7,461 Matching Annotations
  1. Jul 2019
  2. Jun 2019
    1. The a-PMB chain was subjected to acid-acetone treatment to separate the heme from the a globin. Briefly, a solution of concentrated a-PMB chain (5 ml; 30 mg/ml) was added dropwise to I 00 ml of thoroughly chilled acid-acetone solution (0.5% v/v HCI in acetone) with constant shaking, and then incubated at -20°C for 30 min to allow complete precipitation of the globin. The precipitated globin was isolated by centrifugation at 7000 rpm (4°C) for 15 min and the supernatant containing soluble heme was discarded
  3. May 2019
    1. enginethatistheproblembut,rather,theusersofsearchengineswhoare.Itsuggeststhatwhatismostpopularissimplywhatrisestothetopofthesearchpile
      • I wanted to highlight the previous sentence as well, but for some reason it wouldn't let me*

      I understand why the author is troubled by the campaign's opinion of "It's not the search engines fault". It makes it seem as if there was nothing that could be done to stop promoting those ideas, and that if something is popular it will just have to be the result at the top.

      This can be problematic, as people who were not initially searching that specific phrase may click through to read racist, sexist, homophobic, or biased information (to just name a few) that perpetuates inaccuracies and negative stereotypes. It provides easier access into dangerous thinking built on the foundations of racism, sexism, etc.

      If the algorithms are changed or monitored to remove those negative searches, the people exposed to those ideas would decrease, which could help tear down the extreme communities that can build up from them.

      While I do understand this view, I also think that system can be helpful too. All the search engine does is reflect the most popular searches, and if negative ideals are what people are searching, then we can become aware and direct their paths to more educational and unbiased sources. It could be interesting to see what would happen if someone clicked on a link that said "Women belong in the kitchen", that led them to results that spoke about equality and feminism.

    1. 'Sam!' he called. 'Pippin! Merry! Come along! Why don't you keep up?'10There was no answer. Fear took him, and he ran back. As he struggled on he called again, and kept on calling more and more frantically. He was weary, sweating and yet chilled. It was wholly dark.'Where are you?' he cried out miserably.There was no reply. He stood listening. He was suddenly aware that it was getting very cold, and that up here a wind was beginning to blow, an icy wind. A change was coming in the weather. The mist was flowing past him in shreds and tatters. His breath was smok­ing.11 He looked up and saw with surprise that faint stars were ap­pearing overhead amid the strands of hurrying cloud and fog. Oat of the east the biting wind was blowing.'Where are you?' he cried again, both angry and afraid.'Here!' said a voice, deep and cold, that seemed to come out of the ground. 'I am waiting for you!''No!' said Frodo; but he did not run away. His knees gave,12 and he fell on the ground. Nothing happened, and there was no sound. Trembling he looked up in time to see a tall dark figure like a shadow against the stars. It leaned over him. He thought there were two eyes, very cold though lit with a pale light that seemed to come from some remote distance. Then a grip stronger and colder than iron seized him. The icy touch froze his bones, and he remembered no more.When he came to himself again, for a moment he could recall nothing except a sense of dread. Then suddenly he knew that he was imprisoned, caught hopelessly; he was in a barrow. A Barrow-wight had taken him, and he was probably already under the dreadful spells of the Barrow-wights about which whispered tales spoke. Hedared not move, but lay as he found himself: flat on his back upon a cold stone with his hands on his breast.As he lay there, thinking and getting a hold on himself, he no­ticed all at once that the darkness was slowly giving way:13 a pale greenish light was growing round him. He turned, and there in the cold glow he saw lying beside him Sam, Pippin, and Merry.There was a loud rumbling sound, as of stones rolling and fal­ling, and suddenly light streamed in. A low door-like opening appeared at the end of the chamber beyond Frodo's feet; and there was Tom's head against the light of the sun rising red behind him.'Come, friend Frodo!' said Tom. 'Let us get out on to the clean grass! You must help me bear them.' Together they carried out Merry, Pippin and Sam. To Frodo's great joy the hobbits stirred, robbed their eyes, and then suddenly sprang up. They looked about in amazement. 'What in the name of wonder?14 began Merry. 'Where did you get to, Frodo?''I thought that I was lost', said Frodo; 'but I don't want to speak of it.' But Tom shook his head, saying: 'Be glad, my merry friends, and let the warm sunlight heat now heart and limb! Cast off these cold rags! Run naked on the grass!'
