a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.

One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves

Crystallization

Crystallization and data collection

Fab purification from the digestion mixture was carried out by ion-exchange chromatography using SPW-DEAE (60xl50 mm) column on a Waters3000 preparative HPLC (Waters, USA). In:tially, a blank run was carried out thereafter the column was allowed tore-equilibrate with the wash buffer (10 mM Tris-Cl, pH 8.0). A salt gradient of 0 to 0.2 M NaCI over a period of 120 minutes was used to elute the Fab. An aliquot from all the collected fractions were precipitated by using chilled acetone and were analyzed on a SDS-PAGE gel to ascertain which fraction corresponds to Fab. Fab, which has low or zero net negative charge at pH 8.0, was eluted out as the first major peak early in the gradient. The Fe portion and any undigested IgG which have a higher net negative charge at pH 8.0 would elute out later in the gradient. The Fab fractions collected from various HPLC runs for both the antibodies were pooled, concentrated and dialyzed against their respective crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide and SOmM Tris-Cl pH 7.1, 0.05% sodium azide).

Purification of Fab fragment

band has completely disappeared and only the 25 kDa doublet is clearly visible. Optimal w/w ratios of protein/enzyme and time of incubation were ascertained and preparative digestions were carried out using 20-50 mgs of IgG. The digestion mixture was then dialyzed against 10 mM Tris-Cl, pH 8.0 for Fab purification.

The concentration of the purified IgG was estimated usmg micro bicinchoninic acid (BCA) method of protein estimation (Micro BCA Protein Assay Kit , Pierce). To ascertain the optimal ratio of IgG to papain and time of incubation for proteolytic fragmentation of the antibody, an initial analytical digestion was carried out. 1 mg/ml solution of papain (Sigma, St. Louis, USA) was first pre-activated using rJ-mercaptoethanol (2.0m\1) for one hour. The reaction mixtures for digestion constituted 400 J.lg of IgG, rJ-mercaptoethanol (2.0mM) and EDTA (2.0mM) appropriate volumes of the activated papain solution were added so as to obtain various ratios of lgG:papain. The digestion reaction was monitored for 10 hours and 20 Ill aliquots were collected every hour. The proteolysis reaction was stopped with addition of 75 mM iodoacetamide and all the aliquots were analyzed on reducing SDS-PAGE. Initially the lgG appears as two bands, one at 50 kDa and the other at 25 kDa, corresponding to the heavy and light chains, respectively. The intensity of the 50 kDa band decreases and instead, a doublet starts appearing at 25 kDa as the reaction proceeds. The Fe portion may or may not be visible as a band just above the 25 kDa doublet. The digestion is deemed complete when the 50 kDa

Generation of Fab fragment

solution was injected into the HPLC. A salt gradient of 0 to 0.2 M NaCl over a period of 120 minutes was run and fractions for each peak, as detected by measurement of UV absorbance at 220nm, were collected. An aliquot of each fraction was subjected to acetone precipitation and the obtained precipitate was analyzed on SDS-PAGE to ascertain which fraction corresponds to IgG. The IgG fractions from different runs were pooled and concentrated to -1 mg/ml which was then dialyzed against the digestion buffer (0.15 M NaCl, O.lM Tris-Cl, pH 7.1).

The collected ascitic fluid was centrifuged to remove cell debris and fat. Mouse monoclonal ascites, was filtered through glass wool to remove lipid like material left over after centrifugation. The supernatant was then subjected to (Nr4)zS04 fractionation. Saturated (Nlit)zS04 solution (SAS) at pH 7.0 was gradually added to the ascites in an ice bath with continuous stirring till a concentration of 40% (v/v) was achieved. The mixture thus, obtained was centrifuged to get the protein pellet and the pellet was re-suspended in buffer (0.01 M Tris-Cl, pH 8.5). The crude antibody solution obtained from ammonium sulfate fractionation was dialyzed against the wash buffer (0.0 1 \1 Tris-Cl, pH 8.5) and then subjected to ion-exchange chromatography using 5PW-DEAE (60x150 mm) column on a Waters3000 preparative HPLC (Waters, L:SA), to purify IgG. All solutions used during chromatography were filtered (0.451-lm) and then degassed. Following equilibration of the column with wash buffer, a 2 ml aliquot of the crude antibody

Antibody purification

secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.

Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,

Generation of ascites from mice

conditions used for purificatior and crystallization. Therefore, in any attempt at crystallization, the homogeneity of the preparation and its stability in solution is of paramount importance. lgG molecules possess a net negative charge, at pH 8.5. At this pH, IgG molecules, can therefore, bind to positively charged chemical moieties, an association that can be reversed using low concentrations of sodium chloride. Hence, it is possible to purify IgG using anion-exchange chromatography with a salt gradient. Since this method does not involve harsh conditions it represents an ideal way to purify IgG to be ultimately used for crystallization experiments. Ammonium sulphate fractionation prior to chromatography improves the resolution of peaks during IgG purification. The mouse IgG molecules are known to precipitate in the range of 33% to 40% (v/v) saturated ammonium sulphate. lgG molecules have three major domains, each of which are mobile with respect to the other. Consequently, the molecule is highly flexible and not easy to crystallize. Although entire immur.oglobulin molecules have also been crystallized (Harris et a!., 1998), the proteolytic fragments of IgG molecules have been observed to be more amenable to crystallization. Papain, a non-specific proteolytic enzyme obtained from papaya, cleaves antibodies at the hinge region to release one Fe and two Fab domains. Proteolysis by papain, if carried out carefully, followed by purification can yield a homogenous preparation of Fab. This pure preparation of Fab can be used for crystallization experiments.

