Xylanolytic activity was determined according to Archana and Satyanarayana (1997). The reaction mixture containing 0.5 mL of 1% birchwood xylan in glycine NaOH buffer (0.1 M, pH 9.0) and 0.5 mL of cell free sonicated supernatant was incubated at 80 °C in a water bath for 10 min. After incubation, 1 mL DNSA reagent (Miller, 1959) was added to the reaction mixture and the tubes were incubated in a boiling water bath for 10 min, followed by the addition of 400 μL of 33% w/v sodium potassium tartrate. The absorbance values were recorded at 540 nm in a spectrophotometer (Shimadzu, Japan). The liberated reducing sugars were determined by comparing the absorbance values of these with a standard curve drawn with different concentrations of xylose. One unit (IU) of xylanase is defined as the amount of enzyme required for liberating one μmol of reducing sugar as xylose mL-1 min-1under the assay conditions. Composition of Dinitrosalicylic acid (DNSA) reagent NaOH - 10.0 g Phenol - 2.0 g DNSA - 2.0 g Distilled Water - 1000 mL DNSA reagent was stored in an amber bottle at 4 °C till further use. Sodium sulphite (0.05 % v/v) was added just before the use of the reagent.
155 Matching Annotations
- May 2019
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
-
Enzyme Assays
-
Transformation of calcium-competent cells was carried out by the procedure detailed below: •The competent bacterial cells were thawed briefly and 200 μL of cells was mixed rapidly with plasmid DNA (10-50 ng) in fresh, sterile microcentrifuge tubes and maintained on ice for 30 min. A negative control with competent cells only (no added DNA) was also included. •Cell membranes were disrupted by subjecting cells to heat-pulse (42 °C) for 90 sec. •After heat shock, cells were incubated on ice for 5 min. •Cells were then mixed with 1 mL LB medium and incubated with shaking at 37 °C for 1 h. •For blue/white screening 40 μL of X-gal solution (20 mg mL-1 in dimethylformamide) and 4 μL of the IPTG (200 mg mL-1) was spread on LB-ampicillin (LB-amp) plates with a sterile glass rod. The plate was allowed to dry for 1h at 37 °C prior to spreading of bacterial cells. •Bacterial cells (100-200 μL) were spread and the plate was incubated at 37 °C for overnight. •White colonies were picked from the plates and suspended into LB-amp broth and cultivated to OD600=0.5
-
Transformation procedure
-
2 mL of an overnight culture of E. coli cells was inoculated into 100 mL LB medium and incubated with vigorous shaking at 30 °C until A600 of 0.8 was reached. •Cells were collected in 50 mL plastic (Falcon) tubes, cooled for 15 min on ice and centrifuged in a pre-cooled centrifuge (4,000 rpm for 10 min at 4 °C). •The pellet was suspended in 20 mL of ice-cold 50 mM CaCl2-15% glycerol solution, maintained on ice for 15 min and centrifuged again at 4,000 rpm for 10 min at 4 °C. •Pellet was resuspended in 2 mL of ice-cold 50 mM CaCl2-15 % glycerol solution, kept on ice for 30 min and aliquoted in 400 μL in microcentrifuge tubes. These were stored at -80 °C until required.
-
Preparation of calcium-competent cells
-
Preparation of electrocompetent cells (E. coli cells) A protocol was employed. The procedure was carried out in cold under sterile conditions as follows: •A single colony of E. coli DH10B/ DH5α/XL1blue was inoculated in 20 mL of LB medium and grown overnight at 30 °C. •500 mL LB medium was inoculated with 5mL of this overnight grown culture of the E. coli and incubated with vigorous shaking (250 rpm) at 30 °C until an A600of 0.5 - 0.8 was achieved. •The cells were chilled in ice for 10-15 min and transferred to prechilled Sorvall® centrifuge tubes and sedimented at 4,000 rpm for 20 min at 4 °C. •The supernatant was decanted and cells were resuspended in 500 mL of sterile ice-cold water, mixed well and centrifuged as described above. •The washing of the cells described above was repeated with 250 mL of sterile ice-cold water, following which cells were washed with 40 mL of ice-cold 10 % (v/v) glycerol and centrifuged at 4,000 rpm for 10 min. •The glycerol solution was decanted and the cell volume was recorded. The cells were resuspended in an equal volume of ice-cold 10 % glycerol. •Cells were then dispensed in 40 μL volumes and stored at -80 °C until required.
-
Electrotransformation
-
BACTERIAL TRANSFORMATION
-
Ligation of insert DNA with dephosphorylated vector
-
In order to minimize self ligation of vector during cloning experiments, the digested DNA was subsequently treated with calf intestinal phosphatase (CIP) [NEB, UK]. The reaction conditions and amount of CIP were optimized and varied from (0.06-1) unit/picomole DNA termini. The dephosphorylation reaction was carried out in 50 μL reaction as follows. Reaction mixture containing no restriction enzyme was treated as control. Reaction was incubated for 1 h at 37 °C and stopped by heat inactivation at 65 °C for 20 min. 2.5.5. Composition of restriction mixture (50 μL) Linearized Plasmid DNA X μL (1 μg) CIP 1 μL (0.06-1 U μL-1) Reaction buffer (10X) 5.0 μL Distilled water Y μL Total volume 50 μL Linearized and dephosphorylated plasmids from each reaction were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany). 100 ng DNA from each reaction was then ligated in15 μL reaction volume containing 1.5 μL of 10X ligation buffer (NEB, England) and 0.2 μL of T4 DNA ligase to check the efficiency of self ligation after dephosphoryaltion. The ligation mixture was incubated at 16 °C for overnight and transformed into E. coli DH5αcompetent cells.
-
Dephosphorylation of the restricted plasmid
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
The ligation reaction consisted of 10 ng of vector, appropriate amount of insert (insert:vector ratio :: 3: 1), 1 x ligation buffer and 1 U of T 4 DNA ligase (NEB, England). The total volume was made up to 10 III with autoclaved water. The ligation reaction mixture was incubated at 16°C for 12 hrs
-
Ligation
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Enzymatic assays using acyl-peptidyl substrates were set up as follows: 100-120 llmoles of purified ~PL/RNRP protein, 200 l!M valeryl-FT AA-CoA/ valery 1-FT AAlaninal and 2 mM NADPH were incubated at 30°C for 2 hrs. The protein was precipitated with acetonitrile and the reaction was loaded on C 18 RP HPLC column (250 x 4.6 mm, 5l!, phenomenex). The products could be resolved using following gradient: 0 to 48% B in 25 min, 48% B in 40 min and 70% B in 50 min (A-water with 0.1% TF A and B-acetonitrile with 0.1% TF A) at a flow rate 0.6 ml/min. The elution profile was monitored at 220 nm. The identity of peaks obtained was confirmed by TOF-MS and tandem mass spectrometric analysis using ESI-MS (API QSTAR Pulsar i MS/MS, Applied Biosystems).
