Generation of ascites from mice
7,520 Matching Annotations
- May 2019
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
-
conditions used for purificatior and crystallization. Therefore, in any attempt at crystallization, the homogeneity of the preparation and its stability in solution is of paramount importance. lgG molecules possess a net negative charge, at pH 8.5. At this pH, IgG molecules, can therefore, bind to positively charged chemical moieties, an association that can be reversed using low concentrations of sodium chloride. Hence, it is possible to purify IgG using anion-exchange chromatography with a salt gradient. Since this method does not involve harsh conditions it represents an ideal way to purify IgG to be ultimately used for crystallization experiments. Ammonium sulphate fractionation prior to chromatography improves the resolution of peaks during IgG purification. The mouse IgG molecules are known to precipitate in the range of 33% to 40% (v/v) saturated ammonium sulphate. lgG molecules have three major domains, each of which are mobile with respect to the other. Consequently, the molecule is highly flexible and not easy to crystallize. Although entire immur.oglobulin molecules have also been crystallized (Harris et a!., 1998), the proteolytic fragments of IgG molecules have been observed to be more amenable to crystallization. Papain, a non-specific proteolytic enzyme obtained from papaya, cleaves antibodies at the hinge region to release one Fe and two Fab domains. Proteolysis by papain, if carried out carefully, followed by purification can yield a homogenous preparation of Fab. This pure preparation of Fab can be used for crystallization experiments.
-
A prerequisite for collection of X-ray diffraction data for structure determination is availability of well-ordered single crystals. Protein crystallization is considered to be an art and there are no universally applicable methods for obtaining crystals suitable for X-ray diffraction studies. However, it is unlikely that good crystals will not be obtained if attention is paid to the purity and stability of the molecule of interest. A high degree of purity is essential for successful crystallization of most proteins. Also, the molecule must be stable under the
-
Preparation of Fab fragment
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
I 0.0 J.Ll 16.0 J.LI I 0.0 J.Ll 4.0J.Ll 4.0J.Ll 0.5 J..ll 55.5 J.LI I 00 J.L
-
lOX PCR buffer 1.25 J.LM dNTP mix Template DNA (I 0 J.Lg/ml) Primer #I (25 nmoles/ml) Primer #2 (25 nmoles/ml) Taq DNA polymerase (5 U/J.Ll) Sterile water Total volume
-
The reaction was started by an initial hot start at 94 °C for 5 min., followed by a three-step amplification cycle. The amplification cycle consisted of a 1 min. denaturation at 94 °C, followed by a 2 min. annealing at 48 °C and an extension at 72 °C for 2 min. The cycle was repeated 30 times and the reaction mixture was incubated at 72 °C for additional 7 min. to allow for primer extension. The PCR amplified product was separated from the primers on a 1% agarose gel. A well was carved ahead of the required fragment and filled with 15% PEG-T AE solution (Zhen and Swank, 1993). The DNA was electro-eluted in 15% PEG-TAE solution, and purified further by phenoVchloroform extraction and ethanol precipitation.
-
A standard PCR was set up as described below.
-
Polymerase Chain Reaction
-
L-[3,4,5-3H (N)]-Ieucine (143Cilmmol), [35S]-dATPaS, 1251-Na (350mCilml) were obtained from Amersham (England, UK).
-
Radioisotopes
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0
-
Titration of Rabbit Anti-bZP3 Sera
-
Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).
-
Immunocytochemical Localization of Recombinant Proteins in Infected Cells
-
Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.
-
Analysis ofr-bZP3 in VI, V2, V3 and V4 Infected Cells and Supernatant
-
Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.
-
Radiolabeling of Recombinant Proteins in Infected S/9 Cells
-
Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.
-
Expression 'Of bZP3 in BEVS
-
For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.
-
Screening of the Recombinant Viruses
-
The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.
-
Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.
-
Plaque Assay for Isolating Viruses
-
Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
-
Construction of Recombinant Viruses
-
AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.
-
Cell Culture Techniques
-
650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.
-
The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at
-
Screening of the Recombinant Transfer Vector
-
(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
-
Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
-
Plasmid Construction
-
EXPRESSION IN BACULOVIRUS
-
The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.
-
SDS-PAGE and Immunoblot
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
Media Composition and Bacterial Culture
Tags
- Method-2-Method-3-detail
- Method-3-Method-7-detail
- Method-3
- Method-3-Method-10
- Method-3-Method-2-detail
- Method-3-Method-10-detail
- Method-3-Method-9-detail
- Method-3-Method-7
- Method-4-Method-3
- Method-3-Method-3-detail
- Method-1-Method-3-detail
- Method-3-Method-5
- Method-3-Method-5-detail
- Method-2-Method-3
- Method-3-Method-4
- Method-3-Method-4-detail
- Method-3-Method-detail
- Method-1-Method-3
- Method-3-Method-3
- Method-3-Method-1
- Method-4-Method-3-detail
- Method-3-Method-6-detail
- Method-3-Method-6
- Method-3-Method-2
- Method-3-Method-8
- Method-3-Method-9
- Method-3-Method-1-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Lipofectin was kindly provided by Syntex, Inc., USA as an aqueous solution containing 1 mg I ml of 1 ipid ( DOTMA DOPE; 50 50 ). The procedure used was as described by Feigner et al., 1987 with appropriate I modifications as suggested in the user s notes. Lipofection was done with 0.5 x 106 cells seeded on a 60 mm plate. For each plasmid, the lipofection was performed in duplicate. The amount and quality of the plasmid DNA used ranged from 400 ng of crude DNA prepared by the mini prep method, to 5 ug of highly purified, cesium banded DNA. The appropriate amount of DNA was suspended in 1.5 ml of serum free DMEM. In another tube, 30 ug of lipofectin was suspended in 1.5 ml of serum free DMEM. The two solutions were mixed. The cells were washed twice with HBSS to totally wash off all traces of serum. The DNA 1 lipofectin mix was then applied to the cells and the cells incubated for 4 hours at 37°C. Next, 3 ml of media containing 10 % FCS was added and the incubation continued at 3 7°C for 16 hours. The culture supernate was then aspirated off and fresh medium added to the cells. The selection for stable clones was started after 48 hours by the procedure described below.
-
Using lipofectin.
-
mixed with the sample by vortexing, and the DNA loaded on a preparative agarose gel. When digesting vector DNA in preparation for a ligation, the DNA was first purified from the digestion reaction as described in 3.2.4.8. This DNA was then treated with bacterial alkaline phophatase as described by Maniatis et al., 1982 ) • The dephosphorylated DNA was run on a preparative agarose gel to purify the linearised, dephosphorylated vector DNA. The efficiency of dephosphorylation was monitored by self ligation, followed by transformation of competent E.coli cells. Only after achieving efficient dephosphorylation of the vector DNA, was it used for ligation with the insert DNA.
