Capture-C
1,724 Matching Annotations
- May 2019
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
Percentage lethality was calculated as:100×((number of non-CyO/ number CyO)×100)
-
Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}
-
Fly Stocks and Crosses
-
Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).
-
Molecular Biology Protocols
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
otal RNA was isolated from cell lines after 48 hrs of transfection using trizol (Invitrogen, U.S.A.). 32p labeled antisense HBx mRNA was in vitro transcribed using T7 RNA Polymerase and Riboprobe kit (Promega, U.S.A.), as described earlier. For generating antisense HBx probe, plasmid DNA was linearized with Bam HI and subjected to transcription. Total RNA was quantitated and equal concentration (15-20 pg) was loaded after adding loading dye (50%glycerol, 1 mM EDTA, 0.25% bromophenol blue, 0.25% xylene cyanol FF) on 1% formaldehyde-agarose gel and 1X MOPS was used as the running buffer. The gel was then run at 5 V /em length of the gel. The gel was then treated with 2.5% HCl for 15 min for depurination, 0.4N NaOH for another 15 min and then in 3 M sodium acetate for 15 min, before the transfer was set. Also the nylon membrane prior to transfer was first treated with distilled water for 5 min and then in 0.4 N NaOH for 20 min. The overnight transfer was set up using 20X sse buffer as the transfer buffer at room temperature. Thereafter, the membrane was cross-linked by uv and then dipped in 2X sse for 20 min. For pre-hybridization the membrane was soaked in Rapid hybridization buffer (Amersham Biosciences, U.K.) for 2 hr at 65oC in the hybridizing oven. The probe was then added and further incubation for 4 hrs was carried out. Post hybridization the membrane was washed thrice with 6X sse at 37oC on a shaker. The membrane was then dried on a filter paper and wrapped in a saran wrap. The membrane was then analyzed by autoradiography. For ensuring the equal loading, the formaldehyde-agarose gel was also stained with EtBr for 23s and 18s rRNA
-
Northern Blot Analysis
-
ubjected to three washes with PBST and two washes with PBS. The blot was developed using the substrate DAB (Sigma, U.S.A.) or with ECL (Amersham Biosciences, U.K.)
-
he protein samples were diluted with 4X sample buffer which is essentially SDS-reducing buffer (O.SM Tris-Cl, pH 6.8, Glycerol, 10% (w /v) SDS, 2-J3-mercaptoethanol, 0.05% (w /v) bromophenol blue). The samples were denatured at 1000C for 10 min and the proteins were resolved on 12-15% SDS-polyacrylamide gel at 25-30mA. For detection, the proteins were transferred on to nitrocellulose (NC) membrane (Hybond-C extra, Amersham, U.K.) at 200mA, for either 1 hr or at 12 rnA, 40C for overnight. After the transfer was over, the NC membrane was washed thrice with PBST (1X PBS with 0.1% Tween 20) and blocked with 2% BSA for 2hrs (in PBST) at room temperature. Primary antibody to HBx/Vif/ APOBEC3G-NT raised in rabbit and were diluted to 1:1,000 in PBST. One hour incubation with the primary antibody was followed by three washes with PBST (10 min each) and then 1 hr incubation with 1:1,000 dilution of the secondary antibody (Anti-rabbit IgG (Fe) HRP conjugate) was carried out. The blot was further
-
Westem blot analysis
-
After transfection the cells were harvested and protein was isolated from the celllysates. The cells from each well were pelleted at 2000 rpm for 10 min at 40C. The supernatant was carefully removed and the pellet was incubated on ice for 1 hr after adding 50pl of lysis buffer (1% triton X100, 0.1mM EDTA, 0.1mM EGTA, 1mM DTT, 1X PI, all in 1X PBS) with intermittent vortexing. The tubes were centrifuged at maximum rpm for 10 min at 40C and the supernatant, containing the proteins, was collected and stored at -700C. The purified protein fractions were quantitated using the BCA protein assay kit and the O.D. was taken at 562nm
-
rotein isolation from celllysate
-
annealing at 25°C for 5 minutes, the reaction was incubated at 42°C for one hour.
-
series of primers were designed to detect the levels of intact gene of interest or Rz in the cell lysate. The levels of RNA were quantitated by carrying out reverse transcriptase based-PCR using the Im.Prom-11™ Reverse Transcriptase system (Promega, U.S.A.). 1}lg of template RNA and 1}lM terminal primers were combined in 5pl reaction volume and the primer I template mix was thermally denatured at 70°C for 5 minutes and chilled on ice. A reverse transcription reaction mix of volume 15 pl was assembled on ice to contain nuclease-free water, 1X reaction buffer, 1pl reverse transcriptase, 6 mM magnesium chloride, 0.5 mM dNTPs and 1 U ribonuclease inhibitor RNasin. As a final step, the template-primer combination was added to the reaction mix on ice. Following an initia
-
Reverse transcri.ptase polymerase chain reaction (RT-PCR)
-
After transfection the cells were harvested and RNA was isolated from the celllysates using Trizol reagent (Invitrogen) and purified according to the manufacturer's directions. Briefly, the cells were lysed directly in the culture dish by adding 1ml of Trizol reagent to each well. The homogenized sample was incubated at room temperature for 5 min to permit complete dissociation of the nucleoprotein complexes. For purifying the RNA, 200pl of chloroform was added, the tubes were shaken vigorously for 15 seconds and incubated at room temperature for 2-3 min. Tubes were centrifuged at 12,000 ref for 15 min at 40C. The aqueous phase was collected, mixed with 500pl isopropanol and incubated at room temperature for 10 min. Centrifugation was carried out at 12,000 ref for 10 min at 40C. The supernatant was carefully removed and the RNA pellet was washed with 1ml of 70% ethanol by vortexing and then centrifuging at 7500 ref for 5 min. The pellet was air dried and dissolved in 20pl of NFW.
-
RNA isolation from celllysates
-
The cells were assayed for Luciferase gene expression using Luciferase Assay kit (Promega, U.S.A.). After transfection, the cells were washed twice with PBS and then lysed by adding reporter lysis buffer provided in the kit. The cell lysate was collected from individual wells in eppendorf tubes, the cells were twice freeze-thawed in liquid N2 and then centrifuged at 13,000 rpm for 10 min at 40C. The supernatant was transferred to a fresh tube. 20¢ of cell extract was mixed with lOOp! of luciferase assay reagent that was kept at room temparature. The activity was determined using a luminometer (Packard lumicount, U.S.A.
-
Luciferase assay
-
incubator until the cells were 60% confluent. For each transfection, 1-2pg of DNA was diluted in 100 pi serum free media. Also, lOpl of lipofectin reagent · was diluted in 100 pi of serum free media and allowed to stand at room temperature for 30-45 minutes. The two solutions were combined, mixed gently and incubated at room temperature for 15 minutes. The cells were washed once with 2ml of serum free medium. For each transfection, 0.8 ml of serum free medium was added to each tube containing lipofectin-DNA complexes. The complex was mixed gently and overlaid onto cells. The plate was incubated for 4-6 hrs in a CDl incubator. The medium in each well was replaced with serum containing medium and the cells were further incubated for varying periods of time at 370C. The concentration of lipofectamine 2000 was used in the ratio 1:2 or 1:3 with DNA. The Rzs and Dzs were either co-transfected with the plasmid DNA of interest or when required to be transfected alone then pBSK+/-was used as carrier plasmid for better transfection efficiency. In order to ensure uniform transfection efficiency a reporter plasmid DNA (pSV -~ gal, Promega) was used
-
Transfection of cell lines used was carried out u5ing lipofectin reagent (Invitrogen, U.S.A.). In a six well plate 10 s cells/ well were seeded in 2m1 medium supplemented with serum. The cells were incubated in a CD2
-
Materials & Methods dried. These were counted directly to determine the total counts. In duplicate tubes, 1pl of the diluted probe was added to 100pg of carrier nucleic acid (tRNA or Herring Sperm DNA) in a total volume of 100pl. To this 500pl of ice-cold 5% TCA was added, mixed thoroughly and incubated on ice for 15-20 min. Glass fiber filters were wet (in duplicate) properly with 5% TCA and then these samples were applied on to them under vacuum. The filters were washed twice with 5ml of chilled 5% TCA and then air dried after rinsing with 2m1 of acetone. All the dry filters were inserted into scintillation vials containing scintillation fluid and the counts were taken in a liquid scintillation a-counter (LKB Wallac, 1219 Rackbeta, Sweden). The percentage incorporation, specific activity and the total amount of RNA made was then calculated according to the standard procedures. % incorporation =Incorporated cpm X100 Totalcpm Total RNA made (ng) = % incorporation X 338 Specific activity of probe = Total cpm incorporated p.g of RNA synthesized Cell culture media and cell lines: All the cell lines were grown and maintained in Dulbecco' s modified Eagle's medium (DMEM) with 10% Fetal bovine serum (FBS) and 1% antibiotic-antimycotic (penicillin, streptromycin and amphotericin B). The cells were maintained at 37<>C with 5% C02 in a humidified CD2 incubator (Nuaire-IR Autoflow CD2 Water-Jacketed incubator). Transient transfection
-
All the cell lines were grown and maintained in Dulbecco' s modified Eagle's medium (DMEM) with 10% Fetal bovine serum (FBS) and 1% antibiotic-antimycotic (penicillin, streptromycin and amphotericin B). The cells were maintained at 37<>C with 5% C02 in a humidified CD2 incubator (Nuaire-IR Autoflow CD2 Water-Jacketed incubator)
-
ell culture media and cell lines
-
dried. These were counted directly to determine the total counts. In duplicate tubes, 1pl of the diluted probe was added to 100pg of carrier nucleic acid (tRNA or Herring Sperm DNA) in a total volume of 100pl. To this 500pl of ice-cold 5% TCA was added, mixed thoroughly and incubated on ice for 15-20 min. Glass fiber filters were wet (in duplicate) properly with 5% TCA and then these samples were applied on to them under vacuum. The filters were washed twice with 5ml of chilled 5% TCA and then air dried after rinsing with 2m1 of acetone. All the dry filters were inserted into scintillation vials containing scintillation fluid and the counts were taken in a liquid scintillation a-counter (LKB Wallac, 1219 Rackbeta, Sweden). The percentage incorporation, specific activity and the total amount of RNA made was then calculated according to the standard procedures. % incorporation =Incorporated cpm X100 Totalcpm Total RNA made (ng) = % incorporation X 338 Specific activity of probe = Total cpm incorporated p.g of RNA synthesized
-
To determine the percentage of incorporation and probe specific activity, 1:10 dilution of the labeled probe was made in NFW. lpl of this was spotted on to duplicate glass fiber filters (Whatman GF/ A, U.S.A.) and ai
-
richloro acetic acid (TCA) precipitation:
-
