I 0.0 J.Ll 16.0 J.LI I 0.0 J.Ll 4.0J.Ll 4.0J.Ll 0.5 J..ll 55.5 J.LI I 00 J.L
750 Matching Annotations
- May 2019
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
-
lOX PCR buffer 1.25 J.LM dNTP mix Template DNA (I 0 J.Lg/ml) Primer #I (25 nmoles/ml) Primer #2 (25 nmoles/ml) Taq DNA polymerase (5 U/J.Ll) Sterile water Total volume
-
The aggregation of the phospholipid vesicles, induced by ribotoxins, was assayed by titrating 40 nmoles of freshly prepared lipid vesicles with various molar concentrations of restrictocin and its mutants. The samples of I ml volume were prepared in 30 mM Tris-HCl buffer, pH 7.0, containing O.IM NaCl and incubated at 37 °C for I h. The change in absorbance due to an increase in turbidity of the lipid suspension was measured at 400 nm in Lambda Bio 20 spectrophotometer (Perkin Elmer) in the cells of I em optical path length. Appropriate control proteins, not interacting with the membranes and the vesicles without proteins were included in all the experiments. The change in absorbance of the lipid suspension was plotted against the toxin concentration.
-
The organic solution of phospholipid was made in a 1:1 mixture of chloroform and methanol at a concentration of 5 mg/ml. To get a thin and uniform lipid film, lipid was dried down onto the walls of a round bottom flask by rotating for 30 min. in a rotary evaporator fitted with a coo!;ng coil and a thermostatically controlled water bath. The temperature of the water bath was maintained 10 °C above the phase transition temperature of the respective phospholipid. The film was stored under vacuum for 1 2 h to remove the traces of the solvent after flushing with nitrogen. Subsequently, lipid film was dispersed in 30 mM Tris-HCI buffer containing O.IM NaCl, pH 7.0 at a concentration of 1 mg/ml of lipid using glass beads of 0.5 mm-3 mm in diameter. Multilamellar vesicles (ML Vs) were obtained by manual swirling for 2 h at room temperature (Bangham et al., 1965). Nitrogen was flushed into the flask and the vesicle suspension was left overnight at 4 °C. The .following day, maintaining the temperature 10 °C abcve the phase transition temperature of the corresponding phospholipid, MLVs were sonicated in a water bath sonifier (Branson 321 0) for 45 min. to get the small unilamellar vesicles (SUVs) (Huang C, 1969).
-
Tryptic hydrolysis of restrictocin and the chimeric toxins was carried out at neutral pH in 25 mM HEPES, pH 7.4 containing 1 mM CaCh, 0.5 mM EDT A. For acidic pH, the buffer containing 200 mM sodium acetate, pH 5.2 and 1 mM CaCh was used. Trypsin diluted in 50 mM PBS, pH 7.4 was added to the protein and the samples were incubated at 37 °C for specified time periods. The reaction was terminated by the addition of SDS-PAGE sample buffer. The digestion products were analyzed on a 12.5% SDS-PAGE using Tris-Giycine buffer system and restrictocin containing fragments were detected by western blotting with anti-restrictocin antibodies.
-
in IOmM Tris/HCI (pH 7.4)/ lmM EDTN 0.5% SDS. The radioactivity associated with the cells was counted in a y-counter (LKB).
-
Competition binding analysis was performed to compare the affinity of the chimeric toxins with native antibody. Anti-transferrin receptor antibody (HB21) was iodinated using iodogen method as described by Harlow and Lane, (1988). Adherent cell lines, namely, A431 and A549 were plated at 4Xl05 cells per well in a 24 well plate and used 16 h later for the assay. 500 J.Ll medium, same as described in cytotoxicity assay, was used to dispense the cells. HUT102 cells were also plated at the same density in microfuge tubes and used immediately. After 2 washes with binding buffer (0.1% BSA in DMEM), various dilutions of toxin, along with 3 ng of labeled antibody in binding buffer, were added to the cells. The cells were incubated at 25 °C for 2 h with mild shaking, washed three times with binding buffer and lysed
-
The kinetics of intoxication by different restrictocin containing chimeric toxins was investigated by assaying the cytotoxic activity at various time points. HUTI02, K562 and A431 cell lines were seeded at a density of IX104 cells per well in 200 J.ll medium in a similar manner as described in cytotoxicity assay. The various concentrations of chimeric toxins were added and the cells were incubated at 37 °C in the presence of 5% C02 for different time points. At the end of each incubation period cells were pulsed with eH] leucine and the protein synthesis was measured as described above. The results were expressed as percentage of control where no toxin was added to the cells.
-
with appropriate antibiotics. Serial dilutions of the toxin, made in 0.2% HSA were added to the cells and incubated for indicated time periods. After incubation, the adherent cells were labeled with 0.25 J!Ci eH] leucine per well and the suspension cells with 0.75 J!Ci eH] leucine per well for 3 hat 37 °C. The cells were harvested on to filtermats using an automatic cell harvester, and the incorporation of the eH] leucine in the newly synthesized proteins was estimated using LKB ~-plate counter. Activity was expressed as percentage of control where no toxin was added to the cells. To check the specificity of chimeric toxins for TFR, 10 J.Lg of anti-TFR antibody (HB21) was added to each well prior to the addition of the fusion protein in the competition experiments.
-
Cytotoxic activity of restrictocin, its mutants and chimeric toxins was checked on a variety of cell lines. The cellular protein synthesis was assayed in the absence and presence of various concentrations of toxin by measuring eH] leucine incorporation in the newly synthesized proteins. Adherent cell lines namely A431, A549, HeLa, L929 and MCF7 were plated in RPMI 1640 containing 10% FCS at a density of 5x I a:~ cells per well in 96 well culture plates and allowed to adhere for 12 h at 37 °C in the presence of 5% C02• Next day, the medium was replaced with 200 J.LI of leucine free RPMI medium containing 10% serum. The leucine free RPMI containing 1 0% FCS was used for seeding partially adherent cell lines, COL0205 and J774A.1. Cells were allowed to adhere for 12 h and the toxin was added in the same medium. The suspension cell lines, HUT102 and K562 were plated at a density of 5X 103 _cells/well in 80% leucine free RPMI containing 18% complete RPMI and 2% serum immediately before use. The medium used at various stages was supplemented
-
Cell-free protein synthesis inhibitory activity of restrictocin was assayed as described by Harlow and Lane ( 1988). The frozen rabbit reticulocyte lysate was thawed on ice in the presence of 30 J..LI of haemin solution per 0.5 ml vial. The toxin was diluted in 0.2% RNase free BSA and several concentrations were incubated with 10 J..LI lysate, I mM ATP, 0.2 mM GTP, 75 mM KCI, 2 mM magnesium acetate, 3 mM glucose, 10 mM Tris-HCI, pH 7.6, 4 J..LM amino acid mixture without leucine, 0.16 J..LCi eH] leucine, 1.33 mg/ml creatine phosphokinase, and 2.66 mg/ml creatine phosphate in a reaction volume of 30 J.LI. The reaction was carried out at 30 °C for one hour and terminated by adding 0.25 ml of I N NaOH containing 0.2% H202• The reaction mixture was further incubated for I 0 min. at 37 °C, BSA added to a final concentration of 65 J..Lg/ml, and the proteins were precipitated with 15% trichloroacetic acid. The mixture was left on ice for 30 min. for complete precipitation and harvested onto 26 mm glass fibre filters. The filter discs were placed in a manifold harvester (millipore) and rinsed with chilled 5% TCA, before the addition of reaction contents. The filters were thoroughly washed with chilled acetone and dried at 37 °C, for one hour. The dried filters were immersed in organic scintillation fluid, and counted using a liquid scintillation counter (Packard).
-
The specific ribonucleolytic activity of restrictocin and its mutants was followed by detecting the release of the characteristic 400 nucleotide long a-fragment from 28S rRNA of eukaryotic ribosomes. All the reagents, water and glassware used during the experiment were treated with O.I% DEPC to get rid of contaminating ribonucJeases. Rabbit reticulocyte lysate (30 J.Ll) was incubated with different concentrations of the toxin in 40 mM Tris-HCl (pH 7.5) containing 10 mM EDTA at 37 °C for 30 min. in a 50 J.Ll reaction volume. The control reaction did not contain an)' toxin. The reaction was stopped by adding 2 J.Ll of I 0% SDS and incubated at ambient temperature for 5 min. Total RNA was extracted using Trizol reagent. 200 J.LI of the reagent was added to the reaction mixture, mixed well and incubated at room temperature for 5 min. Subsequently, 50 J.LI chloroform was added to each tube, mixed thoroughly and incubated at ambient temperature for 2 min. followed by centrifugation at I2,000 rpm, at 4 °C, for I5 min. in a microfuge (Plastocraft). The aqueous phase was mixed with 125 J.Ll isopropanol to precipitate the RNA, allowed to stand at ambient temperature for I 0 min. and centrifuged at 12,000 rpm at 4 °C for I5 min. The RNA pellet was washed with 75% ethanol, dried in air, dissolved in 10 J.Ll of 0.5% SDS solution and electrophoresed on a 2% agarose gel after heating at 65°C for 2 min. The RNA was visualized by ethidium bromide staining and photographed using Polaroid camera. The photographs were scanned, printed using a laser printer to present as figures in this thesis.
-
1.2% acetylphenylhydrazine (APH) solution to render it anemic. The APH solution wa5 prepared in sterile water and pH was neutralized to 7.0 with 1 M HEPES buffer (pH 7.5). The rabbit was allowed to recover for 5 days, after which it was bled. The blood was collected in a sterile tube, containing an equal volume of prechilled salt solution and the mixture was filtered through a cheese cJoth. Filtrate was centrifuged at 2000 g for 10 min. at 4 °C. Supernatant was discarded, the pellet was washed twice with salt solution without heparin and finally, resuspended in equal volume of chilled sterile water. It was kept on ice for a minute and centrifuged at 20,000 g for 20 min. at 4 °C. The supernatant, containing the lysate, was immediately stored in liquid Nitrogen in 0.5 ml aliquots.
-
The rabbit reticulocyte lysate was prepared as described by Sambrook et al ( 1989). A young male NZW rabbit weighing 2-2.5 Kg was subcutaneously injected for five consecutive days respectively with 2 ml, 1.6 ml, 1.2 ml, 1.6 ml and 2.0 ml of
-
Circular Dichroic spectra of various proteins were recorded at room temperature, using a JASCO J7i0 spectropolarimeter fitted with a thermostated cell holder. I 50 J..Lg protein was dissolved in 3 ml of I 0 mM sodium phosphate buffer (pH 7.0), and the samples were scanned in the far-UV range (200-250 nm). A cell with a 1 em optical path was used to acquire the spectra at a scan speed of 50 nrn/min. with a. sensitivity of 50 mdeg and a response time of I sec. The sample compartment was purged with nitrogen, and spectra were averaged over I 0 accumulations. The CD spectra were normalized to mean residue ellipticity curves using Jasco software. Yang's reference parameters were used to perform secondary structure analyses from CD measurements using Jasco Secondary Structure Estimation Programme (Yang et al., 1986).
-
The proteins were resolved on SDS-polyacrylamide gels and transferred onto a nitrocellulose membrane, in the transfer buffer, at a constant current of 300 rnA for 2 h. The membrane was incubated in blocking buffer for 45 min. at room temperature with continous shaking. The membrane was further incubated in anti-restrictocin antibody diluted in PBS, pH 7.4, containing 0.1% Tween 20 (PBST), for 45 min .. The membrane was washed thrice with PBST, followed by incubation in anti-rabbit IgG-HRP conjugate diluted in PBST for 30 min. with shaking. After repeated washings with PBS, colour was developed by incubating the membrane with the chromogenic substrate 0.5 mg/ml of DAB.4HCI (diaminobenzidine tetrahydrochloride dihydrate) and 1 f..ll/ml of H202 in PBS.
-
M Tris-HCI pH 8.8, containing 4% stacking gels in O.I25 M Tris-HCI pH 6.8. The gels were run in SDS-PAGE running buffer at a constant current of 40 rnA Proteins were visualized by staining the gels with Coomassie brilliant blue.
-
The purified proteins were analysed by SDS-PAGE as described by Laemmli ( 1970). Restrictocin and its mutants were analysed on 12.5% resolving gels in 0.375
-
Heterologus expression of various proteins was done in BL21 (A.DE3) strain of E. coli. Bacterial cells were transformed with the desired construct and grown in Super broth (pH 7.2) containing 100 J.lg/ml ampicillin, at 37 °C with continous shaking in a gyratory shaker at 225 rpm. The cultures were induced, at ~oo of 2.0, with I mM IPTG, and harvested two hours later by centrifugation at 4000 g, at 4 °C, for 20 min .. The recombinant proteins were purified from the inclusion bodies using the procedure described by Buchner et al ( 1992). The total cell pellet from a liter of culture was homogenized in 180 ml of inclusion bodies washing buffer containing 8 ml of freshly prepared lysozyme solution (5 mg/ml). The suspension was incubated at room temperature for 1 hr with intermittent shaking. Added 20 ml each of 5M NaCI and 25% Triton X-100 were added to the suspension and incubated at room temperature for 30 min. with vigorous shaking. The suspension was centrifuged at 13,000 g at 4 °C, for 50 min. and the pellet was resuspended, in the washing buffer containing 1% Triton X-1 00, using a polytron homogenizer and centrifuged at 13,000 g for 50 min. The pellet was washed four times with washing buffer without Triton . X-100. The pellet containing inclusion bodies was solubilized in 6 M guanidine hydrochloride by incubating for 2 hours at room temperature. The solubilized protein was centrifuged at 50,000 g, at 4 °C, for 30 min. and the protein concem.ration was adjusted to 10 mg/ml in the supernatant with 6 M guanidine hydrochloride. The denatured protein thus obtained was reduced by adding 65 mM dithioerythritol and incubated at room temperature for 2 h. To renature, the protein was diluted 1 00-fold in the refolding buffer and incubated at 10 °C for 48 h without stirring or shaking. Renatured material, after dialysis in 20 mM MES buffer, pH 5.0 containing 100 mM urea, was loaded on a S-Sepharose column, and the protein bound to the column was eluted with a 0-1 M NaCI gradient in 20 mM MES on an FPLC system (Pharmacia). The fractions containing the desired protein were pooled and concentrated, and the protein was further purified to homogeneity by gel filtration chromatography on a TSK 3000 column (LKB) in PBS, pH 7.4.
