10,000 Matching Annotations
  1. Jul 2018
    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2013. In the tetanus patients aged 1 to 12 years, vitamin C treatment was associated with a 100% reduction in case fatality rate (95% CI from -100% to -94%). In tetanus patients aged 13 to 30 years, vitamin C treatment was associated with a 45% reduction in case fatality rate (95% CI from -69% to -5%).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 16, Lydia Maniatis commented:

      Another example of the problem discussed by Teller can be found in Pelli (1990), who is proposing a model of perception:

      "In order to make the model as general as possible, yet still be able to measure its parameters, we need threeassumptions,or constraints. First we assume that the observer's level of performance increases monotonically with the contrast of the signal (when everything else is fixed). This guarantees that there will be a unique threshold. Secondly, as indicated on the diagram by the prefix contrast-invariant we assume that the calculation performed is independent of the contrast of the effective stimulus, which is its immedi- ate input. Together, assumptions 1 and 2 are a linking hypothesis. They imply that the observer's squared contrast threshold (which we can measure) is pro- portional to the effective noise level (which is inaccessible). Thirdly, we assume that the equivalent input noise is independent of the amplitude of the input noise and signal, or at least that it too is contrast- invariant, independent of the contrast of the effective image. These assumptions allow us to use two threshold measurements at different external noise levels to estimate the equivalent noise level. In effect, the assumptions state that the proportionality con- stant and the equivalent noise Neq are indeed constant, independent of the contrast of the effective image. These three assumptions are just enough to allow us to make psychophysical measurements that uniquely determine the parameters of our black-box model. Our model makes several testable predictions, as will be discussed below."

      It's worth noting that the main function of the rationale seems to be one of practical convenience.

      Theoretically, Pelli (1990) is proposing to make the case that: "the idea of equivalent input noise and a simplify- ing assumption called 'contrast invariance' allow the observer's overall quantum efficiency (as defined by Barlow, 1962a) to be factored into two components: transduction efficiency (called 'quantum efficiency of the eye' by Rose, 1948) and calculation efficiency..."

      Although he claims his model makes testable predictions, he also states that they had not, as of publication been tested.

      Pelli and Farrell (1999) seem to be referencing the untested, two-component model when they state that: "it is not widely appreciated that visual sensitivity is a product of two factors. By measuring an additional threshold, on a background of visual noise, one can partition visual sensitivity into two compo- nents representing the observer鳠efficiency and equivalent noise. Although they require an extra threshold measurement, these factors turn out to be invariant with respect to many visual parameters and are thus more easily characterized and understood than their product, the traditional contrast threshold."

      No references are provided to suggest the proposal has been corroborated. This problem is not remedied by the subsequent statement that: "Previous authors have presented compelling theoreti- cal reasons for isolating these two quantities in order to understand particular aspects of visual function (refs. 3 㠱3)," since all of the references predate the Pelli (1990) claims. Conveniently, the authors "ignore theory, to focus on the empirical properties of the two factors, especially their remarkable invari- ances, which make them more useful than sensitivity"). Ignoring theory unfortunately seems to be a hallmark of modern vision science.

      In this way, Pelli papers over a theoretical vacuum via technical elaboration of an untested model.

      Both Pelli (1990) and Pelli and Farrell (1999) are referenced by more recent papers as a support for the use of the "Equivalent noise" model.

      Pelli (1990) is cited by Solomon, May & Tyler (2016), without a further rationale for adopting the model (I've commented on that article here: https://pubpeer.com/publications/62E7CB814BC0299FBD4726BE07EA69).

      Dakin, Bex, Cass and Watt (2009) cite Pelli and Farrell (1999), their rationale being that the model "has been widely used elsewhere."

      I feel inclined to describe that what is going on here (it is not uncommon) as a kind of "theory-laundering," where ideas are proposed uncritically, then uncritically repeated, then become popular, and their popularity acts as a substitute for the missing rationale. Is this science?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Feb 15, Lydia Maniatis commented:

      In reading a number of papers in visual perception, I repeatedly noticed authors using the term "linking hypothesis." "Linking hypotheses" - or assertions about how some experimental effect was linked to some cause -would be "introduced" without any ado, i.e. casually, without a rationale. It seemed as though we were supposed to take these "hypotheses" as givens in the interpretation of data, which didn't seem right. I googled the term "linking hypothesis" looking for some kind of formal definition, but didn't find anything of that kind. I did, however, find this article, which confirmed all my worst suspicions. I've only looked over as yet, but here is the final, jaw-dropping paragraph:

      "Perhaps we should include more often in our publications a paragraph or two making our linking propositions explicit. It will be important to define the ranges of intended applicability of individual linking propositions, the kinds of support they receive from prior experiments, their consistency with other broadly accepted linking propositions, the constraints they place on the composite map, the ancil- lary assumptions involved and the overall fit of the linking propositions into the current theoretical net- work of visual science. Within a few years, enough such descriptions should become available that it would be possible to refer to and build upon earlier explications, rather than starting from scratch each time. Similarly, perhaps reviewers could be encouraged to use the explicitness and potential values of linking propositions as one of the criteria of excellence for papers in which arguments containing link- ing propositions are explicitly or implicitly made."

      Essentially, this paragraph reveals that, at least as of the time the article was written, vision "scientists" were basing research on arbitrary claims for which they did NOT define ranges of intended applicability; defend with respect to previous research findings; ensure that they were consistent with accepted ideas (or at least how they challenged these); explain their general implications and connection to the current theoretical framework. They were, rather, "starting from scratch" on the basis of arbitrary assertions. This is not a recognisable picture of the scientific method.

      It doesn't appear that Teller's hopes for correction of these problems were realised. As I read the literature, the culture of "linking hypotheses" and all that that entails has become normalised. In fact, it may have gotten worse, as it has combined with the fashion for model-fitting in vision science. Thus, data collected is arbitrarily assumed to be "linked" to underlying processes, and the data are fitted to an algorithm, which, due to the high degree of predictability of the general outcomes (e.g. that attention will limit performance) and large number of free parameters, will always be achieved "more or less," without, of course, having general applicability.

      I've criticised a number of articles from this unfortunate new (maybe not so new) tradition (a few examples below):

      https://pubpeer.com/publications/90941136CC181AFE4896477BF5BB44

      https://pubpeer.com/publications/62E7CB814BC0299FBD4726BE07EA69

      https://pubpeer.com/publications/F0FDE1805AE5BDE583E3883A8AF39C

      A particularly devilish aspect of this approach is that the absence of intellectual/theoretical rigor is masked not only by incoherence but also by mathematics, which may confuse or scare off potential critics. But the same thing applies to math as to computing: Garbage in, garbage out. The rationale is the thing.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 20, David Mage commented:

      This is an excellent review. However, it seems to have overlooked the paper "Neonatal mortality, the male disadvantage" by Naeye RL, Burt LS, Wright DL, Blanc WA, Tatter D, in Pediatrics. 1971 Dec;48(6):902-6, PMID: 5129451, that concluded that the male excess in infant mortality "must" be X-linked. Naeye et al.'s conclusion that an X-linkage is involved has been supported by work following this 1983 paper as shown in the following:

      Is excess male infant mortality from sudden infant death syndrome and other respiratory diseases X-linked? Mage DT, Donner EM. Acta Paediatr. 2014 Feb;103(2):188-93. doi: 10.1111/apa.12482. Epub 2013 Dec 20. PMID: 24164639

      The X-linkage hypotheses for SIDS and the male excess in infant mortality. Mage DT, Donner M. Med Hypotheses. 2004;62(4):564-7. PMID: 15050108

      The fifty percent male excess of infant respiratory mortality. Mage DT, Donner EM. Acta Paediatr. 2004 Sep;93(9):1210-5. PMID: 15384886

      A genetic basis for the sudden infant death syndrome sex ratio. Mage DT, Donner M. Med Hypotheses. 1997 Feb;48(2):137-42.PMID: 9076695

      Female resistance to hypoxia: does it explain the sex difference in mortality rates? Mage DT, Donner M. J Womens Health (Larchmt). 2006 Jul-Aug;15(6):786-94. Review. PMID: 16910910


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 15, Salzman Lab Journal Club commented:

      This of course is a landmark paper, clearly and concisely demonstrating that RNA alone can catalyze reactions. A finding that is a bit obscure here is that nicked circle IVS has mobility similar to linear IVS minus 15 nt. A later paper by the Cech group showed that this is because the autocyclization reaction cleaves off the 5'-most 15 nt of the linear IVS; they posit that this may limit the reversibility of the splicing reaction. This paper introduced the term "ribozyme", which the authors used in distinction to "enzyme" since the RNA reaction was not multiple-turnover; however these days it has expanded to include any RNA catalysts.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 29, Jamie Horder commented:

      This 1981 report of 5 cases was the first published description of the syndrome that was soon to be known as AIDS. It concluded:

      "The above observations suggest the possibility of a cellular-immune dysfunction related to a common exposure that predisposes individuals to opportunistic infections."


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 25, Richard Sauerheber commented:

      We now know that both calcium and magnesium ions at millimolar concentrations decrease the fluidity of biologic membranes. Inside cells, where calcium is at only micromolar concentrations and magnesium at millimolar concentrations, magnesium ion would be involved, particularly since the inner half bilayer phospholipids have negatively charged groups even at slightly acidic pH (6.9) inside cells. The outer half of the bilayer is also susceptible to effects of both calcium and magnesium at millimolar concentrations in extracellular fluid, where phosphate groups on phospholipids would be negatively charged at alkaline pH (7.3) of extracelluluar fluid. The detailed control of the lipid fluidity of membranes in vivo appears to be quite sophisticated.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 09, Israel Hanukoglu commented:

      This article is the second in the series of first keratin sequences. The first one, https://www.ncbi.nlm.nih.gov/pubmed/6186381 reported the first sequence of a type I keratin.

      This second article reported for the first time the sequence of a type II keratin and predicted the secondary structural domains of the protein by computerized analysis. These predictions were confirmed by an analysis of the crystal structure of a segment of this keratin in coiled-coil form (Lee et al., PMID:22705788).

      The coiled-coiled structure of keratins is presented in an article (http://dx.doi.org/10.1002/bmb.20746 ) that also presents a model that can be viewed in Proteopedia.

      http://proteopedia.org/wiki/index.php/Keratin


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 11, Brett Snodgrass commented:

      Dear Reader,

      Please provide your kind consideration to the following reasons that some of the described "lymphatic structures" may be "myocardial sinusoids."

      Quoted from the article: “The subepicardial and subendocardial systems in dogs and pigs communicate via transmyocardial channels” … "in humans these communications have not been identified with certainty." The subendocardial network of lymphatics described in both animals and humans in this study have many similarities to the myocardial sinusoids described by Wearn.

      http://bit.ly/JTWearn

      Tracing to subepicardial lymphatics was possible in dogs/pigs, but not in humans. This may be explained by the hypothesis that some of the observed “lymphatics” in both animals and humans were “myocardial sinusoids.” Caution should be exercised before assuming that all the irregular subendocardial channels reported in this study were lymphatics. Presumably, many of them were myocardial sinusoids and not lymphatics.

      Whether these myocardial sinusoids communicate with subendocardial lymphatics may be a reasonable area for further study.

      My opinion is that accurate anatomic terminology is a basic principle underlying good medical science, and I ask others to consider whether the aforementioned definitions are appropriate. If this comment is not helpful, please let me know how it might be improved. Comments and suggestions are welcome.

      Thank you very much.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Thank you for the excellent article.

      The authors write “intramyocardial channels normally joining the coronary arteries to the ventricular chambers.” Wearn described these ventriculocoronary arterial connections in addition to atriocoronary arterial connections. The eponym and only pronoun applied to these connections is the vessels of Wearn.

      http://bit.ly/JTWearn

      Finegold et al. astutely acknowledged the vessels of Wearn (connections) as a possible etiology for their findings. For further information related to PAIVS and the connections, please see:

      http://www.ncbi.nlm.nih.gov/pubmed/23332812 https://twitter.com/BrettSnodgrass1/status/419317173689909248

      Comments or suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 31, Santosh Kondekar commented:

      Though amikacin is known to be toxic at non therapeutic doses; I feel the toxicity with single high dose is questionable.

      A fourteen month old child of a hospital staff nurse had presented to us with loose motions. Injection amikacin was advised along with routine supportive therapy for hydration. The dose of amikacin was advised as 7.5mg/kg/dose. The child had oliguria since last 12 hours. The amikacin injection was supposed to be kept on hold in view of same. Due to some miscommunication and advise being followed by a junior staff nurse and being unsuperwised; the child received an accidental overdose of intravenous amikacin bolus as 750 mg instead of 75.0 mg. The mishap was immediately noted by the mother. Mother being a staff nurse alerted the consultant and nephrologist. Immediately, blood was collected for renal profile, blood gas and amikacin levels. There was no acidosis on ABG and BUN was 24g/dl and Cr was 0.9. The child showed no worsening of symptoms nor any new symptoms like irritability,cry or seizures. A collective decision of consultant and parents was made to wait and watch. parents were informed all toxicities of amikacin in details. Child passed urine in subsequent hour. A repeat renal profile was sent after 6 hours and 24 hours. BUN was 22 and Serum Creatinine was 0.8. An audiometry was done after three months. A decision to perform dialysis was averted. Serum amikacin levels couldnot be done.

      I do feel that; in normal renal profile, an accidental overdose upto ten times therapeutic dose in a child should not be a reason to panic and an apprehensive decision to perform hemodialysis can be avoided.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2008, which is available also as a manuscript version, Handle. There is statistically highly significant interaction between gender and vitamin C effect on common cold incidence (P = 0.0001), so that vitamin C reduced cold incidence in males with RR = 0.63 (95% CI 0.50 to 0.78), but not in females (95% CI 0.95 to 1.61).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 02, thomas samaras commented:

      Additional information on height, CHD, and longevity is available from these recent publications.

      Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

      Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.

      Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

      Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

      He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

      Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

      Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 27, Richard Sauerheber commented:

      (from the author) Many have argued that insulin stimulates glucose transport in sensitive cells by recruiting already pre-synthesized glucose transport molecules that are inside the cell waiting to be inserted after insulin binds to cell surface receptors. This however would be an energy-requiring and relatively slow process, to insert water soluble transport protein sections through the hydrophobic lipid bilayer. The function of insulin is to conserve energy after eating a meal, storing glucose for future energy needs in the form of glycogen, as well as other foodstuffs, and to quickly react to meal eating, and then to quickly deactivate energy storage between meals. So energy use, such as that required to insert transporters into an already-formed membrane would be wasteful and a contradiction in function. Also, the insulin stimulation of glucose transport is very rapid, finished within a minute, and the reverse, the deactivation of the transport rate, occurs quickly after insulin washes away, as when insulin levels are miniscule between meals. Removal of transporters from a membrane, to be stored inside the cell for later use again when the next meal is consumed, is a cumbersome notion. The data here point to a much more sophisticated and efficient design, where allosteric conformational changes can cause rapid activation and deactivation cycles in transporter activity when insulin is present and then absent, as during and then between meals throughout the day in the in vivo setting. For all the published data suggesting to investigators this is not a proper view, understand that such presented evidence is not compelling or beyond reasonable doubt, including microscopic observations of what are thought to be widespread intracellular transporters waiting for repeated, rapid re-insertion into, and re-removal from, the plasma membrane. The view described here caused my NIH grant renewal in the 1980's to be rejected. My research position eventually was terminated and I went into teaching (which I fortunately dearly love). Meanwhile, I stand by these observations and continue to teach them.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 09, Matthew Katz commented:

      This is a seminal article in cancer care. NSABP B-06 demonstrated the safety of organ-preserving surgery in breast cancer and established a role for radiation therapy in early breast cancer. At the time there were questions about whether radiation was even necessary, but the segmental mastectomy alone arm fared worse. There results have held up at 20 years, also published the NEJM. Fisher B, 2002

      We still have more to refine on patient selection, treatment approach and other factors. But NSABP B-06 remains an example of how clinical trials can give patients treatment options without compromising cure rates.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jan 21, David Keller commented:

      Vitamin C was administered orally in this study

      When vitamin C is ingested orally, the serum concentration is regulated to a maximum of about 300 microM/L. Intravenous administration of vitamin C bypasses enteric control mechanisms, allowing plasma concentrations of up to 20,000 microM/L to be achieved. Alternative practitioners claim special benefits at the supra-physiologic concentrations which can only be achieved with IV administration. This comment is not meant to support or dispute their claims, it is placed here for the reference of researchers who do not have access to the NEJM archives, since the route of administration is not mentioned in the PubMed abstract.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 04, S A Ostroumov commented:

      ABSTRACT: A unique short review of innovative landmark articles that discovered and proved the membrane potential across the membranes of the bacteria that use light as a source of energy, namely, the bacteria with traditional type of photosynthesis with bacteriochlorophyll and the bacteria with a new type of energetics that is based on bacteriorhodopsin.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      In a recent letter to the Journal Guarino describes an apparently novel method of detecting ascites: the diaphragm of the stethoscope is placed just superior to the pubic crest of a patient who has been standing for three minutes or more, and the physician determines by auscultation the level where the timbre of the “finger-flicking” percussion note changes from dull to loud (1). A similar technique, alas, was described in the 1930s by two French physicians (2) (3). Without mentioning the three-minute caveat, they found that if the physician auscultated in the iliac fossa of a standing patient with ascites, and percussed the abdomen from superior to inferior, the percussion note had a brusque augmentation at the top of the zone liquidienne (2).

      More interestingly, however, the thrust of their articles is directed at a technique they considered far more sensitive and convenient in detecting ascites: listening with the stethoscope bell in one iliac fossa while percussing the contralateral fossa with a “finger pulled back like a hammer” (doigt recourbé en marteau) (3). The presence of ascites is indicated by a distinctive double note in response to percussion (le double bruit ascitique), whereas a single note is heard in normal patients. Abdominal distention due to large ovarian cysts (3) or “enormous urinary retention” (2), the authors say, yields a single sound, while, in cases of hydatidiform cyst, a second sound is present, but of a different character (l’echo hydatique) (2). The authors further claim that, with the patient standing, their method is capable of demonstrating ascites of volume small enough to have otherwise escaped clinical detection. We have ourselves heard the ascitic double note, which the French authors considered the sonic manifestation of a fluid wave (3).

      Two hundred years ago, Marie Antoinette’s milliner is reported to have said, “There is nothing new except what is forgotten” (4). The advent of computer-based bibliographic retrieval systems has dramatically improved mankind’s scientific “memory,” but has not perfected it. Thus, there still is (and, most likely, always will be) a vast corpus of pre-electronic knowledge, searchable only by means that are both painful and tedious. Unfortunately, when dealing with an art as ancient as the physical examination, the scrutiny of this literature demands added attention (5).

      John G. Sotos, MD

      Iredell W. Iglehart III, MD

      (1) Guarino JR. Auscultatory percussion to detect ascites. N Engl J Med. 1986 Dec 11;315(24):1555-6. Pubmed 3785320

      (2) Lian C, Odinet J. De l’existence d’un double bruit par la percussion abdominale dans l’ascite. Societé Medicale des Hospitaux de Paris. 1931; 55: 1402-1408.

      (3) Lian C, Odinet J. Le double bruit ascitique et le signe de la matité horizontale dans la station debout. Presse Medicale. 1934; 42: 1337-1338.

      (4) Bartlett J (comp.). Familiar Quotations. 13th ed. Boston: Little, Brown, 1955; 1002.