    1. A stock solution of xylose (1 mg mL-1) was prepared in distilled water. A dilution series ranging from 100-1000 μg mL-1 was prepared from the stock solution. To 1 mL of solution, 1mL of DNSA was added and kept in a boiling water bath for 10 min and then 400 μL of sodium potassium tartrate solution was added and kept it for cooling. The absorbance was recorded in a spectrophotometer (Shimadzu, UV-VIS) at 540 nm
    2. Transformation of calcium-competent cells was carried out by the procedure detailed below: •The competent bacterial cells were thawed briefly and 200 μL of cells was mixed rapidly with plasmid DNA (10-50 ng) in fresh, sterile microcentrifuge tubes and maintained on ice for 30 min. A negative control with competent cells only (no added DNA) was also included. •Cell membranes were disrupted by subjecting cells to heat-pulse (42 °C) for 90 sec. •After heat shock, cells were incubated on ice for 5 min. •Cells were then mixed with 1 mL LB medium and incubated with shaking at 37 °C for 1 h. •For blue/white screening 40 μL of X-gal solution (20 mg mL-1 in dimethylformamide) and 4 μL of the IPTG (200 mg mL-1) was spread on LB-ampicillin (LB-amp) plates with a sterile glass rod. The plate was allowed to dry for 1h at 37 °C prior to spreading of bacterial cells. •Bacterial cells (100-200 μL) were spread and the plate was incubated at 37 °C for overnight. •White colonies were picked from the plates and suspended into LB-amp broth and cultivated to OD600=0.5
    3. PurifiedDNA fragments of size 2-8 kb were ligated to the treated vector using a 1:3::vector :insert ratio in a volume of 10 μL. The total amount of DNA was about 0.5 μg. Vector and insert DNA was heated to 45 °C for 10 min and the immediately chilled on ice for 5 min prior to addition of ligase and buffer. T4 DNA ligase (NEB, England) was added to a final concentration of 0.125 UμL-1 and reactions were incubated at 16 °C for overnight in a ligation chamber. Reaction mixture incubated under same condition without addition of the enzyme was used as control. A ligation reaction was also set up under condition with linear plasmid DNA containing the
    4. In order to minimize self ligation of vector during cloning experiments, the digested DNA was subsequently treated with calf intestinal phosphatase (CIP) [NEB, UK]. The reaction conditions and amount of CIP were optimized and varied from (0.06-1) unit/picomole DNA termini. The dephosphorylation reaction was carried out in 50 μL reaction as follows. Reaction mixture containing no restriction enzyme was treated as control. Reaction was incubated for 1 h at 37 °C and stopped by heat inactivation at 65 °C for 20 min. 2.5.5. Composition of restriction mixture (50 μL) Linearized Plasmid DNA X μL (1 μg) CIP 1 μL (0.06-1 U μL-1) Reaction buffer (10X) 5.0 μL Distilled water Y μL Total volume 50 μL Linearized and dephosphorylated plasmids from each reaction were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany). 100 ng DNA from each reaction was then ligated in15 μL reaction volume containing 1.5 μL of 10X ligation buffer (NEB, England) and 0.2 μL of T4 DNA ligase to check the efficiency of self ligation after dephosphoryaltion. The ligation mixture was incubated at 16 °C for overnight and transformed into E. coli DH5αcompetent cells.
    5. The vector isolated as above was digested with BamHI to generate the cohesive ends. The reaction was performed in 1.5 mL Eppendorf tubes as described below. Composition of restriction mixture (100 μL) Plasmid DNA X μL (20 μg) Bam HI 8 μL (10 U μL-1) NEB buffer 4 10.0 μL BSA (100X) 1 μL MQ water Y μL The reaction mixture was incubated at 37 °C for 3 h. The digestion was stopped by heat inactivation at 65 °C for 20 min. The digestion of plasmid was checked using 1.2 % (w/v) agarose gel electrophoresis for linearization of the plasmid. The digested plasmid was purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany).
    6. Two hundred μL of alkaline-SDS solution was added to the above suspension, mixed by inverting the tubes up and down 3 times and incubated for 5 min at room temperature. ƒTo the above mixture, 250 μL of 3 M Na-acetate (pH 4.8) was added, mixed by inverting the tubes up and down 3 times, and centrifuged at 12,000 x g for 10 min. ƒThe supernatant was collected in another micro centrifuge tube (MCT), 200 μL of phenol:chloroform solution was added, inverted two times and centrifuged at 12, 000 x g for 8 min at room temperature. ƒThe aqueous phase was transferred to new tubes and 500 μL of chilled (-20 °C) ethanol (96 %) was added. ƒThe tubes were centrifuged at 13,000 x g for 25 min at 4 °C, supernatant discarded and pellet dried for 15 min at room temperature. ƒThe pellet was washed with 500 μL of chilled 70 % (v/v) ethanol and centrifuged at 13, 000 rpm for 4 min at 4 °C. ƒThe pellet was dried at room temperature and dissolved in 50 μL of 1X TE buffer (pH 8.0) containing RNase and stored at -20 °C till further use.
    7. The cells of E. coli DH10B having p18GFP vector were cultivated for overnight at 37 °C in LB medium containing ampicillin (100 μg mL-1). ƒThe E. coli culture having p18 GFP vector (~1.5 mL) was taken in Eppendorf tubes and centrifuged at 10, 000 x g for 5 min. ƒThe pellet was homogenized by vortex mixing in 100 μL of homogenizing solution
    8. The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)
    9. An attempt was made to study the effect of storage of DNA extracts on DNA yield and purity. The DNA extracts were centrifuged and the supernatants were dispensed into 2.0 mL Eppendorf tubes and stored at -20 oC for a month. DNA precipitation and its quantification were carried out at a week intervals.