-
Sequencing of cloned inserts was done by Sanger's dideoxy chain termination method (Sanger et al., J 977) using Sequenase version 2.0 kit from USB. 5 J.ll of J mg/ml suspension of plasmid DNA was incubated in denaturation buffer at 37 °C for 30 min. in a reaction volume of 50 J.ll, and then the precipitation was carried out in the presence of 5.5 J.ll of 3M sodium acetate and 4 volumes of chilled ethanol at -70 °C for 30 min. The pellet, obtained by centrifugation at 10,000 g, for 20 min., at 4 °C, was washed with 70% ethanol and resuspended in 7 J.ll of sterile water. J pmole of sequencing primer in J J.ll water and 2J.ll of 5X sequenase reaction buffer were added to denatured DNA and the reaction mix was incubated at 65 °C for 5 min. for primer annealing. The reaction mixture was cooled slowly to about 35 °C, by putting the heat block at room temperature. For labeling, J J.ll of 0. J M DTT, J J.ll radioactivity containinig J 0 J.lCi of 35S dATP, 2 Jlllabeling mix diluted 5-fold in steriJe water and 2 Jll sequenase enzyme diluted 8-fold in sequenase dilution buffer were added to the· primer annealed DNA. Incubated the reaction mixture at room temperature for 2-5 min. and added 3.5 J.ll to each of the 4 different tubes containing 2.5 J.ll dideoxy nucleotides ddATP, ddTTP, ddCTP, and ddGTP separately. The mixture was incubated at 37 °C for 5 min. and finally, the reaction was stopped by adding 4 J.ll of estop solution to each tube. Reaction products were separated on a 6% polyacrylamide sequencing gel made in TBE buffer containing 7.5 M urea. The samples were heated at 75 °C for 2 min. and immediately loaded on the gel. The gel was run at a constant power of 60 watts maintaining the temperature of gel between 50-55 °C, dried and exposed to an X-ray film.
-
resuspended in 0.2 ml TE, and extracted successively with phenol, phenol-chloroform, and chloroform. In the aqueous phase, 0.25 volume of J 0 M ammonium acetate and two volumes of chilled ethanol were added and the mixture was incubated at room temperature for 5 min. to precipitate the plasmid DNA. The pure plasmid DNA was recovered by centrifugation at J 2,000 g for J 0 min. at 4 °C, washed with 70 %ethanol, dried and resuspended in TE buffer (pH 8.0). The amount and the purity of the DNA was done spectrophotometrically by recording the absorbance at 260 nm.
-
Plasmid DNA was prepared by alkaline lysis method of Ish-Horowicz ( 1981 ). 5 ml cultures were grown as described for small scale plasmid preparation. 0.5 ml from the growing culture was inoculated into 250 ml of LB containing ampicillin. The culture was grown for 12 h at 37 °C with vigorous shaking, centrifuged at 3000 g, at 4 °C, for 15 min. and the bacterial pellet was resuspended gently in 1 0 ml TEG buffer. The mixture was incubated at room temperature for 10 min., followed by addition of 20 ml of freshly prepared alkaline-SDS solution. The contents were mixed by inversion and the mixture was kept on ice for 10 min., followed by the addition of 15 ml of chilled potassium acetate solution. The contents were mixed by inverting the tube, and incubated on ice for 10 min. The lysed cell suspension was centrifuged at 5000 g, at 4 °C, for 20 min. The supernatant was taken, and nucleic acids we~,-.. precipitated by adding 0.6 volume of chilled isopropanol. The mixture was incubated on ice for 10 min. followed by centrifugation at 5000 gat 4 °C, for 10 min .. The pellet was washed with 70% ethanol, dried and resuspended in TE buffer. The plasmid DNA was purified further to remove the contaminating proteins and RNA following the PEG purification protocol as described by Sambrook et al ( 1989). Equal volume of chilled 5 M lithium chloride solution was added to DNA . suspension, mixed well and incubated on ice for 10 min. The precipitate was removed by centrifugation at 10,000 g at 4 °C, for 10 min. DNA was precipitated from the supernatant by adding equal volume of isopropanoL The mixture was centrifuged at 10,000 g for 10 min. at 4 °C and the pellet was washed with 70% ethanol. The DNA thus obtained was incubated in TE buffer containing 20 J.tg/ml of DNase free RNase A for 30 min. at room temperature. Afterwards, equal volume of 1.6 M NaCl containing 13% (w/v) PEG 8000 was added to DNA solution. The contents were. thoroughly mixed and centrifuged at 10,000 g, at 4 °C, for 10 min .. The pellet was
-
of the plasmid DNA with 0.5 volume of cold isopropanol. The mixture was kept on ice for 10 min. and centrifuged at 12,000 rpm at 4°C for 15 min. DNA pellet thus obtained was washed with 80% ethanol, dried and dissolved in 50 J.!l TE buffer (pH 8.0). Minipreps were screened by restriction digestion. 5 J.tl of plasmid DNA was incubated with 5 units of appropriate enzyme(s) and 150 units of RNaseT1 for 2 h and the products were analyzed on an agarose gel to identify the positive clones.
-
5 ml LB containing 100 J.tg/ml of ampicillin was inoculated with single. bacterial colony picked from the culture plates. The culture was grown for 12 h at 37 °C with vigorous shaking. Cells were harvested from 3 ml of culture by centrifugation at 3000 rpm in a microfuge (Plastocraft) at 4 °C for 15 min. Added 200 J.tl of TEG buffer was added to the cells, and tt.ey were gently resusupended to get a uniform suspension and kept on ice for 5 min. 400 J.tl of freshly prepared alkaline-SDS solution was added to the cell suspension and mixed well by inverting the tubes followed by an incubation on ice for 10 min. Subsequently, 300 J.ll of chilled potassium acetate solution was added and mixed thoroughly by vortexing. The mixture was centrifuged at I 0.000 rpm at 4 °C for 15 min.. The supernatant was collected and phenol-chloroform extraction was performed followed by precipitation
-
A control reaction was done with the control annealed DNA lacking the oligonucleotide. The constituents were mixed and incubated on ice for 2 min. afterwards, at room temperature, for 5 min. The reaction was further carried out at 37 °C for 2 h followed by heating at 70 °C for 10 min. 12.5 J.tl of the reaction products were analyzed on an agarose gel along with annealed samples to check the complementary strand synthesis. The samples were diluted I 0-times with water and 5 J.ll of the diluted sample was used to transform 50 J.ll of E. coli host strain, DH5a cells. The suspension was pl~!ed on 2 LB agar plates containing ampicillin. Single colonies were picked, grown in liquid culture and miniprep screening of DNA was done to select the positive clones.
-
Annealed DNA 10.0 J.ll I OX synthesis buffer 2.5 J.ll 1 OX ligation buffer 1.0 J.ll dNTP mix (100 mM) 1.0 J.ll ATP (100 mM) 0.25 J.ll ~ T7 DNA polymerase (5 U/J.tl) 0.5 J.ll T4 DNA ligase (400 U/J.tl) 0.5 J.ll H20 9.25 J.ll Total 25.0 J.l
-
Titration of uracil containing template: The crude preparation of the phagemid DNA (1 ml aliquot), was used to titrate the uridine incorporation in the template. The strains CJ236 (ung-duf) and DH5aF'(ung+ dut+) of E. coli were transformed with the diluted template DNA The CJ236 cells, plated in the presence of ampicillin and chloramphenicol while DH5aF' cells, plated in the presence of ampicillin alone, were grown overnight on LB agar plates. The good incorporation of uridine gave no colonies or very few colonies in DH5aF' cells whereas with CJ236 several colonies were obtained. A ratio of 103-104 between the number of colonies in CJ236 to that in DH5aF' cells was considered ideal for an efficient incorporation of uridine. Phosphorylation of the mutagenic oligonucleotide: The components of a standard reaction to carry out the phosphorylation are described below Oligonucleotide (180 nmoVml) 1.0 J.ll 1 OX Kinase buffer 2.5 J.ll 10mMATP 1.0 J.ll 10 mM spermidine 0.25 J.ll 100mMDTT 1.25 J.ll T4 polynucleotide Kinase 0.5 J.ll H20 18.5 J.ll Total 25.0 J.LI The constituents were . mixed thoroughly, incubated at 37 °C for 30 min. and subsequently, the enzyme was denatured by heat inactivation at 70 °C for 10 min. Annealing of the mutagenic oligonucleotide: 750 ng (approximately) of the uracil containing single stranded template and 1 J.L) of the phosphorylated· oligonucleotide were taken in IX annealing buffer making up the total reaction volume 20 J.LI. A control reaction, was also carried out simultaneously, lacking the oligonucleotide. The contents were mixed by vortexing and incubated at 95 °C for 10 min. in a water bath. The reaction mixtures were further incubated at 80 °C for I 0 min. in a heat block and the heat block was transferred to ambient temperature, cooled slowly to about 30 °C over a period of 30-60 min. Complementary DNA strand synthesis: The oligonucleotide annealed uracil containing template was used for complementary strand synthesis in the following reaction.
-
Site-directed mutagenesis was done according to the method employed by Kunkel et al., 1987. Preparation of Uracil containing phagemid: E. coli strain CJ236 was transformed with the required template DNA and grown on LB plates containing the antibiotics, ampicillin 100 Jlg/ml and chloramphenicol 30 Jlg/ml (stock solution made in alcohol). Further, the plates were incubated at 37 °C for 12 h and a single colony was picked from the center of the plate, inoculated in 5 ml LB containing ampicillin and chloramphenicol. The liquid culture was grown at 37 °C overnight with vigorous. shaking. About 500 Jll of the culture was diluted 40-times with LB containing ampici11in and chloramphenicol and grown at 37 °C with vigorous shaking (200 rpm) upto an OD600 of 0.25-0.3. The speed of shaker was reduced to 100 rpm and the culture was left for 30 min. for the F pilus to grow. Afterwards, it was infected with VCS Ml3 helper phage at an MOl of 1:20. The cells were grown for 30 min. in a stationary culture to allow the phages to infect, followed by slow shaking ( 100 rpm) for one hour. Subsequently, the culture was diluted 10-times with 2X YT medium containing ampicillin and chloramphenicol and grown in the presence of 0.25 Jlg/ml uridine and 50 Jlg/ml kanamycin at 37 °C overnight with vigorous shaking. The following day, the culture was chilled on ice for 10 min. and centrifuged at 12,000 rpm for 10 min. at 4 °C in a Sorvall RC5C centrifuge using a GSA rotor. The pellet was discarded and the supernatant was centrifuged again in fresh GSA bottles. A small aliquot of about 1 ml from the supernatant was saved for titration and the . precipitation of the single stranded phagemid was carried out using 0.15 volume of 16.67% PEG in 3.3 M NaCl followed by incubation on ice for 4 h. J'he mixture was centrifuged at 12,000 rpm at 4 °C for 30 min. using a GSA rotor and the pellet was resuspended in 3 ml TE buffer. The suspension was centrifuged at 15,000 rpm at 4 °C for 10 min. using a SS34 rotor. The supernatant was ultracentrifugated at 100,000 g at 4 °C for 2.5 h. The pellet was resuspended in 500 Jll TE buffer followed by phenol-chloroform extraction and precipitation of the single stranded DNA with ethanol for 30 min. at -70 °C. The DNA pellet was washed with 70% ethanol, dried and dissolved in 200 Jll TE buffer. The uracil containing template was quantitated by analysing on an agarose gel.
-
Transformation of the bacterial host with an appropriate plasmid was performed using the method of Mandel and Higa ( 1970). A vial of competent bacterial cells was thawed on ice. The plasmid DNA was added at a concentration 1 ng/25 Jll of competent cells and the mixture was allowed to stand on ice for 30 min. The cells were given a heat shock by incubating the mixture at 42 °C for 90 sec, followed by a 2 min. incubation on ice. The mixture was diluted 10-fold with LB and incubated at 37 °C for 1 h. Afterwards the cells were plated on the LB-agar containing the antibiotic whose resistance marker was present in the plasmid.
-
The pure PCR amplified product, and the vector were digested with required· restriction enzymes in the reaction buffer as per supplier's recommendation. Ten units of enzyme were used to digest I Jlg of DNA and the samples were incubated for three hours at appropriate temperature. The vector was dephosphorylated with calf intestinal phosphatase (0.2 units/Jlg of DNA) for 30 min. at 37 °C. After digestion, relevant fragments were gel purified in 15% PEG-8000-T AE solution as described by Zhen and Swank (1993). Ligation of the vector and insert DNA was performed in a reaction volume of 20 Jll using 400 units oi T4 DNA ligase in the recommended ligation buffer at 16 °C for 12 h. A control ligation reaction without the insert was also done keeping the other components same. The concentration of insert was eight to ten times more than the vector. The ligated sample and control mix was later used for transformation.
-
The reaction was started by an initial hot start at 94 °C for 5 min., followed by a three-step amplification cycle. The amplification cycle consisted of a 1 min. denaturation at 94 °C, followed by a 2 min. annealing at 48 °C and an extension at 72 °C for 2 min. The cycle was repeated 30 times and the reaction mixture was incubated at 72 °C for additional 7 min. to allow for primer extension. The PCR amplified product was separated from the primers on a 1% agarose gel. A well was carved ahead of the required fragment and filled with 15% PEG-T AE solution (Zhen and Swank, 1993). The DNA was electro-eluted in 15% PEG-TAE solution, and purified further by phenoVchloroform extraction and ethanol precipitation.
-
A standard PCR was set up as described below.
-
Competent cells of the different strains of E. coli were prepared as described by Cohen et al. ( 1972). An LB-agar plate was streaked with the desired strain, and a single colony was inoculated into 5 ml of LB medium. The culture was grown at 37 °C with continuous shaking at 200 rpm for 6 hours. A small inoculum from this culture was used to start a I 00 ml culture in the same medium. At an OD600 of 0.3-0.4, when the culture reached early Jog phase, it was chilled on ice for 30 min .. and centrifuged at 2000 g for 15 min. at 4 °C. The pellet was gently resuspended in 50 ml of chilled 50 mM calcium chloride and incubated on ice for 60 min. The cell suspension was centrifuged at 2000 g for 15 min. at 4 °C, and the pellet was gently resuspended in 5 ml of chilled 50 mM calcium chloride containing 20% glycerol. The competent cell suspension was immediately aliquoted in prechilled vials and stored at -70 °C.
-
Compositions of the different solutions used in this study are described in appendix.
-
Oligonucleotides used in this study were synthesized by Rama Biotechnologies (Hyderabad, India).
-
DNA restriction enzymes were purchased from New England Biolabs (Massachusetts, USA) and Life Technologies (Maryland, USA). Lysozyme and RNase A were obtained from Sigma. RNase Tl, DNA ligase, RNA polymerase, Taq DNA polymerase, lKb DNA ladder and prestained molecular weight markers for· proteins were obtained from Life Technologies (Maryland, USA). Other protein molecular weight markers were from Sigma chemical co. T4 polynucleotide kinase were purchased from Promega. T7 DNA polymerase was obtained from USB.