A prerequisite for collection of X-ray diffraction data for structure determination is availability of well-ordered single crystals. Protein crystallization is considered to be an art and there are no universally applicable methods for obtaining crystals suitable for X-ray diffraction studies. However, it is unlikely that good crystals will not be obtained if attention is paid to the purity and stability of the molecule of interest. A high degree of purity is essential for successful crystallization of most proteins. Also, the molecule must be stable under the

Preparation of Fab fragment

The peptides were purified using reverse-phase HPLC. Binding occurs through hydrophobic interactions between peptide and the column support. Decreasing the ionic nature or increasing the hydrophobicity of eluant such that it competes with peptide for hydrophobic groups on the column accomplishes elution. Crude peptides were purified on a Waters Xbridge™ BEH 130 reverse-phase C 18 column ( 19x250mm, 1 O~m, spherical) on a semi-preparative HPLC system (Waters, USA) using a linear gradient of 0.1% trifluoroacetic acid (Sigma) and acetonitrile (Merck). The absorption was monitored at 214nm. After purification, the peptides were lyophilized. The purity of the peptide was checked by determination of molecular mass using single quadruple mass analyzer (Fisons Instruments, UK). Circular dichroism studies were performed on the peptides to determine secondary structural state, if any, in solution. 50 )lM peptide concentrations in water were used and data was accumulated for 1 0 scans at a temperature of 10° C using a JASCO 710 spectropolarimeter. 1.0 nm bandwidth and O.lnm resolutions were used, with the sample being placed in a 2mm path length cuvette.

Peptide purification

All the peptides used in this study were synthesized by solid phase method on an automated peptide synthesizer (Applied Biosystems, Model 431A), using F-moc (9-fluorenylmethyloxycarbonyl) chemistry on a p-hydroxymethyl phenoxymethyl polystyrene resin (Nova Biochem). For the peptide synthesis, 0.1 mmol of the resin was used and deprotected using 20% piperidine in N-methyl-pyrrolidone (NMP). Subsequently 0.5nmol of the first amino acid was added and coupling was performed usmg DCC-HoBt (dicyclohexylcarbodiimide-hydroxybezotriazole) ester formation method. All other amino acids were coupled by DCC ester coupling. Amino acids and solutions required for peptide synthesis were procured from Nova Biochem and Applied Biosystems, respectively. After completion of synthesis, deprotection was carried out in 20% piperidine/DMF. Finally, the resin was shrunk using ether and dried under vacuum for a minimum of four hours. The cleavage was performed in dark using 94% TF A, 5% anisole, EDT and water accompanied by continuous stirring for two hours. The resin was then filtered and washed with DCM and the solution was evaporated on a rotary evaporator (Buchi, Switzerland) till only a small quantity of DCM/cleavage mixture is left. Cold anhydrous diethyl ether was added to the filtrate to aid in the separation of scavengers from the mixture. The peptides were then extracted with water using a separating funnel. Extraction was followed by evaporation of residual diethyl ether on the rotary evaporator. Total aqueous layer was then frozen as a thin film and lyophilized.

Procedure for peptide synthesis

the peptide and the resin is cleaved using trifluoroacetic acid (TF A) to release the polypeptide.

Solid phase peptide synthesis was introduced by Merrifield in 1963, and includes successive assembly of amino acid residues to build the peptide chain on an insoluble polymeric support. The C-terminal residue, with protected a-amino and side chain functional groups, is chemically attached to the insoluble resin via a flexible linker. Subsequently, in the coupling step, the a-amino group is deprotected and the next protected amino acid is reacted with the resin-bound first amino acid. This cycle of deprotection and coupling is repeated till the complete peptide chain is synthesized. After the synthesis of the desired peptide, the anchoring bond between

Peptide synthesis

The crystallographic analysis of the anti-( 4-hydroxy-3-nitrophenyl)-acetyl (anti-NP) and the anti-p-azophenylarsonate (anti-Ars) germline mAbs, BBE6.12H3 and 36-65 bound to various peptides derived from the screening of a random phage library would yield valuable information regarding their promiscuous binding abilities, associated with a primary immune response. The primary requirement for the crystallographic analysis was the preparation of adequate quantities of pure Fab (fragment antigen binding). Purified Fab fragment of both the mAbs was used for subsequent crystallization experiments with various peptide ligands. The X-ray intensity data for the crystals obtained were collected followed by structure determination, iterative steps of crystallographic refinement and model building. The refined models were structurally validated and then subjected to rigorous analysis. This chapter provides a brief background of the methods utilized and details of the experimental protocols followed.