    10. The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.
    11. Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.
    12. Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min
    1. cycles at 94°C for 30 s, 45°C for 30 s, 68°C for 2 min and final extension at 72°C for 10 min (see table 3.1). PCR products were cloned in pGEM-T easy vector (Promega) and the sequence for the cloned PfCDPK4 gene was obtained by automated DNA sequencing
    2. To obtain PfCDPK4 gene sequence, BLAST search was done usmg either i TgCDPK1 or the published sequence of other CDPKs in the P. Jalciparum genome sequence. An ORF on chromosome 7 exhibited significant sequence homology with other PfCDPKs. Subsequently, PlasmoDB annotation appeared in the public domain and the gene sequence PF07 _0072 matched with the PfCDPK4 sequence! identified by us. For PCR amplification, primers were designed on the basis of' nucleotide sequence of PFb7 _0072. Total RNA from asynchronous P. Jalciparum, cultures was isolated using RNA easy Kit (Qiagen, Germany) and was used to' synthesize cDNA for reverse transcription (RT). Both complimentary and genomic DNA were used as template.
    3. For cryopreservation of P, Jalciparum cultures, mostly ring stage parasites at a high parasitemia were obtained. The parasites were pelleted by centrifugation at 200 g for 5 min with minimum de-acceleration. To the pellet, 1.5 volume of the freezing solution (list I) was added drop-by-drop, while shaking the vial gently; the ad4ition was completed in ~ 1 min. The medium was then transferred into a sterile cryovial, which was stored in ~he liquid nitrogen tank
    1. sodium sulphate, filtered and concentrated. The product was reconstituted in methanol and desalted using LH-20 sephadex column. The identity of the aldehyde was confirmed by TOF-MS and tandem mass spectrometric analysis using ESI-MS (API QST AR Pulsar i MSIMS, Applied Biosystems). Purification of peptide was performed using RP-HPLC. The aldehyde could be resolved from other impurities (including traces of alcohol, valeryl-FTAAlaninol) on Cl8 RP-HPLC column (7.8 x 300 mm, 125A, Waters) using a gradient of 0-48% B in 20 mins, 48% B in 40 mins and 90%B in 50 mins (A: water with 0.1% TF A and B: acetonitrile with 0.1% TF A) using a flow rate of 2 mllmin. The elution profile was monitored at 220 nm and the identity of the aldehyde was confirmed by mass spectrometric analysis
    2. The aldehyde valery I-L-Phe-L-Thr-L-Ala-L-Alaninal (valery!-FT AAlaninal) was synthesized by Fmoc-solid phase solid phase chemistry using the Weinreb AM resin (Novabiochem, 0.63 mM/g) and automated peptide synthesizer (Advanced Chemtech. USA). Fmoc protecting groups of amino acids were removed by 20% piperidine in double distilled dimethyl formamide (DMF). A fourfold excess of respective amino acids were preactivated using HoBt (2 equivalents) in DMF and the coupling was catalyzed by diisopropylcarbodiimide (DIPCDI, 2 equivalents). After synthesis resin was dried with dichloromethane/DCM (3 X) and MeOH (3 X). The Thr side chain protecting group (tertiary butyl) was removed by treatment with 60:40, TF A: DCM, twice. The filtrates were discarded and resin was washed with DCM (3 X) and MeOH (3 X). The dried resin was suspended in tetrahydrofuran (3 ml) in a glass reaction flask (25 ml) under nitrogen, swelled with gentle stirring for 1 h, and then cooled to 0 °C. Cleavage of the peptide aldehyde from the resin was performed by adding lithium aluminium hydride (Aldrich. 2 M equivalents dissolved in THF) drop wise for 30 min at 0°C with constant stirring. The reaction was quenched with careful addition of KHS04 (saturated solution) and stirred until the solution reached room temperature. The resin was then filtered off and washed with DCM (3 X) and MeOH (3 X). The filtrate was treated with sodium potassium tartrate (saturated solution) and organic layer was extracted. This organic layer was dried over
    1. released from the para-ovarian pad of fat as well as from the peritoneal reflections while care was taken to avoid injury to the ovarian vessels. A ligature was tied around the distal end of the fallopian tube including the ovarian vessels following which the ovary was excised. Hemostasis was secured before the stump of the tube was pushed back into the peritoneal cavity. The peritoneum was closed by continuous sutures using 2-0 silk. The same protocol was followed to perform oophorectomy on the contralateral side. The muscular layer and skin were closed together using surgical clips
