1,624 Matching Annotations
  1. Feb 2026
    1. We analyzed the effects of Ezh2Y641F expression on the distribution of H3K27me3 at promoter regions, TSS and gene bodies. Toward that end, we rank-ordered transcripts by level of expression in Ezh2+/+ samples, and averag

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the Ezh2Y641F variant alters the distribution of H3K27me3, indicating a change in molecular function related to gene expression and chromatin modification.

      Gene→Variant (gene-first): 2146:Y641F

      Genes: 2146

      Variants: Y641F

    2. To understand the molecular effects of Ezh2 activation in B-cells and melanoma, we performed RNA-seq and H3K27me3 chromatin immunoprecipitation and sequencing (ChIP-seq). As the expression of Ezh2Y641F in young adult mic

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the Ezh2Y641F variant alters the expression of numerous transcripts in B-cells and melanoma cells, indicating a change in molecular function related to gene expression. Oncogenic: The variant Ezh2Y641F is associated with melanoma cell lines derived from tumors, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 2146:Y641F

      Genes: 2146

      Variants: Y641F

    3. We next assessed the anti-tumor efficacy of EZH2 inhibitors in vivo. We studied lymphoma in CD19CREEzh2Y641F+ mice with autochthonous tumors, and melanoma in immunodeficient mice transplanted with cell lines derived from

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the anti-tumor efficacy of EZH2 inhibitors and their effects on tumor growth inhibition in Ezh2Y641F/+ tumors, indicating a correlation with treatment response. Oncogenic: The variant Ezh2Y641F is implicated in tumor development, as it is studied in the context of autochthonous tumors in mice, suggesting its role in contributing to tumor progression.

      Gene→Variant (gene-first): 2146:Y641F

      Genes: 2146

      Variants: Y641F

    4. Next we investigated whether Ezh2 inhibition could suppress tumor growth in these mice. shRNA-mediated knock-down of Ezh2 in cell lines derived from the mouse melanomas described above resulted in significant growth inhi

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the response of melanoma cell lines with the Y641F variant to various EZH2 inhibitors, indicating a correlation between the variant and sensitivity to treatment. Functional: The passage describes how the Y641F variant affects the potency of the JQEZ5 inhibitor, demonstrating that the variant alters the molecular function of EZH2 in the context of drug response.

      Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

      Genes: 2146

      Variants: Y641F Y646F

    5. We performed experiments to address the cooperation of EZH2 mutation with B-RAF but not N-RAS. We observed that the expression of N-RAS and B-RAF is not altered by the presence of the Y641F mutation (data not shown). A m

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the oncogenic effects of the B-RAFV600E and Ezh2Y641F mutations in the context of melanoma formation, indicating that these variants contribute to tumor development or progression. Functional: The passage describes how the presence of the Y641F mutation does not alter the expression of certain genes, suggesting that it may affect molecular or biochemical functions related to oncogenic pathways.

      Gene→Variant (gene-first): 673:B-RAFV600E 2146:Y641F

      Genes: 673 2146

      Variants: B-RAFV600E Y641F

    6. In contrast, melanocyte-specific activation of Ezh2Y641F in the presence of N-RasQ61R did not accelerate melanomagenesis, with or without p16Ink4a loss (Fig. 2d). As B-RAF is thought to be a downstream effector of N-RAS

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the role of B-RafV600E and Ezh2Y641F in promoting melanoma, indicating that these variants contribute to tumor development or progression. Functional: The mention of B-Raf as a downstream effector of N-RAS signaling suggests that the variant B-RafV600E alters molecular function in the context of signaling pathways involved in melanoma.

      Gene→Variant (gene-first): 673:B-RafV600E 2146:Y641F

      Genes: 673 2146

      Variants: B-RafV600E Y641F

    7. In addition to lymphoma, EZH2Y646 mutations are observed in 3% of human melanoma , with focal amplifications of EZH2 noted in 15 of 262 (5.7%) of cases from the Cancer Genome Atlas (TCGA). As B-RAFV600E or N-RASQ61R muta

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes how the Ezh2Y641F mutation cooperates with the B-RAFV600E mutation to accelerate tumorigenesis in melanoma, indicating that it contributes to tumor development. Functional: The passage implies that the Ezh2Y641F mutation alters the tumorigenic process in conjunction with B-RAFV600E, suggesting a change in molecular function related to tumor maintenance and formation.

      Gene→Variant (gene-first): 673:B-RAFV600E 673:B-RafV600E 2146:Y641F

      Genes: 673 2146

      Variants: B-RAFV600E B-RafV600E Y641F

    8. In vitro, EZH2Y641F exhibits decreased H3K27 mono-methylase activity, but increased di- and tri-methylase activity compared to EZH2+/+ , suggesting that transformation may require expression of both wild-type and mutant

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the EZH2Y641F variant exhibits altered methylase activity, indicating that the variant affects molecular function. Oncogenic: The evidence suggests that the EZH2Y641F mutation contributes to tumor development, as demonstrated by the tumorigenesis observed in mice harboring this mutation.

      Gene→Variant (gene-first): 2146:Y641F 2146:Y646 2146:tyrosine to phenylalanine

      Genes: 2146

      Variants: Y641F Y646 tyrosine to phenylalanine

    9. To determine whether genetic alterations detected in human B-cell lymphomas cooperate with Ezh2Y641F in tumor formation, we transduced hematopoietic progenitors from CD19CRE/+Ezh2+/+ or CD19CRE/+Ezh2Y641F/+ mice with ret

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses how the Ezh2Y641F variant contributes to tumor formation in B-cell lymphomas, indicating its role in tumor development and progression. Functional: The variant is associated with altered molecular function, specifically in the context of its cooperation with other genetic alterations to influence B-cell transformation and apoptotic resistance.

      Gene→Variant (gene-first): 2146:Y641F

      Genes: 2146

      Variants: Y641F

    10. To examine the effects of Ezh2Y641F on B-cell malignancy, we longitudinally observed a cohort of littermate CD19CRE/+Ezh2Y641F/+ and CD19CRE/+Ezh2+/+ animals. In contrast to results employing animals expressing Ezh2Y641F

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic, Prognostic

      Justification: Oncogenic: The passage describes how the Ezh2Y641F variant contributes to the development of B-cell lymphoma in mice, indicating its role in tumor progression. Prognostic: The median survival of one year for mice with the Ezh2Y641F variant suggests a correlation with disease outcome, specifically survival, independent of therapy.

      Gene→Variant (gene-first): 2146:Y641F

      Genes: 2146

      Variants: Y641F

    11. We validated expression of the Ezh2Y641F allele by Southern blot, PCR and qRT-PCR (Fig. 1a, Supplementary Fig. 1a-d). In the absence of CRE-mediated recombination, the allele produces a wild-type transcript (Fig. 1a) and

      [Paragraph-level] PMCID: PMC4899144 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the Y641F mutation alters the expression of Ezh2 transcripts and leads to a gain-of-function effect, evidenced by the increase in H3K27me3 levels in B-cells, indicating a change in molecular function. Oncogenic: The Y641F mutation is described as equivalent to a common EZH2 missense mutation found in human cancers, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

      Genes: 2146

      Variants: Y641F Y646F

    1. Eleven tumors carried BAP1 point mutations, with four silent synonymous mutations and seven missense mutations with unknown significance (I643T, E30K, P629S, R417M, S143N (N = 2), L416F and R59W). It was not surprising t

      [Paragraph-level] PMCID: PMC7074098 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Prognostic

      Justification: Prognostic: The passage discusses the correlation of BAP1 mutations and copy number variations with overall survival in cutaneous melanoma (CM), indicating that certain alterations are associated with better survival outcomes.

      Gene→Variant (gene-first): 8314:E30K 8314:I643T 8314:L416F 8314:P629S 8314:R417M 8314:R59W 6490:S143N

      Genes: 8314 6490

      Variants: E30K I643T L416F P629S R417M R59W S143N

    1. To enable a comparison of the clinicopathological characteristics of patients with PIK3CA-mutated and PIK3CA wild-type TNBC, 50 patients with TNBC were included according to the criteria described in Methods. The median

      [Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency of PIK3CA mutations, including E545K and H1047R, in patients with triple-negative breast cancer (TNBC), indicating their association with the diagnosis of invasive cancer. Oncogenic: The presence of PIK3CA mutations, specifically E545K and H1047R, in patients with invasive cancer suggests that these somatic variants contribute to tumor development or progression in the context of TNBC.

      Gene→Variant (gene-first): 5290:E545K 5290:H1047R

      Genes: 5290

      Variants: E545K H1047R

    2. The following in vivo experimental results further confirmed this conclusion. Four groups of MDA-MB-231 cells were subcutaneously implanted into NOD/SCID mice. When the tumor volume reached 250 mm3, epirubicin was inject

      [Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how the PIK3CA mutation, including E545K, induces resistance to chemotherapy, indicating a correlation with treatment response. Oncogenic: The variant E545K is implicated in tumor development and progression, as evidenced by the experimental results showing increased tumor volume in the presence of this mutation.

      Gene→Variant (gene-first): 5290:E545K

      Genes: 5290

      Variants: E545K

    3. The results above inferred that PIK3CA mutation could promote growth and, in particular, inhibit apoptosis in TNBC cell lines. Considering the low pCR rates of NAC in patients with TNBC carrying PIK3CA mutation, more exp

      [Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how the PIK3CA E545K mutation affects the sensitivity of TNBC cells to chemotherapy, specifically noting that cells with this mutation became less sensitive to the chemotherapeutic agent epirubicin. Oncogenic: The passage indicates that the PIK3CA E545K mutation promotes growth and inhibits apoptosis in TNBC cell lines, suggesting its role in tumor development and progression.

      Gene→Variant (gene-first): 5290:E545K

      Genes: 5290

      Variants: E545K

    4. We evaluated cell viability in the TNBC cell lines MDA-MB-231 and MDA-MB-468 after transfection (PIK3CAOe, PIK3CAE545K, PIK3CAH1047R, and PIK3CActrl) using CCK-8 assays. Among both MDA-MB-231 and MDA-MB-468 cells, cells

      [Paragraph-level] PMCID: PMC8033310 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses how the PIK3CA mutation, including E545K, contributes to enhanced cell proliferation, reduced apoptosis, and increased aggressiveness in TNBC cells, indicating its role in tumor development or progression. Functional: The passage describes how the PIK3CA mutation alters the behavior of TNBC cells, specifically in terms of cell cycle progression and apoptosis, suggesting that the variant affects molecular or biochemical functions.

      Gene→Variant (gene-first): 5290:E545K

      Genes: 5290

      Variants: E545K

    1. In both cohorts, patients had a similar, high ORR regardless of age younger than or >=65 years, sex, presence or absence of brain metastases at baseline, presence or absence of prior anticancer chemotherapy, and smoking

      [Paragraph-level] PMCID: PMC11272140 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the overall response rate (ORR) of patients with specific ROS1 mutations, including G2032R, in relation to treatment with taletrectinib, indicating a correlation with treatment response. Oncogenic: The presence of ROS1 resistance mutations, including G2032R, L2026M, S1986F, and G2101A, suggests that these somatic variants contribute to tumor development or progression, particularly in the context of resistance to crizotinib.

      Gene→Variant (gene-first): 6098:G2032R 4914:G2101A 7294:L2026M 7294:S1986F

      Genes: 6098 4914 7294

      Variants: G2032R G2101A L2026M S1986F

    1. Hepatocellular carcinoma (HCC) is the fifth most common type of cancers worldwide. However, current therapeutic approaches for this epidemic disease are limited, and its 5-year survival rate hasn't been improved in the p

      [Paragraph-level] PMCID: PMC4868698 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutant PDX model to the treatment of a JAK1/2 inhibitor, ruxolitinib, indicating a correlation with response to therapy. Oncogenic: The JAK1S703I mutation is described as activating the JAK-STAT signaling pathway and driving cell proliferation, which suggests its contribution to tumor development or progression.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    1. This is the case of a 47-year-old woman diagnosed with chemotherapy and radiation-refractory BRAF V600E mutant, poorly differentiated intrahepatic cholangiocarcinoma (ICC), with multiple metastatic lesions within the liv

      [Paragraph-level] PMCID: PMC4239128 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the patient's excellent response to dual therapy with dabrafenib and trametinib, indicating that the BRAF V600E mutation correlates with treatment response. Oncogenic: The BRAF V600E variant is described in the context of a poorly differentiated intrahepatic cholangiocarcinoma, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. H3.3 mutational status and survival data were available for 39 DIPG patients, 27 of whom (69 %) carried the K27M-H3.3 mutation. The mean overall survival for patients with K27M-H3.3 mutated tumors was 0.73 years (+-0.48)

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses the correlation between the K27M-H3.3 mutation and overall survival in DIPG patients, indicating that patients with this mutation have significantly worse survival outcomes compared to those with wild-type tumors. Diagnostic: The K27M-H3.3 mutation is associated with the classification of DIPG patients, as it is mentioned that 69% of the patients carried this mutation, which is relevant for defining their disease status.

