduction of POLD3 did ellicit DNA synthesis in mitotic cells.

POLD3 nor POLD4 are not required for MUS81 localization to CFSs during mitosis. Thus, the chromosome can still be cut, even without the polymerase there to repair it with new DNA.

This leads to more broken DNA that cannot be repaired.

POLD3, required for break-induced repair, appears early in mitosis, but not during anaphase.

Phosphorylation of EME1 helps recruit MUS81 during mitosis to initiate the DNA damage response and mitotic DNA synthesis.

Hypothesis/question:

If DNA synthesis is occuring in mitosis, there must be a polymerase carrying out the synthesis. What would happen if we inhibited this polymerase?

Major findings: 1. Inhibition of DNA polymerase during mitosis led to lethal chromosomal mis-segregation and non-disjunction. 2. Mitotic DNA synthesis is necessary for cell survival under replicative stress.

Experiments: cell synchronization experiments allowed researchers to release all cells into mitosis at once, and then observe the affects following cell division. They used 53BP1 nuclear bodies to identify regions of unprocessed CFSs in progeny cells to determine the affect of DNA polymerase inhibition during mitosis.

Inhibition of DNA polymerase during mitosis led to greater number of anaphase bridges, non-disjunction, and cell death. This means that mitotic DNA synthesis can be cricual to cell survival and ability to thrive.

Inhibition of DNA polymerase during mitosis led to greater number of unprocessed CFSs.

53BP1 nuclear bodies are specialized structures in the nucleus that form around unprocessed CFSs and are associated with DNA damage response mechanisms.

Using 53BP1 nuclear bodies, the authors could identify sites of DNA damage, particularly at CFSs.

Researchers wanted to know what polymerases were involved in the synthesis of new DNA during mitosis.

Hypothesis/question:

1. What is the role of MUS81-EME1 and their scaffold proein SLX4 in mitotic DNA synthesis?
2. What events in prophase contribute to DNA synthesis during mitosis (specifcally prophase)?

Major findings:

1. Confirmation that MUS81-EME1 are both required for new DNA synthesis in mitotic cells. MUS81 specically uses endonuclease catalytic activity to promote new DNA synthesis.
2. SLX4 is requried for MUS81 localization to CFSs, but not the opposite.
3. SMC2 and WAPL are required for MUS81 recruitment to CFSs.
4. While they are required for chromosome morphology during the cell cycle, SMC2 and WAPL do not contribute to the stability of chromosomes.
5. Mitotic DNA synthesis occursbefore or during the release of sister chromatids.

Experiments: EdU incorporation to detect new DNA synthesis during knock outs of mitotic proteins involved in DNA damage repair and DNA morphology. Co-localization to detect presence of proteins at CFSs.

When SMC2 and WAPL were depleted, chromosomes were not formed correctly for cell division, as expected.

SMC2 or WAPL depletion led to stalling of interphase checkpoints.

Depletion of SMC2 or WAPL have no affect on DNA damage during S phase.

PLK1i helps release sister chromatids in preparation for cell division.

It's presence inhibited the cell's ability to synthesize new DNA during mitosis, suggesting that sister chromatids are released before or during MiDAS.

Depletion of these proteins related to chromosome structure did not affect SLX4's ability to localize at CFSs.

FANCD2 twin foci are formed by the FANCD2 protein, which is part of the Fanconi Anemia (FA) DNA repair pathway.

The presence of FANCD2 twin foci indicates the location of CFSs.

Co-localization is when two or more molecules or structures are found in close proximity to each other within a cell.

SMC2 and WAPL are required for MUS81 recruitment.

Note: PMAT = mitosis Because the events of MiDAS were determined to occur after G2 but before prometaphase, the authors were interested to see what in prophase contributed to new DNA synthesis.

SMC2 = chromosome compaction

WAPL and PLK1 = release of sister chromatids

Because SLX4 is a scaffold protein for MUS81 and was found to localize with CFSs during mitosis.

Thus, they depleted SLX4 to determine it's role in relation with CFSs during mitosis.

Results: 1. New DNA synthesis was reduced 2. CFS turning into gaps or breaks during mitosis was reduced 3. Reduced recruitment of MUS81 to CFSs

After knocking down MUS81, the researchers wanted to restore it's function to see how EdU incorporation was affected with MUS81 present.

They tried two different methods: 1. siRNA resistant MUS81 2. catalytically inactive MUS81?? (I think this was to determine if it has a catalytic function)

Results: 1. siRNA resistant MUS81 can restore function 2. catalytically inactive MUS81 cannot restore function

siRNA is a type of RNA interference, a mechanism used for regulation of proteins.

In combination with an Ago protein, the seed sequence of the siRNA, found in the 5' UTR, functions as a RISC complex that can find and bind to complimentary mRNA sequences and target them for silencing.

The use of an siRNA resistant MUS81 sequence in this experiment allows for both the knock-down and introduction of MUS81 to observe it's affects.

MUS81-EME1 is responsible for cleaving DNA at stalled and collapsed replication forks, triggering a DNA repair pathway.

However, when MUS81 was knocked down, new DNA synthesis was not observed, because stalled forks were not cleaved and the pathway to fix them was not triggered.

