10,000 Matching Annotations
  1. Mar 2025
    1. Reviewer #3 (Public review):

      Summary:

      In this study, the authors aimed to investigate if hemodynamic occlusion contributes to fluorescent signals measured with two-photon microscopy. For this, they image the activity-independent fluorophore GFP in 2 different cortical areas, at different cortical depths and in different behavioral conditions. They compare the evoked fluorescent signals with those obtained with calcium sensors and neuromodulator sensors and evaluate their relationship to vessel diameter as a readout of blood flow.<br /> They find that GFP fluorescence transients are comparable to GCaMP6f stimuli-evoked signals in amplitude, although they are generally smaller. Yet, they are significant even at the single neuronal level. They show that GFP fluorescence transients resemble those measured with the dopamine sensor GRAB-DA1m and the serotonin sensor GRAB-5HT1.0 in amplitude an nature, suggesting that signals with these sensors are dominated by hemodynamic occlusion. 
Moreover, the authors perform similar experiments with wide-field microscopy which reveals the similarity between the two methods in generating the hemodynamic signals. Together the evidence presented calls for the development and use of high dynamic range sensors to avoid measuring signals that have another origin from the one intended to measure. In the meantime, the evidence highlights the need to control for those artifacts such as with the parallel use of activity independent fluorophores.

      Strengths:

      - Comprehensive study comparing different cortical regions in diverse behavioral settings in controlled conditions.<br /> - Comparison to the state-of-the-art, i.e. what has been demonstrated with wide-field microscopy.<br /> - Comparison to diverse activity-dependent sensors, including the widely used GCaMP.

      Comments on revisions:

      The authors have addressed my concerns well. I have no further comments.

    1. Reviewer #1 (Public review):

      Summary:

      The authors performed experimental evolution of MreB mutants that have a slow growing round phenotype and studied the subsequent evolutionary trajectory using analysis tool from molecular biology. It was remarkable and interesting that they found that the original phenotype was not restored (most common in these studies) but that the round phenotype was maintained.

      Strengths:

      The finding that the round phenotype was maintained during evolution rather than that the original phenotype, rod shape cells, was recovered is interesting. The paper extensively investigates what happens during adaptation with various different techniques. Also the extensive discussion of the findings at the end of the paper is well thought through and insightful.

    2. Reviewer #3 (Public review):

      This paper addresses a long-standing problem in microbiology: the evolution of bacterial cell shape. Bacterial cells can take a range of forms, among the most common being rods and spheres. The consensus view is that rods are the ancestral form and spheres the derived form. The molecular machinery governing these different shapes is fairly well understood but the evolutionary drivers responsible for the transition between rods and spheres is not. Enter Yulo et al.'s work. The authors start by noting that deletion of a highly conserved gene called MreB in the Gram-negative bacterium Pseudomonas fluorescens reduces fitness but does not kill the cell (as happens in other species like E. coli and B. subtilis) and causes cells to become spherical rather than their normal rod shape. They then ask whether evolution for 1000 generations restores the rod shape of these cells when propagated in a rich, benign medium.

      The answer is no. The evolved lineages recovered fitness by the end of the experiment, growing just as well as the unevolved rod-shaped ancestor, but remained spherical. The authors provide an impressively detailed investigation of the genetic and molecular changes that evolved. Their leading results are:

      (1) The loss of fitness associated with MreB deletion causes high variation in cell volume among sibling cells after cell division;<br /> (2) Fitness recovery is largely driven by a single, loss-of-function point mutation that evolves within the first ~250 generations that reduces the variability in cell volume among siblings;<br /> (3) The main route to restoring fitness and reducing variability involves loss of function mutations causing a reduction of TPase and peptidoglycan cross-linking, leading to a disorganized cell wall architecture characteristic of spherical cells.

      The inferences made in this paper are on the whole well supported by the data. The authors provide a uniquely comprehensive account of how a key genetic change leads to gains in fitness and the spectrum of phenotypes that are impacted and provide insight into the molecular mechanisms underlying models of cell shape.

    1. Reviewer #1 (Public review):

      Summary:

      Evading predation is of utmost importance for most animals and camouflage is one of the predominant mechanisms. Wu et al. set out to test the hypothesis of a unique camouflage system in leafhoppers. These animals coat themselves with brochosomes, which are spherical nanostructures that are produced in the Malpighian tubules and are distributed on the cuticle after eclosion. Based on previous findings on reflectivity properties of brochosomes, the authors provide convincing evidence that these nanostructures indeed reduce reflectivity of the animals thereby reducing predation by jumping spiders. Further, they identify four proteins, which are essential for proper development and function of brochosomes: In RNAi experiments, the regular brochosome structure is lost, the reflectivity reduced and the respective animals are prone to increased predation. Finally, the authors provide phylogenetic sequence analyses and speculate about the evolution of these genes.

      Strengths:

      The study is very comprehensive including careful optical measurements, EM and TM analysis of the nanoparticles and their production line in the malphigian tubules, in vivo predation tests and knock-down experiments to identify essential proteins. Indeed, the results are very convincingly in line with the starting hypothesis such that the study robustly assigns a new biological function to the brochosome coating system.

      A key strength of the study is that the biological relevance of the brochosome coating is convincingly shown by an in vivo predation test using a known predator from the same habitat.

      Another major step forward is an RNAi screen, which identified four proteins, which are essential for the brochosome structure (BSMs). After respective RNAi knock-downs, the brochosomes show curious malformations that are interesting in terms of the self-assembly of these nanostructures. The optical and in vivo predation tests provide excellent support for the model that the RNAi knock-down leads to a change of brochosomes structure, which reduces reflectivity, which in turn leads to a decrease of the antipredatory effect.

      Conclusion:

      The authors successfully tested their hypothesis in a multidisciplinary approach and convincingly assigned a new biological function to the brochosomes system. The results fully support their claims on the involvement of the four BSM genes in brochosome structure, the relevance of brochosomes for predation avoidance and they provide evidence for the evolution of these genes.

      The work is a very interesting study case of the evolutionary emergence of a new system to evade predators. Based on this study, the function of the BSM genes could now be studied in other species to provide insights into putative ancestral functions. Further, studying the self-assembly of such highly regular complex nano-structures will be strongly fostered by the identification of the four key structural genes.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors investigate the optical properties of brochosomes produced by leafhoppers. They hypothesize that brochosomes reduce light reflection on the leafhopper's body surface, aiding in predator avoidance. Their hypothesis is supported by experiments involving jumping spiders. Additionally, the authors employ a variety of techniques including micro-UV-Vis spectroscopy, electron microscopy, transcriptome and proteome analysis, and bioassays. This study is highly interesting, and the experimental data is well-organized and logically presented.

      Strengths:

      The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage. This work provides the first biological evidence demonstrating that natural brochosomes can be used as a camouflage coating to reduce the leafhoppers' observability to their predators. The design of the experiments is novel.

      Weaknesses:

      (1) The observation that brochosome coatings become sparse after 25 days in both male and female leafhoppers, resulting in increased predation by jumping spiders, is intriguing. However, since leafhoppers consistently secrete and groom brochosomes, it would be beneficial to explore why brochosomes become significantly less dense after 25 days.

      (2) The authors demonstrate that brochosome coatings reduce UV (specular) reflection compared to surfaces without brochosomes, which can be attributed to the rough geometry of brochosomes as discussed in the literature. However, it would be valuable to investigate whether the proteins forming the brochosomes are also UV absorbing.

      (3) The experiments with jumping spiders show that brochosomes help leafhoppers avoid predators to some extent. It would be beneficial for the authors to elaborate on the exact mechanism behind this camouflage effect. Specifically, why does reduced UV reflection aid in predator avoidance? If predators are sensitive to UV light, how does the reduced UV reflectance specifically contribute to evasion?

      (4) An important reference regarding the moth-eye effect is missing. Please consider including the following paper: Clapham, P. B., and M. C. Hutley. "Reduction of lens reflection by the 'Moth Eye' principle." Nature 244: 281-282 (1973).

      (5) The introduction should be revised to accurately reflect the related contributions in literature. Specifically, the novelty of this work lies in the demonstration of the camouflage effect of brochosomes using jumping spiders, which is verified for the first time in leafhoppers. However, the proposed use of brochosome powder for camouflage was first described by R.B. Swain (R.B. Swain, Notes on the oviposition and life history of the leafhopper Oncometopta undata Fabr. (Homoptera: Cicadellidae), Entomol. News. 47: 264-266 (1936)). Recently, the antireflective and potential camouflage functions of brochosomes were further studied by Yang et al. based on synthetic brochosomes and simulated vision techniques (S. Yang, et al. "Ultra-antireflective synthetic brochosomes." Nature Communications 8: 1285 (2017)). Later, Lei et al. demonstrated the antireflective properties of natural brochosomes in 2020 (C.-W. Lei, et al., "Leafhopper wing-inspired broadband omnidirectional antireflective embroidered ball-like structure arrays using a nonlithography-based methodology." Langmuir 36: 5296-5302 (2020)). Very recently, Wang et al. successfully fabricated synthetic brochosomes with precise geometry akin to those natural ones, and further elucidated the antireflective mechanisms based on the brochosome geometry and their role in reducing the observability of leafhoppers to their predators (L. Wang et al. "Geometric design of antireflective leafhopper brochosomes." Proceedings of the National Academy of Sciences 121: e2312700121 (2024)).

      Comments on revisions:

      In this revision, the authors have addressed some of the key concerns I raised in our previous comments. However, a few issues remain unaddressed. Additionally, the new experimental data introduced in the manuscript require further clarification, which I outline below.

      (1) As I pointed out in my previous review comments, "The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage." While the authors did cite the original hypothesis proposed by R.B. Swain (1936), they have omitted important references that provide evidence on the use of antireflective properties of brochosomes for camouflage in a synthetic setting (see for example, Fig. 5a of S. Yang, et al. Nat. Commun. 8:1285, 2017). The authors are recommended to revise the Abstract and Introduction accordingly to ensure a fair and accurate representation of the existing literature.

      (2) The antireflection mechanisms of brochosome structures have been discussed in detail, specifically, how their geometries (i.e., brochosome diameter and pore size) contribute to reducing UV reflectance (L. Wang, et al., PNAS. 121: e2312700121, 2024 and P. Banergee, et al., Advanced Photonics Research 4:2200343, 2023). The authors should incorporate these recent findings into their discussion (line 381 - line 383 of the manuscript).

      (3) The authors presented new data brochosomes deposited on a quartz slide and measured their reflectance across UV, visible light, and infrared wavelengths. Since reflectance is highly sensitive to the uniformity of brochosome coverage on the substrate, it is crucial to quantify this coverage across the measurement area for comparison. While the authors include SEM images to illustrate the packing of brochosomes on both the leafhopper wing and the quartz substrate (Fig. S7) at a microscopic scale (~10 um view), it would be beneficial to also provide SEM images at a larger scale (e.g., 100 um - 1 mm) and quantify the density of brochosomes per unit area for comparison.

      (4) For the negative control using acetone to remove the brochosomes the leafhopper wing, have the authors confirmed the absence of brochosomes after treatment? If so, the authors should explicitly indicate this for clarity.

    1. Reviewer #1 (Public review):

      The article provides a timely and well-written examination of how group identification influences collective behaviors and performance using fNIRs and behavioral data.

      Comments on revisions:

      Most Reviewer concerns have been addressed in the revised manuscript, but some limitations persist with respect to core aspects of study design (e.g., long block durations and lack of counter-balancing) and analysis (i.e., the potential circularity of some analyses, the insufficiency of a mediation model to demonstrate causality, and a lack of clarity concerning the model us to map task activation).

      Editor's note: Although the Reviewers found the reviews generally responsive, some fundamental concerns remain which will not be changed by further revision.

    1. Reviewer #1 (Public review):

      The goal of this study was to identify the phenotype of olfactory ensheathing cells (OECs) that have been associated with neural tissue repair, and investigate the properties of these cells that can be used to identify them. OECs modify inhibitory glial scar formation, enabling axon regeneration past the scar border and into the lesion center. Single-cell RNA sequencing revealed diverse subtypes of OECs expressing novel marker genes associated with progenitor, axonal regeneration, repair, and microglia-like functions, suggesting their potential roles in wound healing, injury repair, and axonal regeneration. Additionally, the study identified secreted molecules such as Reelin and Connective tissue growth factor, which are important for neural repair and axonal outgrowth, further supporting the multifunctional nature of OECs in facilitating spinal cord injury recovery. This is an extremely well written and impactful series of experiments from a renowned leader in the field. The experimental questions are timely, with similar therapeutic approaches being prepared for clinical trial. The results address a gap that has persisted in the field for several decades, and one that has asked by many scientists long before technology existed to find answers. This highlights the importance of these experiments and the results reported here. The authors have also included a thoughtful discussion that highlights the importance of their data in the context of prior research. They have carefully interpreted their results and also indicate where additional studies in future work will continue to expand our knowledge of these important cells and their potential use for neural repair.

    2. Reviewer #2 (Public review):

      Summary

      This manuscript explores the transcriptomic identities of olfactory ensheathing cells (OECs), glial cells that support life-long axonal growth in olfactory neurons, as they relate to spinal cord injury repair. The authors show that transplantation of cultured, immunopurified rodent OECs at a spinal cord injury site can promote injury-bridging axonal regrowth. They then characterize these OECs using single-cell RNA sequencing, identifying five subtypes and proposing functional roles that include regeneration, wound healing, and cell-cell communication. They identify one progenitor OEC subpopulation and also report several other functionally relevant findings, notably, that OEC marker genes contain mixtures of other glial cell type markers (such as for Schwann cells and astrocytes), and that these cultured OECs produce and secrete Reelin, a regrowth-promoting protein that has been disputed as a gene product of OECs.

      Strengths

      This manuscript offers an extensive, cell-level characterization of OECs, supporting their potential therapeutic value for spinal cord injury and suggesting potential underlying repair mechanisms. The authors use various approaches to validate their findings, providing interesting images that show the overlap between sprouting axons and transplanted OECs, and showing that OEC marker genes identified using single-cell RNA sequencing are present in vivo, in both olfactory bulb tissue and spinal cord after OEC transplantation.

      Concerns about quantification raised during the review were suitably addressed by the authors.

    1. Reviewer #1 (Public review):

      Summary:

      This study provides new insights on the phenomenon of pre-saccadic foveal prediction previously reported by the same authors. In particular, this study examines to what extent this phenomenon varies based on the visibility of the saccade target. Visibility is defined as the contrast level of the target with respect to the noise background, and it is related to the signal-to-noise ratio of the target. A more visible target facilitates the oculomotor behavior planning and execution, however, as speculated by the authors, it can also benefit foveal prediction even if the foveal stimulus visibility is maintained constant. Remarkably, the authors show that presenting a highly visible saccade target is beneficial for foveal vision as detection of stimuli with an orientation similar to that of the saccade target is improved, the lower is the saccade target visibility, the less prominent is this effect. The results are convincing and the research methodology is technically sound.

      Comments on revisions:

      The authors addressed all the concerns raised in the previous rounds of reviews.

    2. Reviewer #3 (Public review):

      Summary:

      In this manuscript, the authors ran a dual task. Subjects monitored a peripheral location for a target onset (to generate a saccade to), and they also monitored a foveal location for a foveal probe. The foveal probe could be congruent or incongruent with the orientation of the peripheral target. In this study, the authors manipulated the conspicuity of the peripheral target, and they saw changes in performance in the foveal task.

      Comments on revisions:

      The authors have addressed all comments. Thanks.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript by Velichko et al. argues that the ability of nucleolar protein Treacles to form phase-separated condensates is necessary for its function in nucleolar organization, rRNA transcription, and rDNA repair. These findings may be of interest to the communities studying biomolecular condensates, nucleolar organization, and ribosome biogenesis. The authors propose that Treacle's ability to undergo liquid-liquid phase separation is the key to its role as a scaffold for the FC of the nucleolus. The experiments in this study were designed and performed well, particularly the overexpression studies, done in the absence of endogenous protein and accounted for the protein expression levels.

      Comments on revisions:

      I am satisfied with the authors' revisions; my earlier concerns have been addressed thoroughly, and the manuscript is considerably improved. This study is important for our understanding of the role of Treacle in nucleolar organization and function, as well as general principles of cellular compartmentalization that involve biomolecular condensates.

    2. Reviewer #2 (Public review):

      Summary:

      Velichko, et al. investigate the role played by the long intrinsically disordered protein Trecle in nucleolar morphology and function, with an interest in its potential ability to undergo condensation. The authors explore Treacle's role in core functions of the nucleolus (rRNA biogenesis and DNA repair), which has been a subject of continual investigation since it was identified that truncation of Treacle is the primary genetic cause of Treacher-Collins syndrome. They show that knock out of Treacle leads to de-mixing of canonical markers of the FC (UBF, RPA194) and DFC (FBL) phases of the nucleolus. They also show that replacing Treacle with mutants that either remove the central region of Treacle (∆83-1121) or reduce the segregation of charged residues by scrambling them (CS- Charge Scrambled) results in different FRAP behavior of the condensates that result from Treacle over-expression. These data give new insight into the role played by the charge-segregated central region of Treacle in terms of having the potential to undergo condensation.

      Strengths:

      The characterizations of changes to nuclear morphology upon Treacle knockout is the strength of this study. The authors characterized effects on the canonical markers of the FC and DFC phases support the idea that Treacle has a scaffolding function. While the effect of Treacle perturbations has been studied before, this has often been investigated in the context of organismal development or rRNA biogenesis and less often at the sub-cellular level, as the authors have carried out.

      Another strength of this study is its characterization of the effects of the charge scramble mutant. The authors find that replacing endogenous Treacle with this mutant reduces the bulk dynamics of Treacle as assessed by FRAP, de-mixes FBL from the DFC, lowers pre-rRNA synthesis, and abolishes the recruitment of the DNA-damage response factor TOPBP1.

      Weaknesses:

      The conclusion that Treacle is a core scaffold of the FC is weakly supported. Recombinant Treacle has intrinsic potential to condense, and its condensation is disrupted by the expected solution conditions (i.e., condensates fail to form at high salt but do form in the presence of an aliphatic alcohol). It should be kept in mind that all proteins will condense at sufficiently high concentrations and under crowding. The authors observed condensation at 100uM protein and 5% PEG8000.

    3. Reviewer #3 (Public review):

      Summary:

      This study provides evidence that the protein Treacle plays an essential role in the structure and function of the fibrillar center (FC) of the nucleolus, which is surrounded by the dense fibrillar component (DFC) and the granular component (GC). The authors provide new evidence that, like the DFC and GC, the functional FC compartment involves a biomolecular condensate that contains Treacle as a key component. Treacle is essential to transcription of the rDNA as well as proper rRNA processing that the authors tie to a role in maintaining separation of FC components from the DFC. In vitro and in vivo experiments highlight that Treacle is itself capable of undergoing condensation in a manner that depends on concentration and charge-charge interactions, but is not affected by 1,6 hexanediol, which disrupts weak hydrophobic interactions. Attempting to generate separation-of-function mutants, the authors provide further evidence of complex interactions that drive proper condensation in the FC mediated by both the central repeat (low-complexity, likely driving the condensation) and C-terminal domain (which appears to target the specificity of the condensation to the proper location). Using mutant forms of Treacle defective in condensation, the authors provide evidence that these same protein forms are also disrupted in supporting Treacle's functions in rDNA transcription and rRNA processing. Last, the authors suggest that cells lacking Treacle are defective in the DNA damage response at the rDNA in response to VP16.

      Strengths:

      In general, the data are of high quality, the experiments are well-designed and the findings are carefully interpreted. The findings of the work complement prior high-impact studies of the DFC and GC that have identified constituent proteins as the lynchpins of the biomolecular condensates that organize the nucleolus into its canonical three concentric compartment structure and are therefore likely to be of broad interest. The attempts to generate separation-of-function mutants to dissect the contribution of condensation to Treacle function are ambitious and critical to demonstrating the relevance of this property to the biology of the FC. The complementarity of the methods applied to investigate Treacle function are appropriate and the findings integrate well towards a compelling narrative.

      Weaknesses:

      While the separation of function mutants of Treacle are a major strength of the work, further studies will be required to fully explore the relevance of Treacle condensation to the stability of the rDNA repeats.

    1. Reviewer #1 (Public review):

      Summary:

      In this meticulously conducted study, the authors show that Drosophila epidermal cells can modulate escape responses to noxious mechanical stimuli. First, they show that activation of epidermal cells evokes many types of behaviors including escape responses. Subsequently, they demonstrate that most somatosensory neurons are activated by activation of epidermal cells, and that this activation has a prolonged effect on escape behavior. In vivo analyses indicate that epidermal cells are mechanosensitive and require stored-operated calcium channel Orai. Altogether, the authors conclude that epidermal cells are essential for nociceptive sensitivity and sensitization, serving as primary sensory noxious stimuli.

      Strengths:

      The manuscript is clearly written. The experiments are logical and complementary. They support the authors' main claim that epidermal cells are mechanosensitive and that epidermal mechanically evoked calcium responses require the stored-operated calcium channel Orai. Epidermal cells activate nociceptive sensory neurons as well as other somatosensory neurons in Drosophila larvae, and thereby prolong escape rolling evoked by mechanical noxious stimulation.

      Weaknesses:

      In several places the text is unclear. For example, core details are missing in the protocols, including the level of LED intensity used, which are necessary for other researchers to reproduce the experiments. Secondly, the rationales are missing for some experiments (for experiments X, Y, and Z). It would be helpful to clarify for your readers why the experiments (for example Figure 3S2) were performed. Finally, for most experiments, the epidermal cells are activated for 60 s, which is long when considering that nocifensive rolling occurs on a timescale of milliseconds. It would be informative to know the shortest duration of epidermal cell activation that is sufficient for observing the behavioral phenotype (prolongation of escape behavior) and activation of sensory neurons.

    2. Reviewer #2 (Public review):

      Summary:

      The authors provide compelling evidence that stimulation of epidermal cells in Drosophila larvae results in the stimulation of sensory neurons that evoke a variety of behavioral responses. Further, the authors demonstrate that epidermal cells are inherently mechanoresponsive and implicate a role for store-operated calcium entry (mediated by Stim and Orai) in the communication to sensory neurons.

      Strengths:

      The study represents a significant advance in our understanding of mechanosensation. Multiple strengths are noted. First, the genetic analyses presented in the paper are thorough with appropriate consideration to potential confounds. Second, behavioral studies are complemented by sophisticated optogenetics and imaging studies. Third, identification of roles for store-operated calcium entry is intriguing. Lastly, conservation of these pathways in vertebrates raise the possibility that the described axis is also functional in vertebrates.

      Weaknesses:

      The study has a few conceptual weaknesses that are arguably minor. The involvement of store-operated calcium entry implicates ER calcium store release. Whether mechanical stimulation evokes ER calcium release in epidermal cells and how this might come about (e.g., which ER calcium channels, roles for calcium-induced calcium release etc.) remains unaddressed. On a related note, the kinetics of store-operated calcium entry is very distinct from that required for SV release. The link between SOC and epidermal cells-neuron transmission is not reconciled. Finally, it is not clear how optogenetic stimulation of epidermal cells results in the activation of SOC.

      Revised manuscript:

      The authors have adequately addressed my original concerns.

    1. Reviewer #1 (Public review):

      Summary:

      The authors show certain memory deficits in a mouse knock-in model of Alzheimer's Disease (AD). They show that the observed memory deficits can be explained by a computational model, the latent cause model of associative memory. The memory tasks used include the fear memory task (CFC) and the 'reverse' Barnes maze. Research on AD is important given its known huge societal burden. Likewise, better characterization of the behavioral phenotypes of genetic mouse models of AD is also imperative to advance our understanding of the disease using these models. In this light, I applaud the authors' efforts.

      Strengths:

      (1) Combining computational modelling with animal behavior in genetic knock-in mouse lines is a promising approach, which will be beneficial to the field and potentially explain any discrepancies in results across studies as well as provide new predictions for future work.

      (2) The authors' usage of multiple tasks and multiple ages is also important to ensure generalization across memory tasks and 'modelling' of the progression of the disease.

      Weaknesses:

      (1) I have some concerns regarding the interpretation of the behavioral results. Since the computational model then rests on the authors' interpretation of the behavioral results, it, in turn, makes judging the model's explanatory power difficult as well. For the CFC data, why do knock-in mice have stronger memory in test 1 (Figure 2C)? Does this mean the knock-in mice have better memory at this time point? Is this explained by the latent cause model? Are there some compensatory changes in these mice leading to better memory? The authors use a discrimination index across tests to infer a deficit in re-instatement, but this indicates a relative deficit in re-instatement from memory strength in test 1. The interpretation of these differential DIs is not straightforward. This is evident when test 1 is compared with test 2, i.e., the time point after extinction, which also shows a significant difference across groups, Figure 2F, in the same direction as the re-instatement. A clarification of all these points will help strengthen the authors' case

      (2) I have some concerns regarding the interpretation of the Barnes maze data as well, where there already seems to be a deficit in the memory at probe test 1 (Figure 6C). Given that there is already a deficit in memory, would not a more parsimonious explanation of the data be that general memory function in this task is impacted in these mice, rather than the authors' preferred interpretation? How does this memory weakening fit with the CFC data showing stronger memories at test 1? While I applaud the authors for using multiple memory tasks, I am left wondering if the authors tried fitting the latent cause model to the Barnes maze data as well.

      (3) Since the authors use the behavioral data for each animal to fit the model, it is important to validate that the fits for the control vs. experimental groups are similar to the model (i.e., no significant differences in residuals). If that is the case, one can compare the differences in model results across groups (Figures 4 and 5). Some further estimates of the performance of the model across groups would help.

      (4) Is there an alternative model the authors considered, which was outweighed in terms of prediction by this model? One concern here is also parameter overfitting. Did the authors try leaving out some data (trials/mice) and predicting their responses based on the fit derived from the training data?

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript proposes that the use of a latent cause model for the assessment of memory-based tasks may provide improved early detection of Alzheimer's Disease as well as more differentiated mapping of behavior to underlying causes. To test the validity of this model, the authors use a previously described knock-in mouse model of AD and subject the mice to several behaviors to determine whether the latent cause model may provide informative predictions regarding changes in the observed behaviors. They include a well-established fear learning paradigm in which distinct memories are believed to compete for control of behavior. More specifically, it's been observed that animals undergoing fear learning and subsequent fear extinction develop two separate memories for the acquisition phase and the extinction phase, such that the extinction does not simply 'erase' the previously acquired memory. Many models of learning require the addition of a separate context or state to be added during the extinction phase and are typically modeled by assuming the existence of a new state at the time of extinction. The Niv research group, Gershman et al. 2017, have shown that the use of a latent cause model applied to this behavior can elegantly predict the formation of latent states based on a Bayesian approach, and that these latent states can facilitate the persistence of the acquisition and extinction memory independently. The authors of this manuscript leverage this approach to test whether deficits in the production of the internal states, or the inference and learning of those states, may be disrupted in knock-in mice that show both a build-up of amyloid-beta plaques and a deterioration in memory as the mice age.

      Strengths:

      I think the authors' proposal to leverage the latent cause model and test whether it can lead to improved assessments in an animal model of AD is a promising approach for bridging the gap between clinical and basic research. The authors use a promising mouse model and apply this to a paradigm in which the behavior and neurobiology are relatively well understood - an ideal situation for assessing how a disease state may impact both the neurobiology and behavior. The latent cause model has the potential to better connect observed behavior to underlying causes and may pave a road for improved mapping of changes in behavior to neurobiological mechanisms in diseases such as AD.

      Weaknesses:

      I have several substantial concerns which I've detailed below. These include important details on how the behavior was analyzed, how the model was used to assess the behavior, and the interpretations that have been made based on the model.

      (1) There is substantial data to suggest that during fear learning in mice separate memories develop for the acquisition and extinction phases, with the acquisition memory becoming more strongly retrieved during spontaneous recovery and reinstatement. The Gershman paper, cited by the authors, shows how the latent causal model can predict this shift in latent states by allowing for the priors to decay over time, thereby increasing the posterior of the acquisition memory at the time of spontaneous recovery. In this manuscript, the authors suggest a similar mechanism of action for reinstatement, yet the model does not appear to return to the acquisition memory state after reinstatement, at least based on the examples shown in Figures 1 and 3. Rather, the model appears to mainly modify the weights in the most recent state, putatively the 'extinction state', during reinstatement. Of course, the authors must rely on how the model fits the data, but this seems problematic based on prior research indicating that reinstatement is most likely due to the reactivation of the acquisition memory. This may call into question whether the model is successfully modeling the underlying processes or states that lead to behavior and whether this is a valid approach for AD.

      (2) As stated by the authors in the introduction, the advantage of the fear learning approach is that the memory is modified across the acquisition-extinction-reinstatement phases. Although perhaps not explicitly stated by the authors, the post-reinstatement test (test 3) is the crucial test for whether there is reactivation of a previously stored memory, with the general argument being that the reinvigorated response to the CS can't simply be explained by relearning the CS-US pairing, because re-exposure the US alone leads to increase response to the CS at test. Of course there are several explanations for why this may occur, particularly when also considering the context as a stimulus. This is what I understood to be the justification for the use of a model, such as the latent cause model, that may better capture and compare these possibilities within a single framework. As such, it is critical to look at the level of responding to both the context alone and to the CS. It appears that the authors only look at the percent freezing during the CS, and it is not clear whether this is due to the contextual US learning during the US re-exposure or to increased response to the CS - presumably caused by reactivation of the acquisition memory. For example, the instance of the model shown in Figure 1 indicates that the 'extinction state', or state z6, develops a strong weight for the context during the reinstatement phase of presenting the shock alone. This state then leads to increased freezing during the final CS probe test as shown in the figure. By not comparing the difference in the evoked freezing CR at the test (ITI vs CS period), the purpose of the reinstatement test is lost in the sense of whether a previous memory was reactivated - was the response to the CS restored above and beyond the freezing to the context? I think the authors must somehow incorporate these different phases (CS vs ITI) into their model, particularly since this type of memory retrieval that depends on assessing latent states is specifically why the authors justified using the latent causal model.

      (3) This is related to the second point above. If the question is about the memory processes underlying memory retrieval at the test following reinstatement, then I would argue that the model parameters that are not involved in testing this hypothesis be fixed prior to the test. Unlike the Gershman paper that the authors cited, the authors fit all parameters for each animal. Perhaps the authors should fit certain parameters on the acquisition and extinction phase, and then leave those parameters fixed for the reinstatement phase. To give a more concrete example, if the hypothesis is that AD mice have deficits in differentiating or retrieving latent states during reinstatement which results in the low response to the CS following reinstatement, then perhaps parameters such as the learning rate should be fixed at this point. The authors state that the 12-month-old AD mice have substantially lower learning rate measures (almost a 20-fold reduction!), which can be clearly seen in the very low weights attributed to the AD mouse in Figure 3D. Based on the example in Figure 3D, it seems that the reduced learning rate in these mice is most likely caused by the failure to respond at test. This is based on comparing the behavior in Figures 3C to 3D. The acquisition and extinction curves appear extremely similar across the two groups. It seems that this lower learning rate may indirectly be causing most of the other effects that the authors highlight, such as the low σx, and the changes to the parameters for the CR. It may even explain the extremely high K. Because the weights are so low, this would presumably lead to extremely low likelihoods in the posterior estimation, which I guess would lead to more latent states being considered as the posterior would be more influenced by the prior.

      (4) Why didn't the authors use the latent causal model on the Barnes maze task? The authors mention in the discussion that different cognitive processes may be at play across the two tasks, yet reversal tasks have been suggested to be solved using latent states to be able to flip between the two different task states. In this way, it seems very fitting to use the latent cause model. Indeed, it may even be a better way to assess changes in σx as there are presumably 12 observable stimuli/locations.

    3. Reviewer #3 (Public review):

      Summary:

      This paper seeks to identify underlying mechanisms contributing to memory deficits observed in Alzheimer's disease (AD) mouse models. By understanding these mechanisms, they hope to uncover insights into subtle cognitive changes early in AD to inform interventions for early-stage decline.

      Strengths:

      The paper provides a comprehensive exploration of memory deficits in an AD mouse model, covering the early and late stages of the disease. The experimental design was robust, confirming age-dependent increases in Aβ plaque accumulation in the AD model mice and using multiple behavior tasks that collectively highlighted difficulties in maintaining multiple competing memory cues, with deficits most pronounced in older mice.

      In the fear acquisition, extinction, and reinstatement task, AD model mice exhibited a significantly higher fear response after acquisition compared to controls, as well as a greater drop in fear response during reinstatement. These findings suggest that AD mice struggle to retain the fear memory associated with the conditioned stimulus, with the group differences being more pronounced in the older mice.

      In the reversal Barnes maze task, the AD model mice displayed a tendency to explore the maze perimeter rather than the two potential target holes, indicating a failure to integrate multiple memory cues into their strategy. This contrasted with the control mice, which used the more confirmatory strategy of focusing on the two target holes. Despite this, the AD mice were quicker to reach the target hole, suggesting that their impairments were specific to memory retrieval rather than basic task performance.

      The authors strengthened their findings by analyzing their data with a leading computational model, which describes how animals balance competing memories. They found that AD mice showed somewhat of a contradiction: a tendency to both treat trials as more alike than they are (lower α) and similar stimuli as more distinct than they are (lower σx) compared to controls.

      Weaknesses:

      While conceptually solid, the model struggles to fit the data and to support the key hypothesis about AD mice's ability to retain competing memories. These issues are evident in Figure 3:

      (1) The model misses key trends in the data, including the gradual learning of fear in all groups during acquisition, the absence of a fear response at the start of the experiment, the increase in fear at the start of day 2 of extinction (especially in controls), and the more rapid reinstatement of fear observed in older controls compared to acquisition.

      (2) The model attributes the higher fear response in controls during reinstatement to a stronger association with the context from the unsignaled shock phase, rather than to any memory of the conditioned stimulus from acquisition.

      These issues lead to potential overinterpretation of the model parameters. The differences in α and σx are being used to make claims about cognitive processes (e.g., overgeneralization vs. overdifferentiation), but the model itself does not appear to capture these processes accurately.

      The authors could benefit from a model that better matches the data and that can capture the retention and recollection of a fear memory across phases.

      Conclusion:

      Overall, the data support the authors' hypothesis that AD model mice struggle to retain competing memories, with the effect becoming more pronounced with age. While I believe the right computational model could highlight these differences, the current model falls short in doing so.

    1. Reviewer #1 (Public review):

      Summary:

      In the current study, Huang et al. examined ACC response during a novel discrimination-avoid task. The authors concluded that ACC neurons primarily encode post-action variables over extended periods, reflecting the animal's preceding actions rather than the outcomes or values of those actions. Specifically, they identified two subgroups of ACC neurons that responded to different aspects of the actions. This work represents admirable efforts to investigate the role of ACC in task-performing mice. However, in my opinion, alternative explanations of the data were not sufficiently explored, and some key findings were not well supported.

      Strengths:

      The development of the new discrimination-avoid task is applauded. Single-unit electrophysiology in task-performing animals represents admirable efforts and the datasets are valuable. The identification of different groups of encoding neurons in ACC can be potentially important.

      Weaknesses:

      One major conclusion is that ACC primarily encodes the so-called post-action variables (specifically shuttle crossing). However, only a single example session was included in Figure 2, while in Supplementary Figure 2 a considerable fraction of ACC neurons appears to respond to either the onset of movement or ramp up their activity prior to movement onset. How did the authors reach the conclusion that ACC preferentially respond to shuttle crossing?

      In Figure 4, it was concluded that ACC neurons respond to action independent of outcome. Since these neurons are active on both correct and incorrect shuttle but not stay trials, they seem to primarily respond to overt movement. If so, the rationale for linking ACC activity and adaptive behavior/associative learning is not very clear to me. Further analyses are needed to test whether their firing rates correlated with locomotion speed or acceleration/deceleration. On a similar note, to what extent are the action state neurons actually responding to locomotion-related signals? And can ACC activity actually differentiate correct vs. incorrect stays?

      Given that a considerable amount of ACC neurons encode 'action content', it is not surprising that by including all neurons the model is able to make accurate predictions in Figure 6. How would the model performance change by removing the content neurons?

      Moving on to Figure 7. Since Figure 4 showed that ACC neurons respond to movement regardless of outcome, it is somewhat puzzling how ACC activity can be linked to future performance.

      Two mice contributed about 50% of all the recorded cells. How robust are the results when analyzing mouse by mouse?

      Lastly, the development of the new discrimination-avoid task is applauded. However, a major missing piece here is to show the importance of ACC in this task and what aspects of this behavior require ACC.

    2. Reviewer #2 (Public review):

      Summary:

      The current dataset utilized a 2x2 factorial shuttle-escape task in combination with extracellular single-unit recording in the anterior cingulate cortex (ACC) of mice to determine ACC action coding. The contributions of neocortical signaling to action-outcome learning as assessed by behavioral tasks outside of the prototypical reward versus non-reward or punished vs non-punished is an important and relevant research topic, given that ACC plays a clear role in several human neurological and psychiatric conditions. The authors present useful findings regarding the role of ACC in action monitoring and learning. The core methods themselves - electrophysiology and behavior - are adequate; however, the analyses are incomplete since ruling out alternative explanations for neural activity, such as movement itself, requires substantial control analyses, and details on statistical methods are not clear.

      Strengths:

      (1) The factorial design nicely controls for sensory coding and value coding, since the same stimulus can signal different actions and values.

      (2) The figures are mostly well-presented, labeled, and easy to read.

      (3) Additional analyses, such as the 2.5/7.5s windows and place-field analysis, are nice to see and indicate that the authors were careful in their neural analyses.

      (4) The n-trial + 1 analysis where ACC activity was higher on trials that preceded correct responses is a nice addition, since it shows that ACC activity predicts future behavior, well before it happens.

      (5) The authors identified ACC neurons that fire to shuttle crossings in one direction or to crossings in both directions. This is very clear in the spike rasters and population-scaled color images. While other factors such as place fields, sensory input, and their integration can account for this activity, the authors discuss this and provide additional supplemental analyses.

      Weaknesses:

      (1) The behavioral data could use slightly more characterization, such as separating stay versus shuttle trials.

      (2) Some of the neural analyses could use the necessary and sufficient comparisons to strengthen the authors' claims.

      (3) Many of the neural analyses seem to utilize long time windows, not leveraging the very real strength of recording spike times. Specifics on the exact neural activity binning/averaging, tests, classifier validation, and methods for quantification are difficult to find.

      (4) The neural analyses seem to suggest that ACC neurons encode one variable or the other, but are there any that multiplex? Given the overwhelming evidence of multiplexing in the ACC a bit more discussion of its presence or absence is warranted.

    3. Reviewer #3 (Public review):

      Summary:

      The authors record from the ACC during a task in which animals must switch contexts to avoid shock as instructed by a cue. As expected, they find neurons that encode context, with some encoding of actions prior to the context, and encoding of neurons post-action. The primary novelty of the task seems to be dynamically encoding action-outcome in a discrimination-avoidance domain, while this is traditionally done using operant methods. While I'm not sure that this task is all that novel, I can't recall this being applied to the frontal cortex before, and this extends the well-known action/context/post-context encoding of ACC to the discrimination-avoidance domain.

      While the analysis is well done, there are several points that I believe should be elaborated upon. First, I had questions about several details (see point 3 below). Second, I wonder why the authors downplayed the clear action coding of ACC ensembles. Third, I wonder if the purported 'novelty' of the task (which I'm not sure of) and pseudo-debate on ACC's role undermines the real novelty - action/context/outcome encoding of ACC in discrimination-avoidance and early learning.

      Strengths:

      Recording frontal cortical ensembles during this task is particularly novel, and the analyses are sophisticated. The task has the potential to generate elegant comparisons of action and outcome, and the analyses are sophisticated.

      Weaknesses:

      I had some questions that might help me understand this work better.

      (1) I wonder if the field would agree that there is a true 'debate' and 'controversy' about the ACC and conflict monitoring, or if this is a pseudodebate (Line 34). They cite 2 very old papers to support this point. I might reframe this in terms of the frontal cortex studying action-outcome associations in discrimination-avoidance, as the bulk of evidence in rodents comes from overtrained operant behavior, and in humans comes from high-level tasks, and humans are unlikely to get aversive stimuli such as shocks.

      (2) Does the purported novelty of the task undermine the argument? While I don't have an exhaustive knowledge of this behavior, the novelty involves applying this ACC. There are many paradigms where a shock triggers some action that could be antecedents to this task.

      (3) The lack of details was confusing to me:

      a) How many total mice? Are the same mice in all analyses? Are the same neurons? Which training day? Is it 4 mice in Figure 3? Five mice in line 382? An accounting of mice should be in the methods. All data points and figures should have the number of neurons and mice clearly indicated, along with a table. Without these details, it is challenging to interpret the findings.

      b) How many neurons are from which stage of training? In some figures, I see 325, in some ~350, and in S5/S2B, 370. The number of neurons should be clearly indicated in each figure, and perhaps a table.

      c) Were the tetrodes driven deeper each day? The depth should be used as a regressor in all analyses?

      d) Was is really ACC (Figure 2A)? Some shanks are in M2? All electrodes from all mice need to be plotted as a main figure with the drive length indicated.

      e) It's not clear which sessions and how many go into which analysis

      f) How many correct and incorrect trials (<7?) are there per session?

      g) Why 'up to 10 shocks' on line 358? What amplitudes were tried? What does scrambled mean?

      (4) Why do the authors downplay pre-action encoding? It is clearly evident in the PETHs, and the classifiers are above chance. It's not surprising that post-shuttle classification is so high because the behavior has occurred. This is most evident in Figure S2B, which likely should be a main figure.

      (5) The statistics seem inappropriate. A linear mixed effects model accounting for between-mouse variance seems most appropriate. Statistical power or effect size is needed to interpret these results. This is important in analyses like Figure 7C or 6B.

      (6) Better behavioral details might help readers understand the task. These can be pulled from Figures S2 and S5. This is particularly important in a 'novel' task.

      (7) Can the authors put post-action encoding on the same classification accuracy axes as Figure 6B? It'd be useful to compare.

      (8) What limitations are there? I can think of several - number of animals, lack of causal manipulations, ACC in rodents and humans.

      Minor:

      (1) Each PCA analysis needs a scree plot to understand the variance explained.

      (2) Figure 4C - y and x-axes have the same label?

      (3) What bin size do the authors use for machine learning (Not clear from line 416)?

      (4) Why not just use PCA instead of 'dimension reduction' (of which there are many?)

      (5) Would a video enhance understanding of the behavior?

    1. Reviewer #1 (Public review):

      Summary:

      The authors tackled the public concern about E-cigarettes among young adults by examining the lung immune environment in mice using single-cell RNA sequencing, discovering a subset of Ly6G- neutrophils with reduced IL-1 activity and increased CD8 T cells following exposure to tobacco-flavored e-cigarettes. Preliminary serum cotinine (nicotine metabolite) measurements validated the effective exposure to fruit, menthol, and tobacco-flavored e-cigarettes with air and PG:VG serving as control groups. They also highlighted the significance of metal leaching, which fluctuated over different exposure durations to flavored e-cigarettes, underscoring the inherent risks posed by these products. The scRNAseq analysis of e-cig exposure to flavors and tobacco demonstrated the most notable differences in the myeloid and lymphoid immune cell populations. Differentially expressed genes (DEGs) were identified for each group and compared against the air control. Further sub-clustering revealed a flavor-specific rise in Ly6G- neutrophils and heightened activation of cytotoxic T cells in response to tobacco-flavored e-cigarettes. These effects varied by sex, indicating that immune changes linked to e-cig use are dependent on gender. By analyzing the expression of various genes and employing gene ontology and gene enrichment analysis, they identified key pathways involved in this immune dysregulation resulting from flavor exposure. Overall, this study affirmed that e-cigarette exposure can suppress the neutrophil-mediated immune response, subsequently enhancing T cell toxicity in the lung tissue of mice.

      Strengths:

      This study used single-cell RNA sequencing to comprehensively analyze the impact of e-cigarettes on the lung. The study pinpointed alterations in immune cell populations and identified differentially expressed genes and pathways that are disrupted following e-cigarette exposure. The manuscript is well written, the hypothesis is clear, the experiments are logically designed with proper control groups, and the data is thoroughly analyzed and presented in an easily interpretable manner. Overall, this study suggested novel mechanisms by which e-cigs impact lung immunity and created a dataset that could benefit the lung immunity field.

