Reviewer #2 (Public Review):

Summary:

Sarcomeres, the contractile units of skeletal and cardiac muscle, contract in a concerted fashion to power myofibril and thus muscle fiber contraction.

Muscle fiber contraction depends on the stiffness of the elastic substrate of the cell, yet it is not known how this dependence emerges from the collective dynamics of sarcomeres. Here, the authors analyze the contraction time series of individual sarcomeres using live imaging of fluorescently labeled cardiomyocytes cultured on elastic substrates of different stiffness. They find that reduced collective contractility of muscle fibers on unphysiologically stiff substrates is partially explained by a lack of synchronization in the contraction of individual sarcomeres.

This lack of synchronization is at least partially stochastic, consistent with the notion of a tug-of-war between sarcomeres on stiff sarcomeres. A particular irregularity of sarcomere contraction cycles is 'popping', the extension of sarcomeres beyond their rest length. The statistics of 'popping' suggest that this is a purely random process.

Strengths:

This study thus marks an important shift of perspective from whole-cell analysis towards an understanding of the collective dynamics of coupled, stochastic sarcomeres.

Weaknesses:

Further insight into mechanisms could be provided by additional analyses and/or comparisons to mathematical models.

Reviewer #2 (Public Review):

Summary:

This manuscript presents a novel and significant investigation into the role of SIRT4 For CCN2 expression in response to TGF-β by modulating U2AF2-mediated alternative splicing and its impact on the development of kidney fibrosis.

Strengths:

The authors' main conclusion is that SIRT4 plays a role in kidney fibrosis by regulating CCN2 expression via pre-mRNA splicing. Additionally, the study reveals that SIRT4 translocates from the mitochondria to the cytoplasm through the BAX/BAK pore under TGF-β stimulation. In the cytoplasm, TGF-β activated the ERK pathway and induced the phosphorylation of SIRT4 at Ser36, further promoting its interaction with importin α1 and subsequent nuclear translocation. In the nucleus, SIRT4 was found to deacetylate U2AF2 at K413, facilitating the splicing of CCN2 pre-mRNA to promote CCN2 protein expression. Overall, the findings are fully convincing. The current study, to some extent, shows potential importance in this field. 

Weaknesses:

(1) Exosomes containing anti-SIRT4 antibodies were found to effectively mitigate UUO-induced kidney fibrosis in mice. While the protein loading capacity and loading methods were not mentioned.

(2) The method section is incomplete, and many methods like cell culture, cell transfection, gene expression profiling analysis, and splicing analysis, were not introduced in detail.

(3) The authors should compare their results with previous studies and mention clearly how their work is important in comparison to what has already been reported in the Discussion section.

Reviewer #2 (Public Review):

Summary:

The study by Xingsen Zhao et al on "A human forebrain organoid model reveals the essential function of GTF2IRD1-TTR-ERK axis for the neurodevelopmental deficits of Williams Syndrome" presents a forebrain organoid model for WS and has identified defects in neurogenesis. The authors have performed scRNAseq from these patients' derived forebrain organoids showing upregulation expression in genes related to cell proliferation while genes involved in neuronal differentiation were downregulated. The major findings presented in this study are an increase in the size of SOX2+ ventricular zone in WS forebrain organoids with an altered developmental trajectory and aberrant excitatory neurogenesis. The study also presents evidence that transthyretin (TTR) has a reduced expression in WS organoids, and its expression is regulated by the transcription factor -GTF2IRD1. The authors then go on identity mechanistic details of TTR function on MAPK/ERK pathway which has been known to be involved in brain development. Overall, this is a well-constructed study revealing the function of one of the key genes that is deleted in WS and provides novel insights into mechanisms underlying the abnormal neurogenesis in WS brain.

Strengths:

WS patients have neurocognitive disorders which most likely stem from defects in early neurodevelopment. This study has investigated a WS forebrain organoid model with scRNAseq and identified differences in cell proliferation and differentiation. This study has presented some new evidence regarding the function and regulation of TTR and its regulator GTF2IRD1 during brain development.

Weaknesses:

Though the evidence presented for the mechanism of action of TTR on the MAPK pathway is unclear and lacks depth. It would require identifying downstream targets of TTR and how it interacts with the MAPK pathway.

Reviewer #2 (Public Review):

Summary:

This manuscript explores the neuronal signals that underlie resistance vs resource-based models of cognitive effort. The authors use a delayed discounting task and computational models to explore these ideas. The authors find that the ACC strongly tracks value and time, which is consistent with prior work. Novel contributions include quantification of a resource-based control signal among ACC ensembles, and linking ACC theta oscillations to a resistance-based strategy.

Strengths:

The experiments and analyses are well done and have the potential to generate an elegant explanatory framework for ACC neuronal activity. The inclusion of local-field potential / spike-field analyses is particularly important because these can be measured in humans.

Weaknesses:

I had questions that might help me understand the task and details of neuronal analyses.

(1) The abstract, discussion, and introduction set up an opposition between resource and resistance-based forms of cognitive effort. It's clear that the authors find evidence for each (ACC ensembles = resource, theta=resistance?) but I'm not sure where the data fall on this dichotomy.<br /> a. An overall very simple schematic early in the paper (prior to the MCML model? or even the behavior) may help illustrate the main point.<br /> b. In the intro, results, and discussion, it may help to relate each point to this dichotomy.<br /> c. What would resource-based signals look like? What would resistance based signals look like? Is the main point that resistance-based strategies dominate when delays are short, but resource-based strategies dominate when delays are long?<br /> d. I wonder if these strategies can be illustrated? Could these two measures (dLP vs ival tracking) be plotted on separate axes or extremes, and behavior, neuronal data, LFP, and spectral relationships be shown on these axes? I think Figure 2 is working towards this. Could these be shown for each delay length? This way, as the evidence from behavior, model, single neurons, ensembles, and theta is presented, it can be related to this framework, and the reader can organize the findings.

(2) The task is not clear to me.<br /> a. I wonder if a task schematic and a flow chart of training would help readers.<br /> b. This task appears to be relatively new. Has it been used before in rats (Oberlin and Grahame is a mouse study)? Some history / context might help orient readers.<br /> c. How many total sessions were completed with ascending delays? Was there criteria for surgeries? How many total recording sessions per animal (of the 54?)<br /> d. How many trials completed per session (40 trials OR 45 minutes)? Where are there errors? These details are important for interpreting Figure 1.

(3) Figure 1 is unclear to me.<br /> a. Delayed vs immediate lever presses are being plotted - but I am not sure what is red, and what is blue. I might suggest plotting each animal.<br /> b. How many animals and sessions go into each data point?<br /> c. Table 1 (which might be better referenced in the paper) refers to rats by session. Is it true that some rats (2 and 8) were not analyzed for the bulk of the paper? Some rats appear to switch strategies, and some stay in one strategy. How many neurons come from each rat?<br /> d. Task basics - RT, choice, accuracy, video stills - might help readers understand what is going into these plots<br /> e. Does the animal move differently (i.e., RTs) in G1 vs. G2?

(4) I wasn't sure how clustered G1 vs. G2 vs G3 are. To make this argument, the raw data (or some axis of it) might help.<br /> a. This is particularly important because G3 appears to be a mix of G1 and G2, although upon inspection, I'm not sure how different they really are<br /> b. Was there some objective clustering criteria that defined the clusters?<br /> c. Why discuss G3 at all? Can these sessions be removed from analysis?

(5) The same applies to neuronal analyses in Fig 3 and 4<br /> a. What does a single neuron peri-event raster look like? I would include several of these.<br /> b. What does PC1, 2 and 3 look like for G1, G2, and G3?<br /> c. Certain PCs are selected, but I'm not sure how they were selected - was there a criteria used? How was the correlation between PCA and ival selected? What about PCs that don't correlate with ival?<br /> d. If the authors are using PCA, then scree plots and PETHs might be useful, as well as comparisons to PCs from time-shuffled / randomized data.

(6) I had questions about the spectral analysis<br /> a. Theta has many definitions - why did the authors use 6-12 Hz? Does it come from the hippocampal literature, and is this the best definition of theta?. What about other bands (delta - 1-4 Hz), theta (4-7 Hz); and beta - 13- 30 Hz? These bands are of particular importance because they have been associated with errors, dopamine, and are abnormal in schizophrenia and Parkinson's disease.<br /> b. Power spectra and time-frequency analyses may justify the authors focus. I would show these (y-axis - frequency, x-axis - time, z-axis, power).

(7) PC3 as an autocorrelation doesn't seem the to be right way to infer theta entrainment or spike-field relationships, as PCA can be vulnerable to phantom oscillations, and coherence can be transient. It is also difficult to compare to traditional measures of phase-locking. Why not simply use spike-field coherence? This is particularly important with reference to the human literature, which the authors invoke.

Reviewer #2 (Public Review):

BTB domains are protein-protein interaction domains found in diverse eukaryotic proteins, including transcription factors. It was previously known that many of the Drosophila transcription factor BTB domains are of the TTK-type - these are defined as having a highly-conserved motif, FxLRWN, at their N-terminus, and they thereby differ from the mammalian BTB domains. Whereas the well-characterised mammalian BTB domains are dimeric, several Drosophila TTK-BTB domains notably form multimers and function as chromosome architectural proteins. The aims of this work were (i) to determine the structural basis of multimerisation of the Drosophila TTK-BTB domains, (ii) to determine how different Drosophila TTK-BTB domains interact with each other, and (iii) to investigate the evolution of this subtype of BTB domain.

The work significantly advances our understanding of the biology of BTB domains. The conclusions of the paper are mostly well-supported, although some aspects need clarification:

Hexameric organisation of the TTK-type BTB domains:<br /> Using cryo-EM, the authors showed that the CG6765 TTK-type BTB domain forms a hexameric assembly in which three "classic" BTB dimers interact via a beta-sheet interface involving the B3 strand. This is particularly interesting, as this region of the BTB domain has recently been implicated in protein-protein interactions in a mammalian BTB-transcription factor, MIZ1. SEC-MALS analysis indicated that the LOLA TTK-type BTB domain is also hexameric, and SAXS data was consistent with a hexameric assembly of the CG6765- and LOLA BTB domains.

The data regarding the hexameric organisation is convincing. However, interpreting the role of specific regions of the BTB domain is difficult because the description of the molecular contacts lacks depth.

Heteromeric interactions between TTK-type BTB domains:<br /> The authors use yeast two-hybrid assays to study heteromeric interactions between various Drosophila TTK-type BTB domains. Such assays are notorious for producing false positives, and this needs to be mentioned. Although the authors suggest that the heteromeric interactions are mediated via the newly-identify B3 interaction interface, there is no evidence to support this, since mutation of B3 yielded insoluble proteins.

Evolution of the TTK-type BTB domains:<br /> The authors carried out a bioinformatics analysis of BTB proteins and showed that most of the Drosophila BTB transcription factors (24 out of 28) are of the TTK-type. They investigated how the TTK-type BTB domains emerged during evolution, and showed that these are only found in Arthropoda, and underwent lineage-specific expansion in the modern phylogenetic groups of insects. These findings are well-supported by the evidence.

Reviewer #2 (Public Review):

The manuscript by Xie and colleagues presents transcriptomic experiments that measure gene expression in eight different tissues taken from adult female and male mice from four species. These data are used to make inferences regarding the evolution of sex-biased gene expression across these taxa. The experimental methods and data analysis are appropriate; however, most of the conclusions drawn in the manuscript have either been previously reported in the literature or are not fully supported by the data.

There are two ways the manuscript could be modified to better strengthen the conclusions.

First, some of the observed differences in gene expression have very little to no effect on other phenotypes, and are not relevant to medicine or fitness. Selectively neutral gene expression differences have been inferred in previous studies, and consistent with that work, sex-biased and between-species expression differences in this study may also be enriched for selectively neutral expression differences. This idea is supported by the analysis of expression variance, which indicates that genes that show sex-biased expression also tend to show more inter-individual variation. This perspective is also supported by the MK analysis of molecular evolution, which suggests that positive selection is more prevalent among genes that are sex-biased in both mus and dom, and genes that switch sex-biased expression are under less selection at the level of both protein-coding sequence and gene expression.

As an aside, I was confused by (line 176): "implying that the enhanced positive selection pressure is triggered by their status of being sex-biased in either taxon." - don't the MK values suggest an excess of positive selection on genes that are sex-biased in both taxa?

Without an estimate of the proportion of differentially expressed genes that might be relevant for broader physiological or organismal phenotypes, it is difficult to assess the accuracy and relevance of the manuscript's conclusions. One (crude) approach would be to analyze subsets of genes stratified by the magnitude of expression differences; while there is a weak relationship between expression differences and fitness effects, on average large gene expression differences are more likely to affect additional phenotypes than small expression differences. Another perspective would be to compare the within-species variance to the between-species variance to identify genes with an excess of the latter relative to the former (similar logic to an MK test of amino acid substitutions).

Second, the analysis could be more informative if it distinguished between genes that are expressed across multiple tissues in both sexes that may show greater expression in one sex than the other, versus genes with specialized function expressed solely in (usually) reproductive tissues of one sex (e.g. ovary-specific genes). One approach to quantify this distinction would be metrics like those used defined by [Yanai I, et al. 2005. Genome-wide midrange transcription profiles reveal expression-level relationships in human tissue specification. Bioinformatics 21:650-659.] These approaches can be used to separate out groups of genes by the extent to which they are expressed in both sexes versus genes that are primarily expressed in sex-specific tissue such as testes or ovaries. This more fine-grained analysis would also potentially inform the section describing the evolution/conservation of sex-biased expression: I expect there must be genes with conserved expression specifically in ovaries or testes (these are ancient animal structures!) but these may have been excluded by the requirement that genes be sex-biased and expressed in at least two organs.

There are at least three examples of statements in the discussion that at the moment misinterpret the experimental results.

The discussion frames the results in the context of sexual selection and sexually antagonistic selection, but these concepts are not synonymous. Sexual selection can shape phenotypes that are specific to one sex, causing no antagonism; and fitness differences between males and females resulting from sexually antagonistic variation in somatic phenotypes may not be acted on by sexual selection. Furthermore, the conditions promoting and consequence of both kinds of selection can be different, so they should be treated separately for the purposes of this discussion.

The discussion claims that "Our data show that sex-biased gene expression evolves extremely fast" but a comparison or expectation for the rate of evolution is not provided. Many other studies have used comparative transcriptomics to estimate rates of gene expression evolution between species, including mice; are the results here substantially and significantly different from those previous studies? Furthermore, the experimental design does not distinguish between those gene expression phenotypes that are fixed between species as compared to those that are polymorphic within one or more species which prevents straightforward interpretation of differences in gene expression as interspecific differences.

The conclusion that "Our results show that most of the genetic underpinnings of sex differences show no long-term evolutionary stability, which is in strong contrast to the perceived evolutionary stability of two sexes" - seems beyond the scope of this study. This manuscript does not address the genetic underpinnings of sex differences (this would involve eQTL or the like), rather it looks at sex differences in gene expression phenotypes. Simply addressing the question of phenotypic evolutionary stability would be more informative if genes expressed specifically in reproductive tissues were separated from somatic sex-biased genes to determine if they show similar patterns of expression evolution.

Reviewer #2 (Public Review):

This study utilized the LCMV Docile infection model, which induces chronic and persistent infection in mice, leading to T cell exhaustion and dysfunction. Through exogenous IL-2 fusion protein treatment during the late stage of infection, the researchers found that IL-2 treatment significantly enlarges the antigen-specific effector CD8 T cells, expanding the CXCR5-TCF1- exhausted population (Tex) while maintaining the size of the CXCR5+TCF1+ precursors of exhausted T cell population (Tpex). This preservation of the Tpex population's self-renewing capacity allows for sustained T cell proliferation and antiviral responses.

The authors discovered a dual effect of IL-2 treatment: it decreases CXCR5 expression on Tpex cells, restricting their entry into the B cell follicle. This may explain why IL-2 treatment has little impact on overall viral control. However, this finding also suggests a potential application of IL-2 treatment for autoimmune diseases, as it can suppress specific immune responses within the B cell follicle. Using imaging-based approaches, the team provided direct evidence that IL-2 treatment shifts the viral load to concentrate within the B cell follicle, correlating with the observed decrease in CXCR5 expression.

Further, the researchers showed that ectopic expression of constitutively active STAT5, downstream of IL-2 induced cytokine signaling, in P14 TCR transgenic T cells (specific for an LCMV epitope), drove the T cell population toward the CXCR5- Tex phenotype over the CXCR5+ Tpex cells in vivo. Additionally, abrogating Blimp1, upregulated by active IL-2-phosphorylated STAT5 signaling, restored the CXCR5+ Tpex population.

Building on these results, the researchers used an engineered IL-2 fusion protein, ANV410, targeting the beta-chain of the IL-2 receptor CD122, which successfully replicated their earlier findings. Importantly, the Tpex-sustaining effect of IL-2 was only observed when treatment was administered during the late stage of infection, as early treatment suppressed Tpex cell generation. Immune profiling of SLE patients undergoing low-dose IL-2 treatment showed a similar reduction in the CXCR5+ Tpex cell population.

This study provides compelling data on the physiological consequences of IL-2 treatment during chronic viral infection. By leveraging the chronic and persistent LCMV Docile infection model, the researchers identified the temporal effects of IL-2 fusion protein treatment, offering strategic insights for therapies targeting cancer and autoimmune diseases.

Reviewer #2 (Public Review):

In the revised manuscript, the authors tried to address some of my comments from the previous round of review. Notably, they have performed some additional ITC experiments where protein precipitation is not an issue to probe interactions between PARKIN and different domains. In addition, they have toned down some of the language in the text to better reflect their data and results. However, I still feel that the manuscript lacks some key answers regarding the relative interactions between p-PARKIN and different domains, as discussed in my previous review. A deeper dive into the underlying biophysical and biochemical features that drive these interactions is important to fully understand the importance of their work. However, this manuscript does provide some interesting potential insights into the mechanisms of PARKIN activation that could be useful for the field moving forward.

Reviewer #3 (Public Review):

Summary

The high heterogeneity nature of α-synuclein (α-syn) fibrils posed significant challenges in structural reconstruction of the ex vivo conformation. A deeper understanding of the factors influencing the formation of various α-syn polymorphs remains elusive. The manuscript by Frey et al. provides a comprehensive exploration of how pH variations (ranging from 5.8 to 7.4) affect the selection of α-syn polymorphs (specifically, Type1, 2 and 3) in vitro by using cryo-electron microscopy (cryo-EM) and helical reconstruction techniques. Crucially, the authors identify two novel polymorphs at pH 7.0 in PBS. These polymorphs bear resemblance to the structure of patient-derived juvenile-onset synucleinopathy (JOS) polymorph and diseased tissue amplified α-syn fibrils. The revised manuscript more strongly supports the notion that seeding is a non-polymorph-specific in the context of secondary nucleation-dominated aggregation, underscoring the irreplaceable role of pH in polymorph formation.

Strengths

This study systematically investigates the effects of environmental conditions and seeding on the structure of α-syn fibrils. It emphasizes the significant influence of environmental factors, especially pH, in determining the selection of α-syn polymorphs. The high-resolution structures obtained through cryo-EM enable a clear characterization of the composition and proportion of each polymorph in the sample. Collectively, this work provides a strong support for the pronounced sensitivity of α-syn fibril structures to the environmental conditions and systematically categorizes previously reported α-syn fibril structures. Furthermore, the identification of JOS-like polymorph also demonstrates the possibility of in vitro reconstruction of brain-derived α-syn fibril structures.

Weaknesses

All my previous concerns have been resolved to my satisfaction.

Reviewer #2 (Public Review):

Summary:

There is significant interest in characterizing the mechanisms by which genetic mutations linked to autoimmunity perturb immune processes. Pahl et al. collect information of dynamic accessible regions, genes, and 3D contacts in primary CD4+ T cell samples that have been stimulated ex vivo. The study includes a variety of analyses characterizing these dynamic changes. With TF footprinting they propose factors linked to active regulatory elements. They compare the performance of their variant mapping pipeline that uses their data versus existing datasets. Most compelling there was a deep dive into additional study of regulatory elements nearby the IL2 gene. Finally, they perform a pharmacological screen targeting several genes they suggest are involved in T cell proliferation.

Strengths:

- The work done characterizing elements at the IL2 locus is impressive.

Weaknesses:

- There are extensive studies performed on resting and activated immune cell states (CD4+ T cells and other cell types) and some at multiple time points or concentrations of stimuli that collect ATAC-seq and/or RNA-seq. Several analyses performed in published studies were similarly performed in this study. I expected the authors to at least briefly mention published studies and whether their conclusions generally agree or disagree. Are the same dynamic regulatory regions or genes identified upon T cell activation? Are the same TF footprints enriched in these dynamic regulatory elements? In the revision, I appreciate that the authors now include additional data from several studies that I had initially suggested for the purposes of nominating disease genes in their precision-recall analysis.

Reviewer #2 (Public Review):

Summary:

The authors aimed to elucidate the role of AARS2, an alanyl-tRNA synthase, in mouse hearts, specifically its impact on cardiac function, fibrosis, apoptosis, and metabolic pathways under conditions of myocardial infarction (MI). By investigating the effects of both deletion and overexpression of AARS2 in cardiomyocytes, the study aims to determine how AARS2 influences cardiac health and survival during ischemic stress.

The authors successfully achieved their aims by demonstrating the critical role of AARS2 in maintaining cardiomyocyte function under ischemic conditions. The evidence presented, including genetic manipulation results, functional assays, and mechanistic studies, robustly supports the conclusion that AARS2 facilitates cardiomyocyte survival through PKM2-mediated metabolic reprogramming. The study convincingly links AARS2 overexpression to improved cardiac outcomes post-MI, validating the proposed protective AARS2-PKM2 signaling pathway.

This work may have a significant impact on the field of cardiac biology and ischemia research. By identifying AARS2 as a key player in cardiomyocyte survival and metabolic regulation, the study opens new avenues for therapeutic interventions targeting this pathway. The methods used, particularly the cardiomyocyte-specific genetic models and ribosome profiling, are valuable tools that can be employed by other researchers to investigate similar questions in cardiac physiology and pathology.

Understanding the metabolic adaptations in cardiomyocytes during ischemia is crucial for developing effective treatments for MI. This study highlights the importance of metabolic flexibility and the role of specific enzymes like AARS2 in facilitating such adaptations. The identification of the AARS2-PKM2 axis adds a new layer to our understanding of cardiac metabolism, suggesting that enhancing glycolysis can be a viable strategy to protect the heart from ischemic damage.

Strengths:

(1) Comprehensive Genetic Models: The use of cardiomyocyte-specific AARS2 knockout and overexpression mouse models allowed for precise assessment of AARS2's role in cardiac cells.

(2) Functional Assays: Detailed phenotypic analyses, including measurements of cardiac function, fibrosis, and apoptosis, provided evidence for the physiological impact of AARS2 manipulation.

(3) Mechanistic Insights: This study used ribosome profiling (Ribo-Seq) to uncover changes in protein translation, specifically highlighting the role of PKM2 in metabolic reprogramming.

(4) Therapeutic Relevance: The use of the PKM2 activator TEPP-46 to reverse the effects of AARS2 deficiency presents a potential therapeutic avenue, underscoring the practical implications of the findings.

Weaknesses:

(1) Species Limitation: The study is limited to mouse and rat models, and while these are highly informative, further validation in human cells or tissues would strengthen the translational relevance.

(2) Temporal Dynamics: The study does not extensively address the temporal dynamics of AARS2 expression and PKM2 activity during the progression of MI and recovery, which could offer deeper insights into the timing and regulation of these processes.

Reviewer #2 (Public Review):

Summary:

This paper from the Barford lab describes medium/high-resolution cryo-EM structures of three versions of the S. cerevisiae anaphase-promoting complex/cyclosome (APC/C):

(1) the recombinant apo complex purified from insect cells,

(2) the apo complex phosphorylated in vitro by cyclin-dependent kinase, and

(3) an active APC/C-Cdh1-substrate ternary complex.

The focus of the paper is on comparing similarities and differences between S. cerevisiae and human APC/C structures, mechanisms of activation by coactivator, and regulation by phosphorylation. The authors find that the overall structures of S. cerevisiae and human APC/C are remarkably similar, including the binding sites and orientation for the substrate-recruiting coactivator, Cdh1. In addition, the mechanism of Cdh1 inhibition by phosphorylation appears conserved across kingdoms. However, key differences were also observed that reveal divergence in APC/C mechanisms that are important for researchers in this field to know. Specifically, the mechanism of APC/C-Cdc20 activation by mitotic phosphorylation appears to be different, due to the absence of the key Apc1 autoinhibition loop in the S. cerevisiae complex. In addition, the conformational activation of human APC/C by coactivator binding was not observed in the S. cerevisiae complex, implying that stimulation of E2 binding must occur via a different mechanism in this species.

Strengths:

Consistent with the numerous prior cryo-EM structures of human APC/C from the Barford lab, the technical quality of the structure models is a major strength of this work. In addition, the detailed comparison of similarities and differences between the two species will be a very valuable resource for the scientific community. The manuscript is written very well and allows readers lacking expertise in cryo-EM to understand the important aspects of the conservation of APC/C structure and mechanism across kingdoms.

Weaknesses:

The lack of experimentation in this work to test some of the putative differences in APC/C mechanism (e.g. stimulation of E2 binding by coactivator and stimulation of activity by mitotic phosphorylation) could be considered a weakness. Nonetheless, the authors do a nice job explaining how the structure interpretations imply these differences likely exist, and this work sets the stage nicely for future studies to understand these differences at a mechanistic level. There is enough value in having the S. cerevisiae structure models and the comparison to the human structures, without any additional experimentation.

The validation of APC/C phosphorylation in the unphosphorylated and hyperphosphorylated states is not very robust. Given the lack of significant effects of phosphorylation on APC/C structure observed here (compared to the human complex), this becomes important. A list of phosphorylation sites identified by mass spec before and after in vitro phosphorylation is provided but lacks quantitative information. This list indicates that a significant number of phosphorylation sites are detected in the purified APC/C prior to reaction with purified kinases. Many more sites are detected after in vitro kinase reaction, but it isn't clear how extensively any of the sites are modified. There is reason for caution then, in accepting the conclusions that structures of unphosphorylated and hyperphosphorylated APC/C from S. cerevisiae are nearly identical.

DOI: 10.1038/s41467-024-50462-2

Resource: RRID:BDSC_9752

Curator: @anisehay

SciCrunch record: RRID:BDSC_9752

What is this?

Reviewer #2 (Public Review):

Summary:<br /> In this manuscript the authors examine the question of whether discrete action sequences and coarticulated continuous sequential actions can be produced from the same controller, without having to derive separate control policies for each sequential movement. Using modeling and behavioral experiments, the authors demonstrate that this is indeed possible if the constraints of the policy are appropriately specified. These results are of interest to those interested in motor sequences, but it is unclear whether these findings can be interpreted to apply to the control of sequences more broadly (see weaknesses below).

Strengths:<br /> The authors provide an interesting and novel extension of the stochastic optimal control model to demonstrate how different temporal constraints can lead to either individual or coarticulated movements. The authors use this model to make predictions about patterns of behavior (e.g., in response to perturbations), which they then demonstrate in human participants both by measuring movement kinematics as well as EMG. Together this work supports the authors' primary claims regarding how changes in task instructions (i.e., task constraints) can result in coarticulated or separated movement sequences and the extent to which the subsequent movement goal affects the planning and control of the previous movement.

Weaknesses:<br /> Although this work is quite interesting, it remains unknown whether there is a fundamental distinction between a coarticulated sequence and a single movement passing through a via point (or equivalently, avoiding an obstacle). The notion of a coarticulated sequence brings with it the notion of sequential (sub)movements and temporal structure, whereas the latter can really be treated as more of a constraint on the production of a single continuous movement. The authors suggest that these are not truly different kinds of movements at the level of a control policy, but this remains to be tested experimentally.

It also remains unclear for the theory of optimal feedback control as a whole where and how the cost function and constraints are specified to guide the optimization process. That is, presumably there is the ability for higher-level or explicit description of these constraints, but how they then become incorporated into a control policy remains unclear. With regard to the kind of multi-target constraints proposed here, in typical sequence tasks, while some movements become coarticulated, people also tend to form chunks with distinct chunk boundaries. This presumably means that there is at least some specification of the sequential ordering of these chunks that must exist beyond the control policy and that multiple control policies may still be warranted to execute an entire sequence (otherwise the authors' model might suggest that people can coarticulate forever without needing to exhibit any chunk boundaries). Hence, while the authors fairly convincingly show that a single control policy can lead to separated or coarticulated movements given an appropriate set of constraints, their work does not speak to where or how those constraints are specified, nor to how longer sequences are controlled.

Reviewer #2 (Public Review):

Summary:

This paper addresses an important computational problem in learning and memory. Why do related memory representations sometimes become more similar to each other (integration) and sometimes more distinct (differentiation)? Classic supervised learning models predict that shared associations should cause memories to integrate, but these models have recently been challenged by empirical data showing that shared associations can sometimes cause differentiation. The authors have previously proposed that unsupervised learning may account for these unintuitive data. Here, they follow up on this idea by actually implementing an unsupervised neural network model that updates the connections between memories based on the amount of coactivity between them. The authors use their modeling framework to simulate three recent empirical studies, showing that their model captures aspects of these findings that are hard to account for with supervised learning.

Overall, this is a strong and clearly described work that is likely to have a positive impact on computational and empirical work in learning and memory. While the authors have written about some of the ideas discussed in this paper previously, a fully implemented and openly available model is a clear advance that will benefit the field. It is not easy to translate a high-level description of a learning rule into a model that actually runs and behaves as expected. The fact that the authors have made all their code available makes it likely that other researchers will extend the model in numerous interesting ways, many of which the authors have discussed and highlighted in their paper.