-
For digestions aimed at purification of restriction fragments, 10 -20 ug of DNA was digested in a reaction mixture of about 100 -200 ul volume. Aliquots from the digestion reaction were checked on a minigel after one hour to monitor the extent of digestion. After the digestion was complete, one tenth volume of the 10 X tracking dye was
-
Digestions involving more than one restriction endonuclease were carried out with 2 - 4 ug DNA in a final reaction volume of up to 50 or 100 ul. In these cases, if the two enzymes had radically different optimal assay conditions, the DNA was digested first with the enzyme requiring a lower salt concentration. After incubating for one hour, a 5 ul aliquot from the digestion reaction was electrophoresed on a mini gel to monitor the extent of digestion. Once the digestion was complete, appropriate amount of salt and the
-
second enzyme were added and the incubation continued in an increased final reaction volume, to offset any increase in the glycerol concentration in the new reaction. Alternatively, the DNA was extracted once with phenol/chloroform, once with chloroform, and then precipitated with one half volume of 7.5 M ammonium acetate and two volumes of ethanol. The precipitation was done for 30 minutes at room temperature, and the DNA spun down for 30 minutes at room temperature. The supernate was discarded, pellet washed with 70% ethanol, recentrifuged, dried briefly under vacuum and finally resuspended in 18 ul distilled water. The DNA purified in this manner could then be used for setting up digestion with a second enzyme or for setting up a ligation. For those double digestions where one of the enzymes was known to be active over a broad range of ionic strength conditions, including those required for the optimal activity of the second enzyme, both the enzymes were added simultaneously in the digestion reaction, which was carried out using the optimal conditions of the second enzyme having more stringent assay requirements.
-
All fine chemicals and the thermal cycler used for PCR, were kindly provided by Cetus Corporation, California, USA. 3.2.4. Digestion of DNA with restriction enzymes. DNA samples were digested with restriction endonucleases in the appropriate digestion buffers as recommended by BRL. The digestion buffers were in most cases, supplied by BRL. Composition of the 1 X buffers is given in Table 4.
-
Figure !• Thermal cycle profile of a typical polymerase chain reaction ( PCR ). A typical PCR consists of repititive cycles of multiple temporal segments ( designated here as A - G ) with distinct target temperatures. After making the desired cocktail of template DNA, primers, Taq polymerase and the enzyme buffer, the reaction tube is incubated in a programmable thermal cycler, to incubate the reaction contents at pre-set temperatures for designated periods of time. Segments A -B, template denaturation; c -D, primer annealing; E -F, strand synthesis; G, ramp to the completion of the first cycle prior to the start of the next cycle ( dotted line ) . The duration and target temperature for each segment in an amplification cycle can be varied to suit the desired objectives.
-
plasmid DNA in a 100 ul mixture having 10 ul of 10 X PCR buffer, 10 ul of 10 mM dNTPs, 3 ul of each primer to give a final primer concentration of 1 uM, and 2.5 units of the Thermus aquaticus thermostable DNA polymerase. PCR reaction buffer ( 10 X ) contains 500 mM KCl, 100 mM Tris. Cl, pH 8 . 3 ' 15 mM MgC12 and 0.1 9.,-0 gelatin. The mixture was subjected to PCR amplification in a programmed thermal cycler block set for 3 0 cycles. The procedure is diagramatically outlined in Fig. 1 and involved four steps : a) The reaction was heated to 95°C for 30 seconds to separate the two strands of the target DNA; b) the reaction was then cooled to 37°C for one minute to allow annealing of the two primers to the template DNA to occur ; c) next, the temperature was raised to 72°C and the reaction maintained at this temperature for 10 minutes, for primer extension to occur; d) at the end of the cycle, the temperature was again raised to 95°C as in step (a) to start a new cycle. In between the steps (a) to (d), one minute ramp times were used to allow the efficient realisation of the set temperature. In the last cycle, the duration of step (c) was extended to ensure the conversion of all single strands into double stranded DNA. At the end of 30 cycles of PCR, a 10 ul aliquot from the PCR reaction was electrophoresed on a 1 % SeaKem I 3 % NuSieve agarose gel in TBE buffer, to resolve the PCR products. The amplified DNA was purified by electrophoresing the entire PCR mixture on a 1 % preparative agarose gel in TAE buffer.
-
Polymerase chain reaction was carried out as described by Scharf et al., ( 1986 ) , witD. some modifications. 23 mer oligonucleotide pri~ers synthesised by the solid phase triester method were designed to flank the target DNA desired to be amplified. A primer was designed to be complementary to , the 5 end of the phCG eDNA (+) strand and I was termed 5 primer ( also see Fig. 20 ) . Another primer was designed to be complementary to the sequence flanking the translation termination codon ( TAA ) of HBsAg (-) strand and this was I 1 I , termed 3 pr1mer. The 5 pr1mer also included the recognition sequence for restriction endonuclease Sal I as an overhang, while the I 3 primer included the recognition sequence for Hind III as an overhang. In addition, two extra bases ( G or C ) flanking the restriction site were included in the sequence of the primers, to improve the enzyme digestion. Thus, the nucleotide sequence of I the 5 primer read as : I I I 5 -GGCGTCGACATGGAGATGTTCCA-3 , while that for the 3 primer read I I as : 5 -CCAAGCTTTTAAATGTATACCCA-3 . A standard PeR· reaction contained 500 ng to 1 ug
-
Polymerase chain reaction ( PCR 1·
-
GTG ) were from FMC Bio Products, USA. SDS, ethidium bromide, calf thymus DNA, cesium chloride, tris base, dithiothreitol, IPTG, X -gal, DAB, ficoll, PVP, chloroquine, coomassie brilliant blue, amido black, bovine serum albumin, were from sigma Chemicals Company ( Sigma ) , USA. DEAE -dextran was from Pharmacia, Sweden. Nick translation kits were from Bethesda Research Laboratories BRL ) , USA, and Amersham International plc, UK. Lipofectin was kindly provided by Syntex, Inc. , USA. J3hCG RIA kit was from ICN Micromedic Systems, Inc., USA. Purified hCG 13,000 I.U./ mg was kindly provided by Dr. Y.Y. Tsang, Population Council, USA. HBsAg detection kit was from Abbott Laboratories, USA. Protein molecular mass standards were from Bio Rad Laboratories, USA. DNA size markers were from BRL. All other chemicals were from Glaxo Laboratories, India, and E. Merck, India.
-
Acrylamide, bisacrylamide, ammonium persulphate, Bio -gel P-4 and TEMED, were from Bio -Rad Laboratories, USA. Agarose ( SeaKem ) and low gelling agarose ( NuSieve
-
Chemicals.
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
ingredients were present except N-acetylglucosamine. This value represented the galactose released. The difference in the counts between the tube in which acceptor was present and control represented transferase activity.
-
A mixture of sodium cacodylate (20 ~L, 0.2 M, pH = 6.5 adjusted with Hel) , MnCI2 (3 ~L, 1 M), mercaptoethanol (3 ~L, 1 M) and Triton X-100 (5 ~L, 10% w/v) was added to a solution containing N-acetylglucosamine (3 ~L, 1 M) and protein (1 00 ~g). The reaction was started with the addition of UOP-galactose (15 ~L, 10 mM with 1 ~Ci of eH] UOP-galactose). The mixture was incubated at 37°C for 60 minutes after which the reaction was stopped by the addition of EOTA (17 ~L, 0.3 M, pH = 7.4 adjusted with NaOH) and placing the tube on ice. The mixture was then passed through a column of Oowex 2X8 (200-400 mesh in cr form) already washed thoroughly with water. The unreacted UOP-galactose remained bound to the column while galactose which had been transferred to N-acetylglucosamine to form lactosamine, as well as free galactose, was eluted out with 1.5 mL of distilled water. One tenth of volume was taken for scintillation counting. For each assay, a control tube was run in which all
-
1,4 ~ Galactosyl transferase assay 96
-
(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
-
solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
-
Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
-
Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)
-
substrate (49). The contents were lyophilized and 250 III of membrane suspension (1.4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The [3H] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting.