      (5) Sotos JG. Diagnosis of fractures of the hip and pelvis (continued). N Engl J Med. 1983 Apr 21;308(16):971. Pubmed 6835304


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 19, Robert Tibshirani commented:

      This paper, along with

      Kung-Yee Liang and Scott Zeger (1986). "Longitudinal data analysis using generalized linear models". Biometrika 73 (1): 13–22.

      introduced the Generalized Estimating equation (GEE) approach for modelling repeated or grouped observations. Full probability models for such data are often hard to specify, so GEEs finesse the issue by including a within subject or group correlation matrix in the usual score equations for a generalized linear model. The GEE is an important advance that has had much impact on statistical practice.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jan 27, Guillaume Filion commented:

      This study reports that the sex-determining factor is the transcription factor ZFY. The claims were later shown to be erroneous and the sex-determining factor was identified as the transcription factor SRY (https://www.ncbi.nlm.nih.gov/pubmed/1695712). Expressing SRY in the XX mouse "Randy" made it develop as a phenotypic male (https://www.ncbi.nlm.nih.gov/pubmed/2030730), confirming that SRY is indeed the sex-determining factor. A historical summary of the events was published 25 years after the birth of Randy (https://www.ncbi.nlm.nih.gov/pubmed/27190031).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Dear Reader,

      These diffuse (minute, aka fine) connections may be consistent with the vessels of Wearn. Since we cannot definitively exclude an arteriosinusoidal vessel, using the term "vessels of Wearn" is appropriate.

      It is also possible that some of the connections enter the capillary bed before entering the heart chamber. If that is the case, then it is possible that some of the connections are Thebesian connections.

      For serial histologic sections, Wearn studied the arteriosinusoidal and arterioluminal vessels utilizing cold celloidin that was too thick to enter the capillaries. Wearn did note that when India ink was injected into the coronary arteries it would enter the heart chambers through numerous minute connections. Since, the ink would not permit serial histologic sections with 3D reconstruction as was used for the arteriosinusoidal and arterioluminal vessels, we may not have sufficient information to specify whether the connections are Arterio-capillary-cameral, or Arterio-capillary-venule-cameral (The venule-cameral connection would be a Thebesian vein).

      Thus, when the diffuse connections are identified, we do not have sufficient data to determine whether they are arteriosinusoidal only, or whether some are arteriosinusoidal and some enter the capillary bed before entering the heart chamber. In addition, if some of the connections were arterioluminal vessels, then we would have an even more difficult time naming the radiographic finding. Thus, the term vessel of Wearn has been proposed. For additional commentary, please see. https://twitter.com/BrettSnodgrass1/status/404825015771619328 and https://twitter.com/BrettSnodgrass1/status/413860163033247744

      Comments, disagreements, and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Dear Reader,

      Please consider that approximately 37 years after Wearn's distinguished Harvey lecture, the arterioluminal and arteriosinusoidal vessels (vessels of Wearn), are reported as veins.

      Morphological and Functional Alterations of the Coronary Circulation. Harvey Lecture, 1940 - http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933738/

      Annotations, commentary, and links to additional related references are found at the following Twitter link:

      https://twitter.com/BrettSnodgrass1/status/419530221927141376

      Comments and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 30, Jim Woodgett commented:

      Characterization of a novel GSK3-like kinase (GlkA) in slime mold that is related to GskA and (similarly to GskA) acts downstream of cAMP in regulating chemotaxis. Rescue data show increased expression of GskA in glkA nulls is unable to complement (unlike re-expression of GlkA) and vice versa. Paper includes comparisons with mammalian isoforms (GSK-3 alpha and beta) and finds GskA target, Daydreamer, is also targeted by GlkA. A huge amount of data in this study including iTRAQ comparative proteomics. Would be good to know if lithium inhibits glkA.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 26, Jason Climer commented:

      Zutshi et al present an interesting framework that explains the phenomenon of grid cell phase precession as a code for movement direction to reduce path integration error in the grid cell circuit. While the hypothesis that precession stabilizes the grid cell code is an intriguing one, there are several caveats to their interpretations from extant data that should be considered.

      Phase precession in the open field has been characterized by several groups (Climer et al, 2013; Jeewajee et al, 2013; Reifenstein et al, 2014). Notably, all three groups demonstrated that precession relative to the distance traveled occurs faster as an animal’s path crosses further away from the center of the field. This causes sequences to sweep past each other in a way that would make decoding the distance traveled more complex. It may be possible to encode additional trajectory information in this family of sequences, but how the brain would read that out physiologically remains an open question.

      There are other minor concerns that are relevant to the field. Attractor network dynamics have yet to generate phase precession during open field movement. The claim that the slower spatial sequences in the absence of temporal sequences would be “adequate if travelling in a particular direction for distances that correspond to approximately the minimum grid spacing” may be misleading, as the ability of the brain to read out such long timescale dynamics has not been demonstrated.

      Altogether, it is an interesting idea, and it will be interesting to see what testable predictions fall out of it.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 14, Erick H Turner commented:

      We appreciate the authors' covering this important topic. However, the search method might have missed some relevant publications. It did cover this 2012 paper of ours...

      • Turner EH, Knoepflmacher D, Shapley L. Publication Bias in Antipsychotic Trials: An Analysis of Efficacy Comparing the Published Literature to the US Food and Drug Administration Database. PLoS Med 2012;9:e1001189. Available at https://doi.org/10.1371/journal.pmed.1001189

      ...but the following two papers of ours, which employed the same methodology, were not included:


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 11, Jim Woodgett commented:

      This is a comprehensive and up to date review of small molecule inhibitor classes of GSK-3 and is to be commended for recognizing the two isoform distinctions in the introduction. Some sections still refer to GSK-3beta specific effects (e.g tau phosphorylation where GSK-3alpha is essentially equally happy to phosphorylate this microtubule -associated protein that is implicated in Alzheimer pathology). All of the inhibitors listed in the review block both isoforms.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 16, Alessandro Rasman commented:

      I think that these two recent papers could be useful to understand better the reasons about the failure of the Brave Dreams trial:

      Factors influencing the hemodynamic response to balloon angioplasty in the treatment of outflow anomalies of internal jugular veins http://www.jvsvenous.org/article/S2213-333X(17)30336-0/pdf

      Optimism, enthusiasm, responsibility http://www.jvsvenous.org/article/S2213-333X(17)30335-9/pdf


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 26, Benjamin W Chaffee commented:

      We appreciate the detailed reading of our publication.

      In response, we note that a risk factor need not account for the majority of cases to be an important public health concern. Of all drivers involved in fatal traffic accidents in the United States, 79% were not impaired by alcohol.[1] Nonetheless, drinking and driving demands public health attention because of its indisputable and preventable contribution to traffic fatalities.

      All risk factors for youth smoking that can be addressed through effective public policy merit attention, particularly if those factors are increasing in prevalence.

      [1] National Highway Traffic Safety Administration. Traffic Safety Facts 2012 Data. DOT HS 811 870. https://crashstats.nhtsa.dot.gov Impaired by alcohol defined as blood alcohol concentration 0.08 or above.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 18, Brad Rodu commented:

      Using youth data from Waves 1 and 2 of the Population Assessment of Tobacco and Health (PATH) survey, Watkins et al. reported that “[a]ny use of e-cigarettes, hookah, noncigarette combustible tobacco, or smokeless tobacco was independently associated with cigarette smoking 1 year later. Use of more than 1 product [polyuse] increased the odds of progressing to cigarette use.”

      Watkins et al. focused almost exclusively on odds ratios, which is problematic because the size of the referent group of never tobacco users at Wave 1 (n= 9,058) is 36 to 97 times the size of the other tobacco use groups. This obscures the relative contributions of the groups to the outcomes, but they can be estimated using baseline numbers and adjusted odds ratios (Model 4) from eTable 10:

      219 = 9058x + 255(2.12x) + 189(2.15x) + 114(3.08x) + 93(1.53x)

      Of the 219 subjects reporting cigarette use in the past 30 days at follow-up, the numbers (percent) from each mutually exclusive tobacco-use group at baseline are: 175 never users (79.9%), 11 e-cigarette-only users (5.0%), 8 hookah-only users (3.7%), 7 other combustibles-only users (3.2%), 3 smokeless-only users (1.4%), and 15 polyusers (6.8%). These numbers are derived from the adjusted odds ratios and may vary slightly from the actual survey numbers, but the relative contributions of the groups will not change.

      While teens who try one tobacco product are more likely to try another, the dominant gateway to cigarettes in the PATH youth survey was from no previous tobacco use.

      Disclosure: BR is supported by unrestricted grants from tobacco manufacturers to the University of Louisville and by the Kentucky Research Challenge Trust Fund.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 08, Massimiliano Tognolini commented:

      Compound 1 (2,5-dimethylpyrrolyl benzoic acid) has been used as an Eph/ephrin inhibitor to assess the role of Eph/ephrin system virus entry. Unfortunately, compound 1 is PAINS (Pan Assay INterference substance) giving positive results in a large number of biological assays (Baell JB, 2010). The compound is highly reactive and spontaneously forms a mixture of non-specifically reactive polymers (Zhu W, 2013). Discoverer of Compound 1 themselves retracted their observation by publishing: "...the newly synthesized compound 1 did not show detectable inhibition of ephrin-A5 binding to EphA4-Fc in ELISAs or EphA2 phosphorylation in cells stimulated with ephrin-A1 Fc. ...when left exposed to air at room temperature in dry form, compound 1 acquired a progressively darker brown color. Concomitantly, the compound became progressively more active in ELISAs measuring inhibition of ephrin-A5-EphA4 binding.” (Noberini R, 2011). Scientists were advised about the use of compound 1 by the writer and colleagues in 2014 (Tognolini M, ACS chem neuroscience and Lodola A, JVI). In conclusion compound 1 IS NOT a RELIABLE EPH/EPHRIN ANTAGONIST.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 03, Rajat Rohatgi commented:

      Hi Pete, You are absolutely correct-- Atthog is a tetraspan protein, but does not belong to the tetraspanin family. Atthog is related to the claudin-like group of tetraspan proteins, but the term "tetraspanin" is specific to a different family. Thank you for bringing this error in nomenclature to our attention so promptly. We apologize for any confusion this may have caused. A correction is forthcoming.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 21, Peter Rogan commented:

      The results reported in Table S1 of the different bioinformatic methods were difficult for us to assess. For example, why were there no bioinformatic analyses for c.426+415_4780dup(insGATCGCAGTGA)? Our analysis includes this mutation. Model cutoffs for these bioinformatic methods are defined arbitrarily because they are based on underlying datasets with unpublished or unknown content; furthermore, the binding site models are not easily reproduced, in part because they are not actually based on binding site affinities (Rogan PK, 2013).

      The details of the methods and source data we use to derive our information weight matrices and the matrices themselves are available (Rogan PK, 2003). The information contents of splice recognition sites or exons are expressed in units of bits, which have been formally proven to be related to binding site affinity through the second law of thermodynamics (Schneider TD, 1997, Rogan PK, 1998). In fact, relative entropy used by maxEntscan, violates the triangle inequality which is a fundamental requirement of the second law (Schneider TD, 1999). These articles demonstrate the cutoff for true binding sites is very close to the theoretical minimum of zero bits (Delta G = 0). We have also demonstrated this thermodynamic threshold holds for other types of binding sites (Lu R, 2017).

      Our pipeline for NGS data analysis has been validated extensively (Shirley BC, 2013, Viner C, 2014, Dorman SN, 2014, Caminsky NG, 2016, Mucaki EJ, 2016, Yang XR, 2017, Dos Santos ES, 2017). The URL of the MutationForecaster pipeline is given in the document linked to our previous PubMed Commons post .


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 17, Kathleen B M Claes commented:

      Dear dr Rogan, thank you very much for your constructive comments. It is very interesting to learn that your exon definition-based mRNA splicing analyses are in agreement with our cDNA analyses for all variants we studied (an overview is provided in Suppl Table S1 of our paper - not S3). I read the detailed comments on the URL you referred to. How easy can this approach be implemented in an NGS data analysis pipeline? Can you define cut-offs in this program to indicate when cDNA analysis is warranted?

      I also would like to thank you for alerting us about the typing error for the Multi-exon duplication in BRCA2 - the correct nomenclature for this duplication is indeed c.426+415_4780dup{insGATCGCAGTGA}. We corrected this in the final proofs.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2018 Jan 12, Peter Rogan commented:

      Twenty one BRCA1 and BRCA2 mRNA splice site variants were analyzed by semi-quantitative RT-PCR, with commercial software that scores putative splice sites by ad hoc methods, and with bioinformatic models based on Adaboost and Random Forest, which are general machine learning approaches. The authors cited our review on interpretation of splicing mutations (Caminsky N, 2014), however the analytic approach described in that paper was not evaluated. As an update to our previous BRCA mutation study (Mucaki EJ, 2011), we carried out information theory-based splicing analysis of all potential splicing mutations listed in Supplemental Table S3. The splicing consequences of all variants were accurately predicted by information analysis. We also report results of exon definition-based mRNA splicing mutation analysis (Mucaki EJ, 2013), which infers relative abundance of wild type and mutated splice isoforms from total splicing information content of each prospective exon. Due to length limitations in PubMed Commons commenting system, detailed results for each variant are described in: https://doi.org/10.5281/zenodo.1146708

      Also, during our analysis, some inconsistencies in mutation designation or interpretation were noted in the paper: (1) The complex BRCA2 duplication described in this article (c.425+415_4780dup[insGATCGCAGTGA]) is sometimes referred to as "c.426-415_4780dup[insGATCGCAGTGA]" (e.g. the title of Figure 5, and Suppl. Table S3), which are not congruent mutations. The true mutation is likely the former, as the Figure 5 legend describes an mRNA splice form that includes 293nt of intron 4. If the duplication was c.426-415_4780dup[insGATCGCAGTGA], the intron inclusion would only be 205nt long. (2) We report an additional inconsistency in regards to Figure 5: The legend of Figure 5E describes a splice form where a truncated exon 11 junctions with the aforementioned 11nt insertion. However, the diagram and the electropherogram in Figure 5e shows exon 11 (ending at c.2398) sharing a junction with the beginning of exon 5. The latter is most likely the correct isoform, as an acceptor is not predicted at the junction between c.4780 and the 11nt insertion.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 29, John-Olov Jansson commented:

      Response to Klaus: We thank Dr Klaus for her useful comment regarding possible sex differences in the response to increased loading. We have consistently found the effect of increased loading to be similar in female and male mice on high fat diet. However, we have not evaluated possible sex differences in the response to increased loading in non-obese rodents given standard diet. One possible explanation for previous inconsistent results could be that the effect of loading in these studies was not evaluated in obese mice on high fat diet, an often used model for clinical obesity.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 23, Susanne Klaus commented:

      I would like to comment on two points. (i) I feel that the discussion would have profited from comparing this study to previous studies using the same experimental approach, i.e. weight implantation to investigate the role of weight per se in body weight regulation (1-3). (ii) Since our previous study using the same experimental approach showed considerable sex differences in the reaction of mice to an implanted weight load it is unfortunate that in all except one experiment the sex of the animals used was not indicated and the question of possible sex differences not even mentioned. This makes it very hard to relate the presented data to previous investigations regarding the existence of a ponderostat (here termed “gravitostat”). In our study published in 2004 (1) we implanted weight loads both into male and female FVB mice resulting in drastical sex difference in long term body weight regulation observed over a period of 14 weeks. While male mice showed a partial long term compensatory decrease in body weight due to decrease of fat mass in response to an increased weight load, female mice regained biological body mass within 3 to 4 weeks after the initial weight loss due to surgery. Furthermore, contrary to males, female mice did not reduce food intake and body fat in response to an implanted weight load in the long term. These gender-specific differences in body mass regulation point to different strategies in males and females to cope with a situation affecting body mass and energy demands suggesting a higher efficiency of energy conservation in female compared to male mice.

      1. Wiedmer P, Boschmann M, & Klaus S (2004) Gender dimorphism of body mass perception and regulation in mice. J Exp Biol 207(Pt 16):2859-2866.
      2. Adams CS, Korytko AI, & Blank JL (2001) A novel mechanism of body mass regulation. J Exp Biol 204(Pt 10):1729-1734.
      3. Wiedmer P, Boschmann M, & Klaus S (2002) Weight per se influences body mass regulation differently in male and female mice. J Gravit Physiol 9(1):P189-190.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 13, Raphael Stricker commented:

      An Outdated View of Lyme Neuroborreliosis

      Raphael B. Stricker, MD. Union Square Medical Associates, San Francisco, CA, USA. rstricker@usmamed.com

      The article by Halperin entitled "Diagnosis and Management of Lyme Neuroborreliosis" attempts to address "widespread misconceptions" about the clinical phenomenology, diagnostic approach and response to treatment of neuroborreliosis. Unfortunately the article promotes these misconceptions by ignoring progress in Lyme disease research over the past 20 years. In fact, with the exception of some cosmetic details such as mention of CxCL13, a nonspecific marker of neuroborreliosis, and C6 peptide testing, a relatively insensitive test for Lyme disease, this article could have been written in 1997. It is equally inaccurate and simplistic now, as described below.

      The article uses an interesting approach to promote "Lyme denialism", the view that Lyme disease is a trivial illness that is easily diagnosed and treated as opposed to the worldwide epidemic of an often debilitating disease that affects more than 300,000 new cases annually in the USA alone (1). The discussion points to extensive uncertainties about various aspects of the neurological disease, and then concludes that, despite these worrisome unanswered questions, diagnosis and treatment of neuroborreliosis is relatively simple. There is no discussion of Borrelia cystic forms, biofilms or persister cells that complicate diagnosis and treatment. Relapsing fever Borrelia (RFB) and RFB-like strains such as B. miyamotoi and B. mayonii are brushed aside because "very few human infections" with these organisms have been identified, mainly because routine clinical testing for these Borrelia species does not exist. There is no mention of SPECT brain scans that may be useful in diagnosis of brain inflammation in neuroborreliosis patients (2), and tickborne coinfections such as Babesia microti, Babesia duncani, Anaplasma, Ehrlichia, Bartonella and Rickettsia that may cause significant neurological complications are completely ignored. Thus the article inhabits a simplistic world that was already obsolete 20 years ago.

      A good example of the misinformation contained in this document is the statement that the erythema migrans (EM) "bullseye" rash is found in "90% of infected children" with Lyme disease. This exaggerated EM prevalence is based on a study that defines Lyme disease according to CDC surveillance criteria, which rely heavily on the EM rash for diagnosis. Thus due to this circular reasoning, patients with an EM rash were significantly over-represented in the study. A more realistic contemporary clinical study of neuroborreliosis in children put the rate of EM rash at 27% (3). This more realistic EM prevalence indicates that diagnosis may not be that simple in children with neuroborreliosis.

      The article restates the myth that two-tier Lyme testing has "high sensitivity and specificity" for diagnosis. This statement ignores evidence for the dismal sensitivity of CDC-sanctioned two-tier testing (4,5). For patients with neuroborreliosis, the allegedly high test sensitivity is based on circular reasoning: to be included in this category, patients were required to have positive Lyme testing, and then they had positive Lyme testing! This type of faulty reasoning is presented uncritically throughout the article.

      The article relies heavily on information from the review by Steere et al. (6), which has an extensive critique in PubMed Commons. Many of those criticisms apply to this article as well.

      References

      (1) Stricker & Johnson, PLoS Pathog 10(1): e1003796.

      (2) Donta et al, Clin Nucl Med. 2012;37:e219.

      (3) Bingham et al, Pediatrics. 1995;96:1053.

      (4) Stricker et al, Expert Rev Anti Infect Ther. 2005;3:155.

      (5) Cook & Puri, Int J Gen Med. 2017;10:113.

      (6) Steere et al, Nature Rev Dis Primers. 2016;2:16090.

      Disclosure: RBS is a member of the International Lyme and Associated Diseases Society (ILADS) and a director of LymeDisease.org. He has no financial or other conflicts to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 06, Ivan Buljan commented:

      Dear Hilda,

      Thank you for your comments. You have made several excellent observations and we are glad to clarify those issues.

      As it was addressed in the limitations, high dropout rate was present in trials with consumers and physicians, while there was none in student trials. Unlike the student’s trial, where we tested the efficacy of the formats, our intention was to test their effectiveness (the real world application). We believe that our results are representative because in the real world there will be a significant amount of patients and physicians who would not want to read the CSR. It is true that in the student trial there was no difference in reading experience between PLS and infographics, but although there was significant difference between infographic and PLS in consumer and physician trials, it has to be admitted (as we did in the article) that the difference was very small (only couple of points on reading experience scale, which poses the question whether that is a “clinical significance”).