      Gene→Variant (gene-first): 3021:K27M

      Genes: 3021

      Variants: K27M

    2. Focal recurrent gains and deletion in both groups were further analyzed using GISTIC2.0. H3.3 wild-type patients had significant focal gains/amplifications of regions 2p25.1 (q = 0.028) and 2p24.3 (q = 0.028) including t

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage discusses frequent focal copy number alterations in the K27M-H3.3 group, indicating that the K27M variant is associated with tumor development through specific genetic alterations. Diagnostic: The mention of the K27M-H3.3 group suggests that the K27M variant is used to classify or define a specific subtype of tumors, indicating its role in disease classification.

      Gene→Variant (gene-first): 3021:K27M

      Genes: 3021

      Variants: K27M

    3. Analysis of DNA copy number alterations in K27M-H3.3 versus H3.3 wild-type DIPG samples showed not only the areas of overlap but also major differences between both groups. Large chromosomal copy number alterations commo

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the K27M-H3.3 mutation in the context of DNA copy number alterations in tumors, indicating its role in tumor development or progression through the identification of specific chromosomal changes associated with this variant.

      Gene→Variant (gene-first): 3021:K27M

      Genes: 3021

      Variants: K27M

    4. As previously described, a significant number of DIPG samples carried mutations in TP53, (17/22, 77 %). Fourteen of these samples carrying TP53 mutations were also mutant for K27M-H3.3 (Table 1). However, even though the

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of the K27M variant in DIPG samples and its association with TP53 mutations, indicating its role in classifying or defining a subtype of disease. Oncogenic: The K27M variant is mentioned in the context of mutations found in DIPG samples, suggesting its contribution to tumor development or progression in this specific cancer type.

      Gene→Variant (gene-first): 3021:K27M

      Genes: 3021

      Variants: K27M

    5. We previously showed that G34V/R-H3.3 GBM samples universally also carried ATRX and TP53 mutations (13/13), while K27M-H3.3 GBM samples had significant, albeit lower, overlap with ATRX and TP53 mutations (respectively, 3

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the association of the K27M-H3.3 mutation with ATRX mutations in DIPG samples, indicating its role in defining or classifying a subtype of disease. Oncogenic: The K27M-H3.3 mutation is mentioned in the context of its presence in GBM samples, suggesting its contribution to tumor development or progression.

      Gene→Variant (gene-first): 3021:G34V/R 3021:K27M

      Genes: 3021

      Variants: G34V/R K27M

    6. We sequenced H3F3A in 42 DIPG samples comprising either biopsy material prior to any treatment (n = 16) or autopsy samples (n = 26, one sample from untreated patient at autopsy; DIPG02). We identified the recurrent mutat

      [Paragraph-level] PMCID: PMC3422615 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The K27M mutation is identified as being present at diagnosis in DIPG samples, indicating its role in defining the disease subtype. Oncogenic: The K27M mutation contributes to tumor development in DIPG, as it is recurrently found in the samples analyzed, suggesting its role in tumor progression.

      Gene→Variant (gene-first): 3021:G34V/R 3021:K27M

      Genes: 3021

      Variants: G34V/R K27M

    1. Fourteen patients with EGFR-mutant and RET fusion-positive lung cancers who experienced prior progression on osimertinib received osimertinib and selpercatinib. EGFR exon 19 deletions (+-T790M, 86%) and non-KIF5B fusions

      [Paragraph-level] PMCID: PMC10524391 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response rate and disease control rate of patients treated with osimertinib and selpercatinib, indicating that the variants mentioned (C797S, G12S, G810S, V600E) are associated with treatment response and resistance mechanisms. Oncogenic: The variants C797S, G12S, G810S, and V600E are described in the context of resistance mechanisms, suggesting their role in tumor development or progression in the setting of lung cancers.

      Gene→Variant (gene-first): 1956:C797S 3845:G12S 5979:G810S 1956:T790M 673:V600E

      Genes: 1956 3845 5979 673

      Variants: C797S G12S G810S T790M V600E

    2. Finally, these individual resistance mechanisms commonly co-occurred (Figure 3). In a third of evaluable paired cases, on-target and off-target resistance coexisted: RET V804E + EML4-ALK + STRN-ALK (n=1) and RET V804M +

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses resistance mechanisms related to specific variants, indicating their correlation with treatment response, particularly in the context of on-target and off-target resistance. Oncogenic: The variants mentioned are associated with resistance mechanisms that contribute to tumor development or progression, as they are involved in co-occurring resistance mechanisms in cancer cases.

      Gene→Variant (gene-first): 1956:C797S 3845:G12S 5979:G810S 673:V600E 5979:V804E 5979:V804M

      Genes: 1956 3845 5979 673

      Variants: C797S G12S G810S V600E V804E V804M

    3. Off-target resistance involving receptor tyrosine kinase or MAPK pathway activation was observed in three of six cases (50%). Hotspot mutations were found in two of these cases: BRAF V600E (n=1) and KRAS G12S (n=1). Acqu

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses hotspot mutations BRAF V600E and KRAS G12S being found in cases of off-target resistance, indicating that these somatic variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 3845:G12S 673:V600E

      Genes: 3845 673

      Variants: G12S V600E

    4. Presumed loss of the enrolling RET fusion in one or more post-combination therapy progression samples was noted in four of six cases (67%, Figure 2A). In three of these cases, post-progression genomics were limited to a

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses an acquired RET G810S mutation in the context of tumor progression, indicating that this somatic variant may contribute to tumor development or progression.

      Gene→Variant (gene-first): 5979:G810S

      Genes: 5979

      Variants: G810S

    5. Resistance mutations that impart steric hindrance to therapeutic EGFR or RET kinase engagement were observed in four of six cases (67%). For EGFR on-target resistance, EGFR C797S was acquired in one patient, and EGFR T79

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses resistance mutations that affect the engagement of therapeutic EGFR or RET kinases, indicating a correlation with resistance to specific therapies. Oncogenic: The variants mentioned (C797S, T790M, V804M/E, G810S) are described as resistance mutations that contribute to tumor progression by impacting kinase engagement, suggesting their role in oncogenesis.

      Gene→Variant (gene-first): 1956:C797S 5979:G810S 1956:T790M 5979:V804M/E

      Genes: 1956 5979

      Variants: C797S G810S T790M V804M/E

    6. All patients were on osimertinib when the acquired RET fusion was identified; 64% (9 patients) were known to have received additional EGFR-directed therapy prior to osimertinib with an earlier generation EGFR TKI (e.g. e

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the presence of the EGFR T790M mutation in patients who had received prior EGFR-directed therapy, indicating a correlation with treatment response or resistance to osimertinib. Diagnostic: The mention of the EGFR T790M mutation being detectable at the time of study enrollment suggests its role in classifying or confirming the disease status in patients undergoing treatment.

      Gene→Variant (gene-first): 1956:T790M

      Genes: 1956

      Variants: T790M

    7. Most tumors (86%, n=12) harbored an EGFR exon 19 deletion (4 of which harbored a concurrent EGFR T790M mutation); the remaining cancers (n=2) both harbored EGFR L858R and EGFR T790M mutations, one of which harbored a con

      [Paragraph-level] PMCID: PMC10524391 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage indicates that the variants L747S, L858R, and T790M are present in tumors, suggesting their role in tumor development or progression. Diagnostic: The presence of specific EGFR mutations, including L747S, L858R, and T790M, is used to classify the tumors, indicating their association with the disease.

      Gene→Variant (gene-first): 1956:L747S 1956:L858R 1956:T790M

      Genes: 1956

      Variants: L747S L858R T790M

    1. The phosphatidylinositol-3-kinase (PI3K)/AKT signaling pathway is critical for cellular growth and metabolism. Correspondingly, loss of function of PTEN, a negative regulator of PI3K, or activating mutations in AKT1, AKT

      [Paragraph-level] PMCID: PMC3461408 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the identification of cancer-associated mutations p.His1047Leu and p.His1047Arg in PIK3CA, which are linked to a syndrome characterized by overgrowth, indicating that these somatic variants contribute to tumor development or progression. Functional: The passage describes how affected dermal fibroblasts showed enhanced phosphatidylinositol-3,4,5-trisphosphate (PIP3) generation and activation of downstream signaling, demonstrating that the variants alter molecular or biochemical function.

      Gene→Variant (gene-first): 5290:p.His1047Arg 5290:p.His1047Leu

      Genes: 5290

      Variants: p.His1047Arg p.His1047Leu

    1. We detected two previously documented single nucleotide polymorphisms (dbSNP rs10251977, rs17290643). Exon 20 harbours the synonymous G/A SNP rs10251977 while exon 23 contains the synonymous SNP T/C rs17290643. There was

      [Paragraph-level] PMCID: PMC1952070 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Diagnostic, Predictive

      Justification: Diagnostic: The passage mentions the detection of single nucleotide polymorphisms (SNPs) and their association with specific exons, indicating their role in defining or classifying genetic variants. Predictive: The passage explicitly states that there was "no correlation between these alleles and gefitinib response," which implies that the variants were evaluated for their predictive value regarding treatment response.

      Gene→Variant (gene-first): 7294:G/A NA:rs10251977 NA:rs17290643

      Genes: 7294 NA

      Variants: G/A rs10251977 rs17290643

    2. We studied the DNA sequence of the EGFR tyrosine kinase domain in our patient samples as this domain was previously associated with increased gefitinib sensitivity. In eight of thirty-eight tumours assessed we found ten

      [Paragraph-level] PMCID: PMC1952070 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the correlation of the L858R mutation with gefitinib response, indicating that it is associated with treatment sensitivity or resistance. Oncogenic: The L858R mutation is described as a somatic mutation found in tumor samples, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R 1956:T790M

      Genes: 1956

      Variants: L858R T790M

    1. KIT mutations were seen in 70% of cases and the majority of KIT mutations involved exon 11 (57%), followed by exon 9 (10%), exon 13 (3%), and exon 17 (1%). Most common exon 11 mutations were in-frame deletions (61.4%) fo

      [Paragraph-level] PMCID: PMC5615879 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of KIT mutations in cases and specifies the types of mutations found in different exons, indicating their association with the disease. Oncogenic: The mention of KIT mutations contributing to tumor development is implied by their prevalence in cases, suggesting a role in cancer progression.

      Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1509_1510insACCTAT 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 5156:c.1925A>G 3815:p.K558_V559delinsS 728378:p.K642R 728378:p.Q556E 3815:p.Q556dup 3815:p.Y503_F504insTY

      Genes: 3815 728378 5156

      Variants: Ala-Tyr c.1509_1510insACCTAT c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup p.Y503_F504insTY

    2. A single case with p.N822K (c.2466T>A) [Figure 4b] was identified. The tumor originated in jejunum in an elderly man with spindle morphology.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

      Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

      Genes: 3815

      Variants: c.2466T>A p.N822K

    3. Three cases involving p.K642E mutation (c.1924A>G) [Figure 4a], 2/3 were in elderly men, at gastric, an anorectal site with mixed morphology. One was a double mutation in association with exon 11 [Table 2].

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

      Genes: 3815

      Variants: c.1924A>G p.K642E

    4. Mutations were identified in 10 cases located in the small intestine with significant association (P = 0.004). One was located in the retroperitoneum. Ninety percent (9/10) tumors revealed internal tandem duplications (I

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

      Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

      Genes: 3815

      Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

    5. Insertion of 3 nucleotides, p.K558delinsBP (c.1673_1674insTCC), and duplication p.Y577_K580dup (c.1731_1742dupTTATGATCACAA) was seen 1 case (1.8%) each, respectively.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

      Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

      Genes: 3815

      Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

    6. The substitution mutations were p.V559D (3/57; 5%), p.V560D (3/57; 5%), p.V559A (2/57; 3.5%), and 1 (1.8%) cases each with p.V560G, p.T574I, and p.L576P among this 9 were homozygous and 2 heterozygous.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

      Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

      Genes: 3815

      Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

    7. One case with simultaneous mutations in exons 11 and 13 harbored in-frame deletion in exon 11; p.M552_K558del (c.1654_1674delATGTATGAAGTACAGTGGAAG) and a novel substitution mutation; p.K642R (c.1925A>G) [Figure 1d] in ex

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

      Genes: 3815 5156 728378

      Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

    8. Exon 11 mutations were heterogeneous with in-frame deletion of 3-51 nucleotides (codons 550-576) in classic hot-spot region at the 5' end of the exon (codons 550-560). Double mutations were identified in 9 cases (16%), 8

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

      Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

      Genes: 728378 3815

      Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

    9. Exon 11 mutations were in 57% of cases [Table 2]. In-frame deletions in 35 (61.4%), 11 substitutions (19.3%), 9 double mutations (15.7%), 1 insertion and duplication (1.8%), respectively. Common mutation was p.W557_K558

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

      Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

      Genes: 3815

      Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

    1. Abivertinib of 300 mg twice a day demonstrated favorable clinical efficacy with manageable side effects in patients with EGFR T790M+ NSCLC.

      [Paragraph-level] PMCID: PMC9365372 Section: ABSTRACT PassageIndex: 9

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage indicates that the variant T790M is associated with favorable clinical efficacy of the therapy Abivertinib in patients, suggesting a correlation with treatment response. Diagnostic: The mention of patients with EGFR T790M+ NSCLC implies that the T790M variant is used to classify or define a specific subtype of non-small cell lung cancer.