Strengths:

The authors succeed in demonstrating that unsupervised learning with a simple u-shaped rule can produce results that are qualitatively in line with the empirical reports. In each of the three models, the authors manipulate stimulus similarity (following Chanales et al.), shared vs distinct associations (following Favila et al.), or learning strength (a stand-in for blocked versus interleaved learning schedule; following Schlichting et al.). In all cases, with hand-tuning of additional parameters, the authors are able to produce model representations that fit the empirical results, but that can't easily be accounted for by supervised learning. Demonstrating these effects isn't trivial and a formal modeling framework for doing so is a valuable contribution. Overall, the work is very thorough. The authors investigate many different aspects of the learning dynamics (learning rate, oscillation strength, hidden layer overlap etc) in these models and produce several key insights. Of particular value are their demonstrations that when differentiation occurs, it occurs very quickly and asymmetrically and results in anti-correlated representations, as well as the distinction between symmetric and asymmetric integration in their model. The authors thoroughly acknowledge the relative difficulty of producing differentiation in their models relative to integration, and are now more clear about why they don't necessarily view this as mismatch with the empirical data. The authors are also more clear about the complicated activation dynamics in their model and why critical ranges for some parameters can't be given -- the number of interacting parameters mean that there are many combinations that could produce the critical activation dynamics and thus the same result. Despite this complexity, the paper is very clearly written; the authors do a good job of both formally describing their model as well as giving readers a high level sense of how many of their critical model components work.

Weaknesses:

Though the u-shaped learning rule is essential to this framework, the paper doesn't do any formal investigation of this learning rule or comparison with other learning rules. The authors do have a strong theoretical interest in this rule as well as experimental precedent for testing this rule, which they now thoroughly discuss in the paper. Still, a stronger argument in support of the non monotonic plasticity hypothesis could have been made by comparing this learning rule to alternatives. Additionally, the authors' choice of strongly prewiring associations makes it difficult to think about how their model maps onto experimental contexts where associations are only weakly learned. However, the authors thoroughly acknowledge why this was necessary and discuss this limitation in the paper.

Reviewer #2 (Public Review):

The study by Link et al. advances our understanding of the actomyosin system in T. brucei, focusing on the role of TbMyo1, a class I myosin, within the parasite's endosomal system. Using a combination of biochemical fractionation, in vitro motility assays, and advanced imaging techniques such as correlative light and electron microscopy (CLEM), this paper demonstrates that TbMyo1 is dynamically distributed across early and late endosomes, the cytosol, is associated with the cytoskeleton, and a fraction has an unexpected association with glycosomes. Notably, the study shows that TbMyo1 can translocate actin filaments at velocities suggesting an active role in intracellular trafficking, potentially higher than those observed for similar myosins in other cell types. This work not only elucidates the spatial dynamics of TbMyo1 within T. brucei but also suggests its broader involvement in maintaining the complex architecture of the endosomal network, underscoring the critical role of the actomyosin system in a parasite that relies on high rates of endocytosis for immune evasion.

A key strength of the study is its exceptional rigor and successful integration of a wide array of sophisticated techniques, such as in vitro motility assays, and advanced imaging methods, e.g. CLEM. This combination of approaches underscores the study's comprehensive approach to examining the ultrastructural organization of the trypanosome endomembrane system. The application of functional data using inhibitors, such as latrunculin A for actin depolymerization, further strengthens the study by providing insights into the dynamics and regulatory mechanisms of the endomembrane system. This demonstrates how the actomyosin system contributes to cellular morphology and trafficking processes. Furthermore, the discovery of TbMyo1 localization to glycosomes introduces a novel aspect to the potential roles of myosin I proteins within the cell, particularly in the context of organelles analogous to peroxisomes. This observation not only broadens our understanding of myosin I functionality but also opens up new avenues for research into the cell biology of trypanosomatids, marking a significant contribution to the field.

A significant initial weakness was the reliance on spatial association data to infer functional relationships without direct demonstration of biochemical activities in vivo. The authors have since addressed this by including new evidence from TbMyo1 RNAi cell lines and EM data that show the effects of TbMyo1 depletion on cellular ultrastructure. The authors' responses and additional data reinforce their initial conclusions and address previous concerns. Several new, elegant hypotheses are proposed in the discussion that warrant further investigation to fully understand TbMyo1's interactions and regulatory mechanisms in vivo.

Reviewer #2 (Public Review):

Summary:

The authors set out to uncover which brain regions might support the continuous updating of semantic associations thereby showing a system of semantic plasticity. Using fMRI data from participants viewing thousands of natural scene images over 30 recording sessions, they hoped to establish how objects co-occuring with each other within images influences the semantic representations in the human brain that relate to those object concepts.

Strengths:

There is a lot to like about the paper. A major strength of the methods and results is the convincing demonstration of many of the results. This includes showing item representations in the ventral visual pathway and medial temporal lobes (MTL), as we would expect. They also show semantic effects - defined using the word co-occurrence vectors from word2vec, along the posterior and anterior ventral visual pathway and MTL - replicating various past studies. The authors use a creative approach to show that the item representations measured within each session are modulated by the co-occurrence structure in previous trials, becoming more closely related. And that item representations seem to subtly change over the course of the 30 sessions, in that they become less related to each other with increasing distance. However, the semantic effects within each session itself are claimed to remain unchanged.

Weaknesses:

This leads to what I see as a weakness in the study. The conclusions relate to semantic plasticity and the changes in semantic (associative) representations. The drift analyses do appear to show representational changes across the sessions, but this is based on the item representations. The inference is that this is due to an updating of knowledge about the associations each item has had with other items. Yet, in the same regions, the authors suggest that semantic associative effects, as tested using word2vec for each session, remain stable. Doesn't this seem to contradict the claims about semantic plasticity?

Some of this is difficult to unpick as the semantic stability analysis using word2vec in each session is only very briefly mentioned, and the data is not shown (I would include it). So, at present, I feel they show evidence of representational changes but do not show evidence of what the nature of the change is. If the neural representations consistently reflect the long-term semantic associations (which is what word2vec captures), then how does this combine with the drift effects of item representations?

Does it mean that the changes in item representations do not reflect semantic associative knowledge? And reflect some other non-specified type of information (perhaps as the participants are doing an image memory test).

Another potential weakness is the robustness of the drift analysis itself. For the drift analysis, item representations in each session are compared to all other sessions and then averaged according to the number of intervening sessions. This means the data for item representation with a session difference of 1 will be based on 29 data points, a session difference of 2 on 28 data points ... and a session difference of 29 based on 1 data point. So there is a huge imbalance in the amount of data that goes into the analysis for the different numbers of intervening sessions. This leads me to wonder if it could impact the validity of the results. An alternative might be to use 1 datapoint for each session (or a suitable value, I imagine 5 would still give enough data to analyse drifts) and calculate drift, and then repeat this with different partitions of the data to see how stable it is, and if drift is reliably occurring. Alternatively, the analyses they use might have been used and validated previously.

To be clear, I do think this is a very nice study and will have a positive impact on researchers interested in object processing, semantic knowledge, statistical learning, and schemas. But think there are some gaps between what the data shows evidence for, and the ultimate inferences made.

Reviewer #2 (Public Review):

Summary:

This manuscript, "Activation of Polycystin-1 Signaling by Binding of Stalk-derived Peptide Agonists", by Miao and coworkers. The autosomal dominant polycystic kidney disease (ADPKD) is a major form of polycystic kidney disease (PKD). To provide better treatment and avoid side effects associated with currently available options, the authors investigated an interesting GPCR, polycystin-1 (PC1), as a potential therapeutic target. In vitro and in silico studies were combined to identify peptide agonists for PC1 and to elucidate their roles in PC1 signaling. Overall, regarding the significance of the findings, this work described valuable peptide agonists for PC1 and the combined in vitro and in silico approach can be useful to study a complex system like PC1. However, the strength of the evidence is incomplete, as more experiments are needed as controls to validate the computational observations. The work appears premature.

Strengths:

(1) This work first described the experimental discovery of short peptides designed to mimic the stalk region of PC1, followed by computational investigation using docking and MD simulations. PC1 is a complex membrane protein and an emerging target for ADPKD, but it can be challenging to study. The knowledge and the peptide discovery can be valuable and useful to understand the mechanism and potential modulation of PC1.<br /> (2) The authors published the mechanistic study of PC1 and identified key interacting residues such as N3074-S3585 and R3848-E4078, using very similar techniques (PNAS 2022, 119(19), e2113786119). This work furthers this research by identifying peptides that are stalk mimics for PC1 activation.<br /> (3) Eight peptides were designed and tested experimentally first; three were computationally studied with docking and GaMD simulations to understand their mechanism (s).

Weaknesses:

(1) The selectivity of the peptides between PC1 and PC2 remains unknown in this revision.

Overall, my comments were mostly addressed properly.

Reviewer #2 (Public Review):

Summary:

The manuscript by Djebar et al investigated the role and the underlying mechanism of the ciliary transition zone protein Rpgrip1l in zebrafish spinal alignment. They showed that rpgrip1l mutant zebrafish develop a nearly full penetrance of body curvature at juvenile stages. The mutant fish have cilia defects associated with ventricular dilations and loss of the Reissner fibers. Scoliosis onset and progression are also strongly associated with astrogliosis and neuroinflammation, and anti-inflammatory drug treatment prevents scoliosis in mutant zebrafish, suggesting a novel pathogenic mechanism for human idiopathic scoliosis. This study is quite comprehensive with high quality data, and the manuscript is well written, providing important information on how the ciliary transition zone protein functions in maintaining the zebrafish body axis straightness.

Strengths:

Very clear and comprehensive analysis of the mutant zebrafish.

Reviewer #2 (Public Review):

In this manuscript, the authors attempted to study mechanisms of transcription inhibition in cells treated with IR. They observed that unlike transcription inhibition induced by UV damage that depends on histone chaperone HIRA, IR induced transcription inhibition is independent on HIRA. Through a CRISPR/Cas9 screen, they identified protein neddylation is important for transcription inhibition. By sequencing nascent RNA, they observed that down-regulated transcripts upon IR treatment are largely highly transcribed genes including histone genes and rDNA.

This study utilized comprehensive approaches to fill in knowledge gap of IR-induced transcription inhibition.

Comments on current version:

The revised manuscript largely addressed my concerns.

Reviewer #2 (Public Review):

Summary:

In the manuscript by Oestreicher et al, the authors use patch-clamp electrophysiology, immunofluorescent imaging of the cochlea, auditory function tests, and single-unit recordings of auditory afferent neurons to probe the unique properties of calcium signaling in cochlear hair cells that allow rapid and sustained neurotransmitter release. The calcium binding proteins (CaBPs) are thought to modify inactivation of the Cav1.3 calcium channels in IHCs that initiate vesicle fusion, reducing the calcium-dependent inactivation (CDI) of the channels to allow sustained calcium influx to support neurotransmitter release. The authors use knockout mice of Cabp1 and Cabp2 in a double knockout (Cabp1/2 DKO) to show that these molecules are required for enabling sustained calcium currents by reducing CDI, enabling proper IHC neurotransmitter release. They further support their evidence by re-introducing Cabp2 using injection of AAV containing the Cabp2 sequence into the cochlea, which restores some of the auditory function and reduces CDI in patch-clamp recordings.

Strengths:

Overall the data is convincing that Cabp1/2 is required for reducing CDI in cochlear hair cells, allowing their sustained neurotransmitter release and sound encoding. Figures are well-prepared, recordings are careful and stats are appropriate, and the manuscript is well written. The discussion appropriately considers aspects of the data that are not yet explained and await further experimentation.

Weaknesses:

There are some sections of the manuscript that pool data from different experiments with slightly different conditions (wt data from a previous paper, different calcium concentrations, different holding voltages, tones vs clicks, etc). This makes the work harder to follow and more complicated to explain. However, the major conclusion, that that cabp1 and 2 work together to reduce calcium dependent inactivation of L-type calcium channels in cochlear inner hair cells, still holds and is well supported. Another minor weakness is that the authors used injections of AAV containing sequences for Cabp2, but do not present data from sham surgeries. In most cases, the improvement of hearing function with AAV injection is believable and should be attributed to the cabp2 function. However, in at least one instance (Figure 4B), the results of the AAV injection experiments may be overinterpreted - the authors show that upon AAV injection, the hair cells have a much longer calcium current recovery following a large, long depolarization to inactivate the calcium channels. Without comparison to a sham surgery, it is not known if this result could be a subtle result of the surgery or indeed due to the Cabp2 expression. The authors have added text acknowledging this, as appropriate.

Reviewer #3 (Public Review):

In this study, Wang and coworkers established a model of Drosophila-S. marcescens interactions and thoroughly examined host-microbe bidirectional interactions. They found that:

(1) Drosophila larvae directly impact microbial aggregation and density;<br /> (2) Drosophila larvae affect microbial metabolism and cell wall morphology, as evidenced by reduced prodigiosin production and EPS production, respectively;<br /> (3) Drosophila larvae attenuate microbial virulence;<br /> (4) Drosophila larvae modulate the global transcription of microbes for adaptation to the host;<br /> (5) Microbial single-cell RNA sequencing (scRNA-seq) analysis revealed heterogeneity in microbial pathogenicity and growth;<br /> (6) AMPs are key factors controlling microbial virulence phenotypes.

Taken together, they concluded that host immune factors such as AMPs are directly involved in the pathogen-to-commensal transition by altering microbial transcription.

In general, in this revised version, I feel that the authors addressed all the points raised in the previous review process. Specifically, they demonstrated that sub-lethal doses of antibiotics such as kanamycin or ampicillin is sufficient to induce the virulence switch in S. marcescens. Furthermore, by testing IMD pathway mutant animals, they concluded that AMP plays a major role in the commensal-to-pathogen transition. In summary, I appreciate the authors' efforts, and I am satisfied with the revision.

Reviewer #2 (Public Review):

This study by Bell et al. focuses on understanding the roles of two alternatively spliced exons in the single Drosophila Cav2 gene cac. The authors generate a series of cac alleles in which one or the other mutually exclusive exons are deleted to determine the functional consequences at the neuromuscular junction. They find alternative splicing at one exon encoding part of the voltage sensor impacts the activation voltage as well as localization to the active zone. In contrast, splicing at the second exon pair does not impact Cav2 channel localization, but it appears to determine the abundance of the channel at active zones. Together, the authors propose that alternative splicing at the Cac locus enables diversity in Cav2 function generated through isoform diversity generated at the single Cav2 alpha subunit gene encoded in Drosophila.

Overall this is an excellent, rigorously validated study that defines unanticipated functions for alternative splicing in Cav2 channels. The authors have generated an important toolkit of mutually exclusive Cac splice isoforms that will be of broad utility for the field, and show convincing evidence for distinct consequences of alternative splicing of this single Cav2 channel at synapses. Importantly, the authors use electrophysiology and quantitative live sptPALM imaging to determine the impacts of Cac alternative splicing on synaptic function. There are some outstanding questions regarding the mechanisms underlying the changes in Cac localization and function, and some additional suggestions are listed below for the authors to consider in strengthening this study. Nonetheless, this is a compelling investigation of alternative splicing in Cav2 channels that should be of interest to many researchers.

Reviewer #2 (Public Review):

Guan and colleagues address the question of how a single neuroblast produces a defined number of progeny, and what influences its decommissioning. The focus of the experiments are two well-studied RNA-binding proteins: Imp and Syp. The Authors find that these factors play an important role in determining the number of neurons in their preferred model system of VNC motor neurons coming from a single lineage (LinA/15) by separate functions taking place at specific stages of development of this lineage: influencing the life-span of the LinA neuroblast to control its timely decommissioning and functioning in the Late-born post-mitotic neurons to influence cell death after the appropriate number of progeny is generated. The post-mitotic role of Imp/Syp in regulating programmed-cell death (PCD) is also correlated with a specific code of key transcription factors that are suspected to influence neuronal identity, linking the fate of neuronal survival with its specification. This paper addresses a wide scope of phenotypes related to the same factors, thus providing an intriguing demonstration of how the nervous system is constructed by context-specific changes in key developmental regulators. The bulk of conclusions drawn by the authors are supported by careful experimental evidence, and the findings are a useful addition to an important topic in developmental neuroscience.

Reviewer #2 (Public Review):

Summary:

The authors present an interesting technique for analysis of diffusion magnetic resonance images (dMRI) using a sub-diffusion model of the diffusion process. They show that the results of their technique when fitted to dMRI with two diffusion times provide robust diffusion coefficient and kurtosis measures.

Strengths:

The measures provided by the sub-diffusion technique are robust and can be reliably estimated from short dMRI data acquisitions. This is potentially useful in application to clinical studies.

Weaknesses:

The authors do not fully demonstrate that their D* and K* measures are not affected by diffusion time. Potential limitations of the technique are not considered.

This reviewer suggests that the paper would benefit from considerations of the limitations of the applied techniques. This would include consideration of:<br /> (i) The use of the sub-diffusion model in the simulation studies - there are circular arguments that should be considered.<br /> (ii) The time dependence of D* and K*. This is because the human data provided in Tables 3 and 4 (for Δ=19ms and Δ=49ms) seem to show that<br /> D* and K* are time dependent.

With respect to the second point this reviewer acknowledges the authors' argument that when the fitting is performed over the higher dimensional space that includes multiple diffusion times then this leads to a more robust estimation of sub-diffusion measures. However, the authors only include two diffusion times in their in-vivo human analysis (Δ=19ms and Δ=49ms) so it is not possible for them to show here that different pairs of diffusion times lead to invariant D* and K* values. This is a limitation of the study as the authors show there is time dependence of D* and K* in tables 3 and 4 (when the model is fitted to single diffusion times). Potentially the larger apparent time dependence of K* in white matter compared to grey matter (tables 3 and 4) could lead to the tissue specific differences in root mean squared error shown in Figure 7.

This reviewer requests that the authors discuss their results more clearly with respect to these potential limitations and include some discussion of their single (and multiple) diffusion time results (for D_SUB and K*) in comparison with the time dependent DKI literature.

Reviewer #2 (Public Review):

Summary:<br /> Replacing linezolid (L) with the preclinical development candidate spectinamide 1599, administered by inhalation, in the BPaL standard of care regimen achieves similar efficacy, reduces hematological changes and por-inflammatory responses.

Strengths:<br /> The authors not only measure efficacy but also quantify histological changes, hematological responses and immune responses, to provide a comprehensive picture of treatment response and the benefits of the L to S substitution.

The authors generate all data in two mouse models of TB infection, each reproducing different aspects of human histopathology.

Extensive supplementary figures ensure transparency.

Weaknesses:<br /> Articulation of objectives and hypotheses can be improved, as suggested below.

Reviewer #2 (Public Review):

Strengths:

The experiments were well-designed and executed with meticulous control. The analyses of both behavioural and electrophysiological data align with the standards in the field.

Weaknesses:

Many of the findings appear to be subtle differences and incremental compared to previous literature, including the authors' own work. While incremental findings are not necessarily a problem, the manuscript lacks clear statements about the extent to which the dataset, analysis, and findings overlap with the authors' prior research. For example, one of the main findings, which suggests that V4 neurons exhibit larger visual responses in hit trials (as shown in Fig. 3), appears to have been previously reported in their 2017 paper.

Furthermore, the manuscript does not explore potentially interesting aspects of the dataset. For instance, the authors could have investigated instances where monkeys made 'false' reports, such as executing saccades towards visual stimuli when no orientation change occurred, which allows for a broader analysis that considers the perceptual component of neural activity over pure sensory responses. Overall, lacking broad interest with the current form.

Reviewer #2 (Public Review):

Studying Apteronotus leptorhynchus (the weakly electric brown ghost knifefish), the authors provide evidence that 'chirps' (brief modulations in the frequency and amplitude of the ongoing wave-like electric signal) function in active sensing (specifically homeoactive sensing) rather than communication. Chirping is a behavior that has been well studied, including numerous studies on the sensory coding of chirps and the neural mechanisms for chirp generation. Chirps are largely thought to function in communication behavior, so this alternative function is a very exciting possibility that should have a great impact on the field.

The authors provide convincing evidence that chirps may function in homeoactive sensing. In particular, the evidence showing increased chirping in more cluttered environments and a relationship between chirping and movement are especially strong and suggestive. Their evidence arguing against a role for chirps in communication is not as strong. However, based on an extensive review of the literature, the authors conclude, I think fairly, that the evidence arguing in favor of a communication function is limited and inconclusive. Thus, the real strength of this study is not that it conclusively refutes the communication hypothesis, but that it calls this hypothesis into question while also providing compelling evidence in favor of an alternative function.

In summary, although the evidence against a role for chirps in communication is not as strong as the evidence for a role in active sensing, this study presents very interesting data that is sure to stimulate discussion and follow-up studies. The authors acknowledge that chirps could function as both a communication and homeactive sensing signal, and the language arguing against a communication function is appropriately measured. A given electrical behavior could serve both communication and homeoactive sensing. I suspect this is quite common in electric fish (not just in gymnotiforms such as the species studied here, but also in the distantly related mormyrids), and perhaps in other actively sensing species such as echolocating animals.

Reviewer #2 (Public Review):

Summary:

This manuscript reports a comparison of microbial traits and host response traits in a laboratory model of infected granuloma using Mtb strains from different lineages. The authors report increased bacillary growth and granuloma formation, inversely associated with T cell activation that is characterized by CXCL9, granzyme B, and TNF expression. They therefore infer that these T cell responses are likely to be host-protective and that the greater virulence of modern Mtb lineages may be driven by their ability to avoid triggering these responses.

Strengths:

The comparison of multiple Mtb lineages in a granuloma model that enables evaluation of the potential role of multiple host cells in Mtb control offers a valuable experimental approach to studying the biological mechanisms that underpin differential virulence of Mtb lineages that have been previously reported in clinical and epidemiological studies.

Weaknesses:

The study is rather limited to descriptive observations and lacks experiments to test causal relationships between host and pathogen traits. Some of the presentation of the data is difficult to interpret, and some conclusions are not adequately supported by the data.

Reviewer #2 (Public Review):

Choi et al. describe a new approach for enabling input-specific CRISPR-based genome editing in cultured cells. While CRISPR-Cas9 is a broadly applied system across all of biology, one limitation is the difficulty in inducing genome editing based on cellular events. A prior study, from the same group, developed ENGRAM - which relies on activity-dependent transcription of a prime editing guide RNA, which records a specific cellular event as a given edit in a target DNA "tape". However, this approach is limited to the detection of induced transcription and does not enable the detection of broader molecular events including protein-protein interactions or exposure to small molecules. As an alternative, this study envisioned engineering the reconstitution of a split prime editing guide RNA (pegRNA) in a protein-protein interaction (PPI)-dependent manner. This would enable location- and content-specific genome editing in a controlled setting.

The authors explored three different design possibilities for engineering a PPI-dependent split pegRNA. First, they tried splitting pegRNA into a functional sgRNA and corresponding prime editing transRNA, incorporating reverse-complementary dimerization sequences on each guide half. This approach, however, resulted in low editing efficiency across 7 different designs with various complementary annealing template lengths (<2% efficiency). They also tried inserting a self-splicing ribozyme within the pegRNA, which produces a functional pegRNA post-transcriptionally. The incorporation of a split-ribozyme, dependent on a PPI, could have been used to reconstitute the split pegRNA in an event-controlled manner. However again, only modest levels of editing were observed with the self-splicing ribozyme design (<2%). Finally, they tried splitting the pegRNA at the repeat:anti-repeat junction that was used to join the original dual-guide system comprised of a crRNA and tracrRNA, into a single-guide RNA. They incorporated the prime editing features into the tracrRNA half, to create petracrRNA. Dimerization was initially induced by different complementary RNA annealing sequences. Using this design, they were able to induce an editing efficiency of ~28% (compared to 37% efficiency using a positive control epegRNA guide).

Having identified a suitable split pegRNA system, they next sought to induce the reconstitution of the two halves in a PPI-dependent manner. They replaced the complementary RNA annealing sequences with two different RNA aptamers (MS2 and BoxB). MS2 detects the MCP protein, while BoxB detects the LambdaN protein. Close proximity between MCP and LambdaN would thus bring together the two split pegRNA halves, creating a functional pegRNA that would enable prime editing at a specific target site. They demonstrated that they could induce MCP-BoxB proximity by fusing them to different dimerizing protein partners: 1) constitutive epitope-nanobody/antibody pairs such as scFv/GCN4 or NbALFA/ALFA-Tag; 2) split-GFP; or 3) chemically-induced protein pairs such as FKBP/FRB or ABI/PYL. For all of these approaches, they could achieve between ~20-60% normalized editing efficiency (relative to positive control editing levels with epegRNA). Additional mutation of the linkers between the RNA and aptamers could increase editing efficiency but also increase non-specific background editing even in the absence of an induced PPI.

Additional applications of this overall strategy included incorporating the design with different DNA base editors, with the most promising examples shown with the base editors CBE4max and ABE8. It should be noted that these specific examples used a non-physiological LambdaN-MCP direct fusion protein as the "bait" that induced reconstitution of the two halves of the guideRNA, rather than relying on a true induced PPI. They also demonstrated that the recently reported RADARS strategy could be incorporated into their system. In this example, they used an ADAR-guide-RNA to drive the expression of a LambdaN-PCP fusion protein in the presence of a specific target RNA molecule, IL6. This induced LambdaN-PCP protein could then reconstitute the split peg-RNAs to drive prime editing. To enable this last application, they replaced the MS2 aptamer in their pegRNA with the PP7 aptamer that binds the PCP protein (this was to avoid crosstalk with RADARS, which also uses MS2/MCP interaction). Using this strategy, they observed a normalized editing efficiency of around 12% (but observed non-specific editing of around 8% in the absence of the target RNA).

Strengths:

The strengths of this paper include an interesting concept for engineering guide RNAs to enable activity-dependent genome editing in living cells in the future, based on discreet protein-protein interactions (either constitutively, spatially, or chemically induced). Important groundwork is laid down to engineer and improve these guide RNAs in the future (especially the work describing altering the linkers in Supplementary Figure 3 - which provides a path forward).

Weaknesses:

In its current state, the editing efficiency appears too low to be applied in physiological settings. Much of the latter work in the paper relies on a LambdaN-MCP direction fusion protein, rather than two interacting protein pairs. Further characterizations in the future, especially varying the transfection amounts/durations/etc of the various components of the system, would be beneficial to improve the system. It will also be important to demonstrate editing at additional sites; to characterize how long the PPI must be active to enable efficient prime editing; and how reversible the reconstitution of the split pegRNA is.

Reviewer #2 (Public Review):

The authors address the question of differences in the development of the central complex (Cx), a brain structure mainly controlling spatial orientation and locomotion in insects, which can be traced back to the neuroblast lineages that produce the Cx structure. The lineages are called type-II neuroblast (NB) lineages and are assumed to be conserved in insects. While Tribolium castaneum produces a functional larval Cx that only consists of one part of the adult Cx structure, the fan-shaped body, in Drosophila melanogaster a non-functional neuropile primordium is formed by neurons produced by the embryonic type-II NBs which then enter a dormant state and continue development in late larval and pupal stages.

The authors present a meticulous study demonstrating that type-II neuroblast (NB) lineages are indeed present in the developing brain of Tribolium castaneum. In contrast to type-I NB lineages, type-II NBs produce additional intermediate progenitors. The authors generate a fluorescent enhancer trap line called fez/earmuff which prominently labels the mushroom bodies but also the intermediate progenitors (INPs) of the type-II NB lineages. This is convincingly demonstrated by high-resolution images that show cellular staining next to large pointed labelled cells, a marker for type-II NBs in Drosophila melanogaster. Using these and other markers (e.g. deadpan, asense), the authors show that the cell type composition and embryonic development of the type-II NB lineages are similar to their counterparts in Drosophila melanogaster. Furthermore, the expression of the Drosophila type-II NB lineage markers six3 and six4 in subsets of the Tribolium type-II NB lineages (anterior 1-4 and 1-6 type-II NB lineages) and the expression of the Cx marker skh in the distal part of most of the lineages provide further evidence that the identified NB lineages are equivalent to the Drosophila lineages that establish the central complex. However, in contrast to Drosophila, there are 9 instead of 8 embryonic type-II NB lineages per brain hemisphere and the lineages contain more progenitor cells compared to the Drosophila lineages. The authors argue that the higher number of dividing progenitor cells supports the earlier development of a functional Cx in Tribolium.

While the manuscript clearly shows that type-II NB lineages similar to Drosophila exist in Tribolium, it does not considerably advance our understanding of the heterochronic development of the Cx in these insects. First of all, the contribution of these lineages to a functional larval Cx is not clear. For example, how do the described type-II NB lineages relate to the DM1-4 lineages that produce the columnar neurons of the Cx? What is the evidence that the embryonically produced type-II NB lineage neurons contribute to a functional larval Cx? The formation of functional circuits could rely on larval neurons (like in Drosophila) which would make a comparison of embryonic lineages less informative with respect to understanding the underlying variations of the developmental processes. Furthermore, the higher number of progenitors (and consequently neurons) in Tribolium could simply reflect the demand for a higher number of cells required to build the fan-shaped body compared to Drosophila. In addition, the larger lineages in Tribolium, including the higher number of INPs could be due to a greater number of NBs within the individual clusters, rather than a higher rate of proliferation of individual neuroblasts, as suggested. What is the evidence that there is only one NB per cluster? The presented schemes (Fig. 7/12) and description of the marker gene expression and classification of progenitor cells are inconsistent but indicate that NBs and immature INPs cannot be consistently distinguished.

The main difference between Tribolium and Drosophila Cx development with regard to the larval functionality might be that Drosophila type-II NB lineage-derived neurons undergo quiescence at the end of embryogenesis so that the development of the Cx is halted, while a developmental arrest does not occur in Tribolium. However, this needs to be confirmed (as the authors rightly observe).

Reviewer #2 (Public Review):

Summary:

This manuscript describes a comprehensive analysis of signalling downstream of the chemokine receptor CCR7. A comprehensive dataset supports the authors' hypothesis that G protein and beta-arrestin signalling can occur simultaneously at CCR7 with implications for continued signalling following receptor endocytosis.