      There were differences between infographics and PLS concerning the number of numerical expressions, but it cannot be claimed that that was the only reason for the dropout from the trials. Participants may have refused to participate in the trials even before reading the text, or before giving the answers about the summary. Also, even with different number of numerical expressions, numeracy was the predictor of results for all formats, meaning that participant with higher numeracy levels were better in understanding the results in a summary format even when fewer numerical expressions were used.

      Although there were differences in the formats with regard to the presentation of quality of the evidence between infographic and PLS. We accounted for that when scoring the results. In the scoring of the answers, we scored the answer as correct if the answer described the studies with terms like “low quality of evidence”, “the quality of studies differed greatly”, “the strength of the evidence from the studies differed”, “the studies were too small”, whereas the incorrect answers would be such as “the quality of evidence was very good”, “there was no differences in quality of studies” or “all studies produced equal strength of the evidence”. The result was that there was no difference between formats in number of correct answers on that question in any of the three trials.

      As for the metaanalysis, we had all individual level data from the three trials, so it was not necessary to use metaanalysis to estimate the effect. We presented the pooled results from all three trials.

      The ways of presentation of evidence to public using infographic are still not well explored. We do not know whether the symbols used in this research were appropriate to consumers for the purposes they are intended to. To explore that, we would need to ask participant their opinion about the symbols used in the infographic, which would require a qualitative approach, which is underway.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 01, Hilda Bastian commented:

      It is great to see randomized trials to test the effects of an infographic. However, I have concerns with the interpretation of the results of this set of 3 trials. The abstract states that these were randomized trials of 171 students, 99 consumers, and 64 doctors. However, those are the numbers of people who completed the knowledge and reading experience questions, not the number randomized: 171 students, 212 consumers, and 108 doctors were randomized. The extremely high dropout rate (e.g. 53% for consumers) leaves only the trial in students as a reliable base for conclusions. And for them, there was no difference in knowledge or reported reading experience - they did not prefer the infographic.

      The authors point out that the high dropout rate may have affected the results for consumers and doctors, especially as they faced a numeracy test after being given the infographic or summary to read. That must have skewed the results. In particular, since the infographic (here) has such different content to the plain language summary (here), this seems inevitably related to the issue of numeracy: the plain language summary is almost number-free, while the infographic is number-heavy (an additional 16 numerical expressions).

      The knowledge test comprised 10 questions, one of which related to the quality of the evidence included in the systematic review. The infographic and plain language summary contained very different information on this. The article's appendix suggests that the correct answer expected was included in the infographic but not in the plain language summary. It would be helpful to know whether this affected the knowledge scores for readers of the plain language summary.

      Cohen's d effect sizes are not reported for the 3 trials separately, and given the heterogeneity in those results, it is not accurate to use the combined result to conclude that all 3 participant groups preferred the infographic and reading it. (In addition, the method for the meta-analysis of effect sizes of the 3 trials is not reported.)

      The specific summary and infographic, although high quality, also point to some of the underlying challenges in communicating with these media to consumers. For example, the infographic uses a coffin as pictograph for mortality, which I don't believe is appropriate in patient information. This highlights the risks inherent in using graphic elements where there aren't well-established conventions. Both the infographic and the plain language summary focus on information about the baby's wellbeing and the birth - but not the impact of the intervention on the pregnant woman, or their views of it. Whatever the format, issues remain with the process of determining the content of research summaries for consumers. (I have written more about the evidence on infographics and this study here.)

      Disclosure: The Cochrane (text) plain language summaries were an initiative of mine in the early days of the Cochrane Collaboration, when I was a consumer advocate. Although I wrote or edited most of those early Cochrane summaries, I had no involvement with the one studied here.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2017 Dec 28, Karen Woolley commented:

      In a consumer-focused world, focusing on consumer preferences is understandable, if not desirable. If an infographic approach to summarising health information appeals to consumers of health information without interfering with knowledge translation, should the Plain Language Expectations for Authors of Cochrane Summaries (PLEACS) be updated to consider the use of graphics? Currently, the PLEACS guidelines focus primarily on text - the use of data visualisation / graphics is not mentioned. The skills of designers and editors can complement the skills of medical writers to produce high-quality plain-language documents. If PubMed Commons made it easier to post graphics (vs hyperlinking to graphics like this https://twitter.com/KWProScribe/status/946247110600540160), then it could serve as a logical, free, readily accessible, international repository for visually engaging plain-language summaries...that could sit right under their matching scientific (and less consumer-friendly) publications. Disclosures: Financial: I am a paid employee of Envision Pharma Group, which provides medical communication services and technology solutions. I have shares in Johnson & Johnson and have been a government-appointed director on the board of 5 hospitals. Nonfinancial: I am an active member and past director of associations that advocate for ethical publication practices. I am a research partner with international patient leaders and advocacy organisations.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 23, Rajarshi Guha commented:

      We've also released an application to explore scaffold trends at https://tripod.nih.gov/ste

      In contrast to the paper, it doesn't generate fits to the raw trend data. However, it does allow you to visualize trends for any substructure, rather than the fixed set employed in the paper. (The bookmarks in the top right list a number of well known scaffolds)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 13, Anthony Michael commented:

      This paper reports that the single-celled green alga Chlamydomonas reinhardtii accumulates the polyamine putrescine and to a lesser extent norspermidine, with low amounts of 1,3-diaminopropane, spermidine and spermine. It also reports that arginine decarboxylase (ADC) activity is detected at a level 20% that of ornithine decarboxylase (ODC), two enzymes involved in the alternative initial step of putrescine biosynthesis. The authors also tentatively suggest that norspermidine could be synthesized by the aspartate beta-semialdehyde pathway, a bacterial polyamine biosynthetic pathway.

      The detection of ADC activity in C. reinhardtii is intriguing because its genome does not encode a homologue of the plant ADC. Rather, C. reinhardtii encodes two paralogues of ODC (XP001697502 and XP00698872) that according to ChloroP analysis, each contain a chloroplast targeting sequence. The authors applied the irreversible, active site suicide inhibitor of ADC, difluoromethylarginine (DFMA) to growing cells and then tested the effect of this inhibitor on activities of ADC and ODC. Against expectation of the authors, DFMA inhibited ODC activity, and the authors reasoned that this was due to DFMA being converted by arginase to difluoromethylornithine (DFMO), a specific inhibitor of ODC. Indeed, the authors found that cell extract supernatant and the pelleted fraction contained arginase activity. Surprisingly, the authors did not question whether the same phenomenon was happening when they assayed ADC activity. ADC activity was determined by measuring the release of [14C] CO2 from [14C] arginine. However, if arginase was converting [14C] arginine to [14C] ornithine, then any ODC activity would release [14C] CO2 from [14C] ornithine that had been formed from [14C] arginine. This would give the impression that there is ADC activity when in fact the [14C] CO2 was being release by ODC activity, in essence, the assay was detecting a phantom ADC activity, particularly relevant in the absence of an ADC homologue in the C. reinhardtii genome. This is a well-known pitfall with detecting plant ADC activity, and the best way to unambiguously detect ADC activity is to measure the product agmatine (decarboxylated arginine) that is produced by ADC activity on arginine.

      The authors also reported that C. reinhardtii accumulated norspermidine and spermine, and proposed that norspermidine is produced by an equivalent of the bacterial aspartate beta-semialdehyde-dependent pathway. Both spermidine and spermine in flowering plants are synthesized by dedicated spermidine and spermine synthases. An isomer of spermine, thermospermine, is synthesized by a dedicated thermospermine synthase. In Arabidopsis, spermine synthase has very likely evolved from gene duplication of spermidine synthase, which happened at the origin of flowering plants, whereas thermospermine synthase was likely acquired endosymbiotically from the cyanobacterial progenitor of the chloroplast. C. reinhardtii does not encode more that one spermidine synthase homologue, i.e., there is no spermine synthase present. However, a homologue of the Arabidopsis Acl5 thermospermine synthase is present (XP_001696651). As spermine and thermospermine have the same molecular mass and are difficult to separate by HPLC, the absence of a spermine synthase homologue, and the presence of a thermospermine synthase homologue, strongly suggests that the authors detected thermospermine rather than spermine in C. reinhardtii. The presence of thermospermine, and the application of Occam’s razor, then eliminates the requirement for a specific norspermidine biosynthetic pathway that is based on the bacterial asparate beta-semialdehyde-dependent pathway. This is because a known member of the plant polyamine oxidase family produces norspermidine from the oxidation of thermospermine (Sagor et al., (2015) The polyamine oxidase from lycophyte Selaginella lepidophylla (SelPAO5), unlike angiosperms, back converts thermospermine to norspermidine. FEBS Letts, 589, 3071-3078).

      In summary, I respectfully suggest that the authors’ own data indicate that the ADC activity detected by the CO2 release assay may be an artifact of: arginase activity on the [14C] arginine substrate to produce [14C] ornithine, and subsequent ODC activity on the resultant [14C] ornithine. The spermine they detect is likely to be thermospermine, which would explain the presence of the thermospermine catabolite, norspermidine. The effect that the authors found, of the spermidine synthase inhibitor cyclohexylamine, in increasing C. reinhardtii putrescine levels and reducing both spermidine and norspermidine levels suggests that inhibition of spermidine synthesis diminishes thermospermine levels. Thermospermine is made by aminopropylation of spermidine, and therefore the amount of the thermospermine catabolite norspermidine is also reduced.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 12, Morten Oksvold commented:

      In this study the authors use artesunate at concentrations ranging from 50 to 400 microM. They argue that the cytotoxic effects of artesunate on normal cells represent a problem for use of the drug in cancer therapy.

      The problem is that the authors study biological effects of artesunate at concentrations which are not physiological relevant. We are using artesunate at concentrations raging from 1 to 5 microM in B-cell lymphoma, where most cells have an IC50 below 1 microM. Maxium serum levels in malaria patients treated with artesunate have been measured to 1-3 microM.

      Artesunate concentrations of 50 microM and above will never be relevant in clinical settings and the study by Li X et al. is therefore misleading and irrelevant.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 19, Andrea Messori commented:

      Eight gene therapies are already supported by a published clinical trial

      by Andrea Messori

      HTA Unit, ESTAR

      50135 Firenze, Italy

      The study by Rangarajan and co-workers shows that gene therapies can be successful for a disease condition where the deficient factor is coded for by a very large gene. As of December 31, 2017, a published clinical trial is already available for the following 8 gene therapies:

      -Voretigene neparvovec (LUXTURNA, Spark Therapeutics): trial by Russell et al 2017; approved by FDA [2].

      -Tisagenlecleucel (KYMRIAH, Novartis): trial by Oncologic Drugs Advisory Committee[3]; approved by FDA [4].

      -Axicabtagene ciloleucel (YESCARTA, Gilead): trial by Neelapu et al [5]; approved by FDA [6].

      -STRIMVELIS (GSK): trial by Cicalese et al 2016; approved by EMA [7].

      -Gene therapy with a high-specific-activity factor IX variant: trial by George et al. 2017 [9].

      -Valoctocogene roxaparvovec: trial by Rangarajan et al 2017 [10].

      -Single-dose gene-replacement therapy Spinal Muscular Atrophy: trial by Mendell et al 2017 [11].

      -Hematopoietic stem-cell gene therapy for cerebral adrenoleukodystrophy: trial by Eichler et al 2017 [12].

      References

      1) Russell S, Bennett and co-workers for Cerebral Adrenoleukodystrophy J, Wellman JA, Chung DC, Yu ZF, Tillman A, Wittes J, Pappas J, Elci O, McCague S, Cross D, Marshall KA, Walshire J, Kehoe TL, Reichert H, Davis M, Raffini L, Georg Spinal Muscular Atrophy e LA, Hudson FP, Dingfield L, Zhu X, Haller JA, Sohn EH, Mahajan VB, Pfeifer W, Weckmann M, Johnson C, Gewaily D, Drack A, Stone E, Wachtel K, Simonelli F, Leroy BP, Wright JF, High KA, Maguire AM. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled, open-label, phase 3 trial. Lancet. 2017 Aug 26;390(10097):849-860. doi: 10.1016/S0140-6736(17)31868-8.

      2) FDA. FDA approves hereditary blindness gene therapy. Nat Biotechnol. 2018 Jan 10;36(1):6. doi: 10.1038/nbt0118-6a.

      3) Novartis. Oncologic Drugs Advisory Committee Briefing Document. Tisagenlecleucel (CTL019) for the Treatment of Pediatric and Young Adult Patients with Relapsed/Refractory B-Cell Acute Lymphoblastic Leukemia. https://www.fda.gov/downloads/advisorycommittees /committeesmeetingmaterials/drugs /oncologicdrugsadvisorycommittee/ucm566168.pdf , July 12, 2017. Accessed September 11, 2017.

      4) Bach PB, Giralt SA, Saltz LB. FDA Approval of Tisagenlecleucel: Promise and Complexities of a $475 000 Cancer Drug. JAMA. 2017 Nov 21;318(19):1861-1862. doi:10.1001/jama.2017.15218.

      5) Neelapu SS, Locke FL, Bartlett NL, Lekakis LJ, Miklos DB, Ja for a totalcobson CA, Braunschweig I, Oluwole OO, Siddiqi T, Lin Y, Timmerman JM, Stiff PJ, Friedberg JW, Flinn IW, Goy A, Hill BT, Smith MR, Deol A, Farooq U, McSweeney P, Munoz J, Avivi I, Castro JE, Westin JR, Chavez JC, Ghobadi A, Komanduri KV, Levy R, Jacobsen ED, Witzig TE, Reagan P, Bot A, Rossi J, Navale L, Jiang Y, Aycock J, Elias M, Chang D, Wiezorek J, Go WY. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med. 2017 Dec 28;377(26):2531-2544. doi: 10.1056/NEJMoa1707447.

      6) FDA. U.S. Food & Drug Administration. YESCARTA (axicabtagene ciloleucel), Axicabtagene Ciloleucel (YESCARTA, Gilead). https://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapyProducts/ApprovedProducts/ucm581222.htm

      7) Cicalese MP, Ferrua F, Castagnaro L, Pajno R, Barzaghi F, Giannelli S, Dionisio F, Brigida I, Bonopane M, Casiraghi M et al. Update on the safety and efficacy of retroviral gene therapy for immunodeficiency due to adenosine deaminase deficiency. Blood 2016;128: 45 – 54.

      8) Aiuti A, Roncarolo MG, Naldini L. Gene therapy for ADA-SCID, the first marketing approval of an ex vivo gene therapy in Europe: paving the road for the next generation of advanced therapy medicinal products. EMBO Mol Med. 2017 Jun;9(6):737-740. doi: 10.15252/emmm.201707573. PubMed PMID: 28396566; URL https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5452047/pdf/EMMM-9-737.pdf

      9) George LA, Sullivan SK, Giermasz A, Rasko JEJ, Samelson-Jones BJ, Ducore J, Cuker A, Sullivan LM, Majumdar S, Teitel J, McGuinn CE, Ragni MV, Luk AY, Hui D, Wright JF, Chen Y, Liu Y, Wachtel K, Winters A, Tiefenbacher S, Arruda VR, van der Loo JCM, Zelenaia O, Takefman D, Carr ME, Couto LB, Anguela XM, High KA. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N Engl J Med. 2017 Dec 7;377(23):2215-2227. doi: 10.1056/NEJMoa1708538.

      10) Rangarajan S, Walsh L, Lester W, Perry D, Madan B, Laffan M, Yu H, Vettermann C, Pierce GF, Wong WY, Pasi KJ. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med. 2017 Dec 28;377(26):2519-2530. doi:10.1056/NEJMoa1708483.

      11) Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, Lowes L, Alfano L, Berry K, Church K, Kissel JT, Nagendran S, L'Italien J, Sproule DM, Wells C, Cardenas JA, Heitzer MD, Kaspar A, Corcoran S, Braun L, Likhite S, Miranda C, Meyer K, Foust KD, Burghes AHM, Kaspar BK. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. N Engl J Med. 2017 Nov 2;377(18):1713-1722. doi: 10.1056/NEJMoa1706198.

      12) Eichler F, Duncan C, Musolino PL, Orchard PJ, De Oliveira S, Thrasher AJ, Armant M, Dansereau C, Lund TC, Miller WP, Raymond GV, Sankar R, Shah AJ, Sevin C, Gaspar HB, Gissen P, Amartino H, Bratkovic D, Smith NJC, Paker AM, Shamir E, O'Meara T, Davidson D, Aubourg P, Williams DA. Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy. N Engl J Med. 2017 Oct 26;377(17):1630-1638. doi: 10.1056/NEJMoa1700554.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 12, D Majerowicz commented:

      In my opinion, a significant control group is missing in this study. The control group should not be a chow diet fed, but a chow diet supplement with olive oil, soy oil or any other oil of this kind. This control would exclude the possibility that the obtained results were caused by a high-fat diet and not by the canola oil. In the current study design, it is impossible to say if the significant effect came from the overall increase in dietary fat or from the specific fatty acid composition of the canola oil.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 17, Stuart RAY commented:

      This is an interesting report, but the wording of claims in the title and abstract seems sensational and likely to mislead some readers; in particular, saying that they observed "evolution of SIVcpz to pandemic HIV-1" might lead some to believe that the result was a strain much more similar to HIV-1. In fact, as the authors note in Fig 1D, SIVcpz strain MB897 has less than 70% sequence similarity with the most similar HIV-1M strain compared, thus there are more than 3000 (30% of 10kb) genomic differences and it remains unclear what further changes would be needed to make the mutated SIVcpz capable of spreading among humans. Even when there is no intent to mislead, words must be carefully chosen to avoid confusion.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 16, Wichor Bramer commented:

      Dear Helge,

      Thanks for your comment. Good to hear our research is helpful.

      In our analysis we did not really differentiate between which specific database delivered the unique references that were coming from Web of Science. All I can see is the databases we subscribe to are these:

      Science Citation Index Expanded (1975-present) Social Sciences Citation Index (1975-present) Arts & Humanities Citation Index (1975-present) Conference Proceedings Citation Index- Science (1990-present) Conference Proceedings Citation Index- Social Science & Humanities (1990-present) Emerging Sources Citation Index (2015-present)

      I have the idea it is mostly the first two databases that contributed the most to the references, but that is only a wild guess and not at all based on objective research.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Dec 15, Helge Knüttel commented:

      This is a very nice and helpful work based on a broad empirical basis. It will have an impact on my future searching for systematic reviews.

      The autors' main conclusion is that at least the databases/search engines Embase, MEDLINE (incl. ahead-of-print publications), Web of Science Core Collection and Google Scholar should be used for searching in a systematic review (plus some more depending on the topic). However, there is no data in the article what content contained in Web of Science (WoS) Core Collection contributed to the search results analyzed in the article. Therefore, it is not clear what content of Wos Core Collection the authors' recommendation relates to.

      Web of Science Core Collection is a brand name for, well, a collection of databases. Currently, there are at least six citation indexes (Science Citation Index Expanded, Social Sciences Citation Index, Arts & Humanities Citation Index, Emerging Sources Citation Index, Book Citation Index, Conference Proceedings Citation Index) and two chemical indexes (Current Chemical Reactions, Index Chemicus) sold under the general term Web of Science Core Collection. These may contribute to relevant search results in highly varying degrees depending on the research question. This is of relevance as the set of databases accessible to a subscribing institution is not fixed. Rather, it is "You get what you pay for." In addition and unlike other databases a running subscription to one of the citation indexes will not give access to content from all previous years. "Archive" content will need to be purchased separately. As a result, the term "Web of Science Core Collection" may stand for a very broad range of database content.