      Weaknesses:

      (1) The authors included a valuable control group - the PG:VG group, since PG:VG is the foundation of the e-liquid formulation. However, most of the comparative analyses use the air group as the control. Further analysis comparing the air group to the PG:VG group, and the PG:VG group to the individual flavored e-cig groups will provide more clear insights into the true source of irritation. This is done for a few analyses but not consistently throughout the paper. Flavor-specific effects should be discussed in greater detail. For example, Figure 1E shows that the Fruit flavor group exhibits more severe histological pathology but similar effects were not corroborated by the single-cell data.

      (2) The characterization of Ly6g+ vs Ly6g- neutrophils is interesting and potentially very impactful. Key results like this from scRNAseq analyses should be validated by qPCR and flow cytometry.

      Also, a recent study by Ruscitti et al reported Ly6g+ macrophages in the lung which can potentially confound the cell type analysis. A more detailed marker gene and sub-population analysis of the myeloid clusters could rule out this potential confounding factor.

    2. Reviewer #2 (Public review):

      This study provides some interesting observations on how different flavors of e-cigarettes can affect lung immunology, however there are numerous flaws including a low number of replicates and a lack of effective validation methods which reduces the robustness and rigor of the findings.

      Strengths:

      The strength of the study is the successful scRNA-seq experiment which gives good preliminary data that can be used to create new hypotheses in this area.

      Weaknesses:

      The major weakness is the low number of replicates and the limited analysis methods. Two biological n per group is not acceptable to base any solid conclusions. Any validatory data was too little (only cell % data) and did not always support the findings (e.g. Figure 4D does not match 4C). Often n seems to be combined and only one data point is shown, it is not at all clear how the groups were analysed and how many cells in each group were compared.

      Other specific weaknesses were identified in addition to the ones above:

      (1) Only 71,725 cells means only 7,172 per group, which is 3,586 per animal - how many of these were neutrophils, T-cells, and macrophages? This was not shown and could be too low.

      (2) The dynamic range of RNA measurement using scRNAseq is known to be limited - how do we know whether genes are not expressed or just didn't hit detection? This links into the Ly6G negative neutrophil comment, but in general, the lack of gene expression in this kind of data should be viewed with caution, especially with a low n number and few cells.

      (3) There is no rigorous quantification of Ly6G+ and Ly6G- cells int he flow cytometry data.

      (4) Eosinophils are heavily involved in lung biology but are missing from the analysis.

      (5) The figures had no titles so were difficult to navigate.

      (6) PGVG is not defined and not introduced early enough.

      (7) Neutrophils are not well known to proliferate, so any claims about proliferation need to be accompanied by validation such as BrdU or other proliferation assays.

      (8) It was not clear how statistics were chosen and why Table S2 had a good comparison (two-way ANOVA with gender as a variable) but this was not used for other data particularly when looking at more functional RNA markers (Table S2 also lacks the interaction statistic which is most useful here).

      (9) Many statistics are only vs air control, but it would be more useful as a flavour comparison to see these vs PGVG. In some cases, the carrier PGVG looks worse than some of the flavours (which have nicotine).

      (10) The n number is a large issue, but in Figures such as 4, 6, and 7 it could be a bigger factor. The number of significant genes identified has been determined by chance rather than any real difference, e.g. Is Il1b not identified in Fruit flavour vs air because there wasn't enough n, while in Air vs Tobacco, it randomly hit the significance mark. This is but an example of the problems with the analysis and conclusions

      (11) The data in Figure 7A is confusing, if this is a comparison to air, then why does air vs air not equal 1? Even if this was the comparison to the average of air between males and females, then this doesn't explain why CCL12 is >1 in both. Is this z-score instead? Regardless the data is difficult to interpret in this format.

      (12) Individual n was not shown for almost all experiments - e.g. Figure 1D - what is this representative of? Figure 2D - is this bulk-grouped data for all cells and all mice? The heatmaps are also pooled from 2n and don't show the variability.

    3. Reviewer #3 (Public review):

      This work aims to establish cell-type specific changes in gene expression upon exposure to different flavors of commercial e-cigarette aerosols compared to control or vehicle. Kaur et al. conclude that immune cells are most affected, with the greatest dysregulation found in myeloid cells exposed to tobacco-flavored e-cigs and lymphoid cells exposed to fruit-flavored e-cigs. The up-and-down-regulated genes are heavily associated with innate immune response. The authors suggest that a Ly6G-deficient subset of neutrophils is found to be increased in abundance for the treatment groups, while gene expression remains consistent, which could indicate impaired function. Increased expression of CD4+ and CD8+ T cells along with their associated markers for proliferation and cytotoxicity is thought to be a result of activation following this decline in neutrophil-mediated immune response.

      Strengths:

      (1) Single-cell sequencing data can be very valuable in identifying potential health risks and clinical pathologies of lung conditions associated with e-cigarettes considering they are still relatively new.

      (2) Not many studies have been performed on cell-type specific differential gene expression following exposure to e-cig aerosols.

      (3) The assays performed address several factors of e-cig exposure such as metal concentration in the liquid and condensate, coil composition, cotinine/nicotine levels in serum and the product itself, cell types affected, which genes are up- or down-regulated and what pathways they control.

      (4) Considerations were made to ensure clinical relevance such as selecting mice whose ages corresponded with human adolescents so that the data collected was relevant.

      Weaknesses:

      (1) The exposure period of 1 hour a day for 5 days is not representative of chronic use and this time point may be too short to see a full response in all cell types. The experimental design is not well-supported based on the literature available for similar mouse models.

      (2) Several claims lack supporting evidence or use data that is not statistically significant. In particular, there were no statistical analyses to compare results across sex, so conclusions stating there is a sex bias for things like Ly6G+ neutrophil percentage by condition are observational.

      (3) Statistical analyses lack rigor and are not always displayed with the most appropriate graphical representation.

      (4) Overall, the paper and its discussion are relatively limited and do not delve into the significance of the findings or how they fit into the bigger picture of the field.

      (5) The manuscript lacks validation of findings in tissue by other methods such as staining.

      (6) This paper provides a foundation for follow-up experiments that take a closer look at the effects of e-cig exposure on innate immunity. There is still room to elaborate on the differential gene expression within and between various cell types.

    1. Reviewer #1 (Public review):

      Summary:

      Praegel et al. explore the differences in learning an auditory discrimination task between adolescent and adult mice. Using freely moving (Educage) and head-fixed paradigms, they compare behavioral performance and neuronal responses over the course of learning. The mice were initially trained for seven days on an easy pure frequency tone Go/No-go task (frequency difference of one octave), followed by seven days of a harder version (frequency difference of 0.25 octave). While adolescents and adults showed similar performances on the easy task, adults performed significantly better on the harder task. Quantifying the lick bias of both groups, the authors then argue that the difference in performance is not due to a difference in perception, but rather to a difference in cognitive control. The authors then used neuropixel recordings across 4 auditory cortical regions to quantify the neuronal activity related to the behavior. At the single-cell level, the data shows earlier stimulus-related discrimination for adults compared to adolescents in both the easy and hard tasks. At the neuronal population level, adults displayed a higher decoding accuracy and lower onset latency in the hard task as compared to adolescents. Such differences were not only due to learning, but also to age as concluded from recordings in novice mice. After learning, neuronal tuning properties had changed in adults but not in adolescents. Overall, the differences between adolescent and adult neuronal data correlate with the behavior results in showing that learning a difficult task is more challenging for younger mice.

      Strengths:

      (1) The behavioral task is well designed, with the comparison of easy and difficult tasks allowing for a refined conclusion regarding learning across ages. The experiments with optogenetics and novice mice complete the research question in a convincing way.

      (2) The analysis, including the systematic comparison of task performance across the two age groups, is most interesting and reveals differences in learning (or learning strategies?) that are compelling.

      (3) Neuronal recording during both behavioral training and passive sound exposure is particularly powerful and allows interesting conclusions.

      Weaknesses:

      (1) The presentation of the paper must be strengthened. Inconsistencies, mislabeling, duplicated text, typos, and inappropriate color code should be changed.

      (2) Some claims are not supported by the data. For example, the sentence that says that "adolescent mice showed lower discrimination performance than adults (l.22) should be rewritten, as the data does not show that for the easy task (Figure 1F and Figure 1H).

      (3) The recording electrodes cover regions in the primary and secondary cortices. It is well known that these two regions process sounds quite differently (for example, one has tonotopy, the other does not), and separating recordings from both regions is important to conclude anything about sound representations. The authors show that the conclusions are the same across regions for Figure 4, but is it also the case for the subsequent analysis? In Figure 7 for example, are the quantified properties not distinct across primary and secondary areas? If this is not the case, how is it compatible with the published literature?

      (4) Some analysis interpretations should be more cautious. For example, I do not understand how the lick bias, defined -according to the method- as the inverse normal distribution of the z-score (hit rate) +z-scored (false alarm rate; Figure 1j?, l.749-750), should reflect a cognitive difficulty (l. 161-162, l.171). A lower lick rate in general could reflect a weaker ability to withhold licking- as indicated on l.164, but also so many other things, like a lower frustration threshold, lower satiation, more energy, etc).

    2. Reviewer #2 (Public review):

      Summary:

      The authors aimed to find out how - and how well - adult and adolescent mice discriminate tones of different frequencies and whether there are differences in processing at the level of the auditory cortex that might explain differences in behavior between the two groups. Adolescent mice were found to be worse at sound frequency discrimination than adult mice. The performance difference between the groups was most pronounced when the sounds were close in frequency and thus difficult to distinguish, and could, at least in part, be attributed to the younger mice's inability to withhold licking in no-go trials. By recording the activity of individual neurons in the auditory cortex when mice performed the task or were passively listening as well as in untrained mice the authors identified differences in the way that the adult and adolescent brains encode sounds and the animals' choice that could potentially contribute to the differences in behavior.

      Strengths:

      The study combines behavioural testing in freely-moving and head-fixed mice, optogenetic manipulation, and high-density electrophysiological recordings in behaving mice to address important open questions about age differences in sound-guided behavior and sound representation in the auditory cortex.

      Weaknesses:

      For some of the analyses that the authors conducted it is unclear what the rationale behind them is and, consequently, what conclusion we can draw from them. The results of the optogenetic manipulation, while very interesting, warrant a more in-depth discussion.

    3. Reviewer #3 (Public review):

      Summary:

      In this study, Benedikt et al. sought to understand how adolescents and adult mice differ in auditory cortical processing, performance on a go/nogo sound-guided task, and learning. They report that behavioral performance is superior in adults. They also report that neuronal representations of both the acoustic stimulus and behavioral choice are weaker and sluggish in adolescents compared to adults and that these differences were larger in expert mice than in novices. The neural basis of adolescent auditory cognition is an important topic (both clinically and from a basic science perspective) and vastly understudied. However, many aspects of the study fell short, thereby undermining the primary conclusions drawn by the authors. My major concerns are as follows:

      (1) The authors report that "adolescent mice showed lower auditory discrimination performance compared to adults" and that this performance deficit was due to (among other things) "weaker cognitive control". I'm not fully convinced of this interpretation, for a few reasons. First, the adolescents may simply have been thirstier, and therefore more willing to lick indiscriminately. The high false alarm rates in that case would not reflect a "weaker cognitive control" but rather, an elevated homeostatic drive to obtain water. Second, even the adult animals had relatively high (~40%) false alarm rates on the freely moving version of the task, suggesting that their behavior was not particularly well controlled either. One fact that could help shed light on this would be to know how often the animals licked the spout in between trials. Finally, for the head-fixed version of the task, only d' values are reported. Without the corresponding hit and false alarm rates (and frequency of licking in the intertrial interval), it's hard to know what exactly the animals were doing.

      (2) There are some instances where the citations provided do not support the preceding claim. For example, in lines 64-66, the authors highlight the fact that the critical period for pure tone processing in the auditory cortex closes relatively early (by ~P15). However, one of the references cited (ref 14) used FM sweeps, not pure tones, and even provided evidence that the critical period for this more complex stimulus occurred later in development (P31-38). Similarly, on lines 72-74, the authors state that "ACx neurons in adolescents exhibit high neuronal variability and lower tone sensitivity as compared to adults." The reference cited here (ref 4) used AM noise with a broadband carrier, not tones.

      (3) Given that the authors report that neuronal firing properties differ across auditory cortical subregions (as many others have previously reported), why did the authors choose to pool neurons indiscriminately across so many different brain regions? And why did they focus on layers 5/6? (Is there some reason to think that age-related differences would be more pronounced in the output layers of the auditory cortex than in other layers?)

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, the authors demonstrate for the first time that opioid signaling has opposing effects on the same target neuron depending on the source of the input. Further, the authors provide evidence to support the role of potassium channels in regulating a brake on glutamatergic and cholinergic signaling, with the latter finding being developmentally regulated and responsive to opioid treatment. This evidence solves a conundrum regarding cholinergic signaling in the interpeduncular nucleus that evaded elucidation for many years.

      Strengths:

      This manuscript provides 3 novel and important findings that significantly advance our understanding of the medial habenula-interpeduncular circuitry:

      (1) Mu opioid receptor activation (mOR) reduces postsynaptic glutamatergic currents elicited from substance P neurons while simultaneously enhancing postsynaptic glutamatergic currents from cholinergic neurons, with the latter being developmentally regulated.

      (2) Substance P neurons from the Mhb provide functional input to the rostral nucleus of the IPN, in addition to the previously characterized lateral nuclei.

      (3) Potassium channels (Kv1.2) provide a break in neurotransmission in the IPN.

      Weaknesses:

      Overall I find the data presented compelling, but I feel that the number of observations is quite low (typically n=3-7 neurons, typically one per animal). While I understand that only a few slices can be obtained for the IPN from each animal, the strength of the novel findings would be more convincing with more frequent observations (larger n, more than one per animal). The findings here suggest that the authors have identified a novel mechanism for the normal function of neurotransmission in the IPN, so it would be expected to be observable in almost any animal. Thus it is not clear to me why the authors investigated so few neurons per slice and chose to combine different treatments into one group (e.g. Figure 2f), even if the treatments have the same expected effect.

      There are also significant sex differences in nAChR expression in the IPN that might not be functionally apparent using the low n presented here. It would be helpful to know which of the recorded neurons came from each sex, rather than presenting only the pooled data.

      There are also some particularly novel observations that are presented but not followed up on, and this creates a somewhat disjointed story. For example, in Figure 2, the authors identify neurons in which no response is elicited by light stimulation of ChAT-neurons, but the application of DAMGO (mOR agonist) un-silences these neurons. Are there baseline differences in the electrophysiological or morphological properties of these "silent" neurons compared to the responsive neurons?

    2. Reviewer #2 (Public review):

      Summary:

      In this paper, Chittajallu and colleagues present compelling evidence that mu opioid receptor (MOR) activation can potentiate synaptic neurotransmission in a medial habenula to interpeduncular nucleus (mHb-IPN) subcircuit. While, projections from mHb tachykinin 1 (Tac1) neurons onto lateral IPN neurons show a canonical opioid-induced synaptic depression in glutamate release, excitatory neurotransmission in mHb choline acetyltransferase (ChAT) projections to the rostral IPN is potentiated by opioids. This process may require the inhibition of voltage-gated potassium channels (Kv1.2) and results in an augmented co-release of glutamate and acetylcholine. This function emerges around age P27 in mice, when MOR expression in the IPN peaks.

      Strengths:

      Carefully executed electrophysiological experiments with appropriate controls. Interesting description of a neurodevelopmental change in the effects of opioids on mHb-IPN signaling.

      Weaknesses:

      The genetic strategy used to target the mHb-IPN pathway (constitutive expression in all ChAT+ and Tac1+ neurons) is not specific to this projection. In addition, a braking mechanism involving Kv1.2 has not been identified.

    3. Reviewer #3 (Public review):

      Summary:

      Here the authors describe the role of mORs in synaptic glutamate release from substance P and cholinergic neurons in the medial habenula to the interpeduncular nucleus (IPN) circuit in adult mice. They show that mOR activation reduces evoked glutamate release from substance P neurons yet increases evoked glutamate release and Ach release from cholinergic neurons. Unlike glutamate release, Ach release is only detected when potassium channels are blocked with 4-AP or dendrotoxin, implicating Kv1.2. The authors also report a previously unidentified glutamatergic input to IPR mediated from SP neurons and describe the developmental timing of mOR-facilitation in adolescent mice.

      Strengths:

      (1) The experiments provide new insight into the role of mORs in controlling evoked glutamate release in a circuit with high levels of mORs and established roles in relevant behaviors.

      (2) The experimental design is generally rigorous, and the results are clear-cut. The conclusions are largely supported by the data.

      (3) The findings will be of interest to those working in the field.

      Weaknesses:

      (1) The mechanistic underpinnings of the most interesting results are not pursued. For example, the experiments do not provide new insight into the differential effects of evoked and spontaneous glutamate/Ach release by Gi/o coupled mORs, nor the differential threshold for glutamate versus Ach release.

      (2) The significance of the ratio of AMPA versus nACh EPSCs shown in Figure 6 is unclear since nAChR EPSCs measured in the K+ channel blockers are compared to AMPA EPSCs in control (presumably 4-AP would also increase AMPA EPSCs).

      (3) The authors note that blocking Kv1 channels typically enhances transmitter release by slowing action potential repolarization. The idea that Kv1 channels serve as a brake for Ach release in this system would be strengthened by showing that these channels are the target of neuromodulators or that they contribute to activity-dependent regulation that allows the brake to be released.

    1. Reviewer #1 (Public review):

      Summary:

      The authors were attempting to describe whether trained innate immunity would modulate antibody-dependent cellular phagocytosis (ADCP) and/or efferocytosis.

      Strengths:

      The use of primary murine macrophages, and not a cell line, is considered a strength.

      The trained immunity-mediated changes to phagocytosis affected both melanoma and breast cancer cells. The broad effect is consistent with trained immunity.

      Weaknesses:

      The most significant weakness, also noted by the authors in the discussion, is the lack of in vivo data. Without these data, it is not possible to put the in vitro data in context. It is unknown if the described effects on efferocytosis will be relevant to the in vivo progression of cancer.

    2. Reviewer #2 (Public review):

      Summary:

      The authors follow up their preclinical work on beta-glucan-induced trained immunity in murine tumor models that they published in Cell in 2020. In particular, they focus on the role of trained immunity and efferocytosis of cancer cells

      Strengths:

      While properly conducted, the work is underwhelming and fully depends on in vitro observations performed with co-cultures of bone marrow derived macrophages from beta-glucan-treated mice and tumor cell lines. From these in vitro studies, the authors conclude that trained immunity induction has no effect on antibody-dependent cellular phagocytosis, while it decreases efferocytosis.

      Weaknesses:

      It would be important to study these phenomena in tumor mouse models in vivo. The authors clearly have the expertise as they have shown in previous studies. Especially because the in vitro observation appears to conflict with the in vivo anti-tumor found in mice prophylactically treated with beta-glucan. Clearly, trained immunity is associated with diverse cellular responses and mechanisms, some of which may promote tumor growth, as the current manuscript suggests, but in the absence of in vivo studies, it is merely a mechanistic exercise of which the relevance is difficult to determine.

    3. Reviewer #3 (Public review):

      Summary:

      Chatzis et al showed that β-glucan trained macrophages have decreased phagocytic activity of apoptotic tumor cells and that is accompanied by lower levels of secreted IL-1β using a mouse model.

      Strengths:

      This finding has a potential impact on designing new cancer immunotherapeutic approaches by targeting macrophage efferocytosis.

      Weaknesses:

      Whether this finding could be applied to other scenarios is underdetermined.

      (1) Does the decrease of efferocytosis also occur in human monocytes/macrophages after training?

      (2) Both β-glucan and BCG are well-trained innate immunity agents, the authors showed that β-glucan decreased efferocytosis via IL-1 β, so it is interesting to know whether BCG has a similar effect.

    1. Reviewer #1 (Public review):

      Summary:

      Integrating large-field stimulation with a retinotopic atlas, this study introduces an fMRI-based method for measuring contrast sensitivity across the visual field. Retinotopy was assessed using pRF mapping and a calibrated Benson atlas. The authors validate their method by replicating known patterns of contrast sensitivity across eccentricities and visual field quadrants in healthy subjects and demonstrate its potential clinical utility through case studies of both simulated and real visual field loss.

      Strengths:

      The new method is promising, with potential clinical utility in assessing visual field loss.

      Weaknesses:

      The current claims should be better supported by more evidence.

      In the first experiment, have the statistics undergone multiple comparison corrections (e.g., Line 441-442)? Given the small sample size, incorporating additional statistical tests (such as the Bayes Factor) could strengthen the analysis.

      The authors claim that "structure-based atlases can replace the need for pRF mapping in cases where it might otherwise be difficult or impossible to collect pRF data." This claim needs further scrutiny. Currently, only one simulated condition of visual field loss was examined in one subject. Also, in Figure 7, contrast sensitivity in the periphery differs between pRF mapping and the Benson atlas. How do the authors explain this discrepancy?

      Overall, the writing could be significantly improved.

    2. Reviewer #2 (Public review):

      Summary:

      This study uses functional MRI to evaluate visual contrast sensitivity across the visual field at the level of the visual cortex, testing the method in a small group of normally sighted individuals and one with sight loss as proof of principle. The results suggest a promising technique to measure vision objectively across the visual field and overcomes the requirement for careful fixation which is often challenging in those with low vision or sight loss.

      Strengths:

      (1) Objective measure of central vision: The proposed method may provide a more comprehensive and objective assessment of residual visual function in individuals with sight loss. This may be particularly useful for those with central visual field loss without the requirement of stable fixation or subjective motor responses.

      (2) More sensitive measure: The use of slope to calculate contrast sensitivity across a range of contrasts within the brain is clever and likely more sensitive than single threshold measurements or standard clinical measures of visual acuity using letter charts. Standard supra-threshold (high contrast) tests are not ideal for capturing residual vision or partial vision loss.

      (3) Good agreement with standard atlas: The Benson atlas provides a good estimate of visual field maps within V1 based on anatomical landmarks, and the authors take steps to refine this informed by cortical magnification and V1 surface area (brain size) for each individual participant. This could allow the technique to be generalised without the need to collect lengthy individual mapping data from every participant.

      (4) Within-subject reproducibility: The measurements appear to be sensitive and reproducible, particularly in those with normal vision, and are consistent with known features of visual sensitivity differences in different parts of the visual field.

      (5) Potential tool to measure visual field sensitivity in controls: Even if the proposed methods are not ideal for widespread clinical translation, they do offer an exciting tool to test hypotheses about visual field differences in healthy controls. For example, there seems to be an increase in sensitivity on either side of the simulated ring scotoma (Figure 6 - perhaps due to the release of lateral inhibition?). Reliability measures suggest that individual differences are consistent in healthy controls (although not tested statistically, perhaps due to the small sample size?). Whether they reflect behaviourally meaningful differences in visual field sensitivity could be tested in individuals by comparing them to behavioural measures across the visual field.

      (6) Potential tool to test novel treatments: The proposed techniques could be used to test within-subject changes in visual function in environments that are equipped to measure and analyse fMRI data, including clinical trials aimed at determining the success of novel treatments. Further testing should reveal whether the method is suitable for testing low-vision patients with unstable fixation (e.g., nystagmus) and whether this affects slope and contrast sensitivity estimates. In theory, it should not have a substantial effect, except perhaps in regions near the stimulus edges.

      Weaknesses:

      (1) Questionable sensitivity to differences in patients. The variability in heat maps across healthy control participants is somewhat surprising. Do differences between individuals represent actual visual sensitivity differences, or are they an artifact of the measurement technique, e.g., due to signal-to-noise differences introduced by local variations in brain anatomy? Will the substantial variance across controls allow for a sufficiently stable baseline to detect meaningful differences in individual patients? Also, as the authors rightly point out, Benson atlas does not model differences along meridians, so upper/lower field differences might not be detectable.

      (2) Effects of unstable fixation/eye movements not explicitly tested: The methods state, 'In all tasks, participants were asked to report when the color of a central fixation dot changed', suggesting participants maintained fairly good fixation. Most of the results seem to pertain to measurements where central fixation is required. How does unstable fixation affect measurements?

      (3) Potential for clinical translation. Although it is a sensitive measure, functional MRI is costly, is not available in all clinical settings, requires significant post-processing analyses, and may be contraindicated in some individuals due to safety (e.g., metallic implants) or other concerns (e.g., claustrophobia). These could present significant barriers to widespread clinical translation if this were the ultimate goal of the study.

      (4) Limited range of spatial frequencies. The spatial frequencies tested were still quite low (0.3 and 3cpd) compared to measures such as visual acuity. Extending the measurements to higher spatial frequencies could allow better characterization of central vision, although necessarily for peripheral vision.

    3. Reviewer #3 (Public review):

      Summary:

      Chow-Wing-Bom et al. introduce an innovative wide-field visual stimulation setup for 3T experiments that enables stimulation up to a diameter of 40{degree sign} visual angle while allowing continuous gaze tracking. Using this setup, the authors systematically investigate contrast sensitivity across the visual field by presenting subjects with sinusoidal gratings varying in contrast and spatial frequency. Their findings confirm the expected organization of contrast sensitivity, demonstrating a preference for high spatial frequencies in the central field and lower frequencies in the periphery. They also extend these measurements to eccentricities up to 20{degree sign}, which exceeds previous fMRI-based reports. Moreover, the study explores the potential of using contrast sensitivity calculations as a method for detecting visual field defects, as demonstrated in both a healthy subject with an artificial, ring-shaped scotoma and a patient with LHON.

      Strengths:

      (1) The manuscript is well written and provides comprehensive methodological details, ensuring high transparency and reproducibility.

      (2) The visual stimulation setup represents a significant technical advance by enabling wide-field stimulation with continuous eye tracking, which is crucial for both research and potential clinical applications.

      (3) The study confirms established findings regarding the organization of contrast sensitivity while extending them to a larger eccentricity range.

      (4) The efforts to establish a measure for visual field losses align with current efforts to develop objective alternatives to conventional perimetry.

      Weaknesses:

      (1) The authors should more strongly emphasize their findings on the organization of contrast sensitivity, particularly in light of the stimulation extent provided by the wide-field setup.

      (2) Certain methodological aspects require further clarification, particularly regarding the correction of eccentricity values from the Benson atlas. It's not clear which V1 masks are used for the specific analysis which could have a substantial impact on the reported differences between the two approaches of pRF mapping and atlas-based pRF parameters.

      (3) Minor inconsistencies in reporting, e.g., the introduction of a second session in the Results section.

      (4) The conclusion that high-contrast patterns as in pRF mapping are not optimal to test for subtle but potentially clinically relevant changes in the visual field coverage is very valid. The suggested use of contrast sensitivity can therefore be a potentially well-suited parameter for estimating visual field losses. The presented work is an interesting starting point and the proposed method of using contrast sensitivity as a measure for partial vision loss should further be explored.

    1. Reviewer #1 (Public review):

      Summary:

      The Szczupak lab published a very interesting paper in 2012 (Rodriquez et al. J Neurophysiol 107:1917-1924) on the effects of the segmentally-distributed non-spiking (NS) cell on crawl-related motoneurons. As far as I can tell, the working model presented in 2012, for how the non-spiking (NS) cell impacts the crawling motor pattern, is the same functional model presented in this new paper. Unfortunately, the Discussion does not address any of the findings in the previous paper or cite them in the context of NS alterations of fictive crawling. Aside from different-looking figures and some new analyses, the results and conclusions are the same.

      Strengths:

      The figures are well illustrated.

      Weaknesses:

      The paper is a mix of what appears to be two different studies and abruptly switches gears to examine how closely the crawl patterning is in the intact animal as compared to the fictive crawl patterning in the intact animal. Unfortunately, previous studies in other labs are not cited even though identical results have been obtained and similar conclusions were made. Thus, the novelty of the results is missing for those who are familiar with the leech preparation. The lack of appropriate citations and discussion of previous studies also deprives the scientific community of fully comprehending the impact of the data presented and the science it was built upon.

      (1) Results, Lines 167-170: "While multiple extracellular recordings have been performed previously (Eisenhart et al., 2000), these results present the first quantitative analysis of motor units activated throughout the crawling cycle. The In-Phase units are expected to control the contraction stage by exciting or inhibiting the longitudinal or circular muscles, respectively, and the Anti-Phase units to control the elongation stage by exciting or inhibiting the circular or longitudinal muscles, respectively."

      The first line above is misleading. The study by Puhl and Mesce (2008, J. Neurosci, 28:4192- 420) contains a comprehensive analysis of the motoneurons active during fictive crawling with the aim of characterizing their roles and phase relationships and solidifying the idea that the oscillator for crawling resides in a single ganglion. Intracellular recordings from a number of key crawl-related motoneurons were made in combination with extracellular recordings of motoneuron DE-3, a key monitor of crawling. In their paper, it was shown that motoneurons AE, VE-4, DI-1, VI-2, and CV were all correlated with crawl activity, and fired repeatedly either in phase or out-of-phase with DE-3. They were shown to be either excitatory or inhibitory.

      At a minimum, the above paper should be cited. The submitted paper would be strengthened if some of these previously identified motoneurons were again recorded with intracellular electrodes and concomitant NS cell stimulation. The power of the leech preparation is that cells can be identified as individuals with dual somatic (intracellular) and axonal recordings (extracellular). The shortfall of this aspect of the study (Figure 5) is that the extracellular units have not been identified here. In fact, these units might not even be motoneurons. They could represent activity from the centrally located sensory neurons, dopamine-modulated afferent neurons or peripherally projecting modulatory neurons. Essentially, they may not have much to do with the crawl motor pattern at all.

      (2) Results Lines 206-210: "with the elongation and contraction stages of in vivo behavior. However the isometric stages displayed in vivo have no obvious counterpart in the electrophysiological recordings. It is important to consider that the rhythmic movement of successive segments along the antero-posterior axis of the animal requires a delay signal that allows the appropriate propagation of the metachronal wave, and this signal is probably absent in the isolated ganglion."

      The so-called isometric stages, indeed, have an electrophysiological counterpart due in part to the overlapping activities across segments. This submitted paper would be considerably strengthened if it referred to the body of work that has examined how the individual crawl oscillators operate in a fully intact nerve cord, excised from the body but with all the ganglia (and cephalic ganglion) attached. Puhl and Mesce 2010 (J. Neurosci 30: 2373-2383) and Puhl et al. 2012 (J. Neurosci, 32:17646 -17657) have shown that "appropriate propagation of the metachronal wave" requires the brain, especially cell R3b-1. They also show that the long-distance projecting cell R3b-1 synapses with the CV motoneuron, providing rhythmic excitatory input to it.

      For this and other reasons, the paper would be much more informative and exciting if the impacts of the NS cell were studied in a fully intact nerve cord. Those studies have never been done, and it would be exciting to see how and if the effects of NS cell manipulation deviated from those in the single ganglion.

      (3) Discussion Lines 322-324. "The absence of descending brain signals and/or peripheral signals are assumed as important factors in determining the cycle period and the sequence at which the different behavioral stages take place."

      The authors could strengthen their paper by including a more complete picture of what is known about the control of crawling. For example, Puhl et al. 2012 (J Neurosci, 32:17646-17657) demonstrated that the descending brain neuron R3b-1 plays a major role in establishing the crawl-cycle frequency. With increased R3b-1 cell stimulation, DE-3 periods substantially shortened throughout the entire nerve cord. Thus, the importance of descending brain inputs should not be merely assumed; empirical evidence exists.

      (4) Discussion Lines 325-327: "the sequence of events, and the proportion of the active cycle dedicated to elongation and contraction were remarkably similar in both experimental settings. This suggests that the network activated in the isolated ganglion is the one underlying the motor behavior."

      The results and conclusions drawn in the current manuscript mirror those previously reported by Puhl and Mesce (2008, J. Neurosci, 28:4192- 420) who first demonstrated that the essential pattern-generating elements for leech crawling were contained in each of the segmental ganglia comprising the nerve cord. Furthermore, the authors showed that the duty cycle of DE-3, in a single ganglion treated with dopamine, was statistically indistinguishable from the DE-3 duty cycle measured in an intact nerve cord showing spontaneous fictive crawling, in an intact nerve cord induced to crawl via dopamine, and in the intact behaving animal. What was statistically significant, however, was that the DE-3 burst period was greatly reduced in the intact animal (i.e., a higher crawl frequency), which was replicated in the submitted paper.

      In my opinion, the novelty of the results reported in the submitted manuscript is diminished in the light of previously published studies. At a minimum, the previous studies should be cited, and the authors should provide additional rationale for conducting their studies. They need to explain in the discussion how their approach provided additional insights into what has already been reported.

    2. Reviewer #2 (Public review):

      The paper is well-written overall. The findings are clearly presented, and the data seems solid overall. I do have, however, a few major and some minor comments representing some concerns. My major comments are below.

      (1) This may seem somewhat semantic, yet, it has implications on the way the data is presented and moreover on the conclusions drawn - a single ganglion cannot show fictive crawling. It can demonstrate rhythmic patterns of activity that may serve in the (fictive) crawling motor pattern. The latter is a result of the intrinsic within single-ganglion connectivity AND the inter-ganglia connections and interactions (coupling) among the sequential ganglia. It may be affected by both short-range and long-range connections (e.g., descending inputs) along the ganglia chain.

      (2) The point above is even more critical where the authors set to compare the motor pattern in single ganglia with the intact animals. It would have made much more sense to add a description of the motor pattern of a chain of interconnected ganglia. The latter would be expected to better resemble the intact animal. Furthermore, this project would have benefitted from a three-way comparison (isolated ganglion-interconnected ganglia-intact animal.

      (3) Two previous studies by the same group are repeatedly mentioned (Rela and Szczupak, 2003; Rodriguez et al., 2009) and serve as a basis for the current work. The aim of one of these previous studies was to assess the role of the NS neurons in regulating the function of motor networks. The other (Rodriguez et al., 2009) reported on a neuron (the NS) that can regulate the crawling motor pattern. LL 71-74 of the current report presents the aim of this study as evaluating the role of the known connectivity of the premotor NS neuron in shaping the crawling motor pattern. The authors should make it very clear what indeed served as background knowledge, what exactly was known about the circuitry beforehand, and what is different and new in the current study.

    1. Reviewer #1 (Public Review):

      The work of Umetani et al. monitors the death of about 100,000 cells caused by lethal antibiotic treatments in a microfluidic device. They observe that the surviving bacteria are either in a dormant or in a non-dormant state prior to the antibiotic treatment. They then study the relative abundances of these different persister cells when varying the physiological state of the culture. In agreement with previous observations, they observe that late stationary phase cultures harbor a high number of dormant persister cells and that this number goes down as the culture is more exponential but remains non-zero, suggesting that cultures at the exponential phase contain different types of persister bacteria. These results were qualitatively similar in a rich and poor medium. Further characterization of the growing persister bacteria shows that they often form L-forms, have low RpoS-mcherry expression levels and grow only slightly more slowly than the non-persister bacteria. Taken together, these results draw a detailed view of persister bacteria and the way they may survive extensive antibiotic treatments. However, in order to represent a substantial advance on previous knowledge, a deeper analysis of the persister bacteria should be done.

    2. Reviewer #2 (Public Review):

      The main question asked by Umenati et al. is whether persister cells to ampicillin arise preferentially from dormant, non-dividing cells or from cells that are actively growing before antibiotic exposure. The authors tracked persister cells generated from populations at different growth phases and culture media using a microfluidic device coupled to fluorescence microscopy, which is a challenge due to the low frequency of these persister cells. One of the main conclusions is that the majority of persisters arising in exponentially-growing populations originated from actively-dividing cells before the antibiotic treatment, reinforcing the idea that dormancy is not a prerequisite for persister formation. The authors made use of a fluorescent reporter monitoring RpoS activity (RpoS-mCherry fusion) and observed that RpoS levels in these persister cells were low. In the few lineages that exhibited no growth before the ampicillin treatment, RpoS levels were low as well, indicating that RpoS is not a predictive marker for persistence. By performing the same experiment with early and late stationary phase cultures, the authors observed that the proportion of persister cells that originated from dormant cells before the ampicillin treatment is significantly increased under these conditions. In the late stationary phase condition, dormant cells were expressing high levels of RpoS. The authors suggested that RpoS-mCherry proteins form aggregates which were suggested by the authors to be a characteristic of 'deep dormancy'. These cells were mostly unable to restart growth after the antibiotic removal while others with the lowest levels of RpoS tended to be persister. Confirming that these cells indeed contain protein aggregates as well as determining the physiological state of these cells appears to be crucial.

    3. Reviewer #3 (Public Review):

      In their manuscript, Umetani, et al. address the question of the origin of persister bacteria using single-cell approaches. Persistence refers to a physiological state where bacteria are less sensitive to antibiotherapy, although they have not acquired a resistance mutation; importantly, the concept of persistence has been refined in the past decade to distinguish it from tolerance where bacteria are only transiently insensitive. Since persister cells are very rare in growing populations (typically 1e-5 or 1e-6), it is very challenging to observe them directly. It had been proposed that individual cells surviving antibiotics are not growing at the start of the treatment, but recent studies (nicely reviewed in the introduction) where persister bacteria were observed directly do not support this link. Following a similar line, the authors nonetheless still aim at "investigating whether non-growing cells are predominantly responsible for bacterial persistence". Based on new experimental data, they claim the contrary that most surviving cells were "actively growing before drug exposure" and that their work "reveals diverse survival pathways underlying antibiotic persistence".

      The main strengths of the manuscript are in my opinion:

      - To report on direct observation of E. coli persisters to ampicillin (200µg/mL) in 5 different growth media (typically 20 persisters or more per condition, one condition with 12 only), which constitutes without a doubt an experimental tour de force.

      - To aim at bridging the population level and the single-cell level by measuring relevant variables for each and analyzing them jointly.

      - To demonstrate that in most conditions a large fraction of surviving cells was actively growing before drug exposure.

      In addition, although it is well-known that E. coli doesn't need to maintain its rod shape for surviving and dividing, I found very remarkable in their data the extent to which morphology can be affected in persister cells and their progeny, since this really challenges our understanding of E. coli's "lifestyle" (these swimming amoeba-like cells in Supp Video 11 are mind-blowing!).

      Unfortunately, these positive aspects are counter-balanced by several shortcomings in the way experiments are analyzed and interpreted, which I explain below. Moreover, the manuscript is written in a way that makes it very hard to find important information on how experiments are done and is likely to leave the reader with an impression of confusion about what the main findings actually are.

      My major concerns are the following:

      (1) The main interpretation framework proposed by the authors is to assess whether cells not growing before drug exposure (so-called "dormant") are more or less likely to survive the treatment than growing ones ("non-dormant"). Fig 2A and Fig 3G show the main conclusions of the article from this perspective, that growing cells can survive the treatment and that the fraction of persisters in a given condition is not explained by the fraction of "dormant" cells, respectively. With this analysis, the authors essentially assume that "dormant" cells are of the same type in their different conditions, which ignores the progress in this field over the last decade (Balaban et al. 2019). I argue on the contrary that the observation of "diverse modes of survival in antibiotic persistence" is expected from their experimental design. In particular, the sensitivity of E. coli to beta-lactams such as ampicillin is expected to be much lower during the lag out of the stationary phase, a phenomenon which has been coined "tolerance"; hence in the Late Stationary condition, two subpopulations coexist for which different response to ampicillin is expected. I propose steps toward a more compelling interpretation of the experimental data. Should this point be taken seriously by the authors, it, unfortunately, implies a major rewriting of the article, including its title.

      (2) The way the authors describe their experiments with bacteria in the stationary phase is very problematic. For instance, they write that they "sampled cells from early and late stationary phases (...) and exposed them to 200 μg/mL of Amp in both batch and single-cell cultures." For any reader in a hurry (hence skipping methods and/or supplementary figure), this leads to believe that bacteria sampled in the stationary phase were exposed to the drug right away (either by adding the drug to the stationary phase sample, or more classically by transferring cells to fresh media with antibiotics). However, it turns out that, after sampling and loading in the microfluidic device, bacteria are grown 2 h in LB (or 4 h in M9) - I don't know what to think of such a blatant omission. The names chosen for each condition should reflect their most important aspects, here "stationary" is simply not appropriate - maybe something like "post early stationary" instead. In any case, I believe that this point highlights further the misconception pointed out in 1 and implies that the average reader will be at best confused, and probably misled.

      (3) Figures 4 and 5 are of very minor significance, and the methodology used in Fig 4 is questionable. The authors measure the abundance of an Rpos-mCherry translational fusion because its "high expression has been suggested to predict persistence". The rationale for this (that an RpoS-mCherry fusion would be a proxy for intracellular ppGpp levels, and in turn predict persistence) has never been firmly established, and the standards used in the article where this reporter was introduced (Maisonneuve, Castro-Camargo, and Gerdes 2013) are notoriously low (which eventually led to its retraction) - I don't know what to think of the fact that the authors cite a review by this group rather than their retracted article. While transcriptional fusions of promoters regulated by RpoS have been proposed to measure its regulatory activity (Patange et al. 2018), the combination of self-regulation and complex post-translational regulation of rpoS makes the physical meaning of the reporter used here completely unclear. Moreover, this translational fusion is introduced without doing any of the necessary controls to demonstrate that the activity of RpoS is not impaired by the addition of the fluorescent protein. Fig 5 simply reports the existence of persisters to ciprofloxacin growing before the treatment. This might be a new observation but it is not unexpected given that a similar observation has been made with a similar drug, ofloxacin (Goormaghtigh and van Melderen 2019), as pointed out in the introduction. There is no further quantitative claim on this.

      (4) The authors don't mention the dead volume nor the speed of media exchange in their device. Hopefully, it is short compared to the duration of the treatment; however, it is challenging to remove all antibiotics after the treatment and only 1e-3 or 1e-4 of the treatment concentration is already susceptible to affecting regrowth in fresh media. If this is described in another article, it would be worth adding a comment in the main text.

      (5) Fig 2A supports the main finding that a significant fraction of bacteria surviving the treatment are growing before drug exposure, but it uses a poorly chosen representation.<br /> - In order to compare between conditions, one would like to see the fraction of each type in the population.<br /> - The current representation (of a fraction of each type among surviving cells) requires a side-by-side comparison with a random sample (which will practically be equivalent to the fraction of each type among killed cells) in order to be informative.

    1. Reviewer #1 (Public review):

      Weiler, Teichert, and Margrie systematically analyzed long-range cortical connectivity, using a retrograde viral tracing strategy to identify layer and region-specific cortical projections onto the primary visual, primary somatosensory, and primary motor cortices. Their analysis revealed several hundred thousand inputs into each region, with inputs originating from almost all cortical regions but dominated in number by connections within cortical sub-networks (e.g. anatomical modules). Generally, the relative areal distribution of contralateral inputs followed the distribution of corresponding ipsilateral inputs. The largest proportion of inputs originated from layer 6a cells, and this layer 6 dominance was more pronounced for contralateral than ipsilateral inputs, which suggests that these connections provide predominantly feedback inputs. The hierarchical organization of input regions was similar between ipsi- and contralateral regions, except for within-module connections, where ipsilateral connections were much more feed-forward than contralateral. These results contrast earlier studies which suggested that contralateral inputs only come from the same region (e.g. V1 to V1) and from L2/3 neurons. The conclusions of this paper are well-supported by the data and analysis, and useful follow-up analyses and discussions are present in the supplemental figures. Taken together, these results provide valuable data supporting a view of interhemispheric connectivity in which layer 6 neurons play an important role in providing modulatory feedback.

    2. Reviewer #2 (Public review):

      Summary:

      Weiler et al use retrograde tracers, two-photon tomography, and automatic cell detection to provide a detailed quantitative description of the laminar and area sources of ipsi- and contralateral cortico-cortical inputs to two primary sensory areas and a primary motor area. They found considerable bilateral symmetry in the areas providing cortico-cortical inputs. However, although the same regions in both hemispheres tended to supply inputs, a larger proportion of inputs from contralateral areas originated from deeper layers (L5 and L6).

      Strengths:

      The study applies state-of-the-art anatomical methods, and the data is very effectively presented and carefully analyzed. The results provide many novel insights on the similarities and differences of inputs from the two hemispheres. While over the past decade there has been many studies quantitively and comprehensively describing cortico-cortical connections, by directly comparing inputs from the ipsi and contralateral hemispheres, this study fills in an important gap in the field. It should be of great utility and an important reference for future studies on inter hemispheric interactions.