-
L-[3,4,5-3H (N)]-Ieucine (143Cilmmol), [35S]-dATPaS, 1251-Na (350mCilml) were obtained from Amersham (England, UK).
-
Cancer cell lines of human origin, HUT102, T-cell leukemia; K562, erythroleukemia; COL0205; colon adenocarcinoma; MCF7, breast adenocarcinoma; A431, epidermoid carcinoma; A549, lung carcinoma and HeLa, cervical carcinoma and J774A.I, mouse monocyte-macrophage; and L929, mouse fibroblast were obtained from ATCC. All the cell Jines were maintained in RPMI 1640 supplemented with antibiotic antimycotic solution, 2 mM glutamine and I 0% heat inactivated foetal calf serum (Life Technologies, Maryland, USA). E. coli strain DH5a was used for DNA manipulation, cloning and mutagenesis. Strains CJ236 and DH5aF' were used. for oligonucleotide mediated site directed mutagenesis. BL21 (A.DE3) strain containing T7 RNA polymerase gene under the control of lac promoter, was used for expression of the recombinant proteins.
-
acrylamide, TEMED were obtained from Bio-Rad laboratories (California, USA). Coomassie Plus protein assay reagent was purchased from Pierce (111inois, USA). All other chemicals were at least of analytical grade and were from Qualigens . laboratories (Bombay, India). HSA was from alpha therapeutic corporation (California, USA). Bacto-tryptone, yeast extract, and bacto-agar were obtained from Difco laboratories (Detroit, USA).
-
Agarose, ampici11in, ammonium acetate, ammonium persulfate, 1-acetyl 2-phenyl hydrazine, ~-mercaptuahanol, boric acid, calcium chloride, chloramphenicol, citric acid, coomassie blue 0250, creatine phosphate, creatine phosphokinase, DEPC, dialysis tubing, disodium hydrogen phosphate, dithioerythritol, dithiothreitol, DMPG, DOPG, DMPA, EDT A, ethidium bromide, glucose, glycerol, GSSG, guanidine hydrochloride, heparin, haemin., HEPES, IPTG, kanamycin, L-glycine, L-arginine, lithium chloride, magnesium acetate, magnesium sulfate, MES, PEG 8000, potassium acetate, potassium chloride, RNase free BSA, SDS, sucrose, sodium acetate, sodium dihydrogen phosphate, spermidine, sodium bicarbonate, sigmacote, Tris base, Triton X-100, urea and uridine were obtained from Sigma chemical Co. (St. Louis, USA). Trizol reagent, PCR buffer, magnesium chloride solution for PCR, RPMI-1640, leucine free RPMI, DMEM, trypsin, Fetal calf serum, antibiotic-antimycotic solution were purchased from Life Technologies (Maryland, USA). NTPs, dNTPs, cation exchange resins: S-sepharose and SP-sepharose were obtained from Pharmacia Biotech (Uppsala, Sweden). Bromophenol blue, xylene cyanol, acrylamide, bis
Tags
- Method-8-detail
- Method-10-detail
- Method-11-detail
- Method-9-detail
- Material-1-detail
- Method-22-detail
- Method-1-detail
- Method-18-detail
- Method-3-detail
- Method-14-detail
- Method-7-detail
- Method-4-detail
- Method-2-detail
- Material-3-detail
- Material-4-detail
- Method-16-detail
- Method-13-detail
- Method-5-detail
- Material-2-detail
- Method-15-detail
- Method-20-detail
- Method-19-detail
- Material-5-detail
- Method-12-detail
- Method-17-detail
- Method-6-detail
- Method-21-detail
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
r-bZP3 was arsanilated using a modification of the procedure of Nisnoff (1967). Briefly, arsanilic acid (100 mg) was dissolved in 5 ml of I M HCI. A IO ml stock of NaN02 (10 mg/ml) was also prepared fresh and added dropwise to the arsanilic acid solution while vortexing. Activation of arsanilic acid was checked on starch-KI paper. The ice cold activated arsanilic acid solution was added dropwise to the protein solution (5 mg of r-bZP3 in 100 mM PB, pH 7.4) stirring constantly in an ice water bath, while pH was maintained between 9.0 and 9.5 with 10 N NaOH. The protein solution was dialyzed extensively against I 00 mM PB having 4 M urea. Arsanilation of r-bZP3 was checked by ELISA using ars-r-bZP3 for coating ( 1 flg/well) and using a 1:100 dilution of murine anti-ars MAb, R 16.7 (Durdik et al., 1 989). Bound Ab was revealed using anti-mouse HRPO conjugate (I :5000). Three monkeys previously immunized with r-bZP3-DT conjugate (MRA-375, MRA-640 and MRA-672) and 2 naive monkeys (MRA-446 and MRA-670) were immunized at 2 intramuscular sites with 250 flg of ars-bZP3 conjugate using Squalene:Arlacel A ( 4: 1) as an adjuvant. Boosters were administered at intervals of 20 days and bleeds were collected I 0 days post immunization. Bleeds were analyzed by ELISA using r-bZP3 and ars-BSA for coating to determine anti-bZP3 and anti-ars Ab titres as described earlier.
-
administered as and when required. Animals were put on continuous mating with males of proven fertility after administration of the three primary injections and monitored for menstrual cyclicity and conception. Ab titres were determined as described above except that anti-monkey HRPO conjugate was used as the revealing Ab.
-
Female bonnet monkeys (Macaca radiata) reared at the Primate Facility (Nil, New Delhi) were selected and serum progesterone levels were estimated for atleast three months in samples which were collected biweekly. Animals showing atleast two consecutive normal ovulatory peaks (serum progesterone levels >2 ng/ml) (Bamezai, 1986) were selected for fertility trials. Five animals (MRA 375, 515, 640, 672, 770) immunized with 250 Jlg equivalent of r-bZP3, expressed in SG I3009[pREP4] cells, conjugated to DT, was emulsified with Squalene and Arlacel A, adjuvants permitted for human use, in a ratio of 4: I and administered intramuscularly at two sites. In addition, the primary dose also contained I mg/animal of SPLPS as an additional adjuvant. Animals were boosted at intervals of 4-6 weeks depending on the Ab titers with 250 Jlg of r-bZP3-DT using Squalene and Arlacel A as adjuvants. A second group of 3 monkeys (MRA 384, 502, 661) were immunized using a slightly different protocol. The primary immunization consisted of 125 J.lg of r-bZP3-DT and 125 J.lg of r-bZP3-TT (expressed in BL2I(DE3) cells) using the same adjuvants and immunization protocols mentioned above except that boosters were administered alternately with 250 Jlg of r-bZP3-DT or -TT conjugates using Squalene and Arlacel A as adjuvants. Following completion of the primary immunization and 2 boosters at monthly intervals, bleeds (1-2 ml) were collected biweekly from the antecubital vein for estimation of progesterone levels and Ab titres. Boosters were
-
Progesterone levels were estimated from sera of bonnet monkeys which were bled biweekly using a radioimmunoassay employing reagents and protocol as prescribed by the W.H.O. Matched Assay Reagent Programme (Sufi et al., 1983). Each sample was run in duplicates. Progesterone was extracted from serum (0.1 ml) by the addition of 2 ml of ice-cold ether in each tube and vortexing for 2 min. The tube was immersed in liquid nitrogen in order to flash freeze the serum phase and the unfrozen ether phase which contained the extracted steroid hormone was decanted into another tube. The ether was allowed to evaporate 0/N and 0.5 ml of steroid assay buffer (0.1 M PBS, pH 7 .3, 0. 1% thiomersal and 0.1% gelatin) was added to the tubes and the tubes were incubated at 40°C for 30 min. Steroid sticking to the walls of the tubes was recovered by vigorous vortexing. 100 J..LI of anti-progesterone Ab (at a dilution giving -50% binding of tritiated p.rogesterone in the absence of unlabelled competing progesterone) was then added to the tubes followed by addition of 0.1 ml of 3H-progesterone ( -10,000 cpm/tube). The mixture was incubated for atleast 16 hrs at 4oc. Unbound progesterone
-
was separated by addition of 0.2 ml of ice cold assay buffer containing 0.625% activated charcoal and 0.0625% dextran and incubated for 30 min at 4oc. This was followed by centrifugation at 2500 rpm for I 5 min at 4°C. The supernatant was carefully decanted into scintillation vials and 4 ml of scintillation fluid (0.4% 2,5 diphenoxazole; 0.01% POPOP [1-4 bis(5-phenyl-2-oxazolyl)benzene] in sulfur free toluene) was added and counted in a liquid scintillation beta counter (Beckman Instruments, California, USA). The amount of progesterone per ml of serum was calculated from a standard curve with known amounts of progesterone in each assay.
-
Human oocytes were washed twice with PBS containing 0.1 % BSA and then incubated with 1 :50 dilution of immune or pre-immune serum samples at RT for 30 min. Following washing with PBS (3 changes of 5 min each), the oocytes were treated with goat anti-rabbit Ig-FITC conjugate for 30 min at RT. After washing with PBS, the treated oocytes were mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
In addition, cryosections of an ovary from a normal cycling female (10 years) were also processed. Sections passing through a follicle were selected, washed in PBS and blocked for 30 min in 5% normal goat serum. The sections were incubated at 37°C with 1 :250 dilution of rabbit pre-immune and immune sera for 1 h, washed with PBS and incubated for 1 h with 1 :2000 dilution of goat anti-rabbit lg-FITC conjugate. Slides were washed with PBS and mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
A 3 year old monkey was treated daily for 3 days with an intramuscular injection of 25 IU of PergonaJ® (Laboratoires Serono S.A., Aubonne, Switzerland). The monkey was ovarectomized on day 6, and the ovary was snap frozen in liquid nitrogen and sections of 5 J..Lm thickness were cut in a cryostat at -20°C and fixed for 20 min in chilled methanol.
-
Porcine ZP3a. and ZP3P prepared as described previously (Yurewicz et al., 1987) and purified r-bZP3 were tested for their reactivity with rabbit anti-r-bZP3 Ab in the immunoblot by the same procedure as described above except that goat anti-rabbit Ig-HRPO conjugate was used.
-
Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0
-
administered at two sites. In addition, the primary dose also contained 500 J..Lg of SPLPS as an additional adjuvant. This was followed by 2 booster at 4 weekly intervals with an equal amount of r-bZP3-DT conjugate.
-
Female New Zealand White rabbit (Small Animal Facility, National Institute of Immunology, New Delhi, India), 6 months of age was immunized intramuscularly with r-bZP3-DT conjugate equivalent to 125 Jlg of r-bZP3 (expressed in SG13009[pREP4] cells) in 0.9% saline emulsified with Squalene and Arlacel "A" in a ratio of 4: I and
-
For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.
-
Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).
-
Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.
-
Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.
-
Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.
-
For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.
-
The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.
-
Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.
-
Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
-
AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.
-
650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.
-
The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at
-
(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
-
Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
-
Peptide antisera were generated in the laboratory against peptides PI, 23-45 aa residues with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVL VE), P2, 300-322 aa residues (CSFSKSSNSWFPVEGPADICQCC) and P3, 324-347 aa residues (KGDCGTPSHSRRQPHVVSQWSRSA) corresponding to bZP3 precursor protein in rabbits and were used to determine their reactivity with the r-bZP3 protein expressed in E. coli in an enzyme linked immunosorbent assay (ELISA). Microtitration plates were coated with 200 ng of r-bZP3 or I J.tg/well of the peptide. HRPO conjugated goat anti-rabbit Ig at I :5000 dilution was used as revealing Ab.
-
E. coli strains deficient in specific proteases were used to study their influence on the expression of r-bZP3. BL21 (DE3) and BL21 (pLysS) deficient in ompT and ion proteases and DF5 carrying a targeted mutation of the ptr gene, were transformed with the pQE-bZP3 plasmid. Colonies obtained were grown 0/N and subcultured next morning and grown till A6oo=0.7. Cultures were then induced with 0.5 mM IPTG for 3 h. Harvested cells were checked by SDS-P AGE and immunoblotting.
-
Conditions for expression of r-bZP3 in SG 13009[pREP4] cells transformed with the pQE-bZP3 plasmid were standardized. Cells were grown till A6oo=0.7 and induced with different concentrations of IPTG (0.5, 1, 2, or 4 mM) for a constant time period (3h) or induced with a 0.5 mM IPTG for different time periods (0, 1, 2, 3 or 5 h). Cells were harvested and analyzed by SDS-PAGE and immunoblot as described above.
-
The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.
-
The pQE-bZP3 plasmid was transformed in Ml5[pREP4] and SG13009[pREP4] bacterial strains provided with the kit. The transformed colonies were analyzed for expression. A single transformed colony was inoculated and grown overnight at 37oc in 1 ml of LB containing 100 J..Lg/ml of ampicillin and 25 J..Lg/ml of kanamycin. Cells were subcultured 1:10, next morning and grown until cell density reached an A600 of approximately 0.6-0.7. The cells were further grown in the presence of isopropyl P-D thiogalactopyranoside (IPTG) to induce expression of the fusion protein under the T -5 promoter. The cells were collected by centrifugation at 13,000 g for 60 sec and the resulting pellet was stored at -700C until used.
-
vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
-
Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B
-
The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).
-
Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.
-
centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.
-
A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,
-
mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.
-
Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents
-
E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.
-
The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and
-
Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.
-
Radioisotopes: dCTP[a-32p] (3000 Ci/mM), dATP[a_35s] (1250 Ci/ mM) and 35s Met (I 000 Ci/ mM), were procured from NEN Life Sciences Products, Boston, MA, USA Others: Ni-nitrilo-tri-acetic acid (NTA) affinity resin from Qiagen; Membranes for Western blotting were obtained from BioRad; Hybond N and X-ray films were from Amersham; DNA and protein analysis softwares, PCgene from IntelliGenetics, Inc., Mountain View, CA, USA and Lasergene from DNASTAR Inc., Madison, Wisconsin, USA; Ultrafilteration assembly and YM5 membranes from Amicon Corp., Lexington, MA, USA.