      It would be helpful if the authors could specify what WoS content their analysis and recommendation relates to.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 13, Xiangbing Meng commented:

      I highly recommend readers to further read the following two references. Xiangbing Meng

      Induction of mitotic cell death by overriding G2/M checkpoint in endometrial cancer cells with non-functional p53. Meng X, Laidler LL, Kosmacek EA, Yang S, Xiong Z, Zhu D, Wang X, Dai D, Zhang Y, Wang X, Brachova P, Albitar L, Liu D, Ianzini F, Mackey MA, Leslie KK. Gynecol Oncol. 2013 Mar;128(3):461-9. doi: 10.1016/j.ygyno.2012.11.004. Epub 2012 Nov 9. PMID:23146687 PMCID:PMC3612022

      Strategies for Molecularly Enhanced Chemotherapy to Achieve Synthetic Lethality in Endometrial Tumors with Mutant p53. Meng X, Dizon DS, Yang S, Wang X, Zhu D, Thiel KW, Leslie KK. Obstet Gynecol Int. 2013;2013:828165. doi: 10.1155/2013/828165. Epub 2013 Dec 7. PMID 24381593 PMCID: PMC3871910


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 04, Anthony Michael commented:

      This paper tackles an interesting problem: whether Salmonella needs to be able to N-acetylate the polyamines spermidine or spermine for successful intracellular replication in human cells. Acetylation of endogenous spermidine in Salmonella might be required to prevent excess/ deleterious accumulation of spermidine. Acetylation by Salmonella of host-derived spermine might detoxify a potentially physiologically disruptive metabolite.

        Until this paper, the tetraamine spermine has never been reproducibly detected in Enterobacteria, however, the authors find that spermine is present in Salmonella at 8.0 mM and is 40 times more abundant than spermidine in Salmonella cells. Such a high molar ratio of spermine to spermidine has never been found in any organism, not even in seminal fluid, where spermine phosphate is sufficiently concentrated to result in some crystallization. This is an extraordinary discovery if reproducible, although it is more likely that some technical problem lies at the heart of this unique finding.
      
         It should be noted that the authors grew the Salmonella in LB medium, a rich, putrescine- and spermidine-containing medium. To determine the native polyamines of a given bacterial species, it is necessary to grow the bacterium in polyamine-free, chemically-defined medium because most bacteria can take up polyamines from the environment. There is barely detectable spermine in LB medium, and so the presence of spermine at 8 mM is all the more remarkable (this is likely a higher concentration of spermine than found in the human host cells, which have a dedicated spermine synthase not found in Salmonella). I suggest the authors use LC-MS to detect the mass of tetrabenzoylated spermine in their benzoylated extracts of Salmonella. Finally, the authors have not demonstrated that the spermidine N-acetyltransferase (speG) gene deletion results in any change in N-acetylspermidine levels. As the Salmonella speG protein has not been previously biochemically characterized, it would be prudent to seek orthogonal proof that the changes ascribed to the speG gene deletion are due to its enzymatic activity as a spermidine N-acetyltransferase. If spermine is reproducibly found to be present in Salmonella at 8.0 mM, I am more than happy to admit that everything that I know is wrong.
      


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 07, Peter Rogan commented:

      We have analyzed this mutation with the Automated Splice Site and Exon Definition Analysis server (ASSEDA). The 1 nt deletion in the splice donor of exon 20 reduces the strength of this site from 11.5 -> 4.1 bits. (100/[2<sup>7.4</sup> bits] = 0.6% binding affinity)

      The information theory-based approach used in ASSEDA predicts isoform abundance and computes the fold changes in binding affinity from mutations (Mucaki EJ, 2013), which corresponds to the degree of exon skipping in this case. The reduction in splice site strength is much greater than the estimates given by the ad hoc methods used in the paper. LOH was not complete; some of the observed expression may have been derived from the contaminating normal allele. In fact, had the loss of function in splice site recognition only been 25-40% according to the paper, it could have been classified as a variant of unknown significance, or possibly as benign (as we suggested in Mucaki EJ, 2011).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Feb 01, Tim Mathes commented:

      We thank Maria-Inti Metzendorf for her comments. We wrote that 2 full-texts were unavailable. By unavailable we mean that the full-text was not available anywhere. For sure, we tried to obtain all articles also via a document delivery services or by contacting the study authors. We assumed that it is not necessary to mention all sources that were used for obtaining full-texts. We chose the term not available, instead of not obtainable because one can never be 100% certain that a full-text don’t exist anywhere. The two mentioned cases were abstracts from the Cochrane Colloquium that were very likely never published as full-texts at the time point of the search. The abstracts did not provide sufficient information to allow an adequate data extraction. The studies were therefore excluded. Both authors are experienced in developing search strategies. Moreover, we tested the search strategy by checking whether the relevant publications known to us were identified before conducting the search (see article Methods section). In the comment no studies are mentioned that were missed by our search strategy. Therefore, it is only an assumption that the search strategy is not sensitive. We suppose this idea has come up because we only used “systematic”sb. In our experience this subset strategy is very sensitive. Our experience has also shown that this subset strategy is even more sensitive than some of the validated search filters for systematic reviews (e.g. health-evidence.ca filter: https://bmcmedresmethodol.biomedcentral.com/articles/10.1186/1471-2288-12-51). It might be always argued that sensitivity could be further increased. However, scientific manpower is not inexhaustible. So, in our opinion also precision of the search strategy is an important feature. However, we welcome suggestions on how to improve our search strategy, although we are confident that our search strategy is sufficient and did retrieve all relevant studies. We also appreciate comments or suggestions for studies we might have missed.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 24, Maria-Inti Metzendorf commented:

      I would like to congratulate the authors on preparing a methodological review on the important topic of data extraction methods in systematic reviews (SR). They report that 11 potentially relevant articles were identfied in the screening process. After full-text evaluation 3 articles were excluded because they did not meet eligiblity criteria, and further 2 articles were excluded as the full-text was not available. Therefore, the authors could only base their analysis on 6 studies and conclude that the evidence base to inform the review´s question is sparse. Given this conclusion I wonder why the authors did not acquire the full-text of the above mentioned 2 articles (via document delivery services or by contacting the authors), as these could have further informed their review. In addition, the review would also have benefited from involving an information specialist who could have checked the search and improved its sensitivity.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 17, Ivan Shatsky commented:

      The review contains an extensive bibliography and in general could be useful for many readers, especially those who are taking their first steps in studying the molecular mechanisms of translation initiation in eukaryotes. The main and serious drawback of the article is an incomplete and distorted presentation of the current status of cellular IRES-elements. I already wrote in Pub Med Commons critical notes on the article from the same lab (Xue S et al. 2015. Nature 517 (7532):33-38)devoted to the same problem but, unfortunately, I was not heard. This review,again,does not say anything about a severe controversy in this field, it does not even mention the fact that the vast majority, if not all,of the cellular IRESs proposed to date must be validated since they all have been indentified using the method of bicistronic DNA constructs, a method extremely prone to almost unavoidable artifacts.

       Most of the works on individual cellular IRES quoted in the review belong to the period from the late 1990s to the end of the first decade of 2000s. In recent years, however, several articles have been published that point to uncertainties of our knowledge on cellular IRES, describe various pitfalls in the approaches used to identify them and suggest methods to avoid artifacts and obtain reliable information. The main requirement in these approaches is to use various RNA constructs, rather than bicistronic DNA, to transfect cells and assess the level of their expression. These approaches and stringent criteria to analyze  experimental  data were described in several of our papers (see, for instance, Andreev et al. 2009. Nucleic Acids Res. 37: 6135–6147; Shatsky et al. 2010. Mol.Cells 30: 285–293; Andreev et al. 2012. FEBS Lett. 586: 4139–4143; Terenin et al. 2017. Cell Mol Life Sci. 74: 1431–1455) and employed in our lab to verify IRESs in c-Myc, Apaf-1 and LINE-1 mRNAs. The authors of this NRMCB article probably found these papers not worthy of attention since they are not quoted. The only exception is reference 101 which represents the article with a detailed analysis of the status of cellular IRES by 2013. The analysis was performed by Richard Jackson, a widely known expert in eukaryotic translation (Jackson 2013. Cold Spring Harb.Perspect. Biol. 5: a011569–a011569.) Remarkably,although this reference is present in the text, nothing is said about the actual content and conclusions of Jackson's work. 
      
       The authors note that “over 100 proposed IRES-containing mRNAs have been reported” but “after decades of work, few examples have been well characterized”. However, the authors do not express any surprise why the progress is that slow, why the methods which have been successfully used to validate viral IRESs are not employed or not applicable to characterize cellular IRESs. The authors also note that putative cellular IRESs have “few structural similarities to each other” and that “their mechanisms of action are largely unknown”. Again, the authors do not ask the question:  why for many years now we have not seen positive data on the validation of cellular IRES? Maybe most of these mysterious structures are simply not IRESs, and we must look for alternative mechanisms? Meanwhile, scientific journals, including top ranking ones, go on publishing papers with novel unvalidated cellular IRESs, thereby only thickening the fog in this area 
      
      In short, it seems to me that this section of the review is written in an overly optimistic manner. It is unlikely to be useful for professionals in the translation mechanisms and may be  misleading for new generation of researchers who do not have a sufficient background in the field.
      


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 23, Richard Holliday commented:

      The oral health risks of tobacco smoking are well known and it is critically important we continue to build the evidence base around novel nicotine products so we can accurately inform our patients of the relative risks. It is great to see more research published on this topic.

      After reading this paper, I was left confused with regards to tobacco smoking within the e-cigarette (EC) consumer group. The study population is described as being made up of ‘former cigarette smokers’ and ‘current EC users’.

      The ‘former smokers’ groups were defined as:

      • Smoked >100 cigarettes in their lifetime.
      • Been abstinent (self-reported) for at least 6 months and not more than 2 years.

      The ‘EC consumers’ group were defined as:

      • EC consumers were ‘smoking’ EC for at least 6 months.<br>

      My concern with the study design and interpretation is that there has been inadequate control of confounding factors, particularly tobacco smoking. ‘Dual use’ (i.e. using both combustible tobacco and EC) is very common, currently around 45% in the UK. The study inclusion criteria do not specify that those in the EC consumer group need to be abstinent from tobacco smoking nor do they include any method of biochemically validating this (e.g. expired air carbon monoxide or salivary/urine biomarkers).

      This confounding factor makes the interpretation of the results very challenging. The comparison is between ‘former smokers’ and ‘users of combustible tobacco and EC’. Unfortunately, you can’t differentiate out the effect of the EC with this design. The papers conclusions ‘Our results show that e-cigarettes are linked to three types of inflammatory lesions in the oral cavity’ hence appear invalid.

      I also felt it would have been useful to have a ‘tobacco smoking (without EC)’ comparator group and I was unsure why this was not included or presented. This would have allowed relative risk to be communicated to tobacco smokers.

      I encourage the authors to clarify these points. Many thanks.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Feb 05, Johanna McEntyre commented:

      We do have a mechanism to do this ("External links") - we just need the databases to participate - something we are keen to see and will be encouraging within the context of ELIXIR over the foreseeable future. e.g. Here are all the papers cited in IntAct: http://europepmc.org/search?query=(HAS_INTACT:y)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Feb 03, Egon Willighagen commented:

      One thing that has been bugging me for some years now (see this write up) is that it is really hard to figure out which databases capture data in articles. An example is WikiPathways which has knowledge extracted from almost 20 thousand articles (unique PubMed IDs), but it is nearly impossible to figure out which databases have data related to some article.

      What would the database community need to do for Europe PMC to use links between articles and database entries?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2018 Jan 10, Christopher Southan commented:

      While the advances described for EPMC are impressive, it remains somewhat misleading to imply European Patent Office biotechnology abstracts as a current resource, since the feed ceased in 2012. Would be great if EPO could backfill these which would then uniquely facilitate // searching of patents and literature.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 29, Michael Hoffman commented:

      I read this paper with interest and welcome its innovative new experimental method.

      Readers may be interested in our 2016 preprint, "Modeling methyl-sensitive transcription factor motifs with an expanded epigenetic alphabet" (Viner et al. 2016, bioRxiv, https://doi.org/10.1101/043794). In our paper, we also extended the four-symbol DNA alphabet to include additional symbols for methyl-C and guanine paired to methyl-C, and used position weight matrices (PWMs) based on this expanded alphabet. Our paper also used sequence logos with the expanded alphabet. The use of an expanded epigenetic alphabet for an energy PWM (ePWM) in the 2017 Zuo et al. paper is an interesting development.

      In 2015, we added custom alphabet support to most tools in the MEME Suite to allow use of this expanded alphabet. We hope that those tools will be useful for many.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 24, Dorothy V M Bishop commented:

      It is great to hear that the authors are conducting a large scale follow-up study: I would urge them to do this as a Registered Report, or at least to pre-register their hypotheses. Yes, small samples are not inherently bad, but, as demonstrated by Ramus in his 2017 paper,it is a sad reality that most findings from small studies in this areas fail to replicate in larger samples - perhaps not surprisingly given heterogeneity of dyslexia. There is a danger that, aware of this history, we might throw out the baby with the bathwater and dismiss genuine, important findings. But it is hard to know which findings are solid because most researchers in this area currently fail to distinguish hypothesis-testing and exploratory studies. A proper, large-scale prospective study with hypotheses identified a priori would be extremely valuable.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Dec 21, Christa Müller-Axt commented:

      We here respond to the questions and concerns raised by Franck Ramus (23th of Nov 2017). We organize our response around four topics: (i) sample size and statistical power, (ii) interpretation of effect sizes, (iii) specific predictions and correlation analyses, and (iv) current status and future directions.

      (i) Sample size and statistical power: Franck Ramus argues that our study lacks statistical power due to the modest sample size (i.e., n=12 dyslexics and n=12 matched controls). First, as recommended by Button et al. (2013), we have explicitly acknowledged and discussed the modest sample size in our manuscript (see pp. 3694 & 3696). Second, given the well-known statistical problems associated with modest sample sizes, we took measures to reproduce our results in additional analyses, as laid out in the paper (i.e., surface-based analyses, see pp. 3694 & e3). While we are aware that these analyses do not constitute an independent replication, they further provide confidence in our main results, as they make it unlikely that the findings are merely due to methodological specificities. Third, the Button et al. (2013) paper elicited a more detailed discussion on sample size issues and neither Button et al. (2013) themselves nor any of the comments and papers in response to Button et al. (2013) suggested that small sample size studies should be dismissed altogether (see e.g., Bacchetti P., 2013; Quinlan P.T., 2013 for a more detailed discussion of these arguments).

      (ii) Interpretation of effect sizes: Franck Ramus questions the plausibility of our results, specifically because the observed effect size for the group difference in left V5/MT-LGN connectivity is larger (d=1.28) than the observed effect size for the associated behavioral difference in rapid automatized naming (RAN) for letters and numbers (composite score: d=1.16). We were surprised by this remark. A larger effect size for left V5/MT-LGN connectivity differences than for behavioral differences on RAN could be explained by a number of reasons, e.g.: 1) altered V5/MT-LGN connectivity might also affect other cognitive processes that are not captured by RAN measures, 2) RAN is supported by additional brain networks, other than V5/MT-LGN connectivity alone, that contribute to task performance, 3) recruitment of compensatory mechanisms that partially substitute altered V5/MT-LGN connectivity to enable RAN performance. In our view, all of these mechanisms (as well as their combinations) seem plausible given the complex and nonlinear nature of the human brain and given the multi-component nature of the RAN. Therefore, we do not see how the apparent difference in reported effect sizes between the behavioral and neural measures would undermine the plausibility of our results.

      (iii) Specific predictions and correlation analyses: Franck Ramus asks whether we had specific predictions about the correlations reported in our paper. We had indeed specific predictions about the RAN and reading comprehension scores. As described in the paper (pp. 3693 & 3695), these predictions were based on a previous finding from our research group that only these two scores correlated with sensory thalamus function in dyslexics in an fMRI study (Diaz et al., 2012). The correlation in that study was only found for RAN and reading comprehension in dyslexics, but not in controls (Diaz et al., 2012). Hence, in the present paper we tested the specific hypothesis that RAN and reading comprehension scores are related to V5/MT-LGN connectivity in dyslexics. Franck Ramus states that there are other core symptoms of dyslexia. He asks whether we tested correlations of V5/MT-LGN connectivity with more behavioral measures than reported, without appropriately correcting for multiple tests. We agree that dyslexia also encompasses other core symptoms (e.g., spelling and reading speed deficits). We did, however, not test for correlations with these or other behavioral measures, as we did not have specific predictions about them. It should go without saying that we do not do selective reporting of test results. Our predictions about the correlations with RAN and reading comprehension related to the dyslexia group, while we did not expect a correlation in the control group. We therefore consider it valid to apply a Bonferroni correction for the two tested correlations within each group separately. We did not compute correlations across the whole sample of dyslexics and controls together, as this would not have addressed our hypothesis (i.e., that RAN and reading comprehension scores are related to V5/MT-LGN connectivity in individuals with developmental dyslexia).

      (iv) Current status and future directions: We appreciate that Franck Ramus highlighted the issue of the replication crisis. Indeed, while we think it is important not to dismiss results merely based on sample size, we agree that novel research findings necessitate replication. For this reason, our research lab is currently conducting a large scale follow-up study for replication as well as testing of further hypotheses generated by the present findings. We hope that the present study will inspire further research on potential deficits at the level of the sensory thalami and cortico-thalamic connections in the dyslexia field – a field that is currently dominated by an almost exclusive cerebral-cortex-centric view.

      Button, K. S., Ioannidis, J. P. A., Mokrysz, C., Nosek, B. A., Flint, J., Robinson, E. S. J., & Munafò, M. R. (2013). Power failure: why small sample size undermines the reliability of neuroscience. Nature Reviews Neuroscience, 14(5), 365‑376. https://doi.org/10.1038/nrn3475

      Bacchetti, P. (2013). Small sample size is not the real problem. Nature Reviews Neuroscience, 14(8), 585-585. https://doi.org/10.1038/nrn3475-c3

      Quinlan, P. T. (2013). Misuse of power: in defence of small-scale science. Nature Reviews Neuroscience, 14(8), 585-585. https://doi.org/10.1038/nrn3475-c1

      Díaz, B., Hintz, F., Kiebel, S. J., & von Kriegstein, K. (2012). Dysfunction of the auditory thalamus in developmental dyslexia. Proceedings of the National Academy of Sciences, 109(34), 13841-13846. https://doi.org/10.1073/pnas.1119828109


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2017 Nov 24, Dorothy V M Bishop commented:

      I agree with Franck's comment. This seems yet another example of a high impact journal favouring newsworthiness of a result over methodological quality. See my earlier blogpost on this topic:

      https://figshare.com/articles/High-impact_journals_where_newsworthiness_trumps_methodology/5631748


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2017 Nov 23, Franck Ramus commented:

      This study seems severely underpowered, which is surprising for such a frequent disorder as dyslexia, and given that we are in the midst of a replication crisis (e.g., Button et al. 2013; Ramus et al. 2017).

      With 12 participants per group, this study had 29% chance to observe a moderate group difference (d=0.6). Here, the significant result is due to a huge group difference (d=1.28) in the left V5/MT-LGN connectivity. Even larger than the corresponding behavioural difference in RAN letters (d=1.27) and numbers (d=0.95) (from Table S1). How plausible is it that there should be such a large brain difference between two groups of dyslexic and control individuals, even larger than the cognitive symptoms that this brain difference is presumed to underlie?

      Similarly, with 12 dyslexic individuals, only huge correlations greater than 0.576 could be significant. Luckily this study observed a correlation of 0.588 between left V5/MT-LGN connectivity and RAN (using a one-tailed test and correcting for two tests), but not with reading comprehension. But what about the other behavioural variables, spelling and reading speed? Are they not core symptoms of dyslexia, even more so than RAN? Do they not rely on visual abilities? Were the a priori predictions so specific to RAN and reading comprehension, that correlations with spelling and reading speed were not even tested? If those predictions had been preregistered, this might be credible. Alternatively, were those correlations tested, but not taken into account in the correction for multiple tests? (not even mentioning correlations within the control group, or across the two groups)

      Button, K. S., Ioannidis, J. P. A., Mokrysz, C., Nosek, B. A., Flint, J., Robinson, E. S. J., & Munafò, M. R. (2013). Power failure: why small sample size undermines the reliability of neuroscience. Nature Reviews Neuroscience, 14(5), 365‑376. https://doi.org/10.1038/nrn3475 Ramus, F., Altarelli, I., Jednoróg, K., Zhao, J., & Scotto di Covella, L. (2017). Neuroanatomy of developmental dyslexia : pitfalls and promise. Neuroscience & Biobehavioral Reviews. https://doi.org/10.1016/j.neubiorev.2017.08.001


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 21, Franz Schelling commented:

      2-dimensional statistics can't come to terms with 4-dimensional hemodynamic problems such as those illustrated by the Unmistakable MS lesions which reflect retrograde venous impacts - as those shown in tell-tale MRI series

      Please share a non-factional look at Dominik Meier's unquestionably stellar MRI sequences of a patient with multiple sclerosis.