Strengths:

The experiments are well controlled and executed, employing a wide range of assays using - in the main - CCR7 transfectants. Data are well presented, with the authors' claims supported by the data. The paper also has an excellent narrative which makes it relatively easy to follow. I think this would certainly be of interest to the readership of the journal.

Weaknesses:

Since the authors show a differential enrichment of RhoGTPases by CCR7 stimulation with CCL19 versus CCL21, I think that they also need to show that the Gi/o coupling of HEK-292-CCR7-APEX2 cells to both CCL19 and CCL21 is not perturbed by the modification. Currently, the authors only show data for CCL19 signalling, which leaves the potential for a false negative finding in terms of CCL21 signalling being selectively impaired. This should be relatively easy to do and should strengthen the authors' conclusions.

The authors conclude the discussion by suggesting that their findings highlight endosomal signalling as a general mechanism for chemokine receptors in cell migration. I think this is an overreach. The authors chose several studies of CXC chemokine receptors to support their argument that C-terminal truncation or mutation of the C-terminal phosphorylation sites impairs endocytosis and chemotaxis (refs 40-42). However, in some instances e.g. at the related chemokine receptor CCR4, C-terminal removal of these sites impairs endocytosis but promotes chemotaxis (Nakagawa et al, 2014); Anderson et al, 2020). I therefore think that either the final statement needs to be tempered down or the counterargument discussed a little.

References:

Anderson, C. A. et al. A degradatory fate for CCR4 suggests a primary role in Th2 inflammation. J Leukocyte Biol 107, 455-466 (2020).

Nakagawa, M. et al. Gain-of-function CCR4 mutations in adult T cell leukaemia/lymphoma. Journal of Experimental Medicine 211, 2497-2505 (2014).

Reviewer #2 (Public Review):

Summary:

In this manuscript, Cozzolino et al. demonstrate that inhibition of the Mediator kinase CDK8 and its paralog CDK19 suppresses hyperactive interferon (IFN) signaling in Down syndrome (DS), which results from trisomy of chromosome 21 (T21). Numerous pathologies associated with DS are considered direct consequences of chronic IFN pathway activation, and thus hyperactive IFN signaling lies at the heart of pathophysiology. The collective interrogation of transcriptomics, metabolomics, and cytokine screens in sibling-matched cell lines (T21 vs D21) allows the authors to conclude that Mediator kinase inhibition could mitigate chronic, hyperactive IFN signaling in T21. To probe the functional outcomes of Mediator kinase inhibition, the authors performed cytokine screens, transcriptomic, and untargeted metabolomics. This collective approach revealed that Mediator kinases establish IFN-dependent cytokine responses at least in part through transcriptional regulation of cytokine genes and receptors. Mediator kinase inhibition suppresses cell responses during hyperactive IFN signaling through inhibition of pro-inflammatory transcription factor activity (anti-inflammatory effect) and alteration of core metabolic pathways, including upregulation of anti-inflammatory lipid mediators, which served as ligands for specific nuclear receptors and downstream phenotypic outcomes (e.g., oxygen consumption). These data provided a mechanistic link between Mediator kinase activity and nuclear receptor function. Finally, the authors also disclosed that Mediator kinase inhibition alters splicing outcomes.

Overall, this study reveals a mechanism by which Mediator kinases regulate gene expression and establish that its inhibition antagonizes chronic IFN signaling through collective transcriptional, metabolic, and cytokine responses. The data have implications for DS and other chronic inflammatory conditions, as Mediator kinase inhibition could potentially mitigate pathological immune system hyperactivation.

Strengths:

(1) One major strength of this study is the mechanistic evidence linking Mediator kinases to hyperactive IFN signaling through transcriptional changes impacting cell signaling and metabolism.

(2) Another major strength of this study is the use of sibling-matched cell lines (T21 vs D21) from various donors (not just one sibling pair), and further cross-referencing with data from large cohorts, suggesting that part of the data and conclusions are generalizable.

(3) Another major strength of this study is the combined experimental approach including transcriptomics, untargeted metabolomics, and cytokine screens to define the mechanisms underlying suppression of hyperactive interferon signaling in DS upon Mediator kinase inhibition.

(4) Another major strength of this study is the significance of the work to DS and its potential impact on other chronic inflammatory conditions.

Weakness:

(1) Genetic evidence linking the mentioned nuclear receptors to activation of an anti-inflammatory program upon Mediator kinase inhibition could improve the definition of the mechanism and overall impact of the work.

(2) Page 5 states that "Mediator kinases broadly regulate cholesterol and fatty acid biosynthesis and this was further confirmed by the metabolomics data", but a clear mechanistic explanation was lacking. Likewise, the data suggest but do not prove, that altered lipid metabolites influence the function of nuclear receptors to regulate an anti-inflammatory program in response to Mediator kinase inhibition (p. 6), despite the fact the gene expression changes elicited by Mediator kinase inhibition tracked with downstream metabolic changes.

(3) The figures are outstanding but dense.

(4) Figure 6 (PRO-Seq). The authors refer to pro-inflammatory TFs (e.g. NF-kB/RelA). It is not clear whether the authors have specifically examined TF binding at enhancers or more broadly at every region occupied by the interrogated TFs?

DOI: 10.1007/s12975-024-01285-2

Resource: (Sigma-Aldrich Cat# SAB5700017, RRID:AB_3083690)

Curator: @dhovakimyan1

SciCrunch record: RRID:AB_3083690

What is this?

DOI: 10.1101/2023.07.31.551330

Resource: ZFIN_ZDB-GENO-230622-2

Curator: @olekpark

SciCrunch record: RRID:ZFIN_ZDB-GENO-230622-2

What is this?

DOI: 10.17912/micropub.biology.000908

Resource: ZFIN_ZDB-GENO-090609-2

Curator: @olekpark

SciCrunch record: RRID:ZFIN_ZDB-GENO-090609-2

What is this?

DOI: 10.7554/eLife.91429

Resource: (ZFIN Cat# ZDB-ALT-090506-2,RRID:ZFIN_ZDB-ALT-090506-2)

Curator: @olekpark

SciCrunch record: RRID:ZFIN_ZDB-ALT-090506-2

What is this?

Reviewer #2 (Public Review):

Summary:

This paper investigates deep-sea bacteriophage systems which appear to employ a chronic replication mechanism that is induced or enhanced by polysaccharide addition. Some preliminary evidence for the potential role of auxiliary metabolic genes in aiding phage and/or host proliferation is also provided. The hypothesis being tested is fully supported with solid and convincing evidence and the findings are potentially generalizable with implications for our understanding of polysaccharide-mediated virus-host interactions and carbon cycling in marine ecosystems more broadly.

Strengths:

This paper synthesizes sequencing and phylogenic analyses of two Lentisphaerae bacteria and three phage genomes; electron microscopy imaging of bacterial/phage particles; differential gene expression analyses; differential growth curve analyses, and differential phage proliferation assays to extract insights into whether laminarin and starch can induce both host growth and phage proliferation. The data presented convincingly demonstrate that both host culture density and phage proliferation increase as a result having host, phage, and polysaccharide carbon source together in culture.

Weaknesses:

The AMG-centered elements of the article would be strengthened by more "mechanistic" experiments focusing on identifying "HOW" the polysaccharide processing, transport, and metabolism genes are being used by the phages to either directly increase viral infection/replication or else to indirectly do so by supporting the growth of the host (via mutualism). The concept of "selfishness" in bacterial systems and its potential role in viral life cycles could be more developed. Selfish bacteria are active throughout the water column of the ocean. ISME COMMUN. 3, 11 (2023) (see for instance https://doi.org/10.1038/s43705-023-00219-7) and such "selfish" bacteria sequester metabolizable polysaccharides in their periplasm to advantage (https://www.nature.com/articles/ismej201726). It is plausible that phages may be either hijacking such polysaccharide sequestration mechanisms to improve infectivity and ENTRY or else helping their hosts to grow and proliferate so they can reap the benefits of simply having more hosts to infect. The current work does not clearly distinguish between these two distinct mechanistic possibilities. The paper would be strengthened by a more detailed/clear discussion of this possibility.

Reviewer #2 (Public Review):

This work clarifies neural mechanisms that can lead to a phenomenology consistent with motor preparation in its broader sense. In this context, motor preparation refers to activity that occurs before the corresponding movement. Another property often associated with preparatory activity is a correlation with global movement characteristics such as reach speed (Churchland et al., Neuron 2006), reach angle (Sun et al., Nature 2022), or grasp type (Meirhaeghe et al., Cell Reports 2023). Such activity has notably been observed in premotor and primary motor cortices, and it has been hypothesized to serve as an input to a motor execution circuit. The timing and mechanisms by which such 'preparatory' inputs are made available to motor execution circuits remain however unclear in general, especially in light of the presence of a 'trigger-like' signal that appears to relate to the transition from preparatory dynamics to execution activity (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021).

The preparatory inputs have been hypothesized to fulfill one or several (non-mutually-exclusive) possible objectives. Two notable hypotheses are that these inputs could be shaped to maximize output accuracy under regularization of the input magnitude; or that they may help the flexible re-use of the neural machinery involved in the control of movements in different contexts.

Here, the authors investigate in detail how the former hypothesis may be compatible with the presence of early inputs in recurrent network models driving arm movements, and compare models to data.

Strengths:

The authors are able to deploy an in-depth evaluation of inputs that are optimized for producing an accurate output at a pre-defined time while using a regularization term on the input magnitude, in the case of movements that are thought to be controlled in a quasi-open loop fashion such as reaches.

First, the authors have identified that optimal control theory is a great framework to study this question as it provides methods to find and analyze exact solutions to this cost function in the case of models with linear dynamics. The authors not only use this framework to get an exact assessment of how much pre-movement input arises in large recurrent networks, but also give insight into the mechanisms by which it happens by dissecting in detail low-dimensional networks. The authors find that two key network properties - observability of the readout's nullspace and limited controllability - give rise to optimal inputs that are large before the start of the movement (while the corresponding network activity lies in the nullspace of the readout). Further, the authors numerically investigate the timing of optimized inputs in models with nonlinear dynamics, and find that pre-movement inputs can also arise in these more general networks. The authors also explore how some variations on their model's constraints - such as penalizing the input roughness or changing task contingencies about the go cue timing - affect their results. Finally, the authors point out some coarse-grained similarities between the pre-movement activity driven by the optimized inputs in some of the models they studied, and the phenomenology of preparation observed in the brain during single reaches and reach sequences. Overall, the authors deploy an impressive arsenal of tools and a very in-depth analysis of their models.

Oustanding questions that could lead to interesting follow-up work:

Like all great pieces of research, this article makes it clear where current limitations lie and therefore opens up opportunities for future work.

(1) Though the optimal control theory framework is ideal for determining inputs that minimize output error while regularizing the input norm or other simple input features, it cannot easily account for some other varied types of objectives - especially those that may lead to a complex optimization landscape. For instance, the reusability of parts of the circuit, sparse use of additional neurons when learning many movements, and ease of planning (especially under uncertainty about when to start the movement), may be alternative or additional reasons that could help explain the preparatory activity observed in the brain. It is interesting to note that inputs that optimize the objective chosen by the authors arguably lead to a trade-off in terms of other desirable objectives. Specifically, the inputs the authors derive are time-dependent, so a recurrent network would be needed to produce them and it may not be easy to interpolate between them to drive new movement variants. In addition, these inputs depend on the desired time of output and therefore make it difficult to plan, e.g. in circumstances when timing should be decided depending on sensory signals. Finally, these inputs are specific to the full movement chain that will unfold, so they do not permit reuse of the inputs e.g. in movement sequences of different orders. Of note, the authors have pointed out in the discussion how their framework may be extended in future work to account for some additional objectives, such as inputs' temporal smoothness or some strategies for dealing with go cue timing uncertainty.

(2) Relatedly, if the motor circuits were to balance different types of objectives, the activity and inputs occurring before each movement may be broken down into different categories that may each specialize into their own objective. For instance, previous work (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021) has suggested that inputs occurring before the movement could be broken down into preparatory inputs 'stricto sensu' - relating to the planned characteristics of the movement - and a trigger signal, relating to the transition from planning to execution - irrespective of whether the movement is internally timed or triggered by an external event. The current work does not address which type(s) of early input may be labeled as 'preparatory' or may be thought of as a part of 'planning' computations, or whether these inputs may come from several different source circuits. Future research could investigate these questions using a different approach, for instance, by including structural constraints from brain architecture into a neural network model.

(3) While the authors rightly point out some similarities between the inputs that they derive and observed preparatory activity in the brain, notably during motor sequences, there are also some differences. For instance, while both the derived inputs and the data show two peaks during sequences, the data reproduced from Zimnik and Churchland show preparatory inputs that have a very asymmetric shape that really plummets before the start of the next movement, whereas the derived inputs have larger amplitude during the movement period - especially for the second movement of the sequence. In addition, the data show trigger-like signals before each of the two reaches. Finally, while the data show a very high correlation between the pattern of preparatory activity of the second reach in the double reach and compound reach conditions, the derived inputs appear to be more different between the two conditions. Note that the data would be consistent with separate planning of the two reaches even in the compound reach condition, as well as the re-use of the preparatory input between the compound and double reach conditions. Therefore, different motor sequence datasets - notably, those that would show even more coarticulation between submovements - may be more promising for finding a tight match between the data and the author's inputs. In the future, further analyses in these datasets could help determine whether the coarticulation could be due to simple filtering by the circuits and muscles downstream of M1, planning of movements with adjusted curvature to mitigate the work performed by the muscles while permitting some amount of re-use across different sequences, or - as suggested by the authors - inputs fully tailored to one specific movement sequence that maximize accuracy and minimize the M1 input magnitude.

(4) Though iLQR is a powerful optimization method to find inputs optimizing the author's cost function, it also has some limitations. First, given that it relies on a linearization of the dynamics at each timestep, it has a limited ability to leverage potential advantages of nonlinearities in the dynamics. Second, the iLQR algorithm is not a biologically plausible learning rule and does not account for biological constraints affecting the circuits that produce and process these inputs. Therefore, it might be difficult for the brain to learn to produce the inputs that it finds. Consequently, when observing differences between model and data, this can confound the question of whether it comes from a difference of assumed objective or a difference of optimization procedure or circuit implementation. It remains unclear whether using alternative algorithms with different limitations - for instance, using variants of BPTT to train a separate RNN to produce the inputs in question - could impact some of the results.

(5) Under the objective considered by the authors, the amount of input occurring before the movement might be impacted by the presence of online sensory signals for closed-loop control. Even if the inputs include some sensory activity and/or the RNN activity could represent all general variables (e.g. sensory) whose states can be decoded from M1, the model does not currently include mechanisms that process imperfect (delayed, noisy) sensory feedback to adapt the output in a trial-specific manner. The information related to such sensory feedback cannot be anticipated, and therefore the related input would have to reach the motor cortex after preparation. Thus, it is an open question whether the objective and network characteristics suggested by the authors could also explain the presence of large preparatory activity before e.g. grasping movements that are thought to be more sensory-feedback-driven (Meirhaeghe et al., Cell Reports 2023).

(6) More broadly, with the type of objectives that the authors assume the inputs fulfill, some M1 properties that lead to strong preparation - notably, limited readout controllability - may not be favorable for control in general, so it would be interesting if other objectives and assumptions could robustly lead to strong preparation under more general M1 properties.'

Reviewer #2 (Public Review):

Pyoverdines, siderophores produced by many Pseudomonads, are one of the most diverse groups of specialized metabolites and frequently used as model systems. Thousands of Pseudomonas genomes are available, but large scale analyses of pyoverdines are hampered by the biosynthetic gene clusters (BGCs) being spread across multiple genomic loci and existing tools' inability to accurately predict amino acid substrates of the biosynthetic adenylation (A) domains. The authors present a bioinformatics pipeline that identifies pyoverdine BGCs and predicts the A domain substrates with high accuracy. They tackled a second challenging problem by developing an algorithm to differentiate between outer membrane receptor selectivity for pyoverdines versus other siderophores and substrates. The authors applied their dataset to thousands of Pseudomonas strains, producing the first comprehensive overview of pyoverdines and their receptors and predicting many new structural variants.

The A domain substrate prediction is impressive, including the correction of entries in the MIBiG database. Their high accuracy came from a relatively small training dataset of A domains from 13 pyoverdine BGCs. The authors acknowledge that this small dataset does not include all substrates, and correctly point out that new sequence/structure pairs can be added to the training set to refine the prediction algorithm. The workflow unfortunately cannot differentiate between different variants of Asp and OHOrn. To validate their predictions, they elucidated structures of several new pyoverdines, and their predictions performed well. The authors tested their workflow on Burkholderiales A domains and had good results, suggesting it can be used on other taxa. Skimming through the source code and data, the algorithm itself appears to be sound and a clear improvement over existing tools for pyoverdine BGC annotation.

Predicting outer membrane receptor specificity is likewise a challenging problem and the authors have made a promising achievement by finding specific gene regions that differentiate the pyoverdine receptor FpvA from FpvB and other receptor families. Their predictions were not tested experimentally, but the finding that only predicted FpvA receptors were proximate to the biosynthesis genes lends credence to the predictive power of the workflow. The authors find predicted pyoverdine receptors across an impressive 468 genera, an exciting finding for expanding the role of pyoverdines as public goods beyond Pseudomonas. However, whether or not these receptors can actually recognize pyoverdines (and if so, which structures!) remains to be investigated.

In all, the authors have assembled a rich dataset that will enable large scale comparative genomic analyses. This dataset could be used by a variety of researchers, including those studying natural product evolution, public good eco/evo dynamics, and NRPS engineering.

Reviewer #2 (Public Review):

Summary:

One of the greatest challenges for the spliceosome is to be able to repress the many cryptic splice sites that can occur in both the intronic and exotic sequences of genes. Although many studies have focused on cryptic signals in introns (because of their common involvement in disease) the question still remained open as to the factors that repress cryptic exons in exons. Because exons are normally much shorter than introns, in many cases the problem does not exist. However, in human genes a significant proportion of exons can be considerably longer than the average 150 nt length and this raises the question of how cryptic splicing can be prevented in long exons. To address this question, the authors have focused on the possible role played by an ancient mammalian RBD protein called RBMX. Using a combination of high-throughput and classic splicing methodologies, they have shown that there is a class of RBMX-dependent ultra-long exons connected where the RBMX, RBMXL2 and RBMY paralogs have closely related functional activity in repressing cryptic splice site selection.

Strengths:

In general, the present work sheds light on what has been a rather understudied process in splicing research. The use of iCLIP and RNA-seq data has not only allowed to identify the long exons where cryptic splicing is prevented by the RBMX proteins but has also allowed to identify a network of genes mostly involved in genome stability and transcriptional control where these proteins seem to play a prominent role. This can therefore also shed additional information on the way splicing has shaped evolutionary processes in the mammalian lineage and will therefore be of interest to many researchers in this field.

Weaknesses:

There are no major weaknesses, although some specific aspects of the findings could be addressed more in-depth in the recommendations to authors.

Reviewer #2 (Public Review):

Here I submit my previous review and a great deal of additional information following on from the initial review and the response by the authors.

* Initial Review *

Assessment:

This manuscript is based upon the unprecedented identification of an apparently highly unusual trigeminal nuclear organization within the elephant brainstem, related to a large trigeminal nerve in these animals. The apparently highly specialized elephant trigeminal nuclear complex identified in the current study has been classified as the inferior olivary nuclear complex in four previous studies of the elephant brainstem. The entire study is predicated upon the correct identification of the trigeminal sensory nuclear complex and the inferior olivary nuclear complex in the elephant, and if this is incorrect, then the remainder of the manuscript is merely unsupported speculation. There are many reasons indicating that the trigeminal nuclear complex is misidentified in the current study, rendering the entire study, and associated speculation, inadequate at best, and damaging in terms of understanding elephant brains and behaviour at worst.

Original Public Review:

The authors describe what they assert to be a very unusual trigeminal nuclear complex in the brainstem of elephants, and based on this, follow with many speculations about how the trigeminal nuclear complex, as identified by them, might be organized in terms of the sensory capacity of the elephant trunk.<br /> The identification of the trigeminal nuclear complex/inferior olivary nuclear complex in the elephant brainstem is the central pillar of this manuscript from which everything else follows, and if this is incorrect, then the entire manuscript fails, and all the associated speculations become completely unsupported.

The authors note that what they identify as the trigeminal nuclear complex has been identified as the inferior olivary nuclear complex by other authors, citing Shoshani et al. (2006; 10.1016/j.brainresbull.2006.03.016) and Maseko et al (2013; 10.1159/000352004), but fail to cite either Verhaart and Kramer (1958; PMID 13841799) or Verhaart (1962; 10.1515/9783112519882-001). These four studies are in agreement, but the current study differs.

Let's assume for the moment that the four previous studies are all incorrect and the current study is correct. This would mean that the entire architecture and organization of the elephant brainstem is significantly rearranged in comparison to ALL other mammals, including humans, previously studied (e.g. Kappers et al. 1965, The Comparative Anatomy of the Nervous System of Vertebrates, Including Man, Volume 1 pp. 668-695) and the closely related manatee (10.1002/ar.20573). This rearrangement necessitates that the trigeminal nuclei would have had to "migrate" and shorten rostrocaudally, specifically and only, from the lateral aspect of the brainstem where these nuclei extend from the pons through to the cervical spinal cord (e.g. the Paxinos and Watson rat brain atlases), the to the spatially restricted ventromedial region of specifically and only the rostral medulla oblongata. According to the current paper the inferior olivary complex of the elephant is very small and located lateral to their trigeminal nuclear complex, and the region from where the trigeminal nuclei are located by others appears to be just "lateral nuclei" with no suggestion of what might be there instead.

Such an extraordinary rearrangement of brainstem nuclei would require a major transformation in the manner in which the mutations, patterning, and expression of genes and associated molecules during development occur. Such a major change is likely to lead to lethal phenotypes, making such a transformation extremely unlikely. Variations in mammalian brainstem anatomy are most commonly associated with quantitative changes rather than qualitative changes (10.1016/B978-0-12-804042-3.00045-2).

The impetus for the identification of the unusual brainstem trigeminal nuclei in the current study rests upon a previous study from the same laboratory (10.1016/j.cub.2021.12.051) that estimated that the number of axons contained in the infraorbital branch of the trigeminal nerve that innervate the sensory surfaces of the trunk is approximately 400 000. Is this number unusual? In a much smaller mammal with a highly specialized trigeminal system, the platypus, the number of axons innervating the sensory surface of the platypus bill skin comes to 1 344 000 (10.1159/000113185). Yet, there is no complex rearrangement of the brainstem trigeminal nuclei in the brain of the developing or adult platypus (Ashwell, 2013, Neurobiology of Monotremes), despite the brainstem trigeminal nuclei being very large in the platypus (10.1159/000067195). Even in other large-brained mammals, such as large whales that do not have a trunk, the number of axons in the trigeminal nerve ranges between 400,000 and 500,000 (10.1007/978-3-319-47829-6_988-1). The lack of comparative support for the argument forwarded in the previous and current study from this laboratory, and that the comparative data indicates that the brainstem nuclei do not change in the manner suggested in the elephant, argues against the identification of the trigeminal nuclei as outlined in the current study. Moreover, the comparative studies undermine the prior claim of the authors, informing the current study, that "the elephant trigeminal ganglion ... point to a high degree of tactile specialization in elephants" (10.1016/j.cub.2021.12.051). While clearly the elephant has tactile sensitivity in the trunk, it is questionable as to whether what has been observed in elephants is indeed "truly extraordinary".

But let's look more specifically at the justification outlined in the current study to support their identification of the unusually located trigeminal sensory nuclei of the brainstem.

(1) Intense cytochrome oxidase reactivity<br /> (2) Large size of the putative trunk module<br /> (3) Elongation of the putative trunk module<br /> (4) Arrangement of these putative modules correspond to elephant head anatomy<br /> (5) Myelin stripes within the putative trunk module that apparently match trunk folds<br /> (6) Location apparently matches other mammals<br /> (7) Repetitive modular organization apparently similar to other mammals.<br /> (8) The inferior olive described by other authors lacks the lamellated appearance of this structure in other mammals

Let's examine these justifications more closely.

(1) Cytochrome oxidase histochemistry is typically used as an indicative marker of neuronal energy metabolism. The authors indicate, based on the "truly extraordinary" somatosensory capacities of the elephant trunk, that any nuclei processing this tactile information should be highly metabolically active, and thus should react intensely when stained for cytochrome oxidase. We are told in the methods section that the protocols used are described by Purkart et al (2022) and Kaufmann et al (2022). In neither of these cited papers is there any description, nor mention, of the cytochrome oxidase histochemistry methodology, thus we have no idea of how this histochemical staining was done. In order to obtain the best results for cytochrome oxidase histochemistry, the tissue is either processed very rapidly after buffer perfusion to remove blood or in recently perfusion-fixed tissue (e.g., 10.1016/0165-0270(93)90122-8). Given: (1) the presumably long post-mortem interval between death and fixation - "it often takes days to dissect elephants"; (2) subsequent fixation of the brains in 4% paraformaldehyde for "several weeks"; (3) The intense cytochrome oxidase reactivity in the inferior olivary complex of the laboratory rat (Gonzalez-Lima, 1998, Cytochrome oxidase in neuronal metabolism and Alzheimer's diseases); and (4) The lack of any comparative images from other stained portions of the elephant brainstem; it is difficult to support the justification as forwarded by the authors. It is likely that the histochemical staining observed is background reactivity from the use of diaminobenzidine in the staining protocol. Thus, this first justification is unsupported.<br /> Justifications (2), (3), and (4) are sequelae from justification (1). In this sense, they do not count as justifications, but rather unsupported extensions.

(4) and (5) These are interesting justifications, as the paper has clear internal contradictions, and (5) is a sequelae of (4). The reader is led to the concept that the myelin tracts divide the nuclei into sub-modules that match the folding of the skin on the elephant trunk. One would then readily presume that these myelin tracts are in the incoming sensory axons from the trigeminal nerve. However, the authors note that this is not the case: "Our observations on trunk module myelin stripes are at odds with this view of myelin. Specifically, myelin stripes show no tapering (which we would expect if axons divert off into the tissue). More than that, there is no correlation between myelin stripe thickness (which presumably correlates with axon numbers) and trigeminal module neuron numbers. Thus, there are numerous myelinated axons, where we observe few or no trigeminal neurons. These observations are incompatible with the idea that myelin stripes form an axonal 'supply' system or that their prime function is to connect neurons. What do myelin stripe axons do, if they do not connect neurons? We suggest that myelin stripes serve to separate rather than connect neurons." So, we are left with the observation that the myelin stripes do not pass afferent trigeminal sensory information from the "truly extraordinary" trunk skin somatic sensory system, and rather function as units that separate neurons - but to what end? It appears that the myelin stripes are more likely to be efferent axonal bundles leaving the nuclei (to form the olivocerebellar tract). This justification is unsupported.

(6) The authors indicate that the location of these nuclei matches that of the trigeminal nuclei in other mammals. This is not supported in any way. In ALL other mammals in which the trigeminal nuclei of the brainstem have been reported they are found in the lateral aspect of the brainstem, bordered laterally by the spinal trigeminal tract. This is most readily seen and accessible in the Paxinos and Watson rat brain atlases. The authors indicate that the trigeminal nuclei are medial to the facial nerve nucleus, but in every other species, the trigeminal sensory nuclei are found lateral to the facial nerve nucleus. This is most salient when examining a close relative, the manatee (10.1002/ar.20573), where the location of the inferior olive and the trigeminal nuclei matches that described by Maseko et al (2013) for the African elephant. This justification is not supported.

(7) The dual to quadruple repetition of rostro-caudal modules within the putative trigeminal nucleus as identified by the authors relies on the fact that in the neurotypical mammal, there are several trigeminal sensory nuclei arranged in a column running from the pons to the cervical spinal cord, these include (nomenclature from Paxinos and Watson in roughly rostral to caudal order) the Pr5VL, Pr5DM, Sp5O, Sp5I, and Sp5C. But, these nuclei are all located far from the midline and lateral to the facial nerve nucleus, unlike what the authors describe in the elephants. These rostrocaudal modules are expanded upon in Figure 2, and it is apparent from what is shown that the authors are attributing other brainstem nuclei to the putative trigeminal nuclei to confirm their conclusion. For example, what they identify as the inferior olive in figure 2D is likely the lateral reticular nucleus as identified by Maseko et al (2013). This justification is not supported.

(8) In primates and related species, there is a distinct banded appearance of the inferior olive, but what has been termed the inferior olive in the elephant by other authors does not have this appearance, rather, and specifically, the largest nuclear mass in the region (termed the principal nucleus of the inferior olive by Maseko et al, 2013, but Pr5, the principal trigeminal nucleus in the current paper) overshadows the partial banded appearance of the remaining nuclei in the region (but also drawn by the authors of the current paper). Thus, what is at debate here is whether the principal nucleus of the inferior olive can take on a nuclear shape rather than evince a banded appearance. The authors of this paper use this variance as justification that this cluster of nuclei could not possibly be the inferior olive. Such a "semi-nuclear/banded" arrangement of the inferior olive is seen in, for example, giraffe (10.1016/j.jchemneu.2007.05.003), domestic dog, polar bear, and most specifically the manatee (a close relative of the elephant) (brainmuseum.org; 10.1002/ar.20573). This justification is not supported.

Thus, all the justifications forwarded by the authors are unsupported. Based on methodological concerns, prior comparative mammalian neuroanatomy, and prior studies in the elephant and closely related species, the authors fail to support their notion that what was previously termed the inferior olive in the elephant is actually the trigeminal sensory nuclei. Given this failure, the justifications provided above that are sequelae also fail. In this sense, the entire manuscript and all the sequelae are not supported.