-
from Gibco BRL; ampicillin, kanamycin and neutral red were from Sigma; FCS, was obtained from Biological Industries, Hibbutz Beit, Haemek, Israel. Bacterial Strains and Plasmids: M15[pREP4] and SG13009[pREP4] from Qiagen GmbH, Hilden, Germany, DH5a, BL21 (DE3) and BL21(pLysS) from Stratagene, La Jolla, USA, DF5 cells were kindly provided by Prof. K. Dharmalingam, Madurai Kamraj University, Madurai, Tamil Nadu, India. pBluescriptll SK( +) vector from Stratagene, pQE30 from Qiagen, pBacPAK8 vector from Clonetech Laboratories Inc., Palo Alto, CA, USA and pAcSecG2T vector, from Pharmingen, San Diego, CA, USA were obtained. Kits: Poly AT® tract mRNA isolation system and Riboclone® eDNA synthesis system from Promega Inc.; Geneclean® II kit from Bio 101 Inc., La Jolla, USA;Plasmid Midi kit and QIAexpress™ from Qiagen GmbH, Hilden, Germany; Sequenase version 2.0 DNA sequencing kit and Multiprime DNA labeling system from Amersham, Little Chalfont, Buckinghamshire, UK; BacPAK™ baculovirus expression system from Clonetech and Baculogold™ transfection kit from Pharmingen. Primers: Various oligonucleotide primers used were custom made by Rama Biotechnologies India Pvt. Ltd., Secunderab_ad, AP, India. Enzymes: Various restriction enzymes used and Vent DNA polymerase were procured from New England Biolabs, Beverly, MA, USA. Taq DNA polymerase was obtained from Stratagene. Antibodies and Conjugates: Goat anti-GST Ab was obtained from Pharmacia Biotech, Uppsala, Sweden. The following secondary revealing Abs were used: i) goat anti-mouse immunoglobulin G (lgG)-horse radish peroxidase (HRPO) from BioRad; ii) goat anti-rabbit IgG-HRPO (Pierce Chemical Co.); iii) goat anti-monkey IgG-HRPO (Sigma); iv) anti-rabbit-FITC and v) anti-goat-HRPO (Reagent Bank, Nil, New Delhi) vi) anti-mouse FITC (Dakopatts a/s, Glostrup, Denmark).
-
Chemicals: Tris, glycine, acrylamide, N', N'-methylene bisacrylamide, sodium dodecyl sulfate (SDS), N', N', N', N'-tetramethylethylene diamine (TEMED), ammonium persulfate (APS), ~-mercaptoethanol (BME), 4-chloronaphthol, urea, guanidine HCl, guanidine isothiocyanate (GITC), sarcosyl, sodium citrate, phenol, ficoll, polyvinylpyrrolidone (PVP), agarose, bromophenol blue, Coomassie brilliant blue, ethidium bromide, calcium chloride and bicinchoninic acid (BCA) were obtained from Sigma Chemical Co., St. Louis, MO, USA. LMP agarose and isopropyl ~-D thiogalactopyranoside (IPTG) were from Amresco, Solon, USA. Molecular weight standards were obtained from Gibco-BRL, Grand Island, NY, USA, or Bio-Rad Laboratories, Hercules, CA, USA. Reagents for enzyme immunoassays viz., bovine serum albumin (BSA), orthophenylene diamine (OPD) were procured from Sigma, while Tween-20 was obtained from Amresco. Reagents for conjugation and immunization, viz. diphtheria toxoid (DT) and tetanus toxoid (TT) were from Serum Institute, Pune, India while glutaraldehyde, L-lysine, 2, 6, 10, 15, 19, 23-hexamethyl-2, 6, 10, 14, 18, 22-tetracosa-hexane (Squalene) and mannide monooleate (Arlacel A) were procured from Sigma; Pergonal® was obtained from Laboratoires Serono S.A., Aubonne, Switzerland; Sodium phthalyl derivative of lipopolysaccharide (SPLPS) was kindly provided by the lmmunoendocrinology Laboratory, National Institute of Immunology (Nil), New Delhi. Reagents used in the estimation of progesterone such as gelatin, charcoal, dextran, 3H-progesterone and anti-progesterone Ab were provided by the WHO Matched Reagent Assay Programme while diphenoxazole (PPO), 1-4 bis (5-phenyl-2-oxazolyl) benzene (POPOP), and mercury-[(o-carboxyphenyl)thio]ethyl sodium salt (Thimerosal) were obtained from Sigma. Media and Antibiotics: Bacto-tryptone, bacto yeast extract and bacto agar were from Difco Laboratories, Detroit, USA; Grace's insect cell medium and antibiotic-antimycotic
Tags
- Method-3-Method-2-detail
- Method-3-Method-9-detail
- Method-2-Method-3-detail
- Method-1-Method-2-detail
- Method-1-Method-1-detail
- Method-4-Method-6-detail
- Method-4-Method-1-detail
- Method-2-Method-6-detail
- Method-4-Method-7-detail
- Material-1-detail
- Method-3-Method-7-detail
- Method-3-Method-detail
- Method-4-Method-4-detail
- Method-1-Method-4-detail
- Method-1-Method-5-detail
- Method-2-Method-8-detail
- Method-2-Method-2-detail
- Method-3-Method-1-detail
- Method-3-Method-4-detail
- Method-3-Method-6-detail
- Method-1-Method-3-detail
- Method-4-Method-3-detail
- Method-3-Method-5-detail
- Method-2-Method-5-detail
- Method-3-Method-3-detail
- Method-2-Method-1-detail
- Method-1-Method-7-detail
- Method-1-Method-6-detail
- Method-4-Method-2-detail
- Method-4-Method-9-detail
- Method-4-Method-8-detail
- Method-1-Method-8-detail
- Method-3-Method-10-detail
- Method-4-Method-5-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
~hCG and HBsAg sequences were accessed from GenBank or NBRF database on a Microvax II computer and sequence analysis performed using the HPLOT and AMPHI programmes. HPLOT is based on the algorithm of Kyte and Doolittle ( 1982 ) and plots the hydrophobic and hydrophilic segments of the protein by scanning the whole length of the sequence in blocks of a few residues. The window size used was 6 amino acids. AMPHI is based on the algorithm of Margalit et al., ( 1985 ) and predicts the amphipathic segments of the proetin which correspond to alpha helices and are therefore, likely candidates for being T cell epitopes.
-
for 3 hours at room temperature or OIN at 4 °c. The excess antibody was washed by washing the filters with PBST for 15 minutes with at least three changes. The filters were subsequently incubated in the appropriate dilution of the second antibody for one hour at room temperature. Dilutions of the primary as well as secondary antibody were made in 3 % BSA in PBST. Following incubation with the second antibody, the filters were washed vigorously with PBST for 5 minutes. The washing was repeated 5-6 times. Finally, the filters were washed twice in PBS and colour developed with DAB ( 0.5 mg I ml in PBS ) containing 6 ul I 10 ul of 30 % H2o2. The colour reaction was stopped after 5 -10 minutes by washing the filters with distilled water.
-
apparatus. At the end of the run, the gel was equilibrated for 15 minutes in the transfer buffer ( 25 mM Tris base,, 192 mM glycine, 20% V/V methanol). Immunoblotting was performed essentially as described by Towbin et al., 1979 ) . The proteins-were blotted on to nitrocellulose Schleicher and Schuell ) for 16 hours in LKB Transphor apparatus. After the completion of electric transfer of proteins, the nitrocellulose paper was washed with PBS 10 mM sodium phosphate buffer, pH 7.4, 0.9 % saline for 10 minutes at room temperature, with gentle rocking to wash off any adhering traces of acrylamide gel. The filter was then stained with a dilute solution of amide black. This was made by diluting 5 fold with water, a solution of 0. 2 % ami do black containing 45 % v;v methanol and 10 % v;v acetic acid. The staining was done for 5 10 seconds and the filter washed immediately with distilled water. The proteins transferred to the gel could be seen at this stage. The lane containing protein molecular weight standards was cut out and . preserved by drying and storage in dark. The filter could be cut into appropriate lanes at this stage. The filter was destained by repeated washing with PBS containing 0.2 % Tween-20 ( PBST ) . After the filter destained completely, it was incubated with 3 % BSA made in PBST for 1 hour at room temperature. During this and in all the subsequent steps, incubation of the filter was performed on a rocker platform to ensure a uniform treatment. The filters were then incubated in the appropriate dilution of the primary antibody
-
Electrophoretic separation of protein samples was carried out on 12.5 % SDS-PAGE in a discontinuous system as described by Laemmli ( 1970 ). The samples were reduced by boiling for 3 minutes in sample buffer containing J3-mercaptoethanol. The samples were then centrifuged for 5 minutes at 10,000 rpm to pellet down all particulate matter, prior to loading on the gel. Electrophoresis was carried out at 100 volts in a LKB vertical slab gel electrophoresis
-
The culture supernates containing the assiociated hCG heterodimer as described above, were tested for their ability to inhibit hCG induced testosterone production by Leydig cells. Leydig cell suspensions were prepared from NMRI inbred adult male mice essentially by the procedure of Van Damme et al., 1974 with modifications. The procedure has been described previously Pal, 1989 and involved the measu~ement of the testosterone produced by the Leydig cells following stimulation with culture supernate containing the associated alpha and beta subunits of hCG.
-
then estimated by monitoring its competitive binding to the hCG recepto~ in the presence of radiolabelled hCG. The testes homogenates from 10 -14 week old Wistar outbred rats were prepared by the method of Dighe and Moudgal ( 1983 ), and the receptor assay 1975 ), with 1989 ) .
-
Culture supernate from stable clones secreting alpha hCG was mixed with the culture supernate from stable clones showing J3hCG activity. The mixing was done with shaking at 37°C for 16 hours, to allow the two subunits to associate. The presence of the heterodimer in the culture supernate was
-
The RIA for alpha hCG was similar to that used to estimate ~hCG. A monoclonal antibody specific to alpha hCG ( Gupta et al. , 1985 was used for the assay. The standard used was total hCG.
-
added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.
-
J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was
-
Quantitative determination of alpha hCG or J3hCG was performed by RIA using subunit specific antisera.
-
conjugated to fluorescene isothiocyanate ( FITC ) or horse radish peroxidase HRP ) , added. In case of the FITC staining, the cells were finally mounted in a medium containing 0. 1 % para-phenylenediamine PPD and 90 % glycerol in NKH buffer, to retard fading of the fluorescent label. In case of HRP staining, the colour was developed with 0. 05 % DAB ( 3', 3-diaminobenzidine tetrahydrochloride ) in NKH buffer with 0. 002 % hydrogen peroxide. The colour was developed for 15 mins. and the reaction stopped by rinsing in phosphate buffer. The cells were examined under a standard 1 ight microscope for HRP staining or a fluorescent microscope ( for FITC staining ) .
-
Cells were grown to subconfluence on polylysine coated glass coverslips contained in plastic dishes. After washing with NKH buffer ( 145 mM NaCl, 5 mM KCl, 15 mM Hepes, pH 7. 4 ) , the cells were fixed for 10 mins. in 70 % ethanol at room temperature. The cells were again rinsed extensively in NKH buffer and the appropriate dilution of primary antibody added. Following OIN incubation at 4°c, the cells were washed 3 X with NKH buffer and the appropriate second antibody,
-
Following transfection with calcium phosphate or lipofectin, the cells were selected for neomycin resistance by using the analogue G418 Geniticin in the culture medium. After 48 ·hours post -transfection, the cells were harvested and replated at a lower density ( 0.5 x 104 cells I 60 mm dish). Culture medium containing G418 was then added to the cells. G418 was used at two concentrations -400 ug I ml and 500 ug 1 ml. The cells were cultured in G418 containing medium for 2 - 3 weeks. During this period, the mock transfected cells and the cells transfected with plasmid lacking neo gene, died and the transformed cells formed colonies. Individual G418 resistant colonies were picked up and propagated as independent clones. The culture supernates from these clones were analysed by RIA for BhCG. The stability of the BhCG secreting clones was assessed by culturing with several passages over a few weeks in media with or without G418.
-
Lipofectin was kindly provided by Syntex, Inc., USA as an aqueous solution containing 1 mg I ml of 1 ipid ( DOTMA DOPE; 50 50 ). The procedure used was as described by Feigner et al., 1987 with appropriate I modifications as suggested in the user s notes. Lipofection was done with 0.5 x 106 cells seeded on a 60 mm plate. For each plasmid, the lipofection was performed in duplicate. The amount and quality of the plasmid DNA used ranged from 400 ng of crude DNA prepared by the mini prep method, to 5 ug of highly purified, cesium banded DNA. The appropriate amount of DNA was suspended in 1.5 ml of serum free DMEM. In another tube, 30 ug of lipofectin was suspended in 1.5 ml of serum free DMEM. The two solutions were mixed. The cells were washed twice with HBSS to totally wash off all traces of serum. The DNA 1 lipofectin mix was then applied to the cells and the cells incubated for 4 hours at 37°C. Next, 3 ml of media containing 10 % FCS was added and the incubation continued at 3 7°C for 16 hours. The culture supernate was then aspirated off and fresh medium added to the cells. The selection for stable clones was started after 48 hours by the procedure described below.
-
PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.
-
Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with
-
Stable transfection was performed into CHO-K1 cells by the following procedures
-
rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.
-
ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were
-
1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass
-
Transient expression of the cloned gene product was studied by transfection performed with
-
with glutamine. Rat-2 and FWIL cells were cultured in IMDM supplemented with glutamine. All media were supplemented with 10 % fetal calf serum~ The cells were maintained in a 5 % co2 atmosphere and were split after 72 hours in culture, at a ratio of 1 : 15 approximately. For splitting the adherent cells, the cells were washed once with HBSS and 0.1 % trypsin in PBS added to the cells. The flask was shaken briefly to ensure a uniform distribution of trypsin over the cells. The cells were incubated in trypsin for 1 - 2 minutes after which 2 ml of FCS was added to the cells to inactivate the trypsin. The trypsin was carefully aspirated from the flask and fresh culture medium was added into the flask. The cells were dislodged from the bottom of the flask by gently tapping the flask against the working bench. Alternately, the cells were resuspended by vigorous pipetting up and down of the medium. The cells were centrifuged at 1500g for 5 minutes at room temperature and the supernate was discarded aseptically. The cells were resuspended in a known volume of fresh culture medium, an aliquot counted on a haemocytometer, and then accordingly seeded at the desired density in a fresh flask. For long term storage, the cells were frozen in a mixture of 95 ~ 0 culture medium and 5 ~ 0 DMSO in liquid nitrogen.