      Isn't https://medium.com/@franzschelling/what-deals-the-brain-such-blows-synchronous-at-least-double-hits-in-an-exemplary-case-of-292877844500 or http://bit.ly/2hu3g9N proving without any shadow of a doubt:

      Such cases of multiple sclerosis are biomechanically primed hemodynamic and obviously venous conditions. Which need to be established as such, to be addressed with the adequate technical equipment and topical expertise.

      F. Schelling, M.D.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Nov 20, Alessandro Rasman commented:

      I think that these two recent papers could be useful to understand better the reasons about the failure of this trial:

      Factors influencing the hemodynamic response to balloon angioplasty in the treatment of outflow anomalies of internal jugular veins http://www.jvsvenous.org/article/S2213-333X(17)30336-0/pdf

      Optimism, enthusiasm, responsibility http://www.jvsvenous.org/article/S2213-333X(17)30335-9/pdf


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 23, Alessandro Rasman commented:

      I think that these two recent papers could be useful to understand better the reasons about the failure of the trial Brave Dreams:

      Factors influencing the hemodynamic response to balloon angioplasty in the treatment of outflow anomalies of internal jugular veins http://www.jvsvenous.org/article/S2213-333X(17)30336-0/pdf

      Optimism, enthusiasm, responsibility http://www.jvsvenous.org/article/S2213-333X(17)30335-9/pdf


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 09, David Keller commented:

      "The most common cause of death was PD"?

      It is notoriously difficult to get physicians to complete death certificates properly, especially when it comes to concisely and accurately identifying the cause of death. Some clinicians list the cause of death as "cardiopulmonary arrest" in nearly all cases, because (they argue) the cessation of pulse and breathing is one of the final events in most deaths, and thus is the most proximate cause of death. This type of error in identifying the cause of death is akin to "missing the forest for the trees", and interferes with research that would benefit from a cause of death that really answered the question: "what disease entity was the main reason this patient died on this admission?"

      On the other hand, we have doctors who are too vague and imprecise in identifying the cause of death, as in this study. Assigning "Parkinson disease" (PD) as the cause of death tells us little in most cases. The fact that a patient had advanced PD when he died does not mean that he died from the direct effects of PD, which is unusual. It would be better to identify a more proximate cause of death, such as stroke associated with recent onset of atrial fibrillation (for example) and list "advanced Parkinson disease" as an "other illness present at death". This would give researchers who use the death certificate a more accurate designation of the proximal prime mover in the patient's death at this time, and also allow for investigations into associations between that cause of death, and the patient's underlying PD.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 20, Doug Altman commented:

      This paper reports a simple descriptive survey of reports of randomised trials published in dermatology journals. It is not a meta-epidemiological study, which is a meta-analytic summary of subgroup analyses across multiple meta-analyses – see for example Sterne et al (Stat Med 2002) [PMID: 12111917].


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 18, Christopher Southan commented:

      As a more convenient alternative to supplementary data or figshare, NAR were enlightened in accepting pointers to our own blog posts (http://www.guidetopharmacology.org/news.jsp). We will thus now be able to update these

      Note also this paper follows on from our 2016 effort https://www.ncbi.nlm.nih.gov/pubmed/26464438 so please switch to this 2018 one for future citations


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 21, Samira Vesali commented:

      Natural conception and reproductive experiences in cancer survivors who stored reproductive material before their treatment In the October 2017 issue of human reproduction (vol: 17, Page:1-8), Hammarberg K, 2017, published an opinion piece arguing of 301 respondents who had tried to achieve pregnancy since completing cancer treatment almost all had succeeded, in most cases through natural conception,Hammarberg K, 2017. There are some worthwhile points were not considered in this study, even as limitations or reasons for caution, which are bias influencing their findings. First, relatively response rate. It is not possible to know whether people with better or worse survival were more or less likely to participate. Our thoughts on this issue is that cancer patients undergoing advanced stages likely did not tend to participate in the survey. As well, those with malignancy normally get more extensive chemotherapy, which can damage their reproductive system. Evidence has been shown that different chemotherapy regimens can affect the reproductive system differently, Long JP, 2016. However, cancer patients who were on malignant stages have likely lower life expectancy and less hope childbearing after their treatment. It is possible they are less inclined to look for and benefit from fertility preservation options to store their cryopreserved material. Second, we believe that it is important to view the findings within the context of the cancer type, stage and chemotherapy regimens of the participants, because all the mentioned factors can lead to use or not use the frozen reproductive material and are effective in the participants’ ability to get pregnant naturally (possibly mild chemotherapy which can preserve some of the ovarian reserve). Third, the cancer patients studied were recruited from 1995 to 2014, but as we know Human Fertility and Embryology Authority (HFEA) has given permission to the usage of frozen eggs in United Kingdom (UK) from 2000, Wise J, 2000, and American Society of Reproductive Medicine (ASRM) removed the label of “experimental” from oocyte freezing in 2013,Practice Committees of American Society for Reproductive Medicine., 2013 . So, giving single vision to all frozen materials of participants during this time period maybe is not correct. Earlier, the patients only could enjoy form the cryopreserved embryo and sperm, then ovarian tissue and more recently oocytes. Looking at the table II, the pregnancy achievement is presented as “as a result of ART with stored material” but is not presented separately. It is not clear that all usage of stored material are adequately cryopreserved gametes or embryos or not. Fourth, the essential problem we see is that age can be another confounding factor in this survey. Many of the people who have never tried to get pregnant may be in advanced age, but we do not know the age of those who did not respond or never tried to get pregnant. Reza Omani Samani1, Samira Vesali1* 1 Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran Correspondence address: Department of Epidemiology and Reproductive Health, Royan Institute for Reproductive Biomedicine, Tehran, Iran. E-mail: samiravesali@yahoo.com.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 19, Gwinyai Masukume commented:

      The authors define this pregnant patient’s Haemoglobin (Hb) of 8.9 g/dL as mild anemia. However according to the World Health Organization (WHO) this is moderate anemia (Hb < 10 but >= 7 g/dL) (WHO, 2011).

      It is suggested that theirs is the first case report describing an HIV infected pregnant patient with uncorrected Tetralogy of Fallot. In 2011 Solanki and co-authors reported such a case Solanki SL, 2011.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 12, Matthew Bjerknes commented:

      Haber AL, 2017 claim as novel their observation that a type of tuft cell expresses "the pan-immune marker CD45, which was not previously associated with non-haematopoietic cells" (see abstract). It is important to correct the oversight that the fact that tuft cells express PTPRC, encoding the pan-immune marker CD45, was first reported by Bezençon C, 2008.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 20, Tanai Cardona commented:

      I had suggested a similar experiment in a blog post back in the day (June 19, 2013): http://tanaiscience.blogspot.co.uk/2013/06/ethanol-production-using-heterocyst.html

      Glad to see it worked and that my prediction for better ethanol production in the heterocysts wasn't too crazy after all. In any case, using cyanobacteria to produce biofuels might need rates many times higher for it to become of any use at all. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4364286/

      Well done! All the best, Tanai


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 18, Anthony Michael commented:

      This article addresses the degradation of the polyamine spermine (Spm) by a strain of Bacillus subtilis used in the fermentation of soybeans to produce the Japanese fermented foodstuff “natto”. The authors have paraphrased half a sentence from a review of mine that dramatically misrepresents the whole sentence and meaning. In their article, the authors state, “However, it is widely accepted that bacteria do not produce Spm (Michael, 2016) and direct degradation of Spm by B. subtilis (natto) is unproven.” In fact, my review stated, “It had been accepted dogma that bacteria do not produce spermine (77); however, that supposition was incorrect, and in fact Spm has been detected in diverse bacteria (25).” (Michael, A.J. (2016) Polyamines in Eukaryotes, Bacteria and Archaea. J. Biol. Chem. 291, 14896-903 PMID: 27268252). In an age of fake news, this could be construed as fake citation.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 31, John Sotos commented:

      "The Popeye sign," described in the Journal as a marked bulge in the upper arm after rupture of the biceps tendon (1), should more correctly have been called "a Popeye sign," given that the term "Popeye arm" has been applied to patients with fascio-scapulo-humeral muscular dystrophy who have wasting of the biceps combined with preserved deltoid and forearm musculature (2).

      The confusion is understandable to anyone familiar with Popeye-the-Sailorman's complex and dynamic upper limb anatomy. In his baseline state, Popeye exhibited the forearm muscular hypertrophy common among sailors of his era (the 1930s), for whom scraping paint was a frequent duty (3). To science's detriment, the instantaneous biceps hypertrophy that Popeye experienced after oral spinach ingestion remains physiologically unexplained.

      Thus, for maximal clarity, an eponymical purist would use the terms "pre-spinach Popeye sign" and "post-spinach Popeye sign," respectively, in cases of fascio-scapulo-humeral muscular dystrophy and biceps tendon rupture.

      (1) Yoshida N, Tsuchida Y. "Popeye" sign. Images in clinical medicine. N Engl J Med. 2017; 377: 1976.

      (2) Case records of the Massachusetts General Hospital, Case 40-1991. N Engl J Med. 1991; 325: 1026-1035.

      (3) Hornfischer JD. The Last Stand of the Tin Can Sailors. New York: Bantam Dell, 2005. Page 90.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 16, Erick H Turner commented:

      The authors make mention of two approaches for dealing with publication bias. However, both of these can be classified as statistical approaches for use when the only data to which one has access is the published literature. Another approach: simply procure the missing data. Instead of relying on manuscript cohorts, one can look further “upstream” to inception cohorts of clinical trials. Examples of sources include regulatory data (e.g. Drugs@FDA), grants databases, and ClinicalTrials.gov.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 17, Giorgio Cattoretti commented:

      In 2014 [PMID: 24794148] we demonstrated that a pH2 Glycine buffer and a boiling 6M Urea buffer fail to remove primary antibodies in an exquisitely affinity-dependent fashion. Secondary antibodies increase the primary antibody affinity, further preventing the antibody complex removal with those buffers. Antibodies were not "degraded " to the point of not being recognizable by a second step, as shown in our paper. Later this year [PMID: 28692376 ] we published two separate and efficient antibody removal technique which preserve tissue antigenicity entirely over ten cycles and more. The method allows whole slide immunostaining with routine reagents and open source analysis tools as per this manuscript, but with far more markers per slide (50 or more). This manuscript describes a partially efficient two-step method for “detachment” but little rationale for the choice of buffers and none of the multiple previous references dealing with antibody removal (see our 2014 manuscript for a list). The fact that the Authors reproduce our previous observations is comforting; unfortunately misses the scientific rationale we provided and the solution of the problem we published.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 17, Xinlai Cheng commented:

      Here is the gRNA sequence information for Stat3 Double Nickase Plasmid (h) : sc-400027-NIC:

      sc-400027-NIC Stat3 Double Nickase Plasmid (h): gcctagatcggctagaaaac sc-400027-NIC Stat3 Double Nickase Plasmid (h): gttgggcgggcctccaatgc

      we can also provide you our established cell line. Let me know if you want


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 19, Kenneth Witwer commented:

      This study suggests that approximately 20 microRNAs (miRNAs) in cerebrospinal fluid (CSF) may distinguish between different responses to exercise or between sedentary controls and individuals living with chronic fatigue syndrome (CFS, also known as myalgic encephalomyelitis, or ME) and Gulf War Illness (GWI). Funded by recent NIH efforts to support research into several related, poorly-understood and debilitating conditions, this report represents a large and commendable undertaking in terms of patient recruitment (182 individuals) and sample collection. Unfortunately, experimental and analytical issues limit interpretation of the results. I would like to highlight several of these here in the hopes of stimulating rigorous follow-up as appropriate.

      1) The choice of a threshold of 35 for a clearly noisy qPCR array. A Cq threshold (to distinguish noise from real signal) was assigned to Cq=35, higher than might have been supported by the negative controls. 82 "positive" negative control features were found in this dataset, with an average Cq of 35.6. 34 of these data points were below Cq 35, averaging 33.1, and several amplified before 25.9. This is a high false positive signal, raising concerns about specificity of the array and suggesting that a lower threshold might have been appropriate.

      2) The noise threshold was effectively ignored by adjusting all values above 35 (PCR noise) to 35. This replaced noise with "data" points and introduced a block of artificially invariable values. In a re-analysis after discarding Cq>35, at least half of the reported differences fall away or are smaller. Specifically, results for the following miRNAs appear to be affected by the Cq=35 adjustment: miR-99b-5p, miR-423-5p, miR-204-5p, miR-30d-5p; let-7i-5p, miR-200a-5p, and miR-93-3p (these three miRNAs also do not reach the 2/3 detection threshold in the exercise groups); miR-19b-3p, miR-505-3p, miR-532-5p, and miR-186-3p (for the latter, only one and two Cq<35 data points were gathered for the SC and CFS groups, respectively); and miR-22-3p and miR-9-3p (detected in only one group). miR-22-3p may remain significant, but the real difference between groups is about half the reported value.

      3) A miRNA was considered "expressed" in any one of the seven groups only if it was found in 2/3 of all samples. Unfortunately, this threshold was then ignored in analysis, when even miRNAs that were "expressed" in only one group were compared between groups. In some cases, miRNAs with only one or two amplifications in a group were reported (like miR-186-3p).

      4) No validation or measures of technical variability. First, there is no assessment of technical variability. The qPCR array gives one reading per miRNA per sample, with the exception of a negative control, read twice. Reading the same sample on three or four arrays would show how precise the readings are. Some of the miRNAs have up to 15-cycle detection ranges (even with Cq=35 as the cutoff) within groups. This represents a >32,000-fold range if it is an accurate measure of abundance. As a result, the purported differences between groups are often overshadowed by large standard deviations. It is unclear how much of this variability is technical, thus it is difficult to assign any differences to biology. Second, no findings are validated by individual assays. Instead of, or in addition to, technical array repeats, individual qPCR assays are routinely used in RNA biomarker studies to confirm profiling findings. These experiments are relatively cheap and permit multiple technical replicates for each sample. Third, no spike-ins are reported (RNA extraction efficiency) nor is there quality control of RNA prior to array measurements. While I can understand that the authors's enthusiasm might have spurred them to proceed without some standard procedures, it is perplexing that reviewers (and editors) would not ask for these crucial experiments.

      Despite these critiques, there are several findings that appear to be supported by a reanalysis (excluding Cq>35). These include the finding of 40-fold decreased abundance of miR-328 in CSF of exercised versus non-exercised individuals (although this is not restricted to any particular disease group), and, to a lesser extent (8-fold), miR-608. While validation is needed, and ideally a before-and-after study (in animals if this is too demanding in humans), at least these miRNAs may justify follow-up. Several other miRNAs are also significantly different between the two groups, but with large variability, diminishing their likely utility as biomarkers. However, with most of the purported CFS or GWI differences confounded by the thresholding strategies, and with no validation, additional evidence will be needed before other conclusions can be drawn. Notably, there was no discernible pattern of neuronal, oligodendrocyte (providing myelin sheath), or inflammation-associated miRNAs, which one might expect with damage or inflammation associated with CFS/ME or the acetylcholinesterase-linked mechanisms for GWI that is mentioned, so I am doubtful that this avenue of investigation will be fruitful.

      Patients of CFS/ME not only have to live with this condition, they have been through a lot in recent years with irreproducible science. I would thus encourage the authors both to moderate speculation about CFS or GWI-associated miRNAs for now and to proceed with and report the results of blinded qPCR quantification. I would recommend using the standard stem-loop RT/TaqMan assays for this. Indeed, I would be glad to examine samples along with you in a blinded fashion if it would be helpful.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 22, Sander Houten commented:

      This paper focuses on the role of KLF14 in the regulation of hepatic gluconeogenesis in mice. The authors show that Klf14 mRNA and KLF14 protein expression in mouse liver is induced after overnight fasting. The authors furthermore show that Klf14 mRNA and KLF14 protein expression increased in liver of C57BL/6 mice on high fat diet, db/db mice and ob/ob mice when compared to control animals. The authors continue to demonstrate that the promoter of peroxisome proliferator-activated receptor-gamma coactivator 1alpha (Pgc-1alpha), a transcriptional regulator of gluconeogenesis, contains one KLF14-binding site. In subsequent experiments the authors use adenovirus-mediated KLF14 overexpression and knockdown in isolated mouse hepatocytes and in vivo in mice, which further indicated that KLF14 modulates hepatic gluconeogenesis (Wang L, 2017).

      I would like to point out that there is little evidence to support the hypothesis that KLF14 plays an important role in adult mouse liver biology. We found no evidence for expression of KLF14 in adult mouse liver as we were unable to amplify Klf14 cDNA, did not find Klf14 mapped reads in liver RNA sequencing data and found no specific signal upon immunoblotting (Argmann CA, 2017). Our data on the absence of Klf14 expression in liver are consistent with previously published work by others (Parker-Katiraee L, 2007) and publicly available data sources. We also investigated the physiological functions of KLF14 by studying a whole body KO mouse model and focused on the metabolic role of this transcription factor in mice on chow and high fat diet. Our results indicate that KLF14 does not play a role in the development of diet-induced insulin resistance in male C57BL/6 mice (Argmann CA, 2017).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 09, Alvaro Alonso commented:

      This paper reports that warfarin users had lower overall incidence rates of cancer than non-users in a large population-based cohort. The association was present for most cancers.

      One major limitations in this analysis, that puts into question the validity of the results, is the lack of adjustment for potential confounders. The reported models seem to only adjust for age and sex. The authors did not consider any other factor that may influence the decision to prescribe or not warfarin. It has been established that frail and sicker individuals are less likely to receive oral anticoagulation with warfarin, even if indicated, and to discontinue treatment (see for example PMID 19151165, 26277091 and 27471198).

      In summary, before concluding that a particular medication has a blanket anticancer effect, I would expect a more careful consideration of confounding.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 22, NephJC - Nephrology Journal Club commented:

      The trial of Tolvaptan in Later-Stage Autosomal Dominant Polycystic Kidney Disease was discussed on November 14th and 15th 2017 on #NephJC, the open online nephrology journal club. Introductory comments written by Ian Logan are available at the NephJC website here and a patient perspective is available here.

      160 people participated in the discussion with an impressive 1215 tweets.

      The highlights of the tweetchat were:

      • In general, tolvaptan is still not routinely used, limited by lack of approval, concerns regarding cost-effectiveness, and patient tolerance in presymptomatic CKD.

      • This was a well-designed study but one year may be too short an interval to evaluate at given that ADPKD is a lifelong disease.

      • The benefit is mainly driven by stage 3a group. In stage 3b & 4 the change in GFR decline was between 0.78-0.81 ml/min

      • The results overall are promising for Tolvaptan particularly if it can delay ESRD by a few years to allow time for pre-emptive transplant but concerns still remain regarding patient selection, tolerance, and the haemodynamic drop in GFR mediated by the drug.

      Transcripts of the tweetchats, and curated versions as storify are available from the NephJC website.

      Interested individuals can track and join in the conversation by following @NephJC or #NephJC on twitter, liking @NephJC on facebook, signing up for the mailing list, or just visit the webpage at NephJC.com.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 10, Arthur Yin Fan commented:

      Great news! This month our article has been selected as one of ten articles for the November 2017 Atlas Awards Nominations: "Acupuncture’s Role in Solving the Opioid Epidemic: Evidence, Cost-Effectiveness, and Care Availability for Acupuncture as a Primary, Non-Pharmacologic Method for Pain Relief and Management–White Paper 2017″ (Arthur Yin Fan is the first author, and Dr.David Miller is the correspondence author, our colleague Sarah Faggert also a co-author---there are 14 authors across the United States).