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 J..ll of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 J..lg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 J..lg/ml tunicamycin). Each assay tube was prepared by adding 12.5 J..ll of 1% Chaps, 28 J..ll of 200 J..lM GDP-Man, 10 J..ll of GDP-[3H]Man (1 J..lCi) and 25 nmol of synthetic
-
Elongating mannosyl phosphate transferase (eMPT) assay45
-
Cultured promastigotes were harvested by centrifugation of suspension culture (500 ml) in falcon tubes at 3000 g for 10 min at 20°C in a cooling centrifuge (Rota 4R; Plastocraft). The clear spun media was carefully decanted and the pellet was resuspended in ice-cold phosphate buffered saline (PBS, 20mM, pH = 7.2). Centrifugation was done again as earlier and washings were collected in a separate falcon. The washing step with PBS was repeated twice. The promastigotes in PBS were then counted using a Neubauer chamber. For this an aliquot was taken and diluted with PBS (normally 10 J..ll original suspension was mixed with 60 J..ll PBS) and then formaldehyde was added to this (30 J..ll to give a final dilution of 1:10). After 10 minutes of fixing in formaldehyde, 10 J..ll of this diluted suspension was put under the coverslip on Neubauer chamber and counted. Total cell count was determined using the standard formula. For breaking cells to get membrane preparation,93 the cell pellet (6.5 x 109 cells) was suspended in 5 ml of hypotonic buffer (0.1 mM TlCK and 1 J..lg/ml leupeptin) and sonicated in ice (6 x 10 s pulses with 3 s intervals). Breaking of cells were assessed by a light microscope. The membrane protein was further processed as per the requirement of the experiment.
-
Preparation of Cell-free system of L.donovani
-
incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
-
For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
-
Maintenance and revival of L.donovani culture
-
Preparation of Microsomal Membranes of L.donovani parasite
-
N-Butyl-4-~-galactopyranosyl-a-D-glucopyranosyl ~-amino lactam (61). To a solution of 5 (12 mg) in CH30H (1 ml) was added palladium on carbon (10%, 35 mg) and formic acid (100 Ill). The mixture was stirred at 50°C overnight. The catalyst was filtered off and solvent was evaporated to afford 61; 1H NMR: 80.72-0.77 (t, 3H, CH2-CH3), 1.14-1.22 (m, 4H, CHz-CHz-CH3),1.40-1.45 (t, 2H, N-CH2), 4.31 (d, J = 7.8 Hz, 1H, H-1'), 5.38 (d, J = 4.2 Hz, 1H, H-1); 13C NMR: 8 12.72,19.69,28.77,40.65, 52.84, 61.09, 67.48, 68.50, 70.88, 72.56, 75.17, 77.66, 79.12, 103.19, 169.83; ESMS (mlz): 430.37 (M+Nat.
-
3,6··Di-O-benzyl-4-(2,3,4,6-tetra-O-benzyl-~-galactopyranosyl)-a-D-glucopyrano syl ~ amino lactam (58). To a solution of hexa-O-benzyl lactal (32, 300 mg, 0.36 mrnol) in CHCI3 (0.36 ml) was added trichloroacetyl isocyanate (90 Ill, 0.74 mmol). The mixture was stirred at rt for 18 h to afford the intermediate 57. This intermediate was characterized by 1 H NMR: 06.04 (1 H, d, J = 5.4 Hz, H-1, gluco isomer), 5.96 (1 H, d, J = 3.3 Hz, man no isomer). The reaction mixture was then cooled to -20°C and treated with benzylamine (0.13 ml, 1.17 mmol) and the flask was gradually brought to rt. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated. The residue was purified by silica column chromatography 1,30% ethyl acetate in hexane) to afford 58 (275 mg, 87%); Rt = 0.33 in 50% ethyl acetate in hexane; 1H NMR: & 3.37-3.46 (m, 5H, H-2,6,6'), 3.58-3.7 (m, 3H, H-3,4,5), 3.77-3.89 (m, 3H, H-2',3',5'), 4.34 (d, J = 4.2 Hz, 1 H, H-1 '),4.44 (d, 1 H, H-4'), 5.4 (d, J = 4.5 Hz, H-1), 6.24 (s, 1 H, NH), 7.22-7.36 (m, 30H, Ph); 13C NMR: & 54.27,68.43, 69.39, 71.48, 72.65, 73.06, 73.12, 73.37, 74.56, 75.05, 75.35, 75.95, 79.47, 82.31, 102.98,127.42-128.33,138.07-138.83,166.90; ESMS (mlz): 914.5 (M+Nat. 4-~-Galactopyranosyl-a-D-glucopyranosyl ~ amino lactam (59). To a solution of 58 (30 mg, 0.035 mmol) in CH30H (3 ml) was added palladium on carbon (10%, 170 mg) and formic acid (
-
Synthesis of anomeric ~-Iactam analogues of eMPT substrate91•92 (Scheme 14 of Results and Discussion)
-
mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-Dmannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-Dgalactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
-
Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
-
(Scheme 13 of Results and Discussion)
-
Synthesis of S'-hemiacetal analogue90 of Gal 1,4~-Man-aphosphate acceptor
-
Design and Synthesis of mechanism based inhibitors of elongating MPT enzyme of LPG biosynthesis
-
was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
-
[14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
-
Synthesis of [14C] labeled Stearyl linked Gal 1,4 f3 Man phosphate (Scheme 12 of Results and Discussion)
-
5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-aD-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
-
1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-Dmannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
-
Synthesis of Stearyl linked Gal 1,4 ~ Man phosphate (synthetic substrate for elongating-MPT activity)
-
Synthesis of Radiolabeled Exogenous Precursor of Phosphoglycan Biosynthesis
-
Design, Synthesis and Evaluation of Inhibitors of Phosphoglycan biosynthesis
-
Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
-
Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
-
Synthesis of phosphoglycans by polycondensation
Tags
- Method-3-Method-1-Method-1-detail
- Method-3-Method-1-Method-2-detail
- Method-3-Method-1-Method-2
- Method-3
- Method-3-Method-4-de
- Method-2-Method-1-Method-3
- Method-2-Method-1-Method-3-detail
- Method-3-Method-3-Method-1-detail
- Method-3-Method-1-Method-1
- Method-4-Method-1-Method-3
- Method-3-Method-2-Method-1
- Method-4-Method-3
- Method-3-Method-4
- Method-3-Method-3-Method-2
- Method-3-Method-4-detail
- Method-3-Method-3-Method-1
- Method-3-Method-3
- Method-3-Method-2-Method-2-detail
- Method-4-Method-3-detail
- Method-3-Method-2
- Method-3-Method-1
- Method-4-Method-1-Method-3-detail
- Method-3-Method-2-Method-2
- Method-3-Method-2-Method-1-detail
- Method-3-Method-3-Method-2-detail
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
d) Particle delivery using the Helios gene gun A day prior to immunization, hair were removed from the abdominal region of mice using a commercial depilatory agent (Anne French cream). Two cartridges/mouse ( ~ 2 Jlg DNA) were shot under pressurized helium gas ( 400 psi) intradermally at the shaven area of the abdomen of mice using the Helios gene gun. Two boosters comprising of two cartridges each were given on days 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 Jlglmouse in saline). Mice were bled retro-orbitally on days 0, 45 and 52 for analysis of antibody response.