    2. The anesthetized mice were operated under strict aseptic conditions inside a laminar flow hood. The mouse was placed over layers of sterile tissue paper and the skin overlying the dorsal flanks was sterilized by wiping with 70% ethanol. The flank was palpated gently to identify the kidney, and an incision(~ 5 mm) was made using a pair of scissors on the overlying skin which penetrated the skin, sub-cutaneous tissue and the muscle layer with the parietal peritoneum being exposed and intact. The para-ovarian pad of fat was identified through the intact peritoneum and a small incision was made on the peritoneum overlying it. The ovarian tissue along with the fallopian tube was mobilized and delivered through the incision site. The ovary was
    3. Leishmania major strain (MHOM/Su73/5ASKH) was a kind gift from Dr. Satyajit Rath, Immunobiology Laboratory, National Institute of Immunology, India. L.major promastigotes were cultured at 23°C in modified DMEM (DMEM (1 L) supplemented with sodium bicarbonate (3.7 g), HEPES (5.96 g), hemin (5 mg), biotin (1 mg), adenine (13.36 mg), xanthine (7.6 mg), triethanolamine (0.5 mL), and tween 80 (40 mg)) supplemented with 10% FCS. It is known that long term culture of L.major promastigotes results in loss of their virulence (2). Hence, to maintain the virulence of these parasites, they were propagated in mice footpad. Towards this end, the stationary phase L.major promastigotes were resuspended in Hank's balanced salt solution and 2x106 promastigotes were injected into the footpad of female BALB/c mice. 6 weeks post-infection, the infected footpad was dissected and the lesion harvested. The obtained lesion was minced and resuspended in modified DMEM supplemented with 10% FCS and placed in 23°C incubator to allow differentiation of intracellular amastigotes to promastigotes. This cycle of harvesting promastigotes from footpad lesions was performed every 6 weeks to maintain the virulent phenotype of this parasite
    1. simultaneously uses all symmetry operators, resulting in a single peak with an improved signal-to-noise ratio which directly gives the position of the model in the unit cell. In addition, the TF is coupled with a PF to remove false maxima which correspond to interpenetrating molecules. Both the TF and PF allow the incorporation of a second model already placed in the cell. The TF solution may be subjected to rigid-body refinement incorporated in MOLREP. Non crystallographic symmetry may be imposed on the model in order to restrain the refinement. Pseudo-translation is automatically detected from analysis of the Patterson map. A significant off-origin peak gives the pseudo-translation vector, which is used to modify structure factors in the TF calculation (Navaza et al., 1998). In MOLREP multiple copies of the macromolecule in the unit cell can be searched (Vagin, 2000).
    2. MOLREP is an automated program for molecular replacement that utilizes a number of original approaches to rotational and translational search and data preparation. MOLREP can perform a variety of tasks that require rotational and/or positional search: standard MR, multi-copy search, fitting a model into electron density, heavy-atom search and model superposition. The arsenal of rotation (RF) and translation (TF) functions includes self-RF, cross-RF, locked cross-RF, phased RF, full-symmetry TF, phased TF, spherically averaged phased TF and packing function (PF).The program is general for all space groups. The output of the program is a PDB file with the atomic model ready for refinement and a text file with details of the calculations. The rotational search is performed using the RF of (Crowther, 1972), which utilizes the fast Fourier transform (FFT) technique. The default radius of the integration sphere is derived from the size of the search model and is usually two times larger than the radius of gyration. The RF solutions are refined prior to positional search using a rigid-body technique. The refinement is performed in space group PI and the outcome is evaluated by the correlation coefficient. It
    3. merging data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. Finally, truncate program was used to obtain structure factor or amplitudes from averaged intensities (output from SCALA, or SCALEPACK) and write a file containing mean amplitudes and the original intensities. If anomalous data is present then F(+), F(-), with the anomalous difference, plus I(+) and 1(-) are also written out. The amplitudes are put on an approximate absolute scale using the scale factor taken from a Wilson plot. For all the Fab-peptide complexes and unliganded Fab of BBE6.12H3 antibody, the diffraction data were collected and processed using MOSFLM and subsequently merged using SCALA. For all the Fab-peptide complexes of 36-65 Fab, the diffraction data were collected and processed using DENZO and subsequently merged using SCALEPACK. The cell dimensions and space groups were unambiguously determined for each crystal. The solvent content and Matthews's constant were calculated (Matthews, 1968). The merged and scaled intensities were used for structure determination.