      Gene→Variant (gene-first): 1956:T790M

      Genes: 1956

      Variants: T790M

    2. To establish recommended phase II dose (RP2D) in phase I and evaluate safety and efficacy of abivertinib in patients with EGFR Thr790Met point mutation (T790M)-positive(+) non-small cell lung cancer (NSCLC) with disease

      [Paragraph-level] PMCID: PMC9365372 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the evaluation of safety and efficacy of abivertinib in patients with the T790M mutation, indicating a correlation with treatment response in the context of non-small cell lung cancer. Diagnostic: The mention of the Thr790Met point mutation (T790M) being positive in patients with non-small cell lung cancer suggests its role in defining or classifying the disease subtype.

      Gene→Variant (gene-first): 1956:T790M 1956:Thr790Met

      Genes: 1956

      Variants: T790M Thr790Met

    1. Overall, 682 patients with stage IB-IIIA (American Joint Committee on Cancer/Union for International Cancer Control, seventh edition) EGFR-mutated (exon 19 deletion/L858R) NSCLC were randomly assigned 1:1 (stratified by

      [Paragraph-level] PMCID: PMC10082285 Section: ABSTRACT PassageIndex: 5

      Evidence Type(s): Predictive, Diagnostic, Prognostic, Oncogenic

      Justification: Predictive: The passage discusses the assignment of patients with EGFR-mutated NSCLC to receive osimertinib, indicating a correlation between the L858R variant and response to this specific therapy. Diagnostic: The mention of patients with EGFR-mutated NSCLC, specifically referencing the L858R variant, suggests its role in defining or classifying the disease subtype. Prognostic: The passage refers to disease-free survival (DFS) and overall survival as endpoints, indicating that the L858R variant may correlate with disease outcomes independent of therapy. Oncogenic: The context of the L858R variant being part of EGFR mutations in NSCLC implies its contribution to tumor development or progression, characteristic of oncogenic variants.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    1. Investigator-assessed confirmed responses were reported in 20 of 36 patients (56%) in the ITT-assessable population, including 3 CRs (8%) and 17 PRs (47%; Table 3, Figure 1); an additional 11 patients (31%) had stable di

      [Paragraph-level] PMCID: PMC9338780 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the correlation between the BRAF V600E mutation and the response to treatment, indicating that all patients with confirmed responses had BRAF V600E-mutant disease, which suggests a predictive relationship with therapy response. Diagnostic: The mention of "centrally confirmed BRAF V600E-mutant disease" indicates that the variant is used to classify or confirm a specific disease subtype, supporting its role as a diagnostic marker.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    2. The ATC cohort totaled 36 patients in the ITT-assessable population, including 15 from the primary analysis cohort and 21 from the expansion cohort (Supplementary Figure S1, available at https://doi.org/10.1016/j.annonc.

      [Paragraph-level] PMCID: PMC9338780 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage states that 33 out of 36 patients had the BRAF V600E mutation confirmed, indicating its use in defining or confirming a disease subtype, specifically in the context of ATC (anaplastic thyroid carcinoma). Oncogenic: The BRAF V600E mutation is known to contribute to tumor development or progression, which aligns with the evidence type of oncogenic variants in cancer.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. Neuroblastoma (NB) is the most common extracranial neoplasm in children. The overall outcome for high-risk NB patients is still unacceptable, therefore, it is critical to deeply understand molecular mechanisms associated

      [Paragraph-level] PMCID: PMC7294133 Section: ABSTRACT PassageIndex: 2

      Evidence Type(s): Oncogenic, Predictive, Prognostic

      Justification: Oncogenic: The variant V871I in the EPHB4 gene is described as contributing to increased proliferation, migration, and invasion properties in neuroblastoma cell lines, indicating its role in tumor development and progression. Predictive: The passage discusses the use of EPHB4 inhibitors that can rescue the phenotype driven by the variant V871I, suggesting a correlation with response to specific therapies. Prognostic: The passage mentions that higher EPHB4 expression is correlated with stage 4 neuroblastoma and poor overall survival, indicating a relationship between the variant and disease outcome.

      Gene→Variant (gene-first): 2050:V871I

      Genes: 2050

      Variants: V871I

    1. Activated RAS promotes dimerization of members of the RAF kinase family. ATP-competitive RAF inhibitors activate ERK signaling by transactivating RAF dimers. In melanomas with mutant BRAF(V600E), levels of RAS activation

      [Paragraph-level] PMCID: PMC3266695 Section: ABSTRACT PassageIndex: 2

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how the presence of the BRAF(V600E) variant correlates with the clinical activity of RAF inhibitors in melanoma patients, indicating a relationship between the variant and treatment response. Oncogenic: The BRAF(V600E) variant is described as contributing to tumor development and progression, particularly in the context of its role in ERK signaling and the development of resistance mechanisms in melanoma.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. BRAFV600E/K is a frequent mutationally active tumor-specific kinase in melanomas that is currently targeted for therapy by the specific inhibitor PLX4032. Our studies with melanoma tumor cells that are BRAFV600E/K and BR

      [Paragraph-level] PMCID: PMC2848976 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic, Functional

      Justification: Predictive: The passage discusses how BRAFV600E/K is targeted for therapy with the specific inhibitor PLX4032, indicating a correlation with treatment response. Oncogenic: BRAFV600E/K is described as a mutationally active tumor-specific kinase in melanomas, suggesting its role in tumor development or progression. Functional: The passage mentions that PLX4032 alters the activity of ERK1/2 in BRAFV600E/K cells, indicating a change in molecular function related to the variant.

      Gene→Variant (gene-first): 673:BRAFV600E 4893:Q61L 673:V600E/K

      Genes: 673 4893

      Variants: BRAFV600E Q61L V600E/K

    2. Two additional assays confirmed that activated FAK had a functional impact on BRAFWT melanoma cells. First, there was a dramatic reduction in colony formation in soft agar in response to PLX4032 (Figure 6C), although the

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how activated FAK has a functional impact on BRAFWT melanoma cells, specifically noting changes in colony formation and cell motility in response to PLX4032, indicating alterations in molecular or biochemical function. Oncogenic: The mention of BRAFWT and BRAFV600E in the context of melanoma cells suggests that these variants are involved in tumor behavior, particularly in how they respond to treatment and their migratory capabilities, indicating a role in tumor development or progression.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    3. PLX4032 also had physiological effects on advanced melanoma cells. We observed enhanced detachment of BRAFWT melanoma cells after treatment with PLX4032 for several hours that were 99% viable (Figure 6A). In contrast, th

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effects of PLX4032 on melanoma cells, indicating a difference in response between BRAFWT and BRAFV600E cells, which suggests a correlation with treatment response. Oncogenic: The mention of BRAFV600E in the context of advanced melanoma cells implies that this somatic variant contributes to tumor development or progression, as it is associated with specific cellular behaviors in the study.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    4. One of the main questions raised by our studies is whether ERK activation had any impact on cellular functions, because we did not detect a significant increase in the proliferation rate of advanced BRAFWT melanoma cells

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 21

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 4893:Q61L

      Genes: 4893

      Variants: Q61L

    5. We explored the spectrum of affected genes by hybridization to NimbleGen whole genome gene expression arrays, comparing untreated to PLX4032 treated (8 and 24 h) YUDOSO-BRAFWT melanoma cells. The results showed strong up

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response of melanoma cells to the therapy PLX4032, indicating that the BRAFV600E variant is associated with a lack of activation of certain proteins in response to treatment, which suggests a predictive relationship regarding therapy response. Oncogenic: The mention of BRAFV600E in the context of melanoma cells implies its role as a somatic variant contributing to tumor development or progression, as it is a well-known oncogenic mutation in melanoma.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    6. Real time RT-PCR demonstrated that known early response genes, FOS and JUNB, were activated within 30 min in YUDOSO-BRAFWT melanoma cells in response to PLX4032, an effect that was persistent for up to 8 h, whereas FOS w

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response of BRAFV600E cells to PLX4032, indicating a correlation with treatment response. Oncogenic: The mention of BRAFV600E in the context of downregulation of FOS and the activation of ERK1/2 suggests that this somatic variant contributes to tumor behavior and progression.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    7. We further explored the activation of downstream ERK targets and changes in gene expression that may shed more light on PLX4032 cellular responses and may provide markers to monitor therapy. Western blotting with phospho

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the cellular responses to PLX4032 therapy and mentions the activation of downstream ERK targets in relation to the BRAFV600E variant, indicating a correlation with treatment response. Oncogenic: The BRAFV600E variant is implicated in the inhibition of p90RSK activation in melanoma cells, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    8. We considered several known pathways by which PLX4032 could activate RAF1. We ruled out triggering an escape pathway, such as a receptor tyrosine kinase, by two independent approaches. First, traditional Western blotting

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the R89L variant of RAF1 alters its ability to bind Ras-GTP and its activation in response to PLX4032, indicating a change in molecular function. Oncogenic: The R89L variant is described in the context of its activation and role in signaling pathways, suggesting its contribution to tumor development or progression.

      Gene→Variant (gene-first): 3726:R89L

      Genes: 3726

      Variants: R89L

    9. Similar studies with RAF1 showed non-detectable activity in YULAC-BRAFV600E and YUMAC-BRAFV600K cells (data not shown). In contrast, a wide range of RAF1 kinase activity was observed in four independent BRAFWT melanoma c

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the activity of RAF1 kinase in relation to BRAFV600E and BRAFV600K variants, indicating that these variants alter the molecular function of RAF1, as evidenced by the observed kinase activity levels. Oncogenic: The mention of BRAFV600E and BRAFV600K in the context of non-detectable activity and their relationship to RAF1 activity suggests that these somatic variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 673:BRAFV600E 673:BRAFV600K

      Genes: 673

      Variants: BRAFV600E BRAFV600K

    10. We therefore assessed BRAF and RAF1 enzymatic activity. Immune-complexes kinase assays showed, as expected, high BRAF activity in YULAC-BRAFV600E and YUMAC-BRAFV600K cells that was suppressed after treatment with PLX4032

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses the enzymatic activity of BRAF variants (BRAFV600E and BRAFV600K) and how their activity is altered by treatment with PLX4032, indicating a change in molecular function. Predictive: The mention of treatment with PLX4032 and its effect on the activity of BRAF variants suggests a correlation with response to therapy, indicating predictive evidence.

      Gene→Variant (gene-first): 673:BRAFV600E 673:BRAFV600K

      Genes: 673

      Variants: BRAFV600E BRAFV600K

    11. Other intracellular signaling pathways were not, or slightly affected by PLX4032. We did not detect engagement of the AKT pathway (Figure S2A, pS6K and pAKT). There were only slight changes in the activated form of p38MA

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 8

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    12. The opposite effects of PLX4032 on ERK1/2 phosphorylation in YULAC-BRAFV600E and YUDOSO-BRAFWT melanoma cells were concentration dependent. Both cell types responded to the drug at 1 and 0.5 muM, but not at 0.1 muM (Figu

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response of melanoma cells with the BRAFV600E variant to the drug PLX4032, indicating a correlation with treatment sensitivity. Oncogenic: The BRAFV600E variant is implicated in the context of melanoma cells, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    13. Changes in dephosphorylation and hyperphosphorylation of ERK1/2 in YULAC-BRAFV600E and YUDOSO-BRAFWT melanoma cells, respectively, occurred within 5 min, and progressed with similar kinetics (Figure 2B, pERK). The Wester

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses changes in the phosphorylation state of ERK1/2 in response to treatment, indicating that the BRAFV600E variant alters the molecular function of these proteins in melanoma cells. Oncogenic: The mention of the BRAFV600E variant in the context of melanoma cells suggests that it contributes to tumor development or progression, as it is associated with changes in signaling pathways relevant to cancer.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    14. The effects of PLX4032 on downstream RAF effectors were examined to further understand the mechanism of drug resistance. Unless otherwise stated, we used 1 muM of PLX4032, about 10x the IC50 of sensitive melanoma cells,

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effects of PLX4032 on BRAFV600E/K melanoma cells, indicating a correlation between the variant and response to the therapy, specifically in terms of ERK1/2 phosphorylation. Oncogenic: The mention of BRAFV600E/K in the context of melanoma cells suggests that these somatic variants contribute to tumor development or progression, as they are associated with the activation of the RAF-MEK-ERK pathway in cancer.

      Gene→Variant (gene-first): 673:BRAFV600K 673:V600E/K

      Genes: 673

      Variants: BRAFV600K V600E/K

    15. The effect of PLX4032 was tested on melanoma cells isolated from primary and metastatic lesions in which BRAF, NRAS and PTEN mutations were characterized (Table 1). Dose response analyses showed that all the BRAF mutant

      [Paragraph-level] PMCID: PMC2848976 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of BRAF mutant melanoma cell strains, including those with the V600E mutation, to the drug PLX4032, indicating a correlation between the variant and response to therapy. Oncogenic: The V600E variant is mentioned in the context of BRAF mutations in melanoma cells, suggesting its role in tumor development or progression as part of the BRAF mutation profile.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. Germline substitutions in the endothelial cell tyrosine kinase receptor TIE2/TEK cause a rare inherited form of venous anomalies, mucocutaneous venous malformations (VMCM). We now identified a somatic 2nd hit causing los

      [Paragraph-level] PMCID: PMC2670982 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predisposing, Oncogenic, Functional

      Justification: Predisposing: The passage describes germline substitutions in the TIE2/TEK receptor that cause a rare inherited form of venous anomalies, indicating that these variants confer inherited risk for developing the disease. Oncogenic: The passage discusses somatic mutations in TIE2 that contribute to tumor development, specifically noting the identification of somatic mutations in lesions and their role in the etiology of sporadic venous malformations. Functional: The passage mentions that the L914F variant shows ligand-independent hyperphosphorylation and abnormal localization when overexpressed, indicating that it alters molecular function.