      Weaknesses:

      Overall, I do not find any major weakness in the analyses or their interpretation. However, one must keep in mind that the study only analyses inputs projecting to three areas. This is not an inherent flaw of the study; however, it warrants caution when extrapolating the results to callosal projections terminating in other areas. As inputs to two primary sensory areas and one is the primary motor cortex are studied, some of the conclusions could potentially be different for inputs terminating in high-order sensory and motor areas. Given that primary areas were injected, there are few instances of feedforward connections sampled in the ipsilateral hemisphere. The study finds that while ipsi- projections from visual cortex to barrel cortex are feedforward given its fILN values, those from the contralateral visual cortex are feedback instead. This is now acknowledged in the revised discussion.

      Another issue that is left unexplored is that, in the current analyses the barrel and primary visual cortex are analyzed as a uniform structure. It is well established that both the laminar sources of callosal inputs and their terminations differ in the monocular and binocular areas of the visual cortex (border with V2L). Similarly, callosal projections differ when terminating the border of S1 (A row of whiskers ) then in other parts of S1. Thus, some of the conclusions regarding the laminar sources of callosal inputs might depend on whether one is analyzing inputs terminating or originating in these border regions. This is now acknowledged in the revised version.

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to identify the proteins that compose the electrical synapse, which are much less understood than those of the chemical synapse. Identifying these proteins is important to understand how synaptogenesis and conductance are regulated in these synapses. The authors identified more than 50 new proteins and used immunoprecipitation and immunostaining to validate their interaction of localization. One new protein, a scaffolding protein, shows particularly strong evidence of being an integral component of the electrical synapse. However, many key experimental details are missing (e.g. mass spectrometry), making it difficult to assess the strength of the evidence.

      Strengths:

      One newly identified protein, SIPA1L3, has been validated both by immunoprecipitation and immunohistochemistry. The localization at the electrical synapse is very striking.<br /> A large number of candidate interacting proteins were validated with immunostaining in vivo or in vitro.

      Weaknesses:

      There is no systematic comparison between the zebrafish and mouse proteome. The claim that there is "a high degree of evolutionary conservation" was not substantiated.

      No description of how mass spectrometry was done and what type of validation was done.

      The threshold for enrichment seems arbitrary.

      Inconsistent nomenclature and punctuation usage.

      The description of figures is very sparse and error-prone (e.g. Figure 6).

      In Figure 1B, there is very broad non-specific labeling by avidin in zebrafish (In contrast to the more specific avidin binding in mice, Figure 2B). How are the authors certain that the enrichment is specific at the electrical synapse?

      In Figure 1E, there is very little colocalization between Cx35 and Cx34.7. More quantification is needed to show that it is indeed "frequently associated."

      Expression of GFP in HCs would potentially be an issue, since GFP is fused to Cx36 (regardless of whether HC expresses Cx36 endogenously) and V5-TurboID-dGBP can bind to GFP and biotinylate any adjacent protein.

      Figure 7: the description does not match up with the figure regarding ZO-1 and ZO-2.

    2. Reviewer #2 (Public review):

      Summary:

      This study aimed to uncover the protein composition and evolutionary conservation of electrical synapses in retinal neurons. The authors employed two complementary BioID approaches: expressing a Cx35b-TurboID fusion protein in zebrafish photoreceptors and using GFP-directed TurboID in Cx36-EGFP-labeled mouse AII amacrine cells. They identified conserved ZO proteins and endocytosis components in both species, along with over 50 novel proteins related to adhesion, cytoskeleton remodeling, membrane trafficking, and chemical synapses. Through a series of validation studies¬-including immunohistochemistry, in vitro interaction assays, and immunoprecipitation - they demonstrate that novel scaffold protein SIPA1L3 interacts with both Cx36 and ZO proteins at electrical synapse. Furthermore, they identify and localize proteins ZO-1, ZO-2, CGN, SIPA1L3, Syt4, SJ2BP, and BAI1 at AII/cone bipolar cell gap junctions.

      Strengths:

      The study demonstrates several significant strengths in both experimental design and validation approaches. First, the dual-species approach provides valuable insights into the evolutionary conservation of electrical synapse components across vertebrates. Second, the authors compare two different TurboID strategies in mice and demonstrate that the HKamac promoter and GFP-directed approach can successfully target the electrical synapse proteome of mouse AII amacrine cells. Third, they employed multiple complementary validation approaches - including retinal section immunohistochemistry, in vitro interaction assays, and immunoprecipitation-providing evidence supporting the presence and interaction of these proteins at electrical synapses.

      Weaknesses:

      The conclusions of this paper are supported by data; however, some aspects of the quantitative proteomics analysis require clarification and more detailed documented. The differential threshold criteria (>3 log2 fold for mouse vs >1 log2 fold for zebrafish) will benefit from biological justification, particularly given the cross-species comparison. Additionally, providing details on the number of biological or technical replicates used in this study, along with analyses of how these replicates compare to each other, would strengthen the confidence in the identification of candidate proteins. Furthermore, including negative controls for the histological validation of proteins interacting with Cx36 could increase the reliability of the staining results.

      While the study successfully characterized the presence of candidate proteins at the electrical synapses between AII amacrine cells and cone bipolar cells, it did not compare protein compositions between the different types of electrical synapses within the circuit. Given that AII amacrine cells form both homologous (AII-AII) and heterologous (AII-cone bipolar cell) electrical synapses-connections that serve distinct functional roles in retinal signaling processing-a comparative analysis of their molecular compositions could have provided important insights into synapse specificity.

    3. Reviewer #3 (Public review):

      Summary:

      This study by Tetenborg S et al. identifies proteins that are physically closely associated with gap junctions in retinal neurons of mice and zebrafish using BioID, a technique that labels and isolates proteins proximal to a protein of interest. These proteins include scaffold proteins, adhesion molecules, chemical synapse proteins, components of the endocytic machinery, and cytoskeleton-associated proteins. Using a combination of genetic tools and meticulously executed immunostaining, the authors further verified the colocalizations of some of the identified proteins with connexin-positive gap junctions. The findings in this study highlight the complexity of gap junctions. Electrical synapses are abundant in the nervous system, yet their regulatory mechanisms are far less understood than those of chemical synapses. This work will provide valuable information for future studies aiming to elucidate the regulatory mechanisms essential for the function of neural circuits.

      Strengths:

      A key strength of this work is the identification of novel gap junction-associated proteins in AII amacrine cells and photoreceptors using BioID in combination with various genetic tools. The well-studied functions of gap junctions in these neurons will facilitate future research into the functions of the identified proteins in regulating electrical synapses.

      Weaknesses:

      I do not see major weaknesses in this paper. A minor point is that, although the immunostaining in this study is beautifully executed, the quantification to verify the colocalization of the identified proteins with gap junctions is missing. In particular, endocytosis component proteins are abundant in the IPL, making it unclear whether their colocalization with gap junction is above chance level (e.g. EPS15l1, HIP1R, SNAP91, ITSN in Figure 3B).

    1. Reviewer #1 (Public review):

      Summary:

      The Authors explore associations between plasma metabolites and glaucoma, a primary cause of irreversible vision loss worldwide. The study relies on measurements of 168 plasma metabolites in 4,658 glaucoma patients and 113,040 controls from the UK Biobank. The Authors show that metabolites improve the prediction of glaucoma risk based on polygenic risk score (PRS) alone, albeit weakly. The Authors also report a "metabolomic signature" that is associated with a reduced risk (or "resilience") for developing glaucoma among individuals in the highest PRS decile (reduction of risk by an estimated 29%). The Authors highlight the protective effect of pyruvate, a product of glycolysis, for glaucoma development and show that this molecule mitigates elevated intraocular pressure and optic nerve damage in a mouse model of this disease.

      Strengths:

      This work provides additional evidence that glycolysis may play a role in the pathophysiology of glaucoma. Previous studies have demonstrated the existence of an inverse relationship between intraocular pressure and retinal pyruvate levels in animal models (Hader et al. 2020, PNAS 117(52)) and pyruvate supplementation is currently being explored for neuro-enhancement in patients with glaucoma (De Moraes et al. 2022, JAMA Ophthalmology 140(1)). The study design is rigorous and relies on validated standard methods. Additional insights gained from a mouse model are valuable.

      Weaknesses:

      Caution is warranted when examining and interpreting the results of this study. Among all participants (cases and controls) glaucoma status was self-reported, determined on the basis of ICD codes or previous glaucoma laser/surgical therapy. This is problematic as it is not uncommon for individuals in the highest PRS decile to have undiagnosed glaucoma (as shown in previous work by some of the authors of this article). The Authors acknowledge a "relatively low glaucoma prevalence in the highest decile group" but do not explore how undiagnosed glaucoma may affect their results. This also applies to all controls selected for this study. The Authors state that "50 to 70% of people affected [with glaucoma] remain undiagnosed". Therefore, the absence of self-reported glaucoma does not necessarily indicate that the disease is not present. Validation of the findings from this study in humans is, therefore, critical. This should ideally be performed in a well-characterized glaucoma cohort, in which case and control status has been assessed by qualified clinicians.

      The authors indicate that within the top decile of PRS participants with glaucoma are more likely to be of white ethnicity, while they are more likely to be of Black and Asian ethnicity if they are in the bottom half of PRS. Have the Authors explored how sensitive their predictions are to ethnicity? Since their cohort is predominantly of European ancestry (85.8%), would it make sense to exclude other ethnicities to increase the homogeneity of the cohort and reduce the risk for confounders that may not be explicitly accounted for?

      The authors discuss the importance of pyruvate, and lactate for retinal ganglion cell survival along with that of several lipoproteins for neuroprotection. However, there is a distinction to be made between locally produced/available glycolysis end products and lipoproteins and those circulating in the blood. It may be useful to discuss this in the manuscript, and for the Authors to explore if plasma metabolites may be linked to metabolism that takes place past the blood-retinal barrier.

      Comments on revisions:

      The Authors have addressed all of my concerns.

    2. Reviewer #2 (Public review):

      Summary

      The authors have used the UK Biobank data to interrogate the association between plasma metabolites and glaucoma.

      (1) They initially assessed plasma metabolites as predictors of glaucoma: The addition of NMR-derived metabolomic data to existing models containing clinical and genetic data was marginal.<br /> (2) They then determined whether certain metabolites might protect against glaucoma in individuals at high genetic risk: Certain molecules in bioenergetic pathways (lactate, pyruvate and citrate) conferred protection.<br /> (3) They provide support for protection conferred by pyruvate in a murine model.

      Weaknesses

      (1) Although it is an invaluable treasure trove of data, selection bias and self-reporting are inescapable problems when using the UK Biobank data for glaucoma research. The high-impact glaucoma-related GWAS publications (Ref 26 and 27) referenced in support of the method suffer the same limitations. This doesn't negate the conclusions but must be taken into consideration. The authors might note that it is somewhat reassuring that the proportion of glaucoma cases (4%) is close to what would be expected in a population-based study of 40-69-year-olds of predominantly white ethnicity.<br /> (2) As noted by the authors, a limitation is the predominantly white ethnicity profile that comprises the UK Biobank.<br /> (3) Also as noted by the authors, the study is cross-sectional and is limited by the "correlation does not imply causation" issue.<br /> (4) The optimal collection, transport and processing of the samples for NMR metabolite analysis is critical for accurate results. Strict policies were in place for these procedures, but deviations from protocol remain an unknown influence on the data.<br /> (5) In addition, all UK Biobank blood samples had unintended dilution during the initial sample storage process at UK Biobank facilities. (Julkunen, H. et al. Atlas of plasma NMR biomarkers for health and disease in 118,461 individuals from the UK Biobank. Nat Commun 14, 604 (2023) Samples from aliquot 3, used for the NMR measurements, suffered from 5-10% dilution. (Allen, Naomi E., et al. Wellcome Open Research 5 (2021): 222.) Julkunen et al. report that "The dilution is believed to come from mixing of participant samples with water due to seals that failed to hold a system vacuum in the automated liquid handling systems. While this issue is likely to have an impact on some of the absolute biomarker concentration values, it is expected to have limited impact on most epidemiological analyses."

      Strengths

      The huge sample size supports a powerful statistical analysis and the opportunity for the inclusion of multiple covariates and interactions without overfitting the models.<br /> The authors have constructed a robust methodology and statistical design.<br /> The manuscript is well-written, and the study is logically presented.<br /> The Figures are of good quality.

      Broadly, the conclusions are justified by the findings.

      Impact<br /> The findings advance personalized prognostics for glaucoma that combine metabolomic and genetic data. In addition, the protective effect of certain metabolites influences further research on novel therapeutic strategies.

      Comments on revisions:

      The authors have thoughtfully and comprehensively addressed my comments. I have no further comments.

    1. Reviewer #1 (Public review):

      Summary:

      By way of background, the Jiang lab has previously shown that loss of the type II BMP receptor Punt (Put) from intestinal progenitors (ISCs and EBs) caused them to differentiate into EBs, with a concomitant loss of ISCs (Tian and Jiang, eLife 2014). The mechanism by which this occurs was activation of Notch in Put-deficient progenitors. How Notch was upregulated in Put-deficient ISCs was not established in this prior work. In the current study, the authors test whether a very low level of Dl was responsible. But co-depletion of Dl and Put led to a similar phenotype as depletion of Put alone. This result suggested that Dl was not the mechanism. They next investigate genetic interactions between BMP signaling and Numb, an inhibitor of Notch signaling. Prior work from Bardin, Schweisguth and other labs has shown that Numb is not required for ISC self-renewal. But the authors wanted to know whether loss of both the BMP signal transducer Mad and Numb would cause ISC loss. This result was observed for RNAi depletion from progenitors and for mad, numb double mutant clones. Of note, ISC loss was observed in 40% of mad, numb double mutant clones, whereas 60% of these clones had an ISC. They then employed a two-color tracing system called RGT to look at the outcome of ISC divisions (asymmetric (ISC/EB) or symmetric (ISC/ISC or EB/EB)). Control clones had 69%, 15% and 16%, respectively, whereas mad, numb double mutant clones had much lower ISC/ISC (11%) and much higher EB/EB (37%). They conclude that loss of Numb in moderate BMP loss of function mutants increased symmetric differentiation which lead caused ISC loss. They also reported that numb15 and numb4 clones had a moderate but significant increase in ISC-lacking clones compared to control clones, supporting the model that Numb plays a role in ISC maintenance. Finally, they investigated the relevance of these observation during regeneration. After bleomycin treatment, there was a significant increase in ISC-lacking clones and a significant decrease in clone size in numb4 and numb15 clones compared to control clones. Because bleomycin treatment has been shown to cause variation in BMP ligand production, the authors interpret the numb clone under bleomycin results as demonstrating an essential role of Numb in ISC maintenance during regeneration.

      Strengths

      i. Data are quantified with statistical analysis<br /> ii. Experiments have appropriate controls and large numbers of samples<br /> iii. Results demonstrate an important role of Numb in maintaining ISC number during regeneration and a genetic interaction between Mad and Numb during homeostasis.

      Weaknesses

      None noted in the revised manuscript.

    2. Reviewer #2 (Public review):

      Summary:

      This work assesses the genetic interaction between the Bmp signaling pathway and the factor Numb, which can inhibit Notch signalling. It follows up on the previous studies of the group (Tian, eLife, 2014; Tian, PNAS, 2014) regarding BMP signaling in controlling stem cell fate decision as well as on the work of another group (Sallé, EMBO, 2017) that investigated the function of Numb on enteroendocrine fate in the midgut. This is an important study providing evidence of a Numb-mediated back up mechanism for stem cell maintenance.

      Strengths:

      (1) Experiments are consistent with these previous publications while also extending our understanding of how Numb functions in the ISC.<br /> (2) Provides an interesting model of a "back up" protection mechanism for ISC maintenance.

      Weaknesses:<br /> (1) Aspects of the experiments could be better controlled or annotated:<br /> (a) As they "randomly chose" the regions analyzed, it would be better to have all from a defined region (R4 or R2, for example) or to at least note the region as there are important regional differences for some aspects of midgut biology.<br /> (b) It is not clear to me why MARCM clones were induced and then flies grown at 18{degree sign}C? It would help to explain why they used this unconventional protocol.

      (2) There are technical limitations with trying to conclude from double-knockdown experiments in the ISC lineage, such as those in Figure 1 where Dl and put are both being knocked down: depending on how fast both proteins are depleted, it may be that only one of them (put, for example) is inactivated and affects the fate decision prior to the other one (Dl) being depleted. Therefore, it is difficult to definitively conclude that the decision is independent of Dl ligand.

      (3) Additional quantification of many phenotypes would be desired.<br /> (a) It would be useful to see esg-GFP cells/total cells and not just field as the density might change (2E for example).<br /> (b) Similarly, for 2F and 2G, it would be nice to see the % of ISC/ total cell and EB/total cell and not only per esgGFP+ cell.<br /> (c) Fig1: There is no quantification - specifically it would be interesting to know how many esg+ are su(H)lacZ positive in Put- Dl- condition compared to WT or Put- alone. What is the n?<br /> (d) Fig2: Pros + cells are not seen in the image? Are they all DllacZ+?<br /> (e) Fig3: it would be nice to have the size clone quantification instead of the distribution between groups of 2 cell 3 cells 4 cell clones.<br /> (f) How many times were experiments performed?

      (4) The authors do not comment on the reduction of clone size in DSS treatment in Figure 6K. How do they interpret this? Does it conflict with their model of Bleo vs DSS?

      (5) There is probably a mistake on sentence line 314 -316 "Indeed, previous studies indicate that endogenous Numb was not undetectable by Numb antibodies that could detect Numb expression in the nervous system".

      Comments on revisions:

      The authors have by and large addressed my main points.

    3. Reviewer #3 (Public review):

      Summary:

      The authors provide an in-depth analysis of the function of Numb in adult Drosophila midgut. Based on RNAi combinations and double mutant clonal analyses, they propose that Numb has a function in inhibiting Notch pathway to maintain intestinal stem cells, and is a backup mechanism with BMP pathway in maintaining midgut stem cell mediated homeostasis.

      Strengths:

      Overall, this is a carefully constructed series of experiments, and the results and statistical analyses provides believable evidence that Numb has a role, albeit weak compared to other pathways, in sustaining ISC and in promoting regeneration especially after damage by bleomycin, which may damage enterocytes and therefore disrupt BMP pathway more. The results overall support their claim.

      The data are highly coherent, and support a genetic function of Numb, in collaborating with BMP signaling, to maintain the number and proliferative function of ISCs in adult midguts. The authors used appropriate and sophisticated genetic tools of double RNAi, mutant clonal analysis and dual marker stem cell tracing approaches to ensure the results are reproducible and consistent. The statistical analyses provide confidence that the phenotypic changes are reliable albeit weaker than many other mutants previously studied.

      Weaknesses:

      In the absence of Numb itself, the midgut has a weak reduction of ISC number (Fig. 3 and 5), as well as weak albeit not statistically significant reduction of ISC clone size/proliferation. I think the authors published similar experiments with BMP pathway mutants. The mad1-2 allele used here as stated below may not be very representative of other BMP pathway mutants. Therefore, it could be beneficial to compare the number of ISC number and clone sizes between other BMP experiments to provide the readers a clearer picture how these two pathways individually contribute (stronger/weaker effects) to the ISC number and gut homeostasis.

      The main weakness of this manuscript is the analysis of the BMP pathway components, especially the mad1-2 allele. The mad RNAi and mad1-2 alleles (P insertion) are supposed to be weak alleles and that might be suitable for genetic enhancement assays here together with numb RNAi. However, the mad1-2 allele, and sometime the mad RNAi, showed weakly increased ISC clone size. This is kind of counter-intuitive that they should have a similar ISC loss and ISC clone size reduction.

      A much stronger phenotype was observed when numb mutants were subject to treatment of tissue damaging agents Bleomycin, which causes damage in different ways than DSS. Bleomycin as previously shown to be causing mainly enterocyte damage, and therefore disrupt BMP signaling from ECs more likely. Therefore, this treatment together with loss of numb led to highly significant reduction of ISC in clones and reduction of clone size/proliferation. One improvement is that it is not clear whether the authors discussed the nature of the two numb mutant alleles used in this study and the comparison to the strength of the RNAi allele. Because the phenotypes are weak, and more variable, the use of specific reagents is important.

      Furthermore, the use of possible activating alleles of either or both pathways to test genetic enhancement or synergistic activation will provide strong support for the claims.

      For the revision, the authors have provided detailed responses, comments, and a revised manuscript that together satisfactorily answer all my questions. The manuscript read well and the flow of information is quite clear. I do not have further concerns and support the manuscript moving forward.

    1. Reviewer #1 (Public review):

      The authors investigated the response of worms to the odorant 1-octanol (1-oct) using a combination of microfluidics-based behavioral analysis and whole-network calcium imaging. They hypothesized that 1-oct may be encoded through two simultaneous, opposing afferent pathways: a repulsive pathway driven by ASH, and an attractive pathway driven by AWC. And the ultimate chemotactic outcome is likely determined by the balance between these two pathways.

      It is not surprising that 1-octanol is encoded as attractive at low concentrations and repulsive at higher concentrations. However, the novel aspect of this study is the discovery of the combinatorial coding of 1-oct in the periphery, where it serves as both an attractant and a repellent. Furthermore, the study uses this dual encoding as a model to explore the neural basis of sensory-driven behaviors at a whole-network scale in this organism. The basic conclusions of this study are well supported by the behavioral and imaging experiments, though there are certain aspects of the manuscript that would benefit from further clarification.

      A key issue is that several previous studies have demonstrated a combinatorial and concentration-dependent coding of odorant sensing in the nematode peripheral nervous system. Specifically, ASH and AWC are the primary receptors for repellent and attractive responses, respectively. However, other neurons such as AWB, AWA, and ADL are also involved in the coding process. These neurons likely communicate with different interneurons to contribute to 1-oct-induced outputs. The authors' conclusion that loss of tax-4 reduces attractive responses and that osm-9 mutants reduce repulsive responses is not entirely convincing. TAX-4 is required for both AWC (an attractive neuron) and AWB (a repulsive neuron), and osm-9 is essential for ASH, ADL, and AWA (attraction-associated). Therefore, the observed effects on the attractive and repulsive responses could be more complex. Additionally, the interpretation of results involving the use of IAA to reduce the contribution of AWC at lower concentrations lacks clarity. A more effective approach might involve using transgenically expressed miniSOG or histamine (HisCl1) to specifically inhibit AWC neurons.

      The authors did not observe any increased correlation between motor command interneurons and sensory neurons, which is consistent with the absence of a consistent relationship between state transitions and 1-oct application. Furthermore, they did not observe significant entrainment of AIB activity with the 2.2 mM 1-oct application. This might be due to the animals being anesthetized with 1 mM tetramisole hydrochloride, which could affect neural activity and/or feedback from locomotion. It is unclear whether subtracting AVA activity from AIB activity provides a valid measure. Similarly, it is unclear how the behavioral data from freely moving worms compares to the whole-network calcium imaging results obtained from immobilized worms.

    2. Reviewer #2 (Public review):

      Summary:

      The authors used whole-network imaging to identify sensory neurons that responded to the repellant 1-octanol. While several olfactory neurons responded to the initial onset of odor pulses, two neurons consistently responded to all the pulses, ASH and AWC. ASH typically activates in response to repellants, and AWC typically activates in response to the removal of attractants. However, in this case, AWC activated in response to the removal of 1-octanol, which was unexpected because 1-octanol is a harmful repellant to the worm. The authors further investigated this phenomenon by testing different concentrations of 1-octanol in a chemotaxis assay and found that at lower (less harmful) concentrations the odor is actually an attractant, but becomes repulsive at higher concentrations. The amplitude of the ASH response appeared to be modulated by concentration, but this was not true for AWC. The authors propose a model where the behavioral response of the worm is the result of integrating these two opposing drives, where repulsion is a result of the increased ASH activity overriding the positive drive from AWC. The authors further tested this theory by testing mutants that ablated the AWC response (tax-4) or ASH response (osm-9), which produced results consistent with their hypothesis. While the interneuron(s) that integrate these signals to influence behavior were not identified, the authors did find that increasing concentrations of 1-octanol did increase the likelihood of AVA activity, a neuron that drives reversals (and hence, behavioral repulsion).

      Strengths:

      This was simple and elegant work that identified specific neurons of interest which generated a hypothesis, which was further tested with mutants that altered neuronal activity. The authors performed both neuronal imaging and behavioral experiments to verify their claims.

      Weaknesses:

      tax-4, but not osm-9 mutants were used in chemotaxis and imaging assays. It would have been nice to have osm-9 results as well for these assays. The mutants are not specific to AWC and ASH. Cell-specific rescue of these neurons would have strengthened the proposed model.

    3. Reviewer #3 (Public review):

      Summary:

      This work describes how two chemosensory neurons in C. elegans drive opposite behaviors in response to a volatile cue. Because they have different concentration dependencies, this leads to different behavioral responses (attraction at low concentration and repulsion at high concentration). It has been known that many odorants that are attractive at low concentrations are aversive at high concentrations, and the implicated neurons (at least AWC for attraction and ASH for repulsion) have been well established. Nonetheless, studying behavior and neural responses in a common context (odor pulses, as opposed to gradients) provides a clear picture of how these sensory neurons may guide the dose-dependent response by separately modulating odor entry and odor exit behaviors.

      Strengths:

      (1) There is good evidence that worms are attracted to low concentrations and repelled by high concentrations of 1-oct. Calcium imaging also makes it clear that dose dependence is stronger for ASH than AWC.

      (2) There is good evidence for conc. dependent responses via ASH (Figure 4E) and attractive inhibition via tonic IAA (Figure 7A).

      (3) This work presents calcium imaging and behavior with the same stimulus (sudden pulses in volatile odor concentration), while previous studies often focus on using neuronal responses to pulses to understand the navigation of gentle gradients.

      Weaknesses:

      (1) It is not clear precisely how important AWC is (compared to other cells) for the attractive response, though the presence of odor-off behavior implicates it. This could be resolved by looking at additional mutants (tax-4 is broad).

      (2) Relatedly, dose-dependent chemotaxis data (Figure 4C, D) should be provided for osm-9 animals to get a sense of the degree to which dose-dependence is explained by ASH.

      (3) Figure 4A, B should include average traces with errors, as there are several ways the responses can vary across conditions.

      (4) The data in Figure 6G does not appear to have error bars. Also, it would help to include a more conventional demonstration of AIB responding to stimuli (e.g. averaging stimulus-aligned responses as a percent of the fluorescence value at stimulus onset to perform the desired subtraction). Subtracted calcium traces are harder to interpret. As it stands, the evidence that sensory signals are persisting in AIB and not being shunted by proprioceptive feedback in microfluidic devices is not strong.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by Xie and colleagues presents transcriptomic experiments that measure gene expression in eight different tissues taken from adult female and male mice from four species. These data are used to make inferences regarding the evolution of sex-biased gene expression across these taxa.

      Strengths:

      The experimental methods and data analysis appear appropriate. The authors promote their study as unprecedented in its size and technical precision.

      Weaknesses:

      The manuscript does not present a clear set of novel evolutionary conclusions. The major findings recapitulate many previous comparative transcriptomics studies - gene expression variation is prevalent between individuals, sexes, and species; and genes with sex-biased expression evolve more rapidly than genes with unbiased expression - but it is not clear how the study extends our understanding of gene expression or its evolution.

      Many gene expression differences between individual animals are selectively neutral, because these differences in mRNA concentration are buffered at the level of translation, or differences in protein abundance have no effect on cellular or organismal function. The hypothesis that sex-biased genes are enriched for selectively neutral expression differences is supported by the excess of inter-individual expression variance and inter-specific expression differences in sex-biased genes. A higher rate of adaptive coding evolution is inferred among sex-biased genes as a group, but it is not clear whether this signal is driven by many sex-biased genes experiencing a little positive selection, or a few sex-biased genes experiencing a lot of positive selection, so the relationship between expression and protein-coding evolution remains unclear. It is likely that only a subset of the gene expression differences detected here will have phenotypic effects relevant for fitness or medicine, but without some idea of how many or which genes comprise this subset, it is difficult to interpret the results in this context.

      Throughout the paper the concepts of sexual selection and sexually antagonistic selection are conflated; while both modes of selection can drive the evolution of sexually dimorphic gene expression, the conditions promoting and consequence of both kinds of selection are different, and the manuscript is not clear about the significance of the results for either mode of selection.

      The manuscript's conclusion that "most of the genetic underpinnings of sex-differences show no long-term evolutionary stability" is not supported by the data, which measured gene expression phenotypes but did not investigate the underlying genetic variation causing these differences between individuals, sexes, or species. Furthermore, most of the gene expression differences are observed between sex-specific organs such as testes and ovaries, which are downstream of the sex-determination pathway that is conserved in these four mouse species, so these conclusions are limited to gene expression phenotypes in somatic organs shared by the sexes.

      The differences between sex-biased expression in mice and humans are attributed to differences in the two species effective population sizes; but the human samples have significantly more environmental variation than the mouse samples taken from age-matched animals reared in controlled conditions, which could also explain the observed pattern.

      The smoothed density plots in Figure 5 are confusing and misleading. Examining the individual SBI values in Table S9 reveals that all of the female and male SBI values for each species and organ are non-overlapping, with the exception of the heart in domesticus and mammary gland in musculus, where one male and one female individual fall within the range of the other sex. The smoothed plots therefore exaggerate the overlap between the sexes; in particular, the extreme variation shown in the SBI in the mammary glands in spretus females and spicilegus males is hard to understand given the normalized values in Table S3. The R code used to generate the smoothed plots is not included in the Github repository, so it is not possible to independently recreate those plots from the underlying data.

      The correlations provided in Table S9 are confusing - most of the reported correlations are 1.0, which are not recovered when using the SBI values in Table S9, and which does not support the manuscript's assertion that sex-biased gene expression can vary between organs within an individual. Indeed, using the SBI values in Table S9, many correlations across organs are negative, which is expected given the description of the result in the text.

    2. Reviewer #3 (Public review):

      This manuscript reports interesting data on sex differences in expression across several somatic and reproductive tissues among 4 mice species or subspecies. The focus is on sex-biased expression in the somatic tissues, where the authors report high rates of turnover such that the majority of sex-biased genes are only sex-biased in one or two taxa. The authors show sex-biased genes have higher expression variance than unbiased genes but also provide some evidence that sex-bias is likely to evolve from genes with higher expression variance. The authors find that sex-biased genes (both female- and male-biased) experience more adaptive evolution (i.e., higher alpha values) than unbiased genes. The authors develop a summary statistic (Sex-Bias Index, SBI) of each individual's degree of sex-bias for a given tissue. They show that the distribution of SBI values often overlap considerably for somatic (but not reproductive) tissues and that SBI values are not correlated across tissues, which they interpret as indicating an individual can be relatively "male-like" in one tissue and relatively "female-like" in another tissue.

      Though the data are interesting, there are some disappointing aspects to how the authors have chosen to present the work. For example, their criteria for sex-bias requires an expression ratio of one sex to the other of 1.25. A reasonably large fraction of the "sex-biased genes" have ratios just beyond this cut-off (Fig. S1). A gene which has a ratio of 1.27 in taxa 1 can be declared as "sex-biased" but which has a ratio of 1.23 in taxa 2 will not be declared as "sex-biased". It is impossible to know from how the data are presented in the main text the extent to which the supposed very high turnover represents substantial changes in dimorphic expression. A simple plot of the expression sex ratio of taxa 1 vs taxa 2 would be illuminating but the authors declined this suggestion.

      I was particularly intrigued by the authors' inference of the proportion of adaptive substitutions ("alpha") in different gene sets. The show alpha is higher for sex-biased than unbiased genes and nicely shows that the genes that are unbiased in focal taxa but sex-biased in the sister taxa also have low alpha. It would be even stronger that sex-bias is associated with adaptive evolution to estimate alpha for only those genes that are sex-biased in the focal taxa but not in the sister taxa (the current version estimates alpha on all sex-biased genes within the focal taxa, both those that are sex-biased and those that are unbiased in the sister taxa).

      The author's Sex Bias Index is measured in an individual sample as: SBI = median(TPM of female-biased genes) - median(TPM of male-biased genes). This index has some strange properties when one works through some toy examples (though any summary statistic will have limitations). The authors do little to jointly discuss the merits and limitations of this metric. It would have been interesting to examine their two key points (degree of overlapping distributions between sexes and correlation across tissues) using other individual measures of sex-bias.

      Figure 5 shows symmetric gaussian-looking distributions of SBI but it makes me wonder to what extent this is the magic of model fitting software as there are only 9 data points underlying each distribution. Whereas Figure 5 shows many broadly overlapping distributions for SBI, Figure 6 seems to suggest the sexes are quite well separated for SBI (e.g., brain in MUS, heart in DOM).

      Fig. S1 should be shown as the log(F/M) ratio so it is easier to see the symmetry, or lack thereof, of female and male-biased genes.<br /> It is important to note that for the variance analysis that IQR/median was calculated for each gene within each sex for each tissue. This is a key piece of information that should be in the methods or legend of the main figure (not buried in Supplemental Table 17).

    1. Reviewer #2 (Public review):

      Summary:

      Makarova et al. provide the first complete cellular-level reconstruction of an insect eye. They use the extremely miniaturized parasitoid wasp, Megaphragma viggiani and apply improved and optimized volumetric EM methods they can describe, the size, volume and position of every single cell in the insect compound eye.

      This data has previously only been inferred from TEM cross-sections taken in different parts of the eye, but in this study and in the associated 3d datasets video and stacks, one can observe the exact position and orientation in 3D space.<br /> The authors have made a very rigorous effort to describe and assess the variation in each cell type and have also compared two different classes of dorsal rim and non-dorsal rim ommatidia and the associated visual apparatus for each, confirming previous known findings about the distribution and internal structure that assists in polarization detection in these insects.

      Strengths:

      The paper is well written and strives to compare the data with previous literature wherever possible and goes beyond cell morphology, calculating the optical properties of the different ommatidia and estimating light sensitivity and spatial resolution limits using rhabdom diameter, focal length and showing how this varies across the eye.

      Finally, the authors provide very informative and illustrative videos showing how the cones, lenses, photoreceptors, pigment cells, and even the mitochondria are arranged in 3D space, comparing the structure of the dorsal rim and non-dorsal rim ommatidia. They also describe three 'ectopic' photoreceptors in more anatomical detail providing images and videos of them.

      Comments on revisions:

      The updates improve the manuscript.

    2. Reviewer #3 (Public review):

      Summary:

      The article presents a meticulous and quantitative anatomical reconstruction of the compound eye of a tiny wasp at the level of subcellular structures, cellular and optical organization of the ommatidia and reveals the ectopic photoreceptors, which are decoupled from the eye's dioptrical apparatus.

      Strengths:

      The graphic material is of very high quality, beautifully organized and presented in a logical order. The anatomical analysis is fully supported by quantitative numerical data at all scales, from organelles to cells and ommatidia, which should be a valuable source for future studies in cellular biology and visual physiology. The 3D renders are highly informative and a real eye candy.

      Weaknesses:

      The claim that the large dorsal part of the eye is the dorsal rim area (DRA), supported by anatomical data on rhabdomere geometry and connectomics in authors' earlier work, would eventually greatly benefit from additional evidence, obtained by other methods.

      Comments on revisions:

      Thank you for considering my remarks and advice. All is fine.

    1. Reviewer #1 (Public review):

      Summary:

      This interesting manuscript first shows that human, murine, and feline sperm penetrate the zona pellucida (ZP) of bovine oocytes recovered directly from the ovary, although first cleavage rates are reduced. Similarly, bovine sperm can penetrate superovulated murine oocytes recovered directly from the ovary. However, bovine oocytes incubated with oviduct fluid (30 min) are generally impenetrable by human sperm.

      Thereafter, the cytoplasm was aspirated from murine oocytes - obtained from the ovary or oviduct. Binding and penetration by bovine and human sperm was reduced in both groups relative to homologous (murine) sperm. However, heterologous (bovine and human) sperm penetration was further reduced in oviduct vs. ovary derived empty ZP. These data show that outer (ZP) not inner (cytoplasmic) oocyte alterations reduce heterologous sperm penetration as well as homologous sperm binding.

      This was repeated using empty bovine ZP incubated, or not, with bovine oviduct fluid. Prior oviduct fluid exposure reduced non-homologous (human and murine) empty ZP penetration, polyspermy, and sperm binding. This demonstrates that species-specific oviduct fluid factors regulate ZP penetrability.

      To test the hypothesis that OVGP1 is responsible, the authors obtained histidiine-tagged bovine and murine OVGP1 and DDK-tagged human OVGP1 proteins. Tagging was to enable purification following over-expression in BHK-21 or HEK293T cells. The authors confirm these recombinant OVGP1 proteins bound to both murine and bovine oocytes. Moreover, previous data using oviduct fluid was mirrored using bovine oocytes supplemented with homologous (bovine) recombinant OVGP1, or not. This confirms the hypothesis, at least in cattle.

      Next, the authors exposed bovine and murine empty ZP to bovine, murine, and human recombinant OVGP1, in addition to bovine, murine, or human sperm. Interestingly, both species-specific ZP and OVGP1 seem to be required for optimal sperm binding and penetration.

      Lastly, empty bovine and murine ZP were treated with neuraminidase, or not, with or without pre-treatment with homologous OVGP1. In each case, neuraminidase reduced sperm binding and penetration. This further demonstrates that both ZP and OVGP1 are required for optimal sperm binding and penetration.

      In summary, the authors demonstrate that two mechanisms seem to underpin mammalian sperm recognition and penetration, the first being specific (ZP-mediated) and the second non-specific (OVGP1 mediated).

    2. Reviewer #2 (Public review):

      Summary:

      In the manuscript entitled "Oviductin sets the species-specificity of the mammalian zona pellucida", de la Fuente et al analyze the species specificity of sperm-egg recognition by looking at sperm binding and penetration of zonae pellucidae from different mammalian species and find a role for the oviductal protein OVGP1 in determining species specificity.

      Strengths:

      By combining sperm, oocytes, zona pellucida (ZP), and oviductal fluid from different mammalian species, they elucidate the essential role of OVGP1 in conferring species-specific fertilization.

      Weaknesses:

      Mice with OVGP1 deletion are viable and fertile. It would be quite interesting to investigate the species-specificity of sperm-ZP binding in this model. That would indicate whether OVGP1 is the only glycoprotein involved in determining species-specificity. Alternatively, the authors could immunodeplete OVGP1 from oviductal fluid and then ascertain whether this depleted fluid retains the ability to impede cross-species fertilization.

      Comments on revisions:

      This resubmission addresses most of my comments and concerns.

    3. Reviewer #3 (Public review):

      Summary:

      The authors submitted a second revised manuscript that reports findings from a series of experiments suggesting that bovine oviductal fluid and species-specific oviductal glycoprotein (OVGP1 or oviductin) from bovine, murine, or human sources modulate the species specificity of bovine and murine oocytes.

      Strengths:

      The study reported in the manuscript deals with an important topic of interest in reproductive biology.

      Weaknesses:

      The authors submitted a second revised manuscript. Some of the previous questions are considered inadequate. There are still several problematic issues that require the authors' attention.

    1. Reviewer #1 (Public review):

      Summary:

      This important article reveals that the Nora virus can colonize the intestinal cells of Drosophila melanogaster, where it persists with minimal immediate impact on its host. However, upon aging, infection, or exposure to toxicants, stem cell activation induces Nora virus proliferation, enabling it to colonize enterocytes. This colonization disrupts enterocyte function, leading to increased gut permeability and a significant reduction in lifespan. Results are convincing with an important impact on the Drosophila community.

      Strengths:

      (1) Building on previous studies by Habayeb et al. (2009) and Hanson et al. (2023), this study highlights cryptic Nora virus infection as a crucial factor in aging and gut homeostasis in Drosophila melanogaster.

      (2) Consistent with the oral route of Nora virus transmission, the study demonstrates that the virus resides in intestinal stem cells, with its replication directly linked to stem cell proliferation. This process facilitates the colonization of enterocytes, ultimately disrupting intestinal function.

      (3) The study establishes a clear connection between stem cell proliferation and virus replication, suggesting that various factors - such as microbiota, aging, diet, and injury - can influence Nora virus dynamics and associated pathology.

      (4) The experimental design is robust, comparing infected flies with virus-cured controls to validate findings.

      Weaknesses:

      (1) The study does not explore or discuss how oral ingestion of Nora virus leads to the colonization of stem cells, which are located basally in the gut. This mechanism should be discussed.

      (2) The authors fail to detect Dicer-GFP fusion protein expression in stem cells, a finding that could explain why the virus persists in these cells. Further investigation is needed to determine whether RNAi functions are effective in stem cells compared to enterocytes. For clarification, the authors could cross esg-Gal4 UAS-GFP and Myo-Gal4 UAS-GFP with UAS GFP-RNAi and/or express a Dicer-GFP construct under a stem cell-specific driver.

      (3) The presentation of experimental parameters (e.g., pathogen type, temperature, time points) should be improved in the results section and at the top of the figures to enhance clarity. Additionally, details regarding the mode of oral infection (continuous exposure vs. single feeding on a filter) should be specified. Given that fly stock flipping frequency influences microbiota load (as noted in Broderick et al.), this should be reported, especially for lifespan studies.

      (4) To confirm that enterocyte colonization requires stem cell proliferation and differentiation, the authors should analyze Nora virus localization in JAK-STAT-deficient flies infected with bacteria or toxicants. This would help determine whether the virus can infect enterocytes in the absence of enterocyte differentiation, but stimulation of stem cells.

      (5) The study does not discuss the spatial distribution of Nora virus infection along the gut. Specifically, it remains unclear whether viral colonization is higher in gut regions R2 and R3, which contain proliferative stem cells. Addressing this could provide valuable insights into the virus's infection dynamics.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors report that Nora virus, a natural Drosophila pathogen that also persistently infects many laboratory fly stocks, infects intestinal stem cells (ISCs), leading to a shorter life span and increased sensitivity to intestinal infection with the Pseudomonas bacterium. Nora virus infection was associated with an increased proliferation of ISC and disrupted gut barrier function. Genetically, the authors show that increased ISC division in Nora virus and Pseudomonas coinfected flies is driven by signaling through the JAK-STAT pathway and apoptosis.

      Accordingly, blocking apoptosis and JAK-STAT signaling reduces viral load, suggesting that in this context the JAK-STAT pathway is proviral in contrast to other previous observations in systemically infected flies. This work adds to the findings of another recent paper showing that another persistent fruit fly virus, Drosophila A virus, also increases ISC proliferation and decreases gut barrier function. Intestinal viruses should therefore be considered confounders in studies of fly intestinal physiology.

      Strengths:

      Overall, the data are convincing and robust, starting with two wildtype fly stocks (Ore-R strain) that differ in their Nora virus infection status, followed by experiments in which cleared stocks are reinfected with a purified Nora virus stock preparation. The conclusions of the paper will be of interest to scientists working on insect physiology, virology, and immunology, but should also serve as a warning for scientists that use the fly as a model to study gut physiology.

      Weaknesses:

      The title does not seem to be fully supported by the data. While the authors convincingly show the increased sensitivity to Pseudomonas infection, effects on another tested bacterium, Serratia marcescens, were not significantly different between Nora-virus-infected and non-infected flies. Thus effects of 'intestinal infection' seem to be too broad a claim. Also, whether the Nora virus increases sensitivity to oxidative stress is not so clear to me: the figure that supports this claim is the survival assay of Figure 5F. However, the difference in survival between control and paraquat-treated Nora (-) flies seems to be in the same order as between control and paraquat-treated Nora (+) flies. Rather, cause and effect seem to be the reverse: paraquat increases ISC proliferation, higher viral loads, and consequently shorter survival. I suggest rephrasing the title and conclusions accordingly.

      Quantification of immunofluorescence microscopy is missing, rendering the images somewhat anecdotal. Quantification should be provided. It will then also be of interest to quantify the number of Nora(+) cells and the Nora virus levels per infected cell (e.g. Figure 5H). Also, the claim that the Nora virus initially infects ISC and later (upon stress) infects enterocytes requires quantification.

      Genetic support for the role of the JAK-STAT pathway in driving ISC proliferation and supporting Nora virus replication is convincing. It would also be of interest to analyze other pathways implicated in ISC proliferation (e.g. JNK, EGFR), especially given the observations of Nigg et al, showing an involvement of STING/NF-kB and EGFR pathway in driving intestinal phenotypes of Drosophila A virus-infected flies (doi: 10.1016/j.cub.2024.05.009).