-
tubing, which was cut into 0.5 inch pieces (cartridges). These cartridges were used to deliver DNA into epidermis of male/female mice. a) Preparation of DNA-gold microcarrier suspension Twenty five mg of gold microcarriers were weighed in a 1.5 ml eppendorf tube to which 100 J..Ll of 0.05 M spermidine was added and vortexed for 10 sec. To the above mixture 100 J..Ll of DNA (0.5 mg/ml) was added and vortexed for another 10 sec. While vortexing, 100 J..Ll of 1 M CaCh was added dropwise to the mixture and left at RT for 10 min to allow precipitation of DNA onto gold microcarriers. The DNA-gold pellet was collected by centrifuging at 12,000 X g for 1 min at RT. The pellet was washed thrice with 100% ethanol (freshly opened bottle), resuspended in 3 ml of 0.1mg/ml polyvinylpyrollidone (PVP) in ethanol and stored at -20°C till further use. b) Loading the DNA/microcarrier suspension into gold-coat tubing using the tubing prep station A 25 inch length of tubing was cut and fixed on tubing prep station, air dried by passing nitrogen gas through it for 15 min. The DNA/microcarrier suspension was vortexed and injected into the tubing using a 5 ml syringe and the microcarriers allowed to settle in the tubing for 3 min. Ethanol from the tubing was removed by slowly sucking into the syringe. The tubing was rotated, while passing the nitrogen gas, using the tubing prep station, for 20-30 sec to allow the microcarriers to evenly coat the inside of the tubing. c) Preparation of cartridges using the tubing cutter The tubing was cut into 0.5 inch long pieces (cartridges) by using the tubing cutter and cartridges stored at 4°C in vials containing desiccant pellets till further use.
-
Suspension of DNA adsorbed onto gold microcarriers at 0.5 Microcarrier Loading Quantity (MLQ; 50 J.lg DNA/25 mg gold microcarriers) was prepared and coated inside Tefzel
-
Plasmid DNA adsorbed onto gold microcarriers
-
For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600
-
To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
-
Localization of the expressed recombinant protein in COS-1 cells
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
PCR amplification of rG cDNAs
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.
-
Headkidney
-
Theacetylcholineconcentrationinthetissueswasestimatedspectrophotometricallyat540nmbythemethodofHestrin(1949)usingformicacid-acetonemixture(0.15mformicacidacetone,3:17V/V)astheextractionmediumAchconcentrationwascalculatedintermsofnmolAch/mgtissue
-
Acetylcholine(Ach)
-
Immediatelyafterisolation,thetissueswereweighedandsubjectedtolipidextractionthatwascarriedoutinduplicateaccordingtoFolchetal.(1957)
-
Totallipids
-
Meancorpuscularhaemoglobinconcentration(MCHC)istheaverageHbconcentrationperunitvolume(100)ofpackedredcells(W/V).Henceitisexpresseding/1whichisthesameaspercent(%).ItiscalculatedbythefollowingformulaHbMCHC=—......x100(g/dl)PCV
-
MCHC
-
Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes
-
PackedCellVolume(PCV)orHaematocrit(Ht)
-
Theexperimentalsetup(Figure8and9)forthedeterminationofO2uptakesimultaneouslyfromairandwaterwassimilartothatusedearlierbyNatarajan(1972),Rani(1994)andVijayalakshmi(1996).Aclosedglassrespirometerof5litrecapacitywasfilledwith3.5litrefreshtapwater.Athermocolfloatwithasemicircularholeatitsperipherywasplacedoverthewater,whichseparatedtheair-waterinterphaseoftherespirometer.Theair-phaseoftherespirometerwasattachedtoafluidmanometer.Asthefishcomestothewatersurfaceandtakesair-gulp,thereisapressurechangeintheair-phasecausinganimbalanceinthemanometricfluid.AgraduatedsyringefilledwithpureO2(takenfrommedicalO2cylinder)isusedtorestoretheimbalanceofthemanometricfluid.TheamountthusneededshowstheaerialO2uptakeofthefish.TheexpiredCO2wasabsorbedbythepelletsofKOHinthepetridishoverthemanometricfluid.Theconcentrationofdissolvedoxygenoftheambientwaterwasestimatedbefore andaftertheexperimenttomeasuretheaquaticO2uptakebythefish.ThedifferenceintheDOandtheamountofwaterindicatestheactualaquaticO2uptake.Winkler’svolumetricmethod(Welch,1948)wasusedtoestimatetoDOofthewatersamples.Darkenedrespiratorychamberswereusedwithdimensionsthatwereclosetothoseofthefishinorderthatthefishshouldremaininmoreorlessthesamepositionbut havesufficientroomtomoveitsopercula.Theflowofwaterthroughtherespirometer wasregulatedandmeasuredbymeansofaflowmeter.APhilipsO2electrode(PI1056)waskeptinawaterjacketmaintainedatthesametemperatureastheclosedcirculation.SamplesoftheinflowandoverflowwatercouldalsobeledovertheO2electrode
-
Bimodalrespiration
-
Thefisheswerefedadlibitumwithboiledhen’seggsontwodaysinaweekandearthwormsontheremainingdays.Feedingwasstopped24hrpriortoexperimentation.Noprophylactictreatmentforanydiseaseproblemwasnecessaryatanytimeduring acclimationandtest
-
Feeding
Tags
- Method-3
- Method-16-Method-3
- Method-10-Method-6-Method-3
- Method-19-Method-3
- Method-17-Method-3
- Method-10-Method-6-Method-3-detail
- Method-10-Method-3
- Method-8-Method-3-detail
- Method-17-Method-3-detail
- Method-16-Method-3-detail
- Method-3-detail
- Method-8-Method-3
- Method-10-Method-3-detail
- Method-19-Method-3-detail
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
The PCR products were ligated with T-tailed vectors (pGEM-T Easy, pTARGE-TfM from Promega or pcDNA3.1 from Invitrogen). In general, the ligation was carried out at a vector: insert molar ratio of 1:3 or 1:4 in a 10pl reaction volume finally containing 1X T4 DNA ligase buffer (300mM Tris-HCl, pH 7.8, 100mM MgCh, 100mM DTT, lOmM dATP) and lU of T4 DNA ligase (Promega, U.S.A.). The reaction mix was incubated at 160C for 16 hrs (overnight). Following the reaction, the ligated DNA was transformed into Calcium Chloride treated E.coli-DH5a or XL-Blue1 competent cells with a high transformation efficiency. The transformed cells were plated on to Luria-Bertani-Agar plates containing 100p.g/ml of ampicillin. Additionally, for blue-white screening of the colonies, 20pl of SOmg/ml of X-Gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside) and 10pl of 0.1M IPTG (lsopropyl-J3-thiogalactopyranoside) (Promega, U.S.A.) was used. The plated cells were incubated at 370C for 8-10 hours
-
Ligation and Transformation:
-
The cell lines, HEK 293 (human embryonic kidney cells) and HepG2 (human hepatocellular carcinoma) cells were obtained from ATCC. APOBEC3G-HA-293 cell line was obtained from the National Institutes of Health (Bethesda, Maryland, USA) AIDS Repository and grown according to standard procedures. Ecoli strains DHSa or XL-Blue were used for DNA cloning
-
ell lines and Bacterial strains