      Gene→Variant (gene-first): 284:L914F 7010:R849W

      Genes: 284 7010

      Variants: L914F R849W

    1. Members of the Src family of non-receptor tyrosine kinases can activate STAT3 by phosphorylating Y705. To assess if our compound can inhibit Src family kinases, we monitored the tyrosine phosphorylation state of Src and

      [Paragraph-level] PMCID: PMC2830973 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses the effects of the compound NSC114792 on the phosphorylation state of serine/threonine kinases, indicating that it alters molecular function related to these kinases.

      Gene→Variant (gene-first): 207:serine/threonine

      Genes: 207

      Variants: serine/threonine

    2. A recent study identified an activating allele of JAK3 (V674A) from an acute myeloid leukemia patient-derived retroviral cDNA library, and showed that JAK3V674A can transform the lymphoid pro-B-cell line BaF3 to IL-3-ind

      [Paragraph-level] PMCID: PMC2830973 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The variant JAK3V674A is described as an activating allele that can transform a lymphoid pro-B-cell line, indicating its role in tumor development or progression. Predictive: The passage discusses how treatment with the compound NSC114792 inhibits JAK3 activity and decreases the viability of BaF3-JAK3V674A cells, suggesting a correlation with response to therapy.

      Gene→Variant (gene-first): 3718:V674A

      Genes: 3718

      Variants: V674A

    1. To determine if a lysine residue is necessary for the nuclear localization of PTEN on ubiquitinK48R expression, we tested lysine residues, K13, K254 and K289, and a cluster of five lysines (K260, K263, K266, K267, K269)

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 31

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the substitution of the lysine residue K13 alters the nuclear localization of PTEN, indicating a change in molecular function related to protein activity and localization.

      Gene→Variant (gene-first): 2597:K13

      Genes: 2597

      Variants: K13

    2. We also tested the effect of co-expression of PTENL320S-GFP and ubiquitin or ubiquitinK48R instead of expression of PTEN-ubiquitin fusion proteins. Intriguingly, in the presence of ubiquitinK48R, PTENL320S-GFP showed str

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 30

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the K48R mutation alters the molecular function of ubiquitin, affecting the localization and abundance of PTENL320S-GFP, indicating a change in biochemical activity.

      Gene→Variant (gene-first): 5728:K48R

      Genes: 5728

      Variants: K48R

    3. We then tested whether the C-terminal ubiquitin tag can rescue the nuclear localization defect of PTENL320S. We found that PTENL320S,A4-Ub-GFP significantly accumulated in the nucleus (Figures 7a and b). To determine whe

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 29

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variant Lys48 affects the molecular function of PTENL320S by influencing its nuclear localization, indicating a change in biochemical activity related to polyubiquitination.

      Gene→Variant (gene-first): 5728:Lys48

      Genes: 5728

      Variants: Lys48

    4. To further analyse the conformations of PTENT277A and PTENL320S, we measured the intramolecular interaction between the membrane-binding regulatory interface and the phosphorylated C-terminal tail of PTEN. In this assay,

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variants PTENT277A and PTENL320S alter the ability of the protein to interact with the C-terminal tail, indicating a change in molecular function.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    5. T277A and L320S inhibit the membrane-bound regulatory interface from interacting with the C-terminus

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that the L320S variant alters the interaction of a protein at the membrane-bound regulatory interface, suggesting a change in molecular function.

      Gene→Variant (gene-first): 4734:L320S

      Genes: 4734

      Variants: L320S

    6. To determine whether the altered protein conformations of PTENT277A and PTENL320S change the ubiquitination of PTEN, we co-expressed HA-ubiquitin with various GFP-PTEN constructs. GFP fusions were immunoprecipitated and

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variants PTENT277A and PTENL320S alter the ubiquitination of the PTEN protein, indicating a change in molecular function related to protein stability.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    7. To determine the effect of L320S and T277A on the protein conformation and folding of PTEN, we performed a trypsin digestion assay. We immunopurified PTENWT-GFP, PTENA4-GFP, PTENT277A-GFP and PTENL320S-GFP from HEK293T c

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variants L320S and T277A alter the protein conformation and folding of PTEN, indicating a change in molecular function as demonstrated by the trypsin digestion assay.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    8. The crystal structure of PTEN has shown that F273 interacts with L320. We hypothesize that the interactions with this amino acid is necessary to stabilize PTEN conformation (Figure 5f). We found that an F273A mutation sh

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the F273 and L320 variants interact and affect the localization and conformation of PTEN, indicating that these variants alter molecular function.

      Gene→Variant (gene-first): 5295:F273 5295:F273A 5295:F273L 4734:L320 4734:L320F 4734:L320S

      Genes: 5295 4734

      Variants: F273 F273A F273L L320 L320F L320S

    9. T277A and L320S open the conformation of PTEN and promote ubiquitination

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that the variants T277A and L320S alter the conformation of PTEN and promote ubiquitination, which suggests a change in molecular function.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    10. We then tested whether L320S affects phosphorylation at other sites on PTEN. Two residues next to L320S, T319 and T321, have reportedly been phosphorylated by RhoA-associated kinase (ROCK) to promote PTEN membrane target

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the mutations T319A and T321A do not enhance protein stability or membrane localization of PTENL320S, indicating that these variants alter molecular function related to protein activity and localization.

      Gene→Variant (gene-first): 4734:L320S 5728:T319 5728:T319A 5728:T321 5728:T321A

      Genes: 4734 5728

      Variants: L320S T319 T319A T321 T321A

    11. Protein phosphorylation prediction analysis suggested that the substitution of L320 to S creates a new potential phosphorylation site (Supplementary Figure S2). We tested whether changing L320 to phospho-mimetic (L320D o

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the substitution of L320 to S affects the molecular function of PTEN, specifically its stability, localization, and phosphorylation status, indicating a change in biochemical function.

      Gene→Variant (gene-first): 4734:L320 4734:L320A 4734:L320D 4734:L320E 4734:L320S

      Genes: 4734

      Variants: L320 L320A L320D L320E L320S

    12. The recruitment of PTEN to the plasma membrane is crucial for PTEN activity. To determine the impact of the T277A and L320S mutations on PTEN membrane localization, we introduced T277A into PTENA4, PTENK13R,A4 and ePTEN,

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the T277A and L320S mutations alter the molecular function of PTEN by blocking its membrane localization and decreasing its ability to reduce AKT phosphorylation, indicating a change in biochemical activity. Oncogenic: The passage suggests that the nuclear localization defects caused by the T277A and L320S mutations could affect PTEN function in suppressing tumor formation, indicating that these mutations contribute to tumor development or progression.

      Gene→Variant (gene-first): 2597:K13R 4734:L320S 5728:T277A

      Genes: 2597 4734 5728

      Variants: K13R L320S T277A

    13. L320S and T277A mutations block PTEN membrane and nuclear localization

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that the L320S and T277A mutations alter the localization of the PTEN protein, which is a change in molecular function.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    14. It has been shown that phosphorylation of PTEN at T366 or S370 destabilizes the protein. To determine whether blocking phosphorylation at these two sites increases the stability of PTENL320S, we created PTENL320S,T366A a

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how specific phosphorylation events at the T366 and S370 sites affect the stability of the PTEN protein, indicating that these variants alter molecular function.

      Gene→Variant (gene-first): 4734:L320S 5728:S370 5728:S370A 5728:T366 5728:T366A

      Genes: 4734 5728

      Variants: L320S S370 S370A T366 T366A

    15. To determine the mechanism that decreases the stability of PTENL320S in greater detail, we combined L320S with mutations that are known to increase PTEN stability. We introduced K13R, which has been shown to block ubiqui

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the L320S variant decreases the stability of PTEN and its interactions with the plasma membrane, indicating an alteration in molecular function. Oncogenic: The context of the passage suggests that the variants, particularly L320S, contribute to tumor development or progression by affecting PTEN stability and function, which is relevant in cancer biology.

      Gene→Variant (gene-first): 5728:C124S 2597:K13 2597:K13R 4734:L320S

      Genes: 5728 2597 4734

      Variants: C124S K13 K13R L320S

    16. To test whether ectopic expression of PTEN can suppress PIP3 signalling in patient-derived GBM cells, we introduced PTENWT-GFP into GBM 651 (which expressed PTENL320S), GBM 965 (which expressed no PTEN proteins) and GBM

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the PTEN variants L320S and T277A alter the molecular function of PTEN, specifically its ability to suppress AKT phosphorylation and inhibit cell migration and proliferation. Oncogenic: The variants PTENL320S and PTENT277A are implicated in decreased activity to suppress key signaling pathways and cellular behaviors associated with tumor development and progression, indicating their role in oncogenesis.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    17. Because most cancer-associated mutations in PTEN abolish its essential phosphatase activity, we first tested whether L320S and T277A affect enzymatic activity. We immunopurified GFP fused to PTENL320S and PTENT277A, wild

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variants L320S and T277A were tested for their effect on enzymatic activity, specifically lipid phosphatase activity, indicating that they alter molecular function.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    18. We found two cells, GBMs 651 and 276, each of which contained a previously uncharacterized point mutation in the PTEN coding region. The former carried L320S while the latter carried T277A. Both mutant proteins had decre

      [Paragraph-level] PMCID: PMC5491373 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the L320S and T277A mutations in PTEN alter the steady state levels of the proteins and their localization, indicating a change in molecular function. Oncogenic: The context suggests that the mutations contribute to the alteration of PTEN function, which is implicated in tumor development or progression.

      Gene→Variant (gene-first): 4734:L320S 5728:T277A

      Genes: 4734 5728

      Variants: L320S T277A

    1. Platelet functional studies were carried out for 20 patients from eight unrelated pedigrees (A to I except B) and for patient J (Table 1). No such studies were performed for subjects belonging to pedigree B and for patie

      [Paragraph-level] PMCID: PMC4845427 Section: RESULTS PassageIndex: 29

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 861:A to I

      Genes: 861

      Variants: A to I

    2. The French FPD/AML cohort consists of nine pedigrees (A to I) and two syndromic patients (J and K) with germline RUNX1 alterations identified in eight hospitals (La Timone and Paoli-Calmettes in Marseille; Nancy; La Piti

      [Paragraph-level] PMCID: PMC4845427 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predisposing

      Justification: Predisposing: The passage discusses germline RUNX1 alterations identified in pedigrees, indicating inherited risk for developing disease.

      Gene→Variant (gene-first): 861:A to I

      Genes: 861

      Variants: A to I

    1. We compared the transcriptional landscape of lung cancers between ever-smokers and never-smokers. There was a significant difference in the number of point mutations between the two groups (Fig. 4A). On average, smokers

      [Paragraph-level] PMCID: PMC3483540 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage discusses the presence of somatic point mutations, specifically the C > A and T > G transversions, in lung cancers of smokers, indicating their contribution to tumor development or progression. Diagnostic: The differences in mutational spectrums between lung cancers of smokers and never-smokers suggest that these variants can be used to classify or define the disease based on smoking status.

      Gene→Variant (gene-first): 2199:C > A 2199:T > G

      Genes: 2199

      Variants: C > A T > G

    2. Using our transcriptome data, we identified 4607 somatic nonsynonymous single nucleotide substitutions and 373 coding short-indel mutations (Supplemental Fig. 2; Supplemental Table 3). Whole-exome sequencing of two rando

      [Paragraph-level] PMCID: PMC3483540 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage discusses several somatic mutations, including those in EGFR, KRAS, NRAS, PIK3CA, BRAF, CTNNB1, and MET, which are identified as driver mutations contributing to lung adenocarcinoma, indicating their role in tumor development or progression. Diagnostic: The passage mentions that specific mutations in well-known cancer genes are associated with lung adenocarcinoma, suggesting that these variants can be used to classify or define the disease.