Introduction

I 0.0 J.Ll 16.0 J.LI I 0.0 J.Ll 4.0J.Ll 4.0J.Ll 0.5 J..ll 55.5 J.LI I 00 J.L

lOX PCR buffer 1.25 J.LM dNTP mix Template DNA (I 0 J.Lg/ml) Primer #I (25 nmoles/ml) Primer #2 (25 nmoles/ml) Taq DNA polymerase (5 U/J.Ll) Sterile water Total volume

METHODS

The aggregation of the phospholipid vesicles, induced by ribotoxins, was assayed by titrating 40 nmoles of freshly prepared lipid vesicles with various molar concentrations of restrictocin and its mutants. The samples of I ml volume were prepared in 30 mM Tris-HCl buffer, pH 7.0, containing O.IM NaCl and incubated at 37 °C for I h. The change in absorbance due to an increase in turbidity of the lipid suspension was measured at 400 nm in Lambda Bio 20 spectrophotometer (Perkin Elmer) in the cells of I em optical path length. Appropriate control proteins, not interacting with the membranes and the vesicles without proteins were included in all the experiments. The change in absorbance of the lipid suspension was plotted against the toxin concentration.

Aggregation of Lipid Vesicles

The organic solution of phospholipid was made in a 1:1 mixture of chloroform and methanol at a concentration of 5 mg/ml. To get a thin and uniform lipid film, lipid was dried down onto the walls of a round bottom flask by rotating for 30 min. in a rotary evaporator fitted with a coo!;ng coil and a thermostatically controlled water bath. The temperature of the water bath was maintained 10 °C above the phase transition temperature of the respective phospholipid. The film was stored under vacuum for 1 2 h to remove the traces of the solvent after flushing with nitrogen. Subsequently, lipid film was dispersed in 30 mM Tris-HCI buffer containing O.IM NaCl, pH 7.0 at a concentration of 1 mg/ml of lipid using glass beads of 0.5 mm-3 mm in diameter. Multilamellar vesicles (ML Vs) were obtained by manual swirling for 2 h at room temperature (Bangham et al., 1965). Nitrogen was flushed into the flask and the vesicle suspension was left overnight at 4 °C. The .following day, maintaining the temperature 10 °C abcve the phase transition temperature of the corresponding phospholipid, MLVs were sonicated in a water bath sonifier (Branson 321 0) for 45 min. to get the small unilamellar vesicles (SUVs) (Huang C, 1969).

Preparation of Lipid Vesicles

Tryptic hydrolysis of restrictocin and the chimeric toxins was carried out at neutral pH in 25 mM HEPES, pH 7.4 containing 1 mM CaCh, 0.5 mM EDT A. For acidic pH, the buffer containing 200 mM sodium acetate, pH 5.2 and 1 mM CaCh was used. Trypsin diluted in 50 mM PBS, pH 7.4 was added to the protein and the samples were incubated at 37 °C for specified time periods. The reaction was terminated by the addition of SDS-PAGE sample buffer. The digestion products were analyzed on a 12.5% SDS-PAGE using Tris-Giycine buffer system and restrictocin containing fragments were detected by western blotting with anti-restrictocin antibodies.

Trypsin Treatment

in IOmM Tris/HCI (pH 7.4)/ lmM EDTN 0.5% SDS. The radioactivity associated with the cells was counted in a y-counter (LKB).

Competition binding analysis was performed to compare the affinity of the chimeric toxins with native antibody. Anti-transferrin receptor antibody (HB21) was iodinated using iodogen method as described by Harlow and Lane, (1988). Adherent cell lines, namely, A431 and A549 were plated at 4Xl05 cells per well in a 24 well plate and used 16 h later for the assay. 500 J.Ll medium, same as described in cytotoxicity assay, was used to dispense the cells. HUT102 cells were also plated at the same density in microfuge tubes and used immediately. After 2 washes with binding buffer (0.1% BSA in DMEM), various dilutions of toxin, along with 3 ng of labeled antibody in binding buffer, were added to the cells. The cells were incubated at 25 °C for 2 h with mild shaking, washed three times with binding buffer and lysed

Binding Studies

The kinetics of intoxication by different restrictocin containing chimeric toxins was investigated by assaying the cytotoxic activity at various time points. HUTI02, K562 and A431 cell lines were seeded at a density of IX104 cells per well in 200 J.ll medium in a similar manner as described in cytotoxicity assay. The various concentrations of chimeric toxins were added and the cells were incubated at 37 °C in the presence of 5% C02 for different time points. At the end of each incubation period cells were pulsed with eH] leucine and the protein synthesis was measured as described above. The results were expressed as percentage of control where no toxin was added to the cells.