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Cells growing in culture medium were harvested by trypsinization and washed twice with ice cold PBS. Cells were fixed by adding ice cold 70% ethanol and stored at 4°C. Before harvesting cells were washed twice with PBS and re-suspended in adequate amount of PBS containing Propidium Iodide (PI) to a final concentration of 50μg/ml and RNase to a final concentration of 10μg/ml. Thereby the cell suspension was incubated at 37°C for 30 minutes in dark. Analysis was done by running the samples in BD FACS Vantage System according to the standard procedures after calibration of instrument with Calibrite beads
-
Flow Cytometry
-
The plates were kept in incubator gently and the colony formation was monitored every week. Media (500μl) was added to the plates every 4th-5th day to avoid drying. Colonies formed in soft agar photographed were taken without staining, under a microscope in light field
-
Agar solution was prepared in a sterile 50ml Schott Duran Bottle and boiled in microwave until fully dissolved and kept at 55°C to 65°C. Master Mix with the rest of the components of bottom agar was made in a sterile corning 50ml tube prewarmed at 55°C and agar solution was added. The solution was once vortex briefly and then added (2ml) carefully to each well avoiding air bubbles. The plates were left undisturbed in laminar flow hood until the agar set fully. Two days before final assay, the bottom agar plates were kept in tissue culture incubator for equilibration. On the day of assay the following mix was prepared for Top Agar 4 dishes 5 dishes1.media with FBS, L-glutamine and Pen-Strep 4.8 ml 6 ml 2.fetal bovine serum 1.8 ml 2.5 ml 3.sterile water 1.8 ml 2.5 ml 4.agar 1.8% (1.8 g/100mLs) 1.8 ml 2.5 ml 5. cell suspension 1.0 X 105/ dish 100 to 350 μl 100 to 350 μl 6. Total 10.2 ml 13.5 ml Top agar mix without cells was first prepared and kept at 42°C. The cells were then trypsinized and re-suspended after counting in final volume of 100μl to 200 μl. Cells were then mixed with top agar and solution was quickly poured over the bottom agar.
-
For soft agar assays 2x104, (A549) or 1x105 cells (E-10) were used in 1.5ml top agar. For preparing bottom agar plates (0.64% final con. of agar), a following mix was prepared for five dishes. 1.2X media with FBS, L-glutamine and Pen-Strep 10 ml 2.fetal bovine serum 5 ml 3.sterile water 1 ml 4.noble agar 1.8% (1.8 g/100mLs) 9 ml 5.Total 25 m
-
Soft Agar Assay
-
For clonogenic assays, 1x103 (A549) or 2x103 (E-10) cells were seeded per well of a six well tissue culture plate and grown for 15 days. For identification of signaling pathways various inhibitors were used viz, PI3K inhibitor LY294002 (10μM), MEK inhibitor PD98059 (10μM) or p38 inhibitor SB203580 (10μM). Cells were grown in the presence of inhibitor for seven days following which fresh medium was added. For staining, cells were washed twice with PBS and fixed in 10% formalin for 10 minutes, washed extensively with water and stained with 0.25% crystal violet prepared in 25% methanol for 4hrs at 4°C. Plates were then washed with milli Q water and dried before scanning
-
Clonogenic Assay
-
and fixed with 100μl of fixative solution per well, for 10 minutes at room temperature. The cells were then washed twice with PBS and 100μl of staining solution was added to each well. The plate was kept at 37° C, until the color development.
-
4x103-5x103 cells were plated in 96 well plate, well. Cells were transfected with reporter plasmid 18 -24 hrs after plating. After 48 hrs, cells were washed once with PBS
-
Procedure:
-
ml 1X PBS
-
This protocol is for the detection of β-gal expression in fixed cells. It was performed on 96-well plates for initial screening of tTA transfected clone, and is a modification of Sanes et al., 1986
-
In situβ-gal staining of Transfected Cells
-
Procedure:
-
β- galactosidase assay was performed in a 96 well format. Briefly, 4000-5000 cells were plated in 96 well tissue culture coated plate. Cells were transfected with reporter plasmid after 18 -24 hrs and after 48 hrs the cells were washed once with D-PBS. 50μl of lysis buffer was added to the well and cells were lysed by freezing plate at -70°C and thawing at 37°C. Cells were pipette up and down and then the plate was centrifuged at 9000 X g for 5 minutes. The supernatant from each plate was transferred to clean eppendorf tube. Immediately prior to assay the ONPG cocktail was prepared as below: 47 μl 0.1 M sodium phosphate (pH 7.5)22 μl 4 mg/ml ONPG1 μl 100X Mg solution30μl of each well extract was added to microtitre well plate and70μl of ONPG cocktail was added to each well. The plate was kept on ice throughout the procedure. After addition of ONPG cocktail the plate was transferred to 37°C and the development of colour was monitored every 10 minutes for development of color. After development of yellow colour, the reaction was stopped by addition of 150μl of 1M sodium carbonate to each well
-
Lysis Buffer: 0.1% Triton X-100/0.1 M Tris-HCl (pH 8.0). 450 ml distilled water 50 ml 1M Tris-HCl (pH 8.0) 0.5 ml Triton X-100 detergent • 100X Mg++ solution: 0.1 M magnesium chloride 4.5 M 2-mercaptoethanol Stored at 4°C. • 0.1 M sodium phosphate (pH 7.5)41 ml 0.2 M Na2HPO4 9 ml 0.2 M Na H2PO4 50 ml distilled water • 4 mg/ml ONPG (o-nitrophenyl-β-D-galactopyranoside) in 0.1 M sodium phosphate (pH 7.5) containing 2 mM β-mercaptoethanol, Stored at –20°C. • 0.1 mg/ml β-gal standard: 0.1 mg/ml β-gal in 0.1 M sodium phosphate (pH 7.5) containing 2 mM 2-mercaptoethanol Stored at 4°C. • 1 M sodium carbonate in water
-
Solutions:
-
β-gal assay in transfected cells
-
normalized to the optical density at day 0 for the appropriate cell type. Growth curve was determined twice
-
Growth curves were prepared for various cell lines using the modified method adopted by Serrano et al, 1997. Briefly, 10, 000 cells were seeded in a 24 well plate in quadruples. At the indicated times, cells were washed once with PBS and fixed in 10% formalin for 20 minutes and rinsed with distilled water. Cells were stained with 0.05% crystal violet for 30 minutes, rinsed extensively and dried. Cell associated dye was extracted with 1.0ml acetic acid. Aliquots were diluted 1:4 with water and transferred to 96 well microtitre plates and the optical density at 590nm determined. Values were
-
Growth Curves:
-
After PCR, 1 μl of Dpn1 enzyme (10U/μl) was added to the amplification mix and incubated at 37°C for 6hours. After that, 10ml of the amplification mix was taken to transform Dh5a cells. Positive clones were selected after confirming the sequence of plasmid DNA
-
The PCR parameters were as follows
-
The reaction mix included 2ml of PSKll(39+) (50ng) containing wild type K-Ras cDNA , 5ml 10x buffer, 20pmoles of primers , 1ml of 10mM dNTP mix and 1ml of deep vent polymerase (NEB).