-
eHO-Kl cells were cultured in Ham s F-12 med1a. NIH3T3, mouse LMtk-and HeLa cells were cultured in DMEM supplemented
-
transferred to another plastic box containing 2 X sse, 1 % SDS and washed at room temperature by gentle rocking for 15 minutes. The buffer was then changed and the washing continued at 60 in a shaking water bath for 30 minutes. Depending on the homology between the probe and the immobil ised DNA, the washing conditions were varied. The stringency ranged from 1 X sse, 1 % SDS, at 65°e to 0.2 X sse, 1 % SDS, at 65°e. After the washing, the filters were immediately sealed into plastic bags and put for autoradiography. Special care was taken to not to allow the filters to dry during any stage which might otherwise cause permanent binding of the probe to the filter preventing the reprobing of the same filter with a different probe at a later time. For autoradiography, the plastic bag containing the washed filter was fixed on a 3 MM Whatman sheet and placed securely ins ide a X ray cassette with one or two intensifying screens, and a X -ray film was placed over the filter in a dark room. The cassette was kept at -7o0e for the desired length of exposure. The film was taken out in the dark room, developed for approximately 3 minutes, washed in water for one minute to wash off all the developer adhering to the film, and fixed for 5 minutes. Finally, the film was washed in cold water for 10 minutes and air dried
-
The prehybridisation and hybridisation of the Southern filters was carried out as described by Maniatis et al., ( 1982 ), with some modifications. In all stages, the SDS concentration was maintained at 1 % to minimise the background likely to occur on the nylon membrane. Prehybridisation was done at 68°C, for 4 - 6 hours, with 0.1 ml of prehybridisation buffer for each square centimeter of the membrane. The probe was denatured by immersing the eppendorf tube in a boiling water bath for 10 minutes and added directly to the bag containing prehybridisation mix. Hybridisation was done in aqueous system, at 68°e, without the use of formam ide, for 18 - 2 4 hours, in a plastic bag kept submerged in a water bath, without any shaking. At the end of hybridisation, the filter was taken out of the bag and quickly immersed in a plastic box containing 5 X sse, 1 % SDS at room temperature. After 15 minutes, the filter was
-
hours. The NC filters having bound DNA liberated from bacterial colonies, were set up for hybridisation with radioactive probes as described by Maniatis et al., ( 1982 ). The filters were washed thoroughly with a solution containing 50 mM Tris.Cl, pH 8.0, 1 M NaCl, 1 mM EDTA, 1 % SDS, at 42°C, for 1 hour, to wash off any residual bacterial debris and agar etc. Prehybridisation and hybridisation was performed in aqueous solution without formamide in 5 X SSPE. The filters were washed up to a stringency of 0.2 X sse at 65°e.
-
Colonies bound to nitrocellulose filter ( NC ) were lysed to liberate the DNA which was hybridised as described by Maniatis et al., 1982 ) . To obtain sharper autoradiography signals, the nitrocellulose filter bearing colonies was first overlaid on a 3 MM Whatman paper impregnated with 10 % SDS till the NC wetted evenly. The NC was peeled off and overlaid on another 3 MM paper impregnated with the denaturing solution. In this manner, the NC was successively treated with denaturing and neutralising solutions. Finally, the NC filter was air dried, sandwiched between two sheets of 3 MM paper and baked at 80°C for two
-
eppendorf tube was put at the bottom of the column to collect the eluate. The column was respun as before and the purified probe collected in the eppendorf tube, the unincorporated nucleotides remaining within the column. One ul aliquot from the purified probe was diluted 100 fold, mixed well and 1 ul aliquots were put in triplicate into 3 ml scintillation fluid containing vials which were counted in a Beckman Liquid Scintillation Counter. The total radioactivity of the probe was calculated by multiplying the mean radioactivity of the three diluted samples with a factor of 104 ( dilution factor, 102, total reaction volume, 102 ). The specific activity of the probes ranged from 1 X 107 to 5 x·1o7 cpm 1 ug DNA. The probe purified by the above method did not require any further purification.
-
The nick translated probe was purified by a spun column procedure to remove the unincorporated nucleotides. A sterile 1 ml syringe was plugged at the lower end with siliconised glass wool. The syringe was then filled with Bio-gel P-4 Bio Rad Laboratories, USA ) equilibrated in advance with TE. For doing this, 30 grammes of Bio-gel P-4 was slowly added into 250 ml of TE ensuring a good dispersion of the powder. This was then autoclaved at 15 psi for 20 minutes. After cooling, the supernate was decanted and replaced with an equal volume of sterile TE. The slurry was stored at 4°C. The slurry was poured upto the 1 ml mark in the syringe. The syringe was placed into a centrifuge tube and spun at 2000 · rpm for 3 minutes. The column was packed by repeating this process till the packed column volume reached 1 ml mark. Next, 50 ul of 2 mg 1 ml denatured salmon sperm DNA was loaded as carrier and the column spun as before. 100 ul of TE was then added to the column and it was respun as before. Finally, the nick translation reaction was diluted to 100 ul with TE and loaded on to the column. A sterile 1.5 ml
-
400 ci 1 mmole to 3000 ci 1 mmole. The nick translation reaction was set up as recommended by the manufacturer of the kit, using about 0.5 ug DNA. The reaction was incubated at 12 -14 °C for 90 minutes, except in the case of small fragments ( 500 bp ) when the reaction was incubated for 45 minutes only. The reaction was terminated by the addition of stop buffer supplied with the kit.
-
DNA was labelled using the nick translation kits supplied by BRL or NEN, USA, or Amersham, UK. The 32P-deTP was from either NEN or Amersham, UK, at a concentration of 10 mei I ml. The specific activity of the label ranged from
-
Following electrophoretic resolution of total RNA, the gels were blotted on to GeneScreen membrane as described by Maniatis et al., 1982 ) .. The RNA gel to be used for blotting was not stained with ethidium bromide. The blotting was performed in 20 X sse or 20 X SSPE, OIN.
-
bands seen in the DNA size marker, were marked with a ball -point pen at the places where small holes had been pierced in the gel earlier ( see above ). Thus it was easy to monitor the size of the fragments showing hybridisation to the probe. The gel was then peeled off and the membrane w~shed in 6 X sse with gentle rocking for 10 minutes to wash away any residual agarose sticking to the membrane. After air drying at room temperature, the membrane was baked at so0e for two hours. The baked filter was stored at room temperature in a dessicator, if not used immediately. The dehydrated gel was restained in water containing 0.5 ug I ml ethidium bromide for 30 minutes and examined on a short wave UV transilluminator to check for the presence of any DNA fragments that escaped blotting. The absence of any residual bands indicated that the transfer was complete.
-
Restriction fragments of DNA resolved on agarose gel were transferred to nylon membrane ( GeneScreen or GeneScreen Plus by the capillary blotting procedure of Southern ( 1975 ) as described by Maniatis et al., ( 1982 ) . After the completion of electrophoresis, the gel was stained and photographed as described earlier. Position of the various bands obtained in the DNA size marker lane were marked by piercing small holes at the two ends of each band in the gel with a yellow tip. The gel was then denatured, neutralised and blotted essentially as described by Maniatis et al., ( 1982 ) . Locally available coarse absorbent paper was used to make the paper towels of the appropriate size. In case of genomic DNA from mammalian cells, the agarose gel was first treated with 0.25 M HCl for 10 minutes, followed by the rest of the procedure as mentioned above. The transfer buffer was 20 X SSPE in all cases. To prevent the absorption of fluid from the 3 MM paper under the gel directly to the blotting paper atop the nylon membrane, the gel was surrounded with polythene sheets to minimise the direct contact between the blotting paper and the 3 MM paper placed under the gel. The blotting was performed for 18 -24 hours. After the transfer was over, the paper towels and the 3 MM papers on top of the nylon filter were peeled off. The gel along with the attached membrane, was turned over and kept on a clean sheet of 3 MM paper with the gel side up. The position of the gel slots was marked with a ball -point pen. Also, the positions of the
-
Colony lifts were performed essentially as described by Maniatis et al. , 1982 ) . Recombinant colonies were grown 0/N at 37°C to have well separated colonies. The colonies were overlaid with 80 mm diameter nitrocellulose filter circles BA 85, S & S and after the filter became wet throughout, it was peeled off in a single, smooth motion, avoiding the smearing of the bacterial colonies. The plate was reincubated at 37°C for a few hours to regenerate the colonies. The colonies transferred to the filter were lysed to bind the liberated DNA to the nitrocellulose.
-
lysed directly in 1. 5 ml of solution D ( 4 M guanidium thiocyanate, 25 rnM sodium citrate, pH 7.0, 0.5 % sarcosyl and 0.1 M 2-mercaptoethanol ) . For every 2 ml of the lysate, 0.2 ml of chloroform was added, followed by vigorous mixing for 15 seconds, and incubation on ice for 15 minutes. The lysate was spun at 12, OOOg, at 4 °c for 15 mins. , and the aqueous phase transferred to another tube. RNA was precipitated with an equal volume of isopropanol and incubation at -2o0c for 45 mins. The samples were then spun at 12,000g for 15 mins. at 4°c, and the supernate discarded. The RNA pellet was washed twice with 75 % ethanol. Finally, the pellet was dried briefly under vacuum for 10 -15 mins. and dissolved in 0.5 % SDS. All chemicals and glassware used for handling RNA were treated with diethylpyrocarbonate ( DEPC ) .
-
Total RNA was isolated from cultured mammalian cells by the method of Chornczynski and Sacchi ( 1987 ), with slight modifications. Briefly, cells from a 3.5 ern petri-dish were
-
From an 0/N grown culture, 1 ml cells were pelleted in a 1.5 rnl eppendorf tube. The cells wer~ washed once with 100 ul of solution I ( 50 rnM glucose in 25 rnM Tris. HCl ,· pH 8. 0 ) . The cells were pelleted again and resuspended in 70 ul of solution I. To this, 20 ul of a freshly prepared solution of lysozyme 10 rng 1 ml in distilled water was added. The tube was vortexed to mix the contents and incubated in ice for 5 minutes. Next, 10 ul of 0.1 M EDTA, pH 8.0, was added, vortexed and the tube incubated in ice for 5 minutes. Next, 200 ul of solution IV ( 0.2 N NaOH + 1 % SDS was added, the contents vortexed quickly but briefly to mix and incubated in ice for 5 minutes. Finally, 150 ul of 5 M potassium acetate, pH 4. 8 was added and the tube incubated in ice. After 60 minutes, the tube was centrifuged for 10 minutes at 10,000 rpm, at 4°C. 450 ul of the supernate was removed to another tube and DNA precipitated with two volumes of ethanol at -7 0°C for 15 minutes. The DNA pellet was collected by centrifugation and after draining off the supernate, the pellet was washed with 80 % ethanol. The pellet was dried briefly under vacuum and finally resuspended in 150 ul TE. From this, a 10 ul aliquot was used for checking on gel or for•setting up digestions with restriction endon~cleases.
-
Transformation was performed in chilled 1.5 ml eppendorf tubes, using 200 ul of competent cells and about 50 ng of ligated plasmid DNA. Frozen competent cells were thawed in ice and the DNA was added immediately after thawing. The DNA volume was always kept under 30 ul. The DNA was mixed well with the cells by gentle tapping, and the tube incubated in ice for 3 0 minutes with occasional gentle shaking. The tube was then immersed in a 42°C water bath for 2 minutes, to give a heat shock to the cells. The cells were then incubated in ice for 10 minutes. Next, 1 ml LB was to the cells, and the cells incubated in a 37°C water bath without shaking, for one hour. 50 ul aliquots were plated in triplicate from the transformed cell mixture on suitable antibiotic containing agar plates and incubated 0/N at 37°C to select the transformants. In case of JM105 cells, the transformed cells were plated on antibiotic containing agar plates on which 50 ul of 2 % X-gal ( made in dimethyl formamide ) , and 10 ul of 100 mM IPTG had been spread in advance, to select for the lac-phenotype. The lac-colonies appeared colourless while the lac+ colonies were blue. For each batch of transformations, a negative control was included in which no DNA was added to the cells while keeping the rest of the procedure the same as for the test transformations.
-
were stored at -70°C for at least six months without any significant loss in the competence.
-
A single ~.coli colony taken from an agar plate was used to inoculate 10 ml of LB and incubated 0/N at 37°C in an incubator-shaker. Next day, 0. 5 ml of this freshly grown culture was used to inoculate 100 ml of LB in a 500 ml flask. The culture was incubated at 37°C in an incubator -shaker and absorbance of the growing culture was monitored at 620 nm. When the A620 reached 0. 4 -0. 5 ( in about 120 -150 minutes), the flask was rapidly chilled by shaking in ice. The cells were harvested in sterile, chilled centrifuge bottles at 4, ooog for 10 minutes at 4 °c. The pellet was gently resuspended in 50 ml sterile, ice cold 100 mM cacl2 and the cells incubated in ice for 30 minutes. The cells were again centrifuged as above and the pellet resuspended in 6.5 ml of sterile, chilled, 100 mM cac12 containing 15 % glycerol. The cells were resuspended very gently, and a 200 ul aliquot was transformed with a standard plasmid DNA to check the competence of the cells. Meanwhile, the rest of the competent cells were incubated in ice for 16 -18 hours, to increase the competence of the cells a further few fold. After ascertaining high transformation efficiency of the competent cells, the cells were dispensed as 200 ul aliquots into prechilled, sterile 1.5 ml eppendorf tubes. These cells
-
All glassware I plasticware used for transformation procedure was sterile and prechilled.
-
minigel alongwith unligated vector to test the ligation. The ligated DNA was used to transform competent ~.coli cells.
-
Wherever possible, the cloning of DNA fragments was achieved by ligation of compatible sticky ends generated on the vector as well as the insert by digestion with the same enzyme. Self ligation of the linearised vector with compatible sticky ends was minimised by dephosphorylation of the vector DNA using bacterial alkaline phosphatase. The ligation conditions for each batch of T4 DNA ligase were standardised using Hind III generated fragments of lambda DNA as a test sample for sticky end ligation. Routinely, 200 ng of vector DNA was mixed with 2 - 5 fold molar excess of the insert fragment DNA, 2 ul each of the 10 X ligase buffer 500 mM Tris. HCl, pH 7. 5, 100 mM Mgcl2 ) , 10 mM ATP, and 200 mM DTT. The final reaction volume was adjusted to 15 - 2 0 ul with sterile double distilled water, and 0.5 - 1 ul of T4 DNA ligase ( 103 units I ml ) was added. The contents were mixed well and incubated at 13°C for 12 -16 hours. An aliquot of 2 ul was electrophoresed on a
-
a 1.5 ml eppendorf tube and the gel slice put into the paper cone. The tube was centrifuged for 10 minutes at room temperature, to elute the DNA into the filtrate. The filtrate was extracted with one volume of phenol I chloroform ( 1:1 vlv ) , and the DNA precipitated from the aqueous phase by the addition of 5 M NaCl to a final concentration of 1 M, and 2 - 3 volumes of ethanol at -20°C, for a few hours. The centrifuged DNA pellet was dissolved in an appropriate volume of TE.