-
The enzymatic assays were performed as described for wild type ~Pl. in chapter 2. The standard reaction mixture contained 100 J.lM fatty acyl-CoA (30 J.lM [1-14C] fatty acyl-CoA (55 mCi/mmole,ARC) and 70 J.lM of unlabeled fatty acyl CoA), 2 mM NADPH and 10-20 nmoles protein for l-2 hrs. Lauroyl aldehyde [ l-14C] was obtained enzymatically from [ l-14C] lauric acid (55mCi/mmole,ARC) using the FadD9 protein, and extracted from TLC by using ethyl acetate. Assays were set up using a total of 100 J.lM ('4C labeled + unlabeled) of lauroyl aldehyde in the presence of 2 mM NADPH and 10-20 nmoles protein for 1-2 hrs. The products were extracted twice in 300 J.ll of hexanes and resolved on silica gel 60 F2s4 TLC plates (Merck) using hexanes:ethyl acetate (80:20, v/v) solvent system. The radiolabeled product was detected by using phosphorimager (Fuji BAS500)
-
nzymatic assays and product characterization
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
treatment were harvested by centrifugation at 250 x g for 5 min following which they were resuspended in 1x PBS (pH 7.5). PI was added at a final concentration of 1 J.tg/mL and incubated for 5 minutes following which the cells were pelleted by centrifugation and washed once with PBS. These cells were analyzed for uptake of PI by either flow cytometry in FL2 channel (570 nm) or by fluorescence microscopy using a G2A filter block.
-
Propidium iodide (PI) is a DNA intercalating fluorescent dye which is excluded by viable cells with intact membranes, however, dead and dying cells with damaged membranes take up the dye. To assess viability, cells after appropriate
-
Assay for cell viability by propidium iodide dye exclusion method
-
Biochemical and cell biology techniques
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Phaser is a program for phasing macromolecular crystal structures by both molecular replacement and experimental phasing methods (A. J. McCoy, 2007). The novel algorithms in Phaser are based on maximum likelihood probability theory and multivariate statistics rather than the traditional least-squares and Patterson methods. For molecular replacement, the new algorithms have proved to be significantly better than traditional methods in discriminating correct solutions from noise. One of the design concepts of Phaser was that it be capable of a high degree of automation. Phaser has novel maximum likelihood phasing algorithms for the rotation functions and translation functions in MR, but also implements other non-likelihood algorithms that are critical to success in certain cases.
-
Automated molecular replacement program (Phaser)
-
merging data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. Finally, truncate program was used to obtain structure factor or amplitudes from averaged intensities (output from SCALA, or SCALEPACK) and write a file containing mean amplitudes and the original intensities. If anomalous data is present then F(+), F(-), with the anomalous difference, plus I(+) and 1(-) are also written out. The amplitudes are put on an approximate absolute scale using the scale factor taken from a Wilson plot. For all the Fab-peptide complexes and unliganded Fab of BBE6.12H3 antibody, the diffraction data were collected and processed using MOSFLM and subsequently merged using SCALA. For all the Fab-peptide complexes of 36-65 Fab, the diffraction data were collected and processed using DENZO and subsequently merged using SCALEPACK. The cell dimensions and space groups were unambiguously determined for each crystal. The solvent content and Matthews's constant were calculated (Matthews, 1968). The merged and scaled intensities were used for structure determination.
-
parameters using the whole data set. It is also used for merging different data sets and carrying out statistical analysis of the measurements related by space group symmetry. SCALEPACK also provides the detailed analysis of the merged data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. MOSFLM is a package of programs with an integrated graphical user interface for processing data collected on any detectors. The programs cover all aspects of data reduction starting from the crystallographic pattern recorded on an image to the final intensities of observed reflections. In MOSFLM this entire process of integration of diffraction images is subdivided into three steps. The first is the determination of the crystal parameters, in particular the crystal lattice (unit cell) and its orientation relative to a laboratory axial system (usually based on the X-ray beam direction and the rotation axis)_ This is usually referred to as autoindexing. Knowledge of these parameters then allows an initial estimate of the crystal mosaicity. The second step is the determination of accurate unit-cell parameters, using a procedure known as post-refinement. This requires the integration of one or more segments of data with a few images in each segment. The final step is the integration of the entire set of diffraction images, while simultaneously refining parameters associated with both the crystal and the detector. After integration of the data, next step is to scale and merge the data set. Scaling and merging are done with the program SCALA. This program scales together multiple observations of reflections, and merges multiple observations into an average intensity. The merging algorithm analyses the data for outliers, and gives detailed analyses. It generates a weighted mean of the observations of the same reflection, after rejecting the out:iers. SCALA also provides the detailed analysis of
-
therefore only partially recorded on any individual image. For each predicted reflection, the background-subtracted diffracted intensity must be estimated. Although straightforward in principle, defects and limitations in both the sample (the crystal) and the detector can make this difficult in practice. Complicating factors include crystal splitting, anisotropic and/or very weak diffraction, high mosaicity, diffuse scattering, the presence of ice rings or spots, unresolved or overloaded spots, noise arising from cosmic rays or zingers, backstop shadows, detector blemishes, radiation damage and spatial distortion. These experimental factors will be important in determining the final quality of a data set. The HKL2000 (Otwinowski, 1997) is GUI based suite of programs for the analysis of X-ray diffraction data collected from single crystals. The package consists of three programs: DENZO, XDISPLA YF and SCALEPACK. HKL is the program that converts the raw X-ray diffraction data, collected from an image plate and reduces it to a file containing the hkl indices, intensities of the spots on the image plate along with estimates of errors involved. DENZO initially performs peak searching. The autoindexing algorithm carries out complete search of all the possible indices of the reflections picked by peak search using a fast Fourier transformation (FFT) software module. After search for real space vectors is completed, the program finds the three best linearly independent vectors, with a minimal unit cell volume, that would index all of the observed peaks. After refining the initial cell dimensions and detector parameters, the determined values are applied to the rest of the frames and the parameters are refined for each frame. The diffraction maxima are also integrated by DENZO_ The program XDISPLA YF (W., 1993) enables visualization of the peak search and processing procedures. SCALEPACK finds the relative scale factors between frames and carries out precise refinement of crystal
-
The collection of macromolecular diffraction data has undergone dramatic advances during the last 20 years with the advent of two-dimensional area detectors such as image plates and CCDs, crystal cryocooling and the availability of intense, monochromatic and highly collimated X-ray beams from synchrotron sources. These technical developments have been accompanied by significant advances in the software used to process the resulting diffraction images. In particular, autoindexing procedures have improved the ease of data processing to the point that in many cases it can be carried out automatically without any user intervention. However, the procedure used to collect the diffraction images, the screenless rotation method, has remained essentially unchanged since it was first suggested for macromolecular crystals by Xuong et al. (Nguyen-huu-Xuong, 1968) and by Arndt and coworkers and popularized by the availability of the Arndt-Wonacott oscillation camera (Arndt, 1977; U. W. Arndt, 1973). In this procedure, each diffraction image is collected while rotating the crystal by a small angle (typically between 0.2 and 2°) about a fixed axis (often referred to as the cpaxis). The only development of the method has been the use of very small rotation angles per image (the so-called fine cp-slicing technique) to provide improved signal to noise for weakly diffracting samples. Since, virtually all macromolecular diffraction data are collected in this way (with the exception of data collected using the Laue technique). The starting point for data integration will therefore be a series of such diffraction images and the desired outcome is a data set consisting of the Miller indices (hk/) of all reflections recorded on these images together with an estimate of the diffracted intensities I(hkl) and their standard uncertainties al(hkl). This requires the prediction of which reflections occur on each image and also the precise position of each reflection on each image (note that typically most reflections will be present on several adjacent images and
-
X-ray intensity data processing
-
mounted on goniometer heads, which were in turn fixed on the oscillator dial of the image plate. However since our crystals suffered significant radiation damage at room temperature we decided to attempt cryo-crystallography and collected data at low temperature. Radiation damage to protein crystals is greatly reduced at lower than room temperatures (D. J. Haas, 1970; Low et al., 1966). Primary radiation damage is largely caused by interactions between the molecules in the crystal and the beam. This energy is dissipated in at least two ways; it produces thermal vibrations (heat) and it provides the necessary energy to break bonds between atoms in the molecules. Secondary damage to the crystals is caused by the diffusion of reactive radicals produced due to damage to the protein. This diffusion is aided by the presence of thermal energy. At cryo-temperature of around 1 OOK, thermal damage is limited and also the reactive products are immobilized and do not cause extensive secondary damage in areas of the crystal which are not exposed to the beam (Garman, 1999). For low temperature data collection, the crystals were initially soaked in a cryo-protectant, which was basically the mixture of the mother liquor and antifreeze. We added 30% glycerol to our mother liquor, in which the crystals were soaked from between 1 to 5 minutes to achieve cryo-protection. The crystals were then picked up using a 20Jl nylon loop, which was immediately flash frozen in a stream of nitrogen at 120k at a flow rate of 6 liters/min (Oxford cryo-systems). The crystals were centered in the beam using the two arcs and translations on the goniometer head and by viewing the crystal on the monitor of the attached CCD camera. The collimation, crystal to detector distance, oscillation angle and the exposure time per frame were optimized after a few trial frames in each case.