Kinetics of Protein Synthesis Inhibition

with appropriate antibiotics. Serial dilutions of the toxin, made in 0.2% HSA were added to the cells and incubated for indicated time periods. After incubation, the adherent cells were labeled with 0.25 J!Ci eH] leucine per well and the suspension cells with 0.75 J!Ci eH] leucine per well for 3 hat 37 °C. The cells were harvested on to filtermats using an automatic cell harvester, and the incorporation of the eH] leucine in the newly synthesized proteins was estimated using LKB ~-plate counter. Activity was expressed as percentage of control where no toxin was added to the cells. To check the specificity of chimeric toxins for TFR, 10 J.Lg of anti-TFR antibody (HB21) was added to each well prior to the addition of the fusion protein in the competition experiments.

Cytotoxic activity of restrictocin, its mutants and chimeric toxins was checked on a variety of cell lines. The cellular protein synthesis was assayed in the absence and presence of various concentrations of toxin by measuring eH] leucine incorporation in the newly synthesized proteins. Adherent cell lines namely A431, A549, HeLa, L929 and MCF7 were plated in RPMI 1640 containing 10% FCS at a density of 5x I a:~ cells per well in 96 well culture plates and allowed to adhere for 12 h at 37 °C in the presence of 5% C02• Next day, the medium was replaced with 200 J.LI of leucine free RPMI medium containing 10% serum. The leucine free RPMI containing 1 0% FCS was used for seeding partially adherent cell lines, COL0205 and J774A.1. Cells were allowed to adhere for 12 h and the toxin was added in the same medium. The suspension cell lines, HUT102 and K562 were plated at a density of 5X 103 _cells/well in 80% leucine free RPMI containing 18% complete RPMI and 2% serum immediately before use. The medium used at various stages was supplemented

Assay of Cytotoxicity of Chimeric Toxins

Cell-free protein synthesis inhibitory activity of restrictocin was assayed as described by Harlow and Lane ( 1988). The frozen rabbit reticulocyte lysate was thawed on ice in the presence of 30 J..LI of haemin solution per 0.5 ml vial. The toxin was diluted in 0.2% RNase free BSA and several concentrations were incubated with 10 J..LI lysate, I mM ATP, 0.2 mM GTP, 75 mM KCI, 2 mM magnesium acetate, 3 mM glucose, 10 mM Tris-HCI, pH 7.6, 4 J..LM amino acid mixture without leucine, 0.16 J..LCi eH] leucine, 1.33 mg/ml creatine phosphokinase, and 2.66 mg/ml creatine phosphate in a reaction volume of 30 J.LI. The reaction was carried out at 30 °C for one hour and terminated by adding 0.25 ml of I N NaOH containing 0.2% H202• The reaction mixture was further incubated for I 0 min. at 37 °C, BSA added to a final concentration of 65 J..Lg/ml, and the proteins were precipitated with 15% trichloroacetic acid. The mixture was left on ice for 30 min. for complete precipitation and harvested onto 26 mm glass fibre filters. The filter discs were placed in a manifold harvester (millipore) and rinsed with chilled 5% TCA, before the addition of reaction contents. The filters were thoroughly washed with chilled acetone and dried at 37 °C, for one hour. The dried filters were immersed in organic scintillation fluid, and counted using a liquid scintillation counter (Packard).

Assay for Inhibition of in Vitro Protein Synthesis

The specific ribonucleolytic activity of restrictocin and its mutants was followed by detecting the release of the characteristic 400 nucleotide long a-fragment from 28S rRNA of eukaryotic ribosomes. All the reagents, water and glassware used during the experiment were treated with O.I% DEPC to get rid of contaminating ribonucJeases. Rabbit reticulocyte lysate (30 J.Ll) was incubated with different concentrations of the toxin in 40 mM Tris-HCl (pH 7.5) containing 10 mM EDTA at 37 °C for 30 min. in a 50 J.Ll reaction volume. The control reaction did not contain an)' toxin. The reaction was stopped by adding 2 J.Ll of I 0% SDS and incubated at ambient temperature for 5 min. Total RNA was extracted using Trizol reagent. 200 J.LI of the reagent was added to the reaction mixture, mixed well and incubated at room temperature for 5 min. Subsequently, 50 J.LI chloroform was added to each tube, mixed thoroughly and incubated at ambient temperature for 2 min. followed by centrifugation at I2,000 rpm, at 4 °C, for I5 min. in a microfuge (Plastocraft). The aqueous phase was mixed with 125 J.Ll isopropanol to precipitate the RNA, allowed to stand at ambient temperature for I 0 min. and centrifuged at 12,000 rpm at 4 °C for I5 min. The RNA pellet was washed with 75% ethanol, dried in air, dissolved in 10 J.Ll of 0.5% SDS solution and electrophoresed on a 2% agarose gel after heating at 65°C for 2 min. The RNA was visualized by ethidium bromide staining and photographed using Polaroid camera. The photographs were scanned, printed using a laser printer to present as figures in this thesis.