-
After digestion of the plasmid DNA with appropriate restriction enzymes, the DNA fragments were resolved by electrophoresis on preparative agarose gels of a suitable percentage, and stained with ethidium bromide as described above. Depending upon the amount of DNA to be resolved on the gel, the size of the sample well varied from 1.5 em - 5 em x 0.3 em, such that the desired fragment could be cut out with a minimum of agarose accompanying it. The DNA bands were visualised under long wave UV ( 366 nm ), using a hand held monitor model UVGL-58 Mineralight Lamp, UVP, Inc., California, USA), and the desired fragment cut out as a thin agarose slice keeping the size of the slice as small as possible ) . DNA was eluted from the agarose slice by the method of Zhu et al., ( 1985). Briefly, a GeneScreen ( NEN ) or Durapore ( Millipore, GVWP 04 700 membrane was wetted with 200 ul of elution buffer ( 0.1 % SDS +50 mM Tris. HCl, pH 7.5 ), and folded over to form a cone. Meanwhile, the conical lower half of an eppendorf tube was cut off and a hole pierced in the bottom with a hot wire or needle. The membrane was placed into this cone, pushing it as far as possible. This assembly was then transferred to
-
containing 2. 2 M formaldehyde and 50 % V /V formamide. The samples were chilled on ice for 5 mins. and loading buffer added. A Taq I digest of phi X 174 DNA, filled-in wi~h Klenow polymerase using 32P-dCTP, was used as size marker for electrophoresis. The gels were run at <5 Vjcm.
-
Total RNA was resolved in formaldehyde -agarose gels as described by Maniatis et al., ( 1982 ) • In general, the electrophoresis was performed using 1.2 ~ 0 agarose gels containing 2.2 M formaldehyde and 1 X running buffer 0.04 M rnorpholinopropanesulfonic acid -MOPS, pH 7.0; 0.01 M sodium acetate; 0.001 M EDTA ). RNA samples upto 20 ug in 5 ul ) were incubated at 55°c for 15 minutes in 5 X gel buffer
-
lectrophoresed on 0.7 % -1.2 % agarose gels in TAE or TBE buffer. Choice of the percentage of agarose and the electrophoresis buffer system was made following the guidelines of Maniatis et al., ( 1982 ). In general, upto 1 kb fragments were resolved on 1.2 % agarose gels using TBE buffer. For most other purposes, TAE buffer was used. Agarose gel electrophoresis was carried out as described by Maniatis et al., ( 1982 ) . The run was stopped when the bromophenol blue dye migrated to within 1 em -1.5 em from the edge of ' the gel, except when the sample had fragments smaller than 500 bp, in which case the elctrophoresis was terminated at an earlier stage. The gel was immersed in water containing 0.5 ug I ml ethidium bromide, for 30 minutes, to stain the DNA. When detecting very low amounts of DNA, the staining was done for 60 minutes followed by destaining in 1 mM Mgso4 for one hour at room temperature. The DNA bands were visualised on a short wavelength UV transilluminator ( Fotodyne, Inc., USA and photographed with a Polaroid MP-4 camera using Polaroid type 667 film.
-
DNA digested with restriction enzymes was
-
For rapid electrophoretic analysis of plasmid DNA prepared by miniprep protocol, or to monitor the progress of digestion during various cloning procedures, the DNA was resolved on short agarose gels, taking less than one hour for the run. The electrophoresis was carried out in TAE buffer using 8 em long gels with a comb of teeth size 0.4 x 0.2 em. The width of the gel was variable, depending on the number of samples to be analysed. Gels were run at 50 100 volts, till the bromophenol blue dye migrated to within 0.5 em of the edge of the gel.
-
mixed with the sample by vortexing, and the DNA loaded on a preparative agarose gel. When digesting vector DNA in preparation for a ligation, the DNA was first purified from the digestion reaction as described in 3.2.4.8. This DNA was then treated with bacterial alkaline phophatase as described by Maniatis et al., 1982 ) • The dephosphorylated DNA was run on a preparative agarose gel to purify the linearised, dephosphorylated vector DNA. The efficiency of dephosphorylation was monitored by self ligation, followed by transformation of competent E.coli cells. Only after achieving efficient dephosphorylation of the vector DNA, was it used for ligation with the insert DNA.
-
For digestions aimed at purification of restriction fragments, 10 -20 ug of DNA was digested in a reaction mixture of about 100 -200 ul volume. Aliquots from the digestion reaction were checked on a minigel after one hour to monitor the extent of digestion. After the digestion was complete, one tenth volume of the 10 X tracking dye was
-
Digestions involving more than one restriction endonuclease were carried out with 2 - 4 ug DNA in a final reaction volume of up to 50 or 100 ul. In these cases, if the two enzymes had radically different optimal assay conditions, the DNA was digested first with the enzyme requiring a lower salt concentration. After incubating for one hour, a 5 ul aliquot from the digestion reaction was electrophoresed on a mini gel to monitor the extent of digestion. Once the digestion was complete, appropriate amount of salt and the
-
second enzyme were added and the incubation continued in an increased final reaction volume, to offset any increase in the glycerol concentration in the new reaction. Alternatively, the DNA was extracted once with phenol/chloroform, once with chloroform, and then precipitated with one half volume of 7.5 M ammonium acetate and two volumes of ethanol. The precipitation was done for 30 minutes at room temperature, and the DNA spun down for 30 minutes at room temperature. The supernate was discarded, pellet washed with 70% ethanol, recentrifuged, dried briefly under vacuum and finally resuspended in 18 ul distilled water. The DNA purified in this manner could then be used for setting up digestion with a second enzyme or for setting up a ligation. For those double digestions where one of the enzymes was known to be active over a broad range of ionic strength conditions, including those required for the optimal activity of the second enzyme, both the enzymes were added simultaneously in the digestion reaction, which was carried out using the optimal conditions of the second enzyme having more stringent assay requirements.
-
Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.
-
All fine chemicals and the thermal cycler used for PCR, were kindly provided by Cetus Corporation, California, USA. 3.2.4. Digestion of DNA with restriction enzymes. DNA samples were digested with restriction endonucleases in the appropriate digestion buffers as recommended by BRL. The digestion buffers were in most cases, supplied by BRL. Composition of the 1 X buffers is given in Table 4.
-
Figure !• Thermal cycle profile of a typical polymerase chain reaction ( PCR ). A typical PCR consists of repititive cycles of multiple temporal segments ( designated here as A - G ) with distinct target temperatures. After making the desired cocktail of template DNA, primers, Taq polymerase and the enzyme buffer, the reaction tube is incubated in a programmable thermal cycler, to incubate the reaction contents at pre-set temperatures for designated periods of time. Segments A -B, template denaturation; c -D, primer annealing; E -F, strand synthesis; G, ramp to the completion of the first cycle prior to the start of the next cycle ( dotted line ) . The duration and target temperature for each segment in an amplification cycle can be varied to suit the desired objectives.
-
plasmid DNA in a 100 ul mixture having 10 ul of 10 X PCR buffer, 10 ul of 10 mM dNTPs, 3 ul of each primer to give a final primer concentration of 1 uM, and 2.5 units of the Thermus aquaticus thermostable DNA polymerase. PCR reaction buffer ( 10 X ) contains 500 mM KCl, 100 mM Tris. Cl, pH 8 . 3 ' 15 mM MgC12 and 0.1 9.,-0 gelatin. The mixture was subjected to PCR amplification in a programmed thermal cycler block set for 3 0 cycles. The procedure is diagramatically outlined in Fig. 1 and involved four steps : a) The reaction was heated to 95°C for 30 seconds to separate the two strands of the target DNA; b) the reaction was then cooled to 37°C for one minute to allow annealing of the two primers to the template DNA to occur ; c) next, the temperature was raised to 72°C and the reaction maintained at this temperature for 10 minutes, for primer extension to occur; d) at the end of the cycle, the temperature was again raised to 95°C as in step (a) to start a new cycle. In between the steps (a) to (d), one minute ramp times were used to allow the efficient realisation of the set temperature. In the last cycle, the duration of step (c) was extended to ensure the conversion of all single strands into double stranded DNA. At the end of 30 cycles of PCR, a 10 ul aliquot from the PCR reaction was electrophoresed on a 1 % SeaKem I 3 % NuSieve agarose gel in TBE buffer, to resolve the PCR products. The amplified DNA was purified by electrophoresing the entire PCR mixture on a 1 % preparative agarose gel in TAE buffer.
-
Polymerase chain reaction was carried out as described by Scharf et al., ( 1986 ) , witD. some modifications. 23 mer oligonucleotide pri~ers synthesised by the solid phase triester method were designed to flank the target DNA desired to be amplified. A primer was designed to be complementary to , the 5 end of the phCG eDNA (+) strand and I was termed 5 primer ( also see Fig. 20 ) . Another primer was designed to be complementary to the sequence flanking the translation termination codon ( TAA ) of HBsAg (-) strand and this was I 1 I , termed 3 pr1mer. The 5 pr1mer also included the recognition sequence for restriction endonuclease Sal I as an overhang, while the I 3 primer included the recognition sequence for Hind III as an overhang. In addition, two extra bases ( G or C ) flanking the restriction site were included in the sequence of the primers, to improve the enzyme digestion. Thus, the nucleotide sequence of I the 5 primer read as : I I I 5 -GGCGTCGACATGGAGATGTTCCA-3 , while that for the 3 primer read I I as : 5 -CCAAGCTTTTAAATGTATACCCA-3 . A standard PeR· reaction contained 500 ng to 1 ug
-
was added followed by gentle shaking for 90 minutes at room temperature. This DNA was stored at 4°C. The DNA prepared by this method was of sufficient purity for restriction endonuclease cleavage and Southern blotting, but because of RNA contamination, this DNA could not be used for accurate absorbance measurements. However, typically a 30 ul aliquot was expected to contain approximately 10 ug DNA.
-
al., ( 1986). Briefly, about 108 cells were pelleted and the pellet washed twice with 10 mM phosphate buffered saline, pH 7. 4. The pellet was resuspended in 2 ml of a sol uti on containing 0.1 M NaCl, 0.2 M sucrose, 0.01 M EDTA, and 0.3 M Tris, pH 8.0. To this, 125 ul of 10 % SDS was added, mixed by vortexing and the sample incubated at 65°c for at least 30 minutes. Next, 350 ul of 8 M potassium acetate was added, the contents vortexed to mix and incubated on ice for 60 minutes. The lysate was centrifuged at 5000g for 10 minutes at 4 °c. The supernate was transferred to a new tube and extracted with 2 ml of phenol ( saturated previously with TE) and 2 ml of chloroform I isoamyl alcohol ( 24:1 ). The extraction was done by gentle rocking or by inverting the tube. The tube was spun at 1500g for 5 minutes to separate the two phases, and the upper aqueous phase was collected. This was re -extracted with 2 ml of chloroform I isoamyl alcohol as described above and the aqueous phase collected. Then 5 ml of ethanol was added to the aqueous phase to precipitate the DNA. The two layers were mixed slowly to prevent shearing of DNA. The DNA was pelleted by centrifugation at 1500g for 10 minutes at 4°C. The supernate was discarded very carefully, to minimise the loss of the loose DNA pellet. The DNA pellet was washed gently with 5 ml of 80 % ethanol. Again, the tube was centrifuged at 1500g to pellet the DNA and the supernate was discarded. The final DNA pellet was dried partially by letting the tube stand at room temperature for 30 minutes. To resuspend the DNA, 300 ul TE
-
Genomic DNA from cultured mammalian cells was isolated by a rapid procedure, essentially as described by Davis et
-
ecanted and the pellet dried briefly under vacuum. The final DNA pellet was resuspended in 500 ul of TE. A 1:50 dilution of the sample was used to measure the absorbance at 260 nm and at 280 nm. The A260 and A280 values were used to estimate the concentration and purity of the sample as described by Maniatis et al., ( 1982).
-
further purified by centrifugation to equilibrium in a 30 ml cesium chloride -ethidium bromide density gradient, as described by Maniatis et al., ( 1982 ) . The band corresponding to closed circular plasmid DNA was collected and further purified by a second centrifugation to equilibrium in a 6. 5 ml cesium chloride -ethidium bromide density gradient. The final DNA band collected from the gradient was extracted with an equal volume of isopropanol which had been previously saturated with TE and cesium chloride. This extraction was repeated twice to completely remove the ethidium bromide from the DNA sample. The DNA was then dialysed against one liter of TE for at least 8 hours, at 4 °c, with several changes of TE. To the dialysed sample, one tenth volume of 3 M sodium acetate, pH 5.2, was added and the DNA precipitated with two volumes of chilled ethanol. The precipitation was carried out 0/N at 0 -20 c. The precipitated centrifugation at 10, 000 rpm, DNA was collected by for 10 minutes. The supernate was carefully d
-
resuspended in 20 ml of Tris -Glucose solution ( 25 mM Tris. HCl, pH 8. 0; 50 mM Glucose ) . The cells were vortexed followed by repeated pipetting to obtain a uniform cell suspension. To this, 6.0 ml of a freshly prepared lysozyme solution ( 10 mg 1 ml, prepared freshly in sterile distilled water ) was added. The cell suspension was swirled to mix thoroughly and incubated for 5 minutes at room temperature. Next, 0.5 M EDTA was added to a final concentration of 10 mM, the contents swirled to mix and incubated in ice for 20 minutes. Next, 40 ml of a lytic mix containing 0. 1 % SDS and 0. 2 N NaOH was added. This was prepared freshly by mixing 4 ml of 10 % SDS solution into 36 ml of 0.22 N NaOH solution. The solution was mixed by vigorous but brief shaking till the cell lysate became clear, followed by incubation on ice for 5 minutes. Finally, 20 ml of 5 M potassium acetate solution, pH 4.8 was added. Again the contents were swirled to mix, followed by incubation in ice for at least 1 - 2 hours. The lysate was centrifuged at 10,000 rpm for 30 minutes at 4°c. The supernate was filtered through sterilised glass wool kept in a funnel, and collected in a graduated cylinder. The measured volume of the cell lysate was transferred into another centrifuge bottle and two volumes of 95 % ethanol added to precipitate the DNA, at 0 -20 c, 0/N. The DNA was pelleted by centrifugation at 10,000 rpm at 4 °c for 30 minutes. The supernate was carefully poured off and the pellet res~spended in 25 ml of TE ( 10 mM Tris.HCl, pH 8.0; 1 mM EDTA ). The plasmid DNA was
-
Plasmid DNA was isolated using the alkaline lysis method of Birnboim ( 1979 ) with slight modifications. One liter of TB supplemented with ampicillin @ 50 ug 1 ml was inoculated with 10 ml of a freshly grown primary culture and the culture incubated 0/N at 37°c, in an incubator -shaker. The cells were pelleted by centrifugation at 4000g for 10 minutes at 4 °c. The supernate was discarded and the pellet
-
yeast extract, and 10 g NaCl in distilled water, pH adjusted to 7.5 with NaOH and final volume made up to one liter (Maniatis et al., 1982). Cultures of ~.coli cells transformed with plasmid DNA were grown in media supplemented with 50 ug/ml of ampicillin. For large scale plasmid DNA isolation, ~.coli cells were grown in an enriched medium, Terrific Broth ( TB ) . One liter of TB was prepared by adding 100 ml of a sterile solution of 0.17 M KH2Po4 and 0.72 M K2HPo4 to a sterile solution containing 12 g Bacto -tryptone, 24 g Bacto -yeast extract, 4.0 ml glycerol and water to a final volume of 900 ml ( Tartof and Hobbs, 1987 ) . The media were sterilised by autoclaving at 15 psi for 20 minutes. Heat labile compounds and antibiotics were sterilised by filtration through a 0.45 u nitrocellulose membrane and added to autoclaved media after cooling the same to 55°C. Solid media was prepared by adding 1. 5 % bacto -agar prior to autoclaving. Storage of ~.coli was carried out essentially as described by Maniatis et al., ( 1982).