What the authors have not done is to trace the pathway of the large trigeminal nerve in the elephant brainstem, as was done by Maseko et al (2013), which clearly shows the internal pathways of this nerve, from the branch that leads to the fifth mesencephalic nucleus adjacent to the periventricular grey matter, through to the spinal trigeminal tract that extends from the pons to the spinal cord in a manner very similar to all other mammals. Nor have they shown how the supposed trigeminal information reaches the putative trigeminal nuclei in the ventromedial rostral medulla oblongata. These are but two examples of many specific lines of evidence that would be required to support their conclusions. Clearly tract tracing methods, such as cholera toxin tracing of peripheral nerves cannot be done in elephants, thus the neuroanatomy must be done properly and with attention to detail to support the major changes indicated by the authors.

So what are these "bumps" in the elephant brainstem?

Four previous authors indicate that these bumps are the inferior olivary nuclear complex. Can this be supported?

The inferior olivary nuclear complex acts "as a relay station between the spinal cord (n.b. trigeminal input does reach the spinal cord via the spinal trigeminal tract) and the cerebellum, integrating motor and sensory information to provide feedback and training to cerebellar neurons" (https://www.ncbi.nlm.nih.gov/books/NBK542242/). The inferior olivary nuclear complex is located dorsal and medial to the pyramidal tracts (which were not labelled in the current study by the authors but are clearly present in Fig. 1C and 2A) in the ventromedial aspect of the rostral medulla oblongata. This is precisely where previous authors have identified the inferior olivary nuclear complex and what the current authors assign to their putative trigeminal nuclei. The neurons of the inferior olivary nuclei project, via the olivocerebellar tract to the cerebellum to terminate in the climbing fibres of the cerebellar cortex.

Elephants have the largest (relative and absolute) cerebellum of all mammals (10.1002/ar.22425), this cerebellum contains 257 x109 neurons (10.3389/fnana.2014.00046; three times more than the entire human brain, 10.3389/neuro.09.031.2009). Each of these neurons appears to be more structurally complex than the homologous neurons in other mammals (10.1159/000345565; 10.1007/s00429-010-0288-3). In the African elephant, the neurons of the inferior olivary nuclear complex are described by Maseko et al (2013) as being both calbindin and calretinin immunoreactive. Climbing fibres in the cerebellar cortex of the African elephant are clearly calretinin immunopositive and also are likely to contain calbindin (10.1159/000345565). Given this, would it be surprising that the inferior olivary nuclear complex of the elephant is enlarged enough to create a very distinct bump in exactly the same place where these nuclei are identified in other mammals?

What about the myelin stripes? These are most likely to be the origin of the olivocerebellar tract and probably only have a coincidental relationship to the trunk. Thus, given what we know, the inferior olivary nuclear complex as described in other studies, and the putative trigeminal nuclear complex as described in the current study, is the elephant inferior olivary nuclear complex. It is not what the authors believe it to be, and they do not provide any evidence that discounts the previous studies. The authors are quite simply put, wrong. All the speculations that flow from this major neuroanatomical error are therefore science fiction rather than useful additions to the scientific literature.

What do the authors actually have?<br /> The authors have interesting data, based on their Golgi staining and analysis, of the inferior olivary nuclear complex in the elephant.

* Review of Revised Manuscript *

Assessment:

There is a clear dichotomy between the authors and this reviewer regarding the identification of specific structures, namely the inferior olivary nuclear complex and the trigeminal nuclear complex, in the brainstem of the elephant. The authors maintain the position that in the elephant alone, irrespective of all the published data on other mammals and previously published data on the elephant brainstem, these two nuclear complexes are switched in location. The authors maintain that their interpretation is correct, but this reviewer maintains that this interpretation is erroneous. The authors expressed concern that the remainder of the paper was not addressed by the reviewer, but the reviewer maintains that these sequelae to the misidentification of nuclear complexes in the elephant brainstem render any of these speculations irrelevant as the critical structures are incorrectly identified. It is this reviewer's opinion that this paper is incorrect. I provide a lot of detail below in order to provide support to the opinion I express.

Public Review of Current Submission:

As indicated in my previous review of this manuscript (see above), it is my opinion that the authors have misidentified, and indeed switched, the inferior olivary nuclear complex (IO) and the trigeminal nuclear complex (Vsens). It is this specific point only that I will address in this second review, as this is the crucial aspect of this paper - if the identification of these nuclear complexes in the elephant brainstem by the authors is incorrect, the remainder of the paper does not have any scientific validity.

The authors, in their response to my initial review, claim that I "bend" the comparative evidence against them. They further claim that as all other mammalian species exhibit a "serrated" appearance of the inferior olive, and as the elephant does not exhibit this appearance, what was previously identified as the inferior olive is actually the trigeminal nucleus and vice versa.

For convenience, I will refer to IOM and VsensM as the identification of these structures according to Maseko et al (2013) and other authors and will use IOR and VsensR to refer to the identification forwarded in the study under review.<br /> The IOM/VsensR certainly does not have a serrated appearance in elephants. Indeed, from the plates supplied by the authors in response (Referee Fig. 2), the cytochrome oxidase image supplied and the image from Maseko et al (2013) shows a very similar appearance. There is no doubt that the authors are identifying structures that closely correspond to those provided by Maseko et al (2013). It is solely a contrast in what these nuclear complexes are called and the functional sequelae of the identification of these complexes (are they related to the trunk sensation or movement controlled by the cerebellum?) that is under debate.

Elephants are part of the Afrotheria, thus the most relevant comparative data to resolve this issue will be the identification of these nuclei in other Afrotherian species. Below I provide images of these nuclear complexes, labelled in the standard nomenclature, across several Afrotherian species.

(A) Lesser hedgehog tenrec (Echinops telfairi)

Tenrecs brains are the most intensively studied of the Afrotherian brains, these extensive neuroanatomical studies were undertaken primarily by Heinz Künzle. Below I append images (coronal sections stained with cresol violet) of the IO and Vsens (labelled in the standard mammalian manner) in the lesser hedgehog tenrec. It should be clear that the inferior olive is located in the ventral midline of the rostral medulla oblongata (just like the rat) and that this nucleus is not distinctly serrated. The Vsens is located in the lateral aspect of the medulla skirted laterally by the spinal trigeminal tract (Sp5). These images and the labels indicating structures correlate precisely with that provided by Künzle (1997, 10.1016/S0168- 0102(97)00034-5), see his Figure 1K,L. Thus, in the first case of a related species, there is no serrated appearance of the inferior olive, the location of the inferior olive is confirmed through connectivity with the superior colliculus (a standard connection in mammals) by Künzle (1997), and the location of Vsens is what is considered to be typical for mammals. This is in agreement with the authors, as they propose that ONLY the elephants show the variations they report.

Peer Review Image 1.

(B) Giant otter shrew (Potomogale velox)

The otter shrews are close relatives of the Tenrecs. Below I append images of cresyl violet (left column) and myelin (right column) stained coronal sections through the brainstem with the IO, Vsens and Sp5 labelled as per standard mammalian anatomy. Here we see hints of the serration of the IO as defined by the authors, but we also see many myelin stripes across the IO. Vsens is located laterally and skirted by the Sp5. This is in agreement with the authors, as they propose that ONLY the elephants show the variations they report.

Peer Response Image 2.

(C) Four-toed sengi (Petrodromus tetradactylus)

The sengis are close relatives of the Tenrecs and otter shrews, these three groups being part of the Afroinsectiphilia, a distinct branch of the Afrotheria. Below I append images of cresyl violet (left column) and myelin (right column) stained coronal sections through the brainstem with the IO, Vsens and Sp5 labelled as per standard mammalian anatomy. Here we see vague hints of the serration of the IO (as defined by the authors), and we also see many myelin stripes across the IO. Vsens is located laterally and skirted by the Sp5. This is in agreement with the authors, as they propose that ONLY the elephants show the variations they report.

Peer Response Image 3.

(D) Rock hyrax (Procavia capensis)

The hyraxes, along with the sirens and elephants form the Paenungulata branch of the Afrotheria. Below I append images of cresyl violet (left column) and myelin (right column) stained coronal sections through the brainstem with the IO, Vsens and Sp5 labelled as per the standard mammalian anatomy. Here we see hints of the serration of the IO (as defined by the authors), but we also see evidence of a more "bulbous" appearance of subnuclei of the IO (particularly the principal nucleus), and we also see many myelin stripes across the IO. Vsens is located laterally and skirted by the Sp5. This is in agreement with the authors, as they propose that ONLY the elephants show the variations they report.

Peer Review Image 4.

(E) West Indian manatee (Trichechus manatus)

The sirens are the closest extant relatives of the elephants in the Afrotheria. Below I append images of cresyl violet (top) and myelin (bottom) stained coronal sections (taken from the University of Wisconsin-Madison Brain Collection, https://brainmuseum.org, and while quite low in magnification they do reveal the structures under debate) through the brainstem with the IO, Vsens and Sp5 labelled as per standard mammalian anatomy. Here we see the serration of the IO (as defined by the authors). Vsens is located laterally and skirted by the Sp5. This is in agreement with the authors, as they propose that ONLY the elephants show the variations they report.

Peer Review Image 5.

These comparisons and the structural identification, with which the authors agree as they only distinguish the elephants from the other Afrotheria, demonstrate that the appearance of the IO can be quite variable across mammalian species, including those with a close phylogenetic affinity to the elephants. Not all mammal species possess a "serrated" appearance of the IO. Thus, it is more than just theoretically possible that the IO of the elephant appears as described prior to this study.

So what about elephants? Below I append a series of images from coronal sections through the African elephant brainstem stained for Nissl, myelin, and immunostained for calretinin. These sections are labelled according to standard mammalian nomenclature. In these complete sections of the elephant brainstem, we do not see a serrated appearance of the IOM (as described previously and in the current study by the authors). Rather the principal nucleus of the IOM appears to be bulbous in nature. In the current study, no image of myelin staining in the IOM/VsensR is provided by the authors. However, in the images I provide, we do see the reported myelin stripes in all stains - agreement between the authors and reviewer on this point. The higher magnification image to the bottom left of the plate shows one of the IOM/VsensR myelin stripes immunostained for calretinin, and within the myelin stripes axons immunopositive for calretinin are seen (labelled with an arrow). The climbing fibres of the elephant cerebellar cortex are similarly calretinin immunopositive (10.1159/000345565). In contrast, although not shown at high magnification, the fibres forming the Sp5 in the elephant (in the Maseko description, unnamed in the description of the authors) show no immunoreactivity to calretinin.

Peer Review Image 6.

Peripherin Immunostaining

In their revised manuscript the authors present immunostaining of peripherin in the elephant brainstem. This is an important addition (although it does replace the only staining of myelin provided by the authors which is unusual as the word myelin is in the title of the paper) as peripherin is known to specifically label peripheral nerves. In addition, as pointed out by the authors, peripherin also immunostains climbing fibres (Errante et al., 1998). The understanding of this staining is important in determining the identification of the IO and Vsens in the elephant, although it is not ideal for this task as there is some ambiguity. Errante and colleagues (1998; Fig. 1) show that climbing fibres are peripherin-immunopositive in the rat. But what the authors do not evaluate is the extensive peripherin staining in the rat Sp5 in the same paper (Errante et al, 1998, Fig. 2). The image provided by the authors of their peripherin immunostaining (their new Figure 2) shows what I would call the Sp5 of the elephant to be strongly peripherin immunoreactive, just like the rat shown in Errant et al (1998), and moreover in the precise position of the rat Sp5! This makes sense as this is where the axons subserving the "extraordinary" tactile sensitivity of the elephant trunk would be found (in the standard model of mammalian brainstem anatomy). Interestingly, the peripherin immunostaining in the elephant is clearly lamellated...this coincides precisely with the description of the trigeminal sensory nuclei in the elephant by Maskeo et al (2013) as pointed out by the authors in their rebuttal. Errante et al (1998) also point out peripherin immunostaining in the inferior olive, but according to the authors this is only "weakly present" in the elephant IOM/VsensR. This latter point is crucial. Surely if the elephant has an extraordinary sensory innervation from the trunk, with 400,000 axons entering the brain, the VsensR/IOM should be highly peripherin-immunopositive, including the myelinated axon bundles?! In this sense, the authors argue against their own interpretation - either the elephant trunk is not a highly sensitive tactile organ, or the VsensR is not the trigeminal nuclei it is supposed to be.

Summary:

(1) Comparative data of species closely related to elephants (Afrotherians) demonstrates that not all mammals exhibit the "serrated" appearance of the principal nucleus of the inferior olive.

(2) The location of the IO and Vsens as reported in the current study (IOR and VsensR) would require a significant, and unprecedented, rearrangement of the brainstem in the elephants independently. I argue that the underlying molecular and genetic changes required to achieve this would be so extreme that it would lead to lethal phenotypes. Arguing that the "switcheroo" of the IO and Vsens does occur in the elephant (and no other mammals) and thus doesn't lead to lethal phenotypes is a circular argument that cannot be substantiated.

(3) Myelin stripes in the subnuclei of the inferior olivary nuclear complex are seen across all related mammals as shown above. Thus, the observation made in the elephant by the authors in what they call the VsensR, is similar to that seen in the IO of related mammals, especially when the IO takes on a more bulbous appearance. These myelin stripes are the origin of the olivocerebellar pathway and are indeed calretinin immunopositive in the elephant as I show.

(4) What the authors see aligns perfectly with what has been described previously, the only difference being the names that nuclear complexes are being called. But identifying these nuclei is important, as any functional sequelae, as extensively discussed by the authors, is entirely dependent upon accurately identifying these nuclei.

(4) The peripherin immunostaining scores an own goal - if peripherin is marking peripheral nerves (as the authors and I believe it is), then why is the VsensR/IOM only "weakly positive" for this stain? This either means that the "extraordinary" tactile sensitivity of the elephant trunk is non-existent, or that the authors have misinterpreted this staining. That there is extensive staining in the fibre pathway dorsal and lateral to the IOR (which I call the spinal trigeminal tract), supports the idea that the authors have misinterpreted their peripherin immunostaining.

(5) Evolutionary expediency. The authors argue that what they report is an expedient way in which to modify the organisation of the brainstem in the elephant to accommodate the "extraordinary" tactile sensitivity. I disagree. As pointed out in my first review, the elephant cerebellum is very large and comprised of huge numbers of morphologically complex neurons. The inferior olivary nuclei in all mammals studied in detail to date, give rise to the climbing fibres that terminate on the Purkinje cells of the cerebellar cortex. It is more parsimonious to argue that, in alignment with the expansion of the elephant cerebellum (for motor control of the trunk), the inferior olivary nuclei (specifically the principal nucleus) have had additional neurons added to accommodate this cerebellar expansion. Such an addition of neurons to the principal nucleus of the inferior olive could readily lead to the loss of the serrated appearance of the principal nucleus of the inferior olive and would require far less modifications in the developmental genetic program that forms these nuclei. This type of quantitative change appears to be the primary way in which structures are altered in the mammalian brainstem.

Reviewer #2 (Public Review):<br /> Summary:<br /> This study used a novel diffusion-weighted pseudo-continuous arterial spin labelling (pCASL) technique to simultaneously explore age- and sex-related differences in brain tissue perfusion (i.e., cerebral blood flow (CBF) & arterial transit time (ATT) - a measure of CBF delivery to brain tissue) and blood-brain barrier (BBB) function, measured as the water exchange (kw) across the BBB. While age- and sex-related effects on CBF are well known, this study provides new insights to support the growing evidence of these important factors in cerebrovascular health, particularly in BBB function. Across the brain, decline in CBF and BBB function (kw) and elevation in ATT was reported in older adults, after the age of 60 and more so in males compared to females. This was also evident in key cognitive regions including the insular, prefrontal, and medial temporal regions, stressing the consideration of age and sex in these brain physiological assessments.

Strengths:<br /> Simultaneous assessment of CBF with BBB along with transit time and at the voxel-level helped elucidate the brain's vulnerability to age and sex-effects. It is apparent that the investigators carefully designed this study to assess regional associations of age and sex with attention to exploring potential non-linear effects.

Weaknesses:<br /> It appears that no brain region showed concurrent CBF and BBB dysfunction (kw), based on the results reported in the main manuscript and supplemental information. Was an association analysis between CBF and kw performed? There is a potential effect of the level of formal education on CBF (PMID: 12633147; 15534055), which could have been considered and accounted for as well, especially for a cohort with stated diversity (age, race, sex).

Reviewer #2 (Public Review):

Summary:

In this manuscript, Peng et al., reported that 36THz high-frequency terahertz stimulation (HFTS) can suppress the activity of pyramidal neurons through enhancing the conductance of voltage-gated potassium channel. The authors also demonstrated the effectiveness of using 36THz HFTS for treating neuropathic pain.

Strengths:

The manuscript is well written and the conclusions are supported by robust results. This study highlighted the potential of using 36THz HFTS for neuromodulation.

Weaknesses:

More characterization of HFTS is needed, so the readers can have a better assessment of the potential usage of HFTS in their own applications.

Reviewer #2 (Public Review):

Summary:

Cancer treatments are not just about the tumor - there is an ever-increasing need for treating pain, fatigue, and anhedonia resulting from the disease as patients are undergoing successful but prolonged bouts with cancer. Using an implantable oral tumor model in the mouse, Barr et al describe neural infiltration of tumors, and posit that these nerve fibers are transmitting pain and other sensory signals to the brain that reduce pleasure and motivation. These findings are in part supported by anatomical and transcriptional changes in the tumor that suggest sensory innervation, neural tracing, and neural activity measurements. Further, the authors conduct behavior assays in tumor-bearing animals and inhibit/ablate pain sensory neurons to suggest involvement of local sensory innervation of tumors in mediating cancer-induced malaise.

Strengths:

• This is an important area of research that may have implications for improving the quality of life of cancer patients.

• The studies use a combination of approaches (tracing and anatomy, transcriptional, neural activity recordings, behavior assays, loss-of-function) to support their claims.

• Tracing experiments suggest that tumor-innervating afferents are connected to brain nuclei involved in oral pain sensing. Consistent with this, the authors observed increased neural activity in those brain areas of tumor-bearing animals. It should be noted that some of these brain nuclei have also been implicated in cancer-induced behavioral alterations in non-head and neck tumor models.

• Experiments are well-controlled and approaches are validated.

• The paper is well-written and the layout was easy to follow.

Weaknesses/Future Directions:

• The main claim is that tumor-infiltrating nerves underlie cancer-induced behavioral alterations. While the studies are supportive of this conclusion, manipulations in the current study are non-specific, ablating all TRPV1 sensory neurons. A direct test would be to selectively inhibit/ablate nerve fibers innervating the tumor or mouth region.

Reviewer #2 (Public Review):

Summary

The authors aimed to investigate the functionality of the GnRH (gonadotropin-releasing hormone) pulse generator in different mouse models to understand its role in reproductive physiology and its implications for conditions like polycystic ovary syndrome (PCOS). They compared the GnRH pulse generator activity in control mice, peripubertal androgen (PPA) treated mice, and prenatal androgen (PNA) exposed mice. The study sought to elucidate how androgen exposure affects the GnRH pulse generator and subsequent LH (luteinizing hormone) secretion, contributing to the pathophysiology of PCOS.

Strengths

(1) Comprehensive Model Selection: The use of both PPA and PNA mouse models allows for a comparative analysis that can distinguish the effects of different timings of androgen exposure.

(2) Detailed Methodology: The methods employed, such as photometry recordings and serial blood sampling, are robust and allow for precise measurement of GnRH pulse generator activity and LH secretion.

(3) Clear Results Presentation: The experimental results are well-documented with appropriate statistical analyses, ensuring the findings are reliable and reproducible.

(4) Relevance to PCOS: The study addresses a significant gap in understanding the neuroendocrine mechanisms underlying PCOS, making the findings relevant to both basic science and potentially clinical research.

Weaknesses

(1) Model Limitations: While the PNA mouse model is suggested as the most appropriate for studying PCOS, the authors acknowledge that it does not completely replicate the human condition, particularly the elevated LH response seen in women with PCOS.

(2) Complex Data Interpretation: The reduced progesterone feedback and its effects on the GnRH pulse generator in PNA mice add complexity to data interpretation, making it challenging to draw straightforward conclusions.

(3) Machine Learning (ML) Selection and Validation: While k-means clustering is a useful tool for pattern recognition, the manuscript lacks detailed justification for choosing this specific algorithm over other potential methods. The robustness of clustering results has not been validated.

(4) Biological Interpretability: Although the machine learning approach identified cyclical patterns, the biological interpretation of these clusters in the context of PCOS is not thoroughly discussed. A deeper exploration of how these clusters correlate with physiological and pathological states could enhance the study's impact.

(5) Sample Size: The study uses a relatively small number of animals (n=4-7 per group), which may limit the generalisability of the findings. Larger sample sizes could provide more robust and statistically significant results.

(6) Scope of Application: The findings, while interesting, are primarily applicable to mouse models. The translation to human physiology requires cautious interpretation and further validation.

Reviewer #2 (Public Review):

Nichols et al studied the role of axon guidance molecules and their receptors and how these work as long-range and/or local cues, using in-vivo time-lapse imaging in C. elegans. They found that the Netrin axon guidance system works in different modes when acting as a long-range (chemotaxis) cue vs local cue (haptotaxis). As an initial context, they take advantage of the postembryonic-born neuron, PDE, to understand how its axon grows and then is guided into its target. They found that this process occurs in various discrete steps, during which the growth cone migrates and pauses at specific structures, such as the vSLNC. The role of the UNC-6/Netrin and UNC-40/DCC axon guidance ligand-receptor pair was then looked at in terms of its requirement for<br /> (1) initial axon outgrowth direction<br /> (2) stabilization at the intermediate target<br /> (3) directional branching from the sublateral region or<br /> (4) ventral growth from the intermediate target to the VNC.

They found that each step is disrupted in the unc-6/Netrin and unc-40/DCC mutants and observed how the localization of these proteins changed during the process of axon guidance in wild-type and mutant contexts. These observations were further supported by analysis of a mutant important for the regulation of Netrin signaling, the E3 ubiquitin ligase madd-2/Trim9/Trim67. Remarkably, the authors identified that this mutant affected axonal adhesion and stabilization, but not directional growth. Using membrane-tethered UNC-6 to specific localities, they then found this to be a consequence of the availability of UNC-6 at specific localities within the axon growth path. Altogether, this data and in-vivo analysis provide compelling evidence of the mechanistic foundation of Netrin-mediated axon guidance and how it works step by step.

The conclusions are well-supported, with both imaging and quantification of each step of axon guidance and localization of UNC-6 and UNC-40. Using a different type of neuron to validate their findings further supports their conclusions and strengthens their model. It's not yet known whether this model holds true for other ligand-receptor pairs, but the current work sets the stage for future analysis of other axon guidance molecules using time-lapse in-vivo imaging. There are still two outstanding questions that are important to address to support the authors' model and conclusions.

(1) The results of UNC-6-TM expression at different locations are clear and support the conclusions but need to consider that there's no diffusible UNC-6 available. What would happen if UNC-6 is tethered to the membrane in an otherwise completely 'normal' UNC-6 gradient. Does the axon guidance ensue normally or does it get stuck in the respective site of the membrane tethered-UNC-6 and doesn't continue to outgrow properly? This is an important control (expression of the UNC-6-TM at the vSLNC or VNC in the wild type background) that would help clarify this question and gain a better insight into the separability of both axon guidance steps and the ability to manipulate these.

(2) Axon guidance systems do not work in a vacuum and are generally competing against each other. For example, the SLT-1/Slit and SAX-3/ROBO axon guidance ligand-receptor pair is also required for PDE, and other post-embryonic neurons, axon guidance. It would be interesting to test mutants for these genes with the membrane tethered-UNC-6 to determine if the different steps of axon guidance are disrupted and if so, to what degree these are disrupted.

Reviewer #2 (Public Review):

The study by Setogawa et al. aims to understand the role that different striatal subregions belonging to parallel brain circuits have in associative learning and discrimination learning (S-O-R and S-R tasks). Strengths of the study are the use of multiple methodologies to measure and manipulate brain activity in rats, from microPET imaging to excitotoxic lesions and multielectrode recordings across anterior dorsolateral (aDLS), posterior ventral lateral (pVLS)and dorsomedial (DMS) striatum.

The main conclusions are that the aDLS promotes stimulus-response association and suppresses response-outcome associations. The pVLS is engaged in the formation and maintenance of the stimulus-response association. There is a lot of work done and some interesting findings however, the manuscript can be improved by clarifying the presentation and reasoning. The inclusion of important controls will enhance the rigor of the data interpretation and conclusions.

Reviewer #2 (Public Review):

Summary:

Li and colleagues applied virtual reality (VR) based training to create different navigational experiences for a set of visually similar scenes. They found that participants were better at visually discriminating scenes with different navigational experiences compared to scenes with similar navigational experiences. Moreover, this experience-based effect was also reflected in the fMRI data, with the PPA showing higher discriminability for scenes with different navigational experiences. Together, their results suggest that previous navigational experiences shape visual scene representation.

Strengths:

(1) The work has theoretical value as it provides novel evidence to the ongoing debate between visual and non-visual contributions to scene representation. While the idea that visual scene representation can encode navigational affordances is not new (e.g., Bonner & Epstein, 2017, PNAS), this study is one of the first to demonstrate that navigational experiences can causally shape visual scene representation. Thus, it serves as a strong test for the hypothesis that our visual scene representations involve encoding top-down navigational information.

(2) The training paradigm with VR is novel and has the potential to be used by the broader community to explore the impact of experience on other categorical visual representations.

(3) The converging evidence from behavioral and fMRI experiments consolidates the work's conclusion.

Weaknesses:

(1) While this work attempts to demonstrate the effect of navigational experience on visual scene representation, it's not immediately clear to what extent such an effect necessarily reflects altered visual representations. Given that scenes in the navigable condition were more explored and had distinct contextual associations than scenes in the non-navigable condition (where participants simply turned around), could the shorter response time for a scene pair with mismatched navigability be explained by the facilitation of different contextual associations or scene familiarities, rather than changes in perceptual representations? Especially when the visual similarity of the scenes was high and different visual cues might not have been immediately available to participants, the different contextual associations and/or familiarity could serve as indirect cues to facilitate participants' judgment, even if perceptual representations remained intact.

(2) Similarly, the above-chance fMRI classification results in the PPA could also be explained by the different contextual associations and/or scene familiarities between navigable and non-navigable scenes, rather than different perceptual processes related to scene identification.

(3) For the fMRI results, the specificity of the experience effect on the PPA is not strictly established, making the statement "such top-down effect was unique to the PPA" groundless. A significant interaction between navigational conditions and ROIs would be required to make such a claim.

(4) For the behavioral results, the p-value of the interaction between groups and the navigational conditions was 0.05. I think this is not a convincing p-value to rule out visual confounding for the training group. Moreover, from Figure 2B, there appears to be an outlier participant in the control group who deviates dramatically from the rest of the participants. If this outlier is excluded, will the interaction become even less significant?

(5) Experiment 1 only consists of 25 participants in each group. This is quite a small sample size for behavioral studies when there's no replication. It would be more convincing if an independent pre-registered replication study with a larger sample size could be conducted.

A Quick Overview on the Groma Kolibri by [[Typewriter Chicago]]

Lucas Dul loves the Groma Kolibri as one of the finest (ultraportable) typewriters out there.

He also loves the Omega 2 (which is nearly identical to the Princess 200.)

“Analysts need to be able to dissect exactly how the AI reached a particular conclusion or recommendation,” “Neo4j enables us to enforce robust information security by applying access controls at the subgraph level.” Chief Business Officer Eric Costantini.

Reviewer #2 (Public Review):

In the current study, Li et al. developed a novel approach that aligns chronological age to a cross-species brain age prediction model to investigate the evolutionary effect. This method revealed some interesting findings, like the brain-age gap of the macaque model in predicting human age will increase as chronological age increases, suggesting an evolutionary alignment between the macaque brain and the human brain in the early stage of development. This study exhibits ample novelty and research significance. However, I still have some concerns regarding the reliability of the current findings.

(1) Although the authors named their new method a "cross-species" model, the current study only focused on the prediction between humans and macaques. It would be better to discuss whether their method can also generalize to cross-species examination of other species (e.g., C. elegans), which may provide more comprehensive evolutionary insights. Also, other future directions with their new method are worth discussing.

(2) Algorithm of prediction model. In the method section, the authors only described how they chose features, but did no description about the algorithm (e.g., supporting vector regression) they used. Please add relevant descriptions to the methods.

(3) Sex difference. The sex difference results are strange to me. For example, in the second row of Figure Supplement 3A, different models show different correlation patterns, but why their Pearson's r is all equal to 0.3939? If they are only typo errors, please correct them. The authors claimed that they found no sex difference. However, the results in Figure Supplement 3 show that, the female seems to have poorer performance in predicting macaque age from the human model. Moreover, accumulated studies have reported sex differences in developing brains (Hines, 2011; Kurth et al., 2021). I think it is also worth discussing why sex differences can't be found in the evolutionary effect.

Reference:<br /> Hines, M. (2011). Gender development and the human brain. Annual review of neuroscience, 34, 69-88.<br /> Kurth, F., Gaser, C., & Luders, E. (2021). Development of sex differences in the human brain. Cognitive Neuroscience, 12(3-4), 155-162.

Reviewer #2 (Public Review):

In "Multi-modal Neural Correlates of Childhood Psychopathology" Krebets et al. integrate multi-modal neuroimaging data using machine learning to delineate dissociable links to diverse dimensions of psychopathology in the ABCD sample. This paper had numerous strengths including a superb use of a large resource dataset, appropriate analyses, beautiful visualizations, clear writing, and highly interpretable results from a data-driven analysis. Overall, I think it would certainly be of interest to a general readership.

That being said, I do have several comments for the authors to consider.

- Out-of-sample testing: while the permutation testing procedure for the PLS is entirely appropriate, without out-of-sample testing the reported effect sizes are likely inflated.

- Site/family structure: it was unclear how site/family structure were handled as covariates.