Specific Ribonucleolytic Activity Assay

1.2% acetylphenylhydrazine (APH) solution to render it anemic. The APH solution wa5 prepared in sterile water and pH was neutralized to 7.0 with 1 M HEPES buffer (pH 7.5). The rabbit was allowed to recover for 5 days, after which it was bled. The blood was collected in a sterile tube, containing an equal volume of prechilled salt solution and the mixture was filtered through a cheese cJoth. Filtrate was centrifuged at 2000 g for 10 min. at 4 °C. Supernatant was discarded, the pellet was washed twice with salt solution without heparin and finally, resuspended in equal volume of chilled sterile water. It was kept on ice for a minute and centrifuged at 20,000 g for 20 min. at 4 °C. The supernatant, containing the lysate, was immediately stored in liquid Nitrogen in 0.5 ml aliquots.

The rabbit reticulocyte lysate was prepared as described by Sambrook et al ( 1989). A young male NZW rabbit weighing 2-2.5 Kg was subcutaneously injected for five consecutive days respectively with 2 ml, 1.6 ml, 1.2 ml, 1.6 ml and 2.0 ml of

Preparation of rabbit reticulocyte lysate

Circular Dichroic spectra of various proteins were recorded at room temperature, using a JASCO J7i0 spectropolarimeter fitted with a thermostated cell holder. I 50 J..Lg protein was dissolved in 3 ml of I 0 mM sodium phosphate buffer (pH 7.0), and the samples were scanned in the far-UV range (200-250 nm). A cell with a 1 em optical path was used to acquire the spectra at a scan speed of 50 nrn/min. with a. sensitivity of 50 mdeg and a response time of I sec. The sample compartment was purged with nitrogen, and spectra were averaged over I 0 accumulations. The CD spectra were normalized to mean residue ellipticity curves using Jasco software. Yang's reference parameters were used to perform secondary structure analyses from CD measurements using Jasco Secondary Structure Estimation Programme (Yang et al., 1986).

Structural Characterization of Proteins by CD Spectroscopy

The proteins were resolved on SDS-polyacrylamide gels and transferred onto a nitrocellulose membrane, in the transfer buffer, at a constant current of 300 rnA for 2 h. The membrane was incubated in blocking buffer for 45 min. at room temperature with continous shaking. The membrane was further incubated in anti-restrictocin antibody diluted in PBS, pH 7.4, containing 0.1% Tween 20 (PBST), for 45 min .. The membrane was washed thrice with PBST, followed by incubation in anti-rabbit IgG-HRP conjugate diluted in PBST for 30 min. with shaking. After repeated washings with PBS, colour was developed by incubating the membrane with the chromogenic substrate 0.5 mg/ml of DAB.4HCI (diaminobenzidine tetrahydrochloride dihydrate) and 1 f..ll/ml of H202 in PBS.

Western Blotting

M Tris-HCI pH 8.8, containing 4% stacking gels in O.I25 M Tris-HCI pH 6.8. The gels were run in SDS-PAGE running buffer at a constant current of 40 rnA Proteins were visualized by staining the gels with Coomassie brilliant blue.

The purified proteins were analysed by SDS-PAGE as described by Laemmli ( 1970). Restrictocin and its mutants were analysed on 12.5% resolving gels in 0.375

SDS-PAGE

Heterologus expression of various proteins was done in BL21 (A.DE3) strain of E. coli. Bacterial cells were transformed with the desired construct and grown in Super broth (pH 7.2) containing 100 J.lg/ml ampicillin, at 37 °C with continous shaking in a gyratory shaker at 225 rpm. The cultures were induced, at ~oo of 2.0, with I mM IPTG, and harvested two hours later by centrifugation at 4000 g, at 4 °C, for 20 min .. The recombinant proteins were purified from the inclusion bodies using the procedure described by Buchner et al ( 1992). The total cell pellet from a liter of culture was homogenized in 180 ml of inclusion bodies washing buffer containing 8 ml of freshly prepared lysozyme solution (5 mg/ml). The suspension was incubated at room temperature for 1 hr with intermittent shaking. Added 20 ml each of 5M NaCI and 25% Triton X-100 were added to the suspension and incubated at room temperature for 30 min. with vigorous shaking. The suspension was centrifuged at 13,000 g at 4 °C, for 50 min. and the pellet was resuspended, in the washing buffer containing 1% Triton X-1 00, using a polytron homogenizer and centrifuged at 13,000 g for 50 min. The pellet was washed four times with washing buffer without Triton . X-100. The pellet containing inclusion bodies was solubilized in 6 M guanidine hydrochloride by incubating for 2 hours at room temperature. The solubilized protein was centrifuged at 50,000 g, at 4 °C, for 30 min. and the protein concem.ration was adjusted to 10 mg/ml in the supernatant with 6 M guanidine hydrochloride. The denatured protein thus obtained was reduced by adding 65 mM dithioerythritol and incubated at room temperature for 2 h. To renature, the protein was diluted 1 00-fold in the refolding buffer and incubated at 10 °C for 48 h without stirring or shaking. Renatured material, after dialysis in 20 mM MES buffer, pH 5.0 containing 100 mM urea, was loaded on a S-Sepharose column, and the protein bound to the column was eluted with a 0-1 M NaCI gradient in 20 mM MES on an FPLC system (Pharmacia). The fractions containing the desired protein were pooled and concentrated, and the protein was further purified to homogeneity by gel filtration chromatography on a TSK 3000 column (LKB) in PBS, pH 7.4.