      Gene→Variant (gene-first): 1499:D32G 22853:E555K 3845:G12C 3845:G12D 3845:G12S 3845:G12V 3845:G13C 3845:G13D 1956:G719A 5290:H1047R 1956:L858R 1499:M1124D 3845:Q61H 4893:Q61K 4893:Q61L 673:V600E

      Genes: 1499 22853 3845 1956 5290 4893 673

      Variants: D32G E555K G12C G12D G12S G12V G13C G13D G719A H1047R L858R M1124D Q61H Q61K Q61L V600E

    1. In addition to histone hypermethylation, human AML cells with IDH1/IDH2 mutation show global DNA hypermethylation. To test whether treatment with BAY1436032 alters DNA methylation, primary human AML cells carrying either

      [Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the treatment of AML cells with BAY1436032 and its effects on DNA methylation, indicating a correlation between the IDH1R132H mutation and the response to this specific therapy. Functional: The passage describes how the IDH1R132H mutation affects DNA methylation patterns and gene expression, demonstrating an alteration in molecular function due to the variant.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    2. The inhibition of histone demethylases by R-2HG results in a histone hypermethylation phenotype. Accordingly, global histone H3 trimethylation levels at residues H3K4, H3K9, H3K27 and H3K36 were analyzed ex vivo by immun

      [Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the response of IDH1 mutant AML cells, including those with the R132H mutation, to the treatment with BAY1436032, indicating a correlation with therapy response. Functional: The passage describes how the R132H variant alters histone methylation levels, demonstrating a change in molecular function related to histone demethylation.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    3. A PDX mouse model was developed using primary AML cells from a patient with IDH1R132C mutant AML (PDX1). Targeted sequencing of the patient AML cells revealed a FLT3-TKD (p.D835del), an atypical NPM1 (p.S254LfsTer4), and

      [Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the treatment of PDX models with BAY1436032, indicating a correlation between the variant mutations and the response to this specific therapy. Oncogenic: The passage describes the presence of somatic mutations (p.D835del and p.Q61R) in AML cells that contribute to tumor development, as evidenced by their propagation in PDX models.

      Gene→Variant (gene-first): 2322:p.D835del 4893:p.Q61R

      Genes: 2322 4893

      Variants: p.D835del p.Q61R

    4. We developed a novel IDH1 inhibitor, BAY1436032, with high selectivity against all known IDH1R132 mutant proteins (R132H, R132C, R132G, R132S and R132L) compared to wild-type IDH1 and wild-type or mutant IDH2. Details on

      [Paragraph-level] PMCID: PMC5629366 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of various IDH1R132 mutant proteins to the IDH1 inhibitor BAY1436032, indicating a correlation between the presence of these variants and the response to the therapy. Oncogenic: The variants mentioned (R132C, R132G, R132H, R132L, R132S) are associated with mutant IDH1 proteins that contribute to tumor development, as evidenced by their expression in patient-derived AML cells and their role in producing R-2HG.

      Gene→Variant (gene-first): 3417:R132C 3417:R132G 3417:R132H 3417:R132L 3417:R132S 3418:R140Q

      Genes: 3417 3418

      Variants: R132C R132G R132H R132L R132S R140Q

    1. Mutation of p53 is the most common genetic change in human cancer, causing complex effects including not only loss of wild-type function but also gain of novel oncogenic functions (GOF). It is increasingly likely that p5

      [Paragraph-level] PMCID: PMC3973211 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Prognostic, Predictive, Oncogenic

      Justification: Prognostic: The passage indicates that mutations at Arg248 and Arg282 positions are associated with shorter patient survival, suggesting a correlation with disease outcome independent of therapy. Predictive: The passage discusses the association of p53 mutations with resistance to several CYP3A4-metabolized chemotherapeutic drugs, indicating a correlation with treatment response. Oncogenic: The mention of p53 mutations contributing to gain of novel oncogenic functions and their association with cancer cell lines suggests that these somatic variants play a role in tumor development or progression.

      Gene→Variant (gene-first): 7157:Arg248 7157:Arg282 7157:R282W

      Genes: 7157

      Variants: Arg248 Arg282 R282W

    1. KRAS, NRAS, or HRAS genes are mutated to encode an active oncogenic protein in a quarter of human cancers. Redox-dependent reactions can also lead to Ras activation in a manner dependent upon the thiol residue of cystein

      [Paragraph-level] PMCID: PMC4234187 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the introduction of a C118S mutation into the Kras allele and its effect on tumorigenesis, indicating that this somatic variant contributes to tumor development or progression. Functional: The passage describes how the thiol residue of cysteine 118 is involved in redox-dependent reactions that lead to Ras activation, suggesting that the C118S mutation alters molecular function related to protein activity.

      Gene→Variant (gene-first): 4843:C118 4843:C118S 4843:cysteine 118

      Genes: 4843

      Variants: C118 C118S cysteine 118

    1. Routine MRI surveillance again showed enlargement of the tumor over the next 6 months following the partial resection (Table 1A). The radiologist reported increases in the size and degree of contrast enhancement of the m

      [Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the patient's lack of response to vinblastine treatment, indicating that the p.T599dup BRAF variant may be associated with resistance to this therapy. Oncogenic: The p.T599dup BRAF variant is mentioned in the context of tumor sequencing, suggesting that it contributes to tumor development or progression.

      Gene→Variant (gene-first): NA:p.T599dup BRAF

      Genes: NA

      Variants: p.T599dup BRAF

    2. An adolescent female initially presented with blurred vision, papilledema, and hydrocephalus and was diagnosed with a probable low-grade glioma based on magnetic resonance imaging (MRI). The patient was treated for hydro

      [Paragraph-level] PMCID: PMC8040738 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the identification of a BRAF p.T599dup mutation in a tumor specimen, indicating that this somatic variant contributes to tumor development or progression, specifically in the context of a low-grade glioma.

      Gene→Variant (gene-first): 673:p.T599dup

      Genes: 673

      Variants: p.T599dup

    1. Two zebrafish models of VM were then developed to validate our findings in vivo and to serve as a platform for screening of potential drug treatments. Artery and vein development in zebrafish are regulated by mechanisms

      [Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The passage describes how the BRAFV600E variant contributes to disordered vessel formation and recapitulates clinical features of vascular malformations, indicating its role in tumor development or progression. Predictive: The passage discusses the response of zebrafish with BRAFV600E to vemurafenib, an approved BRAF inhibitor, showing that the variant correlates with improved blood flow following targeted therapy.

      Gene→Variant (gene-first): 673:BRAFV600E

      Genes: 673

      Variants: BRAFV600E

    2. Structural modeling was undertaken of the 4 mosaic variants detected in exon 2 of the MAP2K1 gene, 2 identical missense variants (p.[K57N]), and 2 small intraexonic deletions removing, respectively, codons 53-58 (novel c

      [Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variants affect the 3D protein structure and stability of helix A in the MAP2K1 gene, indicating that they alter molecular function. Oncogenic: The variants are described as contributing to the destabilization of the conformation of the inactive state of the protein, which suggests a role in tumor development or progression.

      Gene→Variant (gene-first): 5604:E62del NA:K57 5604:c.159_173del 5604:c.173_187del 5604:p.[K57N]

      Genes: 5604 NA

      Variants: E62del K57 c.159_173del c.173_187del p.[K57N]

    3. Twenty-five patients with high-flow and 135 patients with low-flow VMs, in whom known VM-related pathogenic variants had previously been excluded (Methods), were investigated to identify the cause of the clinical phenoty

      [Paragraph-level] PMCID: PMC5873857 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of pathogenic variants in patients with vascular malformations (VMs), indicating that these variants are used to classify or define the clinical phenotype associated with the disease. Oncogenic: The identified variant c.159_173del is described as contributing to the allelic spectrum of variants in the RAS/MAPK pathway, which is known to be involved in tumor development and progression, thus supporting its oncogenic potential.

      Gene→Variant (gene-first): 5604:c.159_173del

      Genes: 5604

      Variants: c.159_173del

    1. Finally, univariate and multivariate analyses were conducted using the Cox-proportional hazards model to determine the factors that influenced poorer outcomes in patients with stage IV CRC (Table II). The univariate anal

      [Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Prognostic, Oncogenic

      Justification: Prognostic: The passage indicates that the presence of the BRAF V600E mutation correlates with poorer outcomes in patients with stage IV CRC, suggesting its role in prognosis independent of therapy. Oncogenic: The BRAF V600E mutation is associated with tumor development or progression, as indicated by its correlation with poorer prognosis in the context of cancer.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    2. To identify miRNAs that were significantly associated with non-MSI tumors containing the BRAF V600E mutation, miRNAs exhibiting no expression among the six CRC tissues and the two corresponding normal colorectal mucosae

      [Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Diagnostic, Prognostic

      Justification: Diagnostic: The passage discusses the association of the BRAF V600E mutation with non-MSI tumors, indicating its role in classifying or defining a specific subtype of colorectal cancer. Prognostic: The passage mentions that miR-31 is being focused on as a candidate prognostic biomarker, suggesting a correlation with disease outcome in the context of tumors harboring the BRAF V600E mutation.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    3. Prior to analyzing the miRNA microarray data, six independent CRC specimens were evaluated according to their KRAS/BRAF mutational profiles and MSI status, which resulted in six subtypes with different genetic and clinic

      [Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the evaluation of CRC specimens based on their BRAF V600E mutation status, which is used to classify the tumors into different subtypes with distinct genetic and clinical features. Oncogenic: The BRAF V600E mutation is mentioned in the context of tumor specimens, indicating its role in tumor development or progression in colorectal cancer.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    4. Identification of miRNAs associated with CRCs expressing the BRAF V600E mutation

      [Paragraph-level] PMCID: PMC7068240 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage indicates that the BRAF V600E mutation is associated with colorectal cancers (CRCs), suggesting its role in defining or classifying a disease subtype. Oncogenic: The mention of the BRAF V600E mutation in the context of colorectal cancers implies that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. We then determined the effect of different genotypes at the SNP (rs1122269) of the CDH4 gene on the gemcitabine response. Experimentally, we took advantage of our LCLs with GWAS genotyping data for each cell line and sel

      [Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the effect of different genotypes at the SNP (rs1122269) on the response to gemcitabine, indicating a correlation between the variant and treatment response. Functional: The passage describes how the SNP genotype affects CDH4 expression levels in response to gemcitabine exposure, indicating an alteration in molecular function.

      Gene→Variant (gene-first): 1002:rs1122269

      Genes: 1002

      Variants: rs1122269

    2. Next, we tested the hypothesis of whether these four SNPs located in the downstream of KRT8P35 and the intron of CDH4 might also influence the expression of these two genes in a cis-manner. We carried out an eQTL (expres

      [Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Prognostic

      Justification: Functional: The passage discusses the influence of SNPs (rs9637468 and rs4925193) on the expression of genes in a cis-manner, indicating that these variants alter molecular function related to gene expression. Prognostic: The mRNA expression levels of CDH4 were associated with overall survival (OS) of pancreatic cancer patients, suggesting that the variants may correlate with disease outcome independent of therapy.

      Gene→Variant (gene-first): 1002:rs1122269 1002:rs4925193 NA:rs9637468

      Genes: 1002 NA

      Variants: rs1122269 rs4925193 rs9637468

    3. After imputation analysis with the 1000 Genome Project, we selected the four top OS-associated imputed SNPs plus the four genotyped SNPs for validation with 537 additional Mayo samples from a second independent cohort us

      [Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Prognostic

      Justification: Predictive: The passage discusses the association of the SNPs rs9637468 and rs4925193 with overall survival (OS) in the context of gemcitabine treatment, indicating their potential as genetic biomarkers for predicting response to therapy. Prognostic: The passage mentions that the SNPs are associated with overall survival (OS) outcomes, suggesting that they may correlate with disease outcome independent of therapy.

      Gene→Variant (gene-first): 1002:rs4925193 NA:rs9637468

      Genes: 1002 NA

      Variants: rs4925193 rs9637468

    4. Those four SNPs (rs7515290, rs1374679, rs10979372, and rs1122269) were mapped to four genomic regions containing four HGNC symbols: LOC100533666, KRT8P35, RPL36P14, and CDH4. Similar to other complex diseases, multiple c

      [Paragraph-level] PMCID: PMC5083195 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses trends of the SNPs being associated with drug response (gemcitabine IC50 values) and mentions pharmacogenomic effects on gemcitabine during pancreatic cancer treatment. Diagnostic: The SNPs are described as influencing disease risk in pancreatic cancer, indicating their potential role in classifying or associating with the disease.

      Gene→Variant (gene-first): NA:rs10979372 1002:rs1122269 NA:rs1374679 57554:rs7515290

      Genes: NA 1002 57554

      Variants: rs10979372 rs1122269 rs1374679 rs7515290

    1. We identified potentially targetable mutations in PIK3CA and CDKN2A. An established canonical mutation, PIK3CA E545K missense mutation were identified in five patients (5%) (Fig. 4A), while CDKN2A R58X nonsense mutation

      [Paragraph-level] PMCID: PMC6333965 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of specific mutations in PIK3CA and CDKN2A, indicating their association with patient populations, which suggests their role in defining or classifying disease subtypes. Oncogenic: The mention of TP53 inactivating mutations (R209Q/W, R243W/Q) causing cell cycle deregulation implies that these somatic variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 5290:E545K 7157:R209Q/W 7157:R243W/Q 1029:R58X

      Genes: 5290 7157 1029

      Variants: E545K R209Q/W R243W/Q R58X

    1. Diffuse Intrinsic Pontine Glioma (DIPG) is a fatal brain cancer that arises in the brainstem of children with no effective treatment and near 100% fatality. The failure of most therapies can be attributed to the delicate

      [Paragraph-level] PMCID: PMC3997489 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the prevalence of the K27M mutation in DIPG, indicating its association with this specific disease, which supports its use as a biomarker for classification. Oncogenic: The K27M mutation is described as part of the unique genetic make-up of DIPG, suggesting its contribution to tumor development or progression in this specific cancer type.