    4. parameters using the whole data set. It is also used for merging different data sets and carrying out statistical analysis of the measurements related by space group symmetry. SCALEPACK also provides the detailed analysis of the merged data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. MOSFLM is a package of programs with an integrated graphical user interface for processing data collected on any detectors. The programs cover all aspects of data reduction starting from the crystallographic pattern recorded on an image to the final intensities of observed reflections. In MOSFLM this entire process of integration of diffraction images is subdivided into three steps. The first is the determination of the crystal parameters, in particular the crystal lattice (unit cell) and its orientation relative to a laboratory axial system (usually based on the X-ray beam direction and the rotation axis)_ This is usually referred to as autoindexing. Knowledge of these parameters then allows an initial estimate of the crystal mosaicity. The second step is the determination of accurate unit-cell parameters, using a procedure known as post-refinement. This requires the integration of one or more segments of data with a few images in each segment. The final step is the integration of the entire set of diffraction images, while simultaneously refining parameters associated with both the crystal and the detector. After integration of the data, next step is to scale and merge the data set. Scaling and merging are done with the program SCALA. This program scales together multiple observations of reflections, and merges multiple observations into an average intensity. The merging algorithm analyses the data for outliers, and gives detailed analyses. It generates a weighted mean of the observations of the same reflection, after rejecting the out:iers. SCALA also provides the detailed analysis of
    5. therefore only partially recorded on any individual image. For each predicted reflection, the background-subtracted diffracted intensity must be estimated. Although straightforward in principle, defects and limitations in both the sample (the crystal) and the detector can make this difficult in practice. Complicating factors include crystal splitting, anisotropic and/or very weak diffraction, high mosaicity, diffuse scattering, the presence of ice rings or spots, unresolved or overloaded spots, noise arising from cosmic rays or zingers, backstop shadows, detector blemishes, radiation damage and spatial distortion. These experimental factors will be important in determining the final quality of a data set. The HKL2000 (Otwinowski, 1997) is GUI based suite of programs for the analysis of X-ray diffraction data collected from single crystals. The package consists of three programs: DENZO, XDISPLA YF and SCALEPACK. HKL is the program that converts the raw X-ray diffraction data, collected from an image plate and reduces it to a file containing the hkl indices, intensities of the spots on the image plate along with estimates of errors involved. DENZO initially performs peak searching. The autoindexing algorithm carries out complete search of all the possible indices of the reflections picked by peak search using a fast Fourier transformation (FFT) software module. After search for real space vectors is completed, the program finds the three best linearly independent vectors, with a minimal unit cell volume, that would index all of the observed peaks. After refining the initial cell dimensions and detector parameters, the determined values are applied to the rest of the frames and the parameters are refined for each frame. The diffraction maxima are also integrated by DENZO_ The program XDISPLA YF (W., 1993) enables visualization of the peak search and processing procedures. SCALEPACK finds the relative scale factors between frames and carries out precise refinement of crystal
    6. The collection of macromolecular diffraction data has undergone dramatic advances during the last 20 years with the advent of two-dimensional area detectors such as image plates and CCDs, crystal cryocooling and the availability of intense, monochromatic and highly collimated X-ray beams from synchrotron sources. These technical developments have been accompanied by significant advances in the software used to process the resulting diffraction images. In particular, autoindexing procedures have improved the ease of data processing to the point that in many cases it can be carried out automatically without any user intervention. However, the procedure used to collect the diffraction images, the screenless rotation method, has remained essentially unchanged since it was first suggested for macromolecular crystals by Xuong et al. (Nguyen-huu-Xuong, 1968) and by Arndt and coworkers and popularized by the availability of the Arndt-Wonacott oscillation camera (Arndt, 1977; U. W. Arndt, 1973). In this procedure, each diffraction image is collected while rotating the crystal by a small angle (typically between 0.2 and 2°) about a fixed axis (often referred to as the cpaxis). The only development of the method has been the use of very small rotation angles per image (the so-called fine cp-slicing technique) to provide improved signal to noise for weakly diffracting samples. Since, virtually all macromolecular diffraction data are collected in this way (with the exception of data collected using the Laue technique). The starting point for data integration will therefore be a series of such diffraction images and the desired outcome is a data set consisting of the Miller indices (hk/) of all reflections recorded on these images together with an estimate of the diffracted intensities I(hkl) and their standard uncertainties al(hkl). This requires the prediction of which reflections occur on each image and also the precise position of each reflection on each image (note that typically most reflections will be present on several adjacent images and
    7. Fab purification from the digestion mixture was carried out by ion-exchange chromatography using SPW-DEAE (60xl50 mm) column on a Waters3000 preparative HPLC (Waters, USA). In:tially, a blank run was carried out thereafter the column was allowed tore-equilibrate with the wash buffer (10 mM Tris-Cl, pH 8.0). A salt gradient of 0 to 0.2 M NaCI over a period of 120 minutes was used to elute the Fab. An aliquot from all the collected fractions were precipitated by using chilled acetone and were analyzed on a SDS-PAGE gel to ascertain which fraction corresponds to Fab. Fab, which has low or zero net negative charge at pH 8.0, was eluted out as the first major peak early in the gradient. The Fe portion and any undigested IgG which have a higher net negative charge at pH 8.0 would elute out later in the gradient. The Fab fractions collected from various HPLC runs for both the antibodies were pooled, concentrated and dialyzed against their respective crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide and SOmM Tris-Cl pH 7.1, 0.05% sodium azide).
    8. band has completely disappeared and only the 25 kDa doublet is clearly visible. Optimal w/w ratios of protein/enzyme and time of incubation were ascertained and preparative digestions were carried out using 20-50 mgs of IgG. The digestion mixture was then dialyzed against 10 mM Tris-Cl, pH 8.0 for Fab purification.