polymerase and [a-32p] UTP (specific activity 3000Ci/mmole). The Riboprobe in vitro Transcription Systems (Promega) was used to make the in vitro transcripts. According to the manufacturer's directions, 0.2-lpg of the linearized DNA template was combined with the following components, in a final volume of 20pl, at room temperature in the following order: 4pl of SX transcription buffer (200mM Tris-HCl, pH 7.5, 30mM MgCh, lOmM Spermidine, 50mM NaCl), 2pl of lOOmM DTT, 20U of RNasin Ribonuclease inhibitor, 2.5mM each of ATP, GTP and CTP (pH 7.0), 2.4pl of lOOpM UTP (pH 7.0), Spl (50pCi at lOpCi/pl) of [a-32P]UTP and 15-20U of T7 or SP6 RNA Polymerase. For carrying out cold in vitro transcription all the four nucleotides (ATP, GTP, CTP, and UTP) were added at 2.5mM concentration and the reaction volume was made up with nuclease free water. The mixture was incubated at 370C for 60 min. The reaction was stopped using the stop buffer (50mM Tris-Cl, pH 7.5, SmM EDTA, 25pg tRNA/ml) and chilled on ice. RQl RNase-free DNase was added at a concentration of lU/pg of template DNA and incubated at 370C for 15 min to remove the DNA template following transcription. The transcripts were then purified by phenol : chloroform : isoamyl alcohol and chloroform : isoamyl alcohol extractions, followed by precipitation with 2.5 volumes of absolute alcohol and 0.5 volumes of 7.5M ammonium acetate and then 0.5 volumes of 1M ammonium acetate to remove the unincorporated nucleotides. After centrifugation for 30 min at 13,000 rpm the supernatant was carefully removed. The pellet was washed with 70% ethanol, vacuum dried and dissolved in 20pl of NFW
-
Plasmids containing the ribozymes or substrates were linearized at their 3' end with the appropriate enzymes. The linearized DNA was purified using the Qiagen Gel Extraction kit as described before (section 7.9). In vitro transcription reaction was then carried out using both T7 or SP6 RNA
-
In vitro Transcription:
-
with 4 ml of equilibration buffer QBT (750mM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100) and the column was allowed to empty by gravity flow. The supernatant was applied to the QIAGEN-tip and allowed to enter the resin by gravity flow. The QIAGEN-tip was washed thrice with 10ml of wash buffer QC (l.OM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol). The DNA was then eluted with 5 ml of elution buffer QF (1.25M NaCl, 50mM Tris-Cl, pH 8.5, 15% isopropanol). The DNA was precipitated by adding 0.7 volumes of isopropanol to the eluted DNA. It was thoroughly mixed and centrifuged immediately at 13,000 rpm for 30 min at 40C. The supernatant was carefully decanted. The DNA pellet was washed with 2 ml of 70% ethanol, and centrifuged at 13,000 rpm for 15 min at 40C. The supernatant was carefully decanted without disturbing the pellet. The pellet was air dried for 5-10 min and the DNA was dissolved in 200 p.l of RNase-DNase free water. To determine the yield, DNA concentration was determined both by Ultra Violet (UV) Spectrophotometry (DU-65 spectrophotometer, Beckman, U.S.A.) and quantitative analysis on an agarose gel using a UV Transilluminator (UVP, California, U.S.A.). All the putative clones were then screened for the correct recombinant clones by restriction enzyme digestion using appropriate enzymes. The digested samples were checked on an agarose gel along with an appropriate size marker to assess the size of the insert from the putative clones. The clones containing very small fragments were further confirmed by sequencing both strands of the DNA
-
For large scale plasmid DNA isolation, the bacterial cells were cultured in 100ml of LB medium with 100pg/ml of ampicillin. The cultures were grown for 8-10 hours at 37<>C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAGEN Plasmid Midi kit (100). Briefly, the bacterial cells were harvested by centrifuging at 6000 rpm for 10 min at 4<>C. The bacterial pellet was resuspended in 4 ml of the resuspension buffer P1 (50mM Tris-Cl, pH 8.0, 10mM EDTA, 100l!g/ml RNase A). 4 ml of lysis buffer P2 (200mM NaOH, 1% SDS) was added, mixed gently by inverting 4-6 times and incubated at room temperature for not more than 5 min. Further 4 ml of chilled neutralization buffer P3 (3.0 M potassium acetate, pHS.S) was added, mixed gently as before and incubated on ice for 10 min. It was then centrifuged at maximum rpm for 30 min at 4<>C. The supernatant containing the plasmid DNA was immediately removed andre-centrifuged at 10,000 rpm for 15 min at 4<>C. The supernatant was now collected in fresh tubes and kept on ice. A QIAGEN-tip 100 was equilibrated
-
lasmid Midipreps:
-
added and mixed by gently inverting the tube 4-6 times. The microfuge tubes were then centrifuged at 13,000 rpm for 10 min. QIAprep spin columns were placed in 2-ml collection tubes and the supernatant was applied to these columns. These were then centrifuged for 1 min and the flow-through was discarded. The Qiaprep columns were then washed by adding 0.75ml of buffer PE and centrifuged for 1 min. The flow-through was discarded and an additional centrifugation was given for another minute to remove traces of the wash buffer. The QIAprep columns were placed in a fresh 1.5ml microfuge tube. Finally, to elute out the DNA, 50pl of buffer EB (10mM Tris-Cl, pH 8.5) or RNase-DNase free water was applied to the center of each column and then centrifuged for 1 min after letting it stand for 1 min. The flow-through contained the DNA of interest.
-
Each single colony (white colonies, in case of blue-white screening), was inoculated individually in Sml Luria-Bertani (LB) medium with 100p.g/ml of ampicillin. The cultures were grown for 8-10 hours at 370C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN, U.K.). According to the manufacturer's directions, the pelleted bacterial cells were resuspended in 250pl of buffer P1 and transferred to a microfuge tube. 250pl of buffer P2 was then added and mixed gently by inverting the tube 4-6 times. Further, 350pl of buffer N3 was
-
Plasmid Minipreps:
-
The PCR products were ligated with T-tailed vectors (pGEM-T Easy, pTARGE-TfM from Promega or pcDNA3.1 from Invitrogen). In general, the ligation was carried out at a vector: insert molar ratio of 1:3 or 1:4 in a 10pl reaction volume finally containing 1X T4 DNA ligase buffer (300mM Tris-HCl, pH 7.8, 100mM MgCh, 100mM DTT, lOmM dATP) and lU of T4 DNA ligase (Promega, U.S.A.). The reaction mix was incubated at 160C for 16 hrs (overnight). Following the reaction, the ligated DNA was transformed into Calcium Chloride treated E.coli-DH5a or XL-Blue1 competent cells with a high transformation efficiency. The transformed cells were plated on to Luria-Bertani-Agar plates containing 100p.g/ml of ampicillin. Additionally, for blue-white screening of the colonies, 20pl of SOmg/ml of X-Gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside) and 10pl of 0.1M IPTG (lsopropyl-J3-thiogalactopyranoside) (Promega, U.S.A.) was used. The plated cells were incubated at 370C for 8-10 hours
-
Ligation and Transformation:
-
eppendorf tube had DNA of interest. The purified DNA fragments were checked on an agarose gel, with an appropriate marker, before setting up the ligation reaction
-
The plasmid DNAs for cloning, were digested with the respective enzymes, checked on an appropriate percentage of agarose gel along with 100 bp ladder or .A Hind ill marker (Promega, USA) and the required fragments were eluted from the gel using the Qiagel Gel Extraction kit (Qiagen, U.K.). According to the manufacturer's directions, the area of the gel containing the DNA fragment was excised using a clean and sharp blade, minimizing the amount of surrounding agarose excised with the fragment. The gel slice was weighed and placed in a microfuge tube. Three volumes of Gel Solubilization Buffer (QG) was added for every one volume of gel. The gel piece was then vortexed and incubated at 500C for 10 min. The contents were mixed in between, by inverting the tube few times, to ensure gel dissolution. It was then centrifuged at 13,000 rpm for 1min. The flow through in the discard column was carefully removed. Then 500 p.l of buffer PB was added to remove the traces of gel and the tube was centrifuged at 13,000 rpm for 1 min. The flow through in the discard column was removed and 750 p.l of Wash Buffer (PE) (containing ethanol) was added and the tube was centrifuged at 13,000 rpm for 1 min. The flow through was discarded and another spin at maximum for 2 min was given to remove the traces of wash buffer. The column was then put on a fresh tube and finally, to elute the DNA, 40 p.l of Tris-EDTA buffer (TE) or RNase-DNase-free water was added and then centrifuged at 13,000 rpm for 1 min. The flow through in the
-
Gel elution of DNA fragments:
-
CR conditions for amplification of vif gene of HIV -1 1. Denaturation-940C-5min 2. Denaturation-940C-30sec 3. Annealing-630C-30sec 4. Extension-720C-45sec 5. Final extension-720C-5min
-
The polymerase chain reaction (PCR) was carried out using the PCR Core System I (Promega, U.S.A.). 200ng of template DNA/oligonucleotide and 1 pM terminal primers were combined in 2Spl reaction volume finally containing 1X Mg free reaction buffer (500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% Triton X-100), dNTP mix with 0.2mM of each, 1.5mM MgCh and 0.62SU of Taq DNA Polymerase. 30 thermal reaction cycles from steps 2-4 were repeatedly carried out, in GeneAmp PCR 2400 machine (Perkin Elmer, USA). PCR amplification was analyzed by 1-2% agarose gel electrophoresis using a 100 bp ladder or A Hind ill marker (Promega, USA). PCR conditions for amplification of HBx gene of HBV 1. Denaturation-94oC-5min 2. Denaturation-94oC-1min 3. Annealing-42oC-2min 4. Extension-72oC-2min 5. Final extension-72oC-5min PCR conditions for amplification of hammerhead-Rz 1. Denaturation-94oC-5min 2. Denaturation-94oC-30sec 3. Annealing-42oC-1min 4. Extension-72oC-15sec 5. Final extension-72oC-2min
-
olymerase chain reaction
Tags
- method-14-detail
- method-9
- method-1-detail
- method-2
- method-13
- method-7-detail
- method-8-detail
- method-10-detail
- method-11
- method-15-detail
- method-4
- method-5-detail
- method-8
- method-9-detail
- method-6-detail
- method-5
- method-3-detail
- method-3
- method-1
- method-10
- method-4-detail
- method-11-detail
- method-13-detail
- method-12
- method-2-detail
- method-12-detail
- method-6
- method-15
- method-14
- method-7
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in10_chapter 3.pdf119
-
Visible Spectrophotometer was from Shimadzu (Tokyo, Japan). 11Quant Microplate Reader was procured from Biotek Instruments Inc. (Winooski, VT). Gene Pulsar X Cell electroporator was purchased from Bio-Rad Laboratories (Hercules, CA) while the cuvettes for electroporating cells were obtained from BTX Harvard Apparatus Inc. (Holliston, MA). BD Calibur flow cytometer was purchased from BD Biosciences (San Jose, CA). Hu 13 Midi DNA gel electrophoresis apparatus was procured from Scie Plas (Cambridge, UK). Protean II and III polycacrylamide gel system and Mini Transblot cells were procured from Bio-Rad Laboratories (Hercules, CA). Electrophoresis Power supply EPS 500/400 was purchased from Pharmacia Biotech-AB (Uppsala, Sweden). Peltier Thermal Cycler -200 was purchased from MJ research (Waltham, MA). UVP Gel Doc-It System was purchased from UVP Bio Imaging Systems Inc. (Upland, CA). JEOL JEM-2100F field emission transmission electron microscope at the Advanced Instrumentation facility, Jawaharlal Nehru University was used to capture images. GC-MS was performed with an Agilent 7890A gas chromatography instrument coupled to an Agilent 5975C mass spectrometer and an Agilent ChemStation software (version G1701EA, Agilent Technologies, Palo Alto, CA) A HP-5MS capillary column (30m x 0.25mm i.d) coated with 0.25 11m film 5% phenyl methyl siloxane was used for separation
-