      As is stated on the Elsevier Atlas Awards homepage: “Each month the Atlas Advisory Board are sent a selection of 10 articles to choose their winning Atlas article. The articles are shortlisted by Elsevier from across journal portfolios based on their potential social impact. We are delighted to present the entire monthly shortlist and congratulate the authors of the nominated articles.” While the voting is still in progress, we are still very excited to even be nominated. This marks the first time that an acupuncture article has been nominated for the Elsevier Atlas Award.You may click on the following link to take you the Elsevier Atlas Awards Nominations page: https://www.elsevier.com/connect/atlas/nominations.

      We will let you know should our article win!

      Nominations Each month the Atlas Advisory Board are sent a selection of 10 articles to choose their winning Atlas article. ELSEVIER.COM


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 17, Jos Verbeek commented:

      The phrase in the background of the abstract of this article that there is 'no consolidated evidence for workplace interventions to reduce or prevent neck pain' is at odds with the four Cochrane reviews that appear in the box of 'similar articles' to the right of the abstract. Given that only English language articles were included, it is unclear what this systematic review adds to the body of evidence already available.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 21, Ralph Brinks commented:

      The authors state that Hoyer and Brinks set up "a hypothetical (micro-simulated) population" with "a linear increase of diabetes incidence to age 70 years". It is not true that we performed a micro-simulation. Instead, we used analytical relations between incidence and prevalence as cited, e.g. Brinks R, 2014. The linear increase of the age-specific incidence is an approximation to the values reported in the original paper. We agree that this an approximation only.

      The key point we made is that ignoring mortality yields to biased estimates of the incidence. This point has not been - and cannot be - undermined by the authors. Thus, we strongly discourage the use of the Styblo method whenever mortality matters.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 29, Wichor Bramer commented:

      Dear Hilda,

      Thank you for your comments and your additional clarification via e-mail upon my request.

      From your comments and clarification I understand that the nature and differences of the ESM and DAH searches might not be clear to you, and therefore also not to the other readers of the article. Let me start by explaining this in more detail.

      The ESM searches were librarian-mediated searches created by me upon requests of researchers at our institute, Erasmus MC in Rotterdam, the Netherlands. The DAH searchers were librarian-mediated searches created by other information specialist upon requests of researchers at other academic hospitals in the Netherlands. The researchers published the outcomes of the searches as systematic reviews between January 2014 and June 2016. The topics of the reviews differ, as can be seen in table 1 in the article. Though we did not check that for all ESM and DAH reviews, the reviews were probably executed and reported according to the PRISMA standards. The review authors were responsible for the inclusion process, and the evaluation of the relevance of the retrieved articles.

      This leads to an answer to your two questions:

      1) The ESM and DAH reviews differ on topics. Therefore there is no direct comparison of two searches (at different times), which would require the exclusion of references retrieved based on a later search date. The ESM and DAH reviews are published in the same period, therefore we can conclude that the searches had been performed in the same period as well (though we did not analyze this).

      2) As the both the ESM and the DAH searches are done at the requests of researchers, it was the responsibility of the review authors, all topic experts, to assess the relevance of the retrieved references. The reviews authors were not involved in the research, neither were they informed of the inclusion of their review in this research. Inclusion was only done after the review was published, therefore to the best of our knowledge, there was no bias in the inclusion process of the ESM and DAH reviews.

      We do acknowledge that the weakness of this study is that a direct comparison is impossible, since there are different searches on different topics. We therefore have started with a follow up research in which we create three simultaneous searches on a topic for a systematic reviews by three independent information specialists. All results will then be combined for the researchers to review the retrieved references for relevance.

      We will take your comments into account by the execution and writing of that research, as we have done with your earlier comments on a previous research article (a comparison of Medline, Embase and Google Scholar) which have influenced the data analysis and reporting of this research.

      Once again thank you for your comments, and looking forward to discussing our research in the future with you.

      Kind regards, Wichor


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Oct 28, Hilda Bastian commented:

      It would be useful if the authors could provide detail on two key issues not described in the paper. The first is the method for excluding identified references that were published subsequent to the date of the original searches.

      The second is how eligibility for study inclusion was assessed for the ESM group, and by whom. This is a key outcome measure, that is also highly susceptible to bias. A method for reducing this bias, for example, would be assessment by more than one assessor independent of those conducting the searches, blinded to the search strategy by which the study had been identified.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 30, Donald Forsdyke commented:

      CRISPR SPACERS PROVIDE "JUNK" VLA RNAs

      A "peculiarity of human thinking" invokes sad head-shaking in some quarters. It is argued, not only that "the vast majority of low abundant transcripts are simply junk," but also that such junk is "simple" (1). Those led to think that junk DNA serves the organism (i.e. can under some conditions be functional and hence selectively advantageous) are labelled "determinists." They can scarcely be distinguished from "ID believers"! There is no mention of the two-decade-old view that very low abundance transcripts (VLA RNAs) represent an intracellular antibody-like repertoire, for which much evidence has since accumulated (2-4).

      For microorganisms, the CRISPR system provided a clear example of the functionality of the transcription of their spacer "junk DNA." Ledford notes that the system "adapts to, and remembers, specific genetic invaders in a similar way to how human antibodies provide long-term immunity after an infection" (5). Just as we have germline cascades of V genes that confer immunological specificity on B and T lymphocytes, so microorganisms have their germline spacers that confer a similar specificity on their RNA populations. However, the functionality of an individual spacer "sense" transcript is only tested when a virus with a specific "antisense" sequence enters the cell. Transcription is conditional. The selective advantage can only emerge when the corresponding pathogen attacks.

      Thus, the analytical problem is not so "simple" as showing by experimental DNA deletion that the transcript of a specific eukaryotic gene is functional, or as dismissively postulating a requirement for "unacceptably high birth rates." Deletion of a single human V-region gene could show no selective effect if no corresponding pathogens invaded the body. Even if there were such an invasion, other V-regions would likely be able to compensate for the deletion. Similarly, deleting a segment of "junk" DNA is unlikely to impact survival if some of the wide spectrum of alternative "junk" transcripts can compensate for this defect in the RNA antibody-like repertoire.

      1.Sverdlov E (2017) Transcribed junk remains junk if it does not acquire a selected function in evolution. BioEssays doi: 10.1002/bies.201700164. Sverdlov E, 2017

      2.Cristillo AD, Mortimer JR, Barrette IH, Lillicrap TP, Forsdyke DR (2001) Double-stranded RNA as a not-self alarm signal: to evade, most viruses purine-load their RNAs, but some (HTLV-1, Epstein-Barr) pyrimidine-load. J Theor Biol 208:475-491. Cristillo AD, 2001

      3.Forsdyke DR, Madill CA, Smith SD (2002) Immunity as a function of the unicellular state: implications of emerging genomic data. Trends Immunol 23:575-579. Forsdyke DR, 2002

      4.Forsdyke DR (2016) Evolutionary Bioinformatics. 3rd edition. Springer, New York, pp. 279-303.

      5.Ledford H (2017) Five big mysteries about CRISPR’s origins. Nature 541:280-282. Ledford H, 2017


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 06, Alexander Kraev commented:

      This is an interesting case of active nescience, because both authors were aware, even before their work started, of the fact that the PLN transgenic strain they used had a peculiar genomic structure that resulted in the presence of two resident wildtype PLN gene copies and 13 transgenic mutant (R9C) PLN gene copies under the control of alpha-MHC promoter. This situation can never, even theoretically, occur in a human patient (https://doi.org/10.1101/075671). Yet, they chose to compare it to another transgenic strain, expressing another gene with the same promoter cassette, wherein the transgene structure and genomic location are unknown. The authors state that "Although these mice are DCM models, their etiology are different from each other", which is based on the assumption that different genes are used in the two transgenes. The original descriptions of the transgenes both lack data on transgene localization and also lack the minimally necessary controls, such as an analysis of two or more transgenic lines produced with the same DNA construct. The readers should interpret the data in this paper with extreme caution, since some or all of the "universality in failing hearts" found between the two strains may stem from the use of the common expression cassette, and/or its genomic location. However, if these data are ever validated by the use of a more advanced transgenic method, this paper would serve as a good reference of the extent of conceptual misdirection the lack of transgene genomic characterization can induce.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 29, David Keller commented:

      No placebo control, blinding or randomization, nor confidence intervals for the purported benefits

      Patients with Parkinson disease (PD) are uniquely susceptible to the placebo effect due to the role of dopamine in expectation effects. Studies which do not include placebo control, double-blinding and randomization of subjects to therapy, cannot claim to provide more than anecdotal data.

      Medical cannabis has been legalized in many states, but remains on Schedule 1 as an illegal drug at the national level. Because the commercial cultivation of cannabis is also illegal, most is supplied by underworld criminal sources. High levels of herbicides such as paraquat have been measured in marijuana, exposure to which is a risk factor for PD. I would insist on cannabis grown under safe legal conditions before risking exposure of PD patients to unknown levels of herbicides.

      It is difficult to imagine how an intoxicant like cannabis, which impairs so many neurological functions, could reduce falls in PD patients. PD patients are also susceptible to dementia, and the long-term dementia risk of cannabis intoxication is not known.

      As a clinician, I cannot at this time place any credence in these reported benefits of cannabis for the treatment of PD.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 24, David Keller commented:

      Treating pain versus preventing addiction - finding a balance

      In their Viewpoint editorial, titled "Underlying Factors in Drug Overdose Deaths", Dowell and colleagues use the term "prescription opioids" to refer to all opioids that can be obtained by prescription, without distinguishing how they were, in fact, obtained. This nomenclature conflates two very distinct and different categories of opioid users: pain patients taking opioids prescribed by their physician, and persons who abuse opioids without medical indication or supervision. The latter should be designated "abusers of prescription opioids" to avoid creating a false impression of elevated risk from the proper use of prescribed opioids.

      The Figure showing alarming increases in "prescription opioid overdose deaths" does not reveal what fraction of these deaths occur in persons who obtain prescription opioid medication by illegal means, such as buying or stealing pills from acquaintances or drug dealers, again inflating the risk of death from the proper use of prescribed opioids.

      Overdose deaths should not be reported as "related to prescription opioids" when coexisting levels of alcohol, benzodiazepines, heroin or other illegal narcotics are found in the blood. Deaths from polysubstance abuse creates a falsely high impression of the risk of prescribed opioids when taken as directed.

      Doctors know full well that "unnecessary exposure to prescription opioids" is to be avoided, but would the crisis of "prescription opioid overdose deaths" end, even if all "prescription opioids" were outlawed completely? Hint: heroin overdoses did not end when heroin was made illegal. Overdoses of "prescription opioids" by drug abusers will not end, regardless of how diligently doctors reduce the therapeutic use of opioids.

      Pain patients are questioned as if they were criminals for needing strong pain medicine, by doctors wary of the legal and regulatory risk of "excessive prescribing" of opioids. Under-treatment of pain becomes inevitable, because clinicians lack time for the extensive documentation, discussions, warnings, contracts, testing, database queries and other precautions which are advised with each opioid prescription.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 23, Franck Ramus commented:

      There is at least one more problem with this study that Mark Seidenberg did not point out in his critique (http://languagelog.ldc.upenn.edu/nll/?p=35144). It is that the two groups were tested sequentially: first the 30 controls, then the 30 dyslexics. This is generally avoided in experimental psychology (and biology as well), because this is so prone to experimenter bias (unwittingly influencing differentially the members of each group), as well as to apparatus bias (e.g., apparatus parameters changing at some point, making these parameters confounded with group membership).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 21, Samira Vesali commented:

      Natural conception and reproductive experiences in cancer survivors who stored reproductive material before their treatment

      In the October 2017 issue of human reproduction (vol: 17, Page:1-8), Hammarberg K, 2017, published an opinion piece arguing of 301 respondents who had tried to achieve pregnancy since completing cancer treatment almost all had succeeded, in most cases through natural conception,Hammarberg K, 2017. There are some worthwhile points were not considered in this study, even as limitations or reasons for caution, which are bias influencing their findings. First, relatively response rate. It is not possible to know whether people with better or worse survival were more or less likely to participate. Our thoughts on this issue is that cancer patients undergoing advanced stages likely did not tend to participate in the survey. As well, those with malignancy normally get more extensive chemotherapy, which can damage their reproductive system. Evidence has been shown that different chemotherapy regimens can affect the reproductive system differently, Long JP, 2016. However, cancer patients who were on malignant stages have likely lower life expectancy and less hope childbearing after their treatment. It is possible they are less inclined to look for and benefit from fertility preservation options to store their cryopreserved material. Second, we believe that it is important to view the findings within the context of the cancer type, stage and chemotherapy regimens of the participants, because all the mentioned factors can lead to use or not use the frozen reproductive material and are effective in the participants’ ability to get pregnant naturally (possibly mild chemotherapy which can preserve some of the ovarian reserve). Third, the cancer patients studied were recruited from 1995 to 2014, but as we know Human Fertility and Embryology Authority (HFEA) has given permission to the usage of frozen eggs in United Kingdom (UK) from 2000, Wise J, 2000, and American Society of Reproductive Medicine (ASRM) removed the label of “experimental” from oocyte freezing in 2013,Practice Committees of American Society for Reproductive Medicine., 2013 . So, giving single vision to all frozen materials of participants during this time period maybe is not correct. Earlier, the patients only could enjoy form the cryopreserved embryo and sperm, then ovarian tissue and more recently oocytes. Looking at the table II, the pregnancy achievement is presented as “as a result of ART with stored material” but is not presented separately. It is not clear that all usage of stored material are adequately cryopreserved gametes or embryos or not.<br> Fourth, the essential problem we see is that age can be another confounding factor in this survey. Many of the people who have never tried to get pregnant may be in advanced age, but we do not know the age of those who did not respond or never tried to get pregnant. Reza Omani Samani1, Samira Vesali1* 1 Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran Correspondence address: Department of Epidemiology and Reproductive Health, Royan Institute for Reproductive Biomedicine, Tehran, Iran. E-mail: samiravesali@yahoo.com.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 22, Christian J. Wiedermann commented:

      Comment on “The dose of hydroxyethyl starch 6% 130/0.4 for fluid therapy and the incidence of acute kidney injury after cardiac surgery: A retrospective matched study”

      In a retrospective cohort study (Momeni M, 2017), it was analyzed whether the incidence of acute kidney injury (AKI) in cardiac surgery differed depending on weight-adjusted cumulative doses of 6% hydroxyethyl starch (HES) 130/0.4 for pump priming and/or perioperative fluid therapy. In the absence of any safety study, authors concluded that in cardiac surgery the cumulative dose of modern HES should be kept less than 30 mL/kg.

      From a total of 1564 evaluable patients fulfilling the study`s inclusion criteria, 63 subjects were excluded from analyses because cardiac surgery had been performed without administration of HES. Without a control group (patients not receiving HES excluded), the study was performed on 983 subjects who received a low dose of HES and 518 who were in a high dose HES group. Among these HES-receiving patients, a dose-dependent increase of AKI was observed, thus, confirming in cardiac surgery patients previous observations of dose-dependent nephrotoxicity of HES (Mutter TC, 2013).

      A safe volume of any HES solution has yet to be determined (Mutter TC, 2013, Wiedermann CJ, 2009). Because AKI in response to 6% HES 130/0.4 may be seen at low doses, the authors' conclusions (Momeni M, 2017) that modern HES should be kept at cumulative doses less than 30 mL/kg ignores the fact that in patients not receiving any HES at all, AKI frequency may be even lower than in their low dose group. Thus, the only conclusion should have been that in cardiac surgery, HES-induced nephrotoxicity is dose dependent. The recommendation of using HES doses less than 30 mL/kg carries the risk of increasing AKI. Unless a safe volume is determined, 6% HES 130/0.4 should be avoided in cardiac surgery.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 13, Franz Schelling commented:

      "Without a good understanding of the vascular pathophysiologic factors that influence the patency of ballooned IJVs, it is difficult to perform any meaningful work relating any neurologic condition that may or may not be associated with constricted venous outflow." ... ought not this point given in the papers 'Discussion' be given in its 'Conclusion' part.

      Three questions asides: (1) Wasn't it observed that the muscular IJV entrapments depend widely on (a) head, (b) shoulder position and (c) jaw bracing? with (a) applying first to the sternal head of the sternocleidomastoid, (a)+(b) to the omohyoid, and (c) to the digastric muscle? (2) What about the often observed efficacy of deep inspiration/chest bracing in terms of flow reversals in the left IJV? (3) MRI findings of a severe hypoplasia of the entire J1 length seem preferentially due to its broad clamping between sternal part of the sternocleidomastoid and anterior scalene muscle - a problem which any good ENT surgeon can solve.

      Just some cues which may prove useful for making further advances.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 17, Joel Nitzkin commented:

      I don't think any conclusions can be drawn from this study with regard to softening or hardening without considering the totality of continuing nicotine intake by the various categories of distressed individuals. A new element, not considered by these authors is the development of electronic nicotine delivery systems that can satisfy the urge to smoke for these and other smokers. Pretending that these products do not exist or that these distressed smokers are not utilizing them, or that self-administered nicotine does not provide significant cognitive benefit to these smokers is to blind ourselves to the possibility that these products may offer a new pathway to more substantial reduction in cigarette consumption than has been considered to date.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Oct 17, Peter Hajek commented:

      The data presented here do not support the 'softening' claim. Objective measures of nicotine intake are needed to see if the reduction in number of cigarettes, which is likely to be a response to increased cost of smoking, generated any reduction in nicotine intake. People may or may not smoke the remaining cigarettes with more puffs and deeper inhalations. Regarding the second finding, a history of more failed quit attempts implies hardening rather than softening.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 08, Franz Schelling commented:

      Apologies, my dear compatriots: So much has been said and shown on the role which particular vein length play in the emergence of the cerebral lesions of MS - why not risk a glimpse at http://bit.ly/2hu3g9N - wouldn't be so kind as to tell me what your focusing on direct or metabolically mediated arterial risk factors has been motivated be?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 18, Kenneth J Smith commented:

      The authors agree, of course, that MS lesions predominantly occur around veins, and we make this point in our paper. A purpose of our paper is to provide a deeper understanding of how perivenous lesions can arise due to tissue hypoxia. We make the point that hypoxia in arterial watershed territories will exacerbate the venous influence on lesion genesis.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Oct 22, Franz Schelling commented:

      The fact that the MS lesion patterns observed in the brain do not reflect arterial border zones, the "last meadows" of arterial perfusion, but an unexplained kind of venous impacts has become more and more evident since 1911. In this year, Alexander Bruce for the first time noted the lesion arrangements along tributaries of the internal cerebral veins. And up to the latest MRI studies, the cerebral MS lesions' vascular relationships have consistently spoken not of central lesion arteries but of central lesion veins.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2017 Nov 18, Kenneth J Smith commented:

      The authors agree that it is well established that the grey matter has a higher metabolic rate than the white matter, and this is in accord with the higher vascular density in the grey matter. This fact does not address whether oligodendrocytes are particularly susceptible to tissue hypoxia. There is widespread experience that oligodendrocytes are very vulnerable, although the underlying reasons remain unclear. The location of oligodendrocytes in the white matter accentuates their vulnerability, not only due to the relative paucity of the vasculature, but also because of the propensity of the white matter vasculature to contain relatively deoxygenated blood.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2017 Oct 22, Franz Schelling commented:

      To come closer to the point: Why needs the cerebral grey matter fife to then as much arterial perfusion, oxygen and nutrients than the cerebral white matter? It is the presence of nerve cells as these are present in the grey matter alone. All the other tissue constituents occur in both white and grey matter.