    9. The concentration of the purified IgG was estimated usmg micro bicinchoninic acid (BCA) method of protein estimation (Micro BCA Protein Assay Kit , Pierce). To ascertain the optimal ratio of IgG to papain and time of incubation for proteolytic fragmentation of the antibody, an initial analytical digestion was carried out. 1 mg/ml solution of papain (Sigma, St. Louis, USA) was first pre-activated using rJ-mercaptoethanol (2.0m\1) for one hour. The reaction mixtures for digestion constituted 400 J.lg of IgG, rJ-mercaptoethanol (2.0mM) and EDTA (2.0mM) appropriate volumes of the activated papain solution were added so as to obtain various ratios of lgG:papain. The digestion reaction was monitored for 10 hours and 20 Ill aliquots were collected every hour. The proteolysis reaction was stopped with addition of 75 mM iodoacetamide and all the aliquots were analyzed on reducing SDS-PAGE. Initially the lgG appears as two bands, one at 50 kDa and the other at 25 kDa, corresponding to the heavy and light chains, respectively. The intensity of the 50 kDa band decreases and instead, a doublet starts appearing at 25 kDa as the reaction proceeds. The Fe portion may or may not be visible as a band just above the 25 kDa doublet. The digestion is deemed complete when the 50 kDa
    10. solution was injected into the HPLC. A salt gradient of 0 to 0.2 M NaCl over a period of 120 minutes was run and fractions for each peak, as detected by measurement of UV absorbance at 220nm, were collected. An aliquot of each fraction was subjected to acetone precipitation and the obtained precipitate was analyzed on SDS-PAGE to ascertain which fraction corresponds to IgG. The IgG fractions from different runs were pooled and concentrated to -1 mg/ml which was then dialyzed against the digestion buffer (0.15 M NaCl, O.lM Tris-Cl, pH 7.1).
    11. The collected ascitic fluid was centrifuged to remove cell debris and fat. Mouse monoclonal ascites, was filtered through glass wool to remove lipid like material left over after centrifugation. The supernatant was then subjected to (Nr4)zS04 fractionation. Saturated (Nlit)zS04 solution (SAS) at pH 7.0 was gradually added to the ascites in an ice bath with continuous stirring till a concentration of 40% (v/v) was achieved. The mixture thus, obtained was centrifuged to get the protein pellet and the pellet was re-suspended in buffer (0.01 M Tris-Cl, pH 8.5). The crude antibody solution obtained from ammonium sulfate fractionation was dialyzed against the wash buffer (0.0 1 \1 Tris-Cl, pH 8.5) and then subjected to ion-exchange chromatography using 5PW-DEAE (60x150 mm) column on a Waters3000 preparative HPLC (Waters, L:SA), to purify IgG. All solutions used during chromatography were filtered (0.451-lm) and then degassed. Following equilibration of the column with wash buffer, a 2 ml aliquot of the crude antibody
    12. secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.
    13. conditions used for purificatior and crystallization. Therefore, in any attempt at crystallization, the homogeneity of the preparation and its stability in solution is of paramount importance. lgG molecules possess a net negative charge, at pH 8.5. At this pH, IgG molecules, can therefore, bind to positively charged chemical moieties, an association that can be reversed using low concentrations of sodium chloride. Hence, it is possible to purify IgG using anion-exchange chromatography with a salt gradient. Since this method does not involve harsh conditions it represents an ideal way to purify IgG to be ultimately used for crystallization experiments. Ammonium sulphate fractionation prior to chromatography improves the resolution of peaks during IgG purification. The mouse IgG molecules are known to precipitate in the range of 33% to 40% (v/v) saturated ammonium sulphate. lgG molecules have three major domains, each of which are mobile with respect to the other. Consequently, the molecule is highly flexible and not easy to crystallize. Although entire immur.oglobulin molecules have also been crystallized (Harris et a!., 1998), the proteolytic fragments of IgG molecules have been observed to be more amenable to crystallization. Papain, a non-specific proteolytic enzyme obtained from papaya, cleaves antibodies at the hinge region to release one Fe and two Fab domains. Proteolysis by papain, if carried out carefully, followed by purification can yield a homogenous preparation of Fab. This pure preparation of Fab can be used for crystallization experiments.
    14. A prerequisite for collection of X-ray diffraction data for structure determination is availability of well-ordered single crystals. Protein crystallization is considered to be an art and there are no universally applicable methods for obtaining crystals suitable for X-ray diffraction studies. However, it is unlikely that good crystals will not be obtained if attention is paid to the purity and stability of the molecule of interest. A high degree of purity is essential for successful crystallization of most proteins. Also, the molecule must be stable under the
    1. The reaction was started by an initial hot start at 94 °C for 5 min., followed by a three-step amplification cycle. The amplification cycle consisted of a 1 min. denaturation at 94 °C, followed by a 2 min. annealing at 48 °C and an extension at 72 °C for 2 min. The cycle was repeated 30 times and the reaction mixture was incubated at 72 °C for additional 7 min. to allow for primer extension. The PCR amplified product was separated from the primers on a 1% agarose gel. A well was carved ahead of the required fragment and filled with 15% PEG-T AE solution (Zhen and Swank, 1993). The DNA was electro-eluted in 15% PEG-TAE solution, and purified further by phenoVchloroform extraction and ethanol precipitation.