-
Composition of growth media used for culturing ~. coli is given in Table 3. For routine propagation, ~.coli cells were grown in Luria Bertani medium LB ) . LB was prepared by dissolving 10 g Bacto -tryptone, 5 g Bacto -
-
All computer software facilities were provided by the NII computer centre.
-
Nitrocellulose membranes ( BA85 ) were obtained from Schleicher and Schuell, Germany. GeneScreen and GeneScreen Plus membranes were from DuPont, USA. Millipore membranes ( 0.45 um ) were from Millipore Corporation, USA. 3 MM and 1 MM chromatography filter papers were from Whatman Ltd, U.K.
-
All antisera were obtained from the reagent bank at National Institute of Immunology, New Delhi.
-
Intensifying screens were from Kiran X-ray Screens, India. X -ray films were from Agfa -Gevaert, Belgium, Kodak, USA, or Hindustan Photo Films, India. Developer and fixer were from Hindustan Photo Films, India.
-
32p -dCTP specific activity 400 or 800 Ci 1 mmole was from Amersham, UK or from New England Nuclear division of DuPont, USA. 125I was from Amersham.
-
Ampicillin, tetracycline, chloramphenicol and gentamycin were from Sigma. Geniticin ( G418 ) was from Gibco Laboratories, USA.
-
Restriction endonucleases, T 4 DNA 1 igase, DNA polymerase I large fragment Klenow ) , bacterial alkaline phosphatase BAP were from BRL, USA and New England Biolabs, USA. Lysozyme and RNase A were from Sigma. Thermus aquaticus thermostable DNA polymerase was kindly provided by Cetus Corporation, California, USA.
-
GTG ) were from FMC Bio Products, USA. SDS, ethidium bromide, calf thymus DNA, cesium chloride, tris base, dithiothreitol, IPTG, X -gal, DAB, ficoll, PVP, chloroquine, coomassie brilliant blue, amido black, bovine serum albumin, were from sigma Chemicals Company ( Sigma ) , USA. DEAE -dextran was from Pharmacia, Sweden. Nick translation kits were from Bethesda Research Laboratories BRL ) , USA, and Amersham International plc, UK. Lipofectin was kindly provided by Syntex, Inc. , USA. J3hCG RIA kit was from ICN Micromedic Systems, Inc., USA. Purified hCG 13,000 I.U./ mg was kindly provided by Dr. Y.Y. Tsang, Population Council, USA. HBsAg detection kit was from Abbott Laboratories, USA. Protein molecular mass standards were from Bio Rad Laboratories, USA. DNA size markers were from BRL. All other chemicals were from Glaxo Laboratories, India, and E. Merck, India.
-
Acrylamide, bisacrylamide, ammonium persulphate, Bio -gel P-4 and TEMED, were from Bio -Rad Laboratories, USA. Agarose ( SeaKem ) and low gelling agarose ( NuSieve
-
Bacto -tryptone, Bacto -agar and Bacto -yeast extract were from Difco Laboratories, Detroit, USA. Fetal calf I serum, Ham s F-12 medium ( DMEM ) , I Iscove s Laboratories, USA.
-
The bacterial strains used in this study were ~.coli Kl2 strains, HBlOl ( F-, hsd S20 ( rB-, mB-) , supE44, ara14, ~-, galK2, lacYl, proA2, rpsL20, xyl-5, mtl-1, recA13 ] (Boyer et al., 1969 ), and JM105 ( thi, rpsL, endA, sbcB15, hsdR4, ( lac-proAB ), {F1, traD36, proAB, laciqZ M15 } ]. The mammalian cell lines used are listed in Table 1. Rat-2 is an established rat fibroblast cell line. FWIL (Larrick et al., unpublished) is a human myeloma cell line derived from the fusion of U266 IgE myeloma cells with WIL-2 lymphoblastoid cells. Rat - 2 and FWIL cell lines were kindly provided by Dr. J.W. Larrick, Cetus Corporation, USA. The other four cell lines were obtained from American Type Culture Collection ( ATCC ). The plasmids used in this study are described in Table 2.
Tags
- Method-5-Method-1-Method-1-detail
- Method-13-Method-1-detail
- Method-10-detail
- Method-9-detail
- Method-22-detail
- Method-12-Method-2-detail
- Material-7-detail
- Material-9-detail
- Method-5-Method-1-Method-2-detail
- Method-2-Method-2-detail
- Method-15-Method-2-Method-1-detail
- Method-18-Method-1-detail
- Method-14-detail
- Method-7-detail
- Material-6-detail
- Material-3-detail
- Material-10-detail
- Method-18-Method-2-detail
- Method-12-Method-1-detail
- Method-17-detail
- Method-6-detail
- Method-21-detail
- Method-3-detail
- Method-15-Method-1-detail
- Method-8-detail
- Method-3-Method-2-detail
- method-4-method-1-detail
- Method-11-Method-2-detail
- Material-1-detail
- Method-11-Method-1-Method-1-detail
- Material-8-detail
- Method-1-detail
- Method-18-detail
- Method-15-Method-3-detail
- method-15-method-2-detail
- Method-8-Method-1-detail
- Method-13-Method-2-detail
- Material-4-detail
- Method-16-detail
- Method-5-Method-2-detail
- Material-2-detail
- Method-3-Method-3-detail
- Method-11-Method-1-Method-2-detail
- Method-2-Method-1-detail
- Method-19-detail
- Material-5-detail
- Method-8-Method-2-detail
- Method-20-detail
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
The inhibition potency of our synthetic substrate, lactal (31), was determined by measuring the hydrolytic activity of ~-D-galactosidase on o-nitrophenyl ~-Dgalactopyranoside.97 Each assay tube contained 2 ml of o-nitrophenyl ~-D galactopyranoside solution (500 IlM), 0.25 units of ~-D-galactosidase (source: Aspergillus oryzae; purchased from Sigma, cat. no. G-5160) and a certain concentration of lacta!. The tube was incubated at 30°C for 13 min, after which 200 III of the mixture was added to a tube containing 100 III of acetate buffer (25 mM, pH = 4.5) and 200 III of sodium carbonate solution (200 mM). The colour liberated was read spectrophotometrically at 400 nm. The control tube contained everything except the substrate, lacta!.
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 III of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 Ilg/ml tunicamycin). Each assay tube was prepared by adding 12.5 III of 1 % Chaps, 2.8 III of 200 IlM GOP-Man, 10 III of GOP-[3H]-Man (1IlCi) and 25 nmol of synthetic substrate (49). The contents were lyophilized and 250 III of membrane suspension (1 .4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The eH] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting. The above assay was then carried out with a range of concentrations of OMJ to assess it's effect on the activity of eMPT enzyme parse.
-
mixture). These samples were lyophilized and 125 III of the reaction mixture was added to each tube. The tubes were then incubated at 25°C for 1 h and the biosynthetic LPG was extracted as described above. 10 III of the solvent E extract was taken for scintillation counting.
-
1. Mild acid hydrolysis: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.02 N HGI (200 Ill). The mixture was then placed in a 100 °G water bath for 5 minutes. After hydrolysis, the sample was again dried under nitrogen and codried thrice with toluene (0.5 ml). The residue was suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 2. Nitrous acid deamination: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.2 ml of 0.125 M sodium acetate (pH = 4.0) and 0.25 M sodium nitrite. The mixture was incubated at 25 °G for 40 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 3. PI-PLC treatment: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and suspended in 0.4 ml of PI-PlG buffer (0.1 M Tris chloride, pH = 7.4 with 0.1 % deoxycholate) and 0.2 ml of PI-PlG concentrate (B.subtifis culture supernatant) was added. The mixture was then incubated at 37 °G for 16 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. The effect of deoxymannojirimycin (Sigma, Gat. no. 0-9160) on the cell free biosynthesis was carried out. OMJ (5 mg) was dissolved in 1 ml of MQ water and 2.5, 5, 25 and 50 III were transferred to eppendorf tubes separately (which corresponded to 0.5, 1, 5 and 10 IlM concentrations of OMJ in 125 III ofthe reaction
-
NaGI in 0.1 M glacial acetic acid, 1.2 ml of 0.1 M glacial acetic acid, 0.6 ml of water and 3.6 ml of solvent E. Fractions of 0.6 ml each were collected and assayed for radioactivity.
-
Parasites (6 X 109) were harvested, pelleted at 3000 g for 10 min, washed with PBS, repelleted and suspended in 10 mL of HEPES buffer (100 mM HEPES-NaOH, pH = 7.4, 50 mM KCI, 10 mM MnCI2, 10 mM MgCI2, 0.1 mM TLCK, 1 Jlg/mL leupeptin) containing 10% glycerol. The cells were disrupted in a Parr nitrogen cavitation bomb (1500 psi, 25 min, 4°C, 3 cycles). The debris was removed by centrifugation at 3000 g for 5 min and the supernatant was centrifuged at 100,000 g for 1 h at 4°C. The resulting membrane pellet was resuspended in 10 mL of HEPES buffer without glycerol and centrifuged again at 100,000 g for 1 h at 4°C. The membranes were finally suspended in 1 mL (13 mg/mL) of HEPES buffer without glycerol. The incubation mixture per reaction contained membrane protein (2 mg) in 125 JlL of 50 mM HEPES-NaOH buffer, pH = 7.2 containing supplements (25 mM KCI, 5 mM MgCI2, 5 mM MnCI2, 0.1 mM TLCK, 1 JlglmL leupeptin, 0.8 mM ATP, 0.4 mM On) with 2 JlM UOP-[3H]-galactose (2 JlCi) and 10 JlM GOP-mannose. The mixture was incubated at 25°C for 1 h, terminated by the addition of CHCI~CH30H (3:2) to give a final ratio of CHCI~CH30H/H20 (3:2:1) and sonicated. The layers were then allowed to separate out after which the lower layer was removed with the aid of a micropipette. The tube containing the upper and intermediate layer was centrifuged (10,000 rpm, 4°C, 5 minutes). The supernatant was discarded and the resultant pellet (membranes) was suspended in 1 mL of CHCI~CH30H/H20 (1:1 :0.3). The solution was again centrifuged (10,000 rpm, 4°C, 5 minutes) and the pellet was extracted with 1 mL of solvent E (H20/ethanol/diethylether/pyridine/NH40H 15:15:5:1 :0.017) thrice. The solvent E extracts were pooled and dried under a stream of nitrogen, suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid and chromatographed over a 1 mL column of phenyl sepharose. Phenyl Sepharose Column of Biosynthetic LPG. The solvent E extract suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid was applied to a column (0.5 x 2 cm) of phenyl sepharose (Pharmacia BioteCh), preequilibrated with 0.1 M NaCI in 0.1 M glacial acetic acid. The column was then washed sequentially with 3 mL of 0.1 M
-
Transport assays were done by mixing 100 III of vesicle suspension (200 Ilg of protein) with 100 III of reaction buffer (10 mM Tris-HCI, pH=7.4, 10 mM MnCI2, 4mM MgCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 Ilg/ml pepstatin A, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM 2,3-dimercaptopropanol and 16 11M (0.16 IlCi) of GDP-[3H]-Man) . After incubation at 28°C for 6 min, the samples were placed on ice, diluted with 1.5 ml of washing buffer (10 mM Tris-HCI, pH=7.4, 0.25 M sucrose), and applied to a filtration apparatus containing HA filters. The filters were washed with 20 ml of washing buffer, and the radioactivity bound onto the filters was measured by scintillation counting. The amount of GDP-[3H]-Man that was non specifically bound to the outside of the vesicles was determined by measuring the radioactivity associated with the vesicles at 0 time of incubation of vesicles with solute.
-
ingredients were present except N-acetylglucosamine. This value represented the galactose released. The difference in the counts between the tube in which acceptor was present and control represented transferase activity.
-
A mixture of sodium cacodylate (20 ~L, 0.2 M, pH = 6.5 adjusted with Hel) , MnCI2 (3 ~L, 1 M), mercaptoethanol (3 ~L, 1 M) and Triton X-100 (5 ~L, 10% w/v) was added to a solution containing N-acetylglucosamine (3 ~L, 1 M) and protein (1 00 ~g). The reaction was started with the addition of UOP-galactose (15 ~L, 10 mM with 1 ~Ci of eH] UOP-galactose). The mixture was incubated at 37°C for 60 minutes after which the reaction was stopped by the addition of EOTA (17 ~L, 0.3 M, pH = 7.4 adjusted with NaOH) and placing the tube on ice. The mixture was then passed through a column of Oowex 2X8 (200-400 mesh in cr form) already washed thoroughly with water. The unreacted UOP-galactose remained bound to the column while galactose which had been transferred to N-acetylglucosamine to form lactosamine, as well as free galactose, was eluted out with 1.5 mL of distilled water. One tenth of volume was taken for scintillation counting. For each assay, a control tube was run in which all
-
Membrane protein suspension (5.2 x 109 cells) was centrifuged (3000 g, 4°C, 10 min). The debris was discarded and the supernatant was subjected to ultracentrifugation (100000 g, 4°C, 1 h). The pellet thus obtained was dissolved in 400 ~L of loading buffer (50 mM HEPES-NaOH, pH = 7.4, 0.25 M sucrose, 1 mM ATP,1 mM EOTA, 2 mM OTT, 2 mM leupeptin, 0.2 mM TLCK, 0.1 mM PMSF), and loaded onto a linear sucrose gradient. The gradient was prepared by layering eight 200. ~L fractions (0.25-2 M sucrose in 25 mM HEPES-NaOH, pH = 7.4) over a sucrose cushion (2.5 M) in Ultraclear centrifuge tube (Beckman) followed by centrifugation at 218000 g for 1 h. Organelles in the buffer were fractionated by centrifugation at 218000 g for 4 h at 4 °c in a Beckman L-80 Ultracentrifuge using a SW41 rotor. Each layer was carefully separated out and diluted with 500 ~L of 50 mM HEPES-NaOH buffer. Protein was estimated for each fraction separately using standard BCA assay. ~-1 ,4 Galactosyl transferase was used as a positive marker for golgi and vesicle integrity was determined by measuring the latency of galactosyltransferase catalyzed transfer of [3H] galactose from UOP-[3H]-Gal to GlcNAc
-
Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.
-
ixture was stirred under argon atmosphere for 2 days.