Forma II Series water jacketed C02 incubator for cell culture was purchased from Thermo Fischer Scientific Inc. (Waltham, MA), BOD incubator for Leishmania cultures was obtained from Jeiotech (Korea) while 37°C incubator for bacterial cultures was purchased from Thermotech Instruments (P) Ltd (Raipur, India). Gyratory incubation shaker (Ecotron) was purchased from Infors-HT (Bottmingen, Switzerland). Optiphot fluorescence microscope, Nikon E600W upright fluorescence microscope and Nikon confocal microscope C1 were from Nikon (Tokyo, Japan). FluoStar Optima and FluoStar Omega fluorescence readers were purchased from BMG Lab technologies Inc. (Offenburg, Germany). UV-160A UV
-
Instrumentation
-
Results are expressed as mean ±SE. An unpaired two tailed student's t-test using Sigma Plot Version 10 & 11 was used for statistical analys
-
Statistical analysis
-
epoxy resins used for infiltration and embedding are not miscible with water. This was carried out by sequentially incubating the agar blocks in 25% methanol for 5 min, 50% methanol for 7 min, 70% methanol for 10 min, 95% methanol for 20 min and finally 100% methanol for 30 min followed by two more changes of methanol for 30 min each. The blocks were then incubated with transitional solvent propylene oxide for 30 min with one change at 15 min. Epoxy resin used for infiltration penetrates the cell and fills the spaces in between providing a hard medium that can withstand the cutting and electron beams. The blocks were first incubated for 30 min with a mixture of propylene oxide and resin in a ratio of 2:1. This was followed by incubation for 60 min with propylene oxide and resin in a 1:1 ratio. Finally, the blocks were put in pure resin and kept overnight at RT under shaking conditions. The following day, the agar blocks were placed in a bean capsule and overlayed with pure resin and incubated at 55°C to allow it to harden. Sectioning and Viewing: This was carried out at the Advanced Instrumentation Research Facility at Jawaharlal Nehru University
-
Sample Processing: Leishmania donovani cultures to be viewed under transmission electron microscope were pelleted at 1258 x g for 5min at RT. The pellet obtained were washed with PBS (0.22p. Filtered) and then resuspended in EM Fixative ( 4% Paraformaldehyde, 25% Glutaraldehyde, 0.1M Sodium Cacodylate) which had also been passed through a 0.22 p.m filter to remove any particulate matter that may interfere later with imaging. The cells were incubated in the fixative for 4-5 hours at RT followed by overnight incubation at 4°C. Subsequently the pellets were washed with sodium cacodylate buffer (0.1M sodium cacodylate, pH 7.3). The pellet was then embedded in 3%agar to prevent loss during subsequent washings. For this, agar was added to the pellet while vortexing so that the cells and agar mix well, then the agar was allowed to set. The MCT with the agar block was then cut to extract the block which itself was cut into smaller pieces to allow the solutions that will be added later to percolate well into the agar block. Post fixation was carried out to increase contrast and stability of fine structure, by incubating with 1% osmium tetraoxide for 2hr at RT. The blocks were then washed thoroughly with distilled water. Sample dehydration has to be carried out because the
-
Materials and Methods Staining withER Tracker™ Blue White DPX: ER Tracker™ is a dapoxyl dye that specifically stains ER in live cells. Since the dye was not found to retain after fixation, live cell staining was performed when fixation was required before staining with antibodies against the CYP proteins. Once washed, the cells were blocked with 3% NGS prepared in 0.001% Digitonin for 30 min at 4°C. This was followed by washing cells with chilled PBS at centrifugation at 805 x g for 10 min at 4°C. Then the cells were incubated with the appropriate primary antibody prepared in 0.001% digitonin for 1h at 4°C. The unbound primary antibody was washed off with chilled PBS three times by centrifugation at 805 x g for 10 min at 4°C. Cells were then incubated with appropriate secondary antibody again prepared in 0.001 % digitonin for 1h on ice. This was followed by three washes with chilled PBS as before. ER Tracker Blue (1p.M) then added to cells which were incubated on ice for 30mins on ice. The excess dye was washed and the cells viewed under the microscope after mounting on slides with anti-fading mounting media. 3.2.C.18 Electron Microscopy
-
taining withER Tracker™ Blue White DPX: ER Tracker™ is a dapoxyl dye that specifically stains ER in live cells. Since the dye was not found to retain after fixation, live cell staining was performed when fixation was required before staining with antibodies against the CYP proteins. Once washed, the cells were blocked with 3% NGS prepared in 0.001% Digitonin for 30 min at 4°C. This was followed by washing cells with chilled PBS at centrifugation at 805 x g for 10 min at 4°C. Then the cells were incubated with the appropriate primary antibody prepared in 0.001% digitonin for 1h at 4°C. The unbound primary antibody was washed off with chilled PBS three times by centrifugation at 805 x g for 10 min at 4°C. Cells were then incubated with appropriate secondary antibody again prepared in 0.001 % digitonin for 1h on ice. This was followed by three washes with chilled PBS as before. ER Tracker Blue (1p.M) then added to cells which were incubated on ice for 30mins on ice. The excess dye was washed and the cells viewed under the microscope after mounting on slides with anti-fading mounting media
-
The protocols for immunostaining cells with different antibodies and dyes were standardized individually for the respective staining procedure: Staining with MitoTracker® Red: MitoTracker® probes diffuse passively across the plasma membrane and accumulate into the active mitochondria. 100]1M stock solutions of MitoTracker Red CMX Ros were prepared in DMSO. Cells were stained at a final concentration of 100nM for 10 min at 37°C, at RT in the dark. The excess unbound dye was washed off and the cells were ready to be viewed under the microscope or processed further for fixation and antibody staining. Staining with antibodies (Table 3.9): Log phase cells were centrifuged at 129 x g for 5 min at RT to remove all dead cells. The live cells were washed 2X with PBS to remove any adherent media and FBS. Fixation was carried out with 2% formaldehyde at RT for 15 min. The fixed cells were washed 2X with PBS by centrifugation at 805 x g at RT for 5 min. They were then blocked using 3% Normal Goat Serum (NGS) prepared in 0.01% Saponin for 30 min at RT. After a wash with PBS, the cells were incubated with appropriate dilution of primary antibody prepared in 0.01% saponin for 1h at RT. The unbound antibody was thoroughly washed off by at least three washes with PBS. Incubation with respective fluorophore conjugated secondary antibody, again diluted in 0.01% saponin, and was carried out for 45 min at RT. The unbound antibody was thoroughly washed off by at least three washes with PBS. The cells were resuspended in a small volume of PBS and mounted on a slide along with anti-fading mounting media (10% glycerol and 0.001% P-phenylenediamine)
-
Immunocytochemistry
-
injection, programmed at 20°C min-1 to 200 °C and held for 10 min, then at 10 °C min-1 to 230 °C, and finally at 5 °C min-1 to 320 °C and held for 5 min. Injection temperature was set at 260 °C. High purity helium was used as carrier gas of 1.0 mL min-1 flow-rate. The spectrophotometers were operated in electron-impact (EI) mode, full scan of 40-550 amu or selected ion monitoring (SIM) was used, the ionization energy was 70 e V. Calibration curve was generated using n-hexane stock solutions of standard ergosterol dilutions (5-300 ng/mL) in duplicates and plotting the peak area versus the concentration (Yang et al., 2009).
-
Gas chromatography (GC) is a common type of chromatography used in analytic chemistry for separating and analysing compounds that can be vaporised without decomposition, while Mass spectrometry (MS) is an analytical technique that measures the mass-to-charge ratio of charged particles and thus determining masses for determining the elemental composition of a sample or molecule, and for elucidating the chemical structures of molecules. Combined together the technique of GC-MS can be used to identify individual components in a mixture and also quantitate them. The sterol extracts prepared in 3.2.C.14 were dried under nitrogen (N2) gas, resuspended in n-hexane and derivatized with BSTF A (N,O-bis (trimethylsilyl) trifluoroacetamide) containing 1% TMCS (trimethylchlorosilane) at 70 °C for 1 hr. The derivative mixture was dried under N2 (gas) to remove excess BSTFA and subsequently re-dissolved in n-hexane. The column temperature was set at 100°C and held for 5 min for
-
GC-MS analysis of ergosterol
-
Chromatography is the technique of separation of compounds on the basis of their distribution/ partition between two phases. Thin Layer Chromatography (TLC) is a solid-liquid form of chromatography where the stationary phase is normally polar absorbent and the liquid phase is the mobile phase made up of a single or combination of solvents depending on the solutes to be separated. The sterol isolated by method described in 3.2.C.14, were also run on a Thin Layer Chromatogram. Standard ergosterol dilutions and samples from wild-type and half knock out parasites were spotted on a Silica Gel G plate. The sterols were resolved using a binary solvent [hexane/ ethyl acetate (75/25)]. The sterols were visualized using Mo' s stain (12.5g Ammonium molybdate (VI) tetrahydrate, 5.0g Ammonium cerium (IV) sulphate, 50mL concentrated sulphuric acid, water upto 500mL
-
hin Layer Chromatography of ergosterol
-
30nm corresponds only to the intermediate. Since equal number of cells was taken for estimation, the height of the peak was taken as a measure of the ergosterol content
-
Ergosterol content was measured as described by Arthington-Skaggs et al. (1999) with slight modifications. Briefly, equal number of cells were harvested and washed with PBS to remove media and FBS. They were resuspended in 3mL of 25% alcoholic KOH (25g KOH, 35mL sterile distilled water brought to lOOmL with ethanol) and vortexed for one minute. The cell suspension was transferred to a glass vial and incubated at 85°C for 1 hr. The vial was cooled to room temperature followed by the addition of 1mL sterile distilled water and 3mL of n-heptane. The vial was vortexed for 3 mins after which the heptane layer was collected. It was diluted 5 times in absolute ethanol and transferred to a cuvette. A spectrum was recorded between 220nm and 300nm. The peak at 281.5nm corresponds to ergosterol along with some intermediates.
-
Spectrophotometric estimation of ergosterol
-
A bioluminescent ATP determination kit from Invitrogen (Carlsbad, CA) was used to quantitate ATP levels. The assay is based on luciferase' s requirement for ATP for producing light (emission maxima at 560nm). The assay was carried out as described previously (Mukherjee et al., 2002). Briefly, a standard reaction mix was prepared-1X reaction buffer, 0.1p.M DTT, O.Sp.M Luciferin and 12.5 p.g/ mL Luciferase. 100 p.L was aliquoted into each well of a 96 well white plate and a base line reading measured using Fluostar Omega using the luminometer adaptor. Then either 106 parasites or different concentrations of A TP (prepared from the stock solution provided in the kit) were added to these wells as test and standard curve samples respectively. Again luminescence was measured and the baseline subtracted from the readings. The different dilutions of ATP were used to plot the standard curve which was then used to calculate the ATP levels in cells expressed as nmol/106 cells.