      Gene→Variant (gene-first): 3021:K27M

      Genes: 3021

      Variants: K27M

    1. Considering individual ESR1 mutations, there was strong evidence for positive selection specifically of ESR1 Y537S through treatment in both treatment groups (p = 0.0037, McNemar's test, q = 0.047, Bonferroni correction

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predictive, Prognostic, Oncogenic

      Justification: Predictive: The passage discusses the positive selection of the ESR1 Y537S mutation through treatment and its association with resistance to fulvestrant, indicating a correlation with treatment response. Prognostic: The exploratory analysis of progression-free survival comparing patients with a Y537S mutation at day 1 to those who acquired it by the end of treatment suggests a correlation with disease outcome, independent of therapy. Oncogenic: The evidence presented indicates that the ESR1 Y537S mutation contributes to tumor development or progression, particularly in the context of promoting resistance to treatment.

      Gene→Variant (gene-first): 5728:Y537S

      Genes: 5728

      Variants: Y537S

    2. Selection of ESR1 Y537S on treatment

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Predictive

      Justification: Predictive: The mention of "Selection of ESR1 Y537S on treatment" suggests that the variant is associated with treatment response or resistance, indicating its predictive nature regarding therapy outcomes.

      Gene→Variant (gene-first): 5728:Y537S

      Genes: 5728

      Variants: Y537S

    3. For PIK3CA, considering both treatment arms, 39 variants in 37 patients (37/195, 19.0%) were identified in the day 1 samples (Figure 2A), consistent with previous findings and indicating low levels of polyclonality. Almo

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the acquisition of PIK3CA mutations, including E542K, E545K, H1047L, and H1047R, in patients during treatment, indicating that these somatic variants contribute to tumor development or progression. Functional: The validation of acquired PIK3CA mutations using ddPCR and the mention of their allele fraction estimation suggest that these variants alter molecular or biochemical function, supporting their functional impact in the context of cancer.

      Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047L 5290:H1047R

      Genes: 5290

      Variants: E542K E545K H1047L H1047R

    4. Six patients acquired detectable RB1 mutations at end of treatment (p = 0.041, McNemar's test with continuity correction), all of these patients having received palbociclib plus fulvestrant. Two of these 6 patients had 2

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The Q257X mutation is described as part of RB1 aberrations that are likely to result in abrogated Rb function, indicating its contribution to tumor development or progression in the context of resistance to therapy. Predictive: The emergence of RB1 aberrations, including the Q257X mutation, is discussed in relation to the treatment with palbociclib plus fulvestrant, suggesting a correlation with resistance to this specific therapy.

      Gene→Variant (gene-first): 5925:Q257X

      Genes: 5925

      Variants: Q257X

    5. A second patient, 253, during treatment with palbociclib plus fulvestrant exhibited marked selection of a subclone featuring an activating mutation in the tyrosine kinase domain of FGFR2 p.K569E, not detectable in the da

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the selection of a subclone featuring the FGFR2 p.K569E mutation during treatment with palbociclib plus fulvestrant, indicating a correlation with resistance to therapy. Oncogenic: The FGFR2 p.K569E mutation is described as an activating mutation that contributes to the development of a resistant subclone, suggesting its role in tumor progression.

      Gene→Variant (gene-first): 2263:D538G 2099:Q75E 2263:p.K569E

      Genes: 2263 2099

      Variants: D538G Q75E p.K569E

    6. Clonal evolution and selection on palbociclib plus fulvestrant was clearly evident between day 1 and EOT plasma in 85.7% 12/14 patients (Figure 1, Supplementary figure 6). Patient 390 had two RB1 truncating mutations, p.

      [Paragraph-level] PMCID: PMC6368247 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the presence of RB1 mutations, including p.Q257X and p.N519fs, in a resistant subclone during treatment with palbociclib plus fulvestrant, indicating a correlation with treatment resistance. Oncogenic: The RB1 mutations are described as contributing to the development of a resistant subclone, suggesting their role in tumor progression and resistance to therapy.

      Gene→Variant (gene-first): 5925:p.N519fs 5925:p.Q257X

      Genes: 5925

      Variants: p.N519fs p.Q257X

    1. As described earlier, ATRX and IDH1/2 mutations co-occur frequently in glioma, and we and others have reported that the latter induce HR defects and PARP inhibitor sensitivity. We thus wanted to understand how PARPi sens

      [Paragraph-level] PMCID: PMC8203843 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how IDH1 mutations, specifically R132H, induce sensitivity to PARP inhibitors, indicating a correlation with treatment response. Oncogenic: The context implies that the IDH1 R132H mutation contributes to tumor behavior, particularly in the context of glioma and its interaction with ATRX mutations.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    1. We first asked whether the EGFR inhibitor afatinib could reduce BTSC viability and sphere formation, using alamarBlue and neurosphere assays. Afatinib inhibited BTSC growth and sphere-forming capacity in a dose-dependent

      [Paragraph-level] PMCID: PMC7086303 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how the G598V mutation influences the sensitivity of BTSC cultures to the EGFR inhibitor afatinib, indicating a correlation with treatment response. Oncogenic: The G598V mutation is described as an activating mutation in the context of EGFR, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 1956:G598V

      Genes: 1956

      Variants: G598V

    1. Somatic mutations in the epidermal growth factor receptor (EGFR) gene are present in approximately 20% (in Caucasians) to 40% (in East Asians) of adenocarcinomas of the lung. Targeted therapy for these lung cancers has b

      [Paragraph-level] PMCID: PMC5021039 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response rates of various EGFR mutations, including E709K, G719X, L858R, and L861Q, to targeted therapies such as gefitinib and erlotinib, indicating their correlation with treatment sensitivity. Oncogenic: The passage mentions that somatic mutations in the EGFR gene, including the variants listed, are present in lung adenocarcinomas and contribute to tumor development, which supports their classification as oncogenic.

      Gene→Variant (gene-first): 1956:E709K 1956:G719X 1956:L858R 1956:L861Q 1956:S768I

      Genes: 1956

      Variants: E709K G719X L858R L861Q S768I

    1. The Kaplan-Meier survival analysis of individual subtypes of KRAS mutation performed in this study showed the following results: the G12D subtype was associated with poor prognosis in PFS (log-rank p = 0.02), other subty

      [Paragraph-level] PMCID: PMC4378307 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Prognostic

      Justification: Prognostic: The passage indicates that the G12D and G12S subtypes of KRAS mutations are associated with poor prognosis in progression-free survival (PFS) and overall survival (OS), respectively, which correlates with disease outcomes independent of therapy.

      Gene→Variant (gene-first): 3845:G12D 3845:G12S

      Genes: 3845

      Variants: G12D G12S

    1. Interestingly, the irreversible EGFR inhibitor CL-387,785 is more effective than gefitinib or erlotinib for inhibition of colony formation by cells expressing the exon 20 insertion mutant (Figure 4C). Calculated IC50 val

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effectiveness of the irreversible EGFR inhibitor CL-387,785 in inhibiting colony formation and autophosphorylation in cells expressing the L858R variant, indicating a correlation with treatment response. Oncogenic: The L858R variant is described in the context of its role in transformation assays, suggesting that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    2. Given the association between the presence of activating EGFR mutations and clinical responses to gefitinib or erlotinib in lung adenocarcinoma patients, we assessed the ability of these EGFR inhibitors to inhibit anchor

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the correlation between the presence of activating EGFR mutations, including G719S, L747_E749del A750P, and L858R, and clinical responses to gefitinib or erlotinib, indicating their sensitivity to these therapies. Oncogenic: The passage describes the ability of the mentioned EGFR mutations to promote anchorage-independent growth in cell lines, which is indicative of their role in tumor development or progression.

      Gene→Variant (gene-first): 1956:G719S 1956:L747_E749del A750P 1956:L858R

      Genes: 1956

      Variants: G719S L747_E749del A750P L858R

    3. Constitutive phosphorylation of mutant EGFR on Y1068 (see Figure 2A), the binding site for the phosphatidylinositol 3-kinase interacting protein Gab1, indicated that signaling pathways downstream of phosphatidylinositol

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the mutant EGFR leads to the constitutive activation of the serine/threonine kinase Akt, indicating an alteration in molecular function related to cell survival signaling pathways.

      Gene→Variant (gene-first): 207:serine/threonine

      Genes: 207

      Variants: serine/threonine

    4. Consistent with previous reports on L858R mutant EGFR, STAT signaling pathways are constitutively activated in the transformed NIH-3T3 cells. Immunoblotting with antibodies specific for phosphorylated Y705, the tyrosine

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage describes how the L858R mutant EGFR alters molecular function by activating STAT signaling pathways and increasing STAT3-dependent gene expression, as demonstrated through immunoblotting and reporter assays. Oncogenic: The L858R variant is associated with transformed NIH-3T3 cells, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. We next asked whether constitutive activation of mutant EGFR is associated with alterations in downstream signaling pathways. Because Y1173, a docking site for the adaptor protein Shc, is constitutively phosphorylated on

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the L858R variant of EGFR alters the molecular function of Shc binding and phosphorylation, indicating a change in biochemical activity associated with the mutant protein. Oncogenic: The L858R variant is described as contributing to constitutive activation of EGFR, which is associated with tumor development or progression, as evidenced by the downstream signaling alterations observed in the study.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    6. The constitutive increase in EGFR activity appears to be ligand-independent, as a combination of neutralizing antibodies against EGF, TGFalpha, and EGFR failed to inhibit elevated basal levels of L858R autophosphorylatio

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the L858R variant alters the molecular function of EGFR, specifically its autophosphorylation activity in response to EGF stimulation, indicating a change in biochemical function. Oncogenic: The L858R variant is associated with tumor development, as it is mentioned in the context of a lung adenocarcinoma cell line, suggesting its role in cancer progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    7. To determine the ability of mutant EGFR to transform a more physiologically relevant cell type, retroviruses expressing the L858R and G719S mutant forms of EGFR were introduced into hTBE cells expressing the SV40 early r

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes how the mutant forms of EGFR (L858R, G719S, L747_E749del A750P, and D770_N771insNPG) contribute to enhanced anchorage-independent growth in hTBE cells, indicating their role in tumor development or progression. Functional: The passage discusses the expression levels of the deletion and insertion mutants (L747_E749del A750P and D770_N771insNPG) and their ability to form colonies in soft agar, suggesting alterations in molecular function related to tumorigenesis.

      Gene→Variant (gene-first): 1956:D770_N771insNPG 1956:G719S 1956:L747_E749del A750P 1956:L858R 3265:V12

      Genes: 1956 3265

      Variants: D770_N771insNPG G719S L747_E749del A750P L858R V12

    8. Representative exon 19 deletion and exon 20 insertion mutations of EGFR were then assessed for transforming activity. Mutants L747_E749del, A750P and D770_N771insNPG (K. Naoki and M. M., unpublished data) were introduced

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses how the EGFR variants A750P, D770_N771insNPG, L747_E749del, L858R, and G719S contribute to tumor development, as evidenced by their ability to form colonies in soft agar and exhibit loss of contact inhibition in NIH-3T3 cells.

      Gene→Variant (gene-first): 1956:A750P 1956:D770_N771insNPG 1956:E749del 1956:G719S 1956:L858R

      Genes: 1956

      Variants: A750P D770_N771insNPG E749del G719S L858R

    9. Transformation of NIH-3T3 cells by L858R or G719S EGFR was further assessed in two independent assays. Expression of the EGFR point mutants in NIH-3T3 cells caused loss of contact inhibition, resulting in focus formation

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes how the L858R and G719S EGFR variants contribute to tumor development, as evidenced by their ability to transform NIH-3T3 cells and form tumors in immunocompromised mice. Functional: The passage indicates that the expression of the EGFR point mutants (L858R and G719S) in NIH-3T3 cells caused loss of contact inhibition, suggesting that these variants alter the molecular function of the EGFR protein.

      Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

      Genes: 1956

      Variants: D837A G719S L858R

    10. To assess the oncogenic potential of EGFR kinase domain mutants, tumor-derived mutations were introduced into the wild-type human EGFR cDNA by site-directed mutagenesis. The resulting wild-type and mutant EGFR cDNAs were

      [Paragraph-level] PMCID: PMC1240052 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the ability of the G719S and L858R mutations to transform NIH-3T3 cells, indicating that these somatic variants contribute to tumor development. Functional: The passage describes how the mutations G719S and L858R alter the ability of EGFR to induce colony formation in soft agar, demonstrating a change in molecular function related to tumorigenesis.

      Gene→Variant (gene-first): 1956:D837A 1956:G719S 1956:L858R

      Genes: 1956

      Variants: D837A G719S L858R

    1. Functional mutations were found in 31%(9/29) of patients; 7 of these mutations were novel and another was the L858R mutation. All missense mutations were found to be activating mutations and responsive to erlotinib. Of t

      [Paragraph-level] PMCID: PMC2970593 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage indicates that the L858R mutation is an activating mutation that is responsive to erlotinib, suggesting a correlation with treatment response. Oncogenic: The mention of the L858R mutation as an activating mutation implies its contribution to tumor development or progression, consistent with oncogenic behavior.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    1. Tumour tissue from the pons of 66 DIPG patients was screened for K27M mutation in histone H3 as previously described. 42/66 (64 %) were found to be mutated for K27M-H3.3, with an additional eight patients with K27M-H3.1

      [Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Prognostic, Diagnostic, Oncogenic

      Justification: Prognostic: The passage indicates that patients with the K27M mutation in histone H3 have worse overall survival compared to patients with no histone mutations, suggesting a correlation between the variant and disease outcome. Diagnostic: The K27M mutation is associated with specific tumor histologies and is used to classify patients into different groups based on their histone mutation status, indicating its role in defining disease subtypes. Oncogenic: The K27M mutation in histone H3 is described as contributing to tumor development, as it is found in a significant proportion of tumors and correlates with specific tumor characteristics.