      The far higher density of blood vessels in the grey as against the white brain tissues testifies equally to the higher metabolic demands of the nerve cell containing - and not of the oligodendrocyte rich tissue.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    5. On 2017 Nov 18, Kenneth J Smith commented:

      The authors do not believe they have deepened any misconceptions. First, we make no claims that Dawson’s fingers are identical to arterial border zones. However, the fact that many MS lesions bear a relationship with arterial border zones has been clearly established, not least in the several detailed studies of thousands of lesions that we cite from other groups. Second, we do not claim that oligodendrocytes’ metabolic demands are generally as high as those of neurons. We do claim that oligodendrocytes are particularly vulnerable to hypoxia, and this is the experience of many investigators. We devote a section to this topic in our manuscript.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    6. On 2017 Oct 17, Franz Schelling commented:

      It is a pity this paper deepens two elementary misconceptions: (1) The assumption the MS-specific ventricle-based lesion-formations (Dawson's fingers) were identical with arterial border-zone lesions - as the latter occasionally touch the ventricular border. (2) The opinion, the oligodendrocytes' metabolic demands were generally as high as those of the neurons. Not only the given authors but also the public at large can only be recommended to study the pertinent evidence more carefully so as not to fall prey to easily reiterated mistaken assumptions regarding these pivotal points.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 17, Hiroshi Yao commented:

      Dear Harald HHW Schmidt, Thank you for your comments on our paper (Int J Mol Sci 2017 Oct 11). I was engaged in our paper (PLoS ONE 2015), when the paper by Kleikers et al. was published. So I could not know this paper at that time, and it was my mistake not to pay attention for this paper during the next 2 years; I am sorry for this. I will comment on this paper in the near future using PubMed Commons. Sincerely yours, Hiroshi Yao, M.D.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 23, Thales Batista commented:

      Erratum

      In September/October 2017, the Journal of the Brazilian College of Surgeons (Rev Col Bras Cir. 2017;44(5):530-44) published the original article titled “A proposal of Brazilian Society of Surgical Oncology for standardizing cytoreductive surgery plus hypertermic intraperitoneal chemotherapy procedures in Brazil: pseudomixoma peritonei, appendiceal tumors and malignant peritoneal mesothelioma.” (http://dx.doi.org/10.1590/0100-69912017005016), by Thales Paulo Batista; Bruno José Queiroz Sarmento; Janina Ferreira Loureiro; Andrea Petruzziello; Ademar Lopes; Cassio Cortez Santos; Cláudio de Almeida Quadros; Eduardo Hiroshi Akaishi; Eduardo Zanella Cordeiro1; Felipe José Fernández Coimbra; Gustavo Andreazza Laporte; Leonaldson Santos Castro; Ranyell Matheus Spencer Sobreira Batista; Samuel Aguiar Júnior; Wilson Luiz Costa Júnior; Fábio Oliveira Ferreira; Comitê de Neoplasias Peritoneais e Quimioterapia Intraperitoneal Hipertérmica da Sociedade Brasileira de Cirurgia Oncológica. The following errors were identified:

      Title:

      Reads: “A proposal of Brazilian Society of Surgical Oncology for standardizing cytoreductive surgery plus hypertermic intraperitoneal chemotherapy procedures in Brazil: pseudomixoma peritonei, appendiceal tumors and malignant peritoneal mesothelioma”;

      Should read: “A proposal of Brazilian Society of Surgical Oncology (BSSO/SBCO) for standardizing cytoreductive surgery (CRS) plus hyperthermic intraperitoneal chemotherapy (HIPEC) procedures in Brazil: pseudomixoma peritonei, appendiceal tumors and malignant peritoneal mesothelioma.”.

      Authors:

      Reads: “Thales Paulo Batista; Bruno José Queiroz Sarmento; Janina Ferreira Loureiro; Andrea Petruzziello; Ademar Lopes; Cassio Cortez Santos; Cláudio de Almeida Quadros; Eduardo Hiroshi Akaishi; Eduardo Zanella Cordeiro1; Felipe José Fernández Coimbra; Gustavo Andreazza Laporte; Leonaldson Santos Castro; Ranyell Matheus Spencer Sobreira Batista; Samuel Aguiar Júnior; Wilson Luiz Costa Júnior; Fábio Oliveira Ferreira; Comitê de Neoplasias Peritoneais e Quimioterapia Intraperitoneal Hipertérmica da Sociedade Brasileira de Cirurgia Oncológica”

      Should read: “Thales Paulo Batista; Bruno José Queiroz Sarmento; Janina Ferreira Loureiro; Andrea Petruzziello; Ademar Lopes; Cassio Cortez Santos; Cláudio de Almeida Quadros; Eduardo Hiroshi Akaishi; Eduardo Zanella Cordeiro1; Felipe José Fernández Coimbra; Gustavo Andreazza Laporte; Leonaldson Santos Castro; Ranyell Matheus Spencer Sobreira Batista; Samuel Aguiar Júnior; Wilson Luiz Costa Júnior; Fábio Oliveira Ferreira; on behalf of the BSSO/SBCO Committee on Peritoneal Surface Malignancies and HIPEC”

      Abstract:

      Reads: “hypertermic”

      Should read: “hyperthermic”

      Rev Col Bras Cir. 2017 Nov-Dec;44(6):665. doi: 10.1590/0100-69912017006016. PMID: 29267565 DOI: 10.1590/0100-69912017006016


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 13, John Tucker commented:

      In this article, Dr. Goldstein et. al raise the pressing issue of drug pricing. They conduct several regression analyses to determine the influence of market changes on oncology drug prices, including labeling changes, off-label use, and the approval of competing drugs on cumulative price increases. Most notably, however, the article serves as a vehicle for the price charts shown in Figures 1 and 2, showing cumulative price increases that are asserted to greatly outstrip the BLS Medical Care Consumer Price Index. The implication of these figures is that drug prices have risen even faster than healthcare prices overall, and thus play a unique role in the rapidly rising cost of care.

      Unfortunately, the paper contains several errors that undercut support for this claim. The key figures show a 39% increase in the BLS Medical Care Price Index from 2005 to 2017, but reference to the primary source shows the increase was 49%. The authors appear to have confused the Medical Commodities CPI, which mainly addresses the costs of pharmaceuticals and medical devices, with the more broadly based Medical Care CPI.

      Simultaneously, drug price increases are overstated by reliance on Average Sales Price data from CMS uncorrected for 340B discounts. The 340B program mandates discounts of 30 to 50% to hospitals meeting certain criteria related to providing services to low income population, and now includes approximately 1/3 of U.S. hospitals. The program has grown at double digit per annum rates over the time period covered by the Goldstein analysis. Genentech recently disclosed that 17% of its worldwide drug sales were conducted under 340B contracts, which would be approximately 35% of U.S. sales.

      Correcting for the effects of the 340B program using publicly available data on the size of the program and hospital/clinic drug expenditures, one finds that the great majority of the price increases discussed in the paper fall below the medical inflation rate described by the BLS Medical Services CPI, and most fall below the general inflation rate as well.

      Overall, there is inarguably a pressing need to control healthcare costs in the U.S. To achieve this we need to look at all sectors of spending, and should expect significant sacrifices across the board. Drug prices will be one part of that, but unnecessary and low value care provision, medical salaries, and insurer overhead will surely play an important role as well.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 04, Nilesh Banavali commented:

      The authors use a few different nucleic acid duplex parameters to understand the extent of B-form RNA structure in the 6S RNA variant structural model reported in this article. A different structural analysis based on Root Mean Square Deviation (RMSD) from canonical A-form and B-form single-strand structures can also address the occurrence and extent of local and global B-form structure. A short description of this analysis on the 6S RNA variant structure is posted on bioRxiv at:

      http://biorxiv.org/cgi/content/short/242503v1

      Nilesh Banavali, Research Scientist, Wadsworth Center, New York State Department of Health.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 21, Sudheendra Rao commented:

      Just an addition since KU955594 was not found in the paper. Literature search suggests that the probable zika strain used to detect seropositivity in India back in 1954 was Zika virus/M.mulatta-tc/UGA/1947/MR-766 (KU955594). Supporting literature is here http://www.jimmunol.org/content/jimmunol/72/4/248.full.pdf http://www.jimmunol.org/content/jimmunol/68/4/461.full.pdf http://www.jimmunol.org/content/jimmunol/68/4/441.full.pdf BLAST results indicate 86-89% identity at nucleotide level of Zika virus/M.mulatta-tc/UGA/1947/MR-766 to Indian strains gb|MF173409, gb|MF173410, gb|MF173411 whereas protein identity is patchy ranging from 81-100% in some regions.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 15, Erick H Turner commented:

      Beyond the question of whether unpublished data were used, how were they used?

      This study asks the important question, what proportion of systematic reviews searched for and made use of unpublished data? However, an important follow-up question remains to be addressed: Among those cases in which unpublished data was used, how was it used? Unpublished data can of course address study publication bias, ie. data from unpublished studies can be simply added to data obtained from the published literature. However, unpublished data can also address outcome reporting bias,[1-3] ie. a trial publication conveys that the intervention is safe and/or effective while unpublished data on the same trial tell a different story. For example, in a study of 74 industry-sponsored antidepressants trials,[4] in addition to 23 (31%) unpublished trials, we found 11 (15%) trials with outcome reporting bias. If we had corrected for the former while ignoring the latter, we would have obtained an effect size estimate that was still inflated. Returning to the current study,[5] an informative follow-up would be to look within the cohort of systematic reviews that made use of unpublished data and determine how many used it to verify the published results.

      References:

      1 Kirkham JJ, Dwan KM, Altman DG, et al. The impact of outcome reporting bias in randomised controlled trials on a cohort of systematic reviews. BMJ 2010;340:c365.

      2 Chan A-W, Altman DG. Identifying outcome reporting bias in randomised trials on PubMed: review of publications and survey of authors. BMJ 2005;330:753. doi:10.1136/bmj.38356.424606.8F

      3 Chan A-W, Hróbjartsson A, Haahr MT, et al. Empirical evidence for selective reporting of outcomes in randomized trials: comparison of protocols to published articles. JAMA 2004;291:2457–65. doi:10.1001/jama.291.20.2457

      4 Turner EH, Matthews AM, Linardatos E, et al. Selective publication of antidepressant trials and its influence on apparent efficacy. N Engl J Med 2008;358:252–60. doi:10.1056/NEJMsa065779

      5 Ziai H, Zhang R, Chan A-W, et al. Search for unpublished data by systematic reviewers: an audit. BMJ Open 2017;7:e017737. doi:10.1136/bmjopen-2017-017737


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 06, Rima Obeid commented:

      Oversampling a high risk group and sampling from a hospital setting where kids were born and later treated for autism (a single Center study) strongly suggest a selection bias. Selection bias limits the external validity and generalizability of results from the Boston cohort. Recent metaanalysis and other large studies do not show an association or show even inverse association (example of links below). Moreover, sensitivity analysis is missing in the study by Raghavan et al.<br> https://www.ncbi.nlm.nih.gov/pubmed/29026508 https://www.ncbi.nlm.nih.gov/pubmed/29299606


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Dec 12, M Daniele Fallin commented:

      True! This is an "enriched risk" ASD cohort in that it was over-sampled for pre-term birth, a consistent risk factor for ASD. In a low-risk or general US population, you would expect somewhere between 1 and 2% based on current CDC estimates of 8 year olds, although the prevalence at younger ages, and in diverse ethnic populations (such as this one) is less clear. This enriched risk design makes the study of ASD possible in this birth cohort (enough ASD events), and is a common design in ASD prospective studies - although typically the risk enrichment is due to family history (baby sibling studies).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 09, Franz Schelling commented:

      The paper https://doi.org/10.24019/jtavr.29 addresses only the point of how a one-sided valvular incompetence of the internal jugular veins endangers the brain. It must not be forgotten, though: the blood contained in the jugulars is driven in direction of the brain as often as these veins are impacted upon - but can't empty themselves, quickly enough, in the normal way.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2017 Oct 09, Franz Schelling commented:

      The hemodynamics of the human brain won't ever be understood ... if the intracranial venous anatomy is not contemplated in its natural context with the extracranial venous and perivenous anatomy and especially its functional changes; the position-dependent strictures and at times tempestuous impacts which the cerebral venous passages located outside the skull are exposed to. Rather than in replacing Newtonian principles with statistical ones, we might make progress in coming to terms with the individually given intricacies of venous hemodynamics. Admittedly a tedious task, showing a humbling underdevelopment of venous computational hemodynamics.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2017 Oct 08, Alessandro Rasman commented:

      This study is important in relationship to how lymph from the brain is deposited back into the blood stream, as this occurs at the junction where the jugular valve is located. Lymph, CSF and blood all go thru this area, and if there is reflux or slowed flow, the brain is negatively affected.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 06, Pete Monk commented:

      LHFPL4 is not a member of the tetraspanin family, as defined by HUGO (https://www.genenames.org/cgi-bin/genefamilies/set/768). It is in the LHFPL tetraspan subfamily (https://www.genenames.org/cgi-bin/genefamilies/set/1489) and likely has a very different structure to the tetraspanins. The title is therefore misleading.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 15, Hauke Fürstenwerth commented:

      Blaustein’s attemps to disqualify Vogeser’s studies started with the false assertion that the analytical protocol did not assess the degree of recovery of the extraction step [1]. Now he presents imaginative speculations about unknown compounds and on a low level of noise in Vogeser’s chromatograms. Blaustein’s defamatory accusations are unfounded. They do not change the fact that Ouabain can not be detected in human serum by using state-of-the-art analytical methods. In the e-pub-first version of his article, Blaustein reports that Clin Chim Acta has refused to retract the Vogeser publication, with good reason. In the assessment of experts in analytical chemistry there is no doubt on the validity of Vogeser’s measurements.

      [1] http://hyper.ahajournals.org/content/64/4/680/tab-e-letters


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 13, Mordecai P Blaustein commented:

      Response to Dr. Füerstenwerth:

      The case for a ouabain-Na pump endocrine system has been laid out in [1] and my previous response to Dr. Fürstenwerth. All the original reports are cited so that readers can verify my statements.

      I must, however, refute Fürstenwerth’s false claim that I made an “unfounded accusation of data manipulation” by stating that Baecher et al. [2] “’edited’ their raw data”. Fürstenwerth apparently has not read Vogeser and Baecher’s Letter to the Editor [3] in which they admit that “In… Fig. 2 of our article ([2])… at a retention time (RT)… of… 5.0 min… the trace signal is broken… This inconsistency was introduced by editing the… (mass spectrum) raw data.” They show (Fig. 2, top, in [3]) that they originally (Fig. 2, top, in [2]) edited out an ion current peak at 4.99 min, and they present a second example (Fig. 1, top, in [3]) in which a similar peak is seen at that same RT (4.98 min) (see [4] Data Supplement). They do not mention the other 28 plasma samples they tested [2]; how many of them exhibited the same peak? Why didn’t they show/describe all their data? (The “broken” trace signal in Fig. 2 of [2] is very difficult to see on the original journal page. Dr. Hamlyn suspected that the spectrum was 'unusually flat'. When he enlarged the image he discovered the discontinuity.) We suggest [4] that the ion current peak at the 5.0 min RT, which has the same mass/charge ratio as ouabain, may correspond to the more polar of two ouabain isomers that have previously been described [5, 6]. Other flaws in the Baecher et al. study [2] are discussed elsewhere [1, 4, 7].

      References:

      [1] Blaustein MP, 2018

      [2] Baecher S, 2014

      [3] Vogeser M, 2015

      [4] Hamlyn JM, 2016

      [5] Jacobs BE, 2012

      [6] Hamlyn JM, 2014

      [7] Blaustein MP, 2015


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2018 Jan 12, Hauke Fürstenwerth commented:

      Final response to Dr. Blaustein

      <p>@ 1: yes, S. kombé contains a mixture of steroids, but contrary to Blaustein’s assertion no ouabain. Kirk discovered the effects of k-strophanthin.</p>

      <p>@ 2: yes, inactivating mutation of the mouse alpha-2 Na+ pump ouabain binding site has physiologic consequences. This is no evidence that the endogenous inhibitor of the NaK-pump is ouabain.</p>

      <p>@ 3: unfounded accusation of data manipulation (”edited their raw data”, “scientific misconduct”) does not refute the fact that in various laboratories it has not been possible to detect ouabain in human serum with highly specific analytical methods.</p>

      <p>@ 4: With the admission that ”ouabain can be expected to have both beneficial and … detrimental effects” Blaustein refutes assertions he has made in his article: “ouabain is a key factor in the pathogenesis of hypertension and heart failure" and “ouabain and its receptor site participate in the pathogenesis of hypertension, cardiac hypertrophy and HF“. Provided ouabain is the endogenous inhibitor of the NaK-pump that at low levels has positive but at elevated levels has detrimental effects, then it remains puzzling why infusion of plant derived ouabain (elevating serum concentration!) in clinical practice lowers blood pressure and is life-saving in acute heart failure. (Oh yes, common sense can be annoying.)</p>

      <p>@ 5: With highly specific analytical methods it is not possible to detect “endogenous ouabain”. (Blaustein admits that there is no ”convenient EO assay.”) However, concentrations of plant derived ouabain can be measured even in extreme low concentrations. From such measurements the therapeutic levels of ouabain serum concentrations are known and have been validated by decades of clinical experience. Thus, effective therapeutic dosing of ouabain is a well established procedure.</p>

      <p>@ 6: The sophisticated total syntheses of ouabain are high-lights in synthetic chemistry. These masterpieces allow the preparation of a few mg on laboratory scale, but they are not suited for large scale production of ouabain.</p>

      Finally, I do agree with Blaustein that in science many notions have landed in the trash bin of history. I dare to predict that ”endogenous ouabain” , too, will suffer that fate.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2018 Jan 12, Mordecai P Blaustein commented:

      Response to Dr. Fürstenwerth

      I thank Dr. Fürstenwerth for his comments about my article. His exuberant advocacy for the clinical use of ouabain is refreshingly entertaining. As he states, however, his views are based largely on “applying common sense”; he appears to ignore the experimental method and actual data. (“Common sense” also led to such ideas as, “the earth is flat,” and “the sun revolves around the earth” – notions that landed in the trash bin of history.)

      1. Fürstenwerth correctly asserts that k-strophanthin is the predominant cardenolide extracted from Strophanthus kombé, but this plant produces a mixture of related steroids [1].

      2. He states that the “endogenous ouabain-Na+ pump endocrine system… is… wishful thinking.” Data from multiple laboratories, summarized in my article, demonstrate that an inactivating mutation of the mouse alpha-2 Na+ pump ouabain binding site, or infusion of anti-ouabain antibodies to immuno-neutralize endogenous ouabain (EO) in rats, induces a clear phenotype. This loss of EO-Na+ pump interaction is manifested by specific disturbances of (e.g.) behavior and learning, exercise endurance, fetal development and basal blood pressure. In my view, these data trump Fürstenwerth’s “common sense”.

      3. He claims that “There is no endogenous ouabain.” Has he read (or understood) the articles listed in Table 2A? Rather than relying on “common sense”, I prefer the mass spectra and NMR spectra published by such distinguished chemists/biochemists as Prof. Wilhelm Schoner [2], Prof. Tadashi Inagami [3], and Prof. Koji Nakanishi [4], a member of the National Academy of Sciences USA and one of the world’s leading natural product chemists. Moreover, the very detailed original mass spectroscopy report included all the original, rigorous purification data [5-7]. In contrast, the few investigators who were unable to detect EO (Table 2C) cut methodological corners (see text and [8]) and even “edited” their raw data [9,10] (and see [8]).

      4. Fürstenwerth claims that my review “neglects” the “beneficial” effects of ouabain and “does not discuss (the)... obvious contradictions” that “ouabain lowers blood pressure, (but also) produces hypertension”. His statement is not true. Table 3 shows that mutation (inactivation) of the alpha-2 Na+ pump ouabain binding site elevates basal blood pressure; this implies that EO is normally needed to help keep blood pressure low (i.e., ‘normal’). On the other hand, Yuan et al. [11] were just the first of numerous investigators to show that prolonged, high ouabain levels elevate blood pressure. Like all hormones, ouabain can be expected to have both beneficial and, if greatly elevated for a prolonged period, detrimental effects (see Fig. 4 and pages C14 and C16 of my article).

      5. I do not dispute Fürstenwerth’s assertion that the “decisive factor is the (ouabain) serum concentration”. But, in that case, given the aforementioned data, his opposition to my call for “solid information” about plasma EO/ouabain levels before and during ouabain therapy makes no sense. Drug treatment based simply on “common sense” must give way to effective therapeutic dosing that utilizes all the available scientific information to optimize treatment and patient safety.

      6. Finally, Fürstenwerth states that “production of Strophanthus glycosides is… restricted to collection of wild plants.” This is not true. The complete chemical synthesis of ouabain was achieved by Deslongchamps [12] and a more concise method has now been developed [13].