- Anatomical features: I was a bit surprised to see volume, surface area, and thickness all evaluated - and that there were several comments on the correspondence between the SA and volume in the results section. Given that cortical volume is simply a product of SA and CT (and mainly driven by SA), this result may be pre-required.

- Ethnicity: the rationale for regressing ethnicity from the data was unclear and may conflict with current best practices.

- Data quality: the authors did an admirable job in controlling for data quality in the analyses of functional connectivity data. However, it is unclear if a comparable measure of data quality was used for the T1/dMRI analyses. This likely will result in inflated effect sizes in some cases; it has the potential to reduce sensitivity to real effects.

Reviewer #2 (Public Review):

This is, to my knowledge, the most scalable method for phylogenetic placement that uses likelihoods. The tool has an interesting and innovative means of using gaps, which I haven't seen before. In the validation the authors demonstrate superior performance to existing tools for taxonomic annotation (though there are questions about the setup of the validation as described below).

The program is written in C with no library dependencies. This is great. However, I wasn't able to try out the software because the linking failed on Debian 11, and the binary artifact made by the GitHub Actions pipeline was too recent for my GLIBC/kernel. It'd be nice to provide a binary for people stuck on older kernels (our cluster is still on Ubuntu 18.04). Also, would it be hard to publish your .zipped binaries as packages?

Thank you for publishing your source files for the validation on zenodo. Please provide a script that would enable the user to rerun the analysis using those files, either on zenodo or on GitHub somewhere.

The validations need further attention as follows.

First, the authors have not chosen data sets that are not well-aligned with real-world use cases for this software, and as a result, its applicability is difficult to determine. First, the leave-one-species-out experiment made use of COI gene sequences representing 253 species from the order Charadriiformes, which includes bird species such as gulls and terns. What is the reasoning for selecting this data set given the objective of demonstrating the utility of Tronko for large scale community profiling experiments which by their nature tend to include microorganisms as subjects? If the authors are interested in evaluating COI (or another gene target) as a marker for characterizing the composition of eukaryotic populations, is the heterogeneity and species distribution of bird species within order Charadriiformes comparable to what one would expect in populations of organisms that might actually be the target of a metagenomic analysis?

Second, It appears that experiments evaluating performance for 16S were limited to reclassification of sequencing data from mock communities described in two publications, Schirmer (2015, 49 bacteria and 10 archaea, all environmental), and Gohl (2016; 20 bacteria - this is the widely used commercial mock community from BEI, all well-known human pathogens or commensals). The authors performed a comparison with kraken2, metaphlan2, and MEGAN using both the default database for each as well as the same database used for Tronko (kudos for including the latter). This pair of experiments provide a reasonable high-level indication of Tronko's performance relative to other tools, but the total number of organisms is very limited, and particularly limited with respect to the human microbiome. It is also important to point out that these mock communities are composed primarily of type strains and provide limited species-level heterogeneity. The performance of these classification tools on type strains may not be representative of what one would find in natural samples. Thus, the leave-one-individual-out and leave-one-species-out experiments would have been more useful and informative had they been applied to extended 16S data sets representing more ecologically realistic populations.

Finally, the authors should describe the composition of the databases used for classification as well as the strategy (and toolchain) used to select reference sequences. What databases were the reference sequences drawn from and by what criteria? Were the reference databases designed to reflect the composition of the mock communities (and if so, are they limited to species in those communities, or are additional related species included), or have the authors constructed general purpose reference databases? How many representatives of each species were included (on average), and were there efforts to represent a diversity of strains for each species? The methods should include a section detailing the construction of the data sets: as illustrated in this very study, the choice of reference database influences the quality of classification results, and the authors should explain the process and design considerations for database construction.

Reviewer #2 (Public Review):

In this manuscript by Perez-Lopez et al., the authors investigate the role of the chemokine CCL28 during bacterial infections in mucosal tissues. This is a well-written study with exciting results. They show a role for CCL28 in promoting neutrophil accumulation to the guts of Salmonella-infected mice and to the lung of mice infected with Acinetobacter. Interestingly, the functional consequences of CCL28 deficiency differ between infections with the two different pathogens, with CCL28-deficiency increasing susceptibility to Salmonella, but increasing resistance to Acinetobacter. The underlying mechanistic reasons for this suggest roles for CCL28 in enhanced neutrophil antimicrobial activity, production of reactive oxygen species, and formation of extracellular traps. However, additional experiments are required to shore up these mechanisms, including addressing the role of other CCL28-dependent cell types and further characterization of neutrophils from CCL28-deficient mice.

Reviewer #2 (Public Review):

This work describes a novel bipotent differentiation capacity of human muscle progenitors marked by CD56 and CD29. In addition to previously well-known myogenic differentiation potential, the authors discovered these progenitors could also be induced into tenocyte-like cells. They describe the sorted CD56+/CD29+ cells not only differentiate into tenocytes in vitro; they were also able to engraft into injured tendons and repair damaged tendons when transplanted into nude mice. Human MuSC transplantation improved the locomotor function and physiological strength of the tendon-injured mice. The authors further observed that this bipotent differentiation potential was specific to human MuSC, the same cell population isolated from mice remains unipotent to myogenic differentiation and not capable of tenocytic differentiation.

The discovery of the tenocyte differentiation potential of human CD56+/CD29+ MuSCs provides a potential cell therapeutic option for tendon injury. This work may have a significant clinical impact on improving treatment outcomes for patients suffering from tendon injury.

Strength of the paper:

Multimodal experimental approach using both in vitro and in vivo experiments provided strong proof for the differentiation capacity of the human MuSCs into tenocytes, and the potential clinical implication of these cells in the treatment of tendon injury in patients by in vivo transplantation assay. Using RNA sequencing to characterise the differentiated myocytic and tenocytic populations proved global expression profile data which have shown non-biased efficiency information to the in vitro differentiated cells.

The comparison of differentiation potentials of human and mouse MuSCs is interesting and clinically meaningful. This work illustrates that animal studies may not always be clinically relevant in studying human diseases and treatment modalities.

Weaknesses:

scRNAseq assay using total mononuclear cell population did not provide meaningful insight that enriched knowledge on CD56+/CD29+ cell population. CD56+/CD29+ cells information may have been lost due to the minority identity of these cells in the total skeletal muscle mononuclear population, especially given the total cell number used for scRNAseq was very low and no information on participant number and repeat sample number used for this assay. Using this data to claim a stem cell lineage relationship for MuSCs and tenocytes may not convincing, as seeing both cell types in the total muscle mononuclear population does not establish a lineage connection between them.

The TGF-b pathway assay uses a small molecular inhibitor of TGF-b to probe Smad2/3. The assay conclusion regarding Smad2/3 pathway responsible for tenocyte differentiation may be overinterpretation without Smad2/3 specific inhibitors being applied in the experiments.

Reviewer #2 (Public Review):

This manuscript offers significant insights into the impact of maternal obesity on oocyte methylation and its transgenerational effects. The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, to explore how high-fat diet (HFD)-induced obesity alters genomic methylation in oocytes and how these changes are inherited by subsequent generations. The findings suggest that maternal obesity induces hyper-methylation in oocytes, which is partly transmitted to F1 and F2 oocytes and livers, potentially contributing to metabolic disorders in offspring. Notably, the study identifies melatonin as a key regulator of this hyper-methylation process, mediated through the cAMP/PKA/CREB pathway.

Strengths:

The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, and provides convincing data.

Weaknesses:

The description in the results section is somewhat verbose. This section (lines 126~227) utilized transgenerational breeding experiments and methylation analysis to demonstrate that maternal obesity-induced alterations in oocyte methylation (including hyper-DMRs and hypo-DMRs) can be partially transmitted to F1 and F2 oocytes and livers. The authors should consider condensing and revising this section for clarity and brevity.

There is a contradiction with Reference 3, but the discrepancy is not discussed. In this study, the authors observed an increase in global methylation in oocytes from HFD mice, whereas Reference 3 indicates Stella insufficiency in oocytes from HFD mice. This Stella insufficiency should lead to decreased methylation (Reference 33). There should be a discussion of how this discrepancy can be reconciled with the authors' findings.

Reviewer #2 (Public Review):

Summary:

This work by Grogan and colleagues aimed to translate animal studies showing that acetylcholine plays a role in motivation by modulating the effects of dopamine on motivation. They tested this hypothesis with a placebo-controlled pharmacological study administering a muscarinic antagonist (trihexyphenidyl; THP) to a sample of 20 adult men performing an incentivized saccade task while undergoing electroengephalography (EEG). They found that reward increased vigor and reduced reaction times (RTs) and, importantly, these reward effects were attenuated by trihexyphenidyl. High incentives increased preparatory EEG activity (contingent negative variation), and though THP also increased preparatory activity, it also reduced this reward effect on RTs.

Strengths:

The researchers address a timely and potentially clinically relevant question with a within-subject pharmacological intervention and a strong task design. The results highlight the importance of the interplay between dopamine and other neurotransmitter systems in reward sensitivity and even though no Parkinson's patients were included in this study, the results could have consequences for patients with motivational deficits and apathy if validated in the future.

Weaknesses:

The main weakness of the study is the small sample size (N=20) that unfortunately is limited to men only. The generalizability and replicability of the conclusions remain to be assessed in future research with a larger and more diverse sample size and potentially a clinically relevant population. The EEG results do not shape a concrete mechanism of action of the drug on reward sensitivity.

Reviewer #2 (Public Review):

Summary:

In this study, the authors aimed to identify if and how magnesium affects the ability of two particular bacteria species to resist the action of antibiotics. In my view, the authors succeeded in their goals and presented a compelling study that will have important implications for the antibiotic resistance research community. Since metals like magnesium are present in all lab media compositions and are present in the host, the data presented in this study certainly will inspire additional research by the community. These could include research into whether other types of metals also induce multi-drug resistance, whether this phenomenon can be observed in other bacterial species, especially pathogenic species that cause clinical disease, and whether the underlying molecular determinants (i.e. enzymes) of metal-induced phenotypic resistance could be new antimicrobial drug targets themselves.

Strengths:

This study's strengths include that the authors used a variety of methodologies, all of which point to a clear effect of exogenous Mg2+ on drug resistance in the targeted species. I also commend the authors for carrying out a comprehensive study, spanning evaluation of whole cell phenotypes, metabolic pathways, genetic manipulation, to enzyme activity level evaluation. The fact that the authors uncovered a molecular mechanism underlying Mg2+-induced phenotypic resistance is particularly important as the key proteins should be studied further.

Weaknesses:

I believe there are weaknesses in the manuscript, however. The authors take for granted that the reader is familiar with all the assays utilized, and do not properly explain some experiments, and thus I highly suggest that the authors add a brief statement in each situation describing the rationale for each selected methodology (more details are in the private review to the authors). The Results section is also quite long and bogs down at times, and I suggest that the authors reduce its length by 10 to 20%. In contrast, the Introduction is sparse and lacks key aspects, for example, there should be mention of the study's main purpose and approaches, plus an introduction to the authors' choice of species and their known drug resistance properties, as well as the drug of choice (balofloxacin). Another notable weakness is that the authors evaluated Mg2+-induced phenotypic resistance only against two closely related species, and thus the generalizability of this mechanism of drug resistance is not known. The paper would be strengthened if the authors could demonstrate this type of phenotypic resistance in at least one more Gram-negative species and at least one Gram-positive species (antimicrobial susceptibility evaluations would suffice), each of which should be pathogenic to humans. Demonstrating magnesium-induced phenotypic drug resistance in the WHO Priority Bacterial Pathogens would be particularly important.

In general, the conclusions drawn by the authors are justified by the data, except for the interpretation of some experiments. Importantly, this paper has discovered new antimicrobial resistance mechanisms and has also pointed to potential new targets for antimicrobials.

Reviewer #2 (Public Review):

I found the original paper to be of high quality and value. The revisions the authors have made (particularly with respect to the more cautious phraseology concerning the ability to track labelled proteins) are valuable additions. The other responses are well-argued and satisfactory to this reviewer.

Reviewer #2 (Public Review):

This is an interesting computational study addressing how salt affects the assembly of biomolecular condensates. The simulation data are valuable as they provide a degree of atomistic details regarding how small salt ions modulate interactions among intrinsically disordered proteins with charged residues, namely via Debye-like screening that weakens the effective electrostatic interactions among the polymers, or through bridging interactions that allow interactions between like charges from different polymer chains to become effectively attractive (as illustrated, e.g., by the radial distribution functions in Supplementary Information). However, this manuscript has several shortcomings: (i) Connotations of the manuscript notwithstanding, many of the authors' concepts about salt effects on biomolecular condensates have been put forth by theoretical models, at least back in 2020 and even earlier. Those earlier works afford extensive information such as considerations of salt concentrations inside and outside the condensate (tie-lines). But the authors do not appear to be aware of this body of prior works and therefore missed the opportunity to build on these previous advances and put the present work with its complementary advantages in structural details in the proper context. (ii) There are significant experimental findings regarding salt effects on condensate formation [which have been modeled more recently] that predate the A1-LCD system (ref.19) addressed by the present manuscript. This information should be included, e.g., in Table 1, for sound scholarship and completeness. (iii) The strengths and limitations of the authors' approach vis-à-vis other theoretical approaches should be discussed with some degree of thoroughness (e.g., how the smallness of the authors' simulation system may affect the nature of the "phase transition" and the information that can be gathered regarding salt concentration inside vs. outside the "condensate" etc.). Accordingly, this manuscript should be revised to address the following. In particular, the discussion in the manuscript should be significantly expanded by including references mentioned below as well as other references pertinent to the issues raised.

(1) The ability to use atomistic models to address the questions at hand is a strength of the present work. However, presumably because of the computational cost of such models, the "phase-separated" "condensates" in this manuscript are extremely small (only 8 chains). An inspection of Fig.1 indicates that while the high-salt configuration (snapshot, bottom right) is more compact and droplet-like than the low-salt configuration (top right), it is not clear that the 50 mM NaCl configuration can reasonably correspond to a dilute or homogeneous phase (without phase separation) or just a condensate with a lower protein concentration because the chains are still highly associated. One may argue that they become two droplets touching each other (the chains are not fully dispersed throughout the simulation box, unlike in typical coarse-grained simulations of biomolecular phase separation). While it may not be unfair to argue from this observation that the condensed phase is less stable at low salt, this raises critical questions about the adequacy of the approach as a stand-alone source of theoretical information. Accordingly, an informative discussion of the limitation of the authors' approach and comparisons with results from complementary approaches such as analytical theories and coarse-grained molecular dynamics will be instructive-even imperative, especially since such results exist in the literature (please see below).

(2) The aforementioned limitation is reflected by the authors' choice of using Dmax as a sort of phase-separation order parameter. However, no evidence was shown to indicate that Dmax exhibits a two-state-like distribution expected of phase separation. It is also not clear whether a Dmax value corresponding to the linear dimension of the simulation box was ever encountered in the authors' simulated trajectories such that the chains can be reliably considered to be essentially fully dispersed as would be expected for the dilute phase. Moreover, as the authors have noted in the second paragraph of the Results, the variation of Dmax with simulation time does not show a monotonic rank order with salt concentration. The authors' explanation is equivalent to stipulating that the simulation system has not fully equilibrated, inevitably casting doubt on at least some of the conclusions drawn from the simulation data.

(3) With these limitations, is it realistic to estimate possible differences in salt concentration between the dilute and condensed phases in the present work? These features, including tie-lines, were shown to be amenable to analytical theory and coarse-grained molecular dynamics simulation (please see below).

(4) In the comparison in Fig.2B between experimental and simulated radius of gyration as a function of [NaCl], there is an outlier among the simulated radii of gyration at [NaCl] ~ 250 mM. An explanation should be offered.

(5) The phenomenon of no phase separation at zero and low salt and phase separation at higher salt has been observed for the IDP Caprin1 and several of its mutants [Wong et al., J Am Chem Soc 142, 2471-2489 (2020) [https://pubs.acs.org/doi/full/10.1021/jacs.9b12208], see especially Fig.9 of this reference]. This work should be included in the discussion and added to Table 1.

(6) The authors stated in the Introduction that "A unifying understanding of how salt affects the phase separation of IDPs is still lacking". While it is definitely true that much remains to be learned about salt effects on IDP phase separation, the advances that have already been made regarding salt effects on IDP phase separation is more abundant than that conveyed by this narrative. For instance, an analytical theory termed rG-RPA was put forth in 2020 to provide a uniform (unified) treatment of salt, pH, and sequence-charge-pattern effects on polyampholytes and polyelectrolytes (corresponding to the authors' low net charge and high net charge cases). This theory offers a means to predict salt-IDP tie-lines and a comprehensive account of salt effect on polyelectrolytes resulting in a lack of phase separation at extremely low salt and subsequent salt-enhanced phase separation (similar to the case the authors studied here) and in some cases re-entrant phase separation or dissolution [Lin et al., J Chem Phys 152. 045102 (2020) [https://doi.org/10.1063/1.5139661]]. This work is highly relevant and it already provided a conceptual framework for the authors' atomistic results and subsequent discussion. As such, it should definitely be a part of the authors' discussion.

(7) Bridging interactions by small ions resulting in effective attractive interactions among polyelectrolytes leading to their phase separation have been demonstrated computationally by Orkoulas et al., Phys Rev Lett 90, 048303 (2003) [https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.90.048303]. This result should also be included in the discussion.

(8) More recently, the salt-dependent phase separations of Caprin1, its RtoK variants and phosphorylated variant (see item #5 above) were modeled (and rationalized) quite comprehensively using rG-RPA, field-theoretic simulation, and coarse-grained molecular dynamics [Lin et al., arXiv:2401.04873 [https://arxiv.org/abs/2401.04873]], providing additional data supporting a conceptual perspective put forth in Lin et al. J Chem Phys 2020 (e.g., salt-IDP tie-lines, bridging interactions, re-entrance behaviors etc.) as well as in the authors' current manuscript. It will be very helpful to the readers of eLife to include this preprint in the authors' discussion, perhaps as per the authors' discretion-along the manner in which other preprints are referenced and discussed in the current version of the manuscript.

Reviewer #2 (Public Review):

Individuals with chronic kidney disease often have dyslipidemia, with the latter both a risk factor for atherosclerotic heart disease and a contributor to progressive kidney disease. Prior studies suggest that oxidized LDL (oxLDL) may cause renal injury through the activation of the LOX1 receptor. The authors had previously reported that LOX1 and AT1 interact to form a complex at the cell surface. In this study, the authors hypothesize that oxLDL, in the setting of angiotensin II, is responsible for driving renal injury by inducing a more pronounced conformational change of the AT1 receptor which results in enhanced Gq signaling.

They go about testing the hypothesis in a set of three studies. In the first set, they engineered CHO cell lines to express AT1R alone, LOX1 in combination with AT1R, or LOX1 with an inactive form of AT1R and indirectly evaluated Gq activity using IP1 and calcium activity as read-outs. They assessed activity after treatment with AngII, oxLDL, or both in combination and found that treatment with both agents resulted in the greatest level of activity, which could be effectively blocked by a Gq inhibitor but not a Gi inhibitor nor a downstream Rho kinase inhibitor targeting G12/13 signaling. These results support their hypothesis, though variability in the level of activation was dramatically inconsistent from experiment to experiment, differing by as much as 20-fold. In contrast, within the experiment, differences between the AngII and AngII/oxLDL treatments, while nominally significant and consistent with their hypothesis, generally were only 10-20%. Another example of unexplained variability can be found in Figures 1g-1j. AngII, at a concentration of 10-12, has no effect on calcium flux in one set of studies (Figure 1g, h) yet has induced calcium activity to a level as great as AngII + oxLDL in another (Figure 1i). The inconsistency of results lessens confidence in the significance of these findings. In other studies with the LOX1-CHO line, they tested for conformational change by transducing AT1 biosensors previously shown to respond to AngII and found that one of them in fact showed enhanced BRET in the setting of oxLDL and AngII compared to AngII alone, which was blocked by an antibody to AT1R. The result is supportive of their conclusions. Limiting enthusiasm for these results is the fact that there isn't a good explanation as to why only 1 sensor showed a difference, and the study should have included a non-specific antibody to control for non-specific effects.

The authors then repeated similar studies using publicly available rat kidney epithelial and fibroblast cell lines that have an endogenous expression of AT1R and LOX1. In these studies, oxLDL in combination with AngiI also enhanced Gq signaling, while knocking down either AT1R or LOX1, and treatment with inhibitors of Gq and AT1R blocked the effects. Like the prior set of studies, however, the effects are very modest and there was significant inter-experimental variability, reducing confidence in the significance of the findings. The authors then tested for evidence that the enhanced Gq signaling could result in renal injury by comparing qPCR results for target genes. While the results show some changes, their significance is difficult to assess. A more global assessment of gene expression patterns would have been more appropriate. In parallel with the transcriptional studies, they tested for evidence of epithelial-mesenchymal transition (EMT) using a single protein marker (alpha-smooth muscle actin) and found that its expression increased significantly in cells treated with oxLDL and AngII, which was blocked by inhibition of Gq inhibition and AT1R. While the data are sound, their significance is also unclear since EMT is a highly controversial cell culture phenomenon. Compelling in vivo studies have shown that most if not all fibroblasts in the kidney are derived from interstitial cells and not a product of EMT. In the last set of studies using these cell lines, the authors examined the effects of AngII and oxLDL on cell proliferation as assayed using BrdU. These results are puzzling---while the two agents together enhanced proliferation which was effectively blocked by an inhibitor to either AT1R or Gq, silencing of LOX1 had no effect.

The final set of studies looked to test the hypothesis in mice by treating WT and Lox1-KO mice with different doses of AngII and either a normal or high-fat diet (to induce oxLDL formation). The authors found that the combination of high dose AngII and a high-fat diet (HFD) increased markers of renal injury (urinary 8-ohdg and urine albumin) in normal mice compared to mice treated with just AngII or HFD alone, which was blunted in Lox1-KO mice). These results are consistent with their hypothesis. However, there are other aspects of these studies that are either inconsistent or complicating factors that limit the strength of the conclusions. For example, Lox1- KO had no effect on renal injury marker expression in mice treated with low-dose AngII and HFD. It also should be noted that Lox1-KO mice had a lower BP response to AngII, which could have reduced renal injury independent of any effects mediated by the AT1R/LOX1 interaction. Another confounding factor was the significant effect the HFD diet had on body weight. While the groups did not differ based on AngII treatment status, the HFD consistently was associated with lower total body weight, which is unexplained. Next, the authors sought to find more direct evidence of renal injury using qPCR of candidate genes and renal histology. The transcriptional results are difficult to interpret; moreover, there were no significant histologic differences between groups. They conclude the study by showing the pattern of expression of LOX1 and AT1R in the kidney by immunofluorescence and conclude that the proteins overlap in renal tubules and are absent from the glomerulus. Unfortunately, they did not co-stain with any other markers to identify the specific cell types. However, these results are inconsistent with other studies that show AT1R is highly expressed in mesangial cells, renal interstitial cells, near the vascular pole, JG cells, and proximal tubules but generally absent from most other renal tubule segments.

In sum, this study tackles an important clinical issue and provides some in vitro evidence to support a mechanism whereby dyslipidemia could accelerate renal functional decline through activation of the AT1R/LOX1 complex by oxLDL and AngII.

However, a very high degree of variability in the results, modest within-experiment differences, some internal inconsistencies that aren't explained, and the lack of compelling and strongly supportive in vivo results suggest this is still more a hypothesis than an established likely mechanism.

Reviewer #2 (Public Review):

Based on bioinformatics and expression analysis using mouse and human samples, the authors claim that the adhesion G-protein coupled receptor ADGRA3 may be a valuable target for increasing thermogenic activity and metabolic health. Genetic approaches to deplete ADGRA3 expression in vitro resulted in reduced expression of thermogenic genes including Ucp1, reduced basal respiration, and metabolic activity as reflected by reduced glucose uptake and triglyceride accumulation. In line, nanoparticle delivery of shAdgra3 constructs is associated with increased body weight, reduced thermogenic gene expression in white and brown adipose tissue (WAT, BAT), and impaired glucose and insulin tolerance. On the other hand, ADGRA3 overexpression is associated with an improved metabolic profile in vitro and in vivo, which can be explained by increasing the activity of the well-established Gs-PKA-CREB axis. Notably, a computational screen suggested that ADGRA3 is activated by hesperetin. This metabolite is a derivative of the major citrus flavonoid hesperidin and has been described to promote metabolic health. Using appropriate in vitro and in vivo studies, the authors show that hesperetin supplementation is associated with increased thermogenesis, UCP1 levels in WAT and BAT, and improved glucose tolerance, an effect that was attenuated in the absence of ADGRA3 expression.

Overall, the data suggest that ADGRA3 is a constitutively active Gs-coupled receptor that improves metabolism by activating adaptive thermogenesis in WAT and BAT. The conclusions of the paper are partly supported by the data, but some experimental approaches need further clarification.

(1) The in vivo approaches to modulate Adgra3 expression in mice are carried out using non-targeted nanoparticle-based approaches. The authors do not provide details of the composition of the nanomaterials, but it is highly likely that other metabolically active organs such as the liver are targeted. This is critical because Adgre3 is expressed in many organs, including the liver, adrenal glands, and gastrointestinal system. Therefore, many of the observed metabolic effects could be indirect, for example by modulating bile acids or corticosterone levels. Consistent with this, after digestion in the gastrointestinal tract, hesperetin is rapidly metabolized in intestinal and liver cells. Thus, hesperetin levels in the systemic circulation are likely to be insufficient to activate Adgra3 in thermogenic adipocytes/precursors. Overall, the authors need to repeat the key metabolic experiments in adipose-specific Adgra3 knockout/overexpression models to validate the reliability of the in vivo results. In addition, to validate the relevance of hesperetin supplementation for adaptive thermogenesis in BAT and WAT vivo, the levels of hesperetin present in the systemic circulation should be quantified.

(2) Standard measurements for energy balance are not presented. Quantitative data on energy expenditure, e.g. by indirect calorimetry, and food intake are missing and need to be included to validate the authors' claims.

(3) The thermographic images used to determine the BAT temperature are not very convincing. The distance and angle between the thermal camera and the BAT have a significant effect on the determination of the temperature, which is not taken into account, at least in the images presented.

(4) The 3T3-L1 cell line is not an adequate cell culture model to study thermogenic adipocyte differentiation. To validate their results, the key experiments showing that ADGRA3 expression modulates thermogenic marker expression in a hesperetin-dependent manner need to be performed in a reliable model, e.g. primary murine adipocytes.

(5) The experimental setup only allows the measurement of basal cellular respiration. More advanced approaches are needed to define the contribution of ADGRA3 versus classical adrenergic receptors to UCP1-dependent thermogenesis.

Reviewer #2 (Public Review):

Summary:

This study uses an elegant design, using cross-decoding of multivariate fMRI patterns across different types of stimuli, to convincingly show a functional dissociation between two sub-regions of the parietal cortex, the anterior inferior parietal lobe (aIPL) and superior parietal lobe (SPL) in visually processing actions. Specifically, aIPL is found to be sensitive to the causal effects of observed actions (e.g. whether an action causes an object to compress or to break into two parts), and SPL to the motion patterns of the body in executing those actions.

To show this, the authors assess how well linear classifiers trained to distinguish fMRI patterns of response to actions in one stimulus type can generalize to another stimulus type. They choose stimulus types that abstract away specific dimensions of interest. To reveal sensitivity to the causal effects of actions, regardless of low-level details or motion patterns, they use abstract animations that depict a particular kind of object manipulation: e.g. breaking, hitting, or squashing an object. To reveal sensitivity to motion patterns, independently of causal effects on objects, they use point-light displays (PLDs) of figures performing the same actions. Finally, full videos of actors performing actions are used as the stimuli providing the most complete, and naturalistic information. Pantomime videos, with actors mimicking the execution of an action without visible objects, are used as an intermediate condition providing more cues than PLDs but less than real action videos (e.g. the hands are visible, unlike in PLDs, but the object is absent and has to be inferred). By training classifiers on animations, and testing their generalization to full-action videos, the classifiers' sensitivity to the causal effect of actions, independently of visual appearance, can be assessed. By training them on PLDs and testing them on videos, their sensitivity to motion patterns, independent of the causal effect of actions, can be assessed, as PLDs contain no information about an action's effect on objects.

These analyses reveal that aIPL can generalize between animations and videos, indicating that it is sensitive to action effects. Conversely, SPL is found to generalize between PLDs and videos, showing that it is more sensitive to motion patterns. A searchlight analysis confirms this pattern of results, particularly showing that action-animation decoding is specific to right aIPL, and revealing an additional cluster in LOTC, which is included in subsequent analyses. Action-PLD decoding is more widespread across the whole action observation network.

This study provides a valuable contribution to the understanding of functional specialization in the action observation network. It uses an original and robust experimental design to provide convincing evidence that understanding the causal effects of actions is a meaningful component of visual action processing and that it is specifically localized in aIPL and LOTC.

Strengths:

The authors cleverly managed to isolate specific aspects of real-world actions (causal effects, motion patterns) in an elegant experimental design, and by testing generalization across different stimulus types rather than within-category decoding performance, they show results that are convincing and readily interpretable. Moreover, they clearly took great care to eliminate potential confounds in their experimental design (for example, by carefully ordering scanning sessions by increasing realism, such that the participants could not associate animation with the corresponding real-world action), and to increase stimulus diversity for different stimulus types. They also carefully examine their own analysis pipeline, and transparently expose it to the reader (for example, by showing asymmetries across decoding directions in Figure S3). Overall, this is an extremely careful and robust paper.

Weaknesses:

I list several ways in which the paper could be improved below. More than 'weaknesses', these are either ambiguities in the exact claims made, or points that could be strengthened by additional analyses. I don't believe any of the claims or analyses presented in the paper show any strong weaknesses, problematic confounds, or anything that requires revising the claims substantially.