-
Data collection for macromolecular crystallography involves exposure of the crystal to X-rays and recording the intensities of the resultant diffraction patterns. Rapid advances in this field have made available sophisticated electronic detectors like the Image plate detector, high power X-ray generators and synchrotrons. Successful data set collection is followed by data processing to extract the hkl indices with corresponding intensities, along with an estimate of the errors involved. At the core of the Image Plate detector is an amorphous thin film made of Barium, Europium and Bromium. This material that is coated on to a motorized plate absorbs X-rays to form F-centers. These F-centers are the regions that store photon energy as excited electrons. After the exposure is complete the plate is read by a He-Ne (2eV) red laser. Absorption of photons induces excited electrons to return to ground state with the emission of blue light (4eV) which is quantitatively read by a photomultiplier. Exposing it to intense white radiation erases the plate. While the basic technology behind the image plates remains the same, improvements in electronics and computers has led to greater automation and faster data collection cycles. The X-ray intensity data for various Fab-peptide complexes of 36-65 were collected on the Mar345dtb, installed on a rotating anode X-ray source (RIGAKU, Japan) operating at 50kV and 1 OOmA (CuKa. radiation) with Osmic mirrors (RIGAKU, Japan). While the Mar225 image plate installed at BM14 (ESRF, Grenoble, France) was used to record three Fab-peptide complexes of BBE6.12H3. Data for antigen free BBE6.12 H3 Fab and its complex with Ppy peptide was recorded on Mar345dtb image plate (Mar research, Germany), installed on the home source. For data collection at room temperature, the crystals were mounted in 0.5 mm quartz capillary tube along with some mother liquor. The capillaries were then
-
X-ray intensity data collection
-
a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.
-
One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves
-
Crystallization
-
Crystallization and data collection
-
Fab purification from the digestion mixture was carried out by ion-exchange chromatography using SPW-DEAE (60xl50 mm) column on a Waters3000 preparative HPLC (Waters, USA). In:tially, a blank run was carried out thereafter the column was allowed tore-equilibrate with the wash buffer (10 mM Tris-Cl, pH 8.0). A salt gradient of 0 to 0.2 M NaCI over a period of 120 minutes was used to elute the Fab. An aliquot from all the collected fractions were precipitated by using chilled acetone and were analyzed on a SDS-PAGE gel to ascertain which fraction corresponds to Fab. Fab, which has low or zero net negative charge at pH 8.0, was eluted out as the first major peak early in the gradient. The Fe portion and any undigested IgG which have a higher net negative charge at pH 8.0 would elute out later in the gradient. The Fab fractions collected from various HPLC runs for both the antibodies were pooled, concentrated and dialyzed against their respective crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide and SOmM Tris-Cl pH 7.1, 0.05% sodium azide).
-
Purification of Fab fragment
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
The pure PCR amplified product, and the vector were digested with required· restriction enzymes in the reaction buffer as per supplier's recommendation. Ten units of enzyme were used to digest I Jlg of DNA and the samples were incubated for three hours at appropriate temperature. The vector was dephosphorylated with calf intestinal phosphatase (0.2 units/Jlg of DNA) for 30 min. at 37 °C. After digestion, relevant fragments were gel purified in 15% PEG-8000-T AE solution as described by Zhen and Swank (1993). Ligation of the vector and insert DNA was performed in a reaction volume of 20 Jll using 400 units oi T4 DNA ligase in the recommended ligation buffer at 16 °C for 12 h. A control ligation reaction without the insert was also done keeping the other components same. The concentration of insert was eight to ten times more than the vector. The ligated sample and control mix was later used for transformation.
-
DNA Digestion and Ligation
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
r-bZP3 was arsanilated using a modification of the procedure of Nisnoff (1967). Briefly, arsanilic acid (100 mg) was dissolved in 5 ml of I M HCI. A IO ml stock of NaN02 (10 mg/ml) was also prepared fresh and added dropwise to the arsanilic acid solution while vortexing. Activation of arsanilic acid was checked on starch-KI paper. The ice cold activated arsanilic acid solution was added dropwise to the protein solution (5 mg of r-bZP3 in 100 mM PB, pH 7.4) stirring constantly in an ice water bath, while pH was maintained between 9.0 and 9.5 with 10 N NaOH. The protein solution was dialyzed extensively against I 00 mM PB having 4 M urea. Arsanilation of r-bZP3 was checked by ELISA using ars-r-bZP3 for coating ( 1 flg/well) and using a 1:100 dilution of murine anti-ars MAb, R 16.7 (Durdik et al., 1 989). Bound Ab was revealed using anti-mouse HRPO conjugate (I :5000). Three monkeys previously immunized with r-bZP3-DT conjugate (MRA-375, MRA-640 and MRA-672) and 2 naive monkeys (MRA-446 and MRA-670) were immunized at 2 intramuscular sites with 250 flg of ars-bZP3 conjugate using Squalene:Arlacel A ( 4: 1) as an adjuvant. Boosters were administered at intervals of 20 days and bleeds were collected I 0 days post immunization. Bleeds were analyzed by ELISA using r-bZP3 and ars-BSA for coating to determine anti-bZP3 and anti-ars Ab titres as described earlier.
-
Arsanilation of r-bZP3
-
administered as and when required. Animals were put on continuous mating with males of proven fertility after administration of the three primary injections and monitored for menstrual cyclicity and conception. Ab titres were determined as described above except that anti-monkey HRPO conjugate was used as the revealing Ab.