-
The following K-Ras-ras mutants were generated by site directed mutagenesis according to the protocol described in QuickChange site directed mutagenesis kit (Stratagene). The primers used are shown in the following table
-
appropriate secondary antibody (conjugated with horse-radish peroxidase) diluted in 5% fat free milk solution (in PBST) and incubated for 45 minutes at room temperature. After incubation the membrane was washed and processed for the detection of protein bands using ECL-plus detection reagent (Amersham Biosciences) followed by detection of signal on X-ray film (Hyperfilm-ECL, Amersham Biosciences)
-
Site Directed Mutagenesis
-
The proteins were resolved using denaturing SDS-PAGE gel and after completion of the run, the gel was over laid on a nitrocellulose paper cut to the size of gel and kept in the blotting cassette in the presence of blotting buffer. Finally the cassette was put in the mini transblot apparatus (Bio Rad) and blotting was done for 4 hours at a constant voltage of 60 V. Then the membrane was taken out and rinsed in PBS containing 0.1% Tween - 20 (PBST) for 5 minutes by gentle shaking. Later the membrane was immersed in 5% non-fat milk solution in PBST with gentle shaking for 1 hour at 37°C. The membrane was washed off from the traces of the fat free milk with PBST and the membrane was over laid with primary antibody diluted in PBST for 3 hours at 4°C with shaking. After incubation the membrane was washed with PBST and layered with
-
Immunobloting
-
For adherent cells from which lysates have to be prepared , culture medium was removed and cells were washed with ice cold 1X PBS twice and then scraped with cell scraper in Cell Lysis buffer. Cells were rotated at 4°C for 30min at cold room and centrifuged at 13000 rpm for 10min at 4°C. The supernatant was collected and protein concentration was estimated using BCA assay. For standard western, 50-70μg of protein was loaded on to the gel
-
Lysate Preparation for Immuno- blotting
-
DTT. Then contents were then mixed and 1μl (200 units) of M-MLV was added. The mixture was then incubated at 37°C for 50 minutes. The reaction was stopped by incubating the mixture at 70°C for 15 minutes. The cDNA thus prepared was then used as a template for PCR. The expression of the investigated genes was determined by normalizing their expression against the expression of actin or GAPDH gene
-
Semi-quantitative RT-PCR
-
μg of total RNA was reverse-transcribed using poly-T oligonucleotide and M-MLV reverse transcriptase (Invitrogen) according to manufacturer’s protocol. Briefly, a 20μl reaction volume was made for 1μg of RNA. In a microcentrifuge tube, 1μl oligo (dT)(500μg/ml) , 1μg total RNA, 1μl 10mM dNTP mix and sterile water was added to afinal volume of 13μl. The mixture was then incubated at 65°C for 5 minutes ad quickly chilled on ice. To this mixture were added 4μl of 5X first strand buffer and 2μl of 0.1M
1
-
Total RNA was isolated by TRIzol method using the manufacturer’s protocol. Briefly, medium was removed, from 35mm dish and 1ml to TRIzol was added directly to the dish and kept at room temperature for 5 minutes. The cells were harvested by pipetting up and down three four times and transferred to a 1.5ml microfuge tube. For each 1mlTRIzol, 200μl of chloroform was added and tubes were shaken vigorously for 10 seconds to completely dissociate the nucleoprotein complexes, followed by vortexing for about 30 seconds. The mixture was kept for 3-5 minutes at room temperature and then centrifuged at maximum speed for 10 minutes. The upper aqueous phase was transferred into a fresh microcentrifuge tube and 500 μl of isopropanol was added and this was incubated at -20°C for 1 hour. The RNA was pelleted by centrifugation at maximum speed for 30 minutes at 4°C. The supernatant was decanted and the pellet washed with 1ml of 70% ethanol followed by a second wash with 1ml of 90% ethanol and centrifugation at maximum speed for 10 minutes. The supernatant was removed and the pellet air-dried for about 5 minutes and re-solubilized in 30-50 μl RNase free deionized (DEPC-treated Milli-Q) water and aliquots were stored at -70°C
-
Total RNA isolation from cultured mammalian cells
-
Transient transfection of plasmid DNA in culture cells was performed using Lipofectamine 2000 according to manufacturer’s protocol. Briefly, forty million cells were seeded in a 35mm tissue culture dish, one day before transfection. Transfection was performed 18-24 hrs after seeding the cells. 4μg DNA was mixed in 50μl of Opti-MEM in one eppendorf tube. In another tube, 5μl of Lipofectamine 2000 was diluted in 50μl Opti-MEM and incubated at room temperature for 5 minutes. After five minutes, DNA and Lipofectamine 2000 were mixed together and complexes, incubated for 30 minutes at room temperature. Meanwhile, the adherent cells were washed twice with PBS and 1ml of Opti-MEM was added. 100μl of complexes were then added to each dish containing cells and medium. After 6hrs, the medium containing complexes was removed and complete medium was added and transgene expression was accessed 24-48 hrs after transfection
-
Transient transfections in adherent cells
-
The quantity and purity of nucleic acids was determined by measuring the absorbance at 260 and 280 nm. The concentration of nucleic acids was calculated by taking 1 OD 260= 50 μg/ml for DNA, 40 μg/ml for RNA and 33 μg/ml for single stranded oligonucleotides. The purity of nucleic acids was checked by their A260/A280 ratio
-
Spectro-photometric estimation of nucleic acids
-
ethanol has dried. The pellet was resuspended in 20 μl of milliQ water and 20 μg/ml RNase added. The tube was incubated at 50°C for 45 min. the tube was vortexed for few seconds. Quality of the plasmid DNA was then accessed by running 1% agarose gel.
-
stored. To prepare competent cells pre-inoculum was prepared. A single bacterial colony was picked from LB agar plate, inoculated into 3 ml LB medium, and incubated overnight at 37°C temperature with shaking at 200 rpm. 1% of this pre-inoculums was sub cultured in 100 ml LB-broth and incubated at 18°C with shaking until OD at 600nm reached 0.5 - 0.6 (approx.). Culture was kept on ice for 10 min. with constant shaking.Cells were pelleted by centrifugation at 2000 g at 4°C for 8 min. Pellet was resuspended in 40 ml of ice-cold TB buffer. Bacterial suspension was kept on ice for 30 min, re-spun at 2000 g at 4°C for 8 min. Pellet was resuspended in 8 ml of TB buffer in which final concentration of DMSO was 7% and left on ice for 10 min. 100 μl aliquots were made and snap frozen in liquid nitrogen and stored at -80°C
-
All the salts (10 mM PIPES, 15 mM CaCl2.2H2O, 250 mM KCl, 55 mM MnCl2.2H2O) except MnCl2 were dissolved in milliQ water and pH was adjusted to 6.7 with 1N KOH. MnCl2 was dissolved separately in mill Q water. MnCl2 was added drop wise while stirring (MnCl2 if added directly will give a brown color to the solution and precipitate out, hence it needs to be dissolved separately). Solution was then filter sterilized and
-
Overnight Grown culture was pelleted by centrifugation at 10,000g at 4°C for 3 min and the supernatant was discarded. Pellet was resuspended in 250 μl of ice-cold alkaline lysis solution 1. 300 μl of alkaline solution 2 was then added and the tube was inverted gently 3-4 times and incubated at room temperature for 5 min. 350 μl of ice cold solution 3 was added and mixed by inverting the tube rapidly for 3 or 5 times. Suspension was incubated on ice for 10 min. Bacterial lysate was spun at 10,000g for 12 min at 4°C. Supernatant was transferred to a fresh tube. 0.4 volume of phenol: chloroform was added to the supernatant and the contents mixed. It was then spun at 10,000g at 4°C for 12 min. Aqueous phase was taken out in a fresh tube and 0.6 volume of isopropanol was added, mixed properly and incubated at room temperature for half an hour followed by spinning at 10,000g at RT for 20 min. Supernatant was discarded. Pellet was washed with 70% ethanol. The tube was stored at room temperature until the
-
Ultra Competent Cells Preparation
-
Experimental Procedures
-
Human lung epithelial type II cells (HPLD) were a kind gift from Dr. T Takahashi, Japan. All the cell lines were maintained in 5% CO2 with the recommended media containing 10% FBS (3% FBS for HPLD) and following the standard guidelines.