      Gene→Variant (gene-first): 90:K27M

      Genes: 90

      Variants: K27M

    2. For 44 patients sufficient tissue was available to assess extent of spread and the presence of disseminated disease. Seventeen of 44 patients (38.6 %) had leptomeningeal spread at autopsy (for example, see Fig. 1b). Furt

      [Paragraph-level] PMCID: PMC4159563 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Prognostic, Oncogenic

      Justification: Prognostic: The passage discusses overall survival rates for patients with and without leptomeningeal spread, indicating that the presence of the K27M mutation correlates with worse survival outcomes. Oncogenic: The K27M variant is mentioned in the context of tumor spread and is associated with specific tumor types (GBM), suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 90:K27M 5290:p.Glu545Gly 90:p.Gly328Val

      Genes: 90 5290

      Variants: K27M p.Glu545Gly p.Gly328Val

    1. 1,449 genes with somatic CNA were observed in at least 10% of tumors (S1 Table) and were located on 26 genomic segments on chromosomes 1, 2, 3, 5, 8, 10, 11, 17, 18, 19 and 20. The size of these genomic loci ranged from

      [Paragraph-level] PMCID: PMC7467277 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses somatic copy number alterations (CNAs) and specifically mentions a segment on chromosome 8 that exhibits deletion, indicating a potential role in tumor development or progression.

      Gene→Variant (gene-first): NA:chr8:208343-27992852

      Genes: NA

      Variants: chr8:208343-27992852

    1. Diffuse intrinsic pontine glioma (DIPG) is the most severe paediatric solid tumour, with no significant therapeutic progress made in the past 50 years. Recent studies suggest that diffuse midline glioma, H3-K27M mutant,

      [Paragraph-level] PMCID: PMC4654747 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The passage discusses how mutations in histone H3, specifically K27M and K27I, contribute to tumor development and progression in diffuse intrinsic pontine glioma (DIPG), indicating their role as somatic variants driving distinct oncogenic programs. Predictive: The K27M mutation is associated with a lack of clinical response to radiotherapy and earlier relapse, suggesting that this variant correlates with treatment resistance and impacts patient outcomes.

      Gene→Variant (gene-first): 3021:K27I 3021:K27M 126961:lysine-to-isoleucine

      Genes: 3021 126961

      Variants: K27I K27M lysine-to-isoleucine

    1. G309 or S310 mutations on the HER2 extracellular domain II induce receptor activation. Clinically, S310F is most frequent among HER2 extracellular domain mutations and patients with the S310F mutation without HER2 amplif

      [Paragraph-level] PMCID: PMC6843359 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the response of patients with the S310F mutation to trastuzumab and pertuzumab treatments, indicating a correlation between the variant and treatment response. Functional: The passage describes how the S310F mutation alters the ability of the HER2 receptor to form homodimers or heterodimers and its interaction with EGFR, demonstrating a change in molecular function.

      Gene→Variant (gene-first): 2064:G309A 2064:G309E 2064:S310 2064:S310F 2064:S310Y

      Genes: 2064

      Variants: G309A G309E S310 S310F S310Y

    1. All patients with a T790M mutation were treated with osimertinib (n=8). There were six partial remissions and one stable disease on osimertinib, one patient had not been assessed at data bank lock. Two patients progresse

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Predictive, Prognostic

      Justification: Predictive: The passage discusses the response of patients with a T790M mutation to osimertinib treatment, indicating a correlation between the variant and treatment response. Prognostic: The passage mentions progression-free survival (PFS) and overall survival (OS) in relation to the T790M mutation, suggesting a correlation with disease outcome independent of therapy.

      Gene→Variant (gene-first): 1956:T790M

      Genes: 1956

      Variants: T790M

    2. Of eleven patients with acquired resistance to 1st/2nd generation EGFR-TKI therapy, ten had an accessible progressive lesion and were re-biopsied. In the remaining case, liquid biopsy was used. In eight patients (73%), a

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Predictive, Diagnostic, Oncogenic, Functional

      Justification: Predictive: The passage discusses the T790M mutation in the context of resistance to EGFR-TKI therapy and its correlation with treatment response, particularly with osimertinib. Diagnostic: The T790M mutation is mentioned as a resistance mutation detected in patients with acquired resistance to EGFR-TKI therapy, indicating its role in classifying the disease state. Oncogenic: The T790M mutation is described as a resistance mutation that contributes to tumor progression in patients undergoing treatment, indicating its role in cancer development. Functional: The passage implies that the T790M mutation alters the response to therapy, suggesting a change in molecular function related to drug resistance mechanisms.

      Gene→Variant (gene-first): 1956:G719C 1956:T790M 673:V600E 1956:c.2155G>T 1956:p.G719C 7157:p.R248W

      Genes: 1956 673 7157

      Variants: G719C T790M V600E c.2155G>T p.G719C p.R248W

    3. Forty-seven of 55 patients with a sensitizing driver mutation received targeted therapy. Their treatment course is shown in the swimmer plot (Figure 4). Eight driver-positive patients did not receive targeted therapy eit

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses patients with sensitizing driver mutations receiving targeted therapy, indicating a correlation between the presence of these mutations (including E709A and G719S) and the response to treatment. Oncogenic: The mention of E709A and G719S as part of a complex EGFR mutation suggests that these somatic variants contribute to tumor development or progression, particularly in the context of the patient's advanced disease stage.

      Gene→Variant (gene-first): 1956:E709A 1956:G719S

      Genes: 1956

      Variants: E709A G719S

    4. ALK/ROS1/BRAF: 111 patients (97% EGFR negative) were tested for an ALK translocation with 8 positive results (7%). Five of 56 men (8.9%), and 3 of 54 women (5.6%) had a positive ALK-FISH test. In line with the literature

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage indicates that the classic V600E mutation was detected in patients, suggesting its role in tumor development or progression, particularly in the context of BRAF mutations.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    5. Transition exon 21 c.2527G>A; p.V843I mutation in an ex-smoker with NSCLC (NOS) who did not receive targeted EGFR-TKI therapy. This mutation has been reported twice in lung cancer (COSMIC databank, accessed 31.10.16) and

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Diagnostic, Predictive, Oncogenic

      Justification: Diagnostic: The variant c.2527G>A; p.V843I is associated with lung cancer, as indicated by its reporting in the COSMIC databank and its presence in a patient with NSCLC. Predictive: The passage states that the mutation does not confer sensitivity to EGFR-TKIs, indicating a lack of response to this specific therapy. Oncogenic: The variant is described as "activating from a biological point of view," suggesting it contributes to tumor development or progression in lung cancer.

      Gene→Variant (gene-first): 1956:c.2527G>A 1956:p.V843I

      Genes: 1956

      Variants: c.2527G>A p.V843I

    6. Transition exon 21 c.2543C>T; p.P848L in a male ex-smoker with AC G1 stage IV (M1b). This patient showed stable disease on erlotinib with a relatively short PFS of 4.6 months. This mutation has been previously described

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Diagnostic, Oncogenic

      Justification: Predictive: The passage indicates that the patient showed stable disease on erlotinib, suggesting a correlation between the variant and response to therapy. Diagnostic: The variant is mentioned in the context of being previously described in lung samples, indicating its association with a specific disease subtype (lung cancer). Oncogenic: The variant is discussed in relation to a patient with stage IV lung cancer, suggesting its potential role in tumor development or progression.

      Gene→Variant (gene-first): 1956:c.2543C>T 1956:p.P848L

      Genes: 1956

      Variants: c.2543C>T p.P848L

    7. Transition exon 19 c.2258T>C; p.P753L in a female smoker with SCC stage IIIA. This mutation has not been described previously in lung cancer (COSMIC databank search 31.10.2016). Upon recurrence after resection, the patie

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the patient's treatment with erlotinib and mentions early progression after disease stabilization, indicating a correlation between the variant and treatment response. Oncogenic: The variant is associated with a patient who has stage IIIA SCC, suggesting that it may contribute to tumor development or progression in the context of lung cancer.

      Gene→Variant (gene-first): 1956:c.2258T>C 1956:p.P753L

      Genes: 1956

      Variants: c.2258T>C p.P753L

    8. Transition exon 19 c.2203G>A; p.G735S in a female ex-smoker with AC G3 stage IV (M1b). This mutation has been described twice in lung cancer (COSMIC databank accessed 31.10.2016) with no data on response to EGFR-TKI ther

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the patient's progressive disease on 2nd line EGFR-TKI therapy with gefitinib, indicating a lack of response to the treatment associated with the variant. Oncogenic: The variant c.2203G>A; p.G735S is mentioned in the context of lung cancer, suggesting it may contribute to tumor development or progression.

      Gene→Variant (gene-first): 1956:c.2203G>A 1956:p.G735S

      Genes: 1956

      Variants: c.2203G>A p.G735S

    9. Driver mutations were detected in 55 patients of 265 tested AC patients (20.8%). The distribution and frequency of the 55 patients with an oncogenic driver mutation are shown in Figure 1A. Sensitizing EGFR-mutations were

      [Paragraph-level] PMCID: PMC5652823 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage indicates that the BRAF mutation V600E is classified as an oncogenic driver mutation, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. To test our results in a high-throughput manner, we utilized the CTD2 database, where we examined the area under the curve (AUC) of 39 different ovarian cancer cell lines and 406 different compounds (targeted and cytotox

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 28

      Evidence Type(s): Predictive

      Justification: Predictive: The passage discusses the association between the rs1801018 variant and response to different treatments, indicating a correlation with treatment sensitivity.

      Gene→Variant (gene-first): 596:(AUC) of 39 596:rs1801018

      Genes: 596

      Variants: (AUC) of 39 rs1801018

    2. Since differences in localization sometimes produce differences that might lead to observed paclitaxel resistance, we studied BCL2 spatial expression patterns in the reference form and in the 21 T > C form. HEK293T cells

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the study of BCL2 spatial expression patterns in relation to paclitaxel resistance, indicating a potential correlation between the 21 T > C variant and treatment response. Functional: The passage describes an immunofluorescence assay that assesses the localization patterns of the BCL2 variant, indicating an alteration in molecular function related to protein localization.

      Gene→Variant (gene-first): 596:21 T > C

      Genes: 596

      Variants: 21 T > C

    3. To observe transcript differences at the level of the single transcript, we used digital PCR, which brings potential advantages over real-time PCR, including the ability to obtain absolute quantification without external

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how the variant 21 T > C leads to higher BCL2 expression, which is associated with resistance to the therapy paclitaxel. Oncogenic: The variant 21 T > C is implicated in contributing to tumor behavior by leading to increased expression of BCL2, which is associated with resistance to treatment, indicating a role in tumor progression.

      Gene→Variant (gene-first): 596:21 T > C

      Genes: 596

      Variants: 21 T > C

    4. Transcripts that include the 21 T > C variant are more abundant in the presence of paclitaxel

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage indicates that the presence of the 21 T > C variant correlates with increased abundance of transcripts when treated with paclitaxel, suggesting a relationship with treatment response. Functional: The mention of increased abundance of transcripts implies that the 21 T > C variant alters molecular function, likely affecting gene expression in response to paclitaxel.

      Gene→Variant (gene-first): 596:21 T > C

      Genes: 596

      Variants: 21 T > C

    5. These results thus show that cells with a BCL2 sequence with a C at location 21 present a more stable BCL2 transcript, which may lead to higher protein levels. To directly quantify the effect of the variant on the in vit

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the in vitro sensitivity to paclitaxel in relation to the 21 T > C variant, indicating that this variant may influence the response to the therapy. Functional: The variant is shown to alter the stability of the BCL2 transcript, which may lead to higher protein levels, indicating a change in molecular function.

      Gene→Variant (gene-first): 596:21 T > C

      Genes: 596

      Variants: 21 T > C

    6. These results suggest a general BCL2-related mechanism. That is, the findings we described so far are not necessarily intrinsic to any cancer mechanism and should be observable in other cell types. Variation at location

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the 21 T > C variant may regulate the transcriptional activity of the BCL2 gene, indicating an alteration in molecular function as evidenced by the increase in BCL2 mRNA levels in lymphocytes.

      Gene→Variant (gene-first): 596:21 T > C 596:C instead of a T

      Genes: 596

      Variants: 21 T > C C instead of a T

    7. These findings led us to hypothesize that the + 21 T > C substitution leads, through a more stable transcript, to an increase in BCL2 protein levels. We tested this hypothesis in cell lines, in 1417 patient samples from

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the + 21 T > C substitution alters BCL2 protein levels, indicating a change in molecular function due to the variant. Oncogenic: The context of the study involves ovarian cancer patients, and the variant is associated with increased BCL2 protein levels, which can contribute to tumor development or progression.