      Figure 5E: An intriguing observation is that GFP:Dicer2 seems to be unstable in Nora virus-infected cells. Here, GFP control driven by the same driver line would be required to confidently conclude that this is due to an effect on Dicer-2 specifically.

      Legends are mostly conclusive, and essential information about the experimental setup is missing in the captions of multiple figures, making the interpretation of the data difficult. See my private recommendations for suggestions to improve the data presentation.

    3. Reviewer #3 (Public review):

      Summary:

      Franchet et al. sought to characterize the impact of Nora virus on host lifespan and sensitivity to a variety of infectious or stressful treatments. Through careful and rigorous analyses, they provide evidence that the Nora virus greatly impacts fly survival to infection, overall lifespan, and intestinal integrity. The authors have been thorough and rigorous, and the experimental evidence including proper isolation of the virus and Koch's Postulate reinoculation of the organism is excellent. The additional work is valuable and to the gold standard of the field, characterizing the pathology of the gut, including data showing gut leakage, the presence of the virus in the intestinal stem cells, and the importance of stem cell proliferation for virus replication and spread using elegant genetic tools to block stem cell proliferation or enterocyte death.

      Strengths:

      The authors have been rigorous and careful. The initial finding is presented through the lens of two related strains differing in virus infection. From there, the authors characterized the virus and isolated a purified culture, which they used to reinoculate a cleared strain to demonstrate proper Koch's Postulate satisfaction. The authors have also probed various parameters in terms of dietary importance in relevant conditions for many experiments. The additional work to characterize the pathology of the gut is compelling, using genetic tools to block or allow intestinal stem cell proliferation and enterocyte death through JAK-STAT and JNK signalling alongside the tracing of virus presence using a Nora virus antibody. JAK-STAT and JNK are previously described as regulators of these processes, making these tools appropriate and convincing. It is also interesting to see good evidence that the virus itself is damaging, rather than simply permitting coinfection by gut microbes (which does happen).

      Weaknesses:

      The claim that Dcr2 is not abundant in ISCs because the protein is not stable is logically consistent and reasonable. Perhaps I missed this, but the authors could additionally knock down or use somatic CRISPR to delete Dcr2 in ISCs to test whether a lack of Dcr2 underlies sensitivity. In this experiment, the expectation would be that depleting Dcr2 in ISCs genetically would make little difference to susceptibility overall compared to controls. This is not an essential experiment request.

    1. Reviewer #1 (Public review):

      Summary:

      This work investigated how the sense of control influences perceptions of stress. In a novel "Wheel Stopping" task, the authors used task variations in difficulty and controllability to measure and manipulate perceived control in two large cohorts of online participants. The authors first show that their behavioral task has good internal consistency and external validity, showing that perceived control during the task was linked to relevant measures of anxiety, depression, and locus of control. Most importantly, manipulating controllability in the task led to reduced subjective stress, showing a direct impact of control on stress perception. However, this work has minor limitations due to the design of the stressor manipulations/measurements and the necessary logistics associated with online versus in-person stress studies.

      Nevertheless, this research adds to our understanding of when and how control can influence the effects of stress and is particularly relevant to mental health interventions.

      Strengths:

      The primary strength of this research is the development of a unique and clever task design that can reliably and validly elicit variations in beliefs about control. Impressively, higher subjective control in the task was associated with decreased psychopathology measures such an anxiety and depression in a non-clinical sample of participants. In addition, the authors found that lower control and higher difficulty in the task led to higher perceived stress, suggesting that the task can reliably manipulate perceptions of stress. Prior tasks have not included both controllability and difficulty in this manner and have not directly tested the direct influence of these factors on incidental stress, making this work both novel and important for the field.

      Weaknesses:

      One minor weakness of this research is the validity of the online stress measurements and manipulations. In this study, the authors measure subjective stress via self-report both during the task and also after either a Trier Social Stress Test (high-stress condition) or a memory test (low-stress condition). One concern is that these stress manipulations were really "threats" of stress, where participants never had to complete the stress tasks (i.e., recording a speech for judgment). While this is not unusual for an in-lab study and can reliably elicit substantial stress/anxiety, in an online study, there is a possibility for communication between participants (via online forums dedicated to such communication), which could weaken the stress effects. That said, the authors did find sensible increases and decreases of perceived stress between relevant time points, but future work could improve upon this design by including more complete stress manipulations and measuring implicit physiological signs of stress.

    2. Reviewer #2 (Public review):

      Summary:

      The authors have developed a behavioral paradigm to experimentally manipulate the sense of control experienced by the participants by changing the level of difficulty of a wheel-stopping task. In the first study, this manipulation is tested by administering the task in a factorial design with two levels of controllability and two levels of stressor intensity to a large number of participants online while simultaneously recording subjective ratings on perceived control, anxiety, and stress. In the second study, the authors used the wheel-stopping task to induce a high sense of controllability and test whether this manipulation buffers the response to a subsequent stress induction when compared to a neutral task, like looking at pleasant videos.

      Strengths:

      (1) The authors validate a method to manipulate stress.<br /> (2) The authors use an experimental manipulation to induce an enhanced sense of controllability to test its impact on the response to stress induction.<br /> (3) The studies involved big sample sizes.

      Weaknesses:

      (1) The study was not preregistered.

      (2) The control manipulation is conflated with task difficulty, and, therefore the reward rate. Although the authors acknowledge this limitation at the end of the discussion, it is a very important limitation, and its implications are not properly discussed. The discussion states that this is a common limitation with previous studies of control but omits that many studies have controlled for it using yoking.

      (3) The methods are not always clear enough, and it is difficult to know whether all the manipulations are done within-subjects or some key manipulations are done between subjects.

      (4) The analysis of internal consistency is based on splitting the data into odd/even sliders. This choice of data parcellation may cause missed drifts in task performance due to learning, practice effects, or tiredness, thus potentially inflating internal consistency.

      (5) Study 2 manipulates the effect of domain (win versus loss WS task), but the interaction of this factor with stressor intensity is not included in the analysis.

      This study will be of interest to psychologists and cognitive scientists interested in understanding how controllability and its subjective perception impact how people respond to stress exposure. Demonstrating that an increased sense of control buffers/protects against subsequent stress is important and may trigger further studies to characterize this phenomenon better. However, beyond the highlighted weaknesses, the current study only studied the effect of stress induction consecutive to the performance of the WS task on the same day and its generalizability is not warranted.

    3. Reviewer #3 (Public review):

      Summary:

      This is an interesting investigation of the benefits of perceiving control and its impact on the subjective experience of stress. To assess a subjective sense of control, the authors introduce a novel wheel-stopping (WS) task where control is manipulated via size and speed to induce low and high control conditions. The authors demonstrate that the subjective sense of control is associated with experienced subjective stress and individual differences related to mental health measures. In a second experiment, they further show that an increased sense of control buffers subjective stress induced by a trier social stress manipulation, more so than a more typical stress buffering mechanism of watching neutral/calming videos.

      Strengths:

      There are several strengths to the manuscript that can be highlighted. For instance, the paper introduces a new paradigm and a clever manipulation to test an important and significant question. Additionally, it is a well-powered investigation that allows for confidence in replicability and the ability to show both high internal consistency and high external validity with an interesting set of individual difference analyses. Finally, the results are quite interesting and support prior literature while also providing a significant contribution to the field with respect to understanding the benefits of perceiving control.

      Weaknesses:

      There are also some questions that, if addressed, could help our readership.

      (1) A key manipulation was the high-intensity stressor (Anticipatory TSST signal), which was measured via subjective ratings recorded on a sliding scale at different intervals during testing. Typically, the TSST conducted in the lab is associated with increases in cortisol assessments and physiological responses (e.g., skin conductance and heart rate). The current study is limited to subjective measures of stress, given the online nature of the study. Since TSST online may also yield psychologically different results than in the lab (i.e., presumably in a comfortable environment, not facing a panel of judges), it would be helpful for the authors to briefly discuss how the subjective results compare with other examples from the literature (either online or in the lab). The question is whether the experienced stress was sufficiently stressful given that it was online and measured via subjective reports. The control condition (low intensity via reading recipes) is helpful, but the low-intensity stress does not seem to differ from baseline readings at the beginning of the experiment.

      (2) The neutral videos represent an important condition to contrast with WS, but it raises two questions. First, the conditions are quite different in terms of experience, and it is interesting to consider what another more active (but not controlled per se) condition would be in comparison to the WS performance. That is, there is no instrumental action during the neutral video viewing (even passive ratings about the video), and the active demands could be an important component of the ability to mitigate stress. Second, the subjective ratings of the stress of the neutral video appear equivalent to the win condition. Would it have been useful to have a high arousal video (akin to the loss condition) to test the idea that experience of control will buffer against stress? That way, the subjective stress experience of stress would start at equivalent points after WS3.

      (3) For the stress relief analysis, the authors included time points 2 and 3 (after the stressor and debrief) but not a baseline reading before stress. Given the potential baseline differences across conditions, can this decision be justified in the manuscript?

      (4) Is the increased control experience during the losses condition more valuable in mitigating experienced stress than the win condition?

      (5) The subjective measure of control ("how in control do you feel right now") tends to follow a successful or failed attempt at the WS task. How much is the experience of control mediated by the degree of experienced success/schedule of reinforcement? Is it an assessment of control or, an evaluation of how well they are doing and/or resolution of uncertainty? An interesting paper by Cockburn et al. 2014 highlights the potential for positive prediction errors to enhance the desire for control.

      (6) While the authors do a very good job in their inclusion and synthesis of the relevant literature, they could also amplify some discussion in specific areas. For example, operationalizing task controllability via task difficulty is an interesting approach. It would be useful to discuss their approach (along with any others in the literature that have used it) and compare it to other typically used paradigms measuring control via presence or absence of choice, as mentioned by the authors briefly in the introduction.

      (7) The paper is well-written. However, it would be useful to expand on Figure 1 to include a) separate figures for study 1 (currently not included) and 2, and b) a timeline that includes the measurements of subjective stress (incorporated in Figure 1). It would also be helpful to include Figure S4 in the manuscript.

    1. Reviewer #1 (Public review):

      Summary:

      Busch and Hansel present a morphological and histological comparison between mouse and human Purkinje cells (PCs) in the cerebellum. The study reveals species-specific differences that have not previoulsy been reported despite numerous observations in these species. While mouse PCs show morphological heterogeneity and occasional multi-innervation by climbing fibers (CFs), human PCs exhibit a widespread, multi-dendritic structure that exceeds expectations based on allometric scaling. Specifically, human PCs are significantly larger, exhibit increased spine density, with a unique cluster-like morphology not found in mice.

      Strengths:

      The manuscript provides an exceptionally detailed analysis of PC morphology across species, surpassing any prior publication. Major strengths include a systematic and thorough methodology, rigorous data analysis, and clear presentation of results. This work is likely to become the go-to resource for quantitation in this field. The authors have largely achieved their aims, with the results effectively supporting their conclusions.

      Weaknesses:

      There are a few concerns that need to be addressed, specifically related to details of the methodolology as well as data interpretation based on the limits of some experimental approaches. Overall, these weaknesses are minor.

      Comments on revisions:

      The authors addressed my concerns in the revised manuscript. One bit of clarification, the defraction limit calculation involves the wavelength of light used for excitation not emission ("...for the minimum resolvable distance (R) given the fluorophore emission wavelength [l; 570nm for the Cy3 probe] and numerical aperture of the objective (NA) as follows:"). This is why a 2p system has less resolving power than a confocal system as it uses much longer wavelengths for excitation.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript follows up on a previously published paper (Busch and Hansel 2023) which proposed that the morphological variation of dendritic bifurcation in Purkinje cells in mouse and human is indicative of the number of climbing fiber inputs, with dendritic bifurcation at the level of the soma resulting in a proportion of these neurons being multi-innervated. The functional and anatomical climbing fiber data was obtained solely from mice, since all human tissue was embalmed and fixed, and the extension of these findings to human Purkinje cells was indirect. The current comparative anatomy study aims to resolve this question in human tissue more directly and to further analyse in detail the properties of adult human Purkinje cell dendritic morphology.

      Strengths:

      The authors have carried out a meticulous anatomical quantification of human Purkinje cell dendrites, in tissue preparations with better signal to noise ratio than their previous study, comparing them with those from mice. They show that human PC dendrites are much larger than would be expected from straightforward scaling to brain size and, importantly, they now present immunolabelling results that trace climbing fiber axons innervating human PCs in a subset of the data. As well as providing detailed analyses of spine properties and interesting and unexpected new findings of human PC dendritic length and spine types, the work suggests that human PCs that have two clearly distinct dendritic branches have an approximately 80% chance of receiving more than one CF input, segregated across the two branches. Albeit entirely observational, the data will be of widespread interest to the cerebellar field, in particular those building computational models of Purkinje cells.

      Weaknesses:

      The work is, by necessity, purely anatomical. It remains to be seen whether there are any functional differences in ion channel expression or functional mapping of granule inputs to human PCs compared with the mouse that might mitigate the major differences in electronic properties suggested.

      Comments on revisions:

      I am happy with the updated manuscript in response to my suggestions and I have no further comments.

    1. Reviewer #1 (Public review):

      Summary:

      In this study from Belato, Knight and co-workers, the authors investigated the Rec domain of a thermophilic Cas9 from Geobacillus stearothermophilus (GeoCas9). The authors investigated three constructs, two individual subdomains of Rec (Rec1 and Rec2) and the full Rec domain. This domain is involved in binding to the guide RNA of Cas9, as well as the RNA-DNA duplex that is formed upon target binding. The authors performed RNA binding and relaxation experiments using NMR for the wild-type domain as well as two-point mutants. They observed differences in RNA binding activities as well as the flexibility of the domain. The authors also performed molecular dynamics and functional experiments on full-length GeoCas9 to determine whether these biophysical differences affect the RNA binding or cleavage activity. Although the authors observed some changes in the thermal stability of the mutant GeoCas9-gRNA complex, they did not observe substantial differences in the guide RNA binding or cleavage activities of the mutant GeoCas9 variants.

      Overall, this manuscript provides a detailed biophysical analysis of the GeoCas9 Rec domain. The NMR assignments for this construct should prove very useful, and can serve as the basis for future similar studies of GeoCas9 Rec domain mutants. While the two mutants tested in the study did not produce significant differences from wild-type GeoCas9, the study rules out the possibility that analogous mutations can be translated between type II-A and II-C Cas9 orthologs. Together, these findings may provide the grounds for future engineering of higher fidelity variants of GeoCas9

    2. Reviewer #2 (Public review):

      The manuscript from Belato et al., used advanced NMR approaches and a mutagenesis campaign probe the conformational dynamics of the recognition lobe (Rec) of the CRISPR Cas9 enzyme from G. stearothermophilus (GeoCas9). Using truncated and full-length constructs they assess the impacts of two different point mutations have on the redistribution and timescale of these motions and assess gRNA recognition and specificity. Single point mutations in the Rec domain in a Cas9 from a related species had profound impacts on- and off-target DNA editing, therefore the authors reasoned analogous mutations in GeoCas9 would have similar effects. However, despite a redistribution of local motions and changes in global stability, their chosen mutations had little impact on DNA editing in the context of the full-length enzyme.

      In their revised manuscript, the authors were highly responsive to the reviewer's comments incorporating new experimental results including molecular dynamics simulations and RNA binding data using full-length GeoCas9, as well as reframing their discussion and conclusions in consideration of the new data. They were receptive to suggestions for clarification in both the text and methods section. With these changes, the manuscript has been significantly improved.

      Their studies highlight the species-specific complexity of interdomain communication and allosteric mechanisms used by these multi-domain endonucleases. The noted strengths of the article remain, and despite the negative results, their approach will garner interest from investigators interested in understanding how the activity and specificity of these enzymes can be engineered to tune activity and limit off-target cleavage by these enzymes. Generally, the manuscript highlights the challenges of studying the effect of allosteric networks on protein function, particularly in multidomain proteins, and thus will be of broad interest to the community.

    3. Reviewer #3 (Public review):

      The authors explore the role of Rec domains in a thermophilic Cas9 enzyme. They report on the crystal structure of part of the recognition lobe, its dynamics from NMR spin relaxation and relaxation-dispersion data, its interaction mode with guide RNA, and the effect of two single-point mutations hypothesised to enhance specificity. They find that mutations have small effects on Rec domain structure and stability but lead to significant rearrangement of micro- to milli-second dynamics which does not translate into major changes in guide RNA affinity or DNA cleavage specificity, illustrating the inherent tolerance of GeoCas9. The work can be considered as a first step towards understanding motions in GeoCas9 recognition lobe, although no clear hotspots were discovered with potential for future rational design of enhanced Cas9 variants.

      Strengths:

      - Detailed biophysical and structural investigation, despite a few technical limitations inherent with working with complex targets, provides converging evidence that molecular dynamics embedded in the recognition lobes allow GeoCas9 to operate on a broad range of substrates.<br /> - Since the authors and others have shown that substrate specificity is dictated by equivalent hotspot mutations in other Cas9 variants, we are one step closer to understanding this phenomenon.

      Weaknesses:

      - Since the mutations investigated here do not significantly affect substrate binding or enzymatic activity, it is difficult to rationalize anything for enzyme engineering at this point.<br /> - Further investigation of the determinants of the observed dynamic modes, and follow-up with rationally designed mutations would hopefully allow to create a real model of the mechanism, but I do understand that this goes beyond the scope of this study.

    1. Reviewer #1 (Public review):

      Summary:

      Using lineage tracing and single-cell RNA sequencing, Li et al. reported brain ECs can differentiate into pericytes after stroke. This finding is novel and important to the field.

      Strengths:

      Detailed characterization of each time point and genetic manipulation of genes for study role of ECs and E-pericyte.

      Weaknesses:

      Genetic evidence for lineage tracing of ECs and E-pericytes requires more convincing data that includse staining, FACS, and scRNA-seq analysis.

    2. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Li and colleagues study the fate of endothelial cells in a mouse model of ischemic stroke. Using genetic lineage tracing approaches, they found that endothelial cells give rise to non-endothelial cells, which they term "E-pericytes." They further show that depleting these cells exacerbates blood-brain barrier leakage and worsens functional recovery. The authors also provide evidence that endothelial-to-mesenchymal transition, myeloid cell-derived TGFβ1, and endothelial TGFβRII are involved in this process. These are potentially interesting findings, however, the experimental evidence that endothelial cells undergo transdifferentiation to non-endothelial cells is weak, as is the evidence that these cells are pericytes. Addressing this foundational weakness will facilitate the interpretation of the other findings.

      Strengths:

      (1) The authors address an important question about blood vessel function and plasticity in the context of stroke.

      (2) The authors use a variety of genetic approaches to understand cell fate in the context of stroke. Particularly commendable is the use of several complementary lineage tracing strategies, including an intersectional strategy requiring both endothelial Cre activity and subsequent mural cell NG2 promoter activity.

      (3) The authors address upstream cellular and molecular mechanisms, including roles for myeloid-derived TGFβ.

      Weaknesses:

      (1) The authors use Cdh5-CreERT2; Ai47 mice to permanently label endothelial cells and their progeny with eGFP. They then isolate eGFP+ cells from control and MCAO RP7D and RP34D brains, and use single-cell RNA-seq to identify the resulting cell types. Theoretically, all eGFP+ cells should be endothelial cells or their progeny. This is a very powerful and well-conceived experiment. The authors use the presence of a pericyte cluster as evidence that endothelial-to-pericyte transdifferentiation occurs. However, pericytes are also present in the scRNA-seq data from sham mice, as are several other cell types such as fibroblasts and microglia. This suggests that pericytes and these other cell types might have been co-purified (e.g., as doublets) with eGFP+ endothelial cells during FACS and may not themselves be eGFP+. Pericyte-endothelial doublets are common in scRNA-seq given that these cell types are closely and tightly associated. Additionally, tight association (e.g., via peg-socket junctions) can cause fragments of endothelial cells to be retained on pericytes (and vice-versa) during dissociation. Finally, it is possible that after stroke or during the dissociation process, endothelial cells lyse and release eGFP that could be taken up by other cell types. All of these scenarios could lead to the purification of cells that were not derived (transdifferentiated) from endothelial cells. The authors note that the proportion of pericytes increased in the stroke groups, but it does not appear this experiment was replicated and thus this conclusion is not supported by statistical analysis. The results of pseudotime and trajectory analyses rely on the foundation that the pericytes in this dataset are endothelial-derived, which, as discussed above, has not been rigorously demonstrated.

      (2) I have the same concern regarding the inadvertent purification of cells that were not derived from endothelial cells in the context of the bulk RNA-seq experiment (Figure S4), especially given the sample-to-sample variability in gene expression in the RP34D, eGFP+ non-ECs-group (e.g., only 2/5 samples are enriched for mesenchymal transcription factor Tbx18, only 1/5 samples are enriched for mural cell TF Heyl). If the sorted eGFP+ non-ECs were pericytes, I would expect a strong and consistent pericyte-like gene expression profile.

      (3) The authors use immunohistochemistry to understand localization, morphology, and marker expression of eGFP+ cells in situ. The representative "E-pericytes" shown in Figure 3A-D are not associated with blood vessels, and the authors' quantification also shows that the majority of such cells are not vessel-associated ("avascular"). By definition, pericytes are a component of blood vessels and are embedded within the vascular basement membrane. Thus, concluding that these cells are pericytes ("E-pericytes") may be erroneous.

      (4) CD13 flow cytometry and immunohistochemistry are used extensively to identify pericytes. In the context of several complementary lineage tracing strategies noted in Strength #2, CD13 immunohistochemistry is the only marker used to identify putative pericytes (Figure S3J-M). In stroke, CD13 is not specific to pericytes; dendritic cells and other monocyte-derived cells express CD13 (Anpep) in mouse brain after stroke (PMID: 38177281, https://anratherlab.shinyapps.io/strokevis/).

      (5) The authors conclude that "EC-specific overexpression of the Tgfbr2 protein by a virus (Tgfbr2) decreases Evans blue leakage, promotes CBF recovery, alleviates neurological deficits and facilitates spontaneous behavioral recovery after stroke by increasing the number of E-pericytes." All data in Figure 10, however, compare endothelial Tgfbr2 overexpression to a DsRed overexpression control. There is no group in which Tgfbr2 is overexpressed but "E-pericytes" are eliminated with DTA (this is done in Figure 9B, but this experiment lacks the Tgfbr2 overexpression-only control). Thus, the observed functional outcomes cannot be ascribed to "E-pericytes"; it remains possible that endothelial Tgfbr2 overexpression affects EB leakage, CBF, and behavior through alternative mechanisms.

      (6) Single-cell and bulk RNA-seq data are not available in a public repository (such as GEO). Depositing these data would facilitate their independent reevaluation and reuse.

    3. Reviewer #3 (Public review):

      Summary:

      The data and experiments presented in that study convincingly show that a subpopulation of endothelial cells undergo transformation into pericyte-like cells after stroke in mice. These so-called "E-pericytes" are protective and might present a new target for stroke recovery. The authors used a huge battery of different techniques and modified signaling pathways and cellular interactions using several genetic and pharmacological tools to show that TGFbeta and EndoMT are causes of this transformation.

      Strengths:

      The amount of different genetic and pharmacological approaches in combination with sophisticated techniques such as single-cell RNAseq is impressive and convincing. The results support their conclusions and the authors achieved their aims. The findings will strongly impact the field of cerebrovascular recovery after stroke and might open up new therapeutic targets.

      Weaknesses:

      The written and graphic presentation of the findings needs substantial improvement. Language editing is strongly recommended (there are a lot of spelling and grammatical errors in the text and illustrations, including legends).

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript by Toledo and colleagues describes the generation and characterization of Y220C mice (Y217C in the mouse allele). The authors make notable findings: Y217C mice that have been backcrossed to C57Bl/6 for five generations show decreased female pup births due to exencephaly, a known defect in p53 -/- mice, and they show a correlation with decreased Xist expression, as well as increased female neonatal death. They also noted similar tumor formation in Y217C/+ and p53 +/- mice, suggesting that Y217C may not function as a dominant negative. Notably, the authors find that homozygous Y217C mice die faster than p53 -/- mice, and that the lymphomas in the Y217C mice were more aggressive and invasive. The authors then perform RNA seq on thymi of Y217C homozygotes compared to p53 -/-, and they suggest that these differentially expressed genes may explain the increased tumorigenesis in Y217C mice.

      Strengths:

      Overall, the study is well controlled and quite well done and will be of interest to a broad audience, particularly given the high frequency of the Y220C mutation in cancer (1% of all cancers, 4% of ovarian cancer).

      Weaknesses:

      None noted

      Comments on revisions:

      The authors have done a superb job on this very interesting work.

    2. Reviewer #2 (Public review):

      Summary:

      Jaber et al. describe the generation and characterization of a knock-in mouse strain expressing the p53 Y217C hot-spot mutation. While the homozygous mutant cells and mice reflect the typical loss-of-p53 functions, as expected, the Y217C mutation also appears to display gain-of function (GOF) properties, exemplified by elevated metastasis in the homozygous context (as noted with several hot-spot mutations). Interestingly, this mutation does not appear to exhibit any dominant-negative effects associated with most hot-spot p53 mutations, as determined by absence of differences in overall survival and tumor predisposition of the heterozygous mice, as well as target gene activation upon nutlin treatment.

      In addition, the authors noted a severe reduction in the female 217/217 homozygous progeny, significantly more than that observed with the p53 null mice, due to exencephaly, leading them to conclude that the Y217C mutation also has additional, non-cancer related GOFs. Thought this property has been well described and attributed to p53 functional impairment, the authors conclude that the Y217C has additional properties in accelerating the phenotype.<br /> Transcriptomic analyses of thymi found additional gene signature differences between p53 null and the Y217C strains, indicative of novel target gene activation, associated with inflammation.

      Strengths:

      Overall, the characterisation of the mice highlights the expected typical outcomes associated with most hot-spot p53 mutations published earlier. The quality of the work presented is well done and good, and the conclusions and reasonably well justified.

      Comments on revisions:

      Revised version has addressed most of our queries and is acceptable.

    1. Reviewer #1 (Public review):

      Summary:

      In this manuscript, Paturi et.al. presents a detailed structural and mechanistic study of the DRB7.2:DRB4 complex in plants, focusing on its role in sequestering endogenous inverted-repeat dsRNA precursors and inhibiting Dicer-like protein 3 (DCL3) activity. By truncating the two proteins, they systematically identify the domains involved in direct interaction between DRB7.2 and DRB4 and study the interactions between the two using biophysical techniques (ITC and NMR). They show using NMR that the interacting domains between the two proteins are likely partially unfolded or aggregated in the absence of the binding partner and determining the NMR structure of the individual interacting domains in the presence of the isotopically unlabelled partner using sparse restrain data combined with Rosetta. They also determine the complex structure of the interacting DRB7.2 dsRBD domain and the DRB4 D3 domain using X-ray crystallography.

      Strengths:

      Overall, the manuscript is well written, provides molecular details at high resolution between the interaction of DRB7.2 and DRB4 and the data in the manuscript strongly supports the proposed model where DRB7.2:DRB4 complex sequesters the DCL3 substrates inhibiting its function of producing epigenetically activated siRNAs.

      Weaknesses:

      Major comments:

      (1) The manuscript unfortunately completely lacks functional validation of the determined DRB7.2:DRB4 complex structure which is required for the rigorous validation of the proposed model. For functional validation of the determined structures, the author should at least present the mutational analysis (impact on complex formation, RNA affinity) of the point mutants derived from the structure of the DRB7.2:DRB4 complex.

      (2) The proposed model shows the DRB7.2M and DRB4D3 as partially folded/aggregated proteins in the absence of the complex, understandably from the presented NMR data of the individual domains. However, in the cellular context, when the RNAs are present, especially DRB7.2M might be properly folded/not aggregated. Could the authors support or negate this by showing the 15N HSQC spectrum of DRB7.2M in complex with the 13 bp dsRNA?

      (3) It remains unclear from the manuscript if DRB7.1 will have a similar or different mechanism of interaction with DRB4. Based on the sequence comparisons of the two proteins, the authors should comment on this in the discussion section.

      Minor comments:

      (1) There are no errors for the N, dH and dS values of the ITC measurements in Table 1. Also, it seems that the measurements are done only once. Values derived from at least triplicates should be presented. This would be helpful to increase confidence in the values derived from ITC especially for the titration between DRB7.2, DRB4C, and DRB4D3 as the N value there is substantially lower than 1 which does not agree with the other data.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript by Paturi and colleagues uses an approach that combines structural biology and biochemistry to probe protein-protein and protein-RNA interactions for two protein factors related to the dsRNA pathway in plants.

      Strengths:

      A key finding in the research is the direct demonstration of the ability of the single dsRBD (double-strand RNA binding domain) of DRB7.2 to interact simultaneously with dsRNA as well as the C-terminal domain of DRB4. The heterodimerization of DRB7.2 and DRB4 is demonstrated to make a high-affinity complex with dsRNA and it is proposed that this atypical use of the dsRBD domain to bridge the protein and RNA may contribute to the ability to prevent cleavage that would otherwise occur for dsRNA. The primary results for the interactions are generally well-supported by the data, and the conclusions are taken from the available results without excessive speculation.

      Weaknesses:

      There is a need for some statistical repeats, as well as a suggested movement of many protein characterization findings in the solution state to support data or to better indicate how these properties could play a role in the final proposed mechanism. There is also the need for certain measurement replicates, such as for the ITC data which are derived from single measurements and lack sufficient estimates of error.

    1. Reviewer #1 (Public review):

      Summary:

      The study shows, perhaps surprisingly, that human fecal homogenates enhance the invasiveness of Salmonella typhimurium into cells of a swine colonic explant. This effect is only seen with chemotactic cells that express the chemoreceptor Tsr. However, two molecules sensed by Tsr that are present at significant concentrations in the fecal homogenates, the repellent indole and the attractant serine, do not, either by themselves or together at the concentrations in which they are present in the fecal homogenates, show this same effect. The authors then go on to study the conflicting repellent response to indole and attractant response to serine in a number of different in vitro assays.

      Strengths:

      The demonstration that homogenates of human feces enhance the invasiveness of chemotactic Salmonella Typhimurium in a colonic explant is unexpected and interesting. The authors then go on to document the conflicting responses to the repellent indole and the attractant serine, both sensed by the Tsr chemoreceptor, as a function of their relative concentration and the spatial distribution of gradients.

      Weaknesses:

      The authors do not identify what is the critical compound or combination of compounds in the fecal homogenate that gives the reported response of increased invasiveness. They show it is not indole alone, serine alone, or both in combination that have this effect, although both are sensed by Tsr and both are present in the fecal homogenates. Some of the responses to conflicting stimuli by indole and serine in the in vitro experiments yield interesting results, but they do little to explain the initial interesting observation that fecal homogenates enhance invasiveness.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript presents experiments using an ex vivo colonic tissue assay, clearly showing that fecal material promotes Salmonella cell invasion into the tissue. It also shows that serine and indole can modulate the invasion, although their effects are much smaller. In addition, the authors characterized the direct chemotactic responses of these cells to serine and indole using a capillary assay, demonstrating repellent and attractant responses elicited by indole and serine, respectively, and that serine can dominate when both are present. These behaviors are generally consistent with those observed in E. coli, as well as with the observed effects on cell invasion.

      Strengths:

      The most compelling finding reported here is the strong influence of fecal material on cell invasion. Also, the local and time-resolved capillary assay provides a new perspective on the cell's responses.

      Weaknesses:

      The weakness is that indole and serine chemotaxis does not seem to control the fecal-mediated cell invasion and thus the underlying cause of this effect remains unclear.

      In addition, the fact that serine alone, which clearly acts as a strong attractant, did not affect cell invasion (compared to buffer) is somewhat puzzling. Additionally, wild-type cells showed nearly a tenfold advantage even without any ligand (in buffer), suggesting that factors other than chemotaxis might control cell invasion in this assay, particularly in the serine and indole conditions. These observations should probably be discussed.

      Final comment. As shown in reference 12, Tar mediates attractant responses to indole, which appear to be absent here (Figure 3J). Is it clear why? Could it be related to receptor expression?

    3. Reviewer #3 (Public review):

      Summary:

      In this manuscript, Franco and colleagues describe careful analyses of Salmonella chemotactic behavior in the presence of conflicting environmental stimuli. By doing so, the authors describe that this human pathogen integrates signals from a chemoattractant and a chemorepellent into an intermediate "chemohalation" phenotype.

      Strengths:

      The study was clearly well-designed and well-executed. The methods used are appropriate and powerful. The manuscript is very well written and the analyses are sound. This is an interesting area of research and this work is a positive contribution to the field.

      Weaknesses:

      Although the authors do a great job in discussing their data and the observed bacterial behavior through the lens of chemoattraction and chemorepulsion to serine and indole specifically, the manuscript lacks, to some extent, a deeper discussion on how other effectors may play a role in this phenomenon. Specifically, many other compounds in the mammalian gut are known to exhibit bioactivity against Salmonella. This includes compounds with antibacterial activity, chemoattractants, chemorepellers, and chemical cues that control the expression of invasion genes. Therefore, authors should be careful when making conclusions regarding the effect of these 2 compounds on invasive behavior. It is important that the word invasion is used in the manuscript only in its strictest sense, the ability displayed by Salmonella to enter non-phagocytic host cells. With that in mind, authors should discuss how other signals that feed into the control of Salmonella invasion can be at play here.

    1. Reviewer #1 (Public review):

      Summary:

      Mazer & Yovel 2025 dissect the inverse problem of how echolocators in groups manage to navigate their surroundings despite intense jamming using computational simulations.

      The authors show that despite the 'noisy' sensory environments that echolocating groups present, agents can still access some amount of echo-related information and use it to navigate their local environment. It is known that echolocating bats have strong small and large-scale spatial memory that plays an important role for individuals. The results from this paper also point to the potential importance of an even lower-level, short-term role of memory in the form of echo 'integration' across multiple calls, despite the unpredictability of echo detection in groups. The paper generates a useful basis to think about the mechanisms in echolocating groups for experimental investigations too.

      Strengths:

      (1) The paper builds on biologically well-motivated and parametrised 2D acoustics and sensory simulation setup to investigate the various key parameters of interest

      (2) The 'null-model' of echolocators not being able to tell apart objects & conspecifics while echolocating still shows agents successfully emerge from groups - even though the probability of emergence drops severely in comparison to cognitively more 'capable' agents. This is nonetheless an important result showing the direction-of-arrival of a sound itself is the 'minimum' set of ingredients needed for echolocators navigating their environment.

      (3) The results generate an important basis in unraveling how agents may navigate in sensorially noisy environments with a lot of irrelevant and very few relevant cues.

      (4) The 2D simulation framework is simple and computationally tractable enough to perform multiple runs to investigate many variables - while also remaining true to the aim of the investigation.

      Weaknesses:

      There are a few places in the paper that can be misunderstood or don't provide complete details. Here is a selection:

      (1) Line 61: '... studies have focused on movement algorithms while overlooking the sensory challenges involved' : This statement does not match the recent state of the literature. While the previous models may have had the assumption that all neighbours can be detected, there are models that specifically study the role of limited interaction arising from a potential inability to track all neighbours due to occlusion, and the effect of responding to only one/few neighbours at a time e.g. Bode et al. 2011 R. Soc. Interface, Rosenthal et al. 2015 PNAS, Jhawar et al. 2020 Nature Physics.

      (2) The word 'interference' is used loosely places (Line 89: '...took all interference signals...', Line 319: 'spatial interference') - this is confusing as it is not clear whether the authors refer to interference in the physics/acoustics sense, or broadly speaking as a synonym for reflections and/or jamming.

      (3) The paper discusses original results without reference to how they were obtained or what was done. The lack of detail here must be considered while interpreting the Discussion e.g. Line 302 ('our model suggests...increasing the call-rate..' - no clear mention of how/where call-rate was varied) & Line 323 '..no benefit beyond a certain level..' - also no clear mention of how/where call-level was manipulated in the simulations.

    2. Reviewer #2 (Public review):

      This manuscript describes a detailed model of bats flying together through a fixed geometry. The model considers elements that are faithful to both bat biosonar production and reception and the acoustics governing how sound moves in the air and interacts with obstacles. The model also incorporates behavioral patterns observed in bats, like one-dimensional feature following and temporal integration of cognitive maps. From a simulation study of the model and comparison of the results with the literature, the authors gain insight into how often bats may experience destructive interference of their acoustic signals and those of their peers, and how much such interference may actually negatively affect the groups' ability to navigate effectively. The authors use generalized linear models to test the significance of the effects they observe.

      In terms of its strengths, the work relies on a thoughtful and detailed model that faithfully incorporates salient features, such as acoustic elements like the filter for a biological receiver and temporal aggregation as a kind of memory in the system. At the same time, the authors' abstract features are complicating without being expected to give additional insights, as can be seen in the choice of a two-dimensional rather than three-dimensional system. I thought that the level of abstraction in the model was perfect, enough to demonstrate their results without needless details. The results are compelling and interesting, and the authors do a great job discussing them in the context of the biological literature.

      The most notable weakness I found in this work was that some aspects of the model were not entirely clear to me. For example, the directionality of the bat's sonar call in relation to its velocity. Are these the same? If so, what is the difference between phi_target and phi_tx in the model equations? What is a bat's response to colliding with a conspecific (rather than a wall)? From the statistical side, it was not clear if replicate simulations were performed. If they were, which I believe is the right way due to stochasticity in the model, how many replicates were used, and are the standard errors referred to throughout the paper between individuals in the same simulation or between independent simulations, or both?

      Overall, I found these weaknesses to be superficial and easily remedied by the authors. The authors presented well-reasoned arguments that were supported by their results, and which were used to demonstrate how call interference impacts the collective's roost exit as measured by several variables. As the authors highlight, I think this work is valuable to individuals interested in bat biology and behavior, as well as to applications in engineered multi-agent systems like robotic swarms.

    3. Reviewer #3 (Public review):

      Summary:

      The authors describe a model to mimic bat echolocation behavior and flight under high-density conditions and conclude that the problem of acoustic jamming is less severe than previously thought, conflating the success of their simulations (as described in the manuscript) with hard evidence for what real bats are actually doing. The authors base their model on two species of bats that fly at "high densities" (defined by the authors as colony sizes from tens to tens of thousands of individuals and densities of up to 33.3 bats/m2), Pipistrellus kuhli and Rhinopoma microphyllum. This work fits into the broader discussion of bat sensorimotor strategies during collective flight, and simulations are important to try to understand bat behavior, especially given a lack of empirical data. However, I have major concerns about the assumptions of the parameters used for the simulation, which significantly impact both the results of the simulation and the conclusions that can be made from the data. These details are elaborated upon below, along with key recommendations the authors should consider to guide the refinement of the model.

      Strengths:

      This paper carries out a simulation of bat behavior in dense swarms as a way to explain how jamming does not pose a problem in dense groups. Simulations are important when we lack empirical data. The simulation aims to model two different species with different echolocation signals, which is very important when trying to model echolocation behavior. The analyses are fairly systematic in testing all ranges of parameters used and discussing the differential results.

      Weaknesses:

      The justification for how the different foraging phase call types were chosen for different object detection distances in the simulation is unclear. Do these distances match those recorded from empirical studies, and if so, are they identical for both species used in the simulation? What reasoning do the authors have for a bat using the same call characteristics to detect a cave wall as they would for detecting a small insect? Additionally, details on the signal creation are also absent, but based on the sample spectrogram in Figure 2A, it appears that the authors used a synthetic linear FM chirp characterized by the call parameters. This simplification of the echolocation signals for these species is not representative of the true emitted signals, which are nonlinear FM for not only the species used within this simulation--PK (Schnitzler et al., 1987; Kalko and Schnitzler 1993 and RM (Schmidt and Joermann 1986)-but also for many other bat species that form large aggregations and undergo dense emergence. Furthermore, echolocation calls of bats emitted during dense emergence flights (see Gillam et al 2010) can be very much different from those emitted during foraging calls, so limiting the simulation to foraging calls may not be valid. Why did the authors not use actual waveforms of calls produced by these species during dense emergence to use biologically relevant signals in their simulation?

      The two species modeled have different calls. In particular, the bandwidth varies by a factor of 10, meaning the species' sonars will have different spatial resolutions. Range resolution is about 10x better for PK compared to RM, but the authors appear to use the same thresholds for "correct detection" for both, which doesn't seem appropriate. Also, the authors did not mention incorporating/correcting for/exploiting Doppler, which leads me to assume they did not model it.

      The success of the simulation may very well be due to variation in the calls of the bats, which ironically enough demonstrates the importance of a jamming avoidance response in dense flight. This explains why the performance of the simulation falls when bats are not able to distinguish their own echoes from other signals. For example, in Figure C2, there are calls that are labeled as conspecific calls and have markedly shorter durations and wider bandwidths than others. These three phases for call types used by the authors may be responsible for some (or most) of the performance of the model since the correlation between different call types is unlikely to exceed the detection threshold. But it turns out this variation in and of itself is what a jamming avoidance response may consist of. So, in essence, the authors are incorporating a jamming avoidance response into their simulation.

      The authors claim that integration over multiple pings (though I was not able to determine the specifics of this integration algorithm) reduces the masking problem. Indeed, it should: if you have two chances at detection, you've effectively increased your SNR by 3dB.

      They also claim - although it is almost an afterthought - that integration dramatically reduces the degradation caused by false echoes. This also makes sense: from one ping to the next, the bat's own echo delays will correlate extremely well with the bat's flight path. Echo delays due to conspecifics will jump around kind of randomly. However, the main concern is regarding the time interval and number of pings of the integration, especially in the context of the bat's flight speed. The authors say that a 1s integration interval (5-10 pings) dramatically reduces jamming probability and echo confusion. This number of pings isn't very high, and it occurs over a time interval during which the bat has moved 5-10m. This distance is large compared to the 0.4m distance-to-obstacle that triggers an evasive maneuver from the bat, so integration should produce a latency in navigation that significantly hinders the ability to avoid obstacles. Can the authors provide statistics that describe this latency, and discussion about why it doesn't seem to be a problem?

      The authors are using a 2D simulation, but this very much simplifies the challenge of a 3D navigation task, and there is an explanation as to why this is appropriate. Bat densities and bat behavior are discussed per unit area when realistically it should be per unit volume. In fact, the authors reference studies to justify the densities used in the simulation, but these studies were done in a 3D world. If the authors have justification for why it is realistic to model a 3D world in a 2D simulation, I encourage them to provide references justifying this approach.

      The focus on "masking" (which appears to be just in-band noise), especially relative to the problem of misassigned echoes, is concerning. If the bat calls are all the same waveform (downsweep linear FM of some duration, I assume - it's not clear from the text), false echoes would be a major problem. Masking, as the authors define it, just reduces SNR. This reduction is something like sqrt(N), where N is the number of conspecifics whose echoes are audible to the bat, so this allows the detection threshold to be set lower, increasing the probability that a bat's echo will exceed a detection threshold. False echoes present a very different problem. They do not reduce SNR per se, but rather they cause spurious threshold excursions (N of them!) that the bat cannot help but interpret as obstacle detection. I would argue that in dense groups the mis-assignment problem is much more important than the SNR problem.

      The criteria set for flight behavior (lines 393-406) are not justified with any empirical evidence of the flight behavior of wild bats in collective flight. How did the authors determine the avoidance distances? Also, what is the justification for the time limit of 15 seconds to emerge from the opening? Instead of an exit probability, why not instead use a time criterion, similar to "How long does it take X% of bats to exit?" What is the empirical justification for the 1-10 calls used for integration? The "average exit time for 40 bats" is also confusing and not well explained. Was this determined empirically? From the simulation? If the latter, what are the conditions? Does it include masking, no masking, or which species?

    1. Reviewer #1 (Public review):

      Summary:

      The authors revisit the specific domains/signals required for the redirection of an inner nuclear membrane protein, emerin, to the secretory pathway. They find that epitope tagging influences protein fate, serving as a cautionary tale for how different visualisation methods are used. Multiple tags and lines of evidence are used, providing solid evidence for the altered fate of different constructs.

      Strengths:

      This is a thorough dissection of domains and properties that confer INM retention vs secretion to the PM/lysosome, and will serve the community well as a caution regarding the placement of tags and how this influences protein fate.