-
Materials and Methods the MTT Lysis buffer (20% SDS , 50% Dimethyl formamide) and the O.D.s7onm was measured. The standard curve was plotted and the equation derived, used to calculate the number of metabolically viable cells in experimental groups. Percentage of viable cells was calculated by comparing the number of viable cells in treated wells with that of untreated wells. 3.2.C.13 ATP determination
-
he MTT Lysis buffer (20% SDS , 50% Dimethyl formamide) and the O.D.s7onm was measured. The standard curve was plotted and the equation derived, used to calculate the number of metabolically viable cells in experimental groups. Percentage of viable cells was calculated by comparing the number of viable cells in treated wells with that of untreated wells
-
MTT micromethod is a colorimetric assay based upon the conversion of the (yellow) MTT reagent (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide), a tetrazole to purple formazan in the mitochondria (succinate dehydrogenase) of the living cell which is quantified by measuring the optical density at 570nm. When the amount of purple formazan produced by untreated control cells is compared to that of treated cells, the effectiveness of the agent can be deduced through the production of a dose-response curve. Parasites in their log phase were harvested and the dead cells removed at 129 x g for 5min at RT. The live cells were resuspended in phenol red-free DMEM containing 10% FBS to a cell count of 2.5 X 107. 1mL of above culture was plated into each well of a 24 well plate and appropriate treatments were given for desired duration of time. Some untreated cells were also kept aside for generating the standard curve. After appropriate treatment, from each well of the 24 well plate 200pL was aliquotted into 4 wells of a 96 well plate. To each well of the 96 well plate, 10pL of MTT solution (5mg/ mL prepared in PBS and filtered with 0.22p filter) was added and the plate incubated at 23°C for 2-3 hours till colour develops in the control cells. A standard curve was also plated by taking different dilutions of untreated cells and processed similarly. Once colour developed, the reaction was stopped by lysing the cells using
-
MTT assay to assess viability of Leishmania parasites
-
hydrolysis of the non-fluorescent derivative dichlorodihydrofluorescein. In the presence of an appropriate oxidant, dichlorodihydrofluorescein is oxidised to the highly fluorescent 2, 7 -dichlorofluorescein. Log phase cultures were taken and dead cells pelleted at 129 x g for 5 min at RT. The live cells were resuspended in fresh phenol red-free DMEM containing 10% FBS to get a cell density of 107 cells per mL. The cells were loaded with the dye (Stock solution prepared in DMSO to a final concentration of 1pg/pL) by incubating every 107 cells with 2pL of stock solution for 15 to 20 min on an end to end shaker at RT and then washed with medium. The cells were incubated for another 15 min to allow de-esterification to occur. 200pL was aliquotted into each well of a black plate and a basal reading taken at 485nm/ 520nm. Subsequently stained cells were exposed to appropriate treatments and fluorescence monitored at appropriate intervals of time. For each experiment, measurements were prepared in quadruplets and expressed as arbitrary f1uorescence intensity units (AFU)
-
CM-H2DCFDA (5-(and-6)-chloromethyl -21,7'-dichlorodihydro fluorescein diacetate, acetyl ester) has been used as a detector of ROS as described previously (Mukherjee et al., 2002).This probe is a non-polar, non-fluorescent dye that diffuses readily into cells, where it is trapped by
-
Assay for measuring intracellular ROS
-
Rhod-2 acetoxymethyl ester is a fluorescent long wavelength calcium indicator, where the AM ester forms are cationic, resulting in a potential driven uptake into the mitochondria making them selective detectors of mitochondrial calcium. Log phase cultures were taken and dead cells pelleted at 129 x g for 5 min at RT. The live cells were washed twice with Kreb' s buffer (118mM Sodium chloride, 5.4mM Potassium chloride, 1.2mM Magnesium chloride, 1.2mM Potassium dihydrogen phosphate, 25mM Sodium hydrogen phosphate, llmM glucose, 1.5mM Calcium chloride, pH 7.4) by centrifugation at 1258 x g for 5 min to wash off all traces of medium and FBS. Washed cells were loaded with 1:1 mixture of Rhod -2 AM (1p.g/p.L stock solution prepared in DMSO) and 20%w/v Pluronic F127 for 1h at RT in the dark with shaking. Excess dye was removed by one wash with Kreb' s buffer followed by incubation of cells at RT for a further 30min for complete hydrolysis of the dye trapped in the mitochondria. Fluorescence intensities of the stained cells were measured fluorimetrically at excitation of 530nm and emission of 576nm or alternatively acquired by flow cytometer.
-
Assay for measuring mitochondrial calcium
-
1mL medium were stained with 1p.L of the dye (1ng/mL) and incubated at 37°C for 10 min in the dark. The unbound dye was washed off with either PBS or medium and cells analysed by flow cytometry or microscopy. Nonylacridine Orange (NAO): NAO (Molecular probes) is a probe which interacts specifically with non-oxidized cardiolipin, a lipid that is exclusively localized in . the inner mitochondrial membrane (Petit et al., 1992). A stock solution of 100p.M was prepared in DMSO and 1p.l (1nM) was used to stain 107 cells in 1mL medium for 10 min at 37°C. The excess dye washed off with PBS and cells were fixed with 4% formaldehyde for 3 min. Subsequently they were analysed with flow cytometry or microscopy
-
Mito Tracker Green®: Mito Tracker® Green (Invitrogen, Carlsbad, CA) is an agent that interacts with mitochondrial lipids and is essentially non-fluorescent in aqueous solution, only becoming fluorescent once it accumulates in the lipid environment of the mitochondria. Since the entry of the dye is not dependent on the mitochondrial membrane potential, it can be used to measure/ compare the mitochondrial mass of cells both in live as well as fixed states. MitoTracker Green® stock solution was prepared in DMSO (1pg/pL) and stored at -20°C. To stain cells
-
Assay for measuring mitochondrial mass
-
C-1 (5,5' ,6,6' -tetrachlorol,1' ,3,3' tetraethyl benzimidazoly 1 carbocyanine iodide) is an anionic mitochondrial vital dye (10mm stock prepared in DMSO) that is lipophilic and becomes concentrated in the mitochondria in proportion to the membrane potential; more dye accumulates in mitochondria with greater potential and ATP generating capacity. The dye exists as a monomer at low concentrations that emit a green fluorescence (530nm) but at high concentrations forms J aggregates that emit red fluorescence (590nm). The ratio of the two fluorescences gives a ratiometric comparison of mitochondrial membrane potential. Following appropriate treatment, 107 (in 1mL medium) cells were transferred to an MCT containing 10pL of the working stock (0.4mM ) of the dye (final concentration of 4pM), and incubated at 37°C for exactly 10 min in the dark. This was followed by centrifugation at 1811 x g for 3 min at RT. The pellet obtained was resuspended in M199 medium containing 10% FBS and centrifuged at 1811 x g for 3 min at RT. Two more such washes were given, after which the pellet was resuspended in 2mL M199 + 10% FBS and fluorescence measured at 485nm/ 530nm and 535nm/ 590nm
-
Assay for measuring Mitochondrial Membrane Potential (JC-1 Staining)
-
were then centrifuged at 1065 x g for 5 min at 4°C. The pellet obtained was resuspended in 1mL ice cold PBS and washed 5 times with PBS. Finally the pellet was resuspended in 1mL lysis buffer (10mM Tris-HCl containing 0.1% Triton X-100) and fluorescence was measured at 380nm/525nm. To normalize different samples and account for any errors in cell number between samples, 10011L of the above sample was also used for protein estimation, carried out as described above
-
Monodansylcadaverine (MDC) is a selective marker for autophagic vacuoles (Biederbick et al., 1995). It is an auto-fluorescent drug accumulates in acidic compartments by ion trapping and also is thought to interact with the membrane lipids of the vacuoles. Stock MDC (50mm, prepared in acetic acid) was diluted to a concentration of 50!lM in M199 medium containing 10%FBS. 107 parasites after appropriate treatment were resuspended in 1mL of working stock and incubated in the dark for 10 min at RT. These
-
Assay for measuring the level of autophagy in Leishmania parasites (MDC staining)
-
s promastigotes develop from procyclic to metacyclic forms, the surface LPG undergoes changes in size and carbohydrate structure. Procyclic promastigotes express a smaller LPG capable of binding to the sand-fly midgut, while metacyclic promastigotes express a larger LPG typically accompanied by changes in the terminal sugar of some of these units (McConville et al., 1992). The lectin peanut agglutinin (PNA) binds to terminal galactose of procyclic LPG but does not bind its metacyclic LPG counterparts which terminate in arabinose. This principle is used in assessing the number of metacyclics in a culture (Sacks et al., 1985). Briefly, after appropriate incubation, 107 cells were harvested and washed once with PBS followed by resuspension in 1mL PBS. PNA (1mg/ mL, prepared in PBS) was added to the cells at a final concentration of 10011g/ mL and incubated at 23°C for 1hr followed by incubation on a shaker incubator set at 40rpm for 5 min. The clumps formed were then pelleted at 100 x g for 3 min at RT. From the supernatant, 1011L was withdrawn for counting on a Neubauer's chamber to get the number of metacyclics per 107 cells
-
Assay for measuring the number of metacyclic parasites (Peanut Agglutination Assay)
-
The growth pattern of wild-type and transfected cells were carried out counting the number of cell in a haemocytometer at 24hr intervals. For this equal number of cells (107 or 5 X106) of wild-type and transfected parasites in log phase were plated. An aliquot was withdrawn every 24 hours and used for counting in a counting chamber to analyse growth pattern.
-
Growth curve analysis
-
In order to create a half and complete knockouts of CYP genes, a strategy of homologous recombination was employed whereby, the allele(s) in the genomic DNA is replaced by an engineered construct, leaving the other loci unaffected. Since Leishmania is an asexual organism, a two-step targeting protocol has to be followed targeting one allele at a time. The engineered construct contains a selection marker flanked on either side by sequences of the target allele and were generated as explained in 3.2.B.17. Leishmania donovani promastigotes were electroporated with the allelic replacement constructs as described above in section 3.2.A.6. 24 hrs post electroporation, selection antibiotic (Neomycin and/ or Hygromycin, as the case may be) was added to the electroporated cultures and scaled up as described above in 3.2.A.6. Clones generated were cultured and their genomic DNAs isolated. The presence of the replacement construct integrated into the genomic DNA was checked for by PCR using primers specific for the replacement construct (Table 3.6 & 3.7). Those clones which showed the presence of the replacement construct in the genomic DNA were assayed for the level of the respective CYP protein using western blotting as described above in 3.2.B.19 and 3.2.B.20
-
Generation of parasites with half and complete knock-out of CYP genes
-
Cell surface membrane proteins were separated using a method by Snapp and Landfear (1997). 4 X 107live cells/mL were resuspended in MME buffer (10mM MPOS, 0.1mM EGTA, 1mM MgS04, 0.1%v/v Triton X-100 and protease cocktail) and incubated at 4°C for 1 hr. on an end to end rotor. This was followed by centrifugation at 3000 x g for 4°C for 10 min. The pellet obtained was washed with PBS and then lysed in 2X sample buffer and run on an SDS-PAGE followed by western blotting
-
Separation of cell surface proteins
-
Western blotting by adding 2X sample buffer as described in 3.2.B.19 and 3.2.B.20 respectively
-
Triton X-114 has a property of a low cloud point (23°C). At temperatures above the cloud point, detergent solutions separate into aqueous and detergent-enriched phases thus separating membrane proteins (detergent phase) from cytosolic ones (aqueous phase). Promastigotes in the logarithmic phase of growth were harvested and dead cells pelleted at 129 x g. 109 live promastigotes were resuspended into 10mL of 0.5% vI v Triton X-114 containing protease inhibitor cocktail. The cells were homogenized using a 30-40 strokes of dounce homogenizer. The homogenate was incubated on ice for 90 min with intermittent stirring. Following this insoluble material was pelleted by centrifugation at 3700 x g for 35 min at 4°C. The supernatant was incubated at 37°C for 2 hr., till layers separated well. The top aqueous layer was separated from the bottom detergent layer. Samples of both these were prepared for SD
-
Triton X-114 extraction of membrane proteins
-
For experiments, cells in the logarithmic phase were taken from slant or liquid medium and dead cells removed by centrifugation at 129 x g for 5 min at RT. The supernatant was centrifuged at 1258 x g for 10 min at RT to pellet the live cells which were then resuspended in fresh medium to a cells count of 107 cells per mL. Treatment with PAT (stock solution of 10mg/mL prepared freshly in medium) was carried out at 100, 200 and 300 Jig/mL; with miltefosine (800Jig/mL stock solution prepared in DMSO) at 10, 20, 40, 60 and 80 JIM, and with H202 at 100, 200 and 300 JIM. Ketoconazole (10mM, prepared in absolute ethanol) and clotrimazole (10mM, prepared in DMSO) were used at 10 and 30 JIM. Ergosterol (3mg/ mL prepared in chloroform or absolute ethanol) was added to culture medium at a final concentration of 5-10Jig/ mL.
-
Drug treatments
-
Densitometry: Densitometry was performed using Labworks™ Image Acquisition and Analysis Software, UVP Biolmaging Systems, UVP Inc. (Upland, CA).