-
A549 (human lung adenocarcinoma epithelial) and murine fibroblast cell line NIH3T3 was purchased from American Type Culture Collection. Murine lung epithelial cell line E-9 and E-10 were a kind gift from Dr. L.M.Anderson, (NCI-FCRDC, Frederick, Maryland)
-
Cell Lines
Tags
- Md-3-Md-11-Md-1-d
- Md-3-Md-13
- Md-3-Md-10-d
- Md-3-Md-11
- Md-3-Md-9
- Md-3-Md-11-Md-1
- Md-3-Md-3
- Mt-3
- Md-3-Md-7-d
- Md-3-Md-12-Md-4-d
- Md-3-Md-12-d
- Md-3-Md-6-d
- Md-3-Md-15-d
- Md-3-Md-10
- Md-3-Md-12
- Md-3-Md-13-d
- Md-3-Md-14
- Md-3-Md-5-d
- Md-3-Md-4-d
- Md-3-Md-15
- Md-3-Md-2-d
- Md-3-Md-3-d
- Md-3-Md-1-d
- Md-3-Md-14-d
- Md-3-Md-11-Md-2
- Md-3-Md-5
- Md-3-Md-11-Md-2-d
- Md-3
- Md-3-Md-12-Md-4
- Mt-3-d
- Md-3-Md-1
- Md-3-Md-8-d
- Md-3-Md-9-d
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
12% resolving gel (for 25 ml)Water = 8.2 ml 30% Acrylamide = 10.0 ml 1.5 mM Tris (pH 8.8) = 6.3 ml 10% SDS = 0.25 ml 10% APS = 0.25 ml TEMED = 0.01 ml 5% stacking gel (for 10 ml)Water = 6.8 ml 30% Acrylamide = 1.7 ml 1.5 mM Tris (pH 6.8) = 1.25 ml 10% SDS = 0.1 ml 10% APS = 0.1 ml TEMED = 0.01 ml
-
A double cylinder gradient former was used with 12% poly acrylamide gel mix in the inner cylinder and a 3% polyacrylamide gel mix in the outer cylinder that was stirred using a magnetic bead on a magnetic stirrer. A pump was connected to the flow tube and the flow rate adjusted at 5-8 to cast a 12-3% gradient gel. A 5% stacking gel was used. After the protein samples were run on the gradient gel, it was stained in instant blue over night under shaking. 3% resolving gel (for 25 ml)Water = 15.68 ml 30% Acrylamide = 2.5 ml 1.5 mM Tris (pH 8.8) = 6.3 ml 10% SDS = 0.25 ml 10% APS = 0.25 ml TEMED = 0.02 ml
-
Casting a gradient SDS-polyacrylamide gel
-
The DNA samples were mixed with the appropriate volumes of the 6X loading dye (0.25% bromophenol blue, 0.25% xylene cyanol and 30% glycerol in water) and subjected to electrophoresis through 1-1.5% agarose gel in either 1X TBE or 1X TAE buffer. The gel was stained in 1 μg/ml of ethidium bromide solution for 30 min at room temperature and the bands were visualized by fluorescence under UV-light
-
Agarose gel electrophoresis
-
The lacZ U118 is an amber nonsense mutation(Am) that confers Lac─phenotype and also polarity of the downstream lacYA genes in the operon due to premature Rho-dependent transcription termination within the untranslated region of lacZ. Melibiose is a sugar which can only be utilized in a lacZ (Am) strain at high temperature (39 ̊C, when the native melibiose permease is inactive) if the downstream gene lacY encoded permease is transcribed and translated. Therefore, in lacZ (Am) strains, growth on minimal melibiose plates (0.2%) at 39°C reflects transcriptional polarity relief at the lac locus, and the same was scored after streaking the relevant strains on such medium
-
lacZ (Am) assay
-
Strains were streaked on LBON agar plates and after an overnight incubation at 42°C growth was monitored (compared to that on LBON at 30°C as control). Absence of single colony growth was taken to reflect temperature sensitivity. Whenever needed the phenotype was also quantitatively assessed by plating dilutions of cultures on LBON agar plates and the drop in plating efficiency was scored after overnight incubation at 30°C and 42°C
-
LBON(Ts) phenotype
-
Plasmids constructed in this study
-
genome cloned in a ColEI-based replicon, and obtained from Dr. Manjula Reddy. pHYD2556 is spectinomycin resistant and carries the minimal nusA+ open-reading frame with its native ribosome-binding site between genomic nucleotide co-ordinates 3314061and 3315548 cloned downstream of the ara regulatory region in a pSC101-based replicon, and obtained from Dr. Ranjan Sen. pHYD2557 is chloramphenicol resistant and carries a 2.3-kb PCR-amplified region between genomic nucleotide co-ordinates 3314061 and 3316393 (containing yhbC nusA region with its own promoter) cloned in a pSC101-based Ts replicon, and obtained from Dr. Ranjan.Plasmid DNA preparations were routinely prepared from recA strains such as DH5αand were stored in 10mM Tris-Cl (pH 8.0) plus 1mM EDTA at ─20 ̊C
-
pWSK30 an Ampicillin resistant vector with pSC101 origin of replication and blue-white screening facility (Wang and Kushner, 1991). pHYD272 is a derivative of pMU575, an IncW-based single copy vector with Trimethoprim resistance marker carrying lacZYA reporter genes under proU promoter (Dattananda et al., 1991). pHYD751 a ColE1 replicon plasmid with ampicillin resistance marker and 2.1kb EcoRI-SalI fragment carrying nusG+cloned into EcoRI-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD763 is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying 3.8 kb BamHI-SacI fragment of nusG+ cloned into BamHI-SacI sites of pMAK705 (Harinarayanan and Gowrishankar, 2003). pHYD1201 a ColE1 replicon plasmid with ampicillin resistance marker and 3.3kb HindIII-SalI fragment carrying rho+cloned into HindIII-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD1622 is the derivative of pHYD1201 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD1623 is the derivative of pHYD751 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD2368 is a derivative of pBAD18 (AmpR) with 1.7 kb fragment encompassing RBS and coding region of uvsW from phage T4gt7 into SacI site of pBAD18 (K. Leela, unpublished). pHYD2554 is a derivative of pMBL18 with ampicillin resistance, carrying the 10-kb EcoRI-HindIII fragment between kilobase co-ordinates 3310.06 and 3320.08 of the E. coli
-
to CCT mutation leading to a Glutamic acid to Glycine change at the 53rd amino acid and a Threonine to Proline change at the 55th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-I119T is a derivative of pLG-H-NS plasmid with ATC to ACC mutation leading to a Isoleucine to Threonine change at the 119th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-P116S is a derivative of pLG-H-NS plasmid with CCA to TCA mutation leading to a Proline to Serine change at the 116th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-Y97C is a derivative of pLG-H-NS plasmid with TAT to TGT mutation leading to a Tyrosine to Cysteine change at the 97th amino acid in the H-NS protein (Willams et al., 1996). pPMrhoCam is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying PuvII-HindIII fragment containing trxArho+ cloned into PuvII-HindIII sites of pPM103 (Martinez et al., 1996). pTrc99A an expression vector with ColE1 origin of replication and ampicillin resistance marker. Provides IPTG dependent induction of the insert (Amann et al., 1988). pUC19 is a high-copy-number ColE1 based E.coli cloning vector (500-700 copies/cell) with an Ampr selectable marker. It is one of a series of related plasmids constructed by Messing and co-workers and contains portions of pBR322 and M13mp19 (Yanisch-Perron et al., 1985). It carries a multiple-cloning site (MCS) region in the lacZα fragment, and therefore allows for blue-white screening of recombinant clones