-
were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m
-
Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents
-
(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
-
solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
-
Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
-
mixture was concentrated and the residue was repeatedly lyophilized to yield 7S; ESMS (mlz): 263.1 (M-Hr. Guanosine 5'-diphospho-4,S-di-deoxy-4,S-difluoro-a-D-talose mono triethyl amine salt) 77. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (27 mg, 34.4 Ilmol) and 7S (10 mg, 21.5 Ilmol) was coevaporated with anhydrous pyridine (3 x 500 Ill). 1 H-tetrazole (5 mg, 68.7 Ilmol) and anhydrous pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 77; ESMS (mlz): 608.3 (M-Hr.
-
6 Hz), 4.85 (1H, s); 13C NMR 853.28,65.12 (15 Hz, C3), 67.3 (24 Hz, C5), 69.72 (C2), 81.1 (JCF = 168 Hz, C4), 89.9 (JCF = 171 Hz, C4), 101.47 (C1). 1 ,2,3-Tri-O-acetyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (73). To compound 72 (100 mg, 0.543 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over sodium sulfate and concentrated to afford 73. 2,3-Di-O-acetyl-4,6-di-deoxY-4,6-difluoro-a-D-talo-di-O-benzyl phosphate (75) : Compound 73 ( 70 mg, 0.225 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3, di-O-acetyl-4,6-di-deoxy-4,6-difloro-a-D-talopyranoside (74). To a stirred solution of compound 74 and 1 H-tetrazole (21 mg, 0.3 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (99.4 Ill, 104.3 mg, 0.3 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (87 mg, 0.504 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 75, which was purified by running a silica coated preparative TlC plate; Rf = 0.24 (50% ethyl acetate in hexane); 1H NMR characterstic ¢ 5.67 (1 H, dd, J = 6.3 Hz and 1.8 Hz, H-1); 13C NMR: ~ 20.5-20.6 (OAc), 64.77, 64.99, 66.28, 66.43, 69.9 (24 Hz, C5), 79.96 (JCF = 169 Hz, JCH = 7.1 Hz, C6), 84.08 (JCF= 180, JCH = 5.4 Hz, C4), 95.68,126.85-128.7,169.50,169.77; 31p NMR 8 -3.03; ESMS (mlz): 551.2 (M+Nat. 4,6-Di-deoxy-4,6-difluoro-a-D-talosyl phosphate (76). To a solution of 75 (30 mg, 0.056 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 280 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction
-
Methyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (72). DAST (750 j.!L, 5.6 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside 62 (200 mg, 1 mmol) in anhyd CH2CI2 (4 mL). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3 h. After cooling to -200C, the excess of reagent was destroyed by addition of CH30H (600 j.!L) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated, loaded onto a silica column and eluted out with CH2CI2 to yield 72; Rf= 0.7 in 12.5% CH30H in CH2CI2; 1H NMR (CDCI3) 83.40 (3H, s, OCH3), 4.19 (1 H, m), 4.52 (1 H, d, 6 Hz), 4.68 (1 H, d,
-
(34 mg, 0.198 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 69, which was purified by running a silica coated preparative TLC plate; Rf = 0.23 in 50% ethyl acetate in hexane; 1H NMR characterstic.8 5.72 (1 H, dd, JHP = 6.9 Hz, JHH = 1.8 Hz, H-1), 5.83 (1 H, t, JHF = 53.4 Hz, H-6); 31p NMR 8 -2.81; ESMS (mlz): 753.36 (M+Nat. 6-Deoxy-6,6-difluoro-a-D-mannosyl phosphate (70). To a solution of 69 (25 mg, 0.034 mmol) in CH30H (1 mL) was added palladium on charcoal (10%, 170 mg) and formic acid (100 j.!L). The mixture was stirred at 50°C overnight. The catalyst was removed by passing the mixture through a pad of celite. A few drops of triethylamine were added and the solution was stirred for 15 minutes. The solvent was evaporated and the product was repeatedly lyophilized to afford 70; ESMS (mlz): 279.22 (M-H)". Guanosine 5'-diphospho-6-deoxy-6,6-difluoro-a-D-mannose (mono-triethyl amine salt) 71. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (29 mg, 0.037 mmol) and 70 (11 mg, 0.023 mmol) was coevaporated with dry pyridine (3 x 200 j.!L). 1 H-tetrazole (5.5 mg, 0.074 mmol) and anhydrous pyridine (900 j.!L) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 71; ESMS (mlz): 624.15 (M-H)"
-
Methyl-6-deoxy-6,6-difluoro-2,3,4-tri-O-benzyl-a-D-mannopyranoside (66). A solution of oxalyl chloride (54.62 mg, 37.6 Ill, 0.43 mmol) in anhydrous CH2CI2 (15 ml) was cooled to -78°C and DMSO (67.2 mg, 62 Ill, 0.86 mmol) was added dropwise, followed by the addition of a solution of 65 (500 mg, 1.07 mmol) in CH2CI2 (5 ml) over a period of 5 minutes. The mixture was stirred for another 30 minutes and then triethylamine (1.2 ml) was added. The solution was brought to room temperature, water was added and the mixture was extracted with CH2CI2. The organic layer was dried over Na2S04 to give the intermediate aldehyde. A solution of DAST (112.8 mg, 92.5 Ill, 0.7 mmol) in anhydrous CH2CI2 (1.5 ml) was cooled to -78°C. To this was added a solution of the aldehyde (325 mg, 0.7mmol) in anhydrous CH2CI2 (1.5 ml) dropwise. The mixture was stirred at rt for 90 minutes. After cooling to -20°C, excess of reagent was destroyed by the addition of CH30H and sodium bicarbonate. The mixture was filtered once effervescence ceased. The filtrate was concentrated and the residue was purified by silica column chromatography (5% ethyl acetate in hexane) to afford 66; Rt = 0.34 in 25% ethyl acetate in hexane; 1H NMR characterstic 8 5.97 (1 H, t, JHF = 52.6 Hz, H-6); 19F NMR &-132.65 (dd, J = 57 and 10.9 Hz), -132.90 (d
-
d, J = 57 and 16.4 Hz); ESMS (mlz): 507.2 (M+Nat. Acetyl-2,3,4-tri-O-benzyl-6-deoxY-6,6-difluoro-a-D-mannopyranoside (67). To compound 66 (70 mg, 0.144 mmol) was added 1 % sulfuric acid solution in acetic anhydride (1 ml). The mixture was stirred at rt for 1 h. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 67 which was purified by silica column chromatography (5% ethyl acetate in hexane); Rt = 0.34 (30% ethyl acetate in hexane). 2,3,4-Tri-O-benzyl-6-deoxy-6,6-difluoro-a-D-manno-di-O-benzyI phosphate (69). Compound 67 (50 mg, 0.105 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-benzyl-6,6-difluoro-a-D-mannopyranoside (68). To a stirred solution of compound 68 (46 mg, 0.097 mmol) and 1 H-tetrazole (8.5 mg, 0.118 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (39 Ill, 40.9 mg, 0.118 mmoL) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40 °C and m-CPBA
-
Methyl-6-0-(triphenylmethyl)-a-D-rnannopyranoside (63). Methyl-a-D-manno pyranoside (62, 5g, 25.7 mmol) was dissolved in DMF (17 mL). Trityl chloride (7.9 g, 28.3 mmol), DMAP (515 mg, 2.06 mmol) and triethylamine (3.9 mL, 28.3 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was purified by silica column chromatography (5% CH30H in CH2CI2) to give 63 (8 g, 71.4%); R, = 0.14 in 5% CH30H in CH2CI2; ESMS (mlz): 459 (M+Nat. Methyl 2,3,4-tri-O-benzyl-6-0-(triphenylmethyl)-a-D-mannopyranoside (64). Compound 63 (5.8 g, 13.3 mmol) was dissolved in DMF (80 mL), followed by addition of sodium hydride (60% dispersion, 2.12 g, 53.2 mmol) and benzyl bromide (6.3 mL, 53.2 mmol) dropwise at 0 °C. The reaction mixture was stirred overnight at rt and the excess of sodium hydride was destroyed by addition of CH30H and water. The mixture was extracted with CH2CI2. The organic phase was washed thoroughly with saturated NaHC03 solution and water, dried over Na2S04 and concentrated to give 64; R,= 0.45 in 20% ethyl acetate in hexane; 1H NMR: 83.25 (dd, 1 H, H-2), 3.39 (s, 3H), 3.7-4.0 (m, 5H), 4.29-4.82 (7H, m, 3 x PhCH2 and H-1), 6.9-7.54 (m, 30H, Ph). Methyl 2,3,4-tri-O-benzyl-a-D-mannopyranoside (65). To a solution of compound 64 (1 g, 1.415 mmol) in CH2CI2 : CH30H (1 :2, 9 mL) was added p-toluene sulfonic acid (14 mg) and the mixture was stirred at rt for 2 h. Excess of acid was neutralized by the addition of triethylamine. The mixture was concentrated and purified by silica column chromatography (40% ethyl acetate in hexane) to yield 65 (4.5 g, 72.5%); R, = 0.13 in 30% ethyl acetate in hexane; 1H NMR: 8 3.29 (s, 3H, OMe), 3.61-3.96 (m, 5H), 3.93 (dd, J = 9 and 7.5 Hz, 1 H, H-3), 4.69 (d, J = 3 Hz, H-1), 4.63-4.95 (m, 6H, 3 x Ph CH2) , 7.25-7.34 (m, 15H, Ph); 13C NMR: 8 54.68, 62.34, 71.95, 72.89, 74.67, 74.79,75.10,80.13,99.27,127.50-128.30; ESMS (mlz): 487.3 (M+Nat.
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 J..ll of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 J..lg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 J..lg/ml tunicamycin). Each assay tube was prepared by adding 12.5 J..ll of 1% Chaps, 28 J..ll of 200 J..lM GDP-Man, 10 J..ll of GDP-[3H]Man (1 J..lCi) and 25 nmol of synthetic
-
Cultured promastigotes were harvested by centrifugation of suspension culture (500 ml) in falcon tubes at 3000 g for 10 min at 20°C in a cooling centrifuge (Rota 4R; Plastocraft). The clear spun media was carefully decanted and the pellet was resuspended in ice-cold phosphate buffered saline (PBS, 20mM, pH = 7.2). Centrifugation was done again as earlier and washings were collected in a separate falcon. The washing step with PBS was repeated twice. The promastigotes in PBS were then counted using a Neubauer chamber. For this an aliquot was taken and diluted with PBS (normally 10 J..ll original suspension was mixed with 60 J..ll PBS) and then formaldehyde was added to this (30 J..ll to give a final dilution of 1:10). After 10 minutes of fixing in formaldehyde, 10 J..ll of this diluted suspension was put under the coverslip on Neubauer chamber and counted. Total cell count was determined using the standard formula. For breaking cells to get membrane preparation,93 the cell pellet (6.5 x 109 cells) was suspended in 5 ml of hypotonic buffer (0.1 mM TlCK and 1 J..lg/ml leupeptin) and sonicated in ice (6 x 10 s pulses with 3 s intervals). Breaking of cells were assessed by a light microscope. The membrane protein was further processed as per the requirement of the experiment.
-
incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
-
For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
-
N-Butyl-4-~-galactopyranosyl-a-D-glucopyranosyl ~-amino lactam (61). To a solution of 5 (12 mg) in CH30H (1 ml) was added palladium on carbon (10%, 35 mg) and formic acid (100 Ill). The mixture was stirred at 50°C overnight. The catalyst was filtered off and solvent was evaporated to afford 61; 1H NMR: 80.72-0.77 (t, 3H, CH2-CH3), 1.14-1.22 (m, 4H, CHz-CHz-CH3),1.40-1.45 (t, 2H, N-CH2), 4.31 (d, J = 7.8 Hz, 1H, H-1'), 5.38 (d, J = 4.2 Hz, 1H, H-1); 13C NMR: 8 12.72,19.69,28.77,40.65, 52.84, 61.09, 67.48, 68.50, 70.88, 72.56, 75.17, 77.66, 79.12, 103.19, 169.83; ESMS (mlz): 430.37 (M+Nat.
-
3,6··Di-O-benzyl-4-(2,3,4,6-tetra-O-benzyl-~-galactopyranosyl)-a-D-glucopyrano syl ~ amino lactam (58). To a solution of hexa-O-benzyl lactal (32, 300 mg, 0.36 mrnol) in CHCI3 (0.36 ml) was added trichloroacetyl isocyanate (90 Ill, 0.74 mmol). The mixture was stirred at rt for 18 h to afford the intermediate 57. This intermediate was characterized by 1 H NMR: 06.04 (1 H, d, J = 5.4 Hz, H-1, gluco isomer), 5.96 (1 H, d, J = 3.3 Hz, man no isomer). The reaction mixture was then cooled to -20°C and treated with benzylamine (0.13 ml, 1.17 mmol) and the flask was gradually brought to rt. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated. The residue was purified by silica column chromatography 1,30% ethyl acetate in hexane) to afford 58 (275 mg, 87%); Rt = 0.33 in 50% ethyl acetate in hexane; 1H NMR: & 3.37-3.46 (m, 5H, H-2,6,6'), 3.58-3.7 (m, 3H, H-3,4,5), 3.77-3.89 (m, 3H, H-2',3',5'), 4.34 (d, J = 4.2 Hz, 1 H, H-1 '),4.44 (d, 1 H, H-4'), 5.4 (d, J = 4.5 Hz, H-1), 6.24 (s, 1 H, NH), 7.22-7.36 (m, 30H, Ph); 13C NMR: & 54.27,68.43, 69.39, 71.48, 72.65, 73.06, 73.12, 73.37, 74.56, 75.05, 75.35, 75.95, 79.47, 82.31, 102.98,127.42-128.33,138.07-138.83,166.90; ESMS (mlz): 914.5 (M+Nat. 4-~-Galactopyranosyl-a-D-glucopyranosyl ~ amino lactam (59). To a solution of 58 (30 mg, 0.035 mmol) in CH30H (3 ml) was added palladium on carbon (10%, 170 mg) and formic acid (
-
mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-Dmannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-Dgalactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
-
Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
Tags
- Method-5-Method-1-detail
- Method-5-Method-1-Method-1-detail
- Method-4-Method-3-detail
- Method-4-Method-1-Method-3-detail
- Method-4-Method-1-Method-1-detail
- Method-4-Method-1-Method-4-detail
- Method-3-Method-2-Method-1-detail
- Method-3-Method-3-Method-2-detail
- Method-3-Method-2-Method-2-detail
- Method-4-Method-4-detail
- Method-4-Method-2-detail
- Method-5-Method-1-Method-2-detail
- Method-6-detail
- Method-3-Method-3-Method-1-detail
- Method-3-Method-4-detail
- Method-4-Method-1-Method-2-detail
Annotators
URL
-