-
followed by several washes with PBS-Tween (50mM PBS containing 0.1 %v /v Tween 20) to remove any traces of acetic acid. Blocking: Nonspecific sites were blocked by incubating the membrane with 3%w /v milk protein (prepared in PBS-I) at 4°C overnight. Subsequently excess blocking reagent was washed off by three washes of PBS-T, each for 15 min at RT on a shaker incubator set at 60-80rpm. Incubation with primary antibody: Appropriate primary antibody dilutions (usually 1:20,000; Table 3.8) were prepared in 0.1% PBS-T or 1% blocking reagent. Blots were incubated with primary antibody for 1hr at RT on a shaker set at 30-40rpm. Unbound primary antibody was then washed off by three washes of PBS-T, each for 15 min at RT on a shaker incubator set at 60-80rpm. Incubation with Secondary antibody : Corresponding secondary antibody dilutions (usually 1:20,000; Table 3.8) were prepared in 0.1% PBS-I or 1% blocking reagent. Blots were incubated with secondary antibody for 1hr at RT on a shaker set at 30-40rpm. Unbound secondary antibody was then washed off by three washes of PBS-T, each for 15 min at RT on a shaker incubator set at 60-SOrpm. Detection by Enhanced Chemi-Luminescence or ECL: In the presence of hydrogen peroxide, horseradish peroxidase catalyses the oxidation of cyclic diacylhydrazides such as luminal. Following oxidation, luminal is in an excited state which decays to the ground state by emitting light. ECL reagents from EZ-ECL kit (Biological industries) were used according to manufacturer's instructions. Briefly, equal volume of ECL solution A (Luminal) and B (Hydrogen peroxide) were mixed and incubated with the membrane for approximately 5 min. Excess solution was drained off and the membrane enclosed in between two sheets of transparencies taking care to remove any air bubbles trapped in between. These were then placed in an X-ray film cassette and exposed to a sheet of X-ray film under red safety light. Depending on the antibody used, exposure times varied. Subsequently the X-ray film was transferred to developer followed by fixer solutions. Excess fixer was washed off with running water and the film air-dried.
-
Transfer of protein onto nitrocellulose membrane: Protein resolved by PAGE were transferred onto Hybond nitrocellulose membrane (Amersham, Pharmacia Biotech, Uppsala, Sweden) at SOV for 2.5 hours at 4°C in chilled transfer buffer (192mM glycine, 25mM Tris Base pH 8.3, 20%v lv methanol). Visualisation of protein bands transferred onto nitrocellulose membrane: Following transfer, the membrane was stained with amido black (0.1 %w lv amido black in 7%v lv acetic acid) for 30-60 s at RT. To destain, the membrane was washed in excess amounts of 7% vI v acetic acid. This was
-
Western Blottin
-
and incubated at RT for 5 min. The O.D. was measured at 595nm spectrophotometrically and quantitated against a standard reference table supplied with the kit. Alternatively, a standard curve was also plotted using different concentrations of Bovine Serum Albumin (BSA) and used to quantitate protein concentration. Electrophoretic separation of proteins: Electrophoresis for protein separation was performed using the Laemmli buffer system (Laemmli, 1970) on 10 or 12% polyacrylamide gels under reducing or denaturing conditions (SDS-PAGE). Polyacrylamide gels were prepared from 30% acrylamide (30% acrylamide, 0.8% bis-acrylamide), 4X running buffer (1.5M Tris-HCl pH 8.8), 4X stacking buffer (O.SM Tris-HCl pH 6.8), 10% SDS and 10% ammonium persulfate (APS). The gels were run in tank buffer (0.025M Tris Base, 0.192M glycine and 0.1% w I v SDS) at 40-60V while samples were in stacking gel and 80-100V once they entered resolving gel. A molecular weight marker (unstained or pre-stained depending on the requirement) containing proteins of known sizes were run to evaluate the approximate molecular weights of the resolved proteins. Visualization of protein bands on Polyacrylamide gels: The protein bands resolved in the gels were stained with Coomassie Brilliant Blue R250 (0.125%w lv CBB R250, 50% v lv methanol, 10% v lv acetic acid) for 15-30 min, followed by washing off excess stain with destain (50%v lv methanol, 10%v lv acetic acid)
-
SDS-PAGE is used to separate proteins according to their electrophoretic mobility which is a function of the length of the polypeptide chain or molecular weight, in the presence of denaturating agents when the secondary structure is lost. One molecule of SDS binds every 2 amino acids, imparting a net negative charge that is proportional to the length of the polypeptide. When loaded on the gel matrix and placed under an electric field, the negatively charged proteins migrate towards the positively charged electrode and are separated by molecular sieve. Preparation of lysates: After appropriate treatments, cells were harvested and washed 1X in PBS to remove any traces of medium and FBS. The remaining pellet was resuspended in residual buffer. A minimal volume of 2X sample buffer (0.125M Tris HCI pH 6.8, 4% sodium dodecyl sulphate, 20%v /v glycerol, 10% P-mercaptoethanol and 0.01 % bromo-phenol blue) was added drop-wise to the pellet while vortexing to ensure complete lysis. The lysate was denatured by boiling at 99°C for 15 min and debris pelleted down by centrifugation at 10000 x g for 5 min at RT. The supernatant was decanted into a fresh tube and used immediately or stored at -70°C. Estimation of protein concentration in lysates: Total protein concentration of whole celllysates was performed using the CB-X™ Protein Assay kit, by a modification of the Bradford method (Bradford, 1976). In brief, 1mL of chilled (-20°C) precipitant solution was added to 10pL of the whole cell lysate and centrifuged at 10,000 x g for 10 min. The supernatant was discarded and the pellet resuspended in 50pL each of solubilising solution A and B. To this 1mL colour reagent was added, the samples were vortexed
-
Sodium Dodecyl Sulphate PolyAcrylamide Gel Electrophoresis
-
The DNA sequencing was carried out at the DBT sequencing facility, Department of Biochemistry, Delhi University, South Campus, New Delhi using the di-deoxy method (Sanger et al., 1977)
-
DNA Sequencing
-
between the 5' and 3' flanking regions using the sites Smai and BamHI to generate pBSK+CYP710C1Hyg
-
The vector pBlueScript SK+ was used as the backbone to generate the replacement constructs. Standard cloning techniques were used (Sambrook et al., 1989). CYP5122A1 allelic replacement constructs were prepared by inserting ORFs encoding Neomycin or Hygromycin resistance between 0.4 Kb 5' and 0.37 Kb 3' CYP5122A1 flanking regions cloned into the vector pBlueScript SK+, to generate the constructs pBSK+CYP5122A1Neo and pBSK+CYP5122A1Hyg respectively. The following steps were performed. (i) A 416bp 5' flanking sequence of CYP5122A1 was amplified by Hi-fidelity PCR (Table 3.6) and cloned in between unique EcoRV and EcoRI sites of pBSK+ vector. (ii) A 378bp 3' flanking region of CYP5122A1 was amplified using Hi-fidelity PCR and cloned in between BamHI and Xbal sites in pBSK+ with the 5'fragment already cloned in. (iii) ORF for Neomycin resistance was amplified from the vector pXG-GFP+2 and cloned in between the 5' and 3' flanking regions already cloned into pBSK+ vector using the EcoRI and BamHI sites, to generate the construct pBSK+CYP5122A1Neo. (iv) To generate the second replacement construct, hygromycin ORF was amplified from the vector pXG-Hyg (Kindly provided by Dr. Stephen M. Beverley, Washington University) and cloned in between the 5' and 3' flanking regions using the sites Smal and BamHI to generate pBSK+CYP5122A1Hyg. Similarly CYP710C1 allelic replacement constructs were prepared by inserting ORFs encoding Neomycin or Hygromycin resistance between 0.36 Kb 5' and 0.37 Kb 3' CYP710C1 flanking regions cloned into the vector pBlueScript SK+, to generate the constructs pBSK+CYP710C1Neo and pBSK+CYP710C1Hyg respectively. The following steps were performed. (i) A 364 bp 5' flanking sequence of CYP710C1 was amplified by Hi-fidelity PCR (Table 3.7) and cloned in between unique EcoRV and EcoRI sites of pBlueScript SK+ vector. (ii) A 378bp 3 'flanking region of CYP710C1 was amplified using Hi-fidelity PCR and cloned in between BamHI and Xbal sites in pBlueScript SK+ with the 5'fragment already cloned in. (iii) ORF for Neomycin resistance was amplified from the vector pXG-GFP+2 and cloned in between the 5' and 3'flanking region cloned into pBlueScript SK+ vector using the EcoRI and BamHI sites, to generate the construct pBSK+CYP710C1Neo. (iv) To generate the second replacement construct, hygromycin ORF was amplified from the vector pXG-Hyg and cloned in
-
Generation of allelic replacement constructs for generation of knock outs
-
Leishmania! expression vector pXG-GFP+2 was obtained as a kind gift from Dr. Stephen S. Beverley (Washington University). Full length CYP5122A1 (Ld27) had been amplified by PCR using primers (F27P3/F27P2, Table 3.4) and cloned into pGEM-T Easy vector. The ORF was then excised from pGEMT using Notl and cloned into pXG-GFP+2 vector. The transformants were selected for the insertion of the gene in the correct orientation using restriction digestion. Standard cloning techniques were used (Sambrook et al., 1989).