      In conclusion, as Withering wrote in 1785 [14], “After all, in spite of opinion, prejudice or error, Time will fix the real value upon this discovery, and determine whether I have imposed upon myself and others, or contributed to the benefit of science and mankind”.

      References:

      [1] Jacobs & Hoffman, J Biol Chem 69: 153-163, 1926.

      [2] Schneider R, 1998

      [3] Tamura M, 1994

      [4] Kawamura A, 1999

      [5] Hamlyn JM, 1991

      [6] Ludens JH, 1991

      [7] Mathews WR, 1991

      [8] Hamlyn JM, 2016

      [9] Baecher S, 2014

      [10] Vogeser M, 2015

      [11] Yuan CM, 1993

      [12] Reddy MS, 2009

      [13] Renata H, 2015

      [14] Withering, “An Account of the Foxglove and Some of its Medical Uses”, M. Swinney for G.G.J. and J. Robinson, Birmingham, 1785.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    5. On 2018 Jan 08, Hauke Fürstenwerth commented:

      the mistreated gift from paradise

      In the final version of his article Blaustein again reveals his ignorance of the history of Ouabain and Strophanthus glycosides. It is not true that Ouabain is found in Strophanthus kombé. The glycoside occurring in S. kombé is k-strophanthin. Ouabain is found in both Acokanthera ouabaio and Strophanthus gratus. Herman Thoms isolated the pure glycosides from S. kombé and S. gratus in 1904 and has unambiguously assigned them with the names k- and g-strophanthin [1].

      Based on the work of Thomas Fraser, Burroughs, Wellcome & Co in 1886 introduced a S. kombé extract called "Tincture of Strophanthus". This was sold at seven shillings per ounce. In America, E.R. Squibb and Sons was one of the first suppliers of Strophanthus preparations. Particularly popular was a chocolate coated tablet of a mixture of Digitalis and Strophanthus extracts, which was sold at 16 cents per one hundred pieces [2]. In 1889, Boehringer Mannheim introduced pure k-strophanthin to the market. In cooperation with Albert Fraenkel Boehringer in 1907 introduced a solution of k-strophanthin for intravenous administration under the brand name “Kombetin”.

      In 1904 E. Merck, Darmstadt, commercialized a standardized solution of pure g-strophanthin as "g-Strophanthin crystallisatum after Thoms". In 1906, also Kali-Chemie began marketing a g-strophanthin solution under the trade name “Purostrophan”. In the following years, several suppliers offered Strophanthus glycosides preparations for oral and intravenous use. In contrast to Blaustein's assertion orally administered ouabain products over the decades of their use have been given as standard medication to millions of patients. The database of the German Institute for Medical Documentation and Information records more than 20 orally administered ouabain preparations that were used in Germany after 1950. Decades of clinical experience with dozens of ouabain based preparations (i.e. treatment of millions of patients) can not be disqualified as „anecdotal“.

      Blaustein's core hypothesis is that “ouabain is a key factor in the pathogenesis of hypertension and heart failure". At the same time he states that ouabain is “equipotent to digoxin” and has been used “for acute iv administration in heart failure emergencies“. By applying common sense, it can be ruled out that a substance that has been used successfully for decades as an emergency drug in the treatment of heart failure will cause heart failure. Equally excluded is that ouabain, which in clinical practice lowers blood pressure, produces hypertension. Already Fraser had pointed out that “strophanthin increases the action of the heart without raising blood pressure.” Blaustein does not discuss these obvious contradictions nor does he suggest an explanation. He as well neglects current reports on cardio protection induced by ouabain as well as conclusions by Lijune Liu and co-workers that ouabain can be beneficial to various stages of heart failure.

      Based on all available data it can be ascertained that the mutually exclusive effects of plant derived ouabain and the inhibitor of the Na/K-ATPase observed in mammalian tissues do not support the hypothesis that this inhibitor is identical with ouabain, but favor the interpretation that “endogenous ouabain” is something different. Hence, Blaustein's request to establish "solid information about the normal plasma EO level under a variety of conditions" is unfounded. There is no endogenous ouabain.

      African healers have long recognized the medical value of Strophanthus extracts. The medical application relied on alcoholic decotions made by steeping roots in a fermented, alcoholic beverage. The resulting bitter tasting solution would be taken in small sips over a period of days or weeks [2]. The healers knew that the effect of Strophanthus as a potent plant with both healing and highly toxic capabilities, crucially depends on the method of preparation of the drug. In 1971 this observation found a decisive scientific confirmation. Lindenbaum et al published findings that different batches of digoxin from the same manufacturer resulted in different serum concentrations [3]. This publication and subsequent studies lead to the transformation of the art of galenics from a trial-and-error exercise into a scientific discipline. Contrary to Blaustein's assertion, today we know from progress in pharmacology and galenics that absolute bioavailability is not decisive for the therapeutic effect. The only decisive factor is the serum concentration, which enables a sustained therapeutic effect. This is achieved by a correspondingly optimized galenic formulation of the active substance. Different formulations require different dosages to produce the same serum concentration. This is the explanation for the different concentrations of ouabain preparations cited by Blaustein. Contrary to Blaustein's assertion the therapeutic serum concentrations of ouabain are well known: 0.5 ng/ml in steady-state after iv administration and 0.4-0.9 ng/ml on oral administration of suitable galenic preparations.

      Blaustein argues on the basis of outdated knowledge that does not take into account the effects of galenics. Today drugs such as Aliskiren, whose absorption rate is about 3%, will not be rejected just because the absorption rate is too low. Aliskiren’s therapeutic effects derive from sufficiently high serum concentrations, not from the total amount absorbed. The same is true for drugs like Nisoldipine (5%), Dabigatranetextilat (6.5%), or Ramipril (15%), which have absorption rates comparable to that of ouabain. For ouabain, absorption rates of up to 10% have been measured.

      Blaustein falsely assumes that Ouabain has been withdrawn from the market because there has been a death following intravenous administration. The anecdotal evidence he refers to is a patient with multiple co-morbidities. It is outright medical malpractice to inject 0.75 mg ouabain in such a patient when the standard dose should not exceed 0.25 mg.

      Ouabain preparations are no longer available because no company was willing to fund the required clinical trials. The historical preference of Digitalis glycosides over Strophanthus glycosides is due to two factors. 1. Digitalis glycosides can be produced at low cost on an industrial scale from commercial Digitalis plantations. The production of Strophanthus glycosides is and was restricted to collection of wild plants and is correspondingly expensive. 2. Cardiac glycosides were used with the aim of strengthening the contraction force of the heart muscle. Since digitalis glycosides have a stronger inotropic effect than Strophanthus glycosides, the former were preferred. Additionally, false ideas about the importance of galenics have certainly contributed to the uncertainty of clinicians.

      For the locals in Africa, Strophanthus was poison and remedy in one. In the mythology of the tribe of the Wilé in Upper Volta, this plant was sent from paradise to the earth to heal or punish people according to their merit [4]. Hence, it is an ethical obligation when studying Strophanthus glycosides to apply generally accepted principles in science. Otherwise hubris and personal vanity will hinder finding the truth. Mordecai P. Blaustein breaks with this generally accepted principles in science. He ignores ideas and data that don’t fit his preconceptions and neglects conflicting results that don’t support his hypotheses. Blaustein’s narrative about the construction of an "endogenous ouabain-Na+ pump endocrine system" lacks a necessary critical perspective. It is guided by wishful thinking and not by facts.

      References

      [1] https://link.springer.com/chapter/10.1007/978-3-662-40381-5_7

      [2] Osseo-Asare AD, Bitter roots: the search for healing plants in Africa, The University of Chicago Press, 2014

      [3] Lindenbaum J, 1971

      [4] Leuenberger H, Gesund durch Gift, Deutsche Verlagsanstalt Stuttgart, 1972


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    6. On 2017 Nov 06, Hauke Fürstenwerth commented:

      Are clinical experiences not relevant?<br> In medical research, decisive results are obtained by clinical experiences. Hence, new hypotheses need to be checked for clinical findings and observations. Ouabain and the related Strophanthus glycoside k-strophanthin by default have been used for more than a century to treat heart diseases. Cymarin and convallatoxin have also been used. As early as 1904, a standardized solution of pure ouabain was commercialized by E. Merck, Darmstadt as “g-Strophanthin crystallisatum nach Thoms”. This ouabain solution was used both intravenously [7] and orally administered in the treatment of heart diseases. In 1909, the French physician Henri Vaquez introduced the intravenous application of ouabain (“Ouabain-Arnaud”) in France. In World War I medical personnel in the German army by order of the ambulance corps exclusively used ouabain solutions to treat heart failure [4]. The therapeutic profile and the disease profiles for which the use of Strophanthus glycosides is appropriate are documented in many reports on clinical experiences and have been summarized in numerous reviews, preferably in the German literature [10]. As early as the first half of the 20th century distinguished scientists such as Albert Fraenkel, University of Heidelberg, and Ernst Edens, University of Dusseldorf, have published monographs [8,5] that document in detail the clinical effects of Strophanthus glycosides. In textbooks ouabain has been praised as "the biggest advance in cardiac therapy since Withering in 1785" [6]. Decades of clinical experience with ouabain provide a yardstick by which all research results and hypotheses related to ouabain have to be measured. Observations at the bedside are more meaningful than speculative hypotheses based on experimental research.

      In his article Mordecai P. Blaustein gives no reference to the comprehensive literature on clinical experience with ouabain. Although he concludes from his hypotheses that “ouabain and its receptor site participate in the pathogenesis of hypertension, cardiac hypertrophy and HF“ he does not even mention the fact that ouabain has been used successfully in medical therapy of heart failure.

      Contrary to well-documented positive clinical experience in the treatment of heart disease with ouabain, Blaustein asserts that ouabain damages the cardio-vascular system. He neglects current reports on cardio protection induced by ouabain [13,15,19] as well as conclusions by Lijune Liu and co-workers that ouabain can be beneficial to various stages of heart failure [14]. Blaustein asserts that ouabain raises blood pressure in humans, but at the same time admits that ouabain increases blood pressure only in selected rodents strains, because the susceptibility to ouabain-induced hypertension is genetically-determined. Thus there is no evidence to suggest that ouabain is hypertensinogenic in humans. In clinical experience a reduction of high blood pressure in patients is observed on treatment with ouabain [9].

      Blaustein asserts that in more than two centuries of clinical use of digoxin no hints have been found that digoxin is hypertensinogenic. However, it is common knowledge that Digitalis as well as Strophanthus glycosides in high enough concentration increase blood pressure [1,8]. The effects of cardiac glycosides are very sensitive to the applied dosage. Cardiac glycosides are prototypical examples of hormetic substances [10]. The hormetic nature of ouabain is also observed in the effect on signal transduction. According to the studies quoted by Blaustein in his article, low concentrations of ouabain activate signaling cascades, while high concentrations inhibit them.

      Ouabain has been used in clinical application to treat digitalis intoxication in patients. Corresponding reports are documented as early as 1902. Recent in vitro and in vivo studies confirm this well-known clinical observation [16]. So contrary to Blaustein’s hypothesis that digoxin prevents negative effects of ouabain, in clinical practise ouabain has been shown to prevent damage from digoxin. It is a frequently reported observation that Strophanthus glycosides also work in patients in whom digitalis glycosides have no effect, see for example the publication of the renowned cardiologists Franz Groedel and Bruno Kisch [11].

      The therapeutic effects of k-and g-strophanthin are largely identical, ouabain being slightly more potent than k-strophanthin [8,17]. In a double blind cross-over study Agostoni compared the effects of k-strophanthin and digoxin in 22 patients with advanced congestive heart failure [2]. K-strophanthin improved functional performance while digoxin failed to provide such results. Norepinephrine plasma level at rest was significantly lowered by k-strophanthin but not by digoxin.

      Based on all available data it can be ascertained that the mutually exclusive effects of ouabain and the inhibitor of the Na/K-ATPase observed in mammalian tissues do not support the hypothesis that this inhibitor is identical with ouabain, but favor the interpretation that “endogenous ouabain” is something different.

      Blaustein asserts that Hamlyn identified two ouabain isomers in rodent plasma that are absent from commercial (plant) ouabain. This assertion is not backed by the corresponding Hamlyn publication [12]. Therein Hamlyn reports the presence of several substances in plasma of pregnant rats that show immunoreactivity. Two substances are chromatographically slightly different from ouabain and have different mass spectra. Hamlyn does not provide any data for the elucidation of the chemical structure. The chemical structure of these products is unknown. So it is not justified to claim that these substances are isomers of ouabain.

      Nor does the existence of these unknown compounds in plasma of rats suggest that endogenous ouabain is of animal origin. A comparison of substances found in unpurified plasma with purified ouabain - ie free from impurities - is meaningless. Provided that these substances will be identified by structural analysis as isomers of ouabain then it still has to be examined whether these substances are also found in Strophanthus or Acokanthera extracts.

      References

      [1] Abelmann WH, 1973<br> [2] Agostoni PG, 1994<br> [4] https://sites.google.com/a/aryapa.faith/iosifpravin/albert-fraenkel-ein-arztleben-in-licht-und-schatten-1864-1938-reihe-ecomed-biographien-3609162600

      [5] Edens E, Die Digitalisbehandlung [Digitalis treatment] , Third edition, Berlin-München, Verlag Urban&Schwarzenberg, 1948

      [6] Eichholtz F, Lehrbuch der Pharmakologie [Textbook of Pharmacology], fifth edition, Berlin und Heidelberg, Springer Verlag, 1947.

      [7] Fleischmann P, Wjasmensky H. Ü̈ber intravenöse Strophanthintherapie bei Verwendung von gratus-Strophanthinum crystallisatum Thoms. Deutsche Medizinische Wochenschrift 35: 918–921, 1909

      [8] https://books.google.de/books?id=iq-kBgAAQBAJ&printsec=frontcover&hl=de&source=gbs_ge_summary_r&cad=0#v=onepage&q&f=false

      [9] https://doi.org/10.9734/BJMMR/2015/17042

      [10] Fürstenwerth H, 2016

      [11] https://doi.org/10.1016/S0025-7125(16)36725-6

      [12] Jacobs BE, 2012

      [13] Lagerstrom CF, 1988

      [14] Liu L, 2016

      [15] Morgan EE, 2010

      [16] Nesher M, 2010

      [17] PFEIFER E, 1960

      [19] Wu J, 2015


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 06, Stuart RAY commented:

      This is a meta-analysis that attempts to correlate mercury exposure with autism spectrum disorders. On page 296 of this report, in the Discussion section, the authors note this first among the limitations of their study: "The major problem with case-control studies is the temporal relationship between exposure and outcome. It is possible, for example, that older children with ASD may exhibit more mouthing behavior than healthy controls, leading to increased levels of mercury (and other pollutants) in their biological tissues." Given this (valid) limitation, the primary conclusion appears to be highly questionable.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 02, Federico Cabitza commented:

      The Limits of Mind: Extended by Computers, or just distanced from sight?

      In their Perspective [1] (Obermeyer Z, 2017), Obermeyer and Lee claim that computers, ”far from being the problem [of the increasing complexity of contemporary medicine], are the solution” and suggest that, as the inadequacy of “our inborn sensorium” spurred the development of “stethoscopes, electrocardiograms, and radiographs”, likewise the inadequacy of our “inborn cognition” motivates an analogous augmentation by computers.

      However, the mentioned sensorial augmentation amplifies subtle clinical signs offering them at the physicians’ interpretation, while computers would augment cognition in terms of mere textual categories and numerical data, thus often shortcutting intuition, dispelling uncertainty [2] (Simpkin AL, 2016) from clinical reasoning and worse yet potentially biasing interpretation [3] (Goddard K, 2012).

      Understating the irreducible gap between the discreteness of data and the continuous (and partly ineffable) experience of illness in physicians regards the “demise of context” we highlighted [4] when physicians overrely on computer outputs (Cabitza F, 2017).

      While the computers’ potential for pattern recognition in diagnostic imaging is indisputable, the complexity of more clinical applications has so far been irksome to master [5].

      This suggests prudence before entrusting the “future of medicine” to a wider digitization, which can entail unintended bottlenecks.

      Federico Cabitza, PhD; Camilla Alderighi, MD; Raffaele Rasoini, MD;

      1. Obermeyer Z, Lee TH. Lost in Thought — The Limits of the Human Mind and the Future of Medicine. NEJM 2017; 377:1209-1211
      
      2. Simpkin AL, Schwartzstein RM. Tolerating uncertainty—the next medical revolution? NEJM 2016; 375(18): 1713-1715.
      
      3. Goddard K, Roudsari A, Wyatt JC. Automation bias: a systematic review of frequency, effect mediators, and mitigators. JAMIA. 2011;19(1):121-7.
      
      4. Cabitza F, Rasoini R, Gensini GF. Unintended Consequences of Machine Learning in Medicine. JAMA 2017; 318(6): 517–518
      
      5. Ross C, Swetlitz I. IBM Pitched Its Watson Supercomputer as a Revolution in Cancer Care. It's Nowhere Close. Scientific American, 6 september 2017.
      


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 02, Peter Rogan commented:

      We would like to alert readers to the fact that information theory-based splicing mutation analysis has been used to analyze a wide range of variants (in/dels and SNVs) that affect splicing in introns and exons in peer reviewed studies. These tools have been used analyze mutations that alter branchpoint recognition and within introns in peer reviewed studies. The Automated Splice Site and Exon Definition Analysis server, ASSEDA (Mucaki EJ, 2013) analyzes mutations at branchpoints, within intronic sequences, at cryptic splice sites, and at splicing regulatory protein binding sites ("enhancer/silencer" sequences). We have also published the Shannon pipeline (Shirley BC, 2013), which carries out mutation analysis affecting splicing (and transcription factor binding sites; Lu R, 2017) on a genome scale. Veridical is software validates splicing mutations found with the Shannon pipeline (or any other program) with RNASeq data from the same individual (Viner C, 2014, Dorman SN, 2014).

      Our previous review article extensively describes the use of these tools for splicing mutation analysis by many other research groups, besides ourselves (Caminsky N, 2014).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Sep 28, Tanai Cardona commented:

      I had a look at my dataset of D1 sequences from Cyanobacteria. You may find interesting that Ala87 is not unique to plants and actually is a trait of early-evolving atypical D1 sequences (rogue and super-rogue) and also of standard D1 forms of early evolving cyanobacteria, like the marine yellowstone Synechococcus (Ja-3-3Ab) or Synechococcus sp. PCC 7336. It is kind of cool because in my 2015 Mol Biol Evol paper, the plant D1 clustered with this early evolving cyanos.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Sep 25, Tony Larkman commented:

      The title of this report 'Case of methaemoglobinaemia caused by tree oils and kerosene' is misleading because it appears to blame tea tree oil and/or kerosene for the symptoms reported. Apart from the 15% tea tree oil and 20% kerosene in the rat poison the product also contained 40% Neem (azadirachtin) oil and 25% pine oil. These products, which were not mentioned in the title, both contain terpenes and other potentially poisonous compounds when ingested.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 12, Jonathan Eisen commented:

      I believe the claims regarding "beneficial" organisms in this paper are inaccurate and misleading. For example, consider statement in the abstract:

      "While the vast majority of microbial species classified were beneficial"

      No evidence is presented anywhere in the paper that the microbes they identify via sequence analysis are beneficial in any way. I engaged in a Twitter discussion with the senior author of this paper, Chris Mason, about this topic where we discussed my concerns. Details of this discussion are here: https://phylogenomics.blogspot.com/2017/11/flaws-in-prediction-of-presence-of.html

      As far as I can tell from this discussion and from the paper, the authors considered all organisms that were not specifically assigned to be a putative pathogen to be beneficial.

      This is simply a flawed approach.

      First, just because they are not assigned to be putative pathogenic does not mean that they are not pathogenic.

      Second, this ignores the possibility that microbes could have no effect. That is, some could be parasitic, some could be beneficial, and some could have no effect - what was the no effect category ignored?

      Third, the DNA could be coming from dead organisms that presumably would not have any significant effects.

      Overall, I believe this paper's claims regarding "beneficial" microbes are inappropriate and misleading.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.