Isolation and Purification of Proteins from the Inclusion Bodies

Sequencing of cloned inserts was done by Sanger's dideoxy chain termination method (Sanger et al., J 977) using Sequenase version 2.0 kit from USB. 5 J.ll of J mg/ml suspension of plasmid DNA was incubated in denaturation buffer at 37 °C for 30 min. in a reaction volume of 50 J.ll, and then the precipitation was carried out in the presence of 5.5 J.ll of 3M sodium acetate and 4 volumes of chilled ethanol at -70 °C for 30 min. The pellet, obtained by centrifugation at 10,000 g, for 20 min., at 4 °C, was washed with 70% ethanol and resuspended in 7 J.ll of sterile water. J pmole of sequencing primer in J J.ll water and 2J.ll of 5X sequenase reaction buffer were added to denatured DNA and the reaction mix was incubated at 65 °C for 5 min. for primer annealing. The reaction mixture was cooled slowly to about 35 °C, by putting the heat block at room temperature. For labeling, J J.ll of 0. J M DTT, J J.ll radioactivity containinig J 0 J.lCi of 35S dATP, 2 Jlllabeling mix diluted 5-fold in steriJe water and 2 Jll sequenase enzyme diluted 8-fold in sequenase dilution buffer were added to the· primer annealed DNA. Incubated the reaction mixture at room temperature for 2-5 min. and added 3.5 J.ll to each of the 4 different tubes containing 2.5 J.ll dideoxy nucleotides ddATP, ddTTP, ddCTP, and ddGTP separately. The mixture was incubated at 37 °C for 5 min. and finally, the reaction was stopped by adding 4 J.ll of estop solution to each tube. Reaction products were separated on a 6% polyacrylamide sequencing gel made in TBE buffer containing 7.5 M urea. The samples were heated at 75 °C for 2 min. and immediately loaded on the gel. The gel was run at a constant power of 60 watts maintaining the temperature of gel between 50-55 °C, dried and exposed to an X-ray film.

DNA Sequencing

resuspended in 0.2 ml TE, and extracted successively with phenol, phenol-chloroform, and chloroform. In the aqueous phase, 0.25 volume of J 0 M ammonium acetate and two volumes of chilled ethanol were added and the mixture was incubated at room temperature for 5 min. to precipitate the plasmid DNA. The pure plasmid DNA was recovered by centrifugation at J 2,000 g for J 0 min. at 4 °C, washed with 70 %ethanol, dried and resuspended in TE buffer (pH 8.0). The amount and the purity of the DNA was done spectrophotometrically by recording the absorbance at 260 nm.

Plasmid DNA was prepared by alkaline lysis method of Ish-Horowicz ( 1981 ). 5 ml cultures were grown as described for small scale plasmid preparation. 0.5 ml from the growing culture was inoculated into 250 ml of LB containing ampicillin. The culture was grown for 12 h at 37 °C with vigorous shaking, centrifuged at 3000 g, at 4 °C, for 15 min. and the bacterial pellet was resuspended gently in 1 0 ml TEG buffer. The mixture was incubated at room temperature for 10 min., followed by addition of 20 ml of freshly prepared alkaline-SDS solution. The contents were mixed by inversion and the mixture was kept on ice for 10 min., followed by the addition of 15 ml of chilled potassium acetate solution. The contents were mixed by inverting the tube, and incubated on ice for 10 min. The lysed cell suspension was centrifuged at 5000 g, at 4 °C, for 20 min. The supernatant was taken, and nucleic acids we~,-.. precipitated by adding 0.6 volume of chilled isopropanol. The mixture was incubated on ice for 10 min. followed by centrifugation at 5000 gat 4 °C, for 10 min .. The pellet was washed with 70% ethanol, dried and resuspended in TE buffer. The plasmid DNA was purified further to remove the contaminating proteins and RNA following the PEG purification protocol as described by Sambrook et al ( 1989). Equal volume of chilled 5 M lithium chloride solution was added to DNA . suspension, mixed well and incubated on ice for 10 min. The precipitate was removed by centrifugation at 10,000 g at 4 °C, for 10 min. DNA was precipitated from the supernatant by adding equal volume of isopropanoL The mixture was centrifuged at 10,000 g for 10 min. at 4 °C and the pellet was washed with 70% ethanol. The DNA thus obtained was incubated in TE buffer containing 20 J.tg/ml of DNase free RNase A for 30 min. at room temperature. Afterwards, equal volume of 1.6 M NaCl containing 13% (w/v) PEG 8000 was added to DNA solution. The contents were. thoroughly mixed and centrifuged at 10,000 g, at 4 °C, for 10 min .. The pellet was

Large Scale Plasmid DNA Preparation

of the plasmid DNA with 0.5 volume of cold isopropanol. The mixture was kept on ice for 10 min. and centrifuged at 12,000 rpm at 4°C for 15 min. DNA pellet thus obtained was washed with 80% ethanol, dried and dissolved in 50 J.!l TE buffer (pH 8.0). Minipreps were screened by restriction digestion. 5 J.tl of plasmid DNA was incubated with 5 units of appropriate enzyme(s) and 150 units of RNaseT1 for 2 h and the products were analyzed on an agarose gel to identify the positive clones.