-
Generation of pXG-GFP+2-Ld27 (CYP5122Al)
-
thoroughly by inverting the tube 4-6 times before keeping at RT for 5 min. 4mL of chilled Buffer P3 was added and mixed immediately and thoroughly by inverting the tube 4-6 times. A cartridge was capped and the entire contents were poured into it and allowed to settle for 10 min at RT. In the meantime, a Qiagen tip was equilibrated with 20mL of buffer QBT (750mM NaCl; SOmM MOPS, pH 7.0; 15%v /v isopropanol and 0.15% triton X-100). After the 10 min incubation, using a plunger, the contents of the cartridge were transferred into the equilibrated tip and allowed to drain by gravity. The tip was then washed with lOmL of Buffer QC (1M NaCl; SOmM MOPS, pH 7.0 and 15%v /v Isopropanol). The DNA was then eluted using SmL Buffer QF (125mM NaCl; SOmM Tris-Cl, pH 8.5 and 15%v /v Isopropanol) into a corex (glass) tube by gravity flow. 3.5mL of isopropanol was added to the eluted DNA and incubated at RT for 30 min. The DNA was then precipitated at 16000 x g at 4°C for 30 min. The supernatant was discarded and the pellet was washed in 2mL 70% ethanol at 16000 x g at 4°C for 10 min. The supernatant was gently decanted; the pellet was dried to remove any traces of alcohol. Then the DNA was resuspended in ~200]lL of Buffer EB (10mM Tris-Cl, pH 8.5) provided with the kit, or alternatively with nuclease-free water. The concentration of the obtained DNA was estimated by measuring the absorbance at 260nm (A26o) and using the known formula: DNA concentration = A260 X SOX dilution factor. Purity of DNA was monitored by looking at the A26o/ A2so ratio (should be above 1.6)
-
Plasmid DNA was isolated in large scale using QIAprep Midiprep kit according to manufacturer's protocol. Briefly, 100mL for a high copy number plasmid and 200mL for a low copy number plasmid was cultured overnight followed by centrifugation at 4629 x g for 15 min at 4°C. The pellet was washed once with PBS and then resuspended well in 4mL Buffer P1 by vortexing. To this, 4mL of Buffer P2 was added an
-
MidiPrep for large scale isolation of plasmids
-
Plasmid DNA was isolated at small scale using QIAprep Miniprep kit according to manufacturer's protocol. Briefly, 5mL of overnight E. coli culture was pelleted and resuspended in 250J..LL Buffer P1(50mM Tris-Cl, pH8.0; 10mM EDTA and 100p.g/mL RNase A). To this, 250 J..LL of Buffer P2(200mM NaOH and 1 %w /v NaOH) was added and mixed thoroughly by inverting the tube 4-6 times. 350 IlL of Buffer N3 (proprietary) was added and mixed immediately and thoroughly by inverting the tube 4-6 times. This was followed by centrifugation at 13000 x g for 10min at RT. The supernatant was applied to a QIAspin column and centrifuges at 13000 x g for 30-60s. The column was washed with 0.5mL Buffer PB followed by 0.75 mL Buffer PE. Residual wash buffer was removed by centrifugation for an additional 60s. The plasmid DNA bound to the column was eluted using the elution buffer, Buffer EB (10mM Tris-Cl, pH 8.5) provided with the kit, or alternatively with nuclease-free water. The concentration of the obtained DNA was estimated by measuring the absorbance at 260nm (A26o) and using the known formula: DNA concentration= A260 X SOX dilution factor
-
Miniprep to isolate plasmids
-
run on an agarose gel and band size determined by comparison against DNA ladder with bands of known sizes. Clones that were positive for the presence of gene/ plasmid were further checked by restriction digestion. For restriction digestion, plasmid was first isolated by Miniprep as described below. The digestion reactions were set according to manufacturer's protocol appropriate for the enzymes used. The products were run on an agarose gel and band size determined by comparison against DNA ladder with bands of known sizes. Clones with the desired pattern of digestion were propagated further and used
-
Bacterial colonies obtained by transformation were checked for the presence of plasmid or gene inserted into the plasmid by colony PCR and restriction digestion. For PCR, a master mix for all the PCR reactions to be performed was made, aliquoted into PCR vials and stored on ice. Individual colonies were picked up, numbered and streaked onto an LB agar plate followed by deposition of a few cells into the PCR mix. PCR was carried out as described above for the respective primer pairs with the exception that the initial denaturation was carried out for 7 min at 94 °C. The products were
-
Screening of bacterial transformants
-
Plasmid/Ligation mix was incubated with ultra-competent cells for 30 min on ice. This was followed by a heat shock at 42°C for exactly 45s after which the cells were chilled on ice for 2 min. lmL of LB (Luria Bertani) medium was added to the cells and incubated at 37°C in a shaker incubator for 45 min. Cells were then plated on LB agar plate containing appropriate antibiotic and/ or X-gal solution and incubated at 37°C overnight
-
Transformation of competent cells with DNA
-
Ultra competent cells were prepared by using the method described by Inoue (Inoue et al., 1990). Briefly, the DH5-a cells were grown in the SOB culture medium (20gm/L Tryptone, 5 gm/L Yeast extract, 0.5 gm/L Sodium chloride, 2.5 mM Potassium chloride and 10mM Magnesium chloride, pH 7.0) at 18°C till the O.D.6oo of 0.55 was attained. The flasks were then shifted to ice-water bath for 10 min. The cells were harvested by centrifugation at 3220 x g, all media was discarded and the cell pellet was resuspended in Inoue transformation buffer (55mM Manganese chloride, 15mM Calcium chloride, 250mM Potassium chloride, 10mM PIPES, pH 6. 7). The suspension was centrifuged at 3220 x g, the buffer discarded and cell pellet was resuspended in fresh Inoue transformation buffer. DMSO (1.5mL/20mL of buffer) was added and the cells were frozen at -70°C. Cells were checked for transformation efficiency and were used if transformation efficiency was above 5 X 108 transformed colonies / Jlg of DNA
-
Preparation of ultra-competent cells of E. coli DHS-a
-
The DNA fragments eluted from the agarose gel or purified PCR products were cloned into pGEM-T easy vector which allows efficient sequencing using the common sequencing primers T7 and SP6. SOng of the vector was used with 1J..lL of T4 DNA ligase in a 10J..lL reaction volume. The reaction was allowed to proceed at 4 °C for 16h followed by transformation into DHS-a strain of E coli following standard protocols. The transformed cells were plated onto LB-agar plates containing appropriate ampicillin (100J..lg/mL) and blue-white selection reagent (40J..lL/plate). The plate was incubated at 37°C for 12 hrs, following which white colonies were picked up for screening for the presence of the gene of interest.
-
Sub-cloning of PCR products into pGEM-TEasy Vecto
-
The PCR products generated using protocol mentioned above were purified using QIAquick PCR purification kit from Qiagen (Hilden, Germany) as per manufacturer's protocol. Briefly, S volumes of buffer PB was added to 1 volume of PCR sample. This was applied to QIAquick spin column and centrifuged at 10,000 x g for 30-60s. The flow-through was discarded and the column washed with 0.7SmL of buffer PE. After discarding the flow-through again, the column was dried by a quick spin. The DNA was eluted using 30-SO J..lL of elution buffer (Buffer EB (10mM Tris-Cl pH 8.S)) or alternatively in nuclease-free water. The concentration of the obtained DNA was estimated by measuring the absorbance at 260nm (A26o) and using the known formula: DNA concentration = A260 X SOX dilution facto
-
Purification of PCR produc
-
Germany) as per manufacturer's protocol. Briefly, the gel was solubilised by incubating it with buffer QG (composition proprietary) at S0°C for 10 min. The solubilized gel was loaded onto a binding column and centrifuged at 12000 x g for 1 min. The flow through was discarded and the column was washed once with buffer PE containing ethanol. The DNA bound to the column was eluted using the elution buffer provided with the kit, or alternatively with nuclease-free water. The concentration of the obtained DNA was estimated by measuring the absorbance at 260nm (A26o) and using the known formula: DNA concentration= A26o X SOX dilution factor.
-
To elute DNA from agarose gel, samples were loaded on a low-melting agarose gel. The samples were resolved and visualized under UV transilluminator, and the band of interest was excised quickly using a scalpel blade. The volume of gel slice was quantified by weighing and the DNA eluted using MinElute Gel Extraction kit from Qiagen (Hilden
-
Elution of DNA from agarose gel
-
DNA fragments were resolved on 1-2 % agarose gel containing 0.5~-tg/mL ethidium bromide in Tris-Acetate-EDTA (TAE) buffer (40mM Iris-acetate, 2mM EDTA, pH 8.1). The samples were mixed with equal volume of 2X loading dye containing bromophenol blue, and the samples resolved by applying a voltage of 5-7 V /em. The resolved DNA fragments were visualized under ultraviolet illumination (312nm) and the relative band size was determined by comparison against DNA ladder with bands of known sizes. When required the images were acquired using a UVP Gel Documentation system
-
Agarose gel electrophoresis
-
RNA was isolated as described above. 3'RACE was carried out using a kit procured from Invitrogen (Carlsbad, CA) according to manufacturer's instructions. Briefly, 4~-tg of RNA was taken and e-DNA prepared using adaptor primer (AP) provided in the kit. This e-DNA was then used as template in a PCR reaction using a gene specific forward primer (Ld30RA3 and Ld34RA1), and the abridged universal amplification primer (AUAP) that is homologous to the adaptor primer as the reverse primer. The PCR product generated was then sequenced using T7 an SP6 primers after cloning into pGEM-TEasy vector as described below
-
Rapid Amplification of e-DNA ends (RACE)
-
get a linear amplification of serial dilutions of e-DNA. Equal quantities of RNA (2~-tg) were used for e-DNA preparation for control and treated samples. Then identical PCR reactions were set for all experimental groups, according to the primer pair. Equal volume of PCR products were visualized by agarose gel electrophoresis as described below. The bands were quantified by densitometry using Labworks™ Image Acquisition and Analysis Software (UVP Bioimaging Systems, UVP Inc., Upland, CA)
-
Relative expression levels of specific gene(s) in treated cells were determined by semi-quantitative PCRs. Initially standardization was carried out for each primer pair (Table 3.5) to determine cycle number to
-
Semi-quantitative RT -PCR
-
Polymerase chain reaction (PCR) was used to amplify specific nucleotide sequences from e-DNA and genomic DNA derived from L. donovani. The reactions consisted of an initial denaturation at 94°C for 5 min, followed by 20-30 cycles of denaturation at 94 °C for 30", annealing at primer specific temperature for 45s, and extension at 72°C for 30s-2 min according to product size of the primer pair. A final extension at 72°C was performed for 10 min. The PCR products were resolved on 1-2 % agarose gel containing ethidium bromide and visualized under UV illumination as described later. The specific primer pairs, their Tms and the respective product sizes are listed in Table 3.1-3.7. For High-fidelity Taq polymerase (Invitrogen, Carlsbad, CA), extension was carried out at 68°C and MgS04 was added instead of MgCh in the reaction mix in accordance to the manufacturer's instructions.
-
Polymerase chain reaction
-
1258 x g for 10 min at RT and washed 2X with PBS to remove all traces of media and FBS. D1e pellet was finally resuspended in 200p.L of resuspension solution provided in the kit. 20p.L of RNase A solution was added and incubated at RT for 2 min. 20p.L of Proteinase K and 200p.L of lysis solution were added and the cell suspension was vortexed for ~15s. This was followed by incubation at 70°C for 10 min. Pre-assembled GenElute MiniPrep Binding column was equilibrated with 500p.L of column preparation buffer by centrifugation at 12000 x g for 1min. Following incubation at 70°C, 200p.L of ethanol was added to the lysate and the vortexed for 5-10s. This lysate was then transferred to the equilibrated column and centrifuged at 6,500 x g for 1min. The column was washed 2X with 500p.L of wash buffer, by centrifugation at 6,500 x g for 3 min. To collect the genomic DNA, the column was incubated at RT with 200p.L of elution buffer for 5 min followed by centrifugation at 6,500 x g for 1 min. The genomic DNA was aliquoted and stored at -20°C for long term and 4°C for short term storage
-
Genomic DNA of Leishmania donovani was obtained using GenElute™ a mammalian genomic DNA Miniprep kit from Sigma Aldrich (St. Louis, MO). Briefly, 108 parasites were harvested by centrifugation at
-
Preparation of genomic DNA from Leishmania donovani culture
-
First strand synthesis of mRNA into e-DNA was performed using First strand e-DNA synthesis kit from Invitrogen (Carlsbad, CA) following manufacturer's protocol. Briefly, 4 !lg of total RNA was denatured at 65°C for 5 min in the presence of Oligo dT12-18 and dNTPs and then cooled on ice for 1 min. DTT, MgCb and RNaseOUT in lOX reverse transcriptase buffer added to the above mixture and incubated at 42°C for 2 min. 1!!L/reaction of the Superscript Reverse Transcriptase enzyme was added to the denatured RNA and incubated at 42°C for 50 min. The enzyme was denatured by heating at 70°C for 15 min. The reaction was completed with degradation of the complementary RNA strand by incubating with RNase H for 20 min at 37°C. The DNA preparation was stored at -20°C.
-
First strand synthesis by reverse transcription
-
debris, polysaccharides, and high molecular weight DNA The supernatant was gently decanted into a fresh microcentrifuge tube and 200!!L of chloroform/ mL of TRizol was added and the tube was shaken vigorously for 15s. The mixture was incubated at room temperature for 2-3 min before centrifugation at 12000 x g for 15 min at 4 °C. This resulted in the separation of the mixture into a lower organic phase and an upper aqueous phase. The aqueous phase containing the RNA was gently aspirated and transferred into a fresh microcentrifuge tube and 500!!L of isopropanol/ mL of TRizol reagent was added and incubated at RT for 10min. The mixture was centrifuged at 12000 x g for 10 min at 4 °C to isolate the RNA as a pellet. The supernatant was discarded and the pellet was washed once with 70% ethanol, centrifuged and the pellet was air-dried and re-dissolved in approximate quantity of nuclease free (DEPC-treated) water. The purity (A2so/ A260 >1.8) and concentration (A2soX dilution factor X 40) of the obtained RNA was determined by measuring the absorbance at 260nm (A26o) and 280nm (A2so). For storage, the RNA was resuspended in 1mL of absolute ethanol and stored at -70°C. Subsequently before use, the RNA was pelleted at 12000 x g for 10 min at 4°C, washed with 70% ethanol and redissolved in DEPC-treated water.