    1. Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0
    2. Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).
    3. Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.
    4. Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.
    5. Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.
    6. For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.
    7. The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.
    8. Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.
    9. Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
    10. AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.
    11. 650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.
    12. The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at
    13. (gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
    14. Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
    15. The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.
    16. All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
    1. Lipofectin was kindly provided by Syntex, Inc., USA as an aqueous solution containing 1 mg I ml of 1 ipid ( DOTMA DOPE; 50 50 ). The procedure used was as described by Feigner et al., 1987 with appropriate I modifications as suggested in the user s notes. Lipofection was done with 0.5 x 106 cells seeded on a 60 mm plate. For each plasmid, the lipofection was performed in duplicate. The amount and quality of the plasmid DNA used ranged from 400 ng of crude DNA prepared by the mini prep method, to 5 ug of highly purified, cesium banded DNA. The appropriate amount of DNA was suspended in 1.5 ml of serum free DMEM. In another tube, 30 ug of lipofectin was suspended in 1.5 ml of serum free DMEM. The two solutions were mixed. The cells were washed twice with HBSS to totally wash off all traces of serum. The DNA 1 lipofectin mix was then applied to the cells and the cells incubated for 4 hours at 37°C. Next, 3 ml of media containing 10 % FCS was added and the incubation continued at 3 7°C for 16 hours. The culture supernate was then aspirated off and fresh medium added to the cells. The selection for stable clones was started after 48 hours by the procedure described below.
    2. mixed with the sample by vortexing, and the DNA loaded on a preparative agarose gel. When digesting vector DNA in preparation for a ligation, the DNA was first purified from the digestion reaction as described in 3.2.4.8. This DNA was then treated with bacterial alkaline phophatase as described by Maniatis et al., 1982 ) • The dephosphorylated DNA was run on a preparative agarose gel to purify the linearised, dephosphorylated vector DNA. The efficiency of dephosphorylation was monitored by self ligation, followed by transformation of competent E.coli cells. Only after achieving efficient dephosphorylation of the vector DNA, was it used for ligation with the insert DNA.
    3. For digestions aimed at purification of restriction fragments, 10 -20 ug of DNA was digested in a reaction mixture of about 100 -200 ul volume. Aliquots from the digestion reaction were checked on a minigel after one hour to monitor the extent of digestion. After the digestion was complete, one tenth volume of the 10 X tracking dye was
    4. Digestions involving more than one restriction endonuclease were carried out with 2 - 4 ug DNA in a final reaction volume of up to 50 or 100 ul. In these cases, if the two enzymes had radically different optimal assay conditions, the DNA was digested first with the enzyme requiring a lower salt concentration. After incubating for one hour, a 5 ul aliquot from the digestion reaction was electrophoresed on a mini gel to monitor the extent of digestion. Once the digestion was complete, appropriate amount of salt and the
    5. second enzyme were added and the incubation continued in an increased final reaction volume, to offset any increase in the glycerol concentration in the new reaction. Alternatively, the DNA was extracted once with phenol/chloroform, once with chloroform, and then precipitated with one half volume of 7.5 M ammonium acetate and two volumes of ethanol. The precipitation was done for 30 minutes at room temperature, and the DNA spun down for 30 minutes at room temperature. The supernate was discarded, pellet washed with 70% ethanol, recentrifuged, dried briefly under vacuum and finally resuspended in 18 ul distilled water. The DNA purified in this manner could then be used for setting up digestion with a second enzyme or for setting up a ligation. For those double digestions where one of the enzymes was known to be active over a broad range of ionic strength conditions, including those required for the optimal activity of the second enzyme, both the enzymes were added simultaneously in the digestion reaction, which was carried out using the optimal conditions of the second enzyme having more stringent assay requirements.
    6. All fine chemicals and the thermal cycler used for PCR, were kindly provided by Cetus Corporation, California, USA. 3.2.4. Digestion of DNA with restriction enzymes. DNA samples were digested with restriction endonucleases in the appropriate digestion buffers as recommended by BRL. The digestion buffers were in most cases, supplied by BRL. Composition of the 1 X buffers is given in Table 4.
    7. Figure !• Thermal cycle profile of a typical polymerase chain reaction ( PCR ). A typical PCR consists of repititive cycles of multiple temporal segments ( designated here as A - G ) with distinct target temperatures. After making the desired cocktail of template DNA, primers, Taq polymerase and the enzyme buffer, the reaction tube is incubated in a programmable thermal cycler, to incubate the reaction contents at pre-set temperatures for designated periods of time. Segments A -B, template denaturation; c -D, primer annealing; E -F, strand synthesis; G, ramp to the completion of the first cycle prior to the start of the next cycle ( dotted line ) . The duration and target temperature for each segment in an amplification cycle can be varied to suit the desired objectives.