(1) Functional specialization claims: throughout the paper, it is not clear what the exact claims of functional specialization are. While, as can be seen in Figure 3A, the difference between action-animation cross-decoding is significantly higher in aIPL, decoding performance is also above chance in right SPL, although this is not a strong effect. More importantly, action-PLD cross-decoding is robustly above chance in both right and left aIPL, implying that this region is sensitive to motion patterns as well as causal effects. I am not questioning that the difference between the two ROIs exists - that is very convincingly shown. But sentences such as "distinct neural systems for the processing of observed body movements in SPL and the effect they induce in aIPL" (lines 111-112, Introduction) and "aIPL encodes abstract representations of action effect structures independently of motion and object identity" (lines 127-128, Introduction) do not seem fully justified when action-PLD cross-decoding is overall stronger than action-animation cross-decoding in aIPL. Is the claim, then, that in addition to being sensitive to motion patterns, aIPL contains a neural code for abstracted causal effects, e.g. involving a separate neural subpopulation or a different coding scheme? Moreover, if sensitivity to motion patterns is not specific to SPL, but can be found in a broad network of areas (including aIPL itself), can it really be claimed that this area plays a specific role, similar to the specific role of aIPL in encoding causal effects? There is indeed, as can be seen in Figure 3A, a difference between action-PLD decoding in SPL and aIPL, but based on the searchlight map shown in Figure 3B I would guess that a similar difference would be found by comparing aIPL to several other regions. The authors should clarify these ambiguities.

(2) Causal effect information in PLDs: the reasoning behind the use of PLD stimuli is to have a condition that isolates motion patterns from the causal effects of actions. However, it is not clear whether PLDs really contain as little information about action effects as claimed. Cross-decoding between animations and PLDs is significant in both aIPL and LOTC, as shown in Figure 4. This indicates that PLDs do contain some information about action effects. This could also be tested behaviorally by asking participants to assign PLDs to the correct action category. In general, disentangling the roles of motion patterns and implied causal effects in driving action-PLD cross-decoding (which is the main dependent variable in the paper) would strengthen the paper's message. For example, it is possible that the strong action-PLD cross-decoding observed in aIPL relies on a substantially different encoding from, say, SPL, an encoding that perhaps reflects causal effects more than motion patterns. One way to exploratively assess this would be to integrate the clustering analysis shown in Figure S1 with a more complete picture, including animation-PLD and action-PLD decoding in aIPL.

(3) Nature of the motion representations: it is not clear what the nature of the putatively motion-driven representation driving action-PLD cross-decoding is. While, as you note in the Introduction, other regions such as the superior temporal sulcus have been extensively studied, with the understanding that they are part of a feedforward network of areas analyzing increasingly complex motion patterns (e.g. Riese & Poggio, Nature Reviews Neuroscience 2003), it doesn't seem like the way in which SPL represents these stimuli are similarly well-understood. While the action-PLD cross-decoding shown here is a convincing additional piece of evidence for a motion-based representation in SPL, an interesting additional analysis would be to compare, for example, RDMs of different actions in this region with explicit computational models. These could be, for example, classic motion energy models inspired by the response characteristics of regions such as V5/MT, which have been shown to predict cortical responses and psychophysical performance both for natural videos (e.g. Nishimoto et al., Current Biology 2011) and PLDs (Casile & Giese Journal of Vision 2005). A similar cross-decoding analysis between videos and PLDs as that conducted on the fMRI patterns could be done on these models' features, obtaining RDMs that could directly be compared with those from SPL. This would be a very informative analysis that could enrich our knowledge of a relatively unexplored region in action recognition. Please note, however, that action recognition is not my field of expertise, so it is possible that there are practical difficulties in conducting such an analysis that I am not aware of. In this case, I kindly ask the authors to explain what these difficulties could be.

(4) Clustering analysis: I found the clustering analysis shown in Figure S1 very clever and informative. However, there are two things that I think the authors should clarify. First, it's not clear whether the three categories of object change were inferred post-hoc from the data or determined beforehand. It is completely fine if these were just inferred post-hoc, I just believe this ambiguity should be clarified explicitly. Second, while action-anim decoding in aIPL and LOTC looks like it is consistently clustered, the clustering of action-PLD decoding in SPL and LOTC looks less reliable. The authors interpret this clustering as corresponding to the manual vs. bimanual distinction, but for example "drink" (a unimanual action) is grouped with "break" and "squash" (bimanual actions) in left SPL and grouped entirely separately from the unimanual and bimanual clusters in left LOTC. Statistically testing the robustness of these clusters would help clarify whether it is the case that action-PLD in SPL and LOTC has no semantically interpretable organizing principle, as might be the case for a representation based entirely on motion pattern, or rather that it is a different organizing principle from action-anim, such as the manual vs. bimanual distinction proposed by the authors. I don't have much experience with statistical testing of clustering analyses, but I think a permutation-based approach, wherein a measure of cluster robustness, such as the Silhouette score, is computed for the clusters found in the data and compared to a null distribution of such measures obtained by permuting the data labels, should be feasible. In a quick literature search, I have found several papers describing similar approaches: e.g. Hennig (2007), "Cluster-wise assessment of cluster stability"; Tibshirani et al. (2001) "Estimating the Number of Clusters in a Data Set Via the Gap Statistic". These are just pointers to potentially useful approaches, the authors are much better qualified to pick the most appropriate and convenient method. However, I do think such a statistical test would strengthen the clustering analysis shown here. With this statistical test, and the more exhaustive exposition of results I suggested in point 2 above (e.g. including animation-PLD and action-PLD decoding in aIPL), I believe the clustering analysis could even be moved to the main text and occupy a more prominent position in the paper.

(5) ROI selection: this is a minor point, related to the method used for assigning voxels to a specific ROI. In the description in the Methods (page 16, lines 514-24), the authors mention using the MNI coordinates of the center locations of Brodmann areas. Does this mean that then they extracted a sphere around this location, or did they use a mask based on the entire Brodmann area? The latter approach is what I'm most familiar with, so if the authors chose to use a sphere instead, could they clarify why? Or, if they did use the entire Brodmann area as a mask, and not just its center coordinates, this should be made clearer in the text.

Reviewer #2 (Public Review):

Summary:

The study links Alzheimer's disease (AD) with metabolic disorders through elevated Kallistatin levels in AD patients. Kallistatin-overexpressing mice show cognitive decline, increased Aβ and tau pathology, and impaired hippocampal function. Mechanistically, Kallistatin enhances Aβ production via Notch1 and promotes tau phosphorylation through GSK-3β activation. Fenofibrate improves cognitive deficits by reducing Aβ and tau phosphorylation in these mice, suggesting therapeutic potential in AD linked to metabolic syndromes.

Strengths:

This study presents novel insights into AD pathogenesis and provides strong evidence about the mechanistic roles of Kallistatin, and the therapeutic potential of fenofibrate in AD.

Weaknesses:

It was suggested that Kallistatin is primarily produced by the liver. The study demonstrates increased Kallistatin levels in the hippocampus tissue of AD mice. It would be valuable to clarify if Kallistatin is also increased in the liver of AD mice, providing a comprehensive understanding of its distribution in disease states.

Does Kallistatin interact directly with Notch1 ligands? Clarifying this interaction mechanism would enhance understanding of how Kallistatin influences Notch1 signaling in AD pathology.

Is there any observed difference in AD phenotype between male and female Kallistatin-transgenic (KAL-TG) mice? Including this information would address potential gender-specific effects on cognitive decline and pathology.

It is recommended to include molecular size markers in Western blots for clarity and accuracy in protein size determination.

The language should be revised for enhanced readability and clarity, ensuring that complex scientific concepts are communicated effectively to a broader audience.

Reviewer #2 (Public Review):

Cuevas et al. investigate the stimulus selectivity of surround-induced responses in the mouse primary visual cortex (V1). While classical experiments in non-human primates and cats have generally demonstrated that stimuli in the surround receptive field (RF) of V1 neurons only modulate activity to stimuli presented in the center RF, without eliciting responses when presented in isolation, recent studies in mouse V1 have indicated the presence of purely surround-induced responses. These have been linked to prediction error signals. In this study, the authors build on these previous findings by systematically examining the stimulus selectivity of surround-induced responses.

Using neuropixels recordings in V1 and the dorsal lateral geniculate nucleus (dLGN) of head-fixed, awake mice, the authors presented various stimulus types (gratings, noise, surfaces) to the center and surround, as well as to the surround only, while also varying the size of the stimuli. Their results confirm the existence of surround-induced responses in mouse V1 neurons, demonstrating that these responses do not require spatial or temporal coherence across the surround, as would be expected if they were linked to prediction error signals. Instead, they suggest that surround-induced responses primarily reflect the representation of the achromatic surface itself.

The literature on center-surround effects in V1 is extensive and sometimes confusing, likely due to the use of different species, stimulus configurations, contrast levels, and stimulus sizes across different studies. It is plausible that surround modulation serves multiple functions depending on these parameters. Within this context, the study by Cuevas et al. makes a significant contribution by exploring the relationship between surround-induced responses in mouse V1 and stimulus statistics. The research is meticulously conducted and incorporates a wide range of experimental stimulus conditions, providing valuable new insights regarding center-surround interactions.

However, the current manuscript presents challenges in readability for both non-experts and experts. Some conclusions are difficult to follow or not clearly justified.

I recommend the following improvements to enhance clarity and comprehension:

(1) Clearly state the hypotheses being tested at the beginning of the manuscript.

(2) Always specify the species used in referenced studies to avoid confusion (esp. Introduction and Discussion).

(3) Briefly summarize the main findings at the beginning of each section to provide context.

(4) Clearly define important terms such as "surface stimulus" and "early vs. late stimulus period" to ensure understanding.

(5) Provide a rationale for each result section, explaining the significance of the findings.

(6) Offer a detailed explanation of why the results do not support the prediction error signal hypothesis but instead suggest an encoding of the achromatic surface.

These adjustments will help make the manuscript more accessible and its conclusions more compelling.

Reviewer #2 (Public Review):

Summary:

The manuscript presenting the discovery of a heparan-sulfate (HS) binding domain in monkeypox virus (MPXV) H3 protein as a new anti-poxviral drug target, presented by Bin Zhen and co-workers, is of interest, given that it offers a potentially broad antiviral substance to be used against poxviruses. Using new computational biology techniques, the authors identified a new alpha-helical domain in the H3 protein, which interacts with cell surface HS, and this domain seems to be crucial for H3-HS interaction. Given that this domain is conserved across orthopoxviruses, authors designed protein inhibitors. One of these inhibitors, AI-PoxBlock723, effectively disrupted the H3-HS interaction and inhibited infection with Monkeypox virus and Vaccinia virus. The presented data should be of interest to a diverse audience, given the possibility of an effective anti-poxviral drug. 

Strengths:

In my opinion, the experiments done in this work were well-planned and executed. The authors put together several computational methods, to design poxvirus inhibitor molecules, and then they test these molecules for infection inhibition.

Weaknesses:

One thing that could be improved, is the presentation of results, to make them more easily understandable to readers, who may not be experts in protein modeling programs. For example, figures should be self-explanatory and understood on their own, without the need to revise text. Therefore, the figure legend should be more informative as to how the experiments were done.

Reviewer #3 (Public Review):

Summary: Through a rigorous methodology, the authors demonstrated that within 11 different primates, the shape of the brain followed a universal scaling law with fractal properties. They enhanced the universality of this result by showing the concordance of their results with a previous study investigating 70 mammalian brains, and the discordance of their results with other folded objects that are not brains. They incidentally illustrated potential applications of this fractal property of the brain by observing a scale-dependant effect of aging on the human brain.

Strengths:<br /> - New hierarchical way of expressing cortical shapes at different scales derived from previous report through implementation of a coarse-graining procedure<br /> - Investigation of 11 primate brains and contextualisation with other mammals based on prior literature<br /> - Proposition of tool to analyse cortical morphology requiring no fine tuning and computationally achievable<br /> - Positioning of results in comparison to previous works reinforcing the validity of the observation.<br /> - Illustration of scale-dependance of effects of brain aging in the human.

Weaknesses:<br /> - The notion of cortical shape, while being central to the article, is not really defined, leaving some interpretation to the reader<br /> - The organization of the manuscript is unconventional, leading to mixed contents in different sections (sections mixing introduction and method, methods and results, results and discussion...). As a result, the reader discovers the content of the article along the way, it is not obvious at what stages the methods are introduced, and the results are sometimes presented and argued in the same section, hindering objectivity.<br /> To improve the document, I would suggest a modification and restructuring of the article such that: 1) by the end of the introduction the reader understands clearly what question is addressed and the value it holds for the community, 2) by the end of the methods the reader understands clearly all the tools that will be used to answer that question (not just the new method), 3) by the end of the results the reader holds the objective results obtained by applying these tools on the available data (without subjective interpretations and justifications), and 4) by the end of the discussion the reader understands the interpretation and contextualisation of the study, and clearly grasps the potential of the method depicted for the better understanding of brain folding mechanisms and properties.

Reviewer #3 (Public Review):

In the manuscript titled "Structure and Evolution of Alanine/Serine Decarboxylases and the Engineering of Theanine Production," Wang et al. solved and compared the crystal structures of Alanine Decarboxylase (AlaDC) from Camellia sinensis and Serine Decarboxylase (SerDC) from Arabidopsis thaliana. Based on this structural information, the authors conducted both in vitro and in vivo functional studies to compare enzyme activities using site-directed mutagenesis and subsequent evolutionary analyses. This research has the potential to enhance our understanding of amino acid decarboxylase evolution and the biosynthetic pathway of the plant specialized metabolite theanine, as well as to further its potential applications in the tea industry.

Reviewer #3 (Public Review):

This is an interesting manuscript that builds off of this group's previous work focused on the interface between Hsf1, heat shock protein (HSP) mRNA production, and 3D genome topology. Here the group subjects the yeast Saccharomyces cerevisiae to either heat stress (HS) or ethanol stress (ES) and examines Hsf1 and Pol II chromatin binding, Histone occupancy, Hsf1 condensates, HSP gene coalescence (by 3C and live cell imaging), and HSP mRNA expression (by RT-qPCR and live cell imaging). The manuscript is well written, and the experiments seem well done, and generally rigorous, with orthogonal approaches performed to support conclusions. The main findings are that both HS and ES result in Hsf1/Pol II-dependent intergenic interactions, along with formation of Hsf1 condensates. Yet, while HS results in rapid and strong induction of HSP gene expression and Hsf1 condensate resolution, ES result in slow and weak induction of HSP gene expression without Hsf1 condensate resolution. Thus, the conclusion is somewhat phenomenological - that the same transcription factor can drive distinct transcription, topologic, and phase-separation behavior in response to different types of stress. While identifying a mechanistic basis for these results would be a tough task perhaps beyond the scope of this study, it would nevertheless be helpful to place these results in context with a series of other studies demonstrating across various organisms showing Hsf1 driving distinct activities dependent on the context of activation. Perhaps even more importantly, this work left out PMID: 32015439 which is particularly relevant considering that it shows that it is human HSF1 condensate resolution rather than simple condensate formation that is associated with HSF1 transcriptional activity - which are similar to the findings here with this particular dose of HS resulting in resolution and high transcriptional activity versus ES resulting in resolution failure and lower activity. It is also worth noting that the stresses themselves are quite different - ethanol can be used as a carbon source and so beyond inducing proteotoxic stress, the yeast are presumably adapting to this distinct metabolic state. Basically, it is not clear whether these differences are due to the dose of stress, versus we are looking at an early timepoint as ES initiates a genome-wide chromatin restructuring and gene expression reprogramming that goes beyond a response to proteotoxic stress. This reviewer is not suggesting a barrage of new experiments, but perhaps discussion points to contextualize results.

Comments on latest version:

The authors have addressed my concerns.

Reviewer #2 (Public Review):

Summary:

This manuscript titled "Identification of pharmacological inducers of a reversible hypometabolic state for whole organ preservation" reports the effects of delta opioid receptor activator SNC80 and its modified analog WB3 with ~1,000 times less delta opioid receptor binding activity on metabolic state.

Strengths:

This is an interesting study with potentially broad implications for organ preservation.

Weaknesses:

However, there are several limitations which raise concerns.

(1) The authors developed an analog of a known delta opioid receptor activator SNC80 with three orders of magnitude lesser binding with the delta opioid receptor WB3. This will likely reduce the undesirable effects of SNC80 while preserving metabolic slowing needed for organ preservation. Yet, most experiments were done with SNC80, not the superior modification, WB3, shown in only a limited set of experiments, Figure 3.

(2) The heart is one of the most challenging organs to preserve, and some experiments are done to establish the metabolic effects of SNC80. However, the biodistribution study, shown in Figure 2, conspicuously omitted the heart.

(3) I do not understand the design of the electrophysiology and contractility experiments with the porcine hearts. How did you defibrillate the hearts after removal and establishing perfusion? Lines 173-175 on Page 7 state: "After defibrillation with epinephrine, the P and QRS waveforms were visible in ECGs from 3 of 4 SNC80-treated hearts (Table S1), suggesting that those hearts regain atrial and ventricular polarization." Please clarify. Defibrillation is done with an electric shock. Also, please show the ECG recordings to support your conclusions about "polarization." What did you mean by "polarization"? Depolarization? Repolarization? Or resting potential. To establish a normal physiological state, please show ECG waveforms and present data on basic ECG characteristics: heart rate, PQ and QT intervals, and P and QRS durations. I recommend perfusion of the porcine heart with WB3, not only SNC80.

(4) Pathology data also raises concerns. The histology images shown in Figure 4f are not quantified, and they show apparently higher levels of tissue disruption in SNC80-treated tissue vs vehicle-treated. The test (lines 169-171) confirms this concern: "In some hearts treated with SNC80, greater waviness of muscle fibers was observed, possibly indicating a state of muscle contraction." It will be helpful to measure markers of apoptosis and necrosis and to apply TTC viability staining.

(5) The apparent state of contracture suggests a higher degree of myocardial damage and a high intracellular calcium level in SNC80-treated hearts. The authors suggested that the sodium-calcium exchanger NCX is a possible target of SNC80 and could be responsible for the "hypometabolic state." However, NCX1 is critically important in the extrusion of cytosolic Ca2+ during the diastolic phase. Failure to remove excessive calcium and restore ionic homeostasis would lead to calcium overload and heart failure.

(6) I am surprised the authors did not consider using the gold standard assay for measuring mitochondrial function in cells by the Seahorse Cell Mito Stress Test.

Comments on revised version:

I am satisfied with the revisions. The authors addressed major concerns with new data and/or provided satisfactory rebuttal.

Reviewer #2 (Public Review):

The authors use ThT dye as a Nernstian potential dye in E. coli. Quantitative measurements of membrane potential using any cationic indicator dye are based on the equilibration of the dye across the membrane according to Boltzmann's law.

Ideally, the dye should have high membrane permeability to ensure rapid equilibration. Others have demonstrated that E.coli cells in the presence of ThT do not load unless there is blue light present, that the loading profile does not look like it is expected for a cationic Nernstian dye. They also show that the loading profile of the dye is different for E.coli cells deleted for the TolC pump. I, therefore, objected to interpreting the signal from the ThT as a Vm signal when used in E.coli. Nothing the authors have said has suggested that I should be changing this assessment.

Specifically, the authors responded to my concerns as follows:

(1) 'We are aware of this study, but believe it to be scientifically flawed. We do not cite the article because we do not think it is a particularly useful contribution to the literature.' This seems to go against ethical practices when it comes to scientific literature citations. If the authors identified work that handles the same topic they do, which they believe is scientifically flawed, the discussion to reflect that should be included.

(2)'The Pilizota group invokes some elaborate artefacts to explain the lack of agreement with a simple Nernstian battery model. The model is incorrect not the fluorophore.'<br /> It seems the authors object to the basic principle behind the usage of Nernstian dyes. If the authors wish to use ThT according to some other model, and not as a Nernstian indicator, they need to explain and develop that model. Instead, they state 'ThT is a Nernstian voltage indicator' in their manuscript and expect the dye to behave like a passive voltage indicator throughout it.

(3)'We think the proton effect is a million times weaker than that due to potassium i.e. 0.2 M K+<br /> versus 10-7 M H+. We can comfortably neglect the influx of H+ in our experiments.'<br /> I agree with this statement by the authors. At near-neutral extracellular pH, E.coli keeps near-neutral intracellular pH, and the contribution from the chemical concentration gradient to the electrochemical potential of protons is negligible. The main contribution is from the membrane potential. However, this has nothing to do with the criticism to which this is the response of the authors. The criticism is that ThT has been observed not to permeate the cell without blue light. The blue light has been observed to influence the electrochemical potential of protons (and given that at near-neutral intracellular and extracellular pH this is mostly the membrane potential, as authors note themselves, we are talking about Vm effectively). Thus, two things are happening when one is loading the ThT, not just expected equilibration but also lowering of membrane potential. The electrochemical potential of protons is coupled via the membrane potential to all the other electrochemical potentials of ions, including the mentioned K+.

(4) 'The vast majority of cells continue to be viable. We do not think membrane damage is dominating.' In response to the question on how the authors demonstrated TMRM loading and in which conditions (and while reminding them that TMRM loading profile in E.coli has been demonstrated in Potassium Phosphate buffer). The request was to demonstrate TMRM loading profile in their condition as well as to show that it does not depend on light. Cells could still be viable, as membrane permeabilisation with light is gradual, but the loading of ThT dye is no longer based on simple electrochemical potential (of the dye) equilibration.

(5) On the comment on the action of CCCP with references included, authors include a comment that consists of phrases like 'our understanding of the literature' with no citations of such literature. Difficult to comment further without references.

(6) 'Shielding would provide the reverse effect, since hyperpolarization begins in the dense centres of the biofilms. For the initial 2 hours the cells receive negligible blue light. Neither of the referee's comments thus seem tenable.'<br /> The authors have misunderstood my comment. I am not advocating shielding (I agree that this is not it) but stating that this is not the only other explanation for what they see (apart from electrical signaling). The other I proposed is that the membrane has changed in composition and/or the effective light power the cells can tolerate. The authors comment only on the light power (not convincingly though, giving the number for that power would be more appropriate), not on the possible changes in the membrane permeability.

(7) 'The work that TolC provides a possible passive pathway for ThT to leave cells seems slightly niche. It just demonstrates another mechanism for the cells to equilibrate the concentrations of ThT in a Nernstian manner i.e. driven by the membrane voltage.' I am not sure what the authors mean by another mechanism. The mechanism of action of a Nernstian dye is passive equilibration according to the electrochemical potential (i.e. until the electrochemical potential of the dye is 0).

(8) 'In the 70 years since Hodgkin and Huxley first presented their model, a huge number of similar models have been proposed to describe cellular electrophysiology. We are not being hyperbolic when we state that the HH models for excitable cells are like the Schrödinger<br /> equation for molecules. We carefully adapted our HH model to reflect the currently understood electrophysiology of E. coli.'

I gave a very concrete comment on the fact that in the HH model conductivity and leakage are as they are because this was explicitly measured. The authors state that they have carefully adopted their model based on what is currently understood for E.coli electrophysiology. It is not clear how. HH uses gKn^4 based on Figure2 here https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1392413/pdf/jphysiol01442-0106.pdf, i.e. measured rise and fall of potassium conductance on msec time scales. I looked at the citation the authors have given and found a resistance of an entire biofilm of a given strain at 3 applied voltages. So why n^4 based on that? Why does unknown current have gqz^4 form? Sodium conductance in HH is described by m^3hgNa (again based on detailed conductance measurements), so why unknown current in E.coli by gQz^4? Why leakage is in the form that it is, based on what measurement?

Throughout their responses, the authors seem to think that collapsing the electrochemical gradient of protons is all about protons, and this is not the case. At near neutral inside and outside pH, the electrochemical potential of protons is simply membrane voltage. And membrane voltage acts on all ions in the cell.

Authors have started their response to concrete comments on the usage of ThT dye with comments on papers from my group that are not all directly relevant to this publication. I understand that their intention is to discredit a reviewer but given that my role here is to review this manuscript, I will only address their comments to the publications/part of publications that are relevant to this manuscript and mention what is not relevant.

Publications in the order these were commented on.

(1) In a comment on the paper that describes the usage of ThT dye as a Nernstian dye authors seem to talk about a model of an entire active cell.<br /> 'Huge oscillations occur in the membrane potentials of E. coli that cannot be described by the SNB model.' The two have nothing to do with each other. Nernstian dye equilibrates according to its electrochemical potential. Once that happens it can measure the potential (under the assumption that not too much dye has entered and thus lowered too much the membrane potential under measurement). The time scale of that is important, and the dye can only measure processes that are slower than that equilibration. If one wants to use a dye that acts under a different model, first that needs to be developed, and then coupled to any other active cell model.

(2) The part of this paper that is relevant is simply the usage of TMRM dye. It is used as Nernstian dye, so all the above said applies. The rest is a study of flagellar motor.

(3) The authors seem to not understand that the electrochemical potential of protons is coupled to the electrochemical potentials of all other ions, via the membrane potential. In the manuscript authors talk about, PMF~Vm, as DeltapH~0. Other than that this publication is not relevant to their current manuscript.

(4) The manuscript in fact states precisely that PMF cannot be generated by protons only and some other ions need to be moved out for the purpose. In near neutral environment it stated that these need to be cations (K+ e.g.). The model used in this manuscript is a pump-leak model. Neither is relevant for the usage of ThT dye.

Further comments include, along the lines of:

'The editors stress the main issue raised was a single referee questioning the use of ThT as an indicator of membrane potential. We are well aware of the articles by the Pilizota group and we believe them to be scientifically flawed. The authors assume there are no voltage-gated ion channels in E. coli and then attempt to explain motility data based on a simple Nernstian battery model (they assume E. coli are unexcitable<br /> matter). This in turn leads them to conclude the membrane dye ThT is faulty, when in fact it is a problem with their simple battery model.'

The only assumption made when using a cationic Nernstian dye is that it equilibrates passively across the membrane according to its electrochemical potential. As it does that, it does lower the membrane potential, which is why as little as possible is added so that this is negligible. The equilibration should be as fast as possible, but at the very least it should be known, as no change in membrane potential can be measured that is faster than that.

This behaviour should be orthogonal to what the cell is doing, it is a probe after all. If the cell is excitable, a Nernstian dye can be used, as long as it's still passively equilibrating and doing so faster than any changes in membrane potential due to excitations of the cells. There are absolutely no assumptions made on the active system that is about to be measured by this expected behaviour of a Nernstian dye. And there shouldn't be, it is a probe. If one wants to use a dye that is not purely Nernstian that behaviour needs to be described and a model proposed. As far as I can find, authors do no such thing.

There is a comment on the use of a flagellar motor as a readout of PMF, stating that the motor can be stopped by YcgR citing the work from 2023. Indeed, there is a range of references such as https://doi.org/10.1016/j.molcel.2010.03.001 that demonstrate this (from around 2000-2010 as far as I am aware). The timescale of such slowdown is hours (see here Figure 5 https://www.cell.com/cell/pdf/S0092-8674(10)00019-X.pdf). Needless to say, the flagellar motor when used as a probe, needs to stay that in the conditions used. Thus one should always be on the lookout at any other such proteins that could slow it down and we are not aware of yet or make the speed no longer proportional to the PMF. In the papers my group uses the motor the changes are fast, often reversible, and in the observation window of 30min. They are also the same with DeltaYcgR strain, which we have not included as it seemed given the time scales it's obvious, but certainly can in the future (as well as stay vigilant on any conditions that would render the motor a no longer suitable probe for PMF).

Reviewer #2 (Public Review):

Summary:<br /> Mistri et al explore the role of SLAM-SAP signaling in the developmental programming of innate-like gd T cell subsets. Using proteo-genomics, they determined that abrogation of SLAM-SAP signaling altered that programming, reducing some IL-17 producing subsets, including a novel Vγ4 γδT1 subset, and diverting gdTCR-expressing precursors to the ab fate. Altogether, this is a very thorough, thoughtfully interpreted study that adds significantly to our understanding of the contribution of the SLAM-SAP pathway to lineage specification. A particularly interesting element is the role of SLAM-SAP in preventing gd17 progenitors from switching fates and adopting the ab fate.

Comments on revised version:

The authors have addressed the minor issues raised in the original submission.

Reviewer #2 (Public Review):

Summary:

This work demonstrates that when E. coli cells divide, and division is not quite symmetric, the smaller cell has a higher growth rate than the larger cell at the beginning, but not the end, of the cell cycle. The authors then demonstrate that smaller cells have a higher ribosome concentration than larger cells, which is consistent with the idea that the two cells receive roughly equal numbers of ribosomes at division because, as they also observe, ribosomes are excluded by the nucleoid from the middle of the mother cell. The experimental observations are reproduced by a mathematical model that assumes growth is driven by ribosome concentration, with contributions from metabolism and active feedback.

Strengths:

The work provides strong evidence in support of the growing consensus that cells correct size fluctuations by modulating growth rate, within a cell cycle and on a single-cell basis. It also offers a plausible explanation for the correction mechanism by showing that ribosomes are excluded from the middle of a mother cell and have a higher concentration in the smaller daughter cell. The work is clearly written and benefits from a strong coupling between the experimental and modeling results. It provides a solid contribution to the field of single-cell bacterial growth control.

Weaknesses:

Although the results strongly suggest it, the work does not explicitly demonstrate (e.g. by direct perturbation) that higher ribosome concentration is the cause of the higher growth rate. Also, it is unclear why an active compensation mechanism is needed in the model, i.e., why size-dependent growth (via ribosome concentration) does not correct growth rate perturbations within a cell cycle automatically.

https://www.wikidata.org/wiki/Q82069695

https://en.m.wikipedia.org/wiki/SARS-CoV-2

Reviewer #2 (Public Review):

Summary:

This work describes the structure of Heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), a lysosomal membrane protein that catalyzes the acetylation reaction of the terminal alpha-D-glucosamine group required for degradation of heparan sulfate (HS). HS degradation takes place during the degradation of the extracellular matrix, a process required for restructuring tissue architecture, regulation of cellular function and differentiation. During this process, HS is degraded into monosaccharides and free sulfate in lysosomes.