Scaffold proteins are known to interact with multiple proteins involved in a signaling pathway, tethering them into complexes. In such pathways, they regulate signal transduction and help localize pathway components.

Hypothesis/question: how late in S phase does replication of CFSs under stress occur?

Major findings: 1. Replicative-stress-induced DNA synthesis can occur after entry into mitosis, but only before prometaphase. 2. Mitotic DNA synthesis occurs primarily at CFSs.

Experiments: EdU incorporation to detect new DNA synthesis under three conditions: stress, cell cycle step, location on chromosomes.

Specific markers that indicate the location of CFSs in the genome.

Occurrence of DNA synthesis was tracked and visualized specifically in cells that had progressed into mitosis after being exposed to replicative stress (APH inhibitor).

Cells that had already moved to prometaphase did not show signs of mitotic DNA synthesis - later papers showed otherwise.

Tells us that some level of DNA replication is occurring in mitosis, as late as anaphase.

40% is questionable among scientists.

(A) thymidine amino acid, (B) 5-bromo-2'-deoxyuridine antibody (BrdU), and (C) 5-ethynyl-2'-deoxyuridine azide (EdU).

EdU is incorporated into the genome during DNA replication and allows for the identification of newly synthesized DNA via fluorescence.

"Why" the authors did these experiments.

Major finding

Major finding

MUS81-EME1 promotes the appearance of chromosome gaps or breaks at CFSs by cleaving stalled replication forks, triggering a DNA damage response that can lead to chromosomal instability.

MUS81-EME1 is a DNA endonuclease that is recruited during prophase of the mitosis. MUS81-EME1 is involved in resolving DNA structures, such as Holliday junctions, formed during genetic recombination. These structures need to be resolved correctly to ensure accurate chromosome segregation during mitosis.

Holliday junction: involves the exchange of DNA strands between two homologous chromosomes or sister chromatids. Resolving a Holliday junction means cleaving the junction to allow the strands to separate properly, ensuring accurate recombination and genetic diversity.

Cancers have high mutation rates, which are increased further under replication stress.

Stalled replications forks arising from CFSs can collapse and form DNA breaks (SSBs and DSBs). This causes the gaps or breaks on metaphase chromosomes.

Common fragile sites are regions of a genome that exhibit difficult-to-replicate sequences and secondary structures (generally resulting from AT-rich repeats). These regions are generally stable, but when a cell experiences replicative stress, they can become more difficult to replicate, leading to incomplete replication of CFSs that are carried through into mitosis [1,2].

CFSs are hotspots for chromosomal instability and rearrangements in cancers [2].

1. T. Glover. Common fragile sites. Cancer Lett 2006. Doi: 10.1016/j.canlet.2005.08.032.
2. Li, S., Wu, X. Common fragile sites: protection and repair. Cell Biosci 2020. https://doi.org/10.1186/s13578-020-00392.

Tumorigenesis: conversion of a healthy cell into cancer cells.

Oncogene activation disrupts canonical cellular pathways, leading to genome instability.

• secondary structures resulting from AT-rich sequences
• Transcription–replication conflicts: cellular machineries responsible for gene expression and genome duplication collide with each other on the same genomic location.
• Lack of replication origins

Replication is a highly regulated process designed to guarantee accurate duplication of the genome once per cell cycle. Any condition that compromises it is referred to as replication stress.

When cells experience replication stress, replication of CFSs are particularly impacted, leading to uncomplete replication when cells enter mitosis.

The recurrent formation of gaps and breaks at CFSs highlights their inherent instability and vulnerability to disruptions in DNA replication processes.

Cytogenetically defined gaps and breaks: gaps and breaks on chromosomes at CFSs are visually identifiable under a microscope using cytogenetic techniques.

In an effort to elucidate the mechanisms that regulate cardiac and smooth muscle genes, scientists performed a BLAST search to look for potential cardiac-specific genes that may be involved in regulation.

Discovery of myocardin

Proteins that assist in the activation of genes involved in muscle formation and function

SRF doesn ot appear to function only in the muscles, so it likely relies on the recruitment of myogenic accessroy factors to accomblish gene activation.

SRF binds to the serum response element (SRE) in the promoter region of target genes.

When certain cells are stimulated by growth factors or mitogens, some of their genes get turned on temporarily. These genes are generally regulated by a region called the serum response element (SRE).

Mitogen = A mitogen is a small bioactive protein or peptide that induces a cell to begin cell division, or enhances the rate of division (mitosis).

1 of the 20 new, previously unidentified sequences matched with a region of the gene MYOCD known as the 3' untranslated region (UTR)

BLAST (Basic Local Alignment Search Tool): * Compares sequences of nucleotides or proteins to find similarities * Wang et. al. compared sequences derived from RNA (expressed sequence tags) obtained from libraries of embryonic cardiac muscle cells with sequences already known and recorded in databases

Transcriptomics: * Techniques used to study an organism's transcriptome, the sum of all of its RNA transcripts. * Can provide insight into gene expression.

individuals who inherit only one mutated copy of the gene (heterozygotes) typically have around a 50% deficiency in the corresponding enzyme. However, this level of deficiency is usually not enough to cause the disease.

Individuals who were homozygous recessive would have the disease.