      Weaknesses:

      Biogenesis pathways are not explored experimentally: it would be interesting to know if the lysosomal pool arrives there via the secretory pathway (eg by engineering a glycosylation site into the lumenal domain) or by autophagy, where failed insertion products may accumulate in the cytoplasm and be degraded directly from cytoplasmic inclusions.

      It would be helpful if the topology of constructs could be directly demonstrated by pulse-labelling and protease protection. It's possible that there are mixed pools of both topologies that might complicate interpretation.

    2. Reviewer #2 (Public review):

      In this manuscript, Mella et al. investigate the effect of GFP tagging on the localization and stability of the nuclear-localized tail-anchored (TA) protein Emerin. A previous study from this group showed that C-terminally GFP-tagged Emerin protein traffics to the plasma membrane and reaches lysosomes for degradation. It is suggested that the C-terminal tagging of tail-anchored proteins shifts their insertion from the post-translational TRC/GET pathway to the co-translational SRP-mediated pathway. The authors of this paper found that C-terminal GFP tagging causes Emerin to localize to the plasma membrane and eventually reach lysosomes. They investigated the mechanism by which Emerin-GFP moves to the secretory pathway. By manipulating the cytosolic domain and the hydrophobicity of the transmembrane domain (TMD), the authors identify that an ER retention sequence and strong TMD hydrophobicity contribute to Emerin trafficking to the secretory pathway. Overall, the data are solid, and the knowledge will be useful to the field. However, the authors do not fully answer the question of why C-terminally GFP-tagged Emerin moves to the secretory pathway. Importantly, the authors did not consider the possible roles of GFP in the ER lumen influencing Emerin trafficking to the secretory pathway.

    1. Reviewer #1 (Public review):

      Summary:

      García-Vázquez et al. identify GTSE1 as a novel target of the cyclin D1-CDK4/6 kinases. The authors show that GTSE1 is phosphorylated at four distinct serine residues and that this phosphorylation stabilizes GTSE1 protein levels to promote proliferation. This regulatory link appears to be particularly important in pathological conditions such as cancer, where cyclin D levels are elevated.

      Strengths:

      The authors support their findings with several previously published results, including databases. In addition, the authors perform a wide range of experiments to support their findings.

      Impact:

      The authors reveal a mechanism by which elevated levels of cyclin D1-CDK4 can stabilize GTSE1 throughout the cell cycle via phosphorylation. This provides insight into the role of cyclin D1-CDK4 in regulating the cell cycle and promoting cancer growth.

      Comments on revisions:

      The authors have addressed all my concerns, and I would like to thank them for their efforts on this great study.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript by García-Vázquez et al identifies the G2 and S phases expressed protein 1(GTSE1) as a substrate of the CycD-CDK4/6 complex. CycD-CDK4/6 is a key regulator of the G1/S cell cycle restriction point, which commits cells to enter a new cell cycle. This kinase is also an important therapeutic cancer target by approved drugs including Palbocyclib. Identification of substrates of CycD-CDK4/6 can therefore provide insights into cell cycle regulation and the mechanism of action of cancer therapeutics. A previous study identified GTSE1 as a target of CycB-Cdk1 but this appears to be the first study to address the phosphorylation of the protein by Cdk4/6.

      The authors identified GTSE1 by mining an existing proteomic dataset that are elevated in AMBRA1 knockout cells. The AMBRA1 complex normally targets D cyclins for degradation. From this list they then identified proteins that contain a CDK4/6 consensus phosphorylation site and were responsive to treatment with Palbocyclib.

      The authors show CycD-CDK4/6 overexpression induces a shift in GTSE1 on phostag gels that can be reversed by Palbocyclib. In vitro kinase assays also showed phosphorylation by CDK4. The phosphorylation sites were then identified by mutagenizing the predicted sites and phostag gets to see which eliminated the shift.

      The authors go on to show that phosphorylation of GTSE1 affects the steady state level of the protein. Moreover, they show that expression and phosphorylation of GTSE1 confer growth advantage on tumor cells and correlate with poor prognosis in patients.

      Strengths:

      The biochemical and mutagenesis evidence presented convincingly show that the GTSE1 protein is indeed a target of the CycD-CDK4 kinase. The follow-up experiments begin to show that the phosphorylation state of the protein affect function and have an impact on patient outcome.

      Weaknesses:

      It is not clear at which stage in the cell cycle GTSE1 is being phosphorylated and how this is affecting the cell cycle. Considering that the protein is also phosphorylated during mitosis by CycB-Cdk1, it is unclear which phosphorylation events may be regulating the protein.

      Additional comments for the revised manuscript

      The authors have made many modifications to the manuscript in response to the reviewer comments, including the addition of new data that have clarified some of the conclusions. Some of the questions regarding the phase of the cell cycle affected have been addressed with flow cytometry.

      There is one issue raised in the first review that can be better addressed. As the authors mentioned in their rebuttal letter, all the reviewers and editor concluded from the original manuscript that GTSE1 was being proposed as a physiological target of CycD-Cdk4 even in non-transformed cells. The authors believe that GTSE1 is likely only a target in cancerous cells that overexpress CycD and have made alterations in the abstract and main text making this point more clear.

      Some additional evidence that GTSE1 phosphorylation is occurring in CycD overexpressing tumor cells would strengthen this argument beyond the overexpression experiments presented in the manuscript. For example, in Supplemental Fig 4A of the revised manuscript, bubble plots from CPTAC data is used to show that total protein levels of GTSE1 correlate with proteins associated with proliferation and metastasis. Do levels of GTSE1 correlate with CycD in this data set?

    3. Reviewer #3 (Public review):

      Summary:

      This paper identifies GTSE1 as a substrate of cyclin D1-CDK4/6 complexes when cyclin D1 is significantly over-expressed (as is common in cancers) rather than its endogenous level. GTSE is stabilized by phosphorylation and GTSE1 correlates with cancer prognosis, probably through an effect on cell proliferation.

      Strengths:

      There are few bonafide cyclin D1-Cdk4/6 substrates identified to be important in vivo so GTSE1 represents a potentially important finding for the field. Currently, the only cyclin D1 substrates involved in proliferation are the Rb family proteins.

      Weaknesses:

      GTSE1 is not a 'normal' target of cyclin D1-Cdk4/6, but rather only a target in a pathological situation.

    1. Reviewer #1 (Public review):

      Summary:

      In this paper, the authors have leveraged Single-cell RNA sequencing of the various stages of evolution of lung adenocarcinoma to identify the population of macrophages that contribute to tumor progression. They show that S100a4+ alveolar macrophages, active in fatty acid metabolic activity, such as palmitic acid metabolism, seem to drive atypical adenomatous hyperplasia (AAH) stage. These macrophages also seem to induce angiogenesis promoting tumor growth. Similar types of macrophage infiltration were demonstrated in the progression of the human lung adenocarcinomas.

      Comments on revised version:

      The authors have satisfactorily addressed my main concerns.

      The only weakness is that infusion of S100a4+ macrophages seem not to affect tumor growth when introduced to the intratracheal route. This negative result somewhat diminishes the significance of the study.

      Overall, the revised manuscript is significantly improved.

    2. Reviewer #2 (Public review):

      Summary:

      The work aims to further understand the role of macrophages in lung precancer/lung cancer evolution

      Strengths:

      (1) The use of single-cell RNA seq to provide comprehensive characterisation.

      (2) Characterisation of cross-talk between macrophages and the lung precancerous cells.

      (3) Functional validation of the effects of S100a4+ cells on lung precancerous cells using in vitro assays.

      (4) Validation in human tissue samples of lung precancer / invasive lesions.

      Weaknesses identified previously:

      (1) The authors need to provide clarification of several points in the text.

      (2) The authors need to carefully assess their assumptions regarding the role of macrophages in angiogenesis in precancerous lesions.

      (3) The authors should discuss more broadly the current state of anti-macrophage therapies in the clinic.

      Comments on revised version:

      The authors have adequately addressed all of my comments.

    1. Reviewer #1 (Public review):

      Summary:

      The study combines predictions from MD simulations with sophisticated experimental approaches including native mass spectrometry (nMS), cryo-EM, and thermal protein stability assays to investigate the molecular determinants of cardiolipin (CDL) binding and binding-induced protein stability/function of an engineered model protein (ROCKET), as well as of the native E. coli intramembrane rhomboid protease, GlpG.

      Strengths:

      State-of-the-art approaches and sharply focused experimental investigation lend credence to the conclusions drawn. Stable CDL binding is accommodated by a largely degenerate protein fold that combines interactions from distant basic residues with greater intercalation of the lipid within the protein structure. Surprisingly, there appears to be no direct correlation between binding affinity/occupancy and protein stability.

      Overall, using both model and native protein systems, this study convincingly underscores the molecular and structural requirements for CDL binding and binding-induced membrane protein stability. This work provides much-needed insight into the poorly understood nature of protein-CDL interactions.

    2. Reviewer #3 (Public review):

      Summary:

      The relationships of proteins and lipids: it's complicated. This paper illustrates how cardiolipins can stabilize membrane protein subunits - and not surprisingly, positively charged residues play an important role here. But more and stronger binding of such structural lipids does not necessarily translate to stabilization of oligomeric states, since many proteins have alternative binding sites for lipids which may be intra- rather than intermolecular. Mutations which abolish primary binding sites can cause redistribution to (weaker) secondary sites which nevertheless stabilize interactions between subunits. This may be at first sight counterintuitive but actually matches expectations from structural data and MD modelling. An analogous cardiolipin binding site between subunits is found in E.coli tetrameric GlpG, with cardiolipin (thermally) stabilizing the protein against aggregation.

      Strengths:

      The use of the artificial scaffold allows testing of hypothesis about the different roles of cardiolipin binding. It reveals effects which are at first sight counterintuitive and are explained by the existence of a weaker, secondary binding site which unlike the primary one allows easy lipid-mediated interaction between two subunits of the protein. Introducing different mutations either changes the balance between primary and secondary binding sites or introduced a kink in a helix - thus affecting subunit interactions which are experimentally verified by native mass spectrometry.

      [Editors' note: The reviewers agreed that the authors addressed all reviewer comments adequately and rigorously.]

    1. In Ihrem Global Energy Review 2025 steht die EAA einen re Commissionen zuwachs im Verbrauch und Produktion von Elektrozytet fest. Dieser Zufachs geht allerdings nur in ganz kleinen Teilen auf den Ersatzforsilerenergien zurück und ist im Wesentlichen durch zunehmenden Energieverbrauch bedingt, z.B. durch Datencenter. Durch diesen Zuwachs steigt der Verbrauch, steigt der Bedarf an bestimmten Mitte um Mineralien ebenfalls sprunghaft an. Der Chef der Ehea geht davon aus, dass um 20-30 Gruppen verknab werden wird. Der Kommentar der Tat weiß deshalb darauf hin, dass die Dekabonisierung durch den Umstieg auf erneuerbare Energien ohne Reduzierung des Verbrauchs nicht gelingen wird. https://taz.de/Die-Tuecken-der-Energiewende/!6074719/

    1. Reviewer #1 (Public review):

      Summary:

      Fernandez et al. investigate the influence of maternal behavior on bat pup vocal development in Saccopteryx bilineata, a species known to exhibit vocal production learning. The authors performed detailed longitudinal observations of wild mother-pup interactions to ask whether non-vocal maternal displays during juvenile vocal practice, or 'babbling', affect vocal production. Specifically, the study examines the durations of pup babbling events and the developmental babbling phase, in relation to female display rates, as well as pup age and the number of nearby singing adult males. Furthermore, the authors examine pup vocal repertoire size and maturation in relation to maternal display rates encountered during babbling. Statistical models identify female display behavior as a predictor of i) babbling bout duration, ii) the length of the babbling phase, iii) song composition and iv) syllable maturation. Notably, these outcomes were not influenced by the number of nearby adult males (the pups' source of song models) and were largely independent of general maturation (pup age). These findings highlight the impact of non-vocal aspects of social interactions in guiding mammalian vocal development.

      Strengths:

      Historically, work on developmental vocal learning has focused on how juvenile vocalizations are influenced by the sounds produced by nearby adults (often males). In contrast, this study takes the novel approach of examining juvenile vocal ontogeny in relation to non-vocal maternal behavior, in one of the few mammals known to exhibit vocal production learning. The authors collected an impressive dataset from multiple wild bat colonies in two Central American countries. This includes longitudinal acoustic recordings and behavioral monitoring of individual mother-pup pairs, across development.

      The identified relationships between maternal behavior and bat pup vocalizations have intriguing implications for understanding the mechanisms that enable vocal production learning in mammals, including human speech acquisition. As such, these findings are likely be relevant to a broad audience interested in the evolution and development of social behavior as well as sensory-motor learning.

      Weaknesses:

      The authors qualitatively describe specific patterns of female displays during pup babbling, however, subsequent quantitative analyses are based on aggregate measures of female behavior that pool across display types. Consequently, it remains unclear how certain maternal behaviors might differentially influence pup vocalizations (e.g. through specific feedback contingencies or more general modulation of pup behavioral states).

      Comments on revisions:

      (1) More detailed analyses of female behavior may be beyond the scope of this study, given the nature of the dataset/recordings. I look forward to the authors' future work on this aspect.

      By addressing the important distinction between display number vs. display rate, the authors have provided more direct support for the claim that babbling behavior is related to female displays.

      (2) The additional information regarding exposure to adult male song is appreciated.

      (3) Added discussion of pup sex differences provides useful context and intriguing speculation about the role of female pup babbling.

      (4) The authors' additions have significantly improved the clarity of their acoustic terminology and syllable analyses.

    1. Reviewer #1 (Public review):

      Du et al. address the cell cycle-dependent clearance of misfolded protein aggregates mediated by the endoplasmic reticulum (ER) associated Hsp70 chaperone family and ER reorganisation. The observations are interesting and impactful to the field.

      Strength:

      The manuscript addresses the connection between the clearance of misfolded protein aggregates and the cell cycle using a proteostasis reporter targeted to ER in multiple cell lines. Through imaging and some biochemical assays, they establish the role of BiP, an Hsp70 family chaperone, and Cdk1 inactivation in aggregate clearance upon mitotic exit. Furthermore, the authors present an initial analysis of the role of ER reorganisation in this clearance. These are important correlations and could have implications for ageing-associated pathologies. Overall, the results are convincing and impactful to the field.

      Weakness:

      The manuscript still lacks a mechanistic understanding of aggregate clearance. Even though the authors have provided the role of different cellular components, such as BiP, Cdk1 and ATL2/3 through specific inhibitors, at least an outline establishing the sequence of events leading to clearance is missing. Moreover, the authors show that the levels of ER-FlucDM-eGFP do not change significantly throughout the cell cycle, indicating that protein degradation is not in play. Therefore, addressing/elaborating on the mechanism of disassembly can add value to the work. Also, the physiological relevance of aggregate clearance upon mitotic exit has not been tested, nor have the cellular targets of this mode of clearance been identified or discussed.

    2. Reviewer #2 (Public review):

      This paper describes an interesting observation that ER-targeted misfolded proteins are trapped within vesicles inside nucleus to facilitate quality control during cell division. This work supports the concept that transient sequestration of misfolded proteins is a fundamental mechanism of protein quality control. The authors satisfactorily addressed several points asked in the review of first submission. The manuscript is improved but still unable to fully address the mechanisms.

      Strengths:

      The observations in this manuscript are very interesting and open up many questions on proteostasis biology.

      Weaknesses:

      Despite inclusions of several protein-level experiments, the manuscript remained a microscopy-driven work and missed the opportunity to work out the mechanisms behind the observations.

    3. Reviewer #3 (Public review):

      This paper describes a new mechanism for the clearance of protein aggregates associated to endoplasmic reticulum re-organization that occurs during mitosis.

      Experimental data showing clearance of protein aggregates during mitosis is solid, statistically significant, and very interesting. The authors made several new experiments included in the revised version to address the concerns raised by reviewers. A new proteomic analysis, co-localization of the aggregates with the ER membrane Sec61beta protein, expression of the aggregate-prone protein in the nucleus does not result in accumulation of aggregates, detection of protein aggregates in the insoluble faction after cell disruption and mostly importantly knockdown of ATL proteins involved in the organization of ER shape and structure impaired the clearance mechanism. This last observation addresses one of the weakest points of the original version which was the lack of experimental correlation between ER structure capability to re-shape and the clearance mechanism.

      In conclusion, this new mechanism of protein aggregate clearance from the ER was not completely understood in this work but the manuscript presented, particularly in the revised version, an ensemble of solid observations and mechanistic information to scaffold future studies that clarify more details of this mechanism. As stated by the authors: "How protein aggregates are targeted and assembled into the intranuclear membranous structure waits for future investigation". This new mechanism of aggregate clearance from the ER is not expected to be fully understood in a single work but this paper may constitute one step to better comprehend the cell capability to resolve protein aggregates in different cell compartments.

    1. Reviewer #1 (Public review):

      Summary:

      The authors investigate the neuroprotective effect of reserpine in a retinitis pigmentosa (P23H-1) model, characterized by a mutation in the rhodopsin gene. Their results reveal that female rats show better preservation of both rod and cone photoreceptors following reserpine treatment compared to males.

      Strengths:

      This study effectively highlights the neuroprotective potential of reserpine and underscores the value of drug repositioning as a strategy for accelerating the development of effective treatments. The findings are significant for their clinical implications, particularly in demonstrating sex-specific differences in therapeutic response.

      Weaknesses:

      The main limitation is the lack of precise identification of the specific pathway through which reserpine prevents photoreceptor death.

      Comments on revisions:

      Thank you for your thorough revisions. I appreciate the effort you have put into addressing all the concerns I previously raised. Upon reviewing your responses and the updated manuscript, I find that you have adequately clarified the issues and incorporated the necessary modifications. Your revisions have strengthened the paper, and I have no further concerns at this stage.

    1. Reviewer #3 (Public review):

      Summary:

      Golamalamdari, van Schaik, Wang, Kumar Zhang, Zhang and colleagues study interactions between the speckle, nucleolus and lamina in multiple cell types (K562, H1, HCT116 and HFF). Their datasets define how interactions between the genome and the different nuclear landmarks relate to each other and change across cell types. They also identify how these relationships change in K562 cells in which LBR and LMNA are knocked out.

      Strengths:

      Overall, there are a number of datasets that are provided, and several "integrative" analyses performed. This is a major strength of the paper, and I imagine the datasets will be of use to the community to further probed and the relationships elucidated here further studied. An especially interesting result was that specific genomic regions (relative to their association with the speckle, lamina, and other molecular characteristics) segregate relative to the equatorial plane of the cell.

      Weaknesses:

      The experiments are primarily descriptive, and the cause-and-effect relationships are limited (though the authors do study the role of LMNA/LBR knockdown with their technologies).

      Comments on revisions:

      I have no additional comments. I appreciate the authors responding to my previous comments. I anticipate the datasets and concepts raised will be helpful to many investigators in the field.

    1. Reviewer #1 (Public review):

      Gray and colleagues describe the identification of Integrator complex subunit 12 (INTS12) as a contributor to HIV latency in two different cell lines and in cells isolated from the blood of people living with HIV. The authors employed a high-throughput CRISPR screening strategy to knock down genes and assess their relevance in maintaining HIV latency. They had used a similar approach in two previous studies, finding genes required for latency reactivation or genes preventing it and whose knockdown could enhance the latency-reactivating effect of the NFκB activator AZD5582. This work builds on the latter approach by testing the ability of gene knockdowns to complement the latency-reactivating effects of AZD5582 in combination with the BET inhibitor I-BET151. This drug combination was selected because it has been previously shown to display synergistic effects on latency reactivation.

      The finding that INTS12 may play a role in HIV latency is novel, and the effect of its knock down in inducing HIV transcription in primary cells, albeit in only a subset of donors, is intriguing.

      In this revised version, the authors have included new data and clarifications which help strengthen their conclusions.

    2. Reviewer #2 (Public review):

      Summary:

      Identifying an important role for Integrator complex in repressing HIV transcription and suggesting that by targeting subunits of this complex specifically, INTS12, reversal of latency with and without latency reversal agents can be enhanced.

      Strengths:

      The strengths of the paper include the general strategy for screening targets that may activate HIV latency and the rigor of exploring the mechanism of INTS12 repression of HIV transcriptional elongation.

      Weaknesses:

      Minor point-there was an opportunity to examine a larger panel of latency reversal agents that reactivate by different mechanisms to determine whether INTS12 and transcriptional elongation are limiting for a broad spectrum of latency reversal agents.

      Comments on revisions:

      I feel the authors have adequately addressed the original questions and concerns.

    3. Reviewer #3 (Public review):

      Summary:

      Transcriptionally silent HIV-1 genomes integrated in the host`s genome represent the main obstacle for an HIV-1 cure. Therefore, agents aimed at promoting HIV transcription, the so-called latency reactivating agents (LRAs) might represent useful tools to render these hidden proviruses visible to the immune system. The authors successfully identified, through multiple techniques, INTS12, a component of the Integrator complex involved in 3' processing of small nuclear RNAs U1 and U2, as a factor promoting HIV-1 latency and hindering elongation of the HIV RNA transcripts. This factor hinders the activity of a previously identified combination of LRAs, one of which, AZD5582, has been validated in the macaque model for HIV persistence during therapy (https://pubmed.ncbi.nlm.nih.gov/37783968/). The other compound, I-BET151, is known to synergize with AZD5582, and is a inhibitor of BET, factors counteracting elongation of RNA transcripts.<br /> Therefore, INTS12 maight represent a target for future LRAs-

      Strengths:

      Findings were confirmed through multiple screens and multiple techniques. The authors successfully mapped the identified HIV silencing factor at the HIV promoter, Silencing of INTS12 increases the activity of small-molecule HIV latency-reversing agents such as the histone deacetylase inhibitor vorinostat. Knockdown of INTS12 does not induce toxic effects in the cells, thus rendering it a candidate a drug discovery campaign aimed at finding new agents for an HIV/AIDS cure.

      Weaknesses:

      A caveat is that the impact of INTS12 in diverse T cell functions or other in vivo functions is not yet known, but the authors acknowledge this in the revised discussion.

    1. Reviewer #1 (Public review):

      Summary:

      The study identifies two types of activation: one that is cue-triggered and non-specific to motion directions, and another that is specific to the exposed motion directions but occurs in a reversed manner. The finding that activity in the medial temporal lobe (MTL) preceded that in the visual cortex suggests that the visual cortex may serve as a platform for the manifestation of replay events, which potentially enhance visual sequence learning.

      Evaluations:

      Identifying the two types of activation after exposure to a sequence of motion directions is very interesting. The experimental design, procedures and analyses are solid. The findings are interesting and novel.

      In the original submission, it was not immediately clear to me why the second type of activation was suggested to occur spontaneously. The procedural differences in the analyses that distinguished between the two types of activation need to be a little better clarified. However, this concern has been satisfactorily addressed in the revision.

    2. Reviewer #2 (Public review):

      This paper shows and analyzes an interesting phenomenon. It shows that when people are exposed to sequences of moving dots (That is moving dots in one direction, followed by another direction etc.), that showing either the starting movement direction, or ending movement direction causes a coarse-grained brain response that is similar to that elicited by the complete sequence of 4 directions. However, they show by decoding the sensor responses that this brain activity actually does not carry information about the actual sequence and the motion directions, at least not on the time scale of the initial sequence. They also show a reverse reply on a highly-compressed time scale, which is elicited during the period of elevated activity, and activated by the first and last elements of the sequence, but not others. Additionally, these replays seem to occur during periods of cortical ripples, similar to what is found in animal studies.

      These results are intriguing. They are based on MEG recordings in humans, and finding such replays in humans is novel. Also, this is based on what seems to be sophisticated statistical analysis. The statistical methodology seems valid, but due to its complexity it is not easy to understand. The methods especially those described in figures 3 and 4 should be explained better.

    1. Reviewer #1 (Public review):

      Overall I found the approach taken by the authors to be clear and convincing. It is striking that the conclusions are similar to those obtained in a recent study using a different computational approach (finite state controllers), and lends confidence to the conclusions about the existence of an optimal memory duration. There are a few questions that could be expanded on in future studies:

      (1) Spatial encoding requirements

      The manuscript contrasts the approach taken here (reinforcement learning in a gridworld) with strategies that involve a "spatial map" such as infotaxis. However, the gridworld navigation algorithm has an implicit allocentric representation, since movement can be in one of four allocentric directions (up, down, left, right), and wind direction is defined in these coordinates. Future studies might ask if an agent can learn the strategy without a known wind direction if it can only go left/right/forward/back/turn (in egocentric coordinates). In discussing possible algorithms, and the features of this one, it might be helpful to distinguish (1) those that rely only on egocentric computations (run and tumble), (2) those that rely on a single direction cue such as wind direction, (3) those that rely on allocentric representations of direction, and (4) those that rely on a full spatial map of the environment.

      (2) Recovery strategy on losing the plume

      The authors explore several recovery strategies upon losing the plume, including backtracking, circling, and learned strategies, finding that a learned strategy is optimal. As insects show a variety of recovery strategies that can depend on the model of locomotion, it would be interesting in the future to explore under which conditions various recovery strategies are optimal and whether they can predict the strategies of real animals in different environments.

      (3) Is there a minimal representation of odor for efficient navigation?

      The authors suggest that the number of olfactory states could potentially be reduced to reduce computational cost. They show that reducing the number of olfactory states to 1 dramatically reduces performance. In the future it would be interesting to identify optimal internal representations of odor for navigation and to compare these to those found in real olfactory systems. Does the optimal number of odor and void states depend on the spatial structure of the turbulence as explored in Figure 5?

    2. Reviewer #2 (Public review):

      Summary:

      The authors investigate the problem of olfactory search in turbulent environments using artificial agents trained using tabular Q-learning, a simple and interpretable reinforcement learning (RL) algorithm. The agents are trained solely on odor stimuli, without access to spatial information or prior knowledge about the odor plume's shape. This approach makes the emergent control strategy more biologically plausible for animals navigating exclusively using olfactory signals. The learned strategies show parallels to observed animal behaviors, such as upwind surging and crosswind casting. The approach generalizes well to different environments and effectively handles the intermittency of turbulent odors.

      Strengths:

      * The use of numerical simulations to generate realistic turbulent fluid dynamics sets this paper apart from studies that rely on idealized or static plumes.<br /> * A key innovation is the introduction of a small set of interpretable olfactory states based on moving averages of odor intensity and sparsity, coupled with an adaptive temporal memory.<br /> * The paper provides a thorough analysis of different recovery strategies when an agent loses the odor trail, offering insights into the trade-offs between various approaches.<br /> * The authors provide a comprehensive performance analysis of their algorithm across a range of environments and recovery strategies, demonstrating the versatility of the approach.<br /> * Finally, the authors list an interesting set of real-world experiments based on their findings, that might invite interest from experimentalists across multiple species.

      Weaknesses:

      * Using tabular Q-learning is both a strength and a limitation. It's simple and interpretable, making it easier to analyze the learned strategies, but the discrete action space seems somewhat unnatural. In real-world biological systems, actions (like movement) are continuous rather than discrete. Additionally, the ground-frame actions may not map naturally to how animals navigate odor plumes (e.g. insects often navigate based on their own egocentric frame).

    1. Reviewer #1 (Public review):

      Summary:

      In this elegant and thorough study, Sánchez-León et al. investigate the effects of tDCS on the firing of single cerebellar neurons in awake and anesthetized mice. They find heterogeneous responses depending on the orientation of the recorded Purkinje cell.

      Strengths:

      The paper is important in that it may well explain part of the controversial and ambiguous outcomes of various clinical trials. It is a well-written paper on a deeply analyzed dataset.

      Weaknesses:

      The sample size could be increased for some of the experiments.

      Comments on revised version: They have not been able to increase the size of some of the critical experiments, but they have done additional statistics, which make me feel confident that the main conclusions are correct.

    2. Reviewer #2 (Public review):

      Summary:

      In this study by Sánchez-León and colleagues, the authors attempted to determine the influence of neuronal orientation on the efficacy of cerebellar tDCS in modulating neural activity. To do this, the authors made recordings from Purkinje cells, the primary output neurons of the cerebellar cortex, and determined the inter-dependency between the orientation of these cells and the changes in their firing rate during cerebellar tDCS application.

      Strengths:

      (1) A major strength is the in vivo nature of this study. Being able to simultaneously record neural activity and apply exogenous electrical current to the brain during both an anesthetized state and during wakefulness in these animals provides important insight into physiological underpinnings of tDCS.<br /> (2) The authors provide evidence that tDCS can modulate neural activity in multiple cell types. For example, there is a similar pattern of modulation in Purkinje cells and non-Purkinje cells (excitatory and inhibitory interneurons). Together, these data provide wholistic insight into how tDCS can affect activity across different populations of cells, which is important implications for basic neuroscience, but also clinical populations where there may be non-uniform or staged effects of neurological disease on these various cell types.<br /> (3) There is systematic investigation into the effects of tDCS on neural activity across multiple regions of the cerebellum. The authors demonstrate that the pattern of modulation is dependent on the target region. These findings have important implications for determining the expected neuromodulatory effects of tDCS when applying this technique over different target regions non-invasively in animals and humans.<br /> (4) The authors provide a thorough background, rationale, and interpretation regarding the expected and observed influence of neuronal orientation on excitability modulation by electrical stimulation.

    3. Reviewer #3 (Public review):

      Summary:

      In this study, Sanchez-Leon et al. combined extracellular recordings of Purkinje cell activity in awake and anesthesized mice with juxtacellular recordings and Purkinje cell staining to link Purkinje cell orientation to their stimulation response. The authors find a relationship between neuron orientation and firing rate, dependent on stimulation type (anodal/cathodal). They also show effects of stimulation intensity and rebound effects.

      Strengths:

      Overall, the work is methodologically sound and the manuscript well written. The authors have taken great care to explain their rationale and methodological choices.

      Weaknesses:

      My only reservation is the lack of reporting of the precise test statistics, p-values and multiple comparison corrections. The work would benefit from adding this and other information.

    1. Reviewer #1 (Public review):

      This study provides significant insights into the dynamics of attentional re-orienting within visual working memory, demonstrating how expected and unexpected memory tests influence attention focus and re-focus. The evidence supporting these conclusions is convincing, with the use of appropriate and validated methodologies, including behavioral measures, EEG, and eye tracking, that are in line with current state-of-the-art practices. This work will be of particular interest to cognitive neuroscientists studying attention and memory processes.

      Thank you for the detailed revisions. I am pleased to see that the manuscript now effectively addresses every point I raised. The clarification between microsaccades and saccades greatly enhances transparency regarding the eye movement data. The inclusion of time-frequency plots and topographic maps for the working-memory test phase further improves the comprehensiveness of the alpha lateralization results, despite the relative lack of alpha effects at that stage. Moreover, the implementation of the Fractional Area Latency analysis successfully rules out amplitude-related confounds in the saccade bias latency measurements. Finally, the clear reporting of the statistical analyses for significant saccade bias further strengthens the reliability of the findings.

      Overall, I appreciate the thorough and thoughtful response, and I believe that all my concerns have been successfully addressed.

    2. Reviewer #2 (Public review):

      Summary:

      This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during expected test suggests a memory verification process, whereas the prolonged spatial bias during unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

      Strengths:

      The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

      Weaknesses:

      The authors addressed the identified weaknesses in a thorough revision during the review process.

    3. Reviewer #3 (Public review):

      Summary:

      Wang and van Ede investigate whether and how attention re-orients within visual working memory following expected and unexpected centrally presented memory tests. Using a combination of spatial modulations in neural activity (EEG-alpha lateralization) and gaze bias quantified as time courses of microsaccade rate, the authors examined how retro cues with varying levels of reliability influence attentional deployment and subsequent memory performance. The conclusion is that attentional re-orienting occurs within visual working memory, even when tested centrally, with distinct patterns following expected and unexpected tests. The findings provide new value for the field and are likely of broad interest and impact, by highlighting working memory as an action-bound process (in)dependent on (an ambiguous) past.

      Strengths:

      The study uniquely integrates behavioral data (accuracy and reaction time), EEG-alpha activity, and gaze tracking to provide a comprehensive analysis of attentional re-orienting within visual working memory. As typical for this research group, the validity of the findings follows from the task design that effectively manipulates the reliability of retro cues and isolates attentional processes related to memory tests. The use of well-established markers for spatial attention (i.e. alpha lateralization) and more recently entangled dependent variable (gaze bias) is commendable. Utilizing these dependent metrics, the concise report presents a thorough analysis of the scaling effects of cue reliability on attentional deployment, both at the behavioral and neural levels. The clear demonstration of prolonged attentional deployment following unexpected memory tests is particularly noteworthy, although there are no significant time clusters per definition as time isn't a factor in a statistical sense, the jackknife approach is convincing. Overall, the evidence is compelling, allowing the conclusion of a second stage of internal attentional deployment following both expected and unexpected memory tests, highlighting the importance of memory verification and re-orienting processes.

      Weaknesses:

      I want to stress upfront that these are not specific to the presented work and do not affect my recommendation to offer the report to the public in its present form.

      The sample size is consistent with previous studies, a larger sample could enhance the generalizability and robustness of the findings. The authors acknowledge high noise levels in EEG-alpha activity, which may affect the reliability of this marker. This is a general issue in non-invasive electrophysiology that cannot be handled by the authors but an interested reader should be aware of it. Effectively, the sensitivity of the gaze analysis appears "better" in part due to the better SNR. The latter also sets the boundaries for single trial analyses as the authors correctly mention. In terms of generalizability, I am convinced that the main outcome will likely generalize to different samples and stimulus types. Yet, as typical for the field, future research could explore different contexts and task demands to validate and extend the findings. The authors provide here how and why (including sharing of data and code).

      Comments on revisions:

      Really nice work, Thank you!

    1. Reviewer #1 (Public review):

      The manuscript by Li et al., investigates metabolism independent role of nuclear IDH1 in chromatin state reprogramming during erythropoiesis. The authors describe accumulation and redistribution of histone H3K79me3, and downregulation of SIRT1, as a cause for dyserythropoiesis observed due to IDH1 deficiency. The authors studied the consequences of IDH1 knockdown, and targeted knockout of nuclear IDH1, in normal human erythroid cells derived from hematopoietic stem and progenitor cells and HUDEP2 cells respectively. They further correlate some of the observations such as nuclear localization of IDH1 and aberrant localization of histone modifications in MDS and AML patient samples harboring IDH1 mutations. These observations are overall intriguing from a mechanistic perspective and hold therapeutic significance. The authors have addressed the previous concerns sufficiently in the revised manuscript.

    2. Reviewer #2 (Public review):

      Li, Zhang, Wu, and colleagues investigated the non-canonical localization of IDH1 in the cell nucleus and its unconventional functions, expanding our understanding of the roles of metabolic enzymes such as IDH1. To study its nuclear function, they generated a HUDEP2 cell line with a specific deletion of nuclear IDH1. They found that the loss of nuclear IDH1 led to abnormalities in nuclear morphology and chromatin organization, particularly in H3K79me3. By integrating ChIP-seq, ATAC-seq, and RNA-seq analyses, they identified SIRT1 as a key regulatory factor mediating IDH1's role in nuclear morphology regulation during the terminal stages of erythroid differentiation.

      Notably, abnormalities in H3K79me3 were also observed in AML/MDS patients harboring IDH1 mutations, offering new perspectives for disease diagnosis and treatment. To robustly determine the nuclear distribution of IDH1 in erythroid cells, the authors employed multiple approaches, including immunofluorescence and nucleus-cytoplasm fractionation. The development of a HUDEP2 cell line lacking nuclear IDH1 was pivotal for studying its non-canonical nuclear functions.

      Experimental results, including euchromatin/heterochromatin observations, histone modification analyses, ChIP-seq, and ATAC-seq, indicated that the deletion of IDH1 disrupts the chromatin landscape. While the authors have identified SIRT1 as a key gene affected by the deficiency of IDH1, the mechanisms underlying IDH1's nuclear function are worth further exploration in future studies.

      Overall, this study advances our understanding of the non-canonical localization of metabolic enzymes and their nuclear functions, shedding new light on their roles in cellular regulation.

    3. Reviewer #3 (Public review):

      Li, Zhang, Wu and colleagues describe a new role for nuclear IDH1 in erythroid differentiation. IDH1 depletion results in a terminal erythroid differentiation defect with polychromatic and orthochromatic erythroblasts showing abnormal nuclei, nuclear condensation defects and an increased proportion of euchromatin, as well as enucleation defects. Using ChIP-seq for the histone modifications H3K79me3, H3K27me2 and H3K9me3, as well as ATAC-seq and RNA-seq in primary CD34-derived erythroblasts, the authors elucidate SIRT1 as a key dysregulated gene that is upregulated upon IDH1 knockdown. They furthermore show that chemical inhibition of SIRT1 partially rescues the abnormal nuclear morphology and enucleation defect during IDH1-deficient erythroid differentiation. The phenotype of delayed erythroid maturation and enucleation upon IDH1 shRNA-mediated knockdown was described in the group's previous co-authored study (PMID: 33535038). The authors describe this new role of IDH1 as non-canonical, but more experiments will be needed to determine whether this function of IDH1 in chromatin organization is secondary to its enzymatic-metabolic role. On the other hand, while the dependency of IDH1 mutant cells on NAD+ as well as a cell survival benefit upon SIRT1 inhibition has already been shown (see, e.g, PMID: 26678339, PMID: 32710757), previous studies focused on cancer cell lines and did not look at a developmental differentiation process, which makes this study interesting.

      The authors had initially hypothesized that IDH1 has a role in the nucleus independent of its enzymatic function, which is interesting but was not supported by the presented experiments. In the revised manuscript, the authors decided to just focus on the nuclear role of IDH1. To this end, they present a system in HUDEP-2 cells harboring a CRISPR/Cas9-mediated IDH1 knockout and overexpression of an IDH1 construct containing a nuclear export signal. While they only use this system in some of their experiments, they mostly use a global IDH1 shRNA knockdown approach is employed, which will affect both forms of IDH1, cytoplasmic and nuclear. Future work using their system that specifically depletes nuclear IDH1 could further delineate changes of the chromatin landscape upon loss of nuclear IDH1 and also address how loss of nuclear IDH1 affects the part of the TCA cycle that has recently been shown to be present in the nucleus (PMID: 36044572).

    1. Reviewer #1 (Public review):

      The manuscript investigates the role of the membrane-deforming cytoskeletal regulator protein Abba in cortical development and its potential implications for microcephaly. It is a valuable contribution to the understanding of Abba's role in cortical development. The strengths and weaknesses identified in the manuscript are outlined below:

      Clinical Relevance:

      The authors identified a patient with microcephaly and intellectual disability patient harboring a mutation in the Abba variant (R671W), adding a clinically relevant dimension to the study.

      Mechanistic Insights:

      The study offers valuable mechanistic insights into the development of microcephaly by elucidating the role of Abba in radial glial cell proliferation, radial fiber organization, and the migration of neuronal progenitors. The identification of Abba's involvement in the cleavage furrow during cell division, along with its interaction with Nedd9 and positive influence on RhoA activity, adds depth to our understanding of the molecular processes governing cortical development.

      In Vivo Validation:

      The overexpression of mutant Abba protein (R671W), which results in phenotypic similarities to Abba knockdown effects, supports the significance of Abba in cortical development.

      Weaknesses:

      The findings in the study suggest that heterozygous expression of the R671W variant may exert a dominant-negative effect on ABBA's role, disrupting normal brain development and leading to microcephaly and cognitive delay. However, evidence also points to a possible gain-of-function effect, as the mutation does not decrease RhoA activity or PH3 expression in vivo. Additionally, the impact of ABBA depletion on cell fate is not fully addressed. While abnormal progenitor accumulation in the ventricular and subventricular zones is observed, the transition of progenitors to neuroblasts and their ability to support neuroblast migration remains unclear. Impaired cleavage furrow ingression and disrupted Nedd9 and RhoA signaling could lead to structural abnormalities in radial glial progenitors, affecting their scaffold function and neuroblast progression. The manuscript lacks an exploration of the loss or decrease in interaction between Abba and NEDD9 in the case of the pathogenic patient-derived mutation in Abba. Furthermore, addressing the changes in localization and ineraction in for NEDD9 following over-expression of the mutant are important to further mehcanistically characterizxe this interaction in future studies. These gaps suggest the need for further exploration of ABBA's role in progenitor cell fate and neuroblast migration to clarify its mechanistic contributions to cortical development.

    2. Reviewer #2 (Public review):

      Summary:

      Carabalona and colleagues investigated the role of the membrane-deforming cytoskeletal regulator protein Abba (MTSS1L/MTSS2) in cortical development to better understand the mechanisms of abnormal neural stem cell mitosis. The authors used short hairpin RNA targeting Abba20 with a fluorescent reporter coupled with in utero electroporation of E14 mice to show changes to neural progenitors. They performed flow cytometry for in-depth cell cycle analysis of Abba-shRNA impact to neural progenitors and determined an accumulation in S phase. Using culture rat glioma cells and live imaging from cortical organotypic slides from mice in utero electroporated with Abba-shRNA, the authors found Abba played a prominent role in cytokinesis. They then used a yeast-two-hybrid screen to identify three high confidence interactors: Beta-Trcp2, Nedd9, and Otx2. They used immunoprecipitation experiments from E18 cortical tissue coupled with C6 cells to show Abba requirement for Nedd9 localization to the cleavage furrow/cytokinetic bridge. The authors performed an shRNA knockdown of Nedd9 by in utero electroporation of E14 mice and observed similar results as with the Abba-shRNA. They tested a human variant of Abba using in utero electroporation of cDNA and found disorganized radial glial fibers and misplaced, multipolar neurons, but lacked the impact of cell division seen in the shRNA-Abba model.

      Strengths:

      Fundamental question in biology about the mechanics of neural stem cell division.<br /> Directly connecting effects in Abba protein to downstream regulation of RhoA via Nedd9.<br /> Incorporation of human mutation in ABBA gene.<br /> Use of novel technologies in neurodevelopment and imaging.

      Weaknesses:

      Unexplored components of the pathway (such as what neurogenic populations are impacted by Abba mutation) and unleveraged aspects of their data (such as the live imaging) limit the scope of their findings and left significant questions about the effect of ABBA on radial glia development.

      (1) Claim of disorganized radial glial fibers lacks quantifications.<br /> -On page 11, the authors claim that knockdown of Abba lead to changes in radial glial morphology observed with vimentin staining. Here they claim misoriented apical processes, detached end feet, and decreased number of RGP cells in the VZ. However, they no not provide quantification of process orientation to better support their first claim. Measurements of radial glia fiber morphology (directionality, length) and of angle of division would be metrics that can be applied to data. Some of these analysis could be done in their time-lapse microscopy images, such as to quantify the number of cell division during their period of analysis (though that is short-15 hours).

      (2) Unclear where effect is:<br /> -in RG or neuroblasts? Is it in cell cleavage that results in accumulation of cells at VZ (as sometimes indicated by their data like in Fig 2A or 4D)? Interrogation of cell death (such as by cleaved caspase 3) would also help. Given their time lapse, can they identify what is happening to the RG fiber? The authors describe a change in "migration" but do not show evidence for this for either progenitor or neuroblast populations. Given they have nice time-lapse imaging data, could they visualize progenitor versus young neuron migration? Analysis of neuroblasts (such as with doublecortin expression in the tissue) would also help understand any issues in migration (of neurons v stem cells).<br /> -at cleaveage furrow? In abscission? There is high resolution data that highlights the cleavage furrow as the location of interest (fig 3A), however there is also data (fig 3B) to suggest Abba is expressed elsewhere as well and there is an overall soma decrease. More detail of the localization of Abba during the division process would be helpful-for example, could cleavage furrow proteins, such as Aurora B, co-localization (and potentially co-IP) help delineate subpopulations of Abba protein? Furthermore, the FRET imaging is unique way to connect their mutation with function-could they measure/quantify differences at furrow compared to rest of soma to further corroborate that Abba-associated RhoA effect was furrow-enriched?<br /> -The data highlights nicely that a furrow doesn't clearly form when ABBA expression and subsequent RhoA activity are decreased (in Fig 3 or 5A). Does this lead to cells that can't divide because of poor abscission, especially since "rounding" still occurs? Or abnormal progenitors (with loss of fiber or inability to support neuroblast migration)? Or abnormal progression of progenitors to neuroblasts?