-
Female bonnet monkeys (Macaca radiata) reared at the Primate Facility (Nil, New Delhi) were selected and serum progesterone levels were estimated for atleast three months in samples which were collected biweekly. Animals showing atleast two consecutive normal ovulatory peaks (serum progesterone levels >2 ng/ml) (Bamezai, 1986) were selected for fertility trials. Five animals (MRA 375, 515, 640, 672, 770) immunized with 250 Jlg equivalent of r-bZP3, expressed in SG I3009[pREP4] cells, conjugated to DT, was emulsified with Squalene and Arlacel A, adjuvants permitted for human use, in a ratio of 4: I and administered intramuscularly at two sites. In addition, the primary dose also contained I mg/animal of SPLPS as an additional adjuvant. Animals were boosted at intervals of 4-6 weeks depending on the Ab titers with 250 Jlg of r-bZP3-DT using Squalene and Arlacel A as adjuvants. A second group of 3 monkeys (MRA 384, 502, 661) were immunized using a slightly different protocol. The primary immunization consisted of 125 J.lg of r-bZP3-DT and 125 J.lg of r-bZP3-TT (expressed in BL2I(DE3) cells) using the same adjuvants and immunization protocols mentioned above except that boosters were administered alternately with 250 Jlg of r-bZP3-DT or -TT conjugates using Squalene and Arlacel A as adjuvants. Following completion of the primary immunization and 2 boosters at monthly intervals, bleeds (1-2 ml) were collected biweekly from the antecubital vein for estimation of progesterone levels and Ab titres. Boosters were
-
Immunization of Female Bonnet Monkeys
-
Progesterone levels were estimated from sera of bonnet monkeys which were bled biweekly using a radioimmunoassay employing reagents and protocol as prescribed by the W.H.O. Matched Assay Reagent Programme (Sufi et al., 1983). Each sample was run in duplicates. Progesterone was extracted from serum (0.1 ml) by the addition of 2 ml of ice-cold ether in each tube and vortexing for 2 min. The tube was immersed in liquid nitrogen in order to flash freeze the serum phase and the unfrozen ether phase which contained the extracted steroid hormone was decanted into another tube. The ether was allowed to evaporate 0/N and 0.5 ml of steroid assay buffer (0.1 M PBS, pH 7 .3, 0. 1% thiomersal and 0.1% gelatin) was added to the tubes and the tubes were incubated at 40°C for 30 min. Steroid sticking to the walls of the tubes was recovered by vigorous vortexing. 100 J..LI of anti-progesterone Ab (at a dilution giving -50% binding of tritiated p.rogesterone in the absence of unlabelled competing progesterone) was then added to the tubes followed by addition of 0.1 ml of 3H-progesterone ( -10,000 cpm/tube). The mixture was incubated for atleast 16 hrs at 4oc. Unbound progesterone
-
was separated by addition of 0.2 ml of ice cold assay buffer containing 0.625% activated charcoal and 0.0625% dextran and incubated for 30 min at 4oc. This was followed by centrifugation at 2500 rpm for I 5 min at 4°C. The supernatant was carefully decanted into scintillation vials and 4 ml of scintillation fluid (0.4% 2,5 diphenoxazole; 0.01% POPOP [1-4 bis(5-phenyl-2-oxazolyl)benzene] in sulfur free toluene) was added and counted in a liquid scintillation beta counter (Beckman Instruments, California, USA). The amount of progesterone per ml of serum was calculated from a standard curve with known amounts of progesterone in each assay.
-
Progesterone Radioimmunoassays
-
Human oocytes were washed twice with PBS containing 0.1 % BSA and then incubated with 1 :50 dilution of immune or pre-immune serum samples at RT for 30 min. Following washing with PBS (3 changes of 5 min each), the oocytes were treated with goat anti-rabbit Ig-FITC conjugate for 30 min at RT. After washing with PBS, the treated oocytes were mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
Indirect Immunofluorescence on Human Oocytes
-
In addition, cryosections of an ovary from a normal cycling female (10 years) were also processed. Sections passing through a follicle were selected, washed in PBS and blocked for 30 min in 5% normal goat serum. The sections were incubated at 37°C with 1 :250 dilution of rabbit pre-immune and immune sera for 1 h, washed with PBS and incubated for 1 h with 1 :2000 dilution of goat anti-rabbit lg-FITC conjugate. Slides were washed with PBS and mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
A 3 year old monkey was treated daily for 3 days with an intramuscular injection of 25 IU of PergonaJ® (Laboratoires Serono S.A., Aubonne, Switzerland). The monkey was ovarectomized on day 6, and the ovary was snap frozen in liquid nitrogen and sections of 5 J..Lm thickness were cut in a cryostat at -20°C and fixed for 20 min in chilled methanol.
-
Immunofluorescence on Bonnet Monkey Ovarian Sections
-
Porcine ZP3a. and ZP3P prepared as described previously (Yurewicz et al., 1987) and purified r-bZP3 were tested for their reactivity with rabbit anti-r-bZP3 Ab in the immunoblot by the same procedure as described above except that goat anti-rabbit Ig-HRPO conjugate was used.
-
Reactivity with Porcine ZP3
-
Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0
-
Titration of Rabbit Anti-bZP3 Sera
-
administered at two sites. In addition, the primary dose also contained 500 J..Lg of SPLPS as an additional adjuvant. This was followed by 2 booster at 4 weekly intervals with an equal amount of r-bZP3-DT conjugate.
-
Female New Zealand White rabbit (Small Animal Facility, National Institute of Immunology, New Delhi, India), 6 months of age was immunized intramuscularly with r-bZP3-DT conjugate equivalent to 125 Jlg of r-bZP3 (expressed in SG13009[pREP4] cells) in 0.9% saline emulsified with Squalene and Arlacel "A" in a ratio of 4: I and
-
Immunization of Rabbit
-
For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.
-
Purification and Conjugation
-
IMMUNOGENICITY AND IN VIVO CONTRACEPTIVE EFFICACY
-
Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
-
Construction of Recombinant Viruses
-
A I 00 ml culture was grown and induced according to the procedure mentioned above. The culture was divided into 2 aliquots and cells were pelleted down. For cytosolic localization, one pellet was resuspended in 5 ml of sonication buffer (50 mM Na-phosphate, pH 7.8, 300 mM NaCI). The sample was frozen and then thawed in ice-water and cells lysed by brief sonication. The sample was centrifuged at I 0,000 g for 20 min. The soup and the pellet represent the soluble and insoluble components of the cell pellet. In order to check for periplasmic localization, the 2nd aliquot of cells was resuspended in I 0 ml of hypertonic solution (30 mM Tris, pH 8, 20% sucrose, 1 mM EDT A) and incubated at RT for 10 min with shaking. Cells were centrifuged at 8,000 g for 10 min. The pellet was subjected to osmotic shock in 5 mM MgS04. Cells were stirred for 10 min in an ice water bath, centrifuged at 8000 g at 4°C for I 0 min. The soup collected represented the periplasmic fraction. The fractions were analyzed by 0.1% SDS-1 0% PAGE and Western blotting as described above.
-
Intracellular Localization
-
E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
-
Preparation of Competent Cells and Transformation
Tags
- Method-4
- Method-4-Method-2
- Method-4-Method-1
- Method-4-Method-1-detail
- Method-1-Method-4-detail
- Method-4-Method-5-detail
- Method-4-Method-4-detail
- Method-1-Method-4
- Method-4-Method-7
- Method-4-Method-8
- Method-4-Method-6
- Method-4-Method-6-detail
- Method-2-Method-4
- Method-4-Method-4
- Method-4-Method-3-detail
- Method-4-Method-8-detail
- Method-3-Method-4-detail
- Method-4-Method-2-detail
- Method-4-Method-3
- Method-4-Method-9
- Method-4-Method-5
- Method-3-Method-4
- Method-4-Method-7-detail
- Method-4-Method-9-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Transport assays were done by mixing 100 III of vesicle suspension (200 Ilg of protein) with 100 III of reaction buffer (10 mM Tris-HCI, pH=7.4, 10 mM MnCI2, 4mM MgCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 Ilg/ml pepstatin A, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM 2,3-dimercaptopropanol and 16 11M (0.16 IlCi) of GDP-[3H]-Man) . After incubation at 28°C for 6 min, the samples were placed on ice, diluted with 1.5 ml of washing buffer (10 mM Tris-HCI, pH=7.4, 0.25 M sucrose), and applied to a filtration apparatus containing HA filters. The filters were washed with 20 ml of washing buffer, and the radioactivity bound onto the filters was measured by scintillation counting. The amount of GDP-[3H]-Man that was non specifically bound to the outside of the vesicles was determined by measuring the radioactivity associated with the vesicles at 0 time of incubation of vesicles with solute.