5 ml LB containing 100 J.tg/ml of ampicillin was inoculated with single. bacterial colony picked from the culture plates. The culture was grown for 12 h at 37 °C with vigorous shaking. Cells were harvested from 3 ml of culture by centrifugation at 3000 rpm in a microfuge (Plastocraft) at 4 °C for 15 min. Added 200 J.tl of TEG buffer was added to the cells, and tt.ey were gently resusupended to get a uniform suspension and kept on ice for 5 min. 400 J.tl of freshly prepared alkaline-SDS solution was added to the cell suspension and mixed well by inverting the tubes followed by an incubation on ice for 10 min. Subsequently, 300 J.ll of chilled potassium acetate solution was added and mixed thoroughly by vortexing. The mixture was centrifuged at I 0.000 rpm at 4 °C for 15 min.. The supernatant was collected and phenol-chloroform extraction was performed followed by precipitation

Mini Plas~id Preparation and Screening

A control reaction was done with the control annealed DNA lacking the oligonucleotide. The constituents were mixed and incubated on ice for 2 min. afterwards, at room temperature, for 5 min. The reaction was further carried out at 37 °C for 2 h followed by heating at 70 °C for 10 min. 12.5 J.tl of the reaction products were analyzed on an agarose gel along with annealed samples to check the complementary strand synthesis. The samples were diluted I 0-times with water and 5 J.ll of the diluted sample was used to transform 50 J.ll of E. coli host strain, DH5a cells. The suspension was pl~!ed on 2 LB agar plates containing ampicillin. Single colonies were picked, grown in liquid culture and miniprep screening of DNA was done to select the positive clones.

Annealed DNA 10.0 J.ll I OX synthesis buffer 2.5 J.ll 1 OX ligation buffer 1.0 J.ll dNTP mix (100 mM) 1.0 J.ll ATP (100 mM) 0.25 J.ll ~ T7 DNA polymerase (5 U/J.tl) 0.5 J.ll T4 DNA ligase (400 U/J.tl) 0.5 J.ll H20 9.25 J.ll Total 25.0 J.l

Titration of uracil containing template: The crude preparation of the phagemid DNA (1 ml aliquot), was used to titrate the uridine incorporation in the template. The strains CJ236 (ung-duf) and DH5aF'(ung+ dut+) of E. coli were transformed with the diluted template DNA The CJ236 cells, plated in the presence of ampicillin and chloramphenicol while DH5aF' cells, plated in the presence of ampicillin alone, were grown overnight on LB agar plates. The good incorporation of uridine gave no colonies or very few colonies in DH5aF' cells whereas with CJ236 several colonies were obtained. A ratio of 103-104 between the number of colonies in CJ236 to that in DH5aF' cells was considered ideal for an efficient incorporation of uridine. Phosphorylation of the mutagenic oligonucleotide: The components of a standard reaction to carry out the phosphorylation are described below Oligonucleotide (180 nmoVml) 1.0 J.ll 1 OX Kinase buffer 2.5 J.ll 10mMATP 1.0 J.ll 10 mM spermidine 0.25 J.ll 100mMDTT 1.25 J.ll T4 polynucleotide Kinase 0.5 J.ll H20 18.5 J.ll Total 25.0 J.LI The constituents were . mixed thoroughly, incubated at 37 °C for 30 min. and subsequently, the enzyme was denatured by heat inactivation at 70 °C for 10 min. Annealing of the mutagenic oligonucleotide: 750 ng (approximately) of the uracil containing single stranded template and 1 J.L) of the phosphorylated· oligonucleotide were taken in IX annealing buffer making up the total reaction volume 20 J.LI. A control reaction, was also carried out simultaneously, lacking the oligonucleotide. The contents were mixed by vortexing and incubated at 95 °C for 10 min. in a water bath. The reaction mixtures were further incubated at 80 °C for I 0 min. in a heat block and the heat block was transferred to ambient temperature, cooled slowly to about 30 °C over a period of 30-60 min. Complementary DNA strand synthesis: The oligonucleotide annealed uracil containing template was used for complementary strand synthesis in the following reaction.