      (3) Limited to a singular time point of mouse cortical development<br /> On page 13, the authors outline the results of their Y2H screen with the identification of three high confidence interactors. Notably, they used a E10.5-E12.5 mouse brain embryo library rather than one that includes E14, the age of their in utero electroporation mice. Many of the authors' claims focus on in utero electroporation of shRNA-Abba of E14 mice that are then evaluated at E16-18. Justification for the focus on this age range should be included to support that their findings can then be applied to all of mouse corticogenesis.

      (4) Detail of the effect of the human variant of the ABBA mutation in mouse is lacking.<br /> Their identification of the R671W mutation is interesting and the IUE model warrants more characterization, as they did with their original KD experiments.<br /> -Could they show that Abba protein levels are decreased (in either cell lines or electroporated tissue)?<br /> -While time-lapse morphology might not have been performed, more analysis on cell division phenotype (such as plane of division and radial glia morphology) would be helpful.

      The resubmission has addressed many of the questions raised.

      I have a few comments that should be addressed:

      (1) The authors maintain a deficit in "migration of immature neurons" which remains unsubstantiated. In their resonse, they state: "we believe that the data showing the accumulation of migrating electroporated cells in the ventricular (V) and subventricular (SV) zones provide compelling evidence of abnormal migration in ABBA-shRNA electroporated cells. "<br /> -Firstly, they do not demonstrate that it's immature neurons, not RGs, that are affected. Secondly, accumulation of cells at the V-SVZ could be due to soley the inability for the RGC to undergo mitosis, therefore remaining stuck"<br /> The commentary of migration, especially of neurons, should be modified.

    1. Reviewer #1 (Public review):

      Summary:

      This work by the Meng lab investigates the role of the proteins MARK2 and CAMSAP2 in the Golgi reorientation during cell polarisation and migration. They identified that both proteins interact together and that MARK2 phosphorylates CAMSAP2 on the residue S835. They show that the phosphorylation affects the localisation of CAMSAP2 at the Golgi apparatus and in turn influences the Golgi structure itself. Using the TurboID experimental approach, the author identified the USO1 protein as a protein that binds differentially to CAMSAP2 when it is itself phosphorylated at residue 835. Dissecting the molecular mechanisms controlling Golgi polarisation during cell migration is a highly complex but fundamental issue in cell biology and the author may have identified one important key step in this process.

      Comments on latest version:

      I thank the authors for the numerous revisions they have made to this manuscript, which have strengthened its clarity and overall quality. However, I must reiterate my initial concerns from the first review regarding the rigor of the data analysis, as certain methodological choices may lead to potential overinterpretation of the results.<br /> For instance, the low number of cells analyzed in the new Figure 1B (N = 3; 0 h: n = 28; 0.5 h: n = 23; 2 h: n = 20) indicates that fewer than 10 fixed cells have been quantified per replicate. Given the variability of the CAMSAP2 signal observed in Supplementary Figure 2, this sample size does not appear optimal for accurately capturing the complexity of CAMSAP2 localization within the cell population. Additionally, the Pearson's coefficients calculated between CAMSAP2 and GM130 in Figure 1B (approximately 0.4) do not align with those in Figure 3C, where the control condition shows values above 0.6. This discrepancy highlights the high variability of CAMSAP2 Golgi localization in the HT1080 cell population, which may not be adequately represented by the quantification of such a limited number of cells. If the population distribution were narrow, averaging only a few cells might be sufficient to achieve high statistical power; however, this does not appear to be the case, and a larger sample size is necessary.

      Furthermore, to ensure a more robust analysis, SuperPlots displaying each biological replicate should be provided for all quantifications, and statistical analysis should be conducted using a t-test or ANOVA on the means of the three independent experiments rather than on the total number of cells, as the latter approach may influence statistical significance (for reference: jcb.202001064). This recommendation is relevant for Figures 1E, 3B, 3C, 4E, 4F, 6F, Sup1D, Sup3D, Sup3E, Sup3I, and Sup3G and should be implemented whenever possible.

      For instance, in the new Figure 6F, the statistical difference (1 star) between Pearson's coefficients for HT1080 and siUSO1-2 conditions, both approaching 90, raises questions about whether this difference is truly substantial enough to support the claim that USO1 knockdown negatively impacts CAMSAP2 localization.

      Publishing in journals such as eLife requires high standards in data analysis to ensure rigorous and reproducible scientific conclusions. In its present form, this manuscript does not yet meet those standards.

      Additional comments:

      Supplementary figure 2<br /> A) The video microscopy conditions are not described in the Materials and Methods section. It is unclear what type of microscope was used-was it a bright-field or confocal microscope? The images contain a significant amount of out-of-focus signal, making it difficult to accurately assess the extent of Golgi apparatus dispersion as described by the authors. If a confocal microscope was used, a Z-stack projection would be beneficial for quantifying this process.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors show that depletion of MARK2 alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation.

      Impact:

      The Golgi apparatus is a key organelle in cell migration- post translationally modifying and sorting cargo for directed trafficking, acting as a signalling hub, whilst functioning as a nucleation site for microtubules. These functions are essential to establish cell polarity during migration, highlighting the importance of understanding how cells reorient their Golgi in response to different environmental cues.

      The study will be of interest to fundamental biologists investigating Golgi function, and positioning, particularly in the context of different cell migration settings. It may also interest scientists investigating the loss of polarity in cancer or the maintenance of epithelial tissue architecture. I am a cell biologist with expertise in cell trafficking, cytoskeleton, and cell migration- during processes spanning development, homeostasis and cancer.

      Comments on latest version:

      Labelling of graphs - many of the graphs are comparing HT1080 cells with two conditions: parental and KO i.e. Figure 2F, H, I. The labels the authors use are "HT1080 and CAMSAP2 KO". This is confusing and should be changed to "parental and CAMSAP2 KO", the cell type HT1080 could be listed in the figure legend or on the graph below the conditions. (Similar to the labelling in Figure 3 H, I where they use "control and siRNA").

      The method section needs improvement - particularly around analysis methods, and statistical details for experiments. I recommend a supplementary table outlining exactly where the data is from (pooled, biological/technical repeats, n definitions, tests of normality etc).

    1. Reviewer #1 (Public review):

      Summary

      In this manuscript, De La Forest Divonne et al. build a repertory of hemocytes from adult Pacific oysters combining scRNAseq data with cytologic and biochemical analyses. Three categories of hemocytes were described previously in this species (i.e. blast, hyalinocyte and granulocytes). Based on scRNAseq data, the authors identified 7 hemocyte clusters presenting distinct transcriptional signatures. Using Kegg pathway enrichment and RBGOA, the authors determined the main molecular features of the clusters. In parallel, using cytologic markers, the authors classified 7 populations of hemocytes (i.e. ML, H, BBL, ABL, SGC, BGC, and VC) presenting distinct sizes, nucleus sizes, acidophilic/basophilic, presence of pseudopods, cytoplasm/nucleus ratio and presence of granules. Then, the authors compared the phenotypic features with potential transcriptional signatures seen in the scRNAseq. The hemocytes were separated in a density gradient to enrich for specific subpopulations. The cell composition of each cell fraction was determined using cytologic markers and the cell fractions were analysed by quantitative PCR targeting major cluster markers (two per cluster). With this approach, the authors could assign cluster 7 to VC, cluster 2 to H, and cluster 3 to SGC. The other clusters did not show a clear association with this experimental approach. Using phagocytic assays, ROS, and copper monitoring, the authors showed that ML and SGC are phagocytic, ML produces ROS, and SGC and BGC accumulate copper. Then with the density gradient/qPCR approach, the authors identified the populations expressing anti-microbial peptides (ABL, BBL, and H). At last, the authors used Monocle to predict differentiation trajectories for each subgroup of hemocytes using cluster 4 as the progenitor subpopulation.

      The manuscript provides a comprehensive characterisation of the diversity of circulating immune cells found in Pacific oysters.

      Strengths

      The combination of scRNAseq, cytologic markers and gradient based hemocyte sorting offers an integrative view of the immune cell diversity.<br /> Hemocytes represent a very plastic cell population that has key roles in homeostatic and challenged conditions. Grasping the molecular features of these cells at the single-cell level will help understand their biology.<br /> This type of study may help elucidate the diversification of immune cells in comparative studies and evolutionary immunology.

      Weaknesses

      Several figures show inconsistency leading to erroneous conclusions and some conclusions are poorly supported. Moreover, the manuscript remains highly descriptive with limited comparison with the available literature.

    2. Reviewer #2 (Public review):

      Summary:

      This work provides a comprehensive understanding of cellular immunity in bivalves. To precisely describe the hemocytes of the oyster C. gigas, the authors morphologically characterized seven distinct cell groups, which they then correlated with single-cell RNA sequencing analysis, also resulting in seven transcriptional profiles. They employed multiple strategies to establish relationships between each morphotype and the scRNAseq profile. The authors correlated the presence of marker genes from each cluster identified in scRNAseq with hemolymph fractions enriched for different hemocyte morphotypes. This approach allowed them to correlate three of the seven cell types, namely hyalinocytes (H), small granule cells (SGC), and vesicular cells (VC). A macrophage-like (ML) cell type was correlated through the expression of macrophage-specific genes and its capacity to produce reactive oxygen species. Three other cell types correspond to blast-like cells, including an immature blast cell type from which distinct hematopoietic lineages originate to give rise to H, SGC, VC, and ML cells. Additionally, ML cells and SGCs demonstrated phagocytic properties, with SGCs also involved in metal homeostasis. On the other hand, H cells, non-granular cells, and blast cells expressed antimicrobial peptides. This study thus provides a complete landscape of oyster hemocytes with functional validation linked to immune activities. This resource will be valuable for studying the impact of bacterial or viral infections in oysters.

      The main strength of this study lies in its comprehensive and integrative approach, combining single-cell RNA sequencing, cytological analysis, cell fractionation and functional assays to provide a robust characterization of hemocyte populations in Crassostrea gigas.

      (1) The innovative use of marker genes, quantifying their expression within specific cell fractions, allows for precise annotation of different cellular clusters, bridging the gap between morphological observations and transcriptional profiles.

      (2)The study provides detailed insights into the immune functions of different hemocyte types, including the identification of professional phagocytes, ROS-producing cells, and cells expressing antimicrobial peptides.

      (3) The identification and analysis of transcription factors specific to different hemocyte types and lineages offer crucial insights into cell fate determination and differentiation processes in oyster immune cells.

      (4) The authors significantly advance the understanding of oyster immune cell diversity by identifying and characterizing seven distinct hemocyte transcriptomic clusters and morphotypes.

      These strengths collectively make this study a significant contribution to the field of invertebrate immunology, providing a comprehensive framework for understanding oyster hemocyte diversity and function.

      Conclusion:

      The authors largely achieved their primary objective of providing a comprehensive characterization of oyster immune cells. They successfully integrated multiple approaches to identify and describe distinct hemocyte types. The correlation of these cell types with specific immune functions represents a significant advancement in understanding oyster immunity. The authors are aware of the limitations of their study, particularly with regards to the pseudotime analysis, which provides a conceptual framework for understanding lineage relationships but requires further experimental validation to confirm its findings.

      This study is likely to have a significant impact on the field of invertebrate immunology, particularly in bivalve research. It provides a new standard for comprehensive immune cell characterization in invertebrates. The identification of specific markers for different hemocyte types will facilitate future research on oyster immunity. The proposed model of hemocyte lineages, while requiring further validation, offers a framework for studying hematopoiesis in bivalves.

    3. Reviewer #3 (Public review):

      The paper addresses pivotal questions concerning the multifaceted functions of oyster hemocytes by integrating single-cell RNA sequencing (scRNA-seq) data with analyses of cell morphology, transcriptional profiles, and immune functions. In addition to investigating granulocyte cells, the study delves into the potential roles of blast and hyalinocyte cells. A key discovery highlighted in this research is the identification of cell types engaged in antimicrobial activities, encompassing processes such as phagocytosis, intracellular copper accumulation, oxidative bursts, and antimicrobial peptide synthesis.

      A particularly intriguing aspect of the study lies in the exploration of hemocyte lineages, warranting further investigation, such as employing scRNA-seq on embryos at various developmental stages.

    1. Reviewer #1 (Public review):

      Summary:

      There has been intense controversy over the generality of Hamilton's inclusive fitness rule for how evolution works on social behaviors. All generally agree that relatedness can be a game changer, for example allowing for otherwise unselectable altruistic behaviors when c < rb, where c is the fitness cost to the altruism, b is the fitness benefit to another, and r their relatedness. Many complications have been successfully incorporated into the theory, including different reproductive values and viscous population structures.

      The controversy has centered on another dimension; Hamilton's original model was for additive fitness, but how does his result hold when fitnesses are non-additive? One approach has been not to worry about a general result but just find results for particular cases. A consistent finding is that the results depend on the frequency of the social allele - non-additivity causes frequency dependence that was absent in Hamilton's approach. Two other approaches derive from Queller via the Price equation. Queller 1 is to find forms like Hamilton's rule, but with additional terms that deal with non-additive interaction, each with an r-like population structure variable multiplied by a b-like fitness effect (Queller 1985). Queller 2 redefines the fitness effects c and b as partial regressions of the actor's and recipient's genes on fitness. This leaves Hamilton's rule intact, just with new definitions of c and b that depend on frequency.

      Queller 2 is the version that has been most adopted by the inclusive fitness community along with assertions that Hamilton's rule in completely general. In this paper, van Veelen argues that Queller 1 is the correct approach. He derives a general form that Queller only hinted at. He does so within a more rigorous framework that puts both Price's equation and Hamilton's rule on firmer statistical ground. Within that framework, the Queller 2 approach is seen to be a statistical misspecification - it employs a model without interaction in cases that actually do have interaction. If we accept that this is a fatal flaw, the original version of Hamilton's rule is limited to linear fitness models, which might not be common.

      Strengths:

      While the approach is not entirely new, this paper provides a more rigorous approach and a more general result. It shows that both Queller 1 and Queller 2 are identities and give accurate results, because both are derived from the Price equation, which is an identity. So why prefer Queller 1? It identifies the misspecification issue with the Queller 2 approach and points out its consequences. For example, it will not give the minimum squared differences between the model and data. It does not separate the behavioral effects of the individuals from the population state (b and c become dependent on r and the population frequency).

      The paper also shows how the same problems can apply to non-social traits. Epistasis is the non-additivity of effects of two genes within the individual. (So one wonders why have we not had a similarly fierce controversy over how we should treat epistasis?)

      The paper is clearly written. Though somewhat repetitive, particularly in the long supplement, most of that repetition has the purpose of underscoring how the same points apply equally to a variety of different models.<br /> Finally, this may be a big step towards reconciliation in the inclusive fitness wars. Van Veelen has been one of the harshest critics of inclusive fitness, and now he is proposing a version of it.

      Weaknesses:

      van Veelen argues that the field essentially abandoned the Queller 1 approach after its publication. I think this is putting it too strongly - there have been a number of theoretical studies that incorporate extra terms with higher-order relatednesses. It is probably accurate to say that there has been relative neglect. But perhaps this is partly due to a perception that this approach is difficult to apply.

      The model in this paper is quite elegant and helps clarify conceptual issues, but I wonder how practical it will turn out to be. In terms of modeling complicated cases, I suspect most practitioners will continue doing what they have been doing, for example using population genetics or adaptive dynamics, without worrying about neatly separating out a series of terms multiplying fitness coefficients and population structure coefficients.

      For empirical studies, it is going to be hard to even try to estimate all those additional parameters. In reality, even the standard Hamilton's rule is rarely tested by trying to estimate all its parameters. Instead, it is commonly tested more indirectly, for example by comparative tests of the importance of relatedness. That of course would not distinguish between additive and non-additive models that both depend on relatedness, but it does test the core idea of kin selection. It will be interesting to see if van Veelen's approach stimulates new ways of exploring the real world.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript reconsiders the "general form" of Hamilton's rule, in which "benefit" and "cost" are defined as regression coefficients. It points out that there is no reason to insist on Hamilton's rule of the form -c+br>0, and that, in fact, arbitrarily many terms (i.e. higher-order regression coefficients) can be added to Hamilton's rule to reflect nonlinear interactions. Furthermore, it argues that insisting on a rule of the form -c+br>0 can result in conditions that are true but meaningless and that statistical considerations should be employed to determine which form of Hamilton's rule is meaningful for a given dataset or model.

      Strengths:

      The point is an important one. While it is not entirely novel-the idea of adding extra terms to Hamilton's rule has arisen sporadically (Queller 1985, 2011; Fletcher & Zwick 2006; van Veelen et al. 2017)--it is very useful to have a systematic treatment of this point. I think the manuscript can make an important contribution by helping to clarify a number of debates in the literature. I particularly appreciate the heterozygote advantage example in the SI.

      Weaknesses:

      Although the mathematical analysis is rigorously done and I largely agree with the conclusions, I feel there are some issues regarding terminology, some regarding the state of the field, and the practice of statistics that need to be clarified if the manuscript is truly to resolve the outstanding issues of the field. Otherwise, I worry that it will in some ways add to the confusion.

      (1) The "generalized" Price equation: I agree that the equations labeled (PE.C) and (GPE.C) are different in a subtle yet meaningful way. But I do not see any way in which (GPE.C) is more general than (PE.C). That is, I cannot envision any circumstance in which (GPE.C) applies but (PE.C) does not. A term other than "generalized" should be used.

      (2) Regression vs covariance forms of the Price equation

      I think the author uses "generalized" in reference to what Price called the "regression form" of his equation. But to almost everyone in the field, the "Price Equation" refers to the covariance form. For this reason, it is very confusing when the manuscript refers to the regression form as simply "the Price Equation".

      As an example, in the box on p. 15, the manuscript states "The Price equation can be generalized, in the sense that one can write a variety of Price-like equations for a variety of possible true models, that may have generated the data." But it is not the Price equation (covariance form) that is being generalized here. It is only the regression that Price used that is being generalized.

      To be consistent with the field, I suggest the term "Price Equation" be used only to refer to the covariance form unless it is otherwise specified as in "regression form of the Price equation".

      (3) Sample covariance: The author refers to the covariance in the Price equation as "sample covariance". This is not correct, since sample covariance has a denominator of N-1 rather than N (Bessel's correction). The correct term, when summing over an entire population, is "population covariance". Price (1972) was clear about this: "In this paper we will be concerned with population functions and make no use of sample functions". This point is elaborated on by Frank (2012), in the subsection "Interpretation of Covariance".

      Of course, the difference is negligible when the population is large. However, the author applies the covariance formula to populations as small as N=2, for which the correction factor is significant.

      The author objects to using the term "population covariance" (SI, pp. 8-9) on the grounds that it might be misleading if the covariance, regression coefficients, etc. are used for inference because in this case, what is being inferred is not a population statistic but an underlying relationship. However, I am not convinced that statistical inference is or should be the primary use of the Price equation (see next point). At any rate, avoiding potential confusion is not a sufficient reason to use incorrect terminology.

      Relatedly, I suggest avoiding using E for the second term in the Price equation, since (as the ms points out), it is not the expectation of any random variable. It is a population mean. There is no reason not to use something like Avg or bar notation to indicate population mean. Price (1972) uses "ave" for average.

      I should add, however, that the distinction between population statistics vs sample statistics goes away for regression coefficients (e.g. b, c, and r in Hamilton's rule) since in this case, Bessel's correction cancels out.

      (4) Descriptive vs. inferential statistics

      When discussing the statistical quantities in the Price Equation, the author appears to treat them all as inferential statistics. That is, he takes the position that the population data are all generated by some probabilistic model and that the goal of computing the statistical quantities in the Price Equation is to correctly infer this model.

      It is worth pointing out that those who argue in favor of the Price Equation do not see it this way: "it is a mistake to assume that it must be the evolutionary theorist, writing out covariances, who is performing the equivalent of a statistical analysis." (Gardner, West, and Wild, 2011); "Neither data nor inferences are considered here" (Rousset 2015). From what I can tell, to the supporters of the Price equation and the regression form of Hamilton's rule, the statistical quantities involved are either population-level *descriptive* statistics (in an empirical context), or else are statistics of random variables (in a stochastic modeling context).

      In short, the manuscript seems to argue that Price equation users are performing statistical inference incorrectly, whereas the users insist that they are not doing statistical inference at all.

      The problem (and here I think the author would agree with me) arises when users of the Price equation go on to make predictive or causal claims that would require the kind of statistical analysis they claim not to be doing. Claims of the form "Hamilton's rule predicts.." or use of terms like "benefit" and "cost" suggest that one has inferred a predictive or causal relationship in the given data, while somehow bypassing the entire theory of statistical inference.

      There is also a third way to use the Price equation which is entirely unobjectionable: as a way to express the relationship between individual-level fitness and population-level gene frequency change in a form that is convenient for further algebraic manipulation. I suspect that this is actually the most common use of the Price equation in practice.

      For a paper that aims to clarify these thorny concepts in the literature, I think it is worth pointing out these different interpretations of statistical quantities in the Price equation (descriptive statistics vs inferential statistics vs algebraic manipulation). One can then critique the conclusions that are inappropriately drawn from the Price equation, which would require rigorous statistical inference to draw. Without these clarifications, supporters of the Price equation will again argue that this manuscript has misunderstood the purpose of the equation and that they never claimed to do inference in the first place.

      (5) "True" models

      Even if one accepts that the statistical quantities in the Price equation are inferential in nature, the author appears to go a step further by asserting that, even in empirical populations, there is a specific "true" model which it is our goal to infer. This assumption manifests at many points in the SI when the author refers to the "true model" or "true, underlying population structure" in the context of an empirical population.

      I do not think it is necessary or appropriate, in empirical contexts, to posit the existence of a Platonic "true" model that is generating the data. Real populations are not governed by mathematical models. Moreover, the goal of statistical inference is not to determine the "true model" for given data but to say whether a given statistical model is justified based on this data. Fitting a linear model, for example, does not rule out the possibility there may be higher-order interactions - it just means we do not have a statistical basis to infer these higher-order interactions from the data (say, because their p-scores are insignificant), and so we leave them out.

      What we can say is that if we apply the statistical model to data generated by a probabilistic model, and if these models match, then as the number of observations grows to infinity, the estimators in the statistical model converge to the parameters of the data-generating one. But this is a mathematical statement, not a statement about real-world populations.

      A resolution I suggest to points 3, 4, and 5 above is:<br /> *A priori, the statistical quantities in the Price Equation are descriptive statistics, pertaining only to the specific population data given.<br /> *If one wishes to impute any predictive power, generalizability, or causal meaning to these statistics, all the standard considerations of inferential statistics apply. In particular, one must choose a statistical model that is justified based on the given data. In this case, one is not guaranteed to obtain the standard (linear) Hamilton's rule and may obtain any of an infinite family of rules.<br /> *If one uses a model that is not justified based on the given data, the results will still be correct for the given population data but will lack any meaning or generalizability beyond that.<br /> *In particular, if one considers data generated by a probabilistic model, and applies a statistical model that does not match the data-generating one, the results will be misleading, and will not generalize beyond the randomly generated realization one uses.

      Of course, the author may propose a different resolution to points 3-5, but they should be resolved somehow. Otherwise, the terminology in the manuscript will be incorrect and the ms will not resolve confusion in the field.

    3. Reviewer #3 (Public review):

      There is an interesting mathematical connection - an "isomorphism"-between Price's equation and least-squares linear regression. Some people have misinterpreted this connection as meaning that there is a generality-limiting assumption of linearity within Price's equation, and hence that Hamilton's rule-which is derived from Price's equation-provides only an approximation of the action of natural selection. This is in contrast to the majority view that Hamilton's rule is a fully general and exact result.

      To briefly give some mathematical details: Price's equation defines the action of natural selection in relation to a trait of interest as the covariance between fitness w and the genetic breeding value g for the trait, i.e. cov(w,g); this is a fully general result that applies exactly to any arbitrary set of (g,w) data; without any loss of generality this covariance can be expressed as the product of genetic variance var(g) and a coefficient b(w,g), the coefficient simply being defined as b(w,g) = cov(w,g)/var(g) for all var(g) > 0; it happens that if one fits a straight line to the same (g,w) data by means of least-squares regression then the slope of that line is equal to b(w,g).

      All of this has already been discussed, repeatedly, in the literature.

      Now turn to the present paper: the first sentence of the Abstract says "The generality of Hamilton's rule is much debated", and then the next sentence says "In this paper, I show that this debate can be resolved by constructing a general version of Hamilton's rule". But immediately it's clear that this isn't really resolving the debate, what this paper is actually doing is asserting the correctness of the minority view (i.e. that Hamilton's rule as it currently stands is not a general result) and then attempting to build a more general form of Hamilton's rule upon that shaky foundation. Predictably, the paper erroneously interprets the standard formulation of Hamilton's rule as a linear approximation and develops non-linear extensions to improve the goodness of fit for a result that is already exactly correct.

      This is not a convincing contribution. It will not change minds or improve understanding of the topic.

      Nor is it particularly novel. Smith et al (2010, "A generalisation of Hamilton's rule for the evolution of microbial cooperation" Science 328, 1700-1703) similarly interpreted Hamilton's rule as a linear model and provided a corresponding polynomial expansion - usefully fitting the model to microbial data so as to learn something about the costs and benefits of cooperation in an empirical setting. it's odd that this paper isn't cited here.

    1. Reviewer #2 (Public review):

      In my previous review, I considered the contributions of the authors to be substantial because they have nearly doubled the number of genome sequences for chitons, and their newly sequenced genomes apparently are very well annotated. I would even extend these strengths now that I have had a chance to better review recent literature on marine animal genomes. Their contribution has helped make the chitons one of the best available marine taxa for comparative genomic studies. However, I still am unconvinced by the authors' claims to have demonstrated an unusually high rate of large-scale genome rearrangements across chitons. Their best argument seems to be comparisons drawn within a couple of similarly ancient bivalve lineages that were used to identify the conserved genomic regions in the first place, specifically the 20 molluscan linkage groups (MLGs). Perhaps it is safest to conclude that these MLGs are mostly conserved in conchiferans. Their main comparison with other molluscan classes is presented in tables 4 and 5 in the supplement, where they report a somewhat higher mean translocation rate for chitons (45.48) than for bivalves (41.10) or gastropods (41.87) but does this justify the implications of the title or the claims made in the Summary? I am not sure, partly because these summary tables are not made in a way that separates the gastropod or bivalve species listed into subtaxa separated by LCAs with estimated age, so the mean value across each class is not especially helpful. I still feel that the authors were not convincing in their arguments that chiton chromosomes have been subject to an unexpected history of rearrangement when contrasting quite ancient chitons lineages. This does not include impressive rearrangements documented for the likely geologically recent rearrangements seen within the genus, Acanthochitona, and separately within the subfamily Acanthopleurinae. These are quite impressive events that occurred recently within lineages of shallow-water chiton taxa, not deep still waters.

      By the authors' estimates, some sequenced chiton genomes represent lineages that share a last common ancestor (LCA) as much as over 300 million years before present. This is like comparing a frog genome with a human genome. I suspect that the authors would agree that the pace of chiton genome rearrangements is not nearly as great as that observed for younger taxa such as mammals or particular insect orders known to have a history of genome shuffling. For example, according to Damas et al. (2022; https://www.pnas.org/doi/full/10.1073/pnas.2209139119) for comparisons within mammals, "94 inversions, 16 fissions, and 14 fusions that occurred over 53 My differentiated the therian from the descendent eutherian ancestor."

      It is more interesting to me how the chiton genome rearrangements compare with other molluscan classes or for comparisons of other marine taxa genomes that share a similarly ancient LCA, but this is difficult to dig out of the authors' presentation. As far as I am aware, there are relatively few such comparisons of genome rearrangements available for marine animals. Attempting to do my own search for any comparison I could make, I noticed in that in a recent compilation of "high quality"* genomes (Martínez-Redondo 2024; https://doi.org/10.1093/gbe/evae235), this included genomes for 84 (mostly insect) arthropods, 67 vertebrates, 31 mollusks, 15 annelids, 12 nematodes, and 6 cnidarians, but the numbers drop off to 1-4 for many phyla, e.g., echinoderms. If there are really so few marine taxa available for comparison to the last 300 My of chiton genome rearrangements and fusions, then I would like to see a better presentation of the contrasts of the 20 molluscan linkage groups (MLGs) across molluscan classes. I found it very difficult to evaluate beyond the assertion that these are relatively conserved in two bivalve taxa. I remain unconvinced whether the amount of genome rearrangement observed by the authors for chitons is either especially rapid or slow. Certainly the genome browsers I have seen do not make it easy to compare, for example, marine gastropod or bivalve genomes (e.g., https://www.ncbi.nlm.nih.gov/cgv/9606 or https://genome.ucsc.edu/cgi-bin/hgGateway).

      An unrelated topic that I also brought up in my earlier review is the ancestral reconstruction of molluscan chromosome numbers. The authors' explanation does nothing to justify how they ended up with an optimization of 20 for the ancestor of Mollusca. The outgroups included two annelids, Owenia [12 chromosomes] and Paraescarpia [14], plus the very distant chordate, Branchiostoma [19] (but the tunicate, Oikopleura has 6). Do the authors not understand that outgroups are critical for the optimization of character states at an ancestral node, with the most proximal outgroups being most important? How did they end up with an ancestral reconstruction of the chiton LCA with 16 chromosomes when there is no chiton with more than 13? Given the number of chromosomes in annelids, which is clearly the most proximal outgroups included with chromosome numbers available, it is more parsimonious to postulate that there was an increase in chromosome number for the conchiferan lineage. Related, they should have rooted that tree figure (Fig. 2) with the deuterostome, Branchiostoma, not a monophyletic grouping of all outgroups.

      A recent study by Lewin et al. (2024; https://doi.org/10.1093/molbev/msae172) comparing annelid genomic rearrangements suggests to me that annelids probably have a more striking history of rearrangements than for chitons, but I found it difficult to evaluate. I do tend to agree with the overall conclusion of Lewin et al: "All animals with bilateral symmetry inherited a genome structure from their last common ancestor that has been highly conserved in some taxa but seemingly unconstrained in others." That is also my impression so far but the authors have done little to summarize what is known. One study that implies that at least deuterostomes have conserved elements of an ancestral chromosomal arrangement is provided by Lin et al. (2024; https://doi.org/10.1371/journal.pbio.3002661), who sequenced two genomes representing crown group hemichordates (LCA about 504 My).

      Even if my general impression is wrong that the history of chiton genome rearrangement is not especially remarkable, or at least we still do not have a great idea of how rapid it is, I still think the authors could have done a better job of demonstrating their claims. This is important if they are going to make big claims about the pace of chiton chromosomal rearrangements. There is very little discussion of other similarly ancient marine animal taxa. I do not especially have a problem with excluding better known terrestrial mammalian or insect genomes as perhaps not a very relevant contrast, but am I supposed to be impressed with the comparisons made with bivalves and gastropods in Tables 4 and 5 of the Supplement? Where do the authors present a detailed comparison of how these estimates compare to conchiferans? Is this amount of genome rearrangement observed for chitons surprising for an extant taxon that has diversified for over 300 My? This is claimed in the title and summary of the manuscript as the take-home for the contribution, but I am left with the impression that there is too little attempt to justify that the pace across Polyplacophora (Neoloricata) is in any way remarkable. Apparently, there are few other lineages of marine taxa within which there are sequenced and well annotated genomes that can be compared, and this confounds the extent of conclusions that can be made.

      * "high quality" genomes defined as follows by Martínez-Redondo (2024): "...we lowered the threshold used to consider a data set as high quality to 70% C + F (complete plus fragmented) BUSCO score (Manni et al. 2021), as the original 85% threshold was too restrictive when prioritizing a wide taxonomic sampling and the inclusion of biologically interesting species that are not widely studied."

    1. Reviewer #1 (Public review):

      Summary:

      The study investigates protein-protein interactions (PPIs) within the nuage, a germline-specific organelle essential for piRNA biogenesis in Drosophila melanogaster, using AlphaFold2 to predict interactions among 20 nuage-localizing proteins. The authors identify five novel interaction candidates and experimentally validate three of them, including Spindle-E and Squash, through co-immunoprecipitation assays. They confirm the functional significance of these interactions by disrupting salt bridges at the Spn-E_Squ interface. The study further expands its scope to analyze approximately 430 oogenesis-related proteins, validating three additional interaction pairs. A comprehensive screen of around 12,000 Drosophila proteins for interactions with the key piRNA pathway player, Piwi, identifies 164 potential binding partners. Overall, the research demonstrates that in silico approaches using AlphaFold2 can link bioinformatics predictions with experimental validation, streamlining the identification of novel protein interactions and reducing the reliance on extensive experimental efforts.

    2. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors use AlphaFold2 to identify potential binding partners of nuage localizing proteins.

      Strengths:

      The main strength of the paper is that the authors experimentally verify a subset of the predicted interactions.

      Many studies have been performed to predict protein-protein interactions in various subsets of proteins. The interesting story here is that the authors (i) focus on an organelle that contains quite some intrinsically disordered proteins and (ii) experimentally verify some (but not all) predictions.

      Weaknesses:

      Identification of pairwise interactions is only a first step towards understanding complex interactions. It is pretty clear from the predictions that some (but certainly not all) of the pairs could be used to build larger complexes. This is Done only for some cases and could be extended to the entire network.

    1. Reviewer #1 (Public review):

      Summary:

      This manuscript investigates the role of the neck linker in coordinating the stepping cycles of the two heads of a kinesin-1 motor. Previous studies in the field showed that kinesin walks by alternating stepping of its heads, referred to as hand-over-hand. In this stepping mechanism, the front head of a kinesin dimer must remain bound until the rear head dissociates from the microtubule, moves forward, and rebinds to the tubulin on the plus-end side of the front head. There is a large body of work done to address this question. These studies all point to the central role of the 14 amino acid extension, a neck-linker, which connects the two heads to a common stalk, in coordination of kinesin motility. In a two-head-bound state, the motor domains (heads) are oriented parallel to the microtubule, but the neck linkers are orienting toward each other, thereby, breaking the symmetry in a homodimeric motor. In addition, the neck linkers are quite short, almost stretching to their near contour length to accommodate the microtubule binding of both heads. Previous studies pointed out that either the opposing orientation or the intramolecular tension of the neck linkers coordinate the stepping cycle.

      However, we still do not know which step(s) in the chemo-mechanical cycle is controlled by the neck-linker to keep the two heads out of phase. The front head gating model postulates that ATP binding to the front head is gated until the rear head detaches from the microtubule. The rear head gating model proposes that the neck linker accelerates the detachment of the rear head from the microtubule. In this study, the authors use pre-steady state kinetics and smFRET to address this question. They measured ATP binding and microtubule detachment kinetics of kinesin's catalytic domain with neck linker constraints 1) imposed by disulfide crosslinking of the neck linker in monomeric kinesin in backward (rear head-like) and forward (front head-like) orientations, and 2) using the E236A-WT heterodimer to create a two-head microtubule-bound state with the mutant and WT heads occupying the rear and front positions respectively. They found that neck-linker conformation of the rear head reduces the ATP dissociation rate but has little effect on microtubule affinity. In comparison, the neck-linker conformation of the front head does not change ATP binding to the front head, but it reduces ATP-induced detachment of the front head, suggesting that a step after ATP binding (i.e. ATP hydrolysis or Pi release) is gated in the front head.

      Significance:

      I believe that this work will make an important contribution to the large body of literature focused on the mechanism of kinesin, which serves as an excellent model system to understand the kinetics and mechanics of a molecular motor. The mechanism proposed by the authors modifies the front-head gating model and is in agreement with recent structural work done on a kinesin dimer bound to a microtubule. Overall, the work is well performed, and the conclusions are well supported by the experimental data.

    2. Reviewer #2 (Public review):

      Summary:

      In this study, the authors investigate the molecular mechanism behind kinesin-1's coordinated movement along microtubules, with a focus on how ATP binding, hydrolysis, and microtubule attachment/detachment are regulated in the leading and trailing heads. Using pre-steady state kinetics and single-molecule assays, they show that the neck linker's conformation modulates nucleotide affinity and detachment rates in each head differently, establishing an asynchronous chemo-mechanical cycle that prevents simultaneous detachment. Supported by cryo-EM structural data, their findings suggest that strain-induced conformational changes in the nucleotide-binding pockets are crucial for kinesin's hand-over-hand movement, presenting a detailed kinetic model of its stepping mechanism. The manuscript is well-crafted, technically rigorous, and should be of significant interest to cell biology and cytoskeletal motor researchers.

      Significance:

      All conclusions are well-supported by the provided data. The findings address a critical gap in our understanding of how kinesin's two motor domains coordinate their movements, offering insights into the molecular basis of its stepping mechanism. This work should be of significant interest to the cytoskeletal research community.

      Comments on latest version:

      The authors have satisfactorily addressed my comments, although I recommend the addition of the following reference:

      Lu Rao, Jan O. Wirth, Jessica Matthias, and Arne Gennerich. 2025. A Two-Heads-Bound State Drives KIF1A Superprocessivity. bioRxiv 2025.01.14.632505

      This paper provides conclusive evidence that kinesin-1 predominantly adopts a one-head-bound state at limiting ATP concentrations and remains in this state for a significant portion of its enzymatic cycle even at saturating ATP. This limits its processivity compared to KIF1A, which predominantly adopts a two-heads-bound state under saturating ATP conditions. These findings directly support the authors' conclusion that trailing head dissociation is favored over leading head detachment.

    3. Reviewer #3 (Public review):

      Kinesin-1 is a dimeric motor protein that transports cargo along microtubules. Its movement relies on the ability of its two catalytic motor domains (heads) to couple microtubule interactions with directional conformational changes and ATP turnover in a coordinated, alternating manner. The kinetics of these processes in each head are tightly regulated (gated) to ensure that at least one motor domain remains bound to the microtubule at all times, preventing detachment.

      Niitani et al. investigated the gating mechanism by focusing on the role of the neck linker, a flexible region extending from the motor domain's C-terminus that undergoes conformational changes during stepping. They examined how the neck linker differentially regulates the microtubule affinity and ATP turnover of the front and rear heads. To do this, they designed cross-linkable monomeric motor domains mimicking the conformations of the front and rear heads and employed a combination of pre-steady-state and single-molecule analyses to measure ATP-binding and microtubule-detachment kinetics. Additionally, they studied a kinesin heterodimer with a locked rear head conformation to distinguish the kinetic properties of the front and rear heads within an active dimer.

      ATP binding rates were measured using stopped-flow experiments with mant-ATP and nucleotide-free kinesin-microtubule complexes. The results showed that crosslinking the neck linker in the forward-pointing conformation (mimicking the rear head) reduced the ATP dissociation rate, while crosslinking it in the rear-pointing conformation (mimicking the front head) had no significant effect on ATP binding kinetics. ATP dissociation from the rear head was further examined using a kinesin mutant (E236A) that stabilizes the ATP-bound state by significantly slowing ATP hydrolysis.

      To assess how neck-linker orientation affects microtubule attachment, the authors monitored turbidity changes after rapidly mixing nucleotide-free, crosslinked kinesin-microtubule complexes with ATP in a stopped-flow apparatus. Their findings demonstrated that the forward-oriented neck linker in the rear head promotes microtubule detachment, whereas the backward-oriented neck linker in the front head reduces detachment rates.

      These results indicate that neck-linker conformation governs gating of microtubule affinity and nucleotide binding. Moreover, they show that even partial docking of the neck linker onto the head is sufficient to partially open the gating mechanism. To further investigate the role of neck linker tension, the authors created kinesin dimers with neck linker insertions of varying lengths. Microtubule detachment kinetics and ATPase activity assays revealed that ATP turnover in the rear head is significantly affected by the degree of forward tension applied to its neck linker.

      Overall, Niitani et al. build upon previous kinesin gating models by introducing a neck-linker tension-based ATP binding affinity mechanism. Their findings provide a mechanistic basis for recent cryo-EM observations for kinesin-1 and kinesin-3 (KIF14) and distinguish the specific roles of neck linker tension in the front and rear heads in regulating ATP binding, hydrolysis, and microtubule detachment. This study is biochemically rigorous and makes an important contribution, though direct structural validation (e.g., cryo-EM snapshots of crosslinked or mutant kinesins bound to microtubules) would further strengthen their conclusions and clarify the asymmetry in ATP affinity between the front and rear heads.

    1. Reviewer #1 (Public review):

      Summary:

      Cell metabolism exhibits a well-known behavior in fast-growing cells, which employ seemingly wasteful fermentation to generate energy even in the presence of sufficient environmental oxygen. This phenomenon is known as Overflow Metabolism or the Warburg effect in cancer. It is present in a wide range of organisms, from bacteria and fungi to mammalian cells.

      In this work, starting with a metabolic network for Escherichia coli based on sets of carbon sources, and using a corresponding coarse-grained model, the author applies some well-based approximations from the literature and algebraic manipulations. These are used to successfully explain the origins of Overflow Metabolism, both qualitatively and quantitatively, by comparing the results with E. coli experimental data.

      By modeling the proteome energy efficiencies for respiration and fermentation, the study shows that these parameters are dependent on the carbon source quality constants K_i (p.115 and 116). It is demonstrated that as the environment becomes richer, the optimal solution for proteome energy efficiency shifts from respiration to fermentation. This shift occurs at a critical parameter value K_A(C).<br /> This counterintuitive result qualitatively explains Overflow Metabolism.

      Quantitative agreement is achieved through the analysis of the heterogeneity of the metabolic status within a cell population. By introducing heterogeneity, the critical growth rate is assumed to follow a Gaussian distribution over the cell population, resulting in accordance with experimental data for E. coli. Overflow metabolism is explained by considering optimal protein allocation and cell heterogeneity.

      The obtained model is extensively tested through perturbations: 1) Introduction of overexpression of useless proteins; 2) Studying energy dissipation; 3) Analysis of the impact of translation inhibition with different sub-lethal doses of chloramphenicol on Escherichia coli; 4) Alteration of nutrient categories of carbon sources using pyruvate. All model perturbations results are corroborated by E. coli experimental results.

      Strengths:

      In this work, the author effectively uses modeling techniques typical of Physics to address complex problems in Biology, demonstrating the potential of interdisciplinary approaches to yield novel insights. The use of Escherichia coli as a model organism ensures that the assumptions and approximations are well-supported in existing literature. The model is convincingly constructed and aligns well with experimental data, lending credibility to the findings. In this version, the extension of results from bacteria to yeast and cancer is substantiated by a literature base, suggesting that these findings may have broad implications for understanding diverse biological systems.

      Weaknesses:

      The author explores the generalization of their results from bacteria to cancer cells and yeast, adapting the metabolic network and coarse-grained model accordingly. In the previous version this generalization was not completely supported by references and data from the literature. This drawback, however, has been treated in this current version, where the authors discuss in much more detail and give references supporting this generalization.

      Comments on revisions:

      I have no specific comments for the authors. My previous comments were all addressed, discussed and explained.

    1. Reviewer #1 (Public review):

      Summary:

      This paper presents a method for reconstructing videos from mouse visual cortex neuronal activity using a state-of-the-art dynamic neural encoding model. The authors achieve high-quality reconstructions of 10-second movies at 30 Hz from two-photon calcium imaging data, reporting a 2-fold increase in pixel-by-pixel correlation compared to previous methods. They identify key factors for successful reconstruction including the number of recorded neurons and model ensembling techniques.

      Strengths:

      (1) A comprehensive technical approach combining state-of-the-art neural encoding models with gradient-based optimization for video reconstruction.

      (2) Thorough evaluation of reconstruction quality across different spatial and temporal frequencies using both natural videos and synthetic stimuli.

      (3) Detailed analysis of factors affecting reconstruction quality, including population size and model ensembling effects.

      (4) Clear methodology presentation with well-documented algorithms and reproducible code.

      (5) Potential applications for investigating visual processing phenomena like predictive coding and perceptual learning.

      Weaknesses:

      The main metric of success (pixel correlation) may not be the most meaningful measure of reconstruction quality:

      High correlation may not capture perceptually relevant features.

      Different stimuli producing similar neural responses could have low pixel correlations The paper doesn't fully justify why high pixel correlation is a valuable goal

      Comparison to previous work (Yoshida et al.) has methodological concerns: Direct comparison of correlation values across different datasets may be misleading; Large differences in the number of recorded neurons (10x more in the current study); Different stimulus types (dynamic vs static) make comparison difficult; No implementation of previous methods on the current dataset or vice versa.

      Limited exploration of how the reconstruction method could provide insights into neural coding principles beyond demonstrating technical capability.