-
GOP Mannose transporter assay 49
-
ingredients were present except N-acetylglucosamine. This value represented the galactose released. The difference in the counts between the tube in which acceptor was present and control represented transferase activity.
-
A mixture of sodium cacodylate (20 ~L, 0.2 M, pH = 6.5 adjusted with Hel) , MnCI2 (3 ~L, 1 M), mercaptoethanol (3 ~L, 1 M) and Triton X-100 (5 ~L, 10% w/v) was added to a solution containing N-acetylglucosamine (3 ~L, 1 M) and protein (1 00 ~g). The reaction was started with the addition of UOP-galactose (15 ~L, 10 mM with 1 ~Ci of eH] UOP-galactose). The mixture was incubated at 37°C for 60 minutes after which the reaction was stopped by the addition of EOTA (17 ~L, 0.3 M, pH = 7.4 adjusted with NaOH) and placing the tube on ice. The mixture was then passed through a column of Oowex 2X8 (200-400 mesh in cr form) already washed thoroughly with water. The unreacted UOP-galactose remained bound to the column while galactose which had been transferred to N-acetylglucosamine to form lactosamine, as well as free galactose, was eluted out with 1.5 mL of distilled water. One tenth of volume was taken for scintillation counting. For each assay, a control tube was run in which all
-
1,4 ~ Galactosyl transferase assay 96
-
Membrane protein suspension (5.2 x 109 cells) was centrifuged (3000 g, 4°C, 10 min). The debris was discarded and the supernatant was subjected to ultracentrifugation (100000 g, 4°C, 1 h). The pellet thus obtained was dissolved in 400 ~L of loading buffer (50 mM HEPES-NaOH, pH = 7.4, 0.25 M sucrose, 1 mM ATP,1 mM EOTA, 2 mM OTT, 2 mM leupeptin, 0.2 mM TLCK, 0.1 mM PMSF), and loaded onto a linear sucrose gradient. The gradient was prepared by layering eight 200. ~L fractions (0.25-2 M sucrose in 25 mM HEPES-NaOH, pH = 7.4) over a sucrose cushion (2.5 M) in Ultraclear centrifuge tube (Beckman) followed by centrifugation at 218000 g for 1 h. Organelles in the buffer were fractionated by centrifugation at 218000 g for 4 h at 4 °c in a Beckman L-80 Ultracentrifuge using a SW41 rotor. Each layer was carefully separated out and diluted with 500 ~L of 50 mM HEPES-NaOH buffer. Protein was estimated for each fraction separately using standard BCA assay. ~-1 ,4 Galactosyl transferase was used as a positive marker for golgi and vesicle integrity was determined by measuring the latency of galactosyltransferase catalyzed transfer of [3H] galactose from UOP-[3H]-Gal to GlcNAc
-
Organelle separation of L.donovani 93
-
Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.
-
ixture was stirred under argon atmosphere for 2 days.
-
were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m
-
Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents
-
Synthesis of L-Mannose analogue of GOP Mannose (Scheme 18 of Results and Discussion)
-
(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
-
solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
-
Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
-
Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)
-
mixture was concentrated and the residue was repeatedly lyophilized to yield 7S; ESMS (mlz): 263.1 (M-Hr. Guanosine 5'-diphospho-4,S-di-deoxy-4,S-difluoro-a-D-talose mono triethyl amine salt) 77. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (27 mg, 34.4 Ilmol) and 7S (10 mg, 21.5 Ilmol) was coevaporated with anhydrous pyridine (3 x 500 Ill). 1 H-tetrazole (5 mg, 68.7 Ilmol) and anhydrous pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 77; ESMS (mlz): 608.3 (M-Hr.
-
6 Hz), 4.85 (1H, s); 13C NMR 853.28,65.12 (15 Hz, C3), 67.3 (24 Hz, C5), 69.72 (C2), 81.1 (JCF = 168 Hz, C4), 89.9 (JCF = 171 Hz, C4), 101.47 (C1). 1 ,2,3-Tri-O-acetyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (73). To compound 72 (100 mg, 0.543 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over sodium sulfate and concentrated to afford 73. 2,3-Di-O-acetyl-4,6-di-deoxY-4,6-difluoro-a-D-talo-di-O-benzyl phosphate (75) : Compound 73 ( 70 mg, 0.225 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3, di-O-acetyl-4,6-di-deoxy-4,6-difloro-a-D-talopyranoside (74). To a stirred solution of compound 74 and 1 H-tetrazole (21 mg, 0.3 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (99.4 Ill, 104.3 mg, 0.3 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (87 mg, 0.504 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 75, which was purified by running a silica coated preparative TlC plate; Rf = 0.24 (50% ethyl acetate in hexane); 1H NMR characterstic ¢ 5.67 (1 H, dd, J = 6.3 Hz and 1.8 Hz, H-1); 13C NMR: ~ 20.5-20.6 (OAc), 64.77, 64.99, 66.28, 66.43, 69.9 (24 Hz, C5), 79.96 (JCF = 169 Hz, JCH = 7.1 Hz, C6), 84.08 (JCF= 180, JCH = 5.4 Hz, C4), 95.68,126.85-128.7,169.50,169.77; 31p NMR 8 -3.03; ESMS (mlz): 551.2 (M+Nat. 4,6-Di-deoxy-4,6-difluoro-a-D-talosyl phosphate (76). To a solution of 75 (30 mg, 0.056 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 280 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction
-
Methyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (72). DAST (750 j.!L, 5.6 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside 62 (200 mg, 1 mmol) in anhyd CH2CI2 (4 mL). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3 h. After cooling to -200C, the excess of reagent was destroyed by addition of CH30H (600 j.!L) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated, loaded onto a silica column and eluted out with CH2CI2 to yield 72; Rf= 0.7 in 12.5% CH30H in CH2CI2; 1H NMR (CDCI3) 83.40 (3H, s, OCH3), 4.19 (1 H, m), 4.52 (1 H, d, 6 Hz), 4.68 (1 H, d,
-
Synthesis of [4,6-Dideoxy-4,6-difluoro]-GDP Talose (Scheme 16 of Results and Discussion)
-
(34 mg, 0.198 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 69, which was purified by running a silica coated preparative TLC plate; Rf = 0.23 in 50% ethyl acetate in hexane; 1H NMR characterstic.8 5.72 (1 H, dd, JHP = 6.9 Hz, JHH = 1.8 Hz, H-1), 5.83 (1 H, t, JHF = 53.4 Hz, H-6); 31p NMR 8 -2.81; ESMS (mlz): 753.36 (M+Nat. 6-Deoxy-6,6-difluoro-a-D-mannosyl phosphate (70). To a solution of 69 (25 mg, 0.034 mmol) in CH30H (1 mL) was added palladium on charcoal (10%, 170 mg) and formic acid (100 j.!L). The mixture was stirred at 50°C overnight. The catalyst was removed by passing the mixture through a pad of celite. A few drops of triethylamine were added and the solution was stirred for 15 minutes. The solvent was evaporated and the product was repeatedly lyophilized to afford 70; ESMS (mlz): 279.22 (M-H)". Guanosine 5'-diphospho-6-deoxy-6,6-difluoro-a-D-mannose (mono-triethyl amine salt) 71. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (29 mg, 0.037 mmol) and 70 (11 mg, 0.023 mmol) was coevaporated with dry pyridine (3 x 200 j.!L). 1 H-tetrazole (5.5 mg, 0.074 mmol) and anhydrous pyridine (900 j.!L) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 71; ESMS (mlz): 624.15 (M-H)"