    8. plasmid DNA in a 100 ul mixture having 10 ul of 10 X PCR buffer, 10 ul of 10 mM dNTPs, 3 ul of each primer to give a final primer concentration of 1 uM, and 2.5 units of the Thermus aquaticus thermostable DNA polymerase. PCR reaction buffer ( 10 X ) contains 500 mM KCl, 100 mM Tris. Cl, pH 8 . 3 ' 15 mM MgC12 and 0.1 9.,-0 gelatin. The mixture was subjected to PCR amplification in a programmed thermal cycler block set for 3 0 cycles. The procedure is diagramatically outlined in Fig. 1 and involved four steps : a) The reaction was heated to 95°C for 30 seconds to separate the two strands of the target DNA; b) the reaction was then cooled to 37°C for one minute to allow annealing of the two primers to the template DNA to occur ; c) next, the temperature was raised to 72°C and the reaction maintained at this temperature for 10 minutes, for primer extension to occur; d) at the end of the cycle, the temperature was again raised to 95°C as in step (a) to start a new cycle. In between the steps (a) to (d), one minute ramp times were used to allow the efficient realisation of the set temperature. In the last cycle, the duration of step (c) was extended to ensure the conversion of all single strands into double stranded DNA. At the end of 30 cycles of PCR, a 10 ul aliquot from the PCR reaction was electrophoresed on a 1 % SeaKem I 3 % NuSieve agarose gel in TBE buffer, to resolve the PCR products. The amplified DNA was purified by electrophoresing the entire PCR mixture on a 1 % preparative agarose gel in TAE buffer.
    9. Polymerase chain reaction was carried out as described by Scharf et al., ( 1986 ) , witD. some modifications. 23 mer oligonucleotide pri~ers synthesised by the solid phase triester method were designed to flank the target DNA desired to be amplified. A primer was designed to be complementary to , the 5 end of the phCG eDNA (+) strand and I was termed 5 primer ( also see Fig. 20 ) . Another primer was designed to be complementary to the sequence flanking the translation termination codon ( TAA ) of HBsAg (-) strand and this was I 1 I , termed 3 pr1mer. The 5 pr1mer also included the recognition sequence for restriction endonuclease Sal I as an overhang, while the I 3 primer included the recognition sequence for Hind III as an overhang. In addition, two extra bases ( G or C ) flanking the restriction site were included in the sequence of the primers, to improve the enzyme digestion. Thus, the nucleotide sequence of I the 5 primer read as : I I I 5 -GGCGTCGACATGGAGATGTTCCA-3 , while that for the 3 primer read I I as : 5 -CCAAGCTTTTAAATGTATACCCA-3 . A standard PeR· reaction contained 500 ng to 1 ug
    10. GTG ) were from FMC Bio Products, USA. SDS, ethidium bromide, calf thymus DNA, cesium chloride, tris base, dithiothreitol, IPTG, X -gal, DAB, ficoll, PVP, chloroquine, coomassie brilliant blue, amido black, bovine serum albumin, were from sigma Chemicals Company ( Sigma ) , USA. DEAE -dextran was from Pharmacia, Sweden. Nick translation kits were from Bethesda Research Laboratories BRL ) , USA, and Amersham International plc, UK. Lipofectin was kindly provided by Syntex, Inc. , USA. J3hCG RIA kit was from ICN Micromedic Systems, Inc., USA. Purified hCG 13,000 I.U./ mg was kindly provided by Dr. Y.Y. Tsang, Population Council, USA. HBsAg detection kit was from Abbott Laboratories, USA. Protein molecular mass standards were from Bio Rad Laboratories, USA. DNA size markers were from BRL. All other chemicals were from Glaxo Laboratories, India, and E. Merck, India.
    1. A mixture of sodium cacodylate (20 ~L, 0.2 M, pH = 6.5 adjusted with Hel) , MnCI2 (3 ~L, 1 M), mercaptoethanol (3 ~L, 1 M) and Triton X-100 (5 ~L, 10% w/v) was added to a solution containing N-acetylglucosamine (3 ~L, 1 M) and protein (1 00 ~g). The reaction was started with the addition of UOP-galactose (15 ~L, 10 mM with 1 ~Ci of eH] UOP-galactose). The mixture was incubated at 37°C for 60 minutes after which the reaction was stopped by the addition of EOTA (17 ~L, 0.3 M, pH = 7.4 adjusted with NaOH) and placing the tube on ice. The mixture was then passed through a column of Oowex 2X8 (200-400 mesh in cr form) already washed thoroughly with water. The unreacted UOP-galactose remained bound to the column while galactose which had been transferred to N-acetylglucosamine to form lactosamine, as well as free galactose, was eluted out with 1.5 mL of distilled water. One tenth of volume was taken for scintillation counting. For each assay, a control tube was run in which all
    2. (1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.