HGSNAT catalyzes the transfer of the acetyl group from acetyl-CoA to the terminal non-reducing amino group of alpha-D-glucosamine. The molecular mechanism by which this process occur has not been described so far. One of the main reasons to study the mechanism of HGSNAT is that multiple mutations spanning the entire sequence of the protein, such as, nonsense mutations, splice-site variants, and missense mutations lead to dysfunction that causes abnormal accumulation of HS within the lysosomes. This accumulation is a cause of mucopolysaccharidosis IIIC (MPS IIIC), an autosomal recessive neurodegenerative lysosomal storage disorder, for which there are no approved drugs or treatment strategies.<br /> This paper provides a 3.26A structure of HGSNAT, determined by single-particle cryo-EM. The structure reveals that HGSNAT is a dimer in detergent micelles, and a density assigned to acetyl-CoA. The authors speculate about the molecular mechanism of the acetylation reaction, map the mutations known to cause MPS IIIC on the structure and speculate about the nature of the HGSNAT disfunction caused by such mutations.

Strengths:

The paper describes a structure of HGSNAT a member of the transmembrane acyl transferase (TmAT) superfamily. The high-resolution of a HGSNAT bound to acetyl-CoA is important for our understanding of HGSNAT mechanism. The density map is of high-quality, except for the luminal domain. The location of the acetyl-CoA allows speculation about the mechanistic role of multiple residues surrounding this molecule. The authors thoroughly describe the architecture of HGSNAT and map the mutations leading to MPS IIIC.

Reviewer #2 (Public Review):

Summary:

This paper utilizes a neural network model to investigate how the brain employs an adaptive chunking strategy to effectively enhance working memory capacity, which is a classical and significant question in cognitive neuroscience. By integrating perspectives from both the 'slot model' and 'limited resource models,' the authors adopted a neural network model encompassing the prefrontal cortex and basal ganglia, introduced an adaptive chunking strategy, and proposed a novel hybrid model. The study demonstrates that the brain can adaptively bind various visual stimuli into a single chunk based on the similarity of color features (a continuous variable) among items in visual working memory, thereby improving working memory efficiency. Additionally, it suggests that the limited capacity of working memory arises from the computational characteristics of the neural system, rather than anatomical constraints.

Strengths:

The neural network model utilized in this paper effectively integrates perspectives from both slot models and resource models (i.e., resource-like constraints within a slot-like system). This methodological innovation provides a better explanation for the limited capacity of working memory. By simulating the neural networks of the prefrontal cortex and basal ganglia, the model demonstrates how to optimize working memory storage and retrieval strategies through reinforcement learning (i.e., the efficient management of access to and from working memory). This biologically plausible simulation offers a novel perspective on human working memory and potentially provides a novel explanation for the working memory difficulties observed in patients with Parkinson's disease and other disorders. Furthermore, the effectiveness of the model is validated through computational simulation experiments, yielding reliable and robust predictions.

Weaknesses:

The model employs a spiking neural network, which is relatively complex. Additionally, while this paper validates the effectiveness of chunking strategies used by the brain to enhance working memory efficiency through computational simulations, further comparison with related phenomena observed in cognitive neuroscience experiments on limited working memory capacity, such as the recency effect, is necessary to verify its generalizability.

Reviewer #2 (Public Review):

Summary:

In this manuscript, Shore et al. investigate the consequent changes in excitability and synaptic efficacy of diverse neuronal populations in an animal model of juvenile epilepsy. Using electrophysiological patch-clamp recordings from dissociated neuronal cultures, the authors find diverging changes in two major populations of inhibitory cell types, namely somatostatin (SST)- and parvalbumin (PV)-positive interneurons, in mice expressing a variant of the KCNT1 potassium channel. They further suggest that the differential effects are due to a compensatory increase in the persistent sodium current in PV interneurons in pharmacological and in silico experiments. It remains unclear why this current is selectively enhanced in PV-interneurons.

Strengths:

(1) Heterozygous KCNT1 gain of function variant was used which more accurately models the human disorder.

(2) The manuscript is clearly written, and the flow is easy to follow. The authors explicitly state the similarities and differences between the current findings and the previously published results in the homozygous KCNT1 gain of function variant.

(3) This study uses a variety of approaches including patch clamp recording, in silico modeling and pharmacology that together make the claims stronger.

(4) Pharmacological experiments are fraught with off-target effects and thus it bolsters the authors' claims when multiple channel blockers (TTX and VU170) are used to reconstruct the sodium-activated potassium current.

Weaknesses:

(1) This study mostly relies on recordings in dissociated cortical neurons. Although specific WT interneurons showed intrinsic membrane properties like those reported for acute brain slices, it is unclear whether the same will be true for those cells expressing KCNT1 variants, especially when the excitability changes are thought to arise from homeostatic compensatory mechanisms. The authors do confirm that mutant SST-interneurons are hypoexcitable using an ex vivo slice preparation which is consistent with work for other KCTN1 gain of function variants (e.g. Gertler et al., 2022). However, the key missing evidence is the excitability state of mutant PV-interneurons, given the discrepant result of reduced excitability of PV cells reported by Gertler et al in acute hippocampal slices.

Reviewer #2 (Public Review):

Summary:

Complexin (Cplx) is expressed at nearly all chemical synapses. Mammalian Cplx comes in four different paralogs which are differentially expressed in different neurons or secretory cell types, either selectively or in combination with one or two other Cplx isoforms. Cplx binds with high affinity to assembled SNARE complexes and promotes evoked synchronous release. Cplx is assumed to preclude premature SV fusion by preventing full SNARE assembly, thereby arresting subsequent SNARE-driven fusion ("fusion-clamp" theory). The protein has multiple domains, the functions of which are controversially discussed. Cplx's function has been studied in a variety of model organisms including mouse, fly, worm, and fish with seemingly conflicting results which led to partly contradicting conclusions.<br /> Makee et al. study the function of mammalian Cplx2 in chromaffin cells by making use of Cplx2 ko mice to overexpress and functionally characterize mutant Cplx2 forms in cultured chromaffin cells. The main conclusion of the present study are:

The hydrophobic character of the amphipathic helix in Cplx's C-terminal domain is essential for inhibiting premature vesicle fusion at a [Ca2+]i of several hundreds of nM (pre-flash [Ca2+]i). The Cplx-mediated inhibition of fusion under these conditions does not rely on expression of either Syt1 or Syt7.

Slow-down of exocytosis by N-terminally truncated Cplx mutants in response to a [Ca2+]i of several µM (peak flash [Ca2+]i) occurs regardless of the presence or absence of Syt7 demonstrating that Cplx2 does not act as a switch favoring preferential assembly of the release machinery with Syt1,2 rather than the "slow" sensor Syt7.

Cplx's N-terminal domain is required for the Cplx2-mediated increase in the speed of exocytosis and faster onset of exocytosis which likely reflect an increased apparent Ca2+ sensitivity and faster Ca2+ binding of the release machinery.

Strengths:

The authors perform systematic truncation/mutational analyses of Cplx2. They analyze the impact of single and combined deficiencies for Cplx2 and Syt1 to establish interactions of both proteins.<br /> State-of-the-art methods are employed: Vesicle exocytosis is assayed directly and with high resolution using capacitance measurements. Intracellular [Ca2+] is controlled by loading via the patch-pipette and by UV-light induced flash-photolysis of caged [Ca2+]. The achieved [Ca2+ ] is measured with Ca2+ -sensitive dyes.<br /> The data is of high quality and the results are compelling.

Weaknesses:

With the exception of mammalian retinal ribbon synapses (and some earlier RNAi knock down studies which had off-target effects), there is little experimental evidence for a "fusion-clamp"-like function of Cplxs at mammalian synapses. At conventional mammalian synapses, genetic loss of Cplx (i.e. KO) consistently decreases AP-evoked release, and generally either also decreases spontaneous release rates or does not affect spontaneous release, which is inconsistent with a "fusion-clamp" theory. This is in stark contrast to invertebrate (D. m. and C. e.) synapses where genetic Cplx loss is generally associated with a strong upregulation of spontaneous release.

There are alternative scenarios explaining how Cplx may phenomenological "clamp" vesicle fusion rates without mechanistically assigning a "clamping" function to Cplx (Neher 2010, Neuron). In fact, changes in asynchronous release kinetics following conditioning AP trains observed at Cplx1 ko calyx of Held synapses do not favor a "fusion clamp" model (Chang et al., 2015, J.Neurosci.), while an alternative model, assigning Cplx the role of a "checkpoint" protein in SNARE assembly, quantitatively reproduces all experimental observations (Lopez et al., 2024, PNAS). It might be helpful for a reader to mention such alternative scenarios.

Reviewer #2 (Public Review):

In this manuscript, Rachubinski and colleagues provide a comprehensive clinical, immunological, and autoantibody assessment of autoimmune/inflammatory manifestations of patients with Down syndrome (DS) in a large number of patients with this disorder. These analyses confirm prior results of excess interferon and cytokine signals in DS patients and extend these observations to highlight early-onset immunological aberrancies, far before symptoms occur, as well as characterizing novel autoantibody reactivities in this patient population. Then, the authors report the interim analysis of an open-label, Phase II, clinical trial of the JAK1/3 inhibitor, tofacitinib, that aims to define the safety, clinical efficacy, and immunological outcomes of DS patients who suffer from inflammatory conditions of the skin. The clinical trial analysis indicates that the treatment is tolerated without serious adverse effects and that the majority of patients have experienced clinical improvement or remission in their corresponding clinical cutaneous manifestations as well as improvement or normalization of aberrant immunological signals such as cytokines.

The major strength of the study is the recruitment and uniform, systematic evaluation of an impressive number of DS patients. Moreover, the promising early results from the tofacitinib clinical trial pave the way for analysis of a larger number of patients within the Phase II trial and otherwise, which may lead to improved clinical outcomes for affected patients. An inherent weakness of such studies is the descriptive nature of several parameters and the relatively small size of tofacitinib-treated DS patients. However, the descriptive nature of some of the correlative research analyses is of scientific interest and is useful to generate hypotheses for future additional (including mechanistic) work, and treatment of 10 DS patients in a formal clinical trial at interim analysis is not a trivial task for a disease like this. The manuscript achieves the aims of the authors and the results support their conclusions. The authors appropriately acknowledge areas that require more research and areas that are not well understood. The results are represented in a useful manner and statistical methods and analyses appear sound.

Reviewer #2 (Public Review):

Summary:<br /> In this manuscript, the authors use the Drosophila model system to study the impact of mild head trauma on sex-dependent brain deficits. They identify Sex Peptide as a modulator of greater negative outcomes in female flies. Additionally, they observe that increased age at the time of injury results in worse outcomes, especially in females, and that this is due to chronic suppression of innate immune defense networks in mated females. The results demonstrate a novel signaling pathway that promotes age- and sex-dependent outcomes after head injury.

Strengths:<br /> The authors have modified their previously reported TBI model in flies to mimic mild TBI, which is novel. Methods are explained in detail, allowing for reproducibility. Experiments are rigorous with appropriate statistics. A number if important controls are included. The work tells a complete mechanistic story and adds important data to increase our understanding of sex-dependent differences in recovery after TBI. The Discussion is comprehensive and puts the work in context of the field.

Weaknesses: None<br /> The authors answered the following concerns, and I have no other concerns:<br /> A very minor weakness is that exact n values should be included in the figure legends. There should also be confirmation of knockdown by RNAi in female flies either by immunohistochemistry or qRT-PCR if possible.

Reviewer #2 (Public Review):

Wnt signaling is the name given to a cell-communication mechanism that cells employ to inform on each other's position and identity during development. In cells that receive the Wnt signal from the extracellular environment, intracellular changes are triggered that cause the stabilization and nuclear translocation of β-catenin, a protein that can turn on groups of genes referred to as Wnt targets. Typically these are genes involved in cell proliferation. Genetic mutations that affect Wnt signaling components can therefore affect tissue expansion. Loss of function of APC is a drastic example: APC is part of the β-catenin destruction complex, and in its absence, β-catenin protein is not degraded and constitutively turns on proliferation genes, causing cancers in the colon and rectum. And here lies the importance of the finding: β-catenin has for long been considered to be regulated almost exclusively by tuning its protein turnover. In this article, a new aspect is revealed: Ctnnb1, the gene encoding for β-catenin, possesses tissue-specific regulation with transcriptional enhancers in its vicinity that drive its upregulation in intestinal stem cells. The observation that there is more active β-catenin in colorectal tumors not only because the broken APC cannot degrade it, but also because transcription of the Ctnnb1 gene occurs at higher rates, is novel and potentially game-changing. As genomic regulatory regions can be targeted, one could now envision that mutational approaches aimed at dampening Ctnnb1 transcription could be a viable additional strategy to treat Wnt-driven tumors.

Reviewer #2 (Public Review):

Summary:

In this manuscript, Zhang et al. examine neural activity in the motor cortex as monkeys make reaches in a novel target interception task. Zhang et al. begin by examining the single neuron tuning properties across different moving target conditions, finding several classes of neurons: those that shift their preferred direction, those that change their modulation gain, and those that shift their baseline firing rates. The authors go on to find an interesting, tilted ring structure of the neural population activity, depending on the target speed, and find that (1) the reach direction has consistent positioning around the ring, and (2) the tilt of the ring is highly predictive of the target movement speed. The authors then model the neural activity with a single neuron representational model and a recurrent neural network model, concluding that this population structure requires a mixture of the three types of single neurons described at the beginning of the manuscript.

Strengths:

I find the task the authors present here to be novel and exciting. It slots nicely into an overall trend to break away from a simple reach-to-static-target task to better characterize the breadth of how the motor cortex generates movements. I also appreciate the movement from single neuron characterization to population activity exploration, which generally serves to anchor the results and make them concrete. Further, the orbital ring structure of population activity is fascinating, and the modeling work at the end serves as a useful baseline control to see how it might arise.

Weaknesses:

While I find the behavioral task presented here to be excitingly novel, I find the presented analyses and results to be far less interesting than they could be. Key to this, I think, is that the authors are examining this task and related neural activity primarily with a single-neuron representational lens. This would be fine as an initial analysis since the population activity is of course composed of individual neurons, but the field seems to have largely moved towards a more abstract "computation through dynamics" framework that has, in the last several years, provided much more understanding of motor control than the representational framework has. As the manuscript stands now, I'm not entirely sure what interpretation to take away from the representational conclusions the authors made (i.e. the fact that the orbital population geometry arises from a mixture of different tuning types). As such, by the end of the manuscript, I'm not sure I understand any better how the motor cortex or its neural geometry might be contributing to the execution of this novel task.

Main Comments:

My main suggestions to the authors revolve around bringing in the computation through a dynamics framework to strengthen their population results. The authors cite the Vyas et al. review paper on the subject, so I believe they are aware of this framework. I have three suggestions for improving or adding to the population results:

(1) Examination of delay period activity: one of the most interesting aspects of the task was the fact that the monkey had a random-length delay period before he could move to intercept the target. Presumably, the monkey had to prepare to intercept at any time between 400 and 800 ms, which means that there may be some interesting preparatory activity dynamics during this period. For example, after 400ms, does the preparatory activity rotate with the target such that once the go cue happens, the correct interception can be executed? There is some analysis of the delay period population activity in the supplement, but it doesn't quite get at the question of how the interception movement is prepared. This is perhaps the most interesting question that can be asked with this experiment, and it's one that I think may be quite novel for the field--it is a shame that it isn't discussed.

(2) Supervised examination of population structure via potent and null spaces: simply examining the first three principal components revealed an orbital structure, with a seemingly conserved motor output space and a dimension orthogonal to it that relates to the visual input. However, the authors don't push this insight any further. One way to do that would be to find the "potent space" of motor cortical activity by regression to the arm movement and examine how the tilted rings look in that space (this is actually fairly easy to see in the reach direction components of the dPCA plot in the supplement--the rings will be highly aligned in this space). Presumably, then, the null space should contain information about the target movement. dPCA shows that there's not a single dimension that clearly delineates target speed, but the ring tilt is likely evident if the authors look at the highest variance neural dimension orthogonal to the potent space (the "null space")--this is akin to PC3 in the current figures, but it would be nice to see what comes out when you look in the data for it.

(3) RNN perturbations: as it's currently written, the RNN modeling has promise, but the perturbations performed don't provide me with much insight. I think this is because the authors are trying to use the RNN to interpret the single neuron tuning, but it's unclear to me what was learned from perturbing the connectivity between what seems to me almost arbitrary groups of neurons (especially considering that 43% of nodes were unclassifiable). It seems to me that a better perturbation might be to move the neural state before the movement onset to see how it changes the output. For example, the authors could move the neural state from one tilted ring to another to see if the virtual hand then reaches a completely different (yet predictable) target. Moreover, if the authors can more clearly characterize the preparatory movement, perhaps perturbations in the delay period would provide even more insight into how the interception might be prepared.

Reviewer #2 (Public Review):

Summary:<br /> After manually labelling 144 human adult hemispheres in the lateral parieto-occipital junction (LPOJ), the authors 1) propose a nomenclature for 4 previously unnamed highly variable sulci located between the temporal and parietal or occipital lobes, 2) focus on one of these newly named sulci, namely the ventral supralateral occipital sulcus (slocs-v) and compare it to neighbouring sulci to demonstrate its specificity (in terms of depth, surface area, gray matter thickness, myelination, and connectivity), 3) relate the morphology of a subgroup of sulci from the region including the slocs-v to the performance in a spatial orientation task, demonstrating behavioural and morphological specificity. In addition to these results, the authors propose an extended reflection on the relationship between these newly named landmarks and previous anatomical studies, a reflection about the slocs-v related to functional and cytoarchitectonic parcellations as well as anatomic connectivity and an insight about potential anatomical mechanisms relating sulcation and behaviour.

Strengths:<br /> - To my knowledge, this is the first study addressing the variable tertiary sulci located between the superior temporal sulcus (STS) and intra-parietal sulcus (IPS).<br /> - This is a very comprehensive study addressing altogether anatomical, architectural, functional and cognitive aspects.<br /> - The definition of highly variable yet highly reproductible sulci such as the slocs-v feeds the community with new anatomo-functional landmarks (which is emphasized by the provision of a probability map in supp. mat., which in my opinion should be proposed in the main body).<br /> - The comparison of different features between the slocs-v and similar sulci is useful to demonstrate their difference.<br /> - The detailed comparison of the present study with state of the art contextualises and strengthens the novel findings.<br /> - The functional study complements the anatomical description and points towards cognitive specificity related to a subset of sulci from the LPOJ<br /> - The discussion offers a proposition of theoretical interpretation of the findings<br /> - The data and code are mostly available online (raw data made available upon request).

Weaknesses:<br /> - While the identification of the sulci has been done thoroughly with expert validation, the sulci have not been labelled in a way that enables the demonstration of the reproducibility of the labelling.

The proposed methodology is convincing in identifying and studying the relationship between highly variable sulci and cognition. This improves our refined understanding of the general anatomical variability in the LPOJ and its potential functional/cognitive correlates. This work is important to the understanding of sulcal variability and its implications on functional and cognitive aspects.

Comments on revised version:

Thank you for the elegant and informative work.

Reviewer #2 (Public Review):

Summary:

This study shows that when excitatory DREADD receptors are expressed in the ventral area of the cervical spinal cord containing phrenic motoneurons, the systemic administration of the DREADD ligand J60 increases diaphragm EMG activity without altering respiratory rate. The authors took a non-selective expression approach in wild-type mice, as well as a more selective Cre-dependent approach in Chat-Cre mice and Chat-Cre rats to stimulate cervical motoneurons in the spinal cord. This is a proof of principle study that supports the use of DREADD technology to stimulate the motor output to the diaphragm.

Strengths:

The strengths of the study lie in the use of both mice and rats and testing activation of diaphragmatic activity with multiple experimental approaches to show that diaphragm EMG and tidal volume are increased.

Weaknesses:

Weaknesses of the study consist in the lack of some important control experiments to consolidate the findings: a test of DREADD ligand effects in the absence of viral construct; repeated respiratory challenges within the same recording session in whole body plethysmographs that could compromise the behaving experiments; and lastly, a limited qualitative analysis of the histological data that does not allow for confirmation of expression in phrenic motoneurons.

Reviewer #2 (Public Review):

Summary:

The authors set out to determine the role of Rtf1 in Cryptococcal biology, and demonstrate that Rtf1 acts independently of the Paf1 complex to exert regulation of Histone H2B monoubiquitylation (H2Bub1). The biological impact of the loss of H2Bub1 was observed in defects in morphogenesis, reduced production of virulence factors, and reduced pathogenic potential in animal models of cryptococcal infection.

Strengths:

The molecular data is quite compelling, demonstrating that the Rtf1-depednent functions require only this histone modifying domain of Rtf1, and are dependent on nuclear localization. A specific point mutation in a residue conserved with the Rtf1 protein in the model yeast demonstrates the conservation of that residue in H2Bub1 modification. Interestingly, whereas expression of the HMD alone suppressed the virulence defect of the rtf1 deletion mutant, it did not suppress defects in virulence factor production.

Weaknesses:

The authors use two different species of Cryptococcus to investigate the biological effect of Rtf1 deletion. The work on morphogenesis utilized C. deneoformans, which is well-known to be a robust mating strain. The virulence work was performed in the C. neoformans H99 background, which is a highly pathogenic isolate. The study would be more complete if each of these processes were assessed in the other strain to understand if these biological effects are conserved across the two species of Cryptococcus. H99 is not as robust in morphogenesis, but reproducible results assessing mating and filamentation in this strain have been performed. Similarly, C. deneoformans does produce capsule and melanin.

There are some concerns with the conclusions related to capsule induction. The images reported in Figure B are purported to be grown under capsule-inducing conditions, yet the H99 panel is not representative of the induced capsule for this strain. Given the lack of a baseline of induction, it is difficult to determine if any of the strains may be defective in capsule induction. Quantification of a population of cells with replicates will also help to visualize the capsular diversity in each strain population.

The authors demonstrate that for specific mating-related genes, the expression of the HMD recapitulated the wild-type expression pattern. The RNA-seq experiments were performed under mating conditions, suggesting specificity under this condition. The authors raise the point in the discussion that there may be differences in Rtf1 deposition on chromatin in H99, and under conditions of pathogenesis. The data that overexpression of HMD restores H2Bub1 by western is quite compelling, but does not address at which promoters H2Bub1 is modulating expression under pathogenesis conditions, and when full-length Rtf1 is present vs. only the HMD.

Reviewer #2 (Public Review):

Summary:

The manuscript expands the current bulk sequencing data deconvolution toolkit to include ATAC-seq. The EPIC-ATAC tool successfully predicts accurate proportions of immune cells in bulk tumour samples and EPIC-ATAC seems to perform well in benchmarking analyses. The authors achieve their aim of developing a new bulk ATAC-seq deconvolution tool.

Strengths:

The manuscript describes simple and understandable experiments to demonstrate the accuracy of EPIC-ATAC. They have also been incredibly thorough with their reference dataset collections and have been robust in their benchmarking endeavours and measured EPIC-ATAC against multiple datasets and tools. This tool will be valuable to the community it serves.

Reviewer #2 (Public Review):

Summary:

In this study, the authors identified a previously unrecognized organ interaction where limb immobilization induces thermogenesis in BAT. They showed that limb immobilization by cast fixation enhances the expression of UCP1 as well as amino acid transporters in BAT, and amino acids are supplied from skeletal muscle to BAT during this process, likely contributing to increased thermogenesis in BAT. Furthermore, the experiments with IL-6 knockout mice and IL-6 administration to these mice suggest that this cytokine is likely involved in the supply of amino acids from skeletal muscle to BAT during limb immobilization.

Strengths:

The function of BAT plays a crucial role in the regulation of an individual's energy and body weight. Therefore, identifying new interventions that can control BAT function is not only scientifically significant but also holds substantial promise for medical applications. The authors have thoroughly and comprehensively examined the changes in skeletal muscle and BAT under these conditions, convincingly demonstrating the significance of this organ interaction.

Weaknesses:

Through considerable effort, the authors have demonstrated that limb-immobilized mice exhibit changes in thermogenesis and energy metabolism dynamics at their steady state. However, The impact of immobilization on the function of skeletal muscle and BAT during cold exposure has not been thoroughly analyzed.

Reviewer #2 (Public Review):

Intrinsic properties of a neuron refer to the ion channels that a neuron expresses. These ion channels determine how a neuron responds to its inputs. How intrinsic properties link to behavior remains poorly understood. Medina and Margoliash address this question using the zebra finch, a well-studied songbird. Previous studies from their lab and other labs have shown that the intrinsic properties of adult songbird basal-ganglia projecting premotor neurons, are more similar within a bird than across birds. Across birds, this similarity is related to the extent of similarity in the songs; the more similar the song between two birds, the more similar the intrinsic properties between the neurons of these two birds. Finally, the intrinsic properties of these neurons change over the course of development and are sensitive to intact auditory feedback. However, the song features that relate to these intrinsic properties and the function of the within-bird homogeneity of intrinsic properties are unclear.

In this manuscript, the authors address these two questions by examining the intrinsic properties of basal-ganglia projecting premotor neurons in zebra finch brain slices. Specifically, they focus on the Ih current (as this is related to rhythmic activity in many pattern-generating circuits) and correlate the properties of the Ih current with song features. They find that the sag ratio (a measure of the driving force of the Ih current) and the rebound area (a measure of the post-inhibitory depolarisation) are both correlated with the temporal features of the song. First, they show the presence of correlations between the length of the song motif and the length of the longest syllable (most often a harmonic stack syllable). Based on this, they conclude that longer song motifs are composed of longer syllables. Second, they show that HVCX neurons within a bird have more similar sag ratios and rebound areas than across birds. Third, the mean sag ratio and mean rebound areas across birds were correlated with the duration of the longest harmonic stack within the song. These two results suggest that IPs are correlated with the temporal structure of the song. To further test this, the authors used natural and experimental tutoring procedures to have birds that learned two different types of songs that only differed in length; the longer song had an extra harmonic stack at the end. Using these two sets of birds, the authors find larger sag ratios and higher firing frequencies in birds with longer songs. Fifth, they show that the post-inhibitory rebound area allows neurons to respond to excitatory inputs and produce spikes. Neurons with a larger rebound area have a larger time window for responding to excitatory inputs. Based on this, they speculate that HVCX neurons with larger rebound areas integrate over larger time windows. Finally, they make a network model of HVC and show that one specific model could explain sequence-specific bursting of HVCX neurons.

Strengths

The question being addressed is an interesting question and the authors use appropriate techniques. The authors find a new temporal structure within the song, specifically, they find that longer songs typically have more syllables and longer syllables. As far as I know, this has not been shown earlier. The authors build on existing literature to suggest that IPs of HVCX neurons are correlated with the temporal structure of songs.

Weaknesses

I have a number of concerns with the statistics and interpretation of the results, insufficient controls for one experiment, and the specifics of the model that affect the implications of these results. These concerns are listed in the recommendations for the authors.

Reviewer #2 (Public Review):

Summary:

Hebin et al reported a fascinating story about antibiotic persistence in the biofilms. First, they set up a model to identify the increased persisters in the biofilm status. They found that the adhesion of bacteria to the surface leads to increased c-di-GMP levels, which might lead to the formation of persisters. To figure out the molecular mechanism, they screened the E.coli Keio Knockout Collection and identified the HipH. Finally, the authors used a lot of data to prove that c-di-GMP not only controls HipH over-expression but also inhibits HipH activity, though the inhibition might be weak.

Strengths:

They used a lot of state-of-the-art technologies, such as single-cell technologies as well as classical genetic and biochemistry approaches to prove the concept, which makes the conclusions very solid. Overall, it is a very interesting and solid story that might attract diverse readers working with c-di-GMP, persisters, and biofilm.

Weaknesses:

(1) Is HipH the only target identified by screening the E.coli Keio Knockout Collection?

(2) Since the story is complicated, a diagrammatic picture might be needed to illustrate the whole story. And the title does not accurately summarize the novelty of this study.

(3) The ratio of mVenus NB to mScarlet-I (R) negatively correlates with the concentration of c-di-GMP. Therefore, R -1 demonstrates a positive correlation with the concentration of c-di-GMP. Is this method validated with other methods to quantify c-di-GMP， or used in other studies？

(4) References are missing throughout the manuscript. Please add enough references for every conclusion.

(5) The novelty of this study should be clearly written and compared with previous references. For example, is it the first study to report the mechanism that the adhesion of bacteria to the surface leads to increased persister formation?

(6) in vitro DNA cleavage assay. Why not use bacterial genomic DNA to test the cleaving of HipH on the bacterial genome?

(7) C-di-gmp -HipH is not a TA, it does not fit in the definition of the TA systems. You can say C-di-gmp is an antitoxin based on your study, but C-di-gmp -HipH is not a TA pair.

Reviewer #2 (Public Review):

Summary:

The manuscript by Munday et al. presents real-time predictions of geographic spread during an Ebola epidemic in north-eastern DRC. Predictions were elicited from individual experts engaged in outbreak response and from two mathematical models. The authors found comparable performance between experts and models overall, although the models outperformed experts in a few dimensions.

Strengths:

Both individual experts and mathematical models are commonly used to support outbreak response but rarely used together. The manuscript presents an in-depth analysis of the accuracy and decision-relevance of the information provided by each source individually and in combination.

Weaknesses:

A few minor methodological details are currently missing.

Reviewer #2 (Public Review):

Summary:<br /> The authors begin with the stated goal of gaining insight into the known repression of autophagy by Ezrin, a major membrane-actin linker that assembles signaling complexes on membranes. RNA and protein expression analysis is consistent with upregulation of lysosomal proteins in Ezrin-deficient MEFs, which the authors confirm by immunostaining and western blotting for lysosomal markers. Expression analysis also implicates EGF signaling as being altered downstream of Ezrin loss, and the authors demonstrate that Ezrin promotes relocalization of EGFR from the plasma membrane to endosomes. Ezrin loss impacts downstream MAPK/Akt/mTORC1 signaling, although the mechanistic links remain unclear. An Ezrin mutant Medaka fish line wa then generated to test Ezrin's role in retinal cells, which are known to be sensitive to changes in autophagy regulation. Phenotypes in this model appear generally consistent with observations made in cultured cells, though mild overall.