      The claim that "stimulus reconstruction promises a more generalizable approach" (line 180) is not well supported with concrete examples or evidence.

      The paper would benefit from addressing how the method handles cases where different stimuli produce similar neural responses, particularly for high-speed moving stimuli where phase differences might be lost in calcium imaging temporal resolution.

    2. Reviewer #2 (Public review):

      This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

      This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

      While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

      (1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

      (2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

      (3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

      (4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

      (5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

      (6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

      (7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

    3. Reviewer #3 (Public review):

      Summary:

      This paper presents a method for reconstructing input videos shown to a mouse from the simultaneously recorded visual cortex activity (two-photon calcium imaging data). The publicly available experimental dataset is taken from a recent brain-encoding challenge, and the (publicly available) neural network model that serves to reconstruct the videos is the winning model from that challenge (by distinct authors). The present study applies gradient-based input optimization by backpropagating the brain-encoding error through this selected model (a method that has been proposed in the past, with other datasets). The main contribution of the paper is, therefore, the choice of applying this existing method to this specific dataset with this specific neural network model. The quantitative results appear to go beyond previous attempts at video input reconstruction (although measured with distinct datasets). The conclusions have potential practical interest for the field of brain decoding, and theoretical interest for possible future uses in functional brain exploration.

      Strengths:

      The authors use a validated optimization method on a recent large-scale dataset, with a state-of-the-art brain encoding model. The use of an ensemble of 7 distinct model instances (trained on distinct subsets of the dataset, with distinct random initializations) significantly improves the reconstructions. The exploration of the relation between reconstruction quality and the number of recorded neurons will be useful to those planning future experiments.

      Weaknesses:

      The main contribution is methodological, and the methodology combines pre-existing components without any new original components. The movie reconstructions include a learned "transparency mask" to concentrate on the most informative area of the frame; it is not clear how this choice impacts the comparison with prior experiments. Did they all employ this same strategy? If not, shouldn't the quantitative results also be reported without masking, for a fair comparison?

    1. Reviewer #1 (Public review):

      Summary:

      This study is built on the emerging knowledge of trained immunity, where innate immune cells exhibit enhanced inflammatory responses upon being challenged by a prior insult. Trained immunity is now a very fast-evolving field and has been explored in diverse disease conditions and immune cell types. Earhart and the team approached the topic from a novel angle and were the first to explore a potential link to the complement system.

      The study focused on the central complement protein C3 and investigated how its signalling may modulate immune training in alveolar macrophages. The authors first performed in vivo experiments in C57BL mouse models to observe the presence of enhanced inflammation and C3a in BAL fluid following immune training. These changes were then compared with those from C3-deficient mice, which confirmed the involvement of C3a. This trained immunity was further validated in ex vivo experiments using primary alveolar macrophage, which was blunted in C3-deficiency, and, intriguingly, rescued by adding exogenous C3 protein, but not C3a. The genetic-based findings were supported by pharmacological experiments using the C3aR antagonist SB290157. Mechanistically, transcriptomic analyses suggested the involvement of metabolism-linked, particularly glycolytic, genes, which was in agreement with an upregulation of glycolytic flux in WT but not C3-deficient macrophages.

      Collectively, these data suggest that C3, possibly through engaging with C3aR, contributes to trained immunity in alveolar macrophages.

      Strengths:

      The conclusions reached were well supported by in vivo and ex vivo experiments, encompassing both genetic-knockout animal models and pharmacological tools.

      The transcriptomic and cell metabolism studies provided valuable mechanistic insights.

      Weaknesses:

      For the in vivo experiments, the histopathological and other inflammatory markers (Figure 1) were not directly linked to alveolar macrophages by experimental evidence. Other innate immune cells (eg. dendritic cells, neutrophils) and endothelial cells could also be involved in immune training and contribute to the pathological outcomes. These cells were not examined or mentioned in the study.

      For the ex vivo experiments assessing immune training in alveolar macrophages, only the release of selected inflammatory factors were measured. Macrophage activities constitute multiple aspects (e.g. phagocytosis, ROS production, microbe killing), which should also be considered to better depict the effect of trained immunity.

      The proposed mechanism of C3 getting cleaved intracellularly and then binding to lysosomal C3aR needs to be further supported by experimental evidence.

      There was an absence of any validation in human-based models.

    2. Reviewer #2 (Public review):

      Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

      (1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

      (2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

      (3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

      (4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

      (5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

      (6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

    1. Reviewer #1 (Public review):

      Summary:

      The authors aimed to characterize neurocomputational signals underlying interpersonal guilt and responsibility. Across two studies, one behavioral and one fMRI, participants made risky economic decisions for themselves or for themselves and a partner; they also experienced a condition in which the partners made decisions for themselves and the participant. The authors also assessed momentary happiness intermittently between choices in the task. Briefly, results demonstrated that participants' self-reported happiness decreased after disadvantageous outcomes for themselves and when both they and their partner were affected; this effect was exacerbated when participants were responsible for their partner's low outcome, rather than the opposite, reflecting experienced guilt. Consistent with previous work, BOLD signals in the insula correlated with experienced guilt, and insula-right IFG connectivity was enhanced when participants made risky choices for themselves and safe choices for themselves and a partner.

      Strengths:

      This study implements an interesting approach to investigating guilt and responsibility; the paradigm in particular is well-suited to approach this question, offering participants the chance to make risky v. safe choices that affect both themselves and others. I appreciate the assessment of happiness as a metric for assessing guilt across the different task/outcome conditions, as well as the implementation of both computational models and fMRI.

      Weaknesses:

      In spite of the overall strengths of the study, I think there are a few areas in which the paper fell a bit short and could be improved.

      (1) While the framing and goal of this study was to investigate guilt and felt responsibility, the task implemented - a risky choice task with social conditions - has been conducted in similar ways in past research that were not addressed here. The novelty of this study would appear to be the additional happiness assessments, but it would be helpful to consider the changes noted in risk-taking behavior in the context of additional studies that have investigated changes in risky economic choice in social contexts (e.g., Arioli et al., 2023 Cerebral Cortex; Fareri et al., 2022 Scientific Reports).

      (2) The authors note they assessed changes in risk preferences between social and solo conditions in two ways - by calculating a 'risk premium' and then by estimating rho from an expected utility model. I am curious why the authors took both approaches (this did not seem clearly justified, though I apologize if I missed it). Relatedly, in the expected utility approach, the authors report that since 'the number of these types of trials varied across participants', they 'only obtained reliable estimates for [gain and loss] trials in some participants' - in study 1, 22 participants had unreliable estimates and in study 2, 28 participants had unreliable estimates. Because of this, and because the task itself only had 20 gains, 20 losses, and 20 mixed gambles per condition, I wonder if the authors can comment on how interpretable these findings are in the Discussion. Other work investigating loss aversion has implemented larger numbers of trials to mitigate the potential for unreliable estimates (e.g., Sokol-Hessner et al., 2009).

      (3) One thing seemingly not addressed in the Discussion is the fact that the behavioral effect did not replicate significantly in study 2.

      (4) Regarding the computational models, the authors suggest that the Reponsibility and Responsibility Redux models provided the best fit, but they are claiming this based on separate metrics (e.g., in study 1, the redux model had the lowest AIC, but the responsibility only model had the highest R^2; additionally, the basic model had the lowest BIC). I am wondering if the authors considered conducting a direct model comparison to statistically compare model fits.

      (5) In the reporting of imaging results, the authors report in a univariate analysis that a small cluster in the left anterior insula showed a stronger response to low outcomes for the partner as a result of participant choice rather than from partner choice. It then seems as though the authors performed small volume correction on this cluster to see whether it survived. If that is accurate, then I would suggest that this result be removed because it is not recommended to perform SVC where the volume is defined based on a result from the same whole-brain analysis (i.e., it should be done a priori).

    2. Reviewer #2 (Public review):

      Summary

      This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

      Strengths

      This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

      The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

      The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

      Weaknesses

      As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

      As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

      This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

      However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of a fed vs hungry state on food decision-making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings:

      Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

    2. Reviewer #3 (Public review):

      Summary:

      This well-powered study tested the effects of hunger on value-based dietary decision-making. The main hypothesis was that attentional mechanisms guide choices toward unhealthier and tastier options when participants are hungry and are in the fasted state compared to satiated states. Participants were tested twice - in a fasted state and in a satiated state after consuming a protein shake. Attentional mechanisms were measured during dietary decision-making by linking food choices and reaction times to eye-tracking data and mathematical drift-diffusion models. The results showed that hunger makes high-conflict food choices more taste-driven and less health-driven. This effect was formally mediated by relative dwell time, which approximates attention drawn to chosen relative to unchosen options. Computational modeling showed that a drift-diffusion model, which assumed that food choices result from a noisy accumulation of evidence from multiple attributes (i.e., taste and health) and discounted non-looked attributes and options, best explained observed choices and reaction times.

      Strengths:

      This study's findings are valuable for understanding how energy states affect decision-making and provide an answer to how hunger can lead to unhealthy choices. These insights are relevant to psychology, behavioral economics, and behavioral change intervention designs.

      The study has a well-powered sample size and hypotheses were pre-registered. The analyses comprised classical linear models and non-linear computational modeling to offer insight into putative cognitive mechanisms.

      In summary, the study advances the understanding of the links between energy states and value-based decision-making by showing that depleting is powerful for shaping the formation of food preferences. Moreover, the computational analysis part offers a plausible mechanistic explanation at the algorithmic level of observed effects.

      Weaknesses:

      Some parts of the positioning of the hunger state manipulation and the interpretation of its effects could be improved.

      On the positioning side, it does not seem like a 'bad' decision to replenish energy states when hungry by preferring tastier, more often caloric options. In this sense, it is unclear whether the observed behavior in the fasted state is a fallacy or a response to signals from the body. The introduction does mention these two aspects of preferring more caloric food when hungry. However, some ambiguity remains about whether the study results indeed reflect suboptimal choice behavior or a healthy adaptive behavior to restore energy stores.

      On the interpretation side, previous work has shown that beliefs about the nourishing and hunger-killing effectiveness of drinks or substances influence subjective and objective markers of hunger, including value-based dietary decision-making, and attentional mechanisms approximated by computational models and the activation of cognitive control regions in the brain. The present study shows differences between the protein shake and a natural history condition (fasted, state). This experimental design, however, cannot rule between alternative interpretations of observed effects. Notably, effects could be due to (a) the drink's active, nourishing ingredients, (b) consuming a drink versus nothing, or (c) both.

    3. Reviewer #1 (Public review):

      Summary:

      In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift-diffusion model, they further find that the best-fitting model has different attentional discounts on the taste and health attributes and that the attentional discount on the health information was larger for the hungry participants.

      Strengths:

      The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 9 different variants of the DDM, including recent models like the mtDDM and maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

      Weaknesses:

      First, in examining some of the model fits in the supplements, e.g. Figures S9, S10, S12, S13, it looks like the "taste weight" parameter is being constrained below 1. Theoretically, I understand why the authors imposed this constraint, but it might be unfairly penalizing these models. In theory, the taste weight could go above 1 if participants had a negative weight on health. This might occur if there is a negative correlation between attractiveness and health and the taste ratings do not completely account for attractiveness. I would recommend eliminating this constraint on the taste weight.

      Second, I'm not sure about the mediation model. Why should hunger change the dwell time on the chosen item? Shouldn't this model instead focus on the dwell time on the tasty option?

      Third, while I do appreciate the within-participant design, it does raise a small concern about potential demand effects. I think the authors' results would be more compelling if they replicated when only analyzing the first session from each participant. Along similar lines, it would be useful to know whether there was any effect of order.

      Fourth, the authors report that tasty choices are faster. Is this a systematic effect, or simply due to the fact that tasty options were generally more attractive? To put this in the context of the DDM, was there a constant in the drift rate, and did this constant favor the tasty option?

      Fifth, I wonder about the mtDDM. What are the units on the "starting time" parameters? Seconds? These seem like minuscule effects. Do they align with the eye-tracking data? In other words, which attributes did participants look at first? Was there a correlation between the first fixations and the relative starting times? If not, does that cast doubt on the mtDDM fits? Did the authors do any parameter recovery exercises on the mtDDM?

    1. Reviewer #1 (Public review):

      Summary:

      Mancl et al. present cryo-EM structures of the Insulin Degrading Enzyme (IDE) dimer and characterize its conformational dynamics by integrating structures with SEC-SAXS, enzymatic activity assays, and all-atom molecular dynamics (MD) simulations. They present five cryo-EM structures of the IDE dimer at 3.0-4.1 Å resolution, obtained with one of its substrates, insulin, added to IDE in a 1:2 ratio. The study identified R668 as a key residue mediating the open-close transition of IDE, a finding supported by simulations and experimental data. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface.

      Strengths:

      The study by Mancl et al. uses a combination of experimental (cryoEM, SEC-SAXS, enzymatic assays) and computational (MD simulations, multibody analysis, 3DVA) techniques to provide a comprehensive characterization of IDE dynamics. The identification of R668 as a key residue mediating the open-to-close transition of IDE is a novel finding, supported by both simulations and experimental data presented in the manuscript. The work offers a refined model for how IDE recognizes and degrades amyloid peptides, incorporating the roles of IDE-N rotation and charge-swapping events at the IDE-N/C interface. The study identifies the structural basis and key residues for IDE dynamics that were not revealed by static structures.

      Weaknesses:

      Based on MD simulations and enzymatic assays of IDE, the authors claim that the R668A mutation in IDE affects the conformational dynamics governing the open-closed transition, which leads to altered substrate binding and catalysis. The functional importance of R668 would be substantiated by enzymatic assays that included some of the other known substrates of IDE than insulin such as amylin and glucagon.

      It is unclear to what extent the force field (FF) employed in the MD simulations favors secondary structures and if the lack of any observed structural changes within the IDE domains in the simulations - which is taken to suggest that the domains behave as rigid bodies - stems from bias by the FF.

    2. Reviewer #2 (Public review):

      Summary:

      The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

    1. Reviewer #1 (Public review):

      This work employs both in vitro and in vivo/transplant methods to investigate the contribution of BDNF/TrkB signaling to enhancing differentiation and dentin-repair capabilities of dental pulp stem cells in the context of exposure to a variety of inflammatory cytokines. A particular emphasis of the approach is the employment of dental pulp stem cells in which BDNF expression has been enhanced using CRISPR technology. Transplantation of such cells is said to improve dentin regeneration in a mouse model of tooth decay.

      The study provides several interesting findings, including demonstrating that exposure to several cytokines/inflammatory agents increases the quantity of (activated) phospho-Trk B in dental pulp stem cells.

      However, a variety of technical issues weaken support for the major conclusions offered by the authors. These technical issues include the following:

      (1) It remains unclear exactly how the cytokines tested affect BDNF/TrkB signaling. For example, in Figure 1C, TNF-alpha increases TrkB and phospho-TrkB immunoreactivity to the same degree, suggesting that the cytokine promotes TrkB abundance without stimulating pathways that activate TrkB, whereas in Figure 2D, TNF-alpha has little effect on the abundance of TrkB, while increasing phospho-TrkB, suggesting that it affects TrkB activation and not TrkB abundance.

      (2) I find the histological images in Figure 3 to be difficult to interpret. I would have imagined that DAPI nuclear stains would reveal the odontoblast layer, but this is not apparent. An adjacent section labeled with conventional histological stains would be helpful here. Others have described Stro-1 as a stem cell marker that is expressed on a minority of cells associated with vasculature in the dental pulp, but in the images in Figure 3, Stro-l label is essentially co-distributed with DAPI, in both control and injured teeth, indicating that it is expressed in nearly all cells. Although the authors state that the Stro-1-positive cells are associated with vasculature, but I see no evidence that is true.

      (3) The data presented convincingly demonstrate that they have elevated BDNF expression in their dental pulp stem cells using a CRISPR-based approach I have a number of questions about these findings. Firstly, nowhere in the paper do they describe the nature of the CRISPR plasmid they are transiently transfecting. Some published methods delete segments of the BDNF 3'-UTR while others use an inactivated Cas9 to position an active transactivator to sequences in the BDNF promoter. If it is the latter approach, transient transfection will yield transient increases in BDNF expression. Also, as BDNF employs multiple promoters, it would be helpful to know which promoter sequence is targeted, and finally, knowing the identity of the guide RNAs would allow assessment for the potential of off-target effects I am guessing that the investigators employ a commercially obtained system from Santa Cruz, but nowhere is this mentioned. Please provide this information.

      (4) Another question left unresolved is whether their approach elevated BDNF, proBDNF, or both. Their 28 kDa western blot band apparently represents proBDNF exclusively, with no mature BDNF apparent, yet only mature BDNF effectively activates TrkB receptors. On the other hand, proBDNF preferentially activates p75NTR receptors. The present paper never mentions p75NTR, which is a significant omission, since other investigators have demonstrated that p75NTR controls odontoblast differentiation.

      (5) In any case, no evidence is presented to support the conclusion that the artificially elevated BDNF expression has any effect on the capability of the dental pulp stem cells to promote dentin regeneration. The results shown in Figures 4 and 5 compare dentin regeneration with BDNF-over-expressing stem cells with results lacking any stem cell transplantation. A suitable control is required to allow any conclusion about the benefit of over-expressing BDNF.

      (6) Whether increased BDNF expression is beneficial or not, the evidence that the BDNF-overexpressing dental pulp stem cells promote dentin regeneration is somewhat weak. The data presented indicate that the cells increase dentin density by only 6%. The text and figure legend disagree on whether the p-value for this effect is 0.05 or 0.01. In either case, nowhere is the value of N for this statistic mentioned, leaving uncertainty about whether the effect is real.

      (7) The final set of experiments applies transcriptomic analysis to address the mechanisms mediating function differences in dental pulp stem cell behavior. Unfortunately, while the Abstract indicates " we conducted transcriptomic profiling of TNFα-treated DPSCs, both with and without TrkB antagonist CTX-B" that does not describe the experiment described, which compared the transcriptome of control cells with cells simultaneously exposed to TNF-alpha and CTX-B. Since CTX-B blocks the functional response of cells to TNF-alpha, I don't understand how any useful interpretation can be attached to the data without controls for the effect of TNF alone and CTX-B alone.

    2. Reviewer #2 (Public review):

      Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

      Strengths:<br /> The potential application to dentin regeneration is interesting.

      Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

      (1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

      (2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

      (3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

      (4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

      (5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

    3. Reviewer #3 (Public review):

      In general, although the authors interpret their results as pointing towards a possible role of BDNF in dentin regeneration, the results are over-interpreted due to the lack of proper controls and focus on TrkB expression, but not its isoforms in inflammatory processes. Surprisingly, the authors do not study the possible role of p75 in this process, which could be one of the mechanisms intervening under inflammatory conditions.

      (1) The authors claim that there are two Trk receptors for BDNF, TrkA and TrkB. To date, I am unaware of any evidence that BDNF binds to TrkA to activate it. It is true that two receptors have been described in the literature, TrkB and p75 or NGFR, but the latter is not TrkA despite its name and capacity to bind NGF along with other neurotrophins. It is crucial for the authors to provide a reference stating that TrkA is a receptor for BDNF or, alternatively, to correct this paragraph.

      (2) The authors discuss BDNF/TrkB in inflammation. Is there any possibility of p75 involvement in this process?

      (3) The authors present immunofluorescence (IF) images against TrkB and pTrkB in the first figure. While they mention in the materials and methods section that these antibodies were generated for this study, there is no proof of their specificity. It should be noted that most commercial antibodies labeled as anti-TrkB recognize the extracellular domain of all TrkB isoforms. There are indications in the literature that pathological and excitotoxic conditions change the expression levels of TrkB-Fl and TrkB-T1. Therefore, it is necessary to demonstrate which isoform of TrkB the authors are showing as increased under their conditions. Similarly, it is essential to prove that the new anti-p-TrkB antibody is specific to this Trk receptor and, unlike other commercial antibodies, does not act as an anti-phospho-pan-Trk antibody.

      (4) I believe this initial conclusion could be significantly strengthened, without opening up other interpretations of the results, by demonstrating the specificity of the antibodies via Western blot (WB), both in the presence and absence of BDNF and other neurotrophins, NGF, and NT-3. Additionally, using WB could help reinforce the quantification of fluorescence intensity presented by the authors in Figure 1. It's worth noting that the authors fixed the cells with 4% PFA for 2 hours, which can significantly increase cellular autofluorescence due to the extended fixation time, favoring PFA autofluorescence. They have not performed negative controls without primary antibodies to determine the level of autofluorescence and nonspecific background. Nor have they indicated optimizing the concentration of primary antibodies to find the optimal point where the signal is strong without a significant increase in background. The authors also do not mention using reference markers to normalize specific fluorescence or indicating that they normalized fluorescence intensity against a standard control, which can indeed be done using specific signal quantification techniques in immunocytochemistry with a slide graded in black-and-white intensity controls. From my experience, I recommend caution with interpretations from fluorescence quantification assays without considering the aforementioned controls.

      (5) In Figure 2, the authors determine the expression levels of TrkA and TrkB using qPCR. Although they specify the primers used for GAPDH as a control in materials and methods, they do not indicate which primers they used to detect TrkA and TrkB transcripts, which is essential for determining which isoform of these receptors they are detecting under different stimulations. Similarly, I recommend following the MIQE guidelines (Minimum Information for Publication of Quantitative Real-Time PCR experiments), so they should indicate the amplification efficiency of their primers, the use of negative and positive controls to validate both the primer concentration used, and the reaction, the use of several stable reference genes, not just one.

      (6) Moreover, the authors claim they are using the same amounts of cDNA for qPCRs since they have quantified the amounts using a Nanodrop. Given that dNTPs are used during cDNA synthesis, and high levels remain after cDNA synthesis from mRNA, it is not possible to accurately measure cDNA levels without first cleaning it from the residual dNTPs. Therefore, I recommend that the authors clarify this point to determine how they actually performed the qPCRs. I also recommend using two other reference genes like 18S and TATA Binding Protein alongside GAPDH, calculating the geometric mean of the three to correctly apply the 2^-ΔΔCt formula.

      (7) Similarly, given that the newly generated antibodies have not been validated, I recommend introducing appropriate controls for the validation of in-cell Western assays.

      (8) The authors' conclusion that TrkB levels are minimal (Figure 2E) raises questions about what they are actually detecting in the previous experiments might not be the TrkB-Fl form. Therefore, it is essential to demonstrate beyond any doubt that both the antibodies used to detect TrkB and the primers used for qPCR are correct, and in the latter case, specify at which cycle (Ct) the basal detection of TrkB transcripts occurs. Treatment with TNF-alpha for 14 days could lead to increased cell proliferation or differentiation, potentially increasing overall TrkB transcript levels due to the number of cells in culture, not necessarily an increase in TrkB transcripts per cell.

      (9) Overall, there are reasonable doubts about whether the authors are actually detecting TrkB in the first three images, as well as the phosphorylation levels and localization of this receptor in the cells. For example, in Figure 3 A to J, it is not clear where TrkB is expressed, necessitating better resolution images and a magnified image to show in which cellular structure TrkB is expressed.

      (10) In Figure 4, the authors indicate they have generated cells overexpressing BDNF after recombination using CRISPR technology. However, the WB they show in Figure 4B, performed under denaturing conditions, displays a band at approximately 28kDa. This WB is absolutely incorrect with all published data on BDNF detection via this technique. I believe the authors should demonstrate BDNF presence by showing a WB with appropriate controls and BDNF appearing at 14kDa to assume they are indeed detecting BDNF and that the cells are producing and secreting it. What antibodies have been used by the authors to detect BDNF? Have the authors validated it? There are some studies reporting the lack of specificity of certain commercial BDNF antibodies, therefore it is necessary to show that the authors are convincingly detecting BDNF.

      (11) While the RNA sequencing data indicate changes in gene expression in cells treated with TNFalpha+CTX-B compared to control, the authors do not show a direct relationship between these genetic modifications with the rest of their manuscript's argument. I believe the results from these RNA sequencing assays should be put into the context of BDNF and TrkB, indicating which genes in this signaling pathway are or are not regulated, and their importance in this context.

    1. Reviewer #1 (Public review):

      Summary:

      In this study, authors utilized in situ cryo-electron tomography (cryo-ET) to uncover the native thylakoid architecture of spinach chloroplasts and mapped the molecular organization of these thylakoids with single-molecule resolution. The obtained images show the detailed ultrastructural features of grana membranes and highlight interactions between thylakoids and plastoglobules. Interestingly, despite the distinct three-dimensional architecture of vascular plant thylakoids, their molecular organization closely resembles that of green algae. The pronounced lateral segregation of PSII and PSI was observed at the interface between appressed and non-appressed thylakoid regions, without evidence of a specialized grana margin zone where these complexes might intermix. Furthermore, unlike isolated thylakoid membranes, photosystem II (PSII) did not form a semi-crystalline array and distributed uniformly within the membrane plane and across stacked grana membranes in intact chloroplasts. Based on the above observations, the authors propose a simplified two-domain model for the molecular organization of thylakoid membranes that can apply to both green algae and vascular plants. This study suggests that the general understanding of the functional separation of thylakoid membranes in vascular plants should be reconsidered.

      Strengths:

      By employing and refining AI-driven computational tools for the automated segmentation of membranes and identification of membrane proteins, this study successfully quantifies the spatial organization of photosynthetic complexes both within individual thylakoid membranes and across neighboring stacked membranes.

      Weaknesses:

      This study's weakness is that it requires the use of chloroplasts isolated from leaves and the need to freeze them on a grid for observation, so it is unclear to what extent the observations reflect physiological conditions. In particular, the mode of existence of the thylakoid membrane complexes seems to be strongly influenced by the physicochemical environment surrounding the membranes, as indicated by the different distribution of PSII between intact chloroplasts and those with ruptured envelope membranes.

    2. Reviewer #2 (Public review):

      Summary:

      For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

      Strengths:

      By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

    1. Reviewer #1 (Public review):

      Summary:

      This paper proposes a new set of local synaptic plasticity rules that differs from classic rules in two regards: First, working under the assumption that signals coming into synapses change smoothly over time and thus have temporal correlations such that immediate activity is positively correlated with subsequent activity, it proposes both fast plasticity that immediately corrects errors as well as slower plasticity. Second, it derives these rules from optimal, Bayesian control theory principles that, even without the fast component of plasticity, are shown to provide more accurate performance than classic, non-Bayesian plasticity rules. As a proof of principle, it applies these to a simple cerebellar learning example that demonstrates how the proposed rules lead to learning performance that exceeds that achieved with classic cerebellar learning rules. The work also provides a potential normative explanation for post-climbing fiber spike pauses in Purkinje cell firing and proposes testable predictions for cerebellar experiments. Overall, I found the idea to be compelling and potentially broadly applicable across many systems. Further, I thought the work was a rare, very beautiful display of the application of optimal control theory to fundamental problems in neuroscience. My comments are all relatively minor and more expressions of interest than criticism.

      Comments:

      (1) The algorithm assumes, reasonably, that inputs are relatively smooth. However, I was wondering if this could make additional experimental predictions for the system being exceptionally noisy or otherwise behaving in signature ways if one were able to train a real biological network to match a rapidly changing or non-smooth function that does not align with the underlying assumptions of the model.

      (2) The algorithm assumes that one can, to a good approximation, replace individual input rates by their across-synapse average. How sensitive is the learning to this assumption, as one might imagine scenarios where a neuron is sensitive to different inputs for different tasks or contexts so that a grand average might not be correct? Or, the functional number of inputs driving the output might be relatively low or otherwise highly fluctuating and less easily averaged over.

      (3) On the cerebellar example, it is nice that the Bayesian example provides a narrower PF-CF interval for plasticity than the classical rules, but the window is not nearly as narrow as the Suvrathan et al. 2016 paper cited by the authors. Maybe this is something special about that system having well-defined, delayed feedback, but (optional) further comments or insights would be welcome if available.

      (4) In the discussion, I appreciated the comparison with the Deneve work which has fast and slow feedback components. I was curious whether, although non-local, there were also conceptual similarities with FORCE learning in which there is also an immediate correction of activity through fast changing of synaptic weights, which then aids the slow long-term learning of synaptic weights.

    2. Reviewer #2 (Public review):

      Summary:

      Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

      Strengths:

      Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

      Weaknesses:

      The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

    1. Reviewer #1 (Public review):

      The ventral nerve cord (VNC) of organisms like Drosophila is an invaluable model for studying neural development and organisation in more complex organisms. Its well-defined structure allows researchers to investigate how neurons develop, differentiate, and organise into functional circuits. As a critical central nervous system component, the VNC plays a key role in controlling motor functions, reflexes, and sensory integration.

      Particularly relevant to this work, the VNC provides a unique opportunity to explore neuronal hemilineages - groups of neurons that share molecular, genetic, and functional identities. Understanding these hemilineages is crucial for elucidating how neurons cooperate to form specialized circuits, essential for comprehending normal brain function and dysfunction.

      A significant challenge in the field has been the lack of developmentally stable, hemilineage-specific driver lines that enable precise tracking and measurement of individual VNC hemilineages. The authors address this need by generating and validating a comprehensive, lineage-specific split-GAL4 driver library.

      Strengths and weaknesses

      The authors select new marker genes for hemilineages from previously published single-cell data of the VNC. They generate and validate specific and temporally stable lines for almost all the hemilineages in the VNC. They successfully achieved their aims, and their results support their conclusions. This will be a valuable resource for investigating neural circuit formation and function.

    2. Reviewer #2 (Public review):

      It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

    3. Reviewer #3 (Public review):

      Summary:

      Soffers et al. developed a comprehensive genetic toolkit that enables researchers to access neuronal hemilineages during developmental and adult time points using scRNA-seq analysis to guide gene cassette exchange-based or CRISPR-based tool building. Currently, research groups studying neural circuit development are challenged with tying together findings in the development and mature circuit function of hemilineage-related neurons. Here, authors leverage publicly available scRNA-seq datasets to inform the development of a split-Gal4 library that targets 32 of 34 hemilineages in development and adult stages. The authors demonstrated that the split-Gal4 library, or genetic toolkit, can be used to assess the functional roles, neurotransmitter identity, and morphological changes in targeted cells. The tools presented in this study should prove to be incredibly useful to Drosophila neurobiologists seeking to link neural developmental changes to circuit assembly and mature circuit function. Additionally, some hemilineages have more than one split-Gal4 combination that will be advantageous for studies seeking to disrupt associated upstream genes.

      Strengths:

      Informing genetic tool development with publicly available scRNA-seq datasets is a powerful approach to creating specific driver lines. Additionally, this approach can be easily replicated by other researchers looking to generate similar driver lines for more specific subpopulations of cells, as mentioned in the Discussion.

      The unification of optogenetic stimulation data of 8B neurons and connectomic analysis of the Giant-Fiber-induced take-off circuit was an excellent example of the utility of this study. The link between hemilineage-specific functional assays and circuit assembly has been limited by insufficient genetic tools. The tools and data present in this study will help better understand how collections of hemilineages develop in a genetically constrained manner to form circuits amongst each other selectively.

      Weaknesses:

      Although cell position, morphology (to some extent), and gene expression are good markers to track cell identity across developmental time, there are genetic tools available that could have been used to permanently label cells that expressed genes of interest from birth, ensuring that the same cells are being tracked in fixed tissue images.

      Although gene activation is a good proxy for assaying neurochemical features, relying on whether neurochemical pathway genes are activated in a cell to determine its phenotype can be misleading given that the Trojan-Gal4 system commandeers the endogenous transcriptional regulation of a gene but not its post-transcriptional regulation. Therefore, neurochemical identity is best identified via protein detection. (strong language used in this section of the paper).

      The authors mainly rely on the intersectional expression of transcription factors to generate split-Gal4 lines and target hemilineages specifically. However, the Introduction (Lines 97-99) makes a notable point about how driver lines in the past, which have also predominantly relied on the regulatory sequences of transcription factors, lack the temporal stability to investigate hemilineages across time. This point seems to directly conflict with the argument made in the Results (Lines 126-127) that states that most transcription factors are stably expressed in hemilineage neurons that express them. It is generally known that transcription factors can be expressed stably or transiently depending on the context. It is unclear how using the genes of transcription factors in this study circumvents the issue of creating temporally stable driver lines.

    1. Reviewer #1 (Public review):

      Summary:

      The authors introduce ImPaqT, a modular toolkit for zebrafish transgenesis, utilizing the Golden Gate cloning approach with the rare-cutting enzyme PaqCI. The toolkit is designed to streamline the construction of transgenes with broad applications, particularly for immunological studies. By providing a versatile platform, the study aims to address limitations in generating plasmids for zebrafish transgenesis.

      Strengths:

      The ImPaqT toolkit offers a modular method for constructing transgenes tailored to specific research needs. By employing Golden Gate cloning, the system simplifies the assembly process, allowing seamless integration of multiple genetic elements while maintaining scalability for complex designs. The toolkit's utility is evident from its inclusion of a diverse range of promoters, genetic tools, and fluorescent markers, which cater to both immunological and general zebrafish research needs. Furthermore, the modular design ensures expandability, enabling researchers to customize constructs for diverse experimental designs. The validation provided in the manuscript is solid, demonstrating the successful generation of several functional transgenic lines. These examples highlight the toolkit's efficacy, particularly for immune-focused applications.

      Weaknesses:

      While the toolkit's technical capabilities are well-demonstrated, there are several areas where additional validation and examples could enhance its impact. One limitation is the lack of data showing whether the toolkit can be directly used for rapid cloning and testing of enhancers or promoters, particularly cloning them directly from PCR using PaqCI overhangs without needing an entry vector. Similarly, the feasibility of cloning genes directly from PCR products into the system is not demonstrated, which would significantly increase the utility for researchers working with genomic elements.

      The authors discuss potential applications such as using the toolkit for tissue-specific knockout applications by assembling CRISPR/Cas9 gRNA constructs. However, they do not demonstrate the cloning of short fragments, such as gRNA sequences downstream of a U6 promoter, which would be an important proof-of-concept to validate these applications. Furthermore, while the manuscript focuses on macrophage-specific promoters, the widely used mpeg1.1 promoter is not included or tested, which limits the toolkit's appeal for researchers studying macrophages and microglia.

      Another potential limitation is the handling of sequences containing PaqCI recognition sites. Although the authors discuss domestication to remove these sites, a demonstration of cloning strategies for such cases or alternative methods to address these challenges would provide practical guidance for users.

    2. Reviewer #2 (Public review):

      Summary:

      Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

      Strengths:

      The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

      Weaknesses:

      (1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

      (2) There is no statement for the upper limitation of the expandability.

      (3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

    1. Reviewer #1 (Public review):

      Summary:

      Optogenetic tools enable very precise spatiotemporal control of the signaling pathway. The authors developed an optimized light-regulated PKC epsilon, Opto-PKCepsilon using AlphaFold for rational design. Interactome and phosphoproteome studies of light-activated Opto-PKCepsilon confirmed a high similarity of interaction partners to PMA-stimulated wild-type PKCepsilon and high specificity for PKCepsilon substrates. Light-dependent recruitment of Opto-PKCepsilon to the plasma membrane revealed the specific phosphorylation of the insulin receptor at Thr 1160 and recruitment to mitochondria the phosphorylation of the complex I subunit NDUFS4 correlating with reduced spare respiratory capacity, respectively. The interactome and phosphoproteome studies confirm the functionality of Opto-PKCepsilon.

      Strengths:

      AlphaFold simulations enable the design of an optimized Opto-PKCepsilon with respect to dark-light activity. Opto-PKCepsilon is a versatile tool to study the function of PKCepsilon in a precisely controlled manner.

      Weaknesses:

      Light-controlled PCKepsilon was recently reported by Gada et al. (2022). Ong et al. developed an optimized Opto-PKCepsilon and presented in their manuscript the potential of this tool for controlling signaling pathways. However, some data have to be improved and appropriate controls are still missing for some experiments.

      Major comments:

      (1) The group of proteins detected as phosphorylated PKC substrates (phospho-Ser PKC substrate antibody) induced by Opto-PKCepsilon varies significantly between Figure 1 C and Figure 2 C. Have the authors any explanation for this? Do both figures show similar areas of the membrane? The size marker indicates that this is not the case.

      (2) The ratio of endogenous and exogeneous PCKepsilon is quite different in the experiments shown in Figure 1 C and Figure 2 C. What is the reason for this effect?

      (3) In addition to the overall phosphorylation of PKC substrates, the PKCepsilon mutants should be tested for phosphorylation of a known PKCepsilon substrate. The phosphorylation of the insulin receptor at Thr 1160 by Opto-PKCepsilon (see Figure 6) is very convincing and would provide clearer results for comparing the mutants.

      (4) The quality of the fluorescence images shown in Figure 5 is poor and should be improved. In addition, a MitoTracker dye for mitochondria labeling should be included to confirm the mitochondrial localization of Opto-PKCepsilon.

      (5) Figure S6 shows a light experiment in the absence of insulin, as stated in the headline of the figure legend and in the main text. Does this mean that Figure 6B shows an experiment in which the cells were exposed to light in the presence of insulin? If so, this should be mentioned in the legend of the figure and in the main text. What influence does insulin have on IR phosphorylation at Thr 1160?

      (6) The signal of NDUSF4 phosphorylation induced by Opto-PKCepsilon is weak in the experiment shown in Figure 7E. What about the effect of shorter and longer exposure times? How many times was this experiment repeated?

    2. Reviewer #2 (Public review):

      Summary:

      The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

      Strengths:

      (1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

      (2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

      (3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

      Weaknesses:

      (1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

      (2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

      (3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

    1. Reviewer #1 (Public review):

      Summary:

      The authors present results and analysis of an experiment studying the genetic architecture of phenology in two geographically and genetically distinct populations of switchgrass when grown in 8 common gardens spanning a wide range of latitudes. They focused primarily on two measures of phenology - the green-up date in the spring, and the date of flowering. They observed generally positive correlations of flowering date across the latitudinal gradient, but negative correlations between northern and southern (i.e. Texas) green-up dates. They use GWAS and multivariate meta-analysis methods to identify and study candidate genetic loci controlling these traits and how their effect sizes vary across these gardens. They conclude that much of the genetic architecture is garden-specific, but find some evidence for photoperiod and rainfall effects on the locus effect sizes.

      Strengths:

      The strengths of the study are in the large scale and quality of the field trials, the observation of negative correlations among genotypes across the latitudinal gradient, and the importance of the central questions: Can we predict how genetic architecture will change when populations are moved to new environments? Can we breed for more/less sensitivity to environmental cues?

      Weaknesses:

      I have tried hard to understand the concept of the GxWeather analysis presented here, but still do not see how it tests for interactions between weather and genetic effects on phenology. I may just not understand it correctly, but if so, then I think more clarity in the logical model would help - maybe a figure explaining how this approach can detect genotype-weather interactions. Also, since this is a proposal for a new approach to detecting gene-environment effects, simulations would be useful to show power and false positive rates, or other ways of validating the results. The QTL validation provided is not very convincing because the same trials and the same ways of calculating weather values are used again, so it's not really independent validation, plus the QTL intervals are so large overlap between QTL and GWAS is not very strong evidence.

      The term "GxWeather" is never directly defined, but based on its pairing with "GxE" on page 5, I assumed it means an interaction between genotypes (either plant lines or genotypes at SNPs) and weather variables, such that different genotypes alter phenology differently as a response to a specific change in weather. For example, some genotypes might initiate green-up once daylengths reach 12 hours, but others require 14 hours. Alternatively (equivalently), an SNP might have an effect on greenup at 12 hours (among plants that are otherwise physiologically ready to trigger greenup on March 21, only those with a genotype trigger), while no effect on greenup with daylengths of 14 hours (e.g., if plants aren't physiologically ready to greenup until June when daylengths are beyond 14 hours, both aa and AA genotypes will greenup at the same time, assuming this locus doesn't affect physiological maturity).

      Either way, GxE and (I assume) GxWeather are typically tested in one of two ways. Either genotype effects are compared among environments (which differ in their mean value for weather variables) and GxWeather would be inferred if environments with similar weather have similar genotype effects. Or a model is fit with an environmental (maybe weather?) variable as a covariate and the genotype:environment interaction is measured as a change of slope between genotypes. Basically, the former uses effect size estimates across environments that differ in mean for weather, while the latter uses variation in weather within an experiment to find GxWeather effects.

      However, the analytical approach here seems to combine these in a non-intuitive way and I don't think it can discover the desired patterns. As I understand from the methods, weather-related variables are first extracted for each genotype in each trial based on their green-up or flowering date, so within each trial each genotype "sees" a different value for this weather variable. For example, "daylength 14 days before green-up" is used as a weather variable. The correlation between these extracted genotype-specific weather variables across the 8 trials is then measured and used as a candidate mixture component for the among-trial covariance in mash. The weight assigned to these weather-related covariance matrices is then interpreted as evidence of genotype-by-weather interactions. However, the correlation among genotypes between these weather variables does not measure the similarity in the weather itself across trials. Daylengths at green-up are very different in MO than SD, but the correlation in this variable among genotypes is high. Basically, the correlation/covariance statistic is mean-centered in each trial, so it loses information about the mean differences among trials. Instead, the covariance statistic focuses on the within-trial variation in weather. But the SNP effects are not estimated using this within-trial variation, they're main effects of the SNP averaged over the within-trial weather variation. Thus it is not clear to me that the interpretation of these mash weights is valid. I could see mash used to compare GxWeather effects modeled in each trial (using the 2nd GxE approach above), but that would be a different analysis. As is, mash is used to compare SNP main effects across trials, so it seems to me this comparison should be based on the average weather differences among trials.

      A further issue with this analysis is that the weather variables don't take into account the sequence of weather events. If one genotype flowers after the 1st rain event and the second flowers after the 2nd rain event, they can get the same value for the cumulative rainfall 7d variable, but the lack of response after the 1st rain event is the key diagnostic for GxWeather. There's also the issue of circularity. Since weather values are defined based on observed phenology dates, they're effectively caused by the phenology dates. So then asking if they are associated with phenology is a bit circular. Also, it takes a couple of weeks after flowering is triggered developmentally before flowers open, so the < 2-week lags don't really make developmental sense.

      Thus, I don't think this sentence in the abstract is a valid interpretation of the analysis: "in the Gulf subpopulation, 65% of genetic effects on the timing of vegetative growth covary with day length 14 days prior to green-up date, and 33% of genetic effects on the timing of flowering covary with cumulative rainfall in the week prior to flowering". There's nothing in this analysis that compares the genetic effects under 12h days to genetic effects under 14h days (as an example), or genetic effects with no rainfall prior to flowering to genetic effects with high rainfall prior to flowering. I think the only valid conclusion is: "65% of SNPs for green-up have a GxE pattern that mirrors the similarity in relationships between green-up and day length among trials." However I don't know how to interpret that statement in terms of the overall goals of the paper.

      Next, I am confused about the framing in the abstract and the introduction of the GxE within and between subpopulations. The statement: "the key expectation that different genetic subpopulations, and even different genomic regions, have likely evolved distinct patterns of GxE" needs justification or clarification. The response to an environmental factor (ie plasticity) is a trait that can evolve between populations. This happens through the changing frequencies of alleles that cause different responses. But this doesn't necessarily mean that patterns of GxE are changing. GxE is the variance in plasticity. When traits are polygenic, population means can change a lot with little change in variance within each population. Most local adaptation literature is focused on changes in mean trait values or mean plasticities between populations, not changes in the variance of trait values or plasticities within populations. Focusing on the goal of this paper, differences in environmental or weather responses between the populations are interesting (Figure 1). However the comparisons of GxE between populations and with the combined population are hard to interpret. GxE within a population means that that population is not fixed for this component of plasticity, meaning that it likely hasn't been strongly locally selected. Doesn't this mean that in the context of comparing the two populations, loci with GxE within populations are less interesting than loci fixed for different values between populations? Also, if there is GxE in the Gulf population, by definition it is also present in the "Both" population. Not finding it there is just a power issue. If individuals in the two subpopulations never cross, the variance across the "Both" population isn't relevant in nature, it's an artificial construct of this experimental design. I wonder if there is confusion about the term "genetic" in GxE and as used in the first paragraph of the intro ("Genetic responses" and "Genetic sensitivity"). These sentences would be most clear if the "genetic" term referred to the mechanistic actions of gene products. But the rest of the paper is about genetic variation, ie the different effects of different alleles at a locus. I don't think this latter definition is what these first uses intend, which is confusing.