-
Methyl-6-deoxy-6,6-difluoro-2,3,4-tri-O-benzyl-a-D-mannopyranoside (66). A solution of oxalyl chloride (54.62 mg, 37.6 Ill, 0.43 mmol) in anhydrous CH2CI2 (15 ml) was cooled to -78°C and DMSO (67.2 mg, 62 Ill, 0.86 mmol) was added dropwise, followed by the addition of a solution of 65 (500 mg, 1.07 mmol) in CH2CI2 (5 ml) over a period of 5 minutes. The mixture was stirred for another 30 minutes and then triethylamine (1.2 ml) was added. The solution was brought to room temperature, water was added and the mixture was extracted with CH2CI2. The organic layer was dried over Na2S04 to give the intermediate aldehyde. A solution of DAST (112.8 mg, 92.5 Ill, 0.7 mmol) in anhydrous CH2CI2 (1.5 ml) was cooled to -78°C. To this was added a solution of the aldehyde (325 mg, 0.7mmol) in anhydrous CH2CI2 (1.5 ml) dropwise. The mixture was stirred at rt for 90 minutes. After cooling to -20°C, excess of reagent was destroyed by the addition of CH30H and sodium bicarbonate. The mixture was filtered once effervescence ceased. The filtrate was concentrated and the residue was purified by silica column chromatography (5% ethyl acetate in hexane) to afford 66; Rt = 0.34 in 25% ethyl acetate in hexane; 1H NMR characterstic 8 5.97 (1 H, t, JHF = 52.6 Hz, H-6); 19F NMR &-132.65 (dd, J = 57 and 10.9 Hz), -132.90 (d
-
d, J = 57 and 16.4 Hz); ESMS (mlz): 507.2 (M+Nat. Acetyl-2,3,4-tri-O-benzyl-6-deoxY-6,6-difluoro-a-D-mannopyranoside (67). To compound 66 (70 mg, 0.144 mmol) was added 1 % sulfuric acid solution in acetic anhydride (1 ml). The mixture was stirred at rt for 1 h. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 67 which was purified by silica column chromatography (5% ethyl acetate in hexane); Rt = 0.34 (30% ethyl acetate in hexane). 2,3,4-Tri-O-benzyl-6-deoxy-6,6-difluoro-a-D-manno-di-O-benzyI phosphate (69). Compound 67 (50 mg, 0.105 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-benzyl-6,6-difluoro-a-D-mannopyranoside (68). To a stirred solution of compound 68 (46 mg, 0.097 mmol) and 1 H-tetrazole (8.5 mg, 0.118 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (39 Ill, 40.9 mg, 0.118 mmoL) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40 °C and m-CPBA
-
Methyl-6-0-(triphenylmethyl)-a-D-rnannopyranoside (63). Methyl-a-D-manno pyranoside (62, 5g, 25.7 mmol) was dissolved in DMF (17 mL). Trityl chloride (7.9 g, 28.3 mmol), DMAP (515 mg, 2.06 mmol) and triethylamine (3.9 mL, 28.3 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was purified by silica column chromatography (5% CH30H in CH2CI2) to give 63 (8 g, 71.4%); R, = 0.14 in 5% CH30H in CH2CI2; ESMS (mlz): 459 (M+Nat. Methyl 2,3,4-tri-O-benzyl-6-0-(triphenylmethyl)-a-D-mannopyranoside (64). Compound 63 (5.8 g, 13.3 mmol) was dissolved in DMF (80 mL), followed by addition of sodium hydride (60% dispersion, 2.12 g, 53.2 mmol) and benzyl bromide (6.3 mL, 53.2 mmol) dropwise at 0 °C. The reaction mixture was stirred overnight at rt and the excess of sodium hydride was destroyed by addition of CH30H and water. The mixture was extracted with CH2CI2. The organic phase was washed thoroughly with saturated NaHC03 solution and water, dried over Na2S04 and concentrated to give 64; R,= 0.45 in 20% ethyl acetate in hexane; 1H NMR: 83.25 (dd, 1 H, H-2), 3.39 (s, 3H), 3.7-4.0 (m, 5H), 4.29-4.82 (7H, m, 3 x PhCH2 and H-1), 6.9-7.54 (m, 30H, Ph). Methyl 2,3,4-tri-O-benzyl-a-D-mannopyranoside (65). To a solution of compound 64 (1 g, 1.415 mmol) in CH2CI2 : CH30H (1 :2, 9 mL) was added p-toluene sulfonic acid (14 mg) and the mixture was stirred at rt for 2 h. Excess of acid was neutralized by the addition of triethylamine. The mixture was concentrated and purified by silica column chromatography (40% ethyl acetate in hexane) to yield 65 (4.5 g, 72.5%); R, = 0.13 in 30% ethyl acetate in hexane; 1H NMR: 8 3.29 (s, 3H, OMe), 3.61-3.96 (m, 5H), 3.93 (dd, J = 9 and 7.5 Hz, 1 H, H-3), 4.69 (d, J = 3 Hz, H-1), 4.63-4.95 (m, 6H, 3 x Ph CH2) , 7.25-7.34 (m, 15H, Ph); 13C NMR: 8 54.68, 62.34, 71.95, 72.89, 74.67, 74.79,75.10,80.13,99.27,127.50-128.30; ESMS (mlz): 487.3 (M+Nat.
-
Synthesis of [6-0eoxy-6,6-difluoro]-GOP Mannose94 (Scheme 15 of Results and Discussion)
-
Synthesis of GOP Mannose analogues
-
Design and Synthesis of GOP Man analogues and Evaluation of Golgi-specific GOP-Man transporter activity of L.donovan
-
substrate (49). The contents were lyophilized and 250 III of membrane suspension (1.4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The [3H] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting.
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 J..ll of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 J..lg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 J..lg/ml tunicamycin). Each assay tube was prepared by adding 12.5 J..ll of 1% Chaps, 28 J..ll of 200 J..lM GDP-Man, 10 J..ll of GDP-[3H]Man (1 J..lCi) and 25 nmol of synthetic
-
Elongating mannosyl phosphate transferase (eMPT) assay45
Tags
- Method-4
- Method-4-Method-1-Method-4-detail
- Method-4-Method-2
- Method-4-Method-1
- Method-3-Method-4-de
- Method-4-Method-1-Method-1
- Method-4-Method-4-detail
- Method-4-Method-1-Method-3
- Method-4-Method-1-Method-2-detail
- Method-4-Method-4
- Method-4-Method-3-detail
- Method-4-Method-1-Method-2
- Method-4-Method-1-Method-3-detail
- Method-3-Method-4-detail
- Method-4-Method-2-detail
- Method-4-Method-3
- Method-4-Method-1-Method-1-detail
- Method-3-Method-4
- Method-4-Method-1-Method-4
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
-
Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry
-
mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
-
The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
-
Assembly of eDNA encoding dZP3-rG fusion protein by PCR
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
TheamountoftotalIgMandspecificantibovineY-globulin(BGG)antibodyinthefishplasmawasmeasuredbyanenzyme-linkedimmunosorbentassay(ELISA)asgiven byAaltonenetal.(1994)
-
Serumimmunoglobulin
-
Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1
-
Thisisanimportantenzymeinvolvedinthecitricacidcycle.Thehomogenatesofcontrolandeffluentexposedtissueswerepreparedin0.25MicecoldsucroseusingPotterElvehjemtypeglasshomogenizerandcentrifugedat3000rpmfor15min
-
Succinicdehydrogenase(SDH)(E.C.1.3.99.1
-
BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated
-
Redbloodcellcount(RBC
-
Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm
-
AerialRespiration
-
Thetapwaterusedforacclimationandexperimentationhadthefollowingaveragecharacteristics:temperature(28°-30°C),pH(7.2-7.4),dissolvedoxygen(7.8-8.0ppm),CO2(2.08mll'1),salinity(0.190gF1)hardness(154ppmasCaCCF?),alkalinity(68ppmasCaC03)andconductivity(0.56mMhos).