-
Total RNA was isolated from cells using TRizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Briefly 2X108 cells were harvested by centrifugation at 1258 x g for 10 min, and washed 1X with PBS. The cell pellet was lysed with 2 mL ice-cold TRizol reagent. The lysate was centrifuged at 12000 x g for 10 min at 4 °C to pellet down cellular
-
Total RNA isolation
-
Molecular Biology Techniques
-
x g for 10 min at RT. The supernatant was centrifuged at 1258 x g for 10 min at RT. The pellet obtained was washed 2X at 4°C in half the culture volume of Cytomix buffer (120 mM KCl, 0.15 mM CaCh, 10 mM K2HP04, 25 mM HEPES, 2 mM EDTA, and 2mM MgCh; pH 7.6) and then resuspended in chilled cytomix buffer at a density of 2 X 108 cells/mL. Electroporation: For a single electroporation, 2011g of plasmid (in water or 10mM Tris pH 8.0) for episomal expression and 5Jlg of plasmid for integration events, was added to a pre-chilled cuvette ( 4mm, BTX, San Diego, CA). 500J1L of chilled cell suspension (108 cells) processed as above was transferred to the cuvette and mixed with DNA by gently tapping and incubated on ice for 10 min. The cells were electroporated twice at 25 J.IF, 1500 V (3.75 kV /em), pausing 10 s between pulses (Robinson and Beverley, 2003) in a BioRad Gene Pulser X Cell electroporator. The cell suspension was then transferred to 5mL of mDMEM containing 20% FBS and allowed to recover for ~18hrs before antibiotic selection commenced. Selection of transformants: Selection of parasites containing recombinant DNA was carried out initially in liquid medium followed by culture with agar. After the rest period, the electroporated cells were exposed to 1011g/ mL of G418 or Hygromycin B for 48 hrs with antibiotic being increased to 2011g/ mL and 50Jlg/ mL at 48 hr. intervals. Part of the cells were then plated onto freshly poured mDMEM plates (1X mDMEM, 2% agar containing 100]lg/ mL, 500]lg/ mL or 1mg/ mL G418; or 50]lg/ mL Hygromycin B) and incubated at 23°C for 7-14 days. Individual colonies obtained on plates were cultured in liquid medium and screened appropriately. Limiting dilution was used to isolate single clones.
-
Preparation of Leishmania culture for electroporation: An early log phase culture of Leishmania donovani was harvested and dead cells pelleted at 129
-
Foreign DNA can be introduced into Leishmania cultures using electroporation. Transfected circular plasmids are maintained as episomes, while linear DNA can integrate into the genome. Preparation of DNA : DNA construct to be electroporated was generated using standard molecular biological techniques as described later. The plasmid DNA was prepared from E. coli DH5-a or XL-1 Blue cells using the EndoFree MaxiPrep kit from Qiagen (Hilden, Germany) according to manufacturer's protocol. Briefly, 200mL of overnight culture was pelleted at 6000 x gat 4°C for 15 min. The pellet was resuspended in 10mL Buffer P1 (50mM Tris-Cl, pH 8.0, 10mM EDTA, 100p.g/mL RNaseA). To this 10mL Buffer P2 (200mM NaOH, 1 %w /v SDS) was added and mixed thoroughly by vigorously inverting 4-6 times and an incubated at RT for 5 mins. Now 10mL of chilled Buffer 3 (3.0M Potassium acetate, pH 5.5) was added and mixed thoroughly by vigorously inverting 4-6 times and then the lysate was poured into a QIAfilter catridge and incubated at RT for 10 min. Subsequently a plunger was used to filter the cell lysate into a 50mL tube to which 2.5mL Buffer ER was added and inverted 10 times to mix. This was incubated on ice for 30 min. In the meantime, a QIAGEN-tip was equilibrated with 10mL Buffer QBT (750mM NaCl, 50mM MOPS, pH 7.0, 15%v /v isopropanol and 0.15%v jv Triton X-100). After incubation, the filtrate was allowed to enter the tip resin by gravity. This was followed by two washes with 30mL of Buffer QC (1.0M Nacl, 50mM Tris-Cl, and pH 7.0 and 15% v /v Isopropanol). DNA was eluted with 15mL Buffer QN (1.6M NaCl, 50mM MOPS, pH 7.0 and 15%v /v isopropanol) and precipitated by adding 10.5 mL (0.7 volumes) isopropanol at RT and centrifugation at 15,000 x g for 30 min at 4°C. The pellet was washed with 5mL endotoxin-free 70% ethanol at RT and centrifuged at 15000 x g for 10 min. The pellet obtained was air dried for 5-10 min and redissolved in a suitable volume of endotoxin-free buffer TE (10mM Tris-Cl, pH 8.0, 1mM EDTA). The concentration of the obtained DNA was estimated by measuring the absorbance at 260nm (A260) and using the known formula: DNA concentration = A260 X SOX dilution factor.
-
Transfection of Leishmania donovani promastigotes
-
Syrian hamsters (Mesocricetus auratus), 3-6 weeks old, were used as in vivo Leishmania infection models. The clinicopathological features of the hamster model of VL closely mimic active human disease. Promastigotes in the stationary phase were harvested at 1258 x g for 10 min at RT and washed several times with sterile PBS to remove all traces of medium and FBS. They were resuspended to a cell count of 2X109 cells/mL in PBS. 10011L of this (108 parasites) were injected intra-cardially into hamsters and infection allowed to proceed for 2 months. After 2 months, the hamsters were euthanized with C02 and the spleens were harvested. The spleens were first weighed, and then cut transversely. The exposed surface was gently pressed onto a clean slide to make imprints which were allowed to air dry. Following this, the smears were fixed either in chilled methanol for 5 min or 4% formaldehyde for 10 min. The slides were washed with PBS and either stored in -70°C for later use or stained with Giemsa stain to visualize infection
-
For in vitro infection studies; J774A.1 macrophages were plated on coverslips at the density of 1 X105 cells/ coverslip in a 6-well culture plate or at a density of 5 X 105 cells/well of a 6-well culture plate, and allowed to rest for 12-18 hrs. The cells were challenged with stationary phase parasites at a multiplicity of infection (MOl) of 1:10 for 6 hrs after which the excess unbound parasites were washed with phosphate buffered saline or plain medium and the macrophages incubated at 37°C for different time points. Infection was visualised by staining the cells with cell permeant nucleic acid stain Syto 11 (Molecular Probes, Eugene, OR) in the dark for 10 min and viewed under a Nikon Eclipse TE2000E fluorescence microscope (Nikon, Japan)
-
In vivo infection of Syrian hamsters with Leishmania donovani parasites
-
In vitro infection of J774A.l murine macrophages with L. donovani parasites
-
0% FBS and cultured as described above. The cells usually regain motility by 24 to 48 hrs and the culture is ready for use after splitting them once
-
For long term storage, Leishmania donovani were stored as Dimethyl Sulfoxide (DMSO) containing frozen stocks (freeze downs). Parasites in mid to late log phase were taken and dead and agglutinated cells removed by centrifugation at 129 x g for 10 min. The supernatant was centrifuged at 1258 x g for 10 min to pellet cells which were then washed 2X with plain medium followed by resuspension in FBS containing 10% DMSO as the cryoprotectant. These were transferred to a labelled cryogenic vial and immediately transferred to -20°C for a few hours, followed by incubation at -70°C overnight. The following day, the stocks were transferred to liquid nitrogen (liq N2). To revive a frozen stock, the stock was retrieved from liq N2 and transferred to a beaker containing water at ~37°C. Once the stock has thawed, the cells were immediately transferred to lOmL plain mDMEM and centrifuged at 217 x g for 10 min. The pellet was washed three to four times with plain medium followed by resuspension in mDMEM containing
-
Preparation and revival of frozen stocks of Leishmania donovani
-
Murine macrophage cell line J774A.1 (ATCC no. TIB-67) was maintained in phenol red free DMEM supplemented with 10% heat inactivated (45 min at 65°C) foetal bovine serum at 37°C in 5% C02 and 95% air. The cultures were sub-cultured every three days or at the attainment of 80 % confluency.
-
In vitro J774A.l murine macrophage cultur
-
Long-term axenic amastigotes were generated by subjecting promastigotes to pH and temperature modulations as described elsewhere (Debrabant et al., 2004). Briefly, live metacyclic promastigotes were harvested by centrifugation and resuspended in DMEM containing 20% FBS and a pH of 5.5 and sub-cultured at 23°C after 72 h three times. Following this, the cells were then transferred to 37°C, 5% C02 for 3 passages after 72 h each. Axenic amastigotes obtained after the last subculture was stained with Giemsa stain and checked under the microscope. They were then maintained at 37°C in a humidified atmosphere containing 5% C02 in air
-
Leishmania donovani promastigotes (MHOM/IN/80/DD8) were obtained from Dr. R Vishwakarma from the National Institute of Immunology, New Delhi, India. These were grown routinely on blood agar slants containing 1% glucose, 5.2% brain heart infusion agar extract, 6%(v jv) of rabbit blood and 1mg/mL of gentamycin as antibiotic (Sudhandiran and Shaha, 2003) at 23°C. After three days of culture on slants, fresh slants were streaked using a loop for regular maintenance. For liquid cultures, cells were transferred from a slant to modified DMEM (3. 7 g Sodium bicarbonate, 5. 96g HE PES, 5mg Hemin, 1mg Biotin, 13.36mg Adenine, 7.6mg Xanthine, 0.5rnl Triethanolamine, 40mg Tween 80) with 10 % foetal bovine serum (FBS). Before experiments, the cells were centrifuged at 129 x g for 10 min to remove dead and agglutinated parasites; the supernatant was centrifuged at 1258 x g for 10 min to pellet the live cells which were then resuspended in appropriate amounts of media for experiments
-
In vitro Leishmania donovani culture
-
Cell Culture Techniques
-
METHODS
Tags
- method-9
- method-1-detail
- method-19
- method-18
- method-detail
- method-10-detail
- method-18-detail
- method-11
- method-17-detail
- method-15-detail
- method-8
- method-6-detail
- method-5
- method-3-detail
- method-16-detail
- method-4-detail
- method-13-detail
- method-12
- method-12-detail
- method-15
- method-14
- Method
- method-7
- method-2
- method-20
- method-14-detail
- method-13
- method-7-detail
- method-17
- method-8-detail
- method-2-details
- method-4
- method-19-detail
- method-5-detail
- method-16
- method-20-detail
- method-9-detail
- method-3
- method-1
- method-10
- method-11-detail
- method-2-detail
- method-6
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Identification of selected micro-organism
-
3.0–5.0, phosphate buffer for pH 6.0–8.0 and Tris-HCl buffer for pH 9.0) were used. •pH stability: The pH stability of the selected tannases was examined in the range of 3.0–9.0 by incubating the enzyme samples for 6 h in different buffers. Tannase activity was estimated under standard assay conditions. •Temperature tolerance: Temperature tolerance of the tannases was examined by assaying their activity at different temperatures in the range of 20 to 80ºC. •Temperature stability: Temperature stability of the tannases was determined by incubating them in the temperature range of 20 to 70 ºC for 6 h. After the incubation tannase activity (%) was determined under standard assay conditions. •Organic solvent stability: In order to determine the suitability of the selected tannases for organic synthesis, their stability was determined in different organic solvents. Experimentally, 10 mg of each of the crude lyophilized tannase from the selected cultures were mixed with 1.0 ml of the following organic solvent: a) Hexane b) Methanol c) Propanol d) Isoamyl alcohol e) Petroleum ether f ) Chloroform The mixture was incubated for 6 h at optimal temperature and the organic solvents were then decanted and the residues were dried in a vacuum desiccator. These dried samples were dissolved in 1.0 ml of citrate phosphate buffer (50 mM, pH 5.0) and the tannase activity was determined under standard assay conditions. The tannase activity thus obtained from each culture were compared with initial tannase activity. Finally, on the basis of tannase titres produced per ml and desirable biochemical properties, the best tannase producer was selected for further investigations
-
The tannases obtained (at high titres) from selected cultures were evaluated for the following important biochemical properties. 1. pH tolerance and stability 2. Temperature tolerance and stability 3. Organic solvent stability •pH tolerance: pH-tolerance of the selected tannases was examined in the range of 3.0–9.0. Buffers (0.05 M) of different pH (citrate phosphate for pH
-
Preliminary biochemical characterization of tannases from the potent tannase producers
-
The reaction mixture contained 10 μl of culture filtrate, 490 μl of double distilled water (DDW) and 300 μl of methanolic rhodanine solution. This mixture was incubated for 5 min at 30°C in a water bath. The reaction was stopped by adding 0.3 ml of methanolic rhodanine solution (0.667 %), which resulted in the formation of complex between gallate and rhodanine. This was followed by the addition of 0.2 ml of KOH solution (0.5N) and the tubes were further incubated at 30°C for 5 min. The total reaction mixture in each tube was diluted with 4.0 ml of distilled water. Tubes were further incubated at 30°C for 10 min. The absorbance was measured at 520 nm against a control having distilled water in place of culture filtrate. The absorbance thus obtained was used to calculate the amount of gallic acid present in the culture filtrate, from the standard gallic acid curve prepared in the range of 100-1000 μg/ml.