      Note that the cited paper (26) is not relevant to this discussion about GxE patterns. This paper discusses the precision of estimating sub-group-specific genetic effects. With respect to the current paper, reference 26 shows that you might get more accurate measures of the SNP effects in the Gulf population using the full "Both" population dataset because i) the sample size is larger, and ii) as long as the true effects are not that different between populations. That paper is not focused on whether effect size variation is caused by evolution but on the technical question of whether GxG or GxE impacts the precision of within-group effect size estimates. The implication of paper 26 is that comparing SNP effects estimated in the "Both" population among gardens might be more powerful for detecting GxE than using only Gulf samples, even if there is some difference in SNP effects among populations. But if there magnitudes (or directions) of SNP effects change a lot among populations (ie not just changes in allele frequency), then modeling the populations separately will be more accurate.

    2. Reviewer #2 (Public review):

      The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

      Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

      (1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

      (2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

      (3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

      (4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

      (5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

      To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

    1. Reviewer #1 (Public review):

      Summary

      This work performed Raman spectral microscopy at the single-cell level for 15 different culture conditions in E. coli. The Raman signature is systematically analyzed and compared with the proteome dataset of the same culture conditions. With a linear model, the authors revealed correspondence between Raman pattern and proteome expression stoichiometry indicating that spectrometry could be used for inferring proteome composition in the future. With both Raman spectra and proteome datasets, the authors categorized co-expressed genes and illustrated how proteome stoichiometry is regulated among different culture conditions. Co-expressed gene clusters were investigated and identified as homeostasis core, carbon-source dependent, and stationary phase-dependent genes. Overall, the authors demonstrate a strong and solid data analysis scheme for the joint analysis of Raman and proteome datasets.

      Strengths and major contributions

      (1) Experimentally, the authors contributed Raman datasets of E. coli with various growth conditions.

      (2) In data analysis, the authors developed a scheme to compare proteome and Ramen datasets. Protein co-expression clusters were identified, and their biological meaning was investigated.

      Weaknesses

      The experimental measurements of Ramen microscopy were conducted at the single-cell level; however, the analysis was performed by averaging across the cells. The author did not discuss if Ramen microscopy can used to detect cell-to-cell variability under the same condition.

      Discussion and impact on the field

      Ramen signature contains both proteomic and metabolomic information and is an orthogonal method to infer the composition of biomolecules. It has the advantage that single-cell level data could be acquired and both in vivo and in vitro data can be compared. This work is a strong initiative for introducing the powerful technique to systems biology and providing a rigorous pipeline for future data analysis.

    2. Reviewer #2 (Public review):

      Summary and strengths:

      Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

      They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

      Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

      Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

      Strengths:

      The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

      Weaknesses:

      Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

    1. Reviewer #1 (Public review):

      Summary:

      This work shows that a specific adenosine deaminase protein in Dictyostelium generates the ammonia that is required for tip formation during Dictyostelium development. Cells with an insertion in the ADGF gene aggregate but do not form tips. A remarkable result, shown in several different ways, is that the ADGF mutant can be rescued by exposing the mutant to ammonia gas. The authors also describe other phenotypes of the ADGF mutant such as increased mound size, altered cAMP signaling, and abnormal cell type differentiation. It appears that the ADGF mutant has defects in the expression of a large number of genes, resulting in not only the tip defect but also the mound size, cAMP signaling, and differentiation phenotypes.

      Strengths:

      The data and statistics are excellent.

      Weaknesses:

      The key weakness is understanding why the cells bother to use a diffusible gas like ammonia as a signal to form a tip and continue development. The rescue of the mutant by adding ammonia gas to the entire culture indicates that ammonia conveys no positional information within the mound. By the time the cells have formed a mound, the cells have been starving for several hours, and desperately need to form a fruiting body to disperse some of themselves as spores, and thus need to form a tip no matter what. One can envision that the local ammonia concentration is possibly informing the mound that some minimal number of cells are present (assuming that the ammonia concentration is proportional to the number of cells), but probably even a minuscule fruiting body would be preferable to the cells compared to a mound. This latter idea could be easily explored by examining the fate of the ADGF cells in the mound - do they all form spores? Do some form spores? Or perhaps the ADGF is secreted by only one cell type, and the resulting ammonia tells the mound that for some reason that cell type is not present in the mound, allowing some of the cells to transdifferentiate into the needed cell type. Thus elucidating if all or some cells produce ADGF would greatly strengthen this puzzling story.

    2. Reviewer #2 (Public review):

      Summary:

      The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

      Strengths:

      The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

      Weaknesses:

      Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

    1. Joint Public Review:

      Summary:

      In this manuscript, the authors investigate how different domains of the presynaptic protein UNC-13 regulate synaptic vesicle release in the nematode C. elegans. By generating numerous point mutations and domain deletions, they propose that two membrane-binding domains (C1 and C2B) can exhibit "mutual inhibition," enabling either domain to enhance or restrain transmission depending on its conformation. The authors also explore additional N-terminal regions, suggesting that these domains may modulate both miniature and evoked synaptic responses. From their electrophysiological data, they present a "functional switch" model in which UNC-13 potentially toggles between a basal state and a gain-of-function state, though the physiological basis for this switch remains partly speculative.

      Strengths:

      (1) The authors conduct a thorough exploration of how mutations in the C1, C2B, and other regulatory domains affect synaptic transmission. This includes single, double, and triple mutations, as well as domain truncations, yielding a large, informative dataset.

      (2) The study includes systematically measure both spontaneous and evoked synaptic currents at neuromuscular junctions, under various experimental conditions (e.g., different Ca²⁺ levels), which strengthens the reliability of their functional conclusions.

      (3) Findings that different domain disruptions produce distinct effects on mEPSCs, mIPSCs, and evoked EPSCs suggest UNC-13 may adopt an elevated functional state to regulate synaptic transmission.

    1. Reviewer #2 (Public review):

      The authors have constructively responded to previous referee comments and I believe that the manuscript is a useful addition to the literature. I particularly appreciate the quantitative approach to social behavior, but have two cautionary comments.

      (1) Conceptually it is important to further justify why this particular maximum entropy model is appropriate. Maximum entropy models have been applied across a dizzying array of biological systems, including genes, neurons, the immune system, as well as animal behavior, so would seem quite beneficial to explain the particular benefits here, for mouse social behavior as coarse-grained through the eco-hab chamber occupancy. This would be an excellent chance to amplify what the models can offer for biological understanding, particularly in the realm of social behavior

      (2) Maximum entropy models of even intermediate size systems involve a large number of parameters. The authors are transparent about that limitation here, but I still worry that the conclusion of the sufficiency of pairwise interactions is simply not general, and this may also relate to the differences from previous work. If, as the authors suggest in the discussion, this difference is one of a choice of variables, then that point could be emphasized. The suggestion of a follow up study with a smaller number of mice is excellent.

    2. Reviewer #3 (Public review):

      Summary:

      Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

      Strengths:

      The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

      Weaknesses:

      A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a new model for animal pose estimation. The core feature they highlight is the model's stability compared to existing models in terms of keypoint drift. The authors test this model across a range of new and existing datasets. The authors also test the model with two mice in the same arena. For the single animal datasets the authors show a decrease in sudden jumps in keypoint detection and the number of undetected keypoints compared with DeepLabCut and SLEAP. Overall average accuracy, as measured by root mean squared error, generally shows generally similar but sometimes superior performance to DeepLabCut and better performance compared to SLEAP. The authors confusingly don't quantify the performance of pose estimation in the multi (two) animal case instead focusing on detecting individual identity. This multi-animal model is not compared with the model performance of the multi-animal mode of DeepLabCut or SLEAP.

      Strengths:

      The major strength of the paper is successfully demonstrating a model that is less likely to have incorrect large keypoint jumps compared to existing methods. As noted in the paper, this should lead to easier-to-interpret descriptions of pose and behavior to use in the context of a range of biological experimental workflows.

      Weaknesses:

      There are two main types of weaknesses in this paper. The first is a tendency to make unsubstantiated claims that suggest either model performance that is untested or misrepresents the presented data, or suggest excessively large gaps in current SOTA capabilities. One obvious example is in the abstract when the authors state ADPT "significantly outperforms the existing deep-learning methods, such as DeepLabCut, SLEAP, and DeepPoseKit." All tests in the rest of the paper, however, only discuss performance with DeepLabCut and SLEAP, not DeepPoseKit. At this point, there are many animal pose estimation models so it's fine they didn't compare against DeepPoseKit, but they shouldn't act like they did. Similar odd presentation of results are statements like "Our method exhibited an impressive prediction speed of 90{plus minus}4 frames per second (fps), faster than DeepLabCut (44{plus minus}2 fps) and equivalent to SLEAP (106{plus minus}4 fps)." Why is 90{plus minus}4 fps considered "equivalent to SLEAP (106{plus minus}4 fps)" and not slower? I agree they are similar but they are not the same. The paper's point of view of what is "equivalent" changes when describing how "On the single-fly dataset, ADPT excelled with an average mAP of 92.83%, surpassing both DeepLabCut and SLEAP (Figure 5B)" When one looks at Figure 5B, however, ADPT and DeepLabCut look identical. Beyond this, oddly only ADPT has uncertainty bars (no mention of what uncertainty is being quantified) and in fact, the bars overlap with the values corresponding to SLEAP and DeepPoseKit. In terms of making claims that seem to stretch the gaps in the current state of the field, the paper makes some seemingly odd and uncited statements like "Concerns about the safety of deep learning have largely limited the application of deep learning-based tools in behavioral analysis and slowed down the development of ethology" and "So far, deep learning pose estimation has not achieved the reliability of classical kinematic gait analysis" without specifying which classical gait analysis is being referred to. Certainly, existing tools like DeepLabCut and SLEAP are already widely cited and used for research.

      The other main weakness in the paper is the validation of the multi-animal pose estimation. The core point of the paper is pose estimation and anti-drift performance and yet there is no validation of either of these things relating to multi-animal video. All that is quantified is the ability to track individual identity with a relatively limited dataset of 10 mice IDs with only two in the same arena (and see note about train and validation splits below). While individual tracking is an important task, that literature is not engaged with (i.e. papers like Walter and Couzin, eLife, 2021: https://doi.org/10.7554/eLife.64000) and the results in this paper aren't novel compared to that field's state of the art. On the other hand, while multi-animal pose estimation is also an important problem the paper doesn't engage with those results either. The two methods already used for comparison in the paper, SLEAP and DeepPoseKit, already have multi-animal modes and multi-animal annotated datasets but none of that is tested or engaged with in the paper. The paper notes many existing approaches are two-step methods, but, for practitioners, the difference is not enough to warrant a lack of comparison. The authors state that "The evaluation of our social tracking capability was performed by visualizing the predicted video data (see supplement Videos 3 and 4)." While the authors report success maintaining mouse ID, when one actually watches the key points in the video of the two mice (only a single minute was used for validation) the pose estimation is relatively poor with tails rarely being detected and many pose issues when the mice get close to each other.

      Finally, particularly in the methods section, there were a number of places where what was actually done wasn't clear. For example in describing the network architecture, the authors say "Subsequently, network separately process these features in three branches, compute features at scale of one-fourth, one-eight and one-sixteenth, and generate one-eight scale features using convolution layer or deconvolution layer." Does only the one-eight branch have deconvolution or do the other branches also? Similarly, for the speed test, the authors say "Here we evaluate the inference speed of ADPT. We compared it with DeepLabCut and SLEAP on mouse videos at 1288 x 964 resolution", but in the methods section they say "The image inputs of ADPT were resized to a size that can be trained on the computer. For mouse images, it was reduced to half of the original size." Were different image sizes used for training and validation? Or Did ADPT not use 1288 x 964 resolution images as input which would obviously have major implications for the speed comparison? Similarly, for the individual ID experiments, the authors say "In this experiment, we used videos featuring different identified mice, allocating 80% of the data for model training and the remaining 20% for accuracy validation." Were frames from each video randomly assigned to the training or validation sets? Frames from the same video are very correlated (two frames could be just 1/30th of a second different from each other), and so if training and validation frames are interspersed with each other validation performance doesn't indicate much about performance on more realistic use cases (i.e. using models trained during the first part of an experiment to maintain ids throughout the rest of it.)

      Editors' note: None of the original reviewers responded to our request to re-review the manuscript. The attached assessment statement is the editor's best attempt at assessing the extent to which the authors addressed the outstanding concerns from the previous round of revisions.

    1. Reviewer #1 (Public review):

      Summary:

      This study aims to uncover molecular and structural details underlying the broad substrate specificity of glycosaminoglycan lyases belonging to a specific family (PL35). They determined the crystal structures of two such enzymes, conducted in vitro enzyme activity assays, and a thorough structure-guided mutagenesis campaign to interrogate the role of specific residues. They made progress towards achieving their aims and I appreciate the attempt of the authors to address my initial comments on the paper.

      Impact on the field:

      I expect this work will have limited impact on the field, although it does stand on its own as a solid piece of structure-function analysis.

      Strengths:

      The major strengths of the study were the combination of structure and enzyme activity assays, comprehensive structural analysis, as well as a thorough structure-guided mutagenesis campaign.

      Weaknesses:

      (Before revision) -the authors claim to have done a ICP-MS experiment to show Mn2+ binds to their enzyme, but did not present the data. The authors could have used the anomalous scattering properties of Mn2+ at the synchrotron to determine the presence and location of this cation (i.e. fluorescence spectra, and/or anomalous data collection at the Mn2+ absorption peak).<br /> *comment after revision: I appreciate that the authors included this data now, and it looks fine.

      (Before revision) -the authors have an over-reliance on molecular docking for understanding the position of substrates bound to the enzyme. The docking analysis performed was cursory at best; Autodock Vina is a fine program but more rigorous software could have been chosen, as well we molecular dynamics simulations. As well the authors do not use any substrate/product-bound structures from the broader PL enzyme family to guide the placement of the substrates in the GAGases, and interpret the molecular docking models.<br /> *comment after revision: the authors used another docking program, which is fine, but did not do any MD analysis or comment on why not. Also maybe it is just me but I still do not see a figure explicitly showing an overlay/superposition of the docking results with crystal structures of similar enzymes with similar ligands. The authors do have a statement in this regard but I believe a figure (e.g. an additional panel on S2) would be very helpful to the reader.

      (Before revision)-the conclusion that the structures of GAGase II and VII are most similar to the structures of alginate lyases (Table 2 data), and the authors' reliance on DALI, are both questioned. DALI uses a global alignment algorithm, which when used for multi-domain enzymes such as these tends to result in sub-optimal alignment of active site residues, particularly if the active site is formed between the two domains as is the case here. The authors should evaluate local alignment methods focused on optimization of the superposition of a single domain; these methods may result in a more appropriate alignment of the active site residues, and different alignment statistics. This may influence the overall conclusion of the evolutionary history of these PL35 enzymes.<br /> *comment after revision: I'm not sure the authors understood my suggestion as the reply reiterates the original conclusions. I suggest local structural alignment of *only* the toroid and antiparallel β-sheet domains, not global alignment of both domains, as this would improve the accuracy of the structural similarity conclusions.

      (Before revision)-the data on the GAGase III residue His188 is not well interpreted; substitution of this residue clearly impacts HA and HS hydrolysis as well. The data on the impact on alginate hydrolysis is weak, which could be due to the fact that the WT enzyme has poor activity against alginate to start with.<br /> *comment after revision: I appreciate that the authors used higher amounts of H188A variants and still do not see activity on alginate, which strengthens the conclusions regarding this substrate. However this variant also has decreased activity against HS (Figure 5C) and thus H188 appears to be important for more substrates than just alginate. The discussion section should be updated accordingly.

      (Before revision)-the authors did not use the words "homology", "homologous", or "homolog" correctly (these terms mean the subjects have a known evolutionary relationship, which may or may not be known in the contexts the authors used these targets); the words "similarity" and "similar" are recommended to be used instead.<br /> *comment after revision: I thank the authors for addressing this.

      (Before revision)-the authors discuss a "shorter" cavity in GAGases, which does not make sense, and is not supported by any figure or analysis. I recommend a figure with a surface representation of the various enzymes of interest, with dimensions of the cavity labeled (as a supplemental figure). The authors also do not specifically define what subsites are in the context of this family of enzymes, nor do they specifically label or indicate the location of the subsites on the figures of the GAGase II and IV enzyme structures.<br /> *comment after revision: I thank the authors for improving their figures and text description on this point.

    2. Reviewer #3 (Public review):

      Summary:

      The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

      Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

      Strengths:

      The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

      Weaknesses:

      The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript under review investigates the role of periosteal stem cells (P-SSC) in bone marrow regeneration using a whole bone subcutaneous transplantation model. While the model is somewhat artificial, the findings were interesting, suggesting the migration of periosteal stem cells into the bone marrow and their potential to become bone marrow stromal cells. This indicates a significant plasticity of P-SSC consistent with previous reports using fracture models (Cell Stem Cell 29:1547, Dev Cell 59:1192).

      Major comments from previous round of review:

      (1) The authors assert that the periosteal layer was completely removed in their model, which is crucial for their conclusions. To substantiate this claim, it is recommended that the authors provide evidence of the successful removal of the entire periosteal stem cell (P-SSC) population. A colony-forming assay, with and without periosteal removal, could serve as a suitable method to demonstrate this.

      (2) The observation that P-SSCs do not express Kitl or Cxcl12, while their bone marrow stromal cell (BM-MSC) derivatives do, is a key finding. To strengthen this conclusion, the authors are encouraged to repeat the experiment using Cxcl12 or Scf reporter alleles. Immunofluorescence staining that confirms the migration of periosteal cells and their transformation into Cxcl12- or Scf-reporter-positive cells would significantly enhance the paper's key conclusion.

      (3) On page 8, line 20, the authors' statement regarding the detection of Periostin+ cells outside the periosteum layer could be misinterpreted due to the use of the periostin antibody. Given that periostin is an extracellular matrix protein, the staining may not accurately represent Periostin-expressing cells but rather the presence of periostin in the extracellular matrix. The authors should revise this section for greater precision.

      Comments on revised version:

      My comments from the previous round of review have mostly been addressed.

    2. Reviewer #2 (Public review):

      Summary:

      The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

      Strengths:

      These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

      Weaknesses:

      There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

      Comments on the current version: The authors have addressed my concerns adequately

    1. Reviewer #1 (Public review):

      In this study, Tiang et al. explore the role of ubiquitination of non-structural protein 16 (nsp16) in the SARS-CoV-2 life cycle. nsp16, in conjunction with nsp10, performs the final step of viral mRNA capping through its 2'-O-methylase activity. This modification allows the virus to evade host immune responses and protects its mRNA from degradation. The authors demonstrate that nsp16 undergoes ubiquitination and subsequent degradation by the host E3 ubiquitin ligases UBR5 and MARCHF7 via the ubiquitin-proteasome system (UPS). Specifically, UBR5 and MARCHF7 mediate nsp16 degradation through K48- and K27-linked ubiquitination, respectively. Notably, degradation of nsp16 by either UBR5 or MARCHF7 operates independently, with both mechanisms effectively inhibiting SARS-CoV-2 replication in vitro and in vivo. Furthermore, UBR5 and MARCHF7 exhibit broad-spectrum antiviral activity by targeting nsp16 variants from various SARS-CoV-2 strains. This research advances our understanding of how nsp16 ubiquitination impacts viral replication and highlights potential targets for developing broadly effective antiviral therapies.

      Strengths:

      The proposed study is of significant interest to the virology community because it aims to elucidate the biological role of ubiquitination in coronavirus proteins and its impact on the viral life cycle. Understanding these mechanisms will address broadly applicable questions about coronavirus biology and enhance our overall knowledge of ubiquitination's diverse functions in cell biology. Employing in vivo studies is a strength.

      Weaknesses:

      Minor comments:<br /> Figure 5A- The authors should ensure that the figure is properly labeled to clearly distinguish between the IP (Immunoprecipitation) panel and the input panel.

    2. Reviewer #3 (Public review):

      Summary:

      The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

      Strengths:

      The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

      Comments on revisions:

      I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

    1. Reviewer #1 (Public review):

      Summary:

      The authors investigated causal inference in the visual domain through a set of carefully designed experiments, and sound statistical analysis. They suggest the early visual system has a crucial contribution to computations supporting causal inference.

      Strengths:

      (1) I believe the authors target an important problem (causal inference) with carefully chosen tools and methods. Their analysis rightly implies the specialization of visual routines for causal inference and the crucial contribution of early visual systems to perform this computation. I believe this is a novel contribution and their data and analysis are in the right direction.<br /> (2) Authors sufficiently discuss the alternative perspective to causal inference.<br /> (3) The authors also expand the discussions beyond pure psychophysics and also include neural aspects.

      Weaknesses:

      I would not call them weaknesses, perhaps a different perspective:

      (1) Authors arguing pro a mere bottom-up contribution of early sensory areas for causal inference. Certainly, as the authors suggested, early sensory areas have a crucial contribution, and the authors expand it to other possibilities in their discussion (but more for more complex scenario). It would say, even in simple cases, we can still consider the effect of top down processes. This particularly makes sense in light of recent studies. These studies progressively suggest perception as an active process that also weighs in strongly, the top-down cognitive contributions. For instance, the most simple cases of perception have been conceptualized along this line (Martin, Solms, and Sterzer 2021) and even some visual illusions (Safavi and Dayan 2022), and other extensions (Kay et al. 2023). Thus, I believe it would be helpful to extend the discussion on the top-down and cognitive contributions of causal inference (of course that can also be hinted at, based on recent developments). Even adaptation, which is central in this study, can be influenced by top-down factors (Keller et al. 2017).

      Lastly, I hope the authors find this review helpful. I generally want to try to end all of my reviews with areas of the paper I liked because I think this should be part of the feedback. Certainly, there were many in this manuscript as well (clever questions, experimental design and statistical analysis) that I had to highlight further. I congratulate the authors again on their manuscript and hope they will find it helpful.

      Bibliography

      Aller, Mate, and Uta Noppeney. 2018. "To Integrate or Not to Integrate: Temporal Dynamics of Bayesian Causal Inference." Biorxiv, December, 504118. .

      Cao, Yinan, Christopher Summerfield, Hame Park, Bruno Lucio Giordano, and Christoph Kayser. 2019. "Causal Inference in the Multisensory Brain." Neuron 102 (5): 1076-87.e8. .

      Coen, Philip, Timothy P. H. Sit, Miles J. Wells, Matteo Carandini, and Kenneth D. Harris. 2021. "The Role of Frontal Cortex in Multisensory Decisions." Biorxiv, April. Cold Spring Harbor Laboratory, 2021.04.26.441250. .

      Kay, Kendrick, Kathryn Bonnen, Rachel N. Denison, Mike J. Arcaro, and David L. Barack. 2023. "Tasks and Their Role in Visual Neuroscience." Neuron 111 (11). Elsevier: 1697-1713. .

      Keller, Andreas J, Rachael Houlton, Björn M Kampa, Nicholas A Lesica, Thomas D Mrsic-Flogel, Georg B Keller, and Fritjof Helmchen. 2017. "Stimulus Relevance Modulates Contrast Adaptation in Visual Cortex." Elife 6. eLife Sciences Publications, Ltd: e21589.

      Kording, K. P., U. Beierholm, W. J. Ma, S. Quartz, J. B. Tenenbaum, and L. Shams. 2007. "Causal Inference in Multisensory Perception." PloS One 2: e943. .

      Martin, Joshua M., Mark Solms, and Philipp Sterzer. 2021. "Useful Misrepresentation: Perception as Embodied Proactive Inference." Trends Neurosci. 44 (8): 619-28. .

      Safavi, Shervin, and Peter Dayan. 2022. "Multistability, Perceptual Value, and Internal Foraging." Neuron, August. .

      Shams, L. 2012. "Early Integration and Bayesian Causal Inference in Multisensory Perception." In The Neural Bases of Multisensory Processes, edited by M. M. Murray and M. T. Wallace. Frontiers in Neuroscience. Boca Raton (FL).

      Shams, Ladan, and Ulrik Beierholm. 2022. "Bayesian Causal Inference: A Unifying Neuroscience Theory." Neuroscience & Biobehavioral Reviews 137 (June): 104619.

    2. Reviewer #2 (Public review):

      This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

      The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

      The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

      The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

      The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

      The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

      One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

      In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

      Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

      Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

      Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

    3. Reviewer #3 (Public review):

      Summary:

      This paper presents evidence from three behavioral experiments that causal impressions of "launching events", in which one object is perceived to cause another object to move, depend on motion direction-selective processing. Specifically, the work uses an adaptation paradigm (Rolfs et al., 2013), presenting repetitive patterns of events matching certain features to a single retinal location, then measuring subsequent perceptual reports of a test display in which the degree of overlap between two discs was varied, and participants could respond "launch" or "pass". The three experiments report results of adapting to motion direction, motion speed and "object identity", and examine how the psychometric curves for causal reports shift in these conditions depending on the similarity of adapter and test. While causality reports in the test display were selective for motion direction (Experiment 1), they were not selective for adapter-test speed differences (Experiment 2) nor for changes in object identity induced via color swap (Experiment 3). These results support the notion of a biological implementation of causality perception in the visual system, possibly even independently of computations of object identity.

      Strengths:

      The setup of the research question and hypotheses are exceptional. The authors thoroughly discuss relevant literature to clearly link their launch/pass paradigm to impressions of causality, strengthening their hypothesis and conclusions. The experiments are carefully performed (appropriate equipment, careful control of eye movements). The slip adaptor is a really nice control condition and effectively mitigates the need to control for motion direction with a drifting grating or similar. Participants were measured with sufficient precision, and a power curve analysis was conducted to determine the sample size. Data analysis and statistical quantification is appropriate. Data and analysis code will be shared on publication, in keeping with open science principles. The paper is concise and well written.

      Weaknesses:

      I would like to emphasise that in the employed paradigm and previously conducted similar study, the only report options are "launch" or "pass". As pointed out by the authors' reply, the adaptation to launches seems to be a highly specific process and likely is a consequence of the causal interaction between the objects. I would nonetheless be interested to see which of the stimulus features driving the adaptation effect observed here are relevant/irrelevant to subjective causal impressions in an experiment.

      References:

      Rolfs, M., Dambacher, M., & Cavanagh, P. (2013). Visual Adaptation of the Perception of Causality. Current Biology, 23(3), 250-254. https://doi.org/10.1016/j.cub.2012.12.017

    1. Reviewer #1 (Public review):

      Summary:

      Machii et al. reported a possible molecular mechanism underlying the parallel evolution of lip hypertrophy in African cichlids. The multifaceted approach taken in this manuscript is highly valued, as it uses histology, proteomics, and transcriptomics to reveal how phylogenetically distinct thick-lips have evolved in parallel. Findings from histology and proteomics connected to wnt signaling through the transcriptome are very exciting.

      Strengths:

      There is consistency between the results and it is possible to make a strong argument from the results.

      Comments on revised version:

      The issues I pointed out in the previous review have been carefully answered, and all issues have been addressed. The main points of the manuscript are clear, and the conclusions are easy to understand. The enlarged lips are a notable example of convergent evolution in African cichlids.

    1. Reviewer #1 (Public review):

      Summary:

      The manuscript focuses on the olfactory system of Pieris brassicae larvae and the importance of olfactory information in their interactions with the host plant Brassica oleracea and the major parasitic wasp Cotesia glomerata. The authors used CRISPR/Cas9 to knockout odorant receptor co-receptors (Orco), and conducted a comparative study on the behavior and olfactory system of the mutant and wild-type larvae. The study found that Orco-expressing olfactory sensory neurons in antennae and maxillary palps of Orco knockout (KO) larvae disappeared, and the number of glomeruli in the brain decreased, which impairs the olfactory detection and primary processing in the brain. Orco KO caterpillars show weight loss and loss of preference for optimal food plants; KO larvae also lost weight when attacked by parasitoids with the ovipositor removed, and mortality increased when attacked by untreated parasitoids. On this basis, the authors further studied the responses of caterpillars to volatiles from plants attacked by the larvae of the same species and volatiles from plants on which the caterpillars were themselves attacked by parasitic wasps. Lack of OR-mediated olfactory inputs prevents caterpillars from finding suitable food sources and from choosing spaces free of enemies.

      Strengths:

      The findings help to understand the important role of olfaction in caterpillar feeding and predator avoidance, highlighting the importance of odorant receptor genes in shaping ecological interactions.

      Weaknesses:

      There are the following major concerns:

      (1) Possible non-targeted effects of Orco knockout using CRISPR/Cas9 should be analyzed and evaluated in Materials and Methods and Results.

      (2) Figure 1E: Only one olfactory receptor neuron was marked in WT. There are at least three olfactory sensilla at the top of the maxillary palp. Therefore, to explain the loss of Orco-expressing neurons in the mutant (Figure 1F), a more rigorous explanation of the photo is required.

      (3) In Figure 1G, H, the four glomeruli are circled by dotted lines: their corresponding relationship between the two figures needs to be further clarified.

      (4) Line 130: Since the main topic in this study is the olfactory system of larvae, the experimental results of this part are all about antennal electrophysiological responses, mating frequency, and egg production of female and male adults of wild type and Orco KO mutant, it may be considered to include this part in the supplementary files. It is better to include some data about the olfactory responses of larvae.

      (5) Line 166: The sentences in the text are about the choice test between " healthy plant vs. infested plant", while in Fig 3C, it is "infested plant vs. no plant". The content in the text does not match the figure.

      (6) Lines 174-178: Figure 3A showed that the body weight of Orco KO larvae in the absence of parasitic wasps also decreased compared with that of WT. Therefore, in the experiments of Figure 3A and E, the difference in the body weight of Orco KO larvae in the presence or absence of parasitic wasps without ovipositors should also be compared. The current data cannot determine the reduced weight of KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (7) Lines 179-181: Figure 3F shows that the survival rate of larvae of Orco KO mutant decreased in the presence of parasitic wasps, and the difference in survival rate of larvae of WT and Orco KO mutant in the absence of parasitic wasps should also be compared. The current data cannot determine whether the reduced survival of the KO mutant is due to the Orco knockout or the presence of parasitic wasps.

      (8) In Figure 4B, why do the compounds tested have no volatiles derived from plants? Cruciferous plants have the well-known mustard bomb. In the behavioral experiments, the larvae responses to ITC compounds were not included, which is suggested to be explained in the discussion section.

      (9) The custom-made setup and the relevant behavioral experiments in Figure 4C need to be described in detail (Line 545).

      (10) Materials and Methods Line 448: 10 μL paraffin oil should be used for negative control.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #1 (Public review):

      The study introduces an open-source, cost-effective method for automating the quantification of male social behaviors in Drosophila melanogaster. It combines machine-learning-based behavioral classifiers developed using JAABA (Janelia Automatic Animal Behavior Annotator) with inexpensive hardware constructed from off-the-shelf components. This approach addresses the limitations of existing methods, which often require expensive hardware and specialized setups. The authors demonstrate that their new "DANCE" classifiers accurately identify aggression (lunges) and courtship behaviors (wing extension, following, circling, attempted copulation, and copulation), closely matching manually annotated ground-truth data. Furthermore, DANCE classifiers outperform existing rule-based methods in accuracy. Finally, the study shows that DANCE classifiers perform as well when used with low-cost experimental hardware as with standard experimental setups across multiple paradigms, including RNAi knockdown of the neuropeptide Dsk and optogenetic silencing of dopaminergic neurons.

      The authors make creative use of existing resources and technology to develop an inexpensive, flexible, and robust experimental tool for the quantitative analysis of Drosophila behavior. A key strength of this work is the thorough benchmarking of both the behavioral classifiers and the experimental hardware against existing methods. In particular, the direct comparison of their low-cost experimental system with established systems across different experimental paradigms is compelling. While JAABA-based classifiers have been previously used to analyze aggression and courtship (Tao et al., J. Neurosci., 2024; Sten et al., Cell, 2023; Chiu et al., Cell, 2021; Isshi et al., eLife, 2020; Duistermars et al., Neuron, 2018), the demonstration that they work as well without expensive experimental hardware opens the door to more low-cost systems for quantitative behavior analysis.

      Although the study provides a detailed evaluation of DANCE classifier performance, its conclusions would be strengthened by a more comprehensive analysis. The authors assess classifier accuracy using a bout-level comparison rather than a frame-level analysis, as employed in previous studies (Kabra et al., Nat Methods, 2013). They define a true positive as any instance where a DANCE-detected bout overlaps with a manually annotated ground-truth bout by at least one frame. This criterion may inflate true positive rates and underestimate false positives, particularly for longer-duration courtship behaviors. For example, a 15-second DANCE-classified wing extension bout that overlaps with ground truth for only one frame would still be considered a true positive. A frame-level analysis performance would help address this possibility.

      In summary, this work provides a practical and accessible approach to quantifying Drosophila behavior, reducing the economic barriers to the study of the neural and molecular mechanisms underlying social behavior.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    3. Reviewer #3 (Public review):

      The preprint by Yadav et al. describes a new setup to quantify a number of aggression and mating behaviors in Drosophila melanogaster. The investigation of these behaviors requires the analysis of a large number of videos to identify each kind of behavior displayed by a fly. Several approaches to automatize this process have been published before, but each of them has its limitations. The authors set out to develop a new setup that includes very low-cost, easy-to-acquire hardware and open-source machine-learning classifiers to identify and quantify the behavior.

      Strengths:

      (1) The study demonstrates that their cheap, simple, and easy-to-obtain hardware works just as well as custom-made, specialized hardware for analyzing aggression and mating behavior. This enables the setup to be used in a wide range of settings, from research with limited resources to classroom teaching.

      (2) The authors used previously published software to train new classifiers for detecting a range of behaviors related to aggression and mating and to make them freely available. The classifiers are very positively benchmarked against a manually acquired ground truth as well as existing algorithms.

      (3) The study demonstrates the applicability of the setup (hardware and classifiers) to common methods in the field by confirming a number of expected phenotypes with their setup.

      Weaknesses:

      (1) When measuring the performance of the duration-based classifiers, the authors count any bout of behavior as true positive if it overlaps with a ground-truth positive for only 1 frame - despite the minimal duration of a bout is 10 frames, and most bouts are much longer. That way, true positives could contain cases that are almost totally wrong as long there was an overlap of a single frame. For the mating behaviors that are classified in ongoing bouts, I think performance should be evaluated based on the % of correctly classified frames, not bouts.

      (2) In the methods part, only one of the pre-existing algorithms (MateBook), is described. Given that the comparison with those algorithms is a so central part of the manuscript, each of them should be briefly explained and the settings used in this study should be described.

      Taken together, this work can greatly facilitate research on aggression and mating in Drosophila. The combination of low-cost, off-the-shelf hardware and open-source, robust software enables researchers with very little funding or technical expertise to contribute to the scientific process and also allows large-scale experiments, for example in classroom teaching with many students, or for systematic screenings.

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    2. Reviewer #1 (Public Review):

      Summary:

      In this manuscript, Quach et al. report a detailed investigation into the defense mechanisms of Caenorhabditis elegans in response to predatory threats from Pristionchus pacificus. Based on principles from predatory imminence and prey refuge theories, the authors delineate three defense modes (pre-encounter, post-encounter, and circa-strike) corresponding to increasing levels of threat proximity. These modes are observed in a controlled but naturalistic setup and are quantified by multiple behavioral outputs defined in time and/or space domains allowing nuanced phenotypic assays. The authors demonstrate that C. elegans displays graded defense behavioral responses toward varied lethality of threats and that only life-threatening predators trigger all three defense modes. The study also offers a narrative on the behavioral strategies and underlying molecular regulation, focusing on the roles of SEB-3 receptors and NLP-49 peptides in mediating responses in these defense modes. They found that the interplay between SEB-3 and NLP-49 peptides appears complex, as evidenced by the diverse outcomes when either or both genes are manipulated in various behavioral modes.

      Strengths:

      The paper presents an interesting story, with carefully designed experiments and necessary controls, and novel findings and implications about predator-induced defensive behaviors and underlying molecular regulation in this important model organism. The design of experiments and description of findings are easy to follow and well-motivated. The findings contribute to our understanding of stress response systems and offer broader implications for neuroethological studies across species.

      Weaknesses:

      Although overall the study is well designed and movitated, the paper could benefit from further improvements on some of the methods descriptions and experiment interpretations.

    1. Reviewer #1 (Public review):

      Summary:

      This paper describes molecular dynamics simulations (MDS) of the dynamics of two T-cell receptors (TCRs) bound to the same major histocompatibility complex molecule loaded with the same peptide (pMHC). The two TCRs (A6 and B7) bind to the pMHC with similar affinity and kinetics, but employ different residue contacts. The main purpose of the study is to quantify via MDS the differences in the inter- and intra-molecular motions of these complexes, with a specific focus on what the authors describe as catch-bond behavior between the TCRs and pMHC, which could explain how T-cells can discriminate between different peptides in the presence of weak separating force.

      Strengths:

      The authors present extensive simulation data that indicates that, in both complexes, the number of high-occupancy inter-domain contacts initially increases with applied load, which is generally consistent with the authors' conclusion that both complexes exhibit catch-bond behavior, although to different extents. In this way, the paper expands our understanding of peptide discrimination by T-cells. The conclusions of the study are generally well supported by data. Further, the paper makes predictions about the relative strength of the catch-bond response of the two TCRs, which could be tested experimentally through protein mutagenesis and force application in Atomic Force Microscopy.

    2. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    3. Reviewer #3 (Public review):

      Summary:

      The paper by Chang-Gonzalez et al. is a molecular dynamics (MD) simulation study of the dynamic recognition (load-induced catch bond) by the T cell receptor (TCR) of the complex of peptide antigen (p) and the major histocompatibility complex (pMHC) protein. The methods and simulation protocols are essentially identical as those employed in a previous study by the same group (Chang-Gonzalez et al., eLife 2024). In the current manuscript the authors compare the binding of the same pMHC complex to two different TCRs, B7 and A6 which was investigated in the previous paper. While the binding is more stable for both TCRs under load (of about 10-15 pN) than in the absence of load, the main difference is that B7 shows a smaller amount of stable contacts with the pMHC than A6.

      Strengths:

      The topic is interesting because of the relevance of mechanosensing in biological processes including cellular immunology. The MD simulations provide strong evidence that different TCRs can respond mechanically in a different way upon binding the same pMHC complex. These findings are useful for interpreting how mechanical force is employed for modulating different function of T cells.

    1. Joint public review

      Summary:

      The authors examine the eigenvalue spectrum of the covariance matrix of neural recordings in the whole-brain larval zebrafish during hunting and spontaneous behavior. They find that the spectrum is approximately power law, and, more importantly, exhibits scale-invariance under random subsampling of neurons. This property is not exhibited by conventional models of covariance spectra, motivating the introduction of the Euclidean random matrix model. The authors show that this tractable model captures the scale invariance they observe. They also examine the effects of subsampling based on anatomical location or functional relationships. Finally, they discuss the benefit of neural codes which can be subsampled without significant loss of information.

      Strengths:

      With large-scale neural recordings becoming increasingly common, neuroscientists are faced with the question: how should we analyze them? To address that question, this paper proposes the Euclidean random matrix model, which embeds neurons randomly in an abstract feature space. This model is analytically tractable and matches two nontrivial features of the covariance matrix: approximate power law scaling, and invariance under subsampling. It thus introduces an important conceptual and technical advance for understanding large-scale simultaneously recorded neural activity.

      Comment:

      Are there quantitative comparisons of the collapse indices for the null models in Figure 2 and the data covariance in 2F? If so, this could be potentially useful to report.

    1. Reviewer #1 (Public review):

      Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

      The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents certain weaknesses that could be improved. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice.

      Comments on revised version:

      Some of the recommendations provided by this Reviewer in the first version of the manuscript have been successfully addressed in the revision. However, others, particularly those related to human translation, remain unresolved due to the lack of additional samples for analysis. Since the revised title now indicates that the mechanisms described were primarily observed in mice, it seems reasonable to defer addressing this issue to future studies.

    2. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #1 (Public review):

      Summary:

      This paper explores how diverse forms of inhibition impact firing rates in models for cortical circuits. In particular, the paper studies how the network operating point affects the balance of direct inhibition from SOM inhibitory neurons to pyramidal cells, and disinhibition from SOM inhibitory input to PV inhibitory neurons. This is an important issue as these two inhibitory pathways have largely been studies in isolation. A combination of analytical calculations and direct numerical simulations provide convincing evidence that the interplay of these inhibitory circuits can separately control network gain and stability.

      Strengths

      The paper has improved in revision, and the intuitive summary statements added to the end of each results section are quite helpful. The addition of numerical simulations to extend the conclusions beyond the linear range of network behavior are also quite helpful.

      Weaknesses

      None

    2. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    3. Reviewer #3 (Public review):

      Summary:

      Bos et al study a computational model of cortical circuits with excitatory (E) and two subtypes of inhibition - parvalbumin (PV) and somatostatin (SOM) expressing interneurons. They perform stability and gain analysis of simplified models with nonlinear transfer functions when SOM neurons are perturbed. Their analysis suggests that in a specific setup of connectivity, instability and gain can be untangled, such that SOM modulation leads to both increase in stability and gain, in contrast to the typical direction in neuronal networks where increased gain results in decreased stability.

      Strengths:

      - Analysis of the canonical circuit in response to SOM perturbations. Through numerical simulations and mathematical analysis, the authors have provided a rather comprehensive picture of how SOM modulation may affect response changes.<br /> - Shedding light on two opposing circuit motifs involved in the canonical E-PV-SOM circuitry - namely, direct inhibition (SOM -> E) vs disinhibition (SOM -> PV -> E). These two pathways can lead to opposing effects, and it is often difficult to predict which one results from modulating SOM neurons. In simplified circuits, the authors show how these two motifs can emerge and depend on parameters like connection weights.<br /> - Suggesting potentially interesting consequences for cortical computation. The authors suggest that certain regimes of connectivity may lead to untangling of stability and gain, such that increases in network gain are not compromised by decreasing stability. They also link SOM modulation in different connectivity regimes to versatile computations in visual processing in simple models.

      Weaknesses:

      - Computationally, the analysis is solid, but it's very similar to previous studies (del Molino et al, 2017). Many studies in the past few years have done the perturbation analysis of a similar circuitry with or without nonlinear transfer functions (some of them listed in the references). This study applies the same framework to SOM perturbations, which is a useful computational analysis, in view of the complexity of the high-dimensional parameter space.<br /> - A general weakness of the paper is a lack of direct comparison to biological parameters or experiments. How different experiments can be reconciled by the results obtained here, and what new circuit mechanisms can be revealed? In its current form, the paper reads as a general suggestion that different combinations of gain modulation and stability can be achieved in a circuit model equipped with many parameters (12 parameters). This is potentially interesting but not surprising, given the high dimensional space of possible dynamical properties. A more interesting result would have been to relate this to biology, by providing reasoning why it might be relevant to certain circuits (and not others), or to provide some predictions or postdictions, which are currently not very strong in the manuscript.<br /> - Tuning curves are simulated for an individual orientation (same for all neurons), not considering the heterogeneity of neuronal networks with multiple orientation selectivity (and other visual features) - making the model too simplistic.

    1. Reviewer #1 (Public review):

      Summary:

      In this article, the authors set out to understand how people's food decisions change when they are hungry vs. sated. To do so, they used an eye-tracking experiment where participants chose between two food options, each presented as a picture of the food plus its "Nutri-Score". In both conditions, participants fasted overnight, but in the sated condition, participants received a protein shake before making their decisions. The authors find that participants in the hungry condition were more likely to choose the tastier option. Using variants of the attentional drift diffusion model, they further find that the best fitting model has different attentional discounts on the taste and health attributes, and that the attentional discount on the health information was larger for the hungry participants.

      Strengths:

      The article has many strengths. It uses a food-choice paradigm that is established in neuroeconomics. The experiment uses real foods, with accurate nutrition information, and incentivized choices. The experimental manipulation is elegant in its simplicity - administering a high-calorie protein shake. It is also commendable that the study was within-participant. The experiment also includes hunger and mood ratings to confirm the effectiveness of the manipulation. The modeling work is impressive in its rigor - the authors test 8 different variants of the DDM, including recent models like the maaDDM, as well as some completely new variants (maaDDM2phi and 2phisp). The model fits decisively favor the maaDDM2phi.

      Weaknesses:

      While I do appreciate the within-participant design, it does raise a small concern about potential demand effects. The authors' results would have been more compelling if they had replicated when only analyzing the first session from each participant. However, the authors did demonstrate that there was no effect of order on the results, which helps to alleviate this concern.

    2. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.