-
pAM34 is a pBR322-derived cloning vector with Ampr and Specr selectable markers. The replication of this plasmid is dependent on the presence of IPTG, the gratuitous inducer of the lac operon (Gil and Bouche, 1991). pBAD18 is an expression vector with a pBR322 derived origin of replication and allows for tightly regulated expression of the genes cloned under the PBAD promoter of the araBADoperon (Guzman et al., 1995). The vector also carries the araC gene, encoding the positive and negative regulator of this promoter. pBluescript II KS (pBKS) is also a high-copy-number ColE1 based cloning vector with Ampr selectable marker and blue-white screening facility (obtained from Stratagene). pCL1920 is a low-copy-number vector with pSC101 replicon (~ 5 copies/cell), that carries streptomycin (Str)/spectinomycin (Spec)-resistance marker (encoded by aadA) and also carries a MCS region within the lacZα that allows blue-white screening to detect recombinants (Lerner and Inouye, 1990). pCP20 pSC101-based Ts replicon, CmR AmpR, for in vivo expression of Flp recombinase (Datsenko and Wanner, 2000). pLG339 is a low-copy-number cloning vector with pSC101 replicon that has a Kanrselectable marker (Stoker et al., 1982). pLG-H-NS is a pLG339 derivative where the hns ORF had been cloned into the EcoRI-SalIsites of pLG339 vector (KanR, pSC101) (Willams et al., 1996). pLG-H-NSΔ64 is a derivative of pLG-H-NS plasmid with AT base pair deletion after codon 63 in the hns gene resulting in a frameshift (Willams et al., 1996). pLG-H-NS-L26P is a derivative of pLG-H-NS plasmid with CTG to CCG mutation leading to a Leucine to Proline change at the 26th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-E53G/T55P is a derivative of pLG-H-NS plasmid with GAG to GGG and ACT
-
pACYC184 is a medium-copy-number cloning vector (~ 20 copies/cell) with Cmr and Tetrselectable markers. It carries the origin of replication from plasmid p15A (Chang and Cohen, 1978), which is related to and yet is compatible with that of ColE1. This property enables pACYC184 to co-exist in cells with ColE1 plasmid vectors, including all the ones mentioned above
-
Plasmids that have been described elsewhere
-
Plasmids
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Cell surface membrane proteins were separated using a method by Snapp and Landfear (1997). 4 X 107live cells/mL were resuspended in MME buffer (10mM MPOS, 0.1mM EGTA, 1mM MgS04, 0.1%v/v Triton X-100 and protease cocktail) and incubated at 4°C for 1 hr. on an end to end rotor. This was followed by centrifugation at 3000 x g for 4°C for 10 min. The pellet obtained was washed with PBS and then lysed in 2X sample buffer and run on an SDS-PAGE followed by western blotting
-
Separation of cell surface proteins
-
1258 x g for 10 min at RT and washed 2X with PBS to remove all traces of media and FBS. D1e pellet was finally resuspended in 200p.L of resuspension solution provided in the kit. 20p.L of RNase A solution was added and incubated at RT for 2 min. 20p.L of Proteinase K and 200p.L of lysis solution were added and the cell suspension was vortexed for ~15s. This was followed by incubation at 70°C for 10 min. Pre-assembled GenElute MiniPrep Binding column was equilibrated with 500p.L of column preparation buffer by centrifugation at 12000 x g for 1min. Following incubation at 70°C, 200p.L of ethanol was added to the lysate and the vortexed for 5-10s. This lysate was then transferred to the equilibrated column and centrifuged at 6,500 x g for 1min. The column was washed 2X with 500p.L of wash buffer, by centrifugation at 6,500 x g for 3 min. To collect the genomic DNA, the column was incubated at RT with 200p.L of elution buffer for 5 min followed by centrifugation at 6,500 x g for 1 min. The genomic DNA was aliquoted and stored at -20°C for long term and 4°C for short term storage
-
Genomic DNA of Leishmania donovani was obtained using GenElute™ a mammalian genomic DNA Miniprep kit from Sigma Aldrich (St. Louis, MO). Briefly, 108 parasites were harvested by centrifugation at
-
Preparation of genomic DNA from Leishmania donovani culture
-
0% FBS and cultured as described above. The cells usually regain motility by 24 to 48 hrs and the culture is ready for use after splitting them once
-
For long term storage, Leishmania donovani were stored as Dimethyl Sulfoxide (DMSO) containing frozen stocks (freeze downs). Parasites in mid to late log phase were taken and dead and agglutinated cells removed by centrifugation at 129 x g for 10 min. The supernatant was centrifuged at 1258 x g for 10 min to pellet cells which were then washed 2X with plain medium followed by resuspension in FBS containing 10% DMSO as the cryoprotectant. These were transferred to a labelled cryogenic vial and immediately transferred to -20°C for a few hours, followed by incubation at -70°C overnight. The following day, the stocks were transferred to liquid nitrogen (liq N2). To revive a frozen stock, the stock was retrieved from liq N2 and transferred to a beaker containing water at ~37°C. Once the stock has thawed, the cells were immediately transferred to lOmL plain mDMEM and centrifuged at 217 x g for 10 min. The pellet was washed three to four times with plain medium followed by resuspension in mDMEM containing
-
Preparation and revival of frozen stocks of Leishmania donovani
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Automated DNA sequencing on plasmid templates or on PCR products was carried outwith dye terminator cycle sequencing kits from Perkin-Elmer on an automatedsequencer (model 377, Applied Biosystems), following the manufacturer’s instructions.Manual sequencing was achieved using the SequenaseVersion2.0 DNASequencing Kit from USB Corp. as described in manufacturer’s instructions and thesequencing reaction products were resolved by electrophoresis on a 6% sequencing gel
-
DNA sequencing
-