-
Physico-chemicalcharacteristicsoftapwater
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-
until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
-
Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
-
Capture-C
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
added and mixed by gently inverting the tube 4-6 times. The microfuge tubes were then centrifuged at 13,000 rpm for 10 min. QIAprep spin columns were placed in 2-ml collection tubes and the supernatant was applied to these columns. These were then centrifuged for 1 min and the flow-through was discarded. The Qiaprep columns were then washed by adding 0.75ml of buffer PE and centrifuged for 1 min. The flow-through was discarded and an additional centrifugation was given for another minute to remove traces of the wash buffer. The QIAprep columns were placed in a fresh 1.5ml microfuge tube. Finally, to elute out the DNA, 50pl of buffer EB (10mM Tris-Cl, pH 8.5) or RNase-DNase free water was applied to the center of each column and then centrifuged for 1 min after letting it stand for 1 min. The flow-through contained the DNA of interest.
-
Each single colony (white colonies, in case of blue-white screening), was inoculated individually in Sml Luria-Bertani (LB) medium with 100p.g/ml of ampicillin. The cultures were grown for 8-10 hours at 370C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN, U.K.). According to the manufacturer's directions, the pelleted bacterial cells were resuspended in 250pl of buffer P1 and transferred to a microfuge tube. 250pl of buffer P2 was then added and mixed gently by inverting the tube 4-6 times. Further, 350pl of buffer N3 was
-
Plasmid Minipreps:
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
In order to create a half and complete knockouts of CYP genes, a strategy of homologous recombination was employed whereby, the allele(s) in the genomic DNA is replaced by an engineered construct, leaving the other loci unaffected. Since Leishmania is an asexual organism, a two-step targeting protocol has to be followed targeting one allele at a time. The engineered construct contains a selection marker flanked on either side by sequences of the target allele and were generated as explained in 3.2.B.17. Leishmania donovani promastigotes were electroporated with the allelic replacement constructs as described above in section 3.2.A.6. 24 hrs post electroporation, selection antibiotic (Neomycin and/ or Hygromycin, as the case may be) was added to the electroporated cultures and scaled up as described above in 3.2.A.6. Clones generated were cultured and their genomic DNAs isolated. The presence of the replacement construct integrated into the genomic DNA was checked for by PCR using primers specific for the replacement construct (Table 3.6 & 3.7). Those clones which showed the presence of the replacement construct in the genomic DNA were assayed for the level of the respective CYP protein using western blotting as described above in 3.2.B.19 and 3.2.B.20
-
Generation of parasites with half and complete knock-out of CYP genes
-
Polymerase chain reaction (PCR) was used to amplify specific nucleotide sequences from e-DNA and genomic DNA derived from L. donovani. The reactions consisted of an initial denaturation at 94°C for 5 min, followed by 20-30 cycles of denaturation at 94 °C for 30", annealing at primer specific temperature for 45s, and extension at 72°C for 30s-2 min according to product size of the primer pair. A final extension at 72°C was performed for 10 min. The PCR products were resolved on 1-2 % agarose gel containing ethidium bromide and visualized under UV illumination as described later. The specific primer pairs, their Tms and the respective product sizes are listed in Table 3.1-3.7. For High-fidelity Taq polymerase (Invitrogen, Carlsbad, CA), extension was carried out at 68°C and MgS04 was added instead of MgCh in the reaction mix in accordance to the manufacturer's instructions.
-
Polymerase chain reaction
-
For in vitro infection studies; J774A.1 macrophages were plated on coverslips at the density of 1 X105 cells/ coverslip in a 6-well culture plate or at a density of 5 X 105 cells/well of a 6-well culture plate, and allowed to rest for 12-18 hrs. The cells were challenged with stationary phase parasites at a multiplicity of infection (MOl) of 1:10 for 6 hrs after which the excess unbound parasites were washed with phosphate buffered saline or plain medium and the macrophages incubated at 37°C for different time points. Infection was visualised by staining the cells with cell permeant nucleic acid stain Syto 11 (Molecular Probes, Eugene, OR) in the dark for 10 min and viewed under a Nikon Eclipse TE2000E fluorescence microscope (Nikon, Japan)
-
In vitro infection of J774A.l murine macrophages with L. donovani parasites
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
was observed by the formation of a clear zone of hydrolysis around the bacterial/fungal colony. Tannase production, in terms of the diameter of the zone of hydrolysis around the colony, was measured (in mm) after 24 (bacteria) and 48 hours (fungi) of incubation. The diameter of the hydrolytic zone was measured at three points and the average was calculated. The microorganisms showing a zone of tannic acid hydrolysis were considered as tannase producers. The potent tannase producers were further tested quantitatively for the amount of enzyme produced in broth.