Strengths:<br /> Data on the impact of Ezrin-loss on relocalization of EGFR from the plasma membrane are extensive, and thoroughly demonstrate that Ezrin is required for EGFR internalization in response to EGF.

A new Ezrin-deficient in vivo model (Medaka fish) is generated.

Strong data demonstrates that Ezrin loss suppresses Akt signaling. Ezrin loss also clearly suppresses mTORC1 signaling in cell culture, although examination of mTORC1 activity is notably missing in Ezrin-deficient fish.

Weaknesses:<br /> LC3 is used as a readout of autophagy, however the lipidated/unlipidated LC3 ratio generally does not appear to change, thus there does not appear to be evidence that Ezrin loss is affecting autophagy in this study.

The conclusion is drawn that Ezrin loss suppresses EGF signaling, however this is complicated by a strong increase in phosphorylation of the p38 MAPK substrate MK2. Without additional characterization of MAPK and Erk signaling, the effect of Ezrin loss remains unclear.

Causative conclusions between effects on MAPK, Akt, and mTORC1 signaling are frequently drawn, but the data only demonstrate correlations. For example, many signaling pathways can activate mTORC1 including MAPK/Erk, thus reduced mTORC1 activity upon Ezrin-loss cannot currently be attributed to reduced Akt signaling. Similarly, other kinases can phosphorylate TSC2 at the sites examined here, so the conclusion cannot be drawn that Ezrin-loss causes a reduction in Akt-mediated TSC2 phosphorylation. In Figure 7, the conclusion cannot be drawn that retinal degeneration results from aberrant EGFR signaling.

It is unclear why TSC1 is highlighted in the title, as there does not appear to be any specific regulation of TSC1 here.

In Figure 1 the conclusion is drawn that there is an increase in lysosome number with Ezrin KO, however it does not appear that the current analysis can distinguish an increased number from increased lysosome size or activity. Similarly, conclusions about increased lysosome "biogenesis" could instead reflect decreased turnover.

Immunoprecipitation data for a role for Ezrin as a signaling scaffold appear minimal and seem to lack important controls.

In Figure 3A it seems difficult to conclude that EGFR dimerization is reduced since the whole blot, including the background between lanes, is lighter on that side.

In Figure 6C specificity controls for the TSC1 and TSC2 antibodies are not included, but seem necessary since their localization patterns appear very different from each other in WT cells.

In Figure 7 the signaling effects in Ezrin-deficient fish are mild compared to cultured cells, and effects on mTORC1 are not examined. Further data on the retinal cell phenotypes would strengthen the conclusions.

In Figure 7F there appears to be more EGFR throughout the cell, so it is difficult to conclude that more EGFR at the PM in Ezrin-/- fish means reduced internalization.

Reviewer #2 (Public Review):

Summary:

This study investigates in mice neural mechanisms generating sighs, which are periodic large-amplitude breaths occurring during normal breathing that subserve physiological pulmonary functions and are associated with emotional states such as relief, stress, and anxiety. Sighs are generated by a structure called the preBötzinger complex (preBötC) in the medulla oblongata that generates various forms of inspiratory activity including sighs. The authors have previously described a circuit involving neurons producing bombesin-related peptides Neuromedin B (NMB) and gastrin-releasing peptide (GRP) that project to preBötC neurons expressing receptors for NMB (NMBRs) and GRP (GRPRs) and that activation of these preBötC neurons via these peptide receptors generates sighs. In this study, the authors further investigated mechanisms of sigh generation by applying optogenetic and chemogenetic strategies to selectively activate the subpopulations of preBötC neurons expressing NMBRs and/or GRPRs, and a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs. The authors present convincing evidence that sigh-like inspirations can be evoked by photostimulation of the preBötC neurons expressing NMBRs or GRPRs. Photostimulation of SST neurons can independently evoke sighs, and chemogenetic inhibition of these neurons can abolish sighs. The results presented support the authors' conclusion that the preBötC neurons expressing NMBRs or GRPRs produce sighs via pathways to downstream SST neurons. Thus, these studies have identified some of the preBötC cellular elements likely involved in generating sighs.

Strengths:

(1) This study employs an effective combination of electrophysiological, transgenic, optogenetic, chemogenetic, pharmacological, and neuron activity imaging techniques to investigate sigh generation by distinct subpopulations of preBötC neurons in mice.

(2) The authors extend previous studies indicating that there is a peptidergic circuit consisting of NMB and GRP expressing neurons that project from the parafacial (pF) nucleus region to the preBötC and provides sufficient input to generate sighs, since photoactivation of either pF NMB or GRP neurons evoke ectopic sighs in this study.

(3) Convincing evidence is presented that sighs can be evoked by direct photostimulation of preBötC neurons expressing NMBRs and/or GRPRs, and also a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs.

(4) The mRNA-expression data presented from in situ hybridization indicates that most preBötC neurons expressing NMBR, GRPR (or both) are glutamatergic and excitatory.

(5) Measurements in slices in vitro indicate that only the NMBR-expressing neurons are normally rhythmically active during normal inspiratory activity and endogenous sigh activity.

(6) Evidence is presented that activation of preBötC NMBRs and/or GRPRs is not necessary for sigh production, suggesting that sighs are not the unique product of the preBötC bombesin-peptide signaling pathway.

(7) The novel conclusion is presented that the preBötC neurons expressing NMBRs and/or GRPRs produce sighs via the separate downstream population of preBötC SST neurons, which the authors demonstrate can independently generate sighs, whereas chemogenetic inhibition of preBötC SST neurons selectively abolishes sighs generated by activating NMBRs and GRPRs.

Weaknesses:

(1) While these studies have identified subpopulations of preBötC neurons capable of episodically evoking sigh-like inspiratory activity, mechanisms producing the normal slow sigh rhythm were not investigated and remain unknown.

(2) Several key technical aspects of the study require further clarification to aid in interpreting the experimental results, including issues relating to the validation of the transgenic mouse lines and virally transduced expressions of proteins utilized for optogenetic and chemogenetic experiments, as well as justifying the optogenetic photostimulation paradigms used to evoke sighs.

Reviewer #2 (Public Review):

Summary:

Exploring the DEP-MAP database and two drug-screen databases, the authors identify WSB2 as an interactor of several BCL2 proteins. In follow-up experiments, they show that CRL5/WSB2 controls NOXA protein levels via K48 ubiquitination following direct protein-protein interaction, and cell death sensitivity in the context of BH3 mimetic treatment, where WSB2 depletion synergizes with drug treatment.

Strengths:

The authors use a set of orthogonal methods across different model cell lines and a new WSB2 KO mouse model to confirm their findings. They also manage to correlate WSB2 expression with poor prognosis in prostate and liver cancer, supporting the idea that targeting WSB2 may sensitize cancers for treatment with BH3 mimetics.

Weaknesses:

The conclusions drawn based on the findings in cancer patients are very speculative, as regulation of NOXA cannot be the sole function of CRL5/WSB2 and it is hence unclear what causes correlation with patient survival. Moreover, the authors do not provide a clear mechanistic explanation of how exactly higher levels of NOXA promote apoptosis in the absence of WSB2. This would be important knowledge, as usually high NOXA levels correlate with high MCL1, as they are turned over together, but in situations like this, or loss of other E3 ligases, such as MARCH, the buffering capacity of MCL1 is outrun, allowing excess NOXA to kill (likely by neutralizing other BCL2 proteins it usually does not bind to, such as BCLX). Moreover, a necroptosis-inducing role of NOXA has been postulated. Neither of these options is interrogated here.

Reviewer #2 (Public Review):

The manuscript by Chen et al. describes how low levels of CPT1A in colorectal cancer (CRC) confer radioresistance by expediting radiation-induced ROS clearance. The authors propose that this mechanism of ROS homeostasis is regulated through FOXM1. CPT1A is known for its role in fatty acid metabolism via beta-oxidation of long-chain fatty acids, making it important in many metabolic disorders and cancers.

Previous studies have suggested that the upregulation of CPT1A is essential for the tumor-promoting effect in colorectal cancers (CRC) (PMID: 32913185). For example, CPT1A-mediated fatty acid oxidation promotes colorectal cancer cell metastasis (PMID: 2999587), and repression of CPT1A activity renders cancer cells more susceptible to killing by cytotoxic T lymphocytes (PMID: 37722058). Additionally, inhibition of CPT1A-mediated fatty-acid oxidation (FAO) sensitizes nasopharyngeal carcinomas to radiation therapy (PMID: 29721083). While this suggests a tumor-promoting effect for CPT1A, the work by Chen et al. suggests instead a tumor-suppressive function for CPT1A in CRC, specifically that loss or low expression of CPT1A confers radioresistance in CRC. This makes the findings important given that they oppose the previously proposed tumorigenic function of CPT1A. However, the data presented in the manuscript is limited in scope and analysis.

Major Limitations:

(1) Analysis of Patient Samples

- Figure 1D shows that CPT1A levels are significantly lower in COAD and READ compared to normal tissues. It would be beneficial to show whether CPT1A levels are also significantly lower in CRC compared to other tumor types using TCGA data.<br /> - The analysis should include a comparison of closely related CPT1 isoforms (CPT1B and CPT1C) to emphasize the specific importance of CPT1A silencing in CRC.<br /> - Figure 2 lacks a clear description of how IHC scores were determined and the criteria used to categorize patients into CPT1A-high and CPT1A-low groups. This should be detailed in the text and figure legend.<br /> - None of Figure 2B or 2C show how many patients were assigned to the CPT1A-low and CPT1A-high groups.

(2) Model Selection and Experimental Approaches

- The authors primarily use CPT1A knockout (KO) HCT116 cells and CPT1A overexpression (OE) SW480 cells for their experiments, which poses major limitations.<br /> - The genetic backgrounds of the cell lines (e.g., HCT116 being microsatellite instable (MSI) and SW480 not) should be considered as they might influence treatment outcomes. This should be acknowledged as a major limitation.<br /> - Regardless of their CPT1A expression levels, for the experiments with HCT116 and SW480 cells in Figure 3C-F, it would be useful to see whether HCT116 cells can be further sensitized to radiotherapy in overexpression and whether SW480 cells can be desensitized through CPT1A KO.<br /> - The use of only two CRC cell lines is insufficient to draw broad conclusions. Additional CRC cell lines should be used to validate the findings and account for genetic heterogeneity. The authors should repeat key experiments with additional CRC cell lines to strengthen their conclusions.

(3) Pharmacological Inhibition

Several studies have reported beneficial outcomes of using CPT1 pharmacological inhibition to limit cancer progression (e.g., PMID: 33528867, PMID: 32198139), including its application in sensitization to radiation therapy (PMID: 30175155). Since the authors argue for the opposite case in CRC, they should show this through pharmacological means such as etomoxir and whether CPT1A inhibition phenocopies their observed genetic KO effect, which would have important implications for using this inhibitor in CRC patients.

(4) Data Representation and Statistical Analysis

- The relative mRNA expression levels across the seven cell lines (Supplementary Figure 1C) differ greatly from those reported in the DepMap (https://depmap.org/portal/). This discrepancy should be addressed.<br /> - The statistical significance of differences in mRNA and protein levels between RT-sensitive and RT-resistant cells should be shown (Supplementary Figure 1C, D).

Conclusion

The study offers significant insights into the role of CPT1A in CRC radioresistance, proposing a tumor-suppressive function. However, the scope and depth of the analysis need to be expanded to fully validate these claims. Additional CRC cell lines, pharmacological inhibition studies, and a more detailed analysis of patient samples are essential to strengthen the conclusions.

Reviewer #2 (Public Review):

Summary:

This manuscript by Wei et al studies the role of ZFP36L1, an RNA-binding protein, in promoting PD-L1 expression in gastric cancer (GC). They used human gastric cancer tissues from six patients and performed H3K27ac CUT&Tag to unbiasedly identify SE specific for the infiltrative type. They identified an SE driving the expression of ZFP36L1 and immune evasion through upregulation of PD-L1. Mechanistically, they show that SPI1 binds to ZFP36L1-SE and ZFP36L1 in turn regulates PD-L1 expression through modulation of the 3'UTR of HDAC3. This mechanism of PD-L1 regulation in gastric cancer is novel, and ZFP36L1 has not been previously implicated in GC progression. However, the data presented are largely correlations and no direct proof is presented that the identified SE regulates ZFP36L1 expression. Furthermore, the effect of ZFP36L1 manipulation elicited a modest effect on PDL1 expression. In fact, several cell lines (XGC1, MNK45) express abundant ZFP36L1 but no PD-L1, suggesting the ZFP36L1 per se is not a key stimulant of PD-L1 expression as IFNg is. Thus, the central conclusions are not supported by the data.

Strengths:

Use of human GC specimens to identify SE regulating PD-L1 expression and immune evasion.

Weaknesses:

Major comments:

(1) The difference in H3K27ac over the ZFP36L1 locus and SE between the expanding and infiltrative GC is marginal (Figure 2G). Although the authors establish that ZFP36L1 is upregulated in GC, particularly in the infiltrative subtype, no direct proof is provided that the identified SE is the source of this observation. CRISPR-Cas9 should be employed to delete the identified SE to prove that it is causatively linked to the expression of ZFP36L1.

(2) In Figure 3C the impact of shZFP36L1 on PD-L1 expression is marginal and it is observed in the context of IFNg stimulation. Moreover, in XGC-1 cell line the shZFP36L1 failed to knock down protein expression thus the small decrease in PD-L1 level is likely independent of ZFP36L1. The same is the case in Figure 3D where forced expression of ZFP36L1 does not upregulate the expression of PDL1 and even in the context of IFNg stimulation the effect is marginal.

(3) In Figure 4, it is unclear why ELF1 and E2F1 that bind ZFP36L1-SE do not upregulate its expression and only SPI1 does. In Figure 4D the impact of SPI overexpression on ZFP36L1 in MKN45 cells is marginal. Likewise, the forced expression of SPI did not upregulate PD-L1 which contradicts the model. Only in the context of IFNg PD-L1 is expressed suggesting that whatever role, if any, ZFP36L1-SPI1 axis plays is secondary.

(4) The data presented in Figure 6 are not convincing. First, there is no difference in the tumor growth (Figure 6E). IHC in Figure 6I for CD8a is misleading. Can the authors provide insets to point CD8a cells? This figure also needs quantification and review from a pathologist.

Reviewer #2 (Public Review):

Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects. While the authors address an important question, more rigor is required to understand the full behavior of the model.

Major Points

(1) The authors compare DIPx to the winning method of the DREAm challenge, TAJI to show that from molecular features alone they retrain TAJI to create TAJI-M without the monotherapy data inputs. They mention that "of course, we could also use such data in DIPx...", but they never show the behaviour of DIPx with these data. The authors need to demonstrate that this statement holds true or else compare it to the full TAJI.

(2) It would be neat to see how the DIPx feature importance changes with monotherapy input. For most realistic scenarios in which these models are used robust monotherapy data do exist.

(3) In Figure 2, the authors compare DIPx and TAJI-M on various test sets. If I understood correctly, they also bootstrapped the training set with n=100 and reported all the model variants in many of the comparisons. While this is a nice way of showing model robustness, calculating p-values with bootstrapped data does not make sense in my opinion as by increasing the value of n, one can make the p-value arbitrarily small. The p-value should only be reported for the original models.

(4) From Figures 2 and 3, it appears DIPx is overfit on the training set with large gaps in Spearman correlations between Test Set 2/ONeil set and Test Set 1. It also features much better in cases where it has seen both compounds. Could the authors also compare TAJI on the ONeil dataset to show if it is as much overfit?

Reviewer #2 (Public Review):

Summary:

In this manuscript, Guayasamin et al. show that early-life stress (ELS) can induce a shift in fear generalisation in mice. They took advantage of a fear conditioning paradigm followed by a discrimination test and complemented learning and memory findings with measurements for anxiety-like behaviors. Next, astrocytic dysfunction in the lateral amygdala was investigated at the cellular level by combining staining for c-Fos with astrocyte-related proteins. Changes in excitatory neurotransmission were observed in acute brains slices after ELS suggesting impaired communication between neurons and astrocytes. To confirm the causality of astrocytic-neuronal dysfunction in behavioral changes, viral manipulations were performed in unstressed mice. Occlusion of functional coupling with a dominant negative construct for gap junction connexin 43 or reduction in astrocytic calcium with CalEx mimicked the behavioral changes observed after ELS suggesting that dysfunction of the astrocytic network underlies ELS-induced memory impairments.

Strengths:

Overall, this well-written manuscript highlights a key role for astrocytes in regulating stress-induced behavioral and synaptic deficits in the lateral amygdala in the context of ELS. Results are innovative, and methodological approaches relevant to decipher the role of astrocytes in behaviors. As mentioned by the authors, non-neuronal cells are receiving increasing attention in the neuroscience, stress, and psychiatry fields.

Weaknesses:

I do have several suggestions and comments to address that I believe will improve the clarity and impact of the work. For example, there is currently a lack of information on the timeline for behavioral experiments, tissue collection, etc.

Notice that many fake news stories begin from a place of fear. This fear hijacks our brains and triggers fight or flight options in our system I circuitry and actively prevent the use of the rational parts of system II which would quickly reveal problems in the information.

Reviewer #2 (Public Review):

Summary:

In this manuscript, the authors use a combination of transgenic animals, intersectional viruses, retrograde tracing, and ex-vivo slice electrophysiology to show that VTA projection neurons synapse locally. First, the authors injected a cre-dependent channelrhodopsin into the VTA of PV, SST, MOR, and NTS-Cre mice. Importantly, PV, SST, MOR, and NTS are molecular markers previously used to describe VTA interneurons. Imaging of known VTA target regions identified that these neurons are not localized to the VTA and instead project to the PFC, NAc, VP, and LHb. Next, the authors used an intersectional viral strategy to label projection neurons with both GFP (membrane localized) and Syn:Ruby (release sites). These experiments identified that VTA projection neurons also make intra-VTA synapses. Finally, the authors use a combination of optogenetics and ex-vivo slice electrophysiology to show that neurons projecting from the VTA to the NAc/VP/PFC also synapse locally. Overall, most of the conclusions seem to be well supported by the data.

Strengths:

Previous literature has described Pvalb, Sst, Oprm1, and Nts as selective markers of VTA interneurons. Here, the authors make use of cre driver lines to show that neurons defined by these genes are not interneurons and project to known VTA target regions. Additionally, the authors convincingly use intersectional viral approaches and slice electrophysiology to show that projection neurons synapse onto neighboring cells within the VTA

Weaknesses:

While the authors use several cre driver lines to identify GABAergic projection neurons, they then use wild-type mice to show that projection neurons synapse onto neighboring cells within the VTA. This does not seem to lend evidence to the idea that previously described "interneurons" are projection neurons that collateralize within the VTA.

Reviewer #2 (Public Review):

Summary:

Franke et al. characterize the representation of color in the primary visual cortex of mice, highlighting how this changes across the visual field. Using calcium imaging in awake, head-fixed mice, they characterize the properties of V1 neurons (layer 2/3) using a large center-surround stimulation where green and ultra-violet colors were presented in random combinations. Clustering of responses revealed a set of functional cell-types based on their preference to different combinations of green and UV in their center and surround. These functional types were demonstrated to have different spatial distributions across V1, including one neuronal type (Green-ON/UV-OFF) that was much more prominent in the posterior V1 (i.e. upper visual field). Modelling work suggests that these neurons likely support the detection of predator-like objects in the sky.

Strengths:

The large-scale single-cell resolution imaging used in this work allows the authors to map the responses of individual neurons across large regions of the visual cortex. Combining this large dataset with clustering analysis enabled the authors to group V1 neurons into distinct functional cell types and demonstrate their relative distribution in the upper and lower visual fields. Modelling work demonstrated the different capacity of each functional type to detect objects in the sky, providing insight into the ethological relevance of color opponent neurons in V1.

Weaknesses:

It is unfortunate the authors were unable to provide stronger mechanistic insights into how color opponent neurons in V1 are formed.

Overall, this study will be a valuable resource for researchers studying color vision, cortical processing, and the processing of ethologically relevant information. It provides a useful basis for future work on the origin of color opponency in V1 and its ethological relevance.

Reviewer #3 (Public Review):

Summary:<br /> Animals can evaluate food quality in many ways. In contrast to the rapid sensory evaluation with smell and taste, the mechanism of slow nutrient sensation and its impact on food choice is unexplored. The authors utilize C. elegans larvae and their bacterial food as an elegant model to tackle this question and reveal the detailed molecular mechanism to avoid nutrient-poor foods.

Strength:<br /> The strength of this study is that they identified the molecular identities of the critical players in bacterial food and C. elegans using unbiased approaches, namely metabolome analysis, E. coli mutant screening, and RNA sequencing. Furthermore, they strengthened their findings by thorough experiments combining multiple methods such as genetics, fluorescent reporter analysis, and Western blot.

Weakness:<br /> The major caveat of this study is the reporter genes; specifically, transcriptional reporters used to monitor the UPRER and immune responses in the intestine of C. elegans. However, their tissue-specific rescue experiments suggest that the genes in the UPRER and immune response function in the neurons. Thus, we should carefully interpret the results of the reporter genes. Another point to be aware of is that although they show that lack of carbohydrates elicits the response to "low-quality" food, carbohydrate supplementation with heat-killed E. coli was insufficient to support animal growth.

Overall, this work provides convincing data to support their model. In the C. elegans field, the behaviors of larvae are not well studied compared to adults. This work will pose an interesting question about the difference between larvae and adults in nutrition sensing in C. elegans and provide a framework and candidate molecules to be studied in other organisms.

Reviewer #2 (Public Review):

Summary:

This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

Strengths:

The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

Weaknesses:

Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

(1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

(2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

(3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

(4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

(5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

(6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

(7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

Reviewer #2 (Public Review):

Li and colleagues investigate the enzymatic activity-independent function of IDH1 in regulating erythropoiesis. This manuscript reveals that IDH1 deficiency in the nucleus leads to the redistribution of histone marks (especially H3K79me3) and chromatin state reprogramming. Their findings suggest a non-typical localization and function of the metabolic enzyme, providing new insights for further studies into the non-metabolic roles of metabolic enzymes. However, there are still some issues that need addressing:

(1) Could the authors show the RNA and protein expression levels (without fractionation) of IDH1 on different days throughout the human CD34+ erythroid differentiation?

(2) Even though the human CD34+ erythroid differentiation protocol was published and cited in the manuscript, it would be helpful to specify which erythroid stages correspond to cells on days 7, 9, 11, 13, and 15.

(3) It is important to mention on which day the lentiviral knockdown of IDH1 was performed. Will the phenotype differ if the knockdown is performed in early vs. late erythropoiesis? In Figures 1C and 1D, on which day do the authors begin the knockdown of IDH1 and administer NAC and GSH treatments?

(4) The authors validate that IDH1 regulates erythropoiesis in an enzymatic activity-independent manner by adding ROS scavengers or α-KG. Given the complexity of metabolic pathways, these two strategies may not suffice. Mutating the enzymatic active site could provide a clearer explanation for this point.

(5) While the cell phenotype of IDH1 deficiency is quite dramatic, yielding cells with larger nuclei and multi-nuclei, the authors only attribute this phenotype to defects in chromatin condensation. Is it possible that IDH1-knockdown cells also exhibit primary defects in mitosis/cytokinesis (not just secondary to the nuclear condensation defect)?), given the function of H3K79Me in cell cycle regulation?

(6) Why are there two bands of Histone H3 in Figure 4A?

(7) Are the density and localization of histone modifications (not just H3K79me3) in Sg-NEG-IDH1 HuDEP2 cells similar to those in IDH1-shRNA erythroid cells compared to control cells?

(8) Displaying a heatmap and profile plots in Figure 5A between control and IDH1-deficient cells will help illustrate changes in H3K79me3 density in the nucleus after IDH1 knockdown.

(9) Are the distribution and intensity of H3K79me3 in primary healthy erythroid cells in the bone marrow similar to or distinct from those in AML and MDS cells? The authors could present at least one sample of healthy donor cells for comparison.

(10) In Figure 7E, why are the bands of Luciferase-shRNA in the input and probe both light, while the bands of IDH1-shRNA are both dark? This suggests that the expression of KLF1 is much higher in IDH1-shRNA cells than in control cells. Therefore, this result may not strongly support the increased binding of KLF1 at the SIRT1 promoter after IDH1 knockdown.

Reviewer #2 (Public Review):

The authors present a computational methodology for de-biasing/denoising high-throughput genomic signals using optimal transport techniques, thus allowing disparate datasets to be merged and jointly analysed. They apply this methodology on liquid biopsy data and they demonstrate improved performance (compared to simpler bias-correcting approaches) for cancer detection using common machine learning algorithms. This is a theoretically interesting and potentially useful approach for addressing a very common practical problem in computational genomics.

I have the following recommendations:

(1) When comparing performance metrics between different approaches (e.g., tables 3 and 4), 95% confidence intervals should also be provided and a pairwise statistical test should be applied to establish whether the observed difference in each performance metric between the proposed method and the alternatives is statistically significant, thus justifying the claim that the proposed method offers an improvement over existing methodologies.

(2) The commonly used center-and-scale and GC debias approaches presented by the authors are fairly simple. How does their methodology compare to more elaborate approaches, such as tangent normalisation (https://academic.oup.com/bioinformatics/article/38/20/4677/6678978) and robust PCA (https://github.com/mskilab-org/dryclean)?

(3) What is the computational cost of the proposed methodology and how does it compare to the alternatives?

(4) The proposed approach relies on a reference dataset, against which a given dataset is adapted. What are the implications for cross-validation experiments (which are essential for assessing the out-of-sample error of every methodology), particularly with regards to the requirement to avoid information leakage between training and validation/test data sets?

In conclusion, this is an interesting and potentially useful paper and I would like to encourage the authors to address the above points, which hopefully will strengthen their case.

Reviewer #2 (Public Review):

Summary:

In this manuscript, the authors investigated whether a salticid spider, Phidippus regius, recognizes other individuals of the same species. The authors placed each spider inside a container from which it could see another spider for 7 minutes, before having its view of the other spider occluded by an opaque barrier for 3 minutes. The spider was then either presented with the same individual again (habituation trial) or a different individual (dishabituation trial). The authors recorded the distance between the two spiders during each trial. In habituation trials, the spiders were predicted to spend more time further away from each other and, in dishabituation trials, the spiders were predicted to spend more time closer to each other. The results followed these predictions, and the authors then considered whether the spiders in habituation trials were generally fatigued instead of being habituated to the appearance of the other spider, which may have explained why they spent less time near the other individual. The authors presented the spiders with a different (novel) individual after a longer period of time (which they considered to be a long-term dishabituation trial), and found that the spiders switched to spending more time closer to the other individual again during this trial. This suggested that the spiders had recognized and had habituated to the individual that they had seen before and that they became dishabituated when they encountered a different individual.

Strengths:

It is interesting to consider individual recognition by Phidippus regius. Other work on individual recognition by an invertebrate has been, for instance, known for a species of social wasp, but Phidippus regius is a different animal. Importantly and more specifically, P. regius is a salticid spider, and these spiders are known to have exceptional eyesight for animals of their size, potentially making them especially suitable for studies on individual recognition. In the current study, the results from experiments were consistent with the authors' predictions, suggesting that the spiders were recognizing each other by being habituated to individuals they had encountered before and by being dishabituated to individuals they had not encountered before. This is a good start in considering individual recognition by this species.

Weaknesses:

The experiments in this manuscript (habituation/dishabituation trials) are a good start for considering whether individuals of a salticid species recognize each other. I am left wondering, however, what features the spiders were specifically paying attention to when recognizing each other. The authors cited Sheehan and Tibbetts (2010) who stated that "Individual recognition requires individuals to uniquely identify their social partners based on phenotypic variation." Also, recognition was considered in a paper on another salticid by Tedore and Johnsen (2013).

Tedore, C., & Johnsen, S. (2013). Pheromones exert top-down effects on visual recognition in the jumping spider Lyssomanes viridis. The Journal of Experimental Biology, 216, 1744-1756. doi: 10.1242/jeb.071118

In this elegant study, the authors presented spiders with manipulated images to find out what features matter to these spiders when recognizing individuals.

Part of the problem with using two living individuals in experiments is that the behavior of one individual can influence the behavior of the other, and this can bias the results. However, this issue can be readily avoided because salticids are well known, for example, to be highly responsive to lures (e.g. dead prey glued in lifelike posture onto cork disks) and to computer animation. These methods have already been successful and helpful for standardizing the different stimuli presented during many different experiments for many different salticid spiders, and they would be helpful for better understanding how Phidippus regius might recognize another individual on the basis of phenotypic variation. There are all sorts of ways in which a salticid might recognize another individual. Differences in face or body structure, or body size, or all of these, might have an important role in recognition, but we won't know what these are using the current methods alone. Also, I didn't see any details about whether body size was standardized in the current manuscript.

For another perspective, my thoughts turn to a paper by Cross et al.

Cross, F. R., Jackson, R. R., & Taylor, L. A. (2020). Influence of seeing a red face during the male-male encounters of mosquito-specialist spiders. Learning & Behavior, 48, 104-112. doi: 10.3758/s13420-020-00411-y

These authors found that males of Evarcha culicivora, another salticid species that is known to have a red face, become less responsive to their own mirror images after having their faces painted with black eyeliner than if their faces remained red. In all instances, the spiders only saw their own mirror images and never another spider, and these results cannot be interpreted on the basis of habituation/dishabituation because the spiders were not responding differently when they simply saw their mirror image again. Instead, it was specifically the change to the spider's face which resulted in a change of behavior. The findings from this paper and from Tedore and Johnsen can help give us additional perspectives that the authors might like to consider. On the whole, I would like the authors to further consider the features that P. regius might use to discern and recognize another individual.