      Gene→Variant (gene-first): 596:+ 21 T > C 596:C instead of a T

      Genes: 596

      Variants: + 21 T > C C instead of a T

    8. Changing T to C at location 21 leads to an increase in protein levels in vitro

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that changing T to C at a specific location alters protein levels, which demonstrates a change in molecular function.

      Gene→Variant (gene-first): 596:T to C

      Genes: 596

      Variants: T to C

    9. These findings rely on the hypothesis that genomic variation alters transcript stability. To measure the stability of the different BCL2 mRNA transcripts, we used the same set of transfected cells and variants described

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the T > C variant alters the stability of BCL2 mRNA transcripts, indicating a change in molecular function.

      Gene→Variant (gene-first): 596:T > C

      Genes: 596

      Variants: T > C

    10. To experimentally validate these computational results, we studied the effect of sequence modification on transcript stability. Ovarian carcinoma HeyA8 cells were transfected with GFP or one of three GFP-BCL2 variants: r

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how sequence modifications of BCL2 variants affect transcript stability and expression levels, indicating that the variants alter molecular function.

      Gene→Variant (gene-first): 596:+21 C 596:+21 T 728378:+23 C > T 596:T > C

      Genes: 596 728378

      Variants: +21 C +21 T +23 C > T T > C

    11. Changing location 21 in BCL2 from C to T stabilizes BCL2 RNA secondary structure in vitro

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional

      Justification: Functional: The variant C to T alters the molecular function by stabilizing the BCL2 RNA secondary structure, as indicated by the in vitro analysis.

      Gene→Variant (gene-first): 596:C to T

      Genes: 596

      Variants: C to T

    12. Here, we used RNA-folding prediction software to assess structural changes that could result from the C > T change in BCL2. As demonstrated in ref. , synonymous changes in UTRs that alter the mRNA structural ensemble of

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the C > T change in BCL2 alters the mRNA structural ensemble, indicating that the variant affects molecular function related to RNA structure.

      Gene→Variant (gene-first): 596:+ 21 T > C 728378:+ 23 C > T 596:C > T 596:T > C 596:T at position 21

      Genes: 596 728378

      Variants: + 21 T > C + 23 C > T C > T T > C T at position 21

    13. The T >C variant at location 21 of BCL2 changes its RNA secondary structure

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that the T > C variant alters the RNA secondary structure of BCL2, which is a change in molecular function.

      Gene→Variant (gene-first): 596:T >C

      Genes: 596

      Variants: T >C

    14. This variation is referred to as rs1801018 in the NCBI's public archive of all short-sequence variations (dbSNP). The variation status matched patient resistance to paclitaxel in a manner that was able to retrospectively

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses how the variant rs1801018 correlates with patient resistance to paclitaxel, indicating its predictive value for treatment response. Diagnostic: The variation is associated with the classification of patients based on their treatment response, helping to define which patients are likely to respond to single or multiple lines of therapy.

      Gene→Variant (gene-first): 596:T instead of a C 596:rs1801018

      Genes: 596

      Variants: T instead of a C rs1801018

    15. However, one variation, the transition from a C to a T at location 21 of BCL2 (+ 21 T > C, Fig. 1b), showed a significant association with resistance to paclitaxel (Fig. 1c).

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Predictive

      Justification: Predictive: The passage indicates that the variant + 21 T > C is associated with resistance to paclitaxel, which correlates the variant with treatment response.

      Gene→Variant (gene-first): 596:+ 21 T > C 596:C to a T

      Genes: 596

      Variants: + 21 T > C C to a T

    16. Combined, TUBB1 and BCL2 have 11 variable loci (Fig. 1b and Fig. S1, Tables S1-S4). These variable regions have all been recorded as single-nucleotide polymorphisms (SNPs). Among these 11 loci, eight showed variation in

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic

      Justification: Diagnostic: The variant rs6070697 is discussed in the context of its distribution among treatment groups and its presence in both patients and controls, indicating its association with the study population and suggesting a role in defining or classifying the patient cohort.

      Gene→Variant (gene-first): 81027:rs6070697

      Genes: 81027

      Variants: rs6070697

    17. A T > C variation at position 21 of the BCL2 sequence predicts response to paclitaxel

      [Paragraph-level] PMCID: PMC6478919 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Predictive

      Justification: Predictive: The passage states that the T > C variation at position 21 of the BCL2 sequence predicts response to paclitaxel, indicating a correlation with treatment response.

      Gene→Variant (gene-first): 596:T > C variation at position 21

      Genes: 596

      Variants: T > C variation at position 21

    1. To assess this possibility, we first estimated, using the NetMHCpan-4.0 algorithm, how frequently in the general population neopeptides derived from the out-of-frame sequence following pathogenic mutations were predicted

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses common founder mutations such as BRCA2:c.5946delT and BRCA1:c.68_69delAG, indicating their association with neopeptides that are likely presented in the population, which relates to defining or classifying a disease. Oncogenic: The mention of pathogenic mutations and their associated neoantigens suggests that these variants contribute to tumor development or progression, as they are described as potential tumor antigens.

      Gene→Variant (gene-first): 672:c.5266dupC 675:c.5946delT 672:c.68_69delAG

      Genes: 672 675

      Variants: c.5266dupC c.5946delT c.68_69delAG

    2. Interestingly, we noted very few missense pathogenic mutations in the set of reported reversions. For example, in the Incidence tumour sequencing datasets used previously, we found that (40/849, 4.7%) of these pathogenic

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of pathogenic missense mutations, specifically mentioning the BRCA1:p.C61S and p.M1I mutations, in the context of their association with disease, indicating their role in defining or confirming a disease subtype. Oncogenic: The passage refers to the BRCA1:p.C61S and p.M1I mutations as pathogenic, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.

      Gene→Variant (gene-first): 672:p.C61S 672:p.M1I

      Genes: 672

      Variants: p.C61S p.M1I

    3. For each of these common founder mutations, we noted that the reversions that emerged in these patients were generally localised to the 3' flanking sequence of the original pathogenic mutation (transcriptionally downstre

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 675:c.7355delA

      Genes: 675

      Variants: c.7355delA

    4. Amongst the 91 patients we collated data from, most (68/91, 75%) had unique pathogenic mutations (Figure 1E, annotated as "single-patient mutations" and Supplementary Figure 1). There were eight pathogenic mutations repr

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.

      Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

      Genes: 672 675

      Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

    1. Median OS was 48 weeks (range=4-140). None of the following factors had a significant impact on OS: PS (P=0.403), histology (P=0.198), smoking (P=0.242), sex (P=0.475), skin rash (P=0.182) and EFGR IHC expression (P=0.63

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    2. The median follow-up period was 109 weeks and the median time to tumour progression (TTP) 20 weeks (range=4-140). A total of 23 (36%) patients had a TTP>24 weeks and 7 (10.9%) >52 weeks (Table 5). There was no difference

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    3. The DCR was significantly higher in patients of the 'classical' mutations than in patients of the 'wild-type' (90.9 and 43.3%, respectively; P=0.006) group; conversely, there was no significant difference between the DCR

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    4. A total of 1 (1.1%) patient (no. 13) had two 'other' mutations, while 3 (3.4%) patients (nos. 9, 11 and 18), who were included in the 'classical mutations' group, had both the exon 21 L858R mutation and an 'other' mutati

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. According to the mutational status, three groups of patients were identified as follows: (i) the 'wild-type' group (n=61 patients; 71%) with no detectable mutations; (ii) 'classical' mutations group (n=11 patients, 13%;

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    1. The finding that gilteritinib inhibited FLT3-D835Y and FLT3-ITD-D835Y, both of which harbor mutations in the activation loop essential for binding type 2 inhibitors, suggests that gilteritinib is a type 1 FLT3 inhibitor.

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.

      Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

      Genes: 2322

      Variants: D835 D835Y F691

    2. Since mutations within the TKD of FLT3 (eg, FLT3-D835Y or FLT3-F691) often confer resistance to FLT3 inhibitors that were previously effective against FLT3-ITD, the effect of gilteritinib on these resistance mutations wa

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

      Genes: 2322

      Variants: D835Y F691 F691 L F691I

    3. Inhibitory activity of gilteritinib against FLT3 containing ITD +- D835Y or F691 L/I mutations

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

      Genes: 2322

      Variants: D835Y F691 L/I

    1. Four human NSCLC cell lines expressing different forms of the EGFR were investigated. Sensitivity of each cell line to the anti-proliferative effect of erlotinib was evaluated by methylene blue assay and is presented in

      [Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.

      Gene→Variant (gene-first): 1956:L858R 1956:T790M

      Genes: 1956

      Variants: L858R T790M

    1. In addition to the main driver mutations discussed above, several patients carry recurrent mutations that are clearly subclonal (present in some but not all tumour areas in a patient) and occur at later stages of tumour

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.

      Gene→Variant (gene-first): 5290:H1047R

      Genes: 5290

      Variants: H1047R

    2. We analysed 134 punch cores from nine DIPG whole brain specimens obtained at autopsy as previously described. Selected punch cores represented multiple spatial regions of the primary tumour and adjacent areas within the

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 8358:K27M

      Genes: 8358

      Variants: K27M

    1. Somatic mutations found within the tyrosine kinase domain (TKD) of the human epidermal growth factor (HER) family of receptors have been implicated in the development and progression of non-small cell lung cancer (NSCLC)

      [Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive, Functional

      Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    2. Taken together, these data suggest that the V855A mutation alters the activity of HER3, which may correlate with a malignant phenotype.

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    3. To elucidate and predict the impact of mutant V855A on the conformation of the wild-type HER3, protein modeling was performed via the automated I-TASSER server. Server predicted models were further refined by submitting

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    4. Impact of V855A on HER3 protein structure

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    5. We further examined the effects of the inhibitors on HER-related signaling activity and survival using the Ba/F3 model system. Afatinib (100nmol/L) potently inhibited NRG1beta-induced phosphorylation of HER3, wild type H

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive

      Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    6. To assess the effect of the inhibitors on colony formation, Ba/F3 co-transfectants were seeded onto methyl-cellulose and treated with HER inhibitors in the presence of NRG1beta. As shown in Fig 6b, afatinib (100 nmol/L)

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    7. To investigate whether HER3-V855A can be therapeutically targeted; we examined the growth inhibitory effects of inhibitors targeting the extracellular and kinase domain of the HER receptors. These inhibitors include: erl

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    8. To further confirm that the V855A mutation provides increased activity to HER3 through enhanced physical interaction with HER2, we performed co-immunoprecipitaton experiments on Ba/F3 co-transfectants stimulated with or

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    9. Tyrosine trans-phosphorylation is a major event in HER signaling. To examine if HER3-V855A enhances trans-phosphorylation of HER2, we performed immunoblot analysis on Ba/F3 and HEK 293Tlysates after 16hr incubation in se

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    10. We next examined the effect of chronic treatment with NRG1beta on HER3/HER2 phosphorylation and their downstream targets AKT and ERK 1/2 in the Ba/F3 co-transfectants. As shown in Figure 3e, a five-day chronic treatment

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    11. We also investigated the functional relevance of stable Ba/F3 transfectants co-expressing HER3-V855A and EGFR (Supplemental Fig. 1a). While Ba/F3 cells co-expressing HER3-V855A and EGFR exerted a robust growth response t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    12. To assess the ability of HER3-V855A to form colonies we performed a methyl cellulose-based colony formation assay. As shown in Fig 3c & 3d, while NRG1beta treatment did not induce an increase in colony number between the

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    13. To determine the transforming potential of HER3-V855A in the context of IL-3 -independent growth, Ba/F3 transfectants were grown in the absence or presence of IL-3, or HER cognate ligands (neuregulin1beta (NRG1beta) or t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    14. HER3 has been described as a contributor to oncogenic transformation and tumorigenesis, particularly when combined with its HER2 dimerization partner. Therefore, we hypothesized that the HER3 kinase mutation may cause a

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    15. To analyze the location and significance of the novel HER3-V855A mutation, we performed protein sequence alignment of exon 21 of the EGFR and HER3. Although, the amino acid at position 855 in HER3 is not conserved relati

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.

      Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

      Genes: 673 1956 324

      Variants: L597V L858 L858R V855 V855A

    16. EGFR pathogenic mutations sensitize in varying degrees to inhibition by small molecule TKIs. These mutations include both class I short in-frame deletions and class II missense mutations. One of these mutations, the L858

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    1. Results: We found that rs3786362 G allele of thymidylate synthase (TYMS) gene was significantly associated with PFS (P = 1.10 x 10-2), OS (P = 2.50 x 10-2) and DCR (P = 5.00 x 10-3). The expression of TYMS was overexpres

      [Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).

      Gene→Variant (gene-first): 7298:rs3786362

      Genes: 7298

      Variants: rs3786362

    1. Thirty-two patients with BRAF V600E positive metastatic colorectal cancer (mCRC) and 7 patients with other cancers were enrolled. No dose-limiting toxicities were observed in escalation, with vemurafenib 960 mg twice dai

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    2. BRAF V600E mutant metastatic colorectal cancer represents a significant clinical problem, with combination approaches being developed clinically with oral BRAF inhibitors combined with EGFR-targeting antibodies. While co

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E