-
The procedure of Bradoo et al. (1996), involving point inoculation of the microorganisms on tannic acid agar plates was followed. The plates were incubated at 37 and 30±1°C for bacterial and fungal isolates. The presence of tannase activity
-
Qualitative screening for tannase producer/s
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Non-stringent washes were carried out in 2XSSC and 0.25-0.5% SDS in DEPC water.Stringent washing was done in 1XSSC and 0.5% SDS in DEPC water. Washing was carried out at 55-56oC for 20 minutes. After washing, the blot was covered in the saran-wrap and exposed to the phosphoimager film. After the desired time of exposure, the filmwas then scanned in phosphoimager and the picture saved.The densitometric analysis of the bands was carried out as described in the section 2.2.3.7.Normalization of the signal intensities in northern blotting experiments using probe against tRNA(U73)Arg5was done as follows. The intensity of the tRNA(U73)Arg5signalin the WT or the parent strain in the absence of IPTG was taken as 1 and the relative change in the other strain/growth condition calculated. The value thus obtained was corrected using the change in the corresponding 5S rRNA intensity relative to that in the WT/parent strain in the absence of IPTG
-
Washingof the membrane, exposure and scanning
-
For hybridisation,probe was heated at 95oC for 5 minutes and snap-chilled for 5 minutes and then added to the hybridisation bottles containing the blot. Hybridisation was carried out overnight at 50oC.The probes used and their radioactivity counts (in parentheses) were 5s RNA probe (2.5×106cpm), U73 probe (5×106cpm) and lacZ probes (106 cpm)
-
Hybridisation of the membrane
-
ii.10% Dextran Sulphateiv.0.5% SDSv.100 μg/mlSalmon Sperm DNAvi.DEPC water5ml of pre-hybridisation buffer was used per blotin 150×35mmhybridisation bottles(Labnet). Salmon sperm DNA was heated at 95oC for 5 minutes and snap-chilled for 5 minutes prior to adding to the rest of the mix. Blot was inserted into the bottle such that it stuck to the wallsand the surface containing the RNA faced the inner side of bottle. Pre-hybridisation was carried out at 50oC for 3 hours in hybridisation chamber(Labnet Problot 12S hybridisation oven)
-
The pre-hybridization buffer contained the following constituents:i.6X SSCii.5X Denhardt’s solution
-
Pre-hybridization of the membrane
-
The RNA was cross-linked onto the membrane after transfer by exposing it to the UV light of 200KJ/cm2 energy in a UV-crosslinker
-
UV-crosslinking of the RNA
-
Semi-dry transfer apparatus (Bio-Rad trans blot semi dry transfer cell)was used for the transfer of RNA from the gel to the membrane. The Hybond-N+ membrane from Amersham biosciences was used which was cut as per dimensions of the gel containing the RNA samples. For each transfer 6 pieces of Whatman3mmsheets of the size of the membrane were used. The membrane was soaked for 30-60 minutes in 0.5XTBE before transfer. The transferapparatus was set up as describedby the manufacturer. Transfer was done in 0.5XTBE buffer at 20V, 400mA and 100W for 1.15 hours
-
Transfer of RNA to the membrane
-
vii.RNA buffer II from Ambion(1-2X Xylene cyanol + Bromophenol blue)used for loading the samples. RNA isolation for Northern blotting for lacZtranscript was done aftergrowing cultures till A600of 0.6 in LB in the presence or absence of 1mM IPTG at 30oC while for lacZ-lacYʹ-tRNA(U73)Arg5or lacZʹ-tRNA(U73)Arg5transcripts, cultures were grown in LBupto A600of 0.3 and induced with 1mM IPTG for 30 min followed by RNA extraction.30ml of 10% polyacrylamide gels of 1.5mm thickness were cast in the Broviga slab vertical gel electrophoresis apparatus. Gels were polymerizedby the addition of TEMED and APS (1/100th volume of gel mix). The gel was pre-runat 300V for 15-20 minutes prior to loading.Sample preparation for gel loading was done as follows. The normalizedamounts of RNA samplesto be analyzed were mixed with the equal volumes of 2X gel loadingbuffer II(Ambion)making a final concentration of 1X. The samples were then heated at 80 degrees in a thermoblock (eppendorf) for 10 minutes and loaded on the gel when still warm. The gel was run at constant voltage of 300Vfor 3-4 hours till xylene cynol covered 2/3rddistance
-
The following solutions were used to cast and run denaturing PAGE gels:i.40% acrylamidestock solution ii.7.5M Ureaiii.5X TBEiv.Ammonium persulphate (APS) stock: 10% (w/v) solution made fresh v.TEMED (N,N,N′, N′-tetramethyl ethylene diamine) vi.Gel running buffer (0.5X TBE)
-
Denaturing polyacrylamide gel electrophoresis of RNA
-
The method followed was as described in(Lopezet al., 1997)with few modifications. The steps are as described
-
Northern Blotting
-
The semi-quantitative reverse transcription-PCR (RT-PCR) involves the synthesis ofcomplementary DNA (cDNA)from RNA. For this, 1μgof RNAwas treated with 1μl (1 unit) DNase I enzyme (Sigma, amplification grade) for20 min to remove DNA contamination. DNase I was inactivated by heating at 70oC for 10 min. Next, 5pmol reverse primer wasadded along with dNTPs and volume made to 10μlwith DEPC-treated water; the mix washeated at 65oC for 5 min and incubated on ice forat least 1 min. The reverse transcription reaction was set up with this mix using the Superscript III RT kit (Invitrogen) as per manufacturer’s protocolto obtain cDNA. The cDNA servedas the template for setting up a PCR for requirednumber of cycles. The samples were finally run on agarose gels
-
Reverse transcription(RT)-PCR
-
DNA fragments to be used for specific purposes like ligation or radioactive labellingwere eluted from the agarose gel after electrophoresis. The gel piece containing the desired band was sliced out from the gel and the DNA was purified using commercially available purification kit (Qiagen)for this purpose. The efficiency of elution was determined by checking a small aliquot of DNA sample on the gel
-
Purification of DNA by gel elution
-
Around 0.5-1μg DNA was regularly used for each restriction digestion. 2 to 5 units of restriction enzyme were used in the total reaction volume of 20μl containing 2μl of the corresponding buffer supplied at 10X concentration by the manufacturer. The reaction was incubated for 3hours at the temperaturerecommended by the manufacturer. The DNA fragments were visualized after electrophoresis on 0.8 to 1.5% agarose gels. Commercially available DNA size markers were run along with the digestion samples to compare with and to estimate the sizes of the restriction fragments
-
C. LBON temperature-sensitivityStrains were streaked on LBON agar plates and after an overnight incubation at42°C, growth was monitored (compared to that on LBON at 30°C as control). Absence of single colony growth was taken to reflect temperature sensitivity. D. In vivotranscription termination phenotypes The rationale for each phenotype is described in the relevant section. SMG-sensitivityThe E. coli relA mutants exhibit SMG-sensitive (SMGs) phenotype,that is,growth-inhibition in the presence of serine, methionine and glycine at 1mM concentration each(Uzan & Danchin, 1978)and is proposed to be a consequence of transcriptional polarity exerted by a frameshift mutation in the ilvG gene on the expression of downstream genes of the ilvGMEDA operon(Lopes & Lawther, 1989).This test was therefore used to distinguish relA+from relA−strains. Growth in the presence of amino acids serine, methionine, and glycine (SMG) was scored on glucose-minimal A plates supplemented with each of the amino acids at 40μg/ml and compared with the growth on non-supplemented glucose-minimal A plates to score for SMG phenotype. galEp3assayThis assay was used to test for relief of transcriptional polarity in the rho and nusG mutants. The galEp3 (galE490*) mutation represents a 1.3kb IS2 insertion in the gal leader region (between the promoter and structural genes of the galETKM operon). The mutation causes transcriptional polarity on the structural genes due to Rho-dependent transcription termination within IS2. In this assay, the gal operon expression in a galEp3 mutant or its derivatives was monitored by usingMacConkey galactose indicator plates (with 1% galactose), where Gal+colonies are red, and Gal−colonies are white. Therefore, the depth of color serves as an indicator of relative levels of gal expression, i.e., the extent of transcriptional polarity relief
-
A.lacZphenotype lacZ+colonies were distinguished from lacZ–colonies on X-gal containing plate or MacConkey lactose plate. X-gal is non-inducing colourless substrate of β-galactosidase enzyme which upon hydrolysis yields dark blue indolyl group and hence the lacZ+colonies on X-gal plate appear as dark blue colonies. Similarly, on the MacConkey agar plateslacZ+colonies appear dark pink whereas lacZ–colonies remain colourless. B. UV-sensitivityTo check the UV-sensitivity of the strains qualitatively, the strains were streaked on duplicate LB-agar plates and one of the plates was UV-irradiatedwith a 15-W UV-germicidal lamp at a distance of 70cm for 30 seconds. The UV-exposed and unexposed plates were incubated overnight in the dark after wrapping with aluminium foil and then growth was scored. This test could differentiate a recA–strain (UVs) from a recA+strain (UVr)
-
Scoring for Phenotypes
Tags
- Method-4
- Method-4-Method-2
- Method-2-Method-4-detail
- Method-4-Method-1
- Method-4-Method-1-detail
- Method-1-Method-4-detail
- Method-4-Method-5-detail
- Method-4-Method-4-detail
- Method-1-Method-4
- Method-4-Method-6
- Method-4-Method-6-detail
- Method-2-Method-4
- Method-4-Method-4
- Method-4-Method-3-detail
- Method-4-detail
- Method-3-Method-4-detail
- Method-4-Method-2-detail
- Method-4-Method-3
- Method-4-Method-5
- Method-3-Method-4
Annotators
URL
-