-
The procedure of Sharma et al. (2000) was used to estimate the gallic acid in the culture filtrate. Reagents: Methanolic rhodanine solution (0.667% w/v): Prepared by dissolving 0.667 g of rhodanine in 100 ml of methanol.Potassium hydroxide (0.5 N): 2.8 gpotassium hydroxide dissolved in100 ml of distilled water.
-
Gallic acid estimation (Sharma et al., 2000)
-
The tannin sample (1.0 ml) was added to 2.0 ml BSA solution in a 15 ml glass centrifuge tube. The solution was mixed and allowed to stand at room temperature for 15 min and then centrifuged at 10000 rpm for 15 min to separate the precipitated tannin-protein complex as pellet. The supernatant was discarded and the pellet and the walls of the tube were washed with acetate buffer without disturbing the pellet. Now, the pellet was dissolved in 4.0 ml of SDS-triethanolamine solution and to this, 1.0 ml of ferric chloride reagent was added and was mixed immediately. After 30 min of addition of ferric chloride, the absorbance was noted at 510 nm on spectrophotometer. All observations were carried out in triplicates. The concentration of the tannin was determined with the help of tannic acid (Sigma) standard curve prepared in the range of 0.2 to 1.0 mg/ml
-
The procedure of Hagerman and Butler (1978) was used to estimate the tannin content in different tannin sources. Reagents: Bovine serum albumin (BSA) 1.0 mg/ml: 10.0 mg of bovine serum albumin was dissolved in 10.0 ml of 0.2 M acetate buffer, pH 5.0, containing 0.17 M sodium chloride. Sodium dodecyl sulfate (SDS)-triethanolamine solution: The solution contained 1.0% SDS and 5.0% (v/v) triethanolamine in distilled water. Ferric chloride reagent (0.01 M): 1.62 g of ferric chloride was dissolved in 1.0 L of 0.01 N hydrochloric acid.
-
Tannin estimation (Hagerman and Butler, 1978)
-
To 1.0 ml of suitably diluted culture filtrate, 5.0 ml of solution C was added. It was incubated for 10 min at room temperature. To this, 0.5 ml of Folin Ciocalteau’s reagent (diluted 1:1 with distilled water) was added. The solution was vortexed and kept in dark for 30 min. After incubation, absorbance was read at 660 nm against a reagent blank. Protein content was calculated (in mg/ml) using standard curve of bovine serum albumin (BSA) prepared in the range 100-1000 μg/ml
-
The total protein content in the culture filtrate was estimated by Lowry’s method as described below: Reagents: Solution A: 2.0% Na2CO3 in 0.1 N NaOHSolution B: 0.5 % CuSO4 in 1.0 % Sodium potassium tartarate Solution C: 50.0 ml of solution A was mixed with 1.0 ml of solution B Folin Ciocalteau’s reagent
-
Protein estimation (Lowry et al., 1951)
-
For estimation of tannase activity the reaction mixture (4 ml) contained 1.0 ml of 1.0% tannic acid (prepared in citrate-phosphate buffer, pH 5.0), 2.0 ml of citrate-phosphate buffer (pH 5.0) and 1.0 ml of appropriately diluted culture supernatant. The reaction mixture was incubated at 40°C for 30 min in a water bath. The reaction was stopped by adding 4.0 ml of 2.0% BSA solution. In the control reaction, BSA was added prior to incubation. Now the tubes were left for 20 min,at room temperature, for precipitating the residual tannins and subsequently centrifuged at 10,000 rpm for 20 min. The end product, gallic acid thus formed was estimated by diluting 20 μl of the supernatant to 10 ml with DDW. Now, the absorbance at 260 nm was read against a blank (DDW) in a UV spectrophotometer (1601, Shimadzu Corporation, Japan). One unit of tannase: One tannase unit is defined as the amount of enzyme that releases 1 μmol of gallic acid from the substrate (tannic acid) per ml per min under standard assay conditions
-
In this method, tannase activity was estimated through spectrophotometric method by determining the concentration of the end product i.e., gallic acid, by estimating the absorbance at 260 nm. Reagents: •Tannic acid (1.0%): The solution was prepared by dissolving 1.0 g of tannic acid in 100 ml of citrate-phosphate buffer of the desired pH.•Bovine serum albumin (BSA): BSA (2.0%) was prepared in citrate phosphate buffer (pH 5.0)
-
Estimation of tannase activity (Deschamp et. al., 1983)
-
For bacterial isolates, a single colony from a nutrient agar slant was inoculated into 50 ml of nutrient broth in a 250 ml Erlenmeyer flask. These flasks were incubated at 37±1°C in a incubator shaker till an optical density of 0.6 at 660nm. Now these cultures were used to inoculate 50 ml of the tannase production medium in 250 ml Erlenmeyer flasks using 2% v/v inoculum. These flasks were incubated at 37±1°C in an incubator shaker (Multitron AG-27; Switzerland) at 200 rpm for 72h. The experiments were carried out in triplicates. Samples (2.0 ml for bacteria and same for fungi) were withdrawn at regular intervals of 12h upto 72 h. The samples thus obtained were centrifuged at 10,000 rpm in a refrigerated centrifuge (SIGMA 4K15 Germany) for 10 min at 4°C. The supernatant/s were analyzed for tannase activity
-
For fungal cultures, spores were harvested from 72 hour old cultures grown on PDA/Tannic acid agar slants by adding 10 ml of sterilized normal saline and a few drops of sterilized Tween-80 followed by vortexing. The spore suspension was filtered through sterile cotton filter to ensure that mycelial filaments are removed. The spores were counted using a haemocytometer (Neubaeur). Approximately, 5X106 spores were inoculated in 50 ml of tannase production medium in 250 ml Erlenmeyer flasks. These flasks were then incubated at 30±1 and 37±1°C in an incubator shaker (model G25KC, New Brunswick Scientific, NJ, USA) at 200 rpm
-
Quantitative assay
-
was observed by the formation of a clear zone of hydrolysis around the bacterial/fungal colony. Tannase production, in terms of the diameter of the zone of hydrolysis around the colony, was measured (in mm) after 24 (bacteria) and 48 hours (fungi) of incubation. The diameter of the hydrolytic zone was measured at three points and the average was calculated. The microorganisms showing a zone of tannic acid hydrolysis were considered as tannase producers. The potent tannase producers were further tested quantitatively for the amount of enzyme produced in broth.
-
The procedure of Bradoo et al. (1996), involving point inoculation of the microorganisms on tannic acid agar plates was followed. The plates were incubated at 37 and 30±1°C for bacterial and fungal isolates. The presence of tannase activity
-
Qualitative screening for tannase producer/s
-
A total of 150 fungal and 150 bacterial isolates were screened qualitatively and quantitatively for their ability to produce the enzyme, tannase.
-
Screening and selection of potential tannase producers
-
Microorganisms were isolated from the above mentioned sources using direct plating method. Serial dilution of the different soil samples with normal saline was carried out and the different dilutions were spread plated on to potato dextrose agar (PDA) for isolation of fungi and on to nutrient agar (NA) for the isolation of bacteria. The plates were incubated at either 30 or 37±1°C in a bacteriological incubator so that the different organisms could grow and form visible colonies. The different fungal and bacterial colonies isolated by the procedure mentioned above were purified by subculturing on respective media, and subsequently screened for tannase production. The new isolates, alongwith different cultures obtained from laboratory stock culture collection, were revived on potato dextrose agar (PDA) slants. These cultures were regularly subcultured and stored at 8±1°C in a BOD incubator. Their purity was periodically checked by microscopic examination.
-
Isolation of bacteria and fungi from the samples
-
In the present investigation, microorganisms including both bacteria and fungi were isolated from soil samples collected from different geographical locations in India. Microorganisms were also isolated from the bark of trees as well as from the soil near the roots of those trees. Some cultures were also procured from the laboratory stock culture collection.
-
Collection of samples
-
Isolation of tannase producing microorganism/s
Tags
- method--1-method-5-material-2
- method-1-method-1
- method--1-method-9
- method-1-method-8-detail
- method-1-method-3-detail
- method-1-method-2 detail
- method-1-method-10-detail
- method-1-method-3
- method-1-method-8-material
- method-1-method-7
- method-1-method-1 detail
- method-1
- method-1-method-4
- method-1-method-6
- method-1-method-11
- method--1-metthod-8
- method-1-method-5
- method-1-method-10-material
- method-1-method-7-material
- method-1method-5-material-1
- method-1-method-9-detail
- method--1-method-6-detail
- method-1-method-10
- method-1-method-6-material
- method-1-method-7-detail
- method-1method-2
- method-1-method-4-detail
- method-1-method-9-material
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Cultures in mid-exponential phasenormalized using A600and solubilizedin 1X sample buffer at 99°C for 5 min were subjected to electrophoresis on 12% sodium dodecyl sulfate (SDS) -polyacrylamide gels. Cell extracts equivalent to 0.04A600(1X) and 0.02A600(0.5X) were loaded and run using Tris-glycine-(SDS) buffer. Separated proteins were electrotransferred to PVDF polyvinyledene difluoride) membrane (Amersham) electrophoretically by a semi-dry method using Bio-Rad apparatus.The transfer was done for 2-3 hrs using a voltage of 75V at 4oC and membrane was probed using anti-FtsZ primary antibody at 1:5000 dilution (rabbit, polyclonal), washed and probed with anti-rabbit IgG conjugated to horseradish peroxidase (HRP) at 1:20000 dilution, as described(Sambrook & Russell, 2001).Membranes were developed with chemiluminescencereagent (Amersham ECL Prime) and visualized with the aid of a chemiluminescence detection system according to the manufacturer’s protocol (Sigma Chemical Co., St. Louis, MO). Quantification of band intensity and subtraction of background was done using Fujifilm Multi Gauge V3.0 imaging system(Image Quant software)
-
Gel Electrophoresis and Western blotting
-