Site-directed mutagenesis was done according to the method employed by Kunkel et al., 1987. Preparation of Uracil containing phagemid: E. coli strain CJ236 was transformed with the required template DNA and grown on LB plates containing the antibiotics, ampicillin 100 Jlg/ml and chloramphenicol 30 Jlg/ml (stock solution made in alcohol). Further, the plates were incubated at 37 °C for 12 h and a single colony was picked from the center of the plate, inoculated in 5 ml LB containing ampicillin and chloramphenicol. The liquid culture was grown at 37 °C overnight with vigorous. shaking. About 500 Jll of the culture was diluted 40-times with LB containing ampici11in and chloramphenicol and grown at 37 °C with vigorous shaking (200 rpm) upto an OD600 of 0.25-0.3. The speed of shaker was reduced to 100 rpm and the culture was left for 30 min. for the F pilus to grow. Afterwards, it was infected with VCS Ml3 helper phage at an MOl of 1:20. The cells were grown for 30 min. in a stationary culture to allow the phages to infect, followed by slow shaking ( 100 rpm) for one hour. Subsequently, the culture was diluted 10-times with 2X YT medium containing ampicillin and chloramphenicol and grown in the presence of 0.25 Jlg/ml uridine and 50 Jlg/ml kanamycin at 37 °C overnight with vigorous shaking. The following day, the culture was chilled on ice for 10 min. and centrifuged at 12,000 rpm for 10 min. at 4 °C in a Sorvall RC5C centrifuge using a GSA rotor. The pellet was discarded and the supernatant was centrifuged again in fresh GSA bottles. A small aliquot of about 1 ml from the supernatant was saved for titration and the . precipitation of the single stranded phagemid was carried out using 0.15 volume of 16.67% PEG in 3.3 M NaCl followed by incubation on ice for 4 h. J'he mixture was centrifuged at 12,000 rpm at 4 °C for 30 min. using a GSA rotor and the pellet was resuspended in 3 ml TE buffer. The suspension was centrifuged at 15,000 rpm at 4 °C for 10 min. using a SS34 rotor. The supernatant was ultracentrifugated at 100,000 g at 4 °C for 2.5 h. The pellet was resuspended in 500 Jll TE buffer followed by phenol-chloroform extraction and precipitation of the single stranded DNA with ethanol for 30 min. at -70 °C. The DNA pellet was washed with 70% ethanol, dried and dissolved in 200 Jll TE buffer. The uracil containing template was quantitated by analysing on an agarose gel.

Site-directed Mutagenesis

Transformation of the bacterial host with an appropriate plasmid was performed using the method of Mandel and Higa ( 1970). A vial of competent bacterial cells was thawed on ice. The plasmid DNA was added at a concentration 1 ng/25 Jll of competent cells and the mixture was allowed to stand on ice for 30 min. The cells were given a heat shock by incubating the mixture at 42 °C for 90 sec, followed by a 2 min. incubation on ice. The mixture was diluted 10-fold with LB and incubated at 37 °C for 1 h. Afterwards the cells were plated on the LB-agar containing the antibiotic whose resistance marker was present in the plasmid.

Transformation of Bacterial Host

The pure PCR amplified product, and the vector were digested with required· restriction enzymes in the reaction buffer as per supplier's recommendation. Ten units of enzyme were used to digest I Jlg of DNA and the samples were incubated for three hours at appropriate temperature. The vector was dephosphorylated with calf intestinal phosphatase (0.2 units/Jlg of DNA) for 30 min. at 37 °C. After digestion, relevant fragments were gel purified in 15% PEG-8000-T AE solution as described by Zhen and Swank (1993). Ligation of the vector and insert DNA was performed in a reaction volume of 20 Jll using 400 units oi T4 DNA ligase in the recommended ligation buffer at 16 °C for 12 h. A control ligation reaction without the insert was also done keeping the other components same. The concentration of insert was eight to ten times more than the vector. The ligated sample and control mix was later used for transformation.

DNA Digestion and Ligation

The reaction was started by an initial hot start at 94 °C for 5 min., followed by a three-step amplification cycle. The amplification cycle consisted of a 1 min. denaturation at 94 °C, followed by a 2 min. annealing at 48 °C and an extension at 72 °C for 2 min. The cycle was repeated 30 times and the reaction mixture was incubated at 72 °C for additional 7 min. to allow for primer extension. The PCR amplified product was separated from the primers on a 1% agarose gel. A well was carved ahead of the required fragment and filled with 15% PEG-T AE solution (Zhen and Swank, 1993). The DNA was electro-eluted in 15% PEG-TAE solution, and purified further by phenoVchloroform extraction and ethanol precipitation.

A standard PCR was set up as described below.

Polymerase Chain Reaction

Competent cells of the different strains of E. coli were prepared as described by Cohen et al. ( 1972). An LB-agar plate was streaked with the desired strain, and a single colony was inoculated into 5 ml of LB medium. The culture was grown at 37 °C with continuous shaking at 200 rpm for 6 hours. A small inoculum from this culture was used to start a I 00 ml culture in the same medium. At an OD600 of 0.3-0.4, when the culture reached early Jog phase, it was chilled on ice for 30 min .. and centrifuged at 2000 g for 15 min. at 4 °C. The pellet was gently resuspended in 50 ml of chilled 50 mM calcium chloride and incubated on ice for 60 min. The cell suspension was centrifuged at 2000 g for 15 min. at 4 °C, and the pellet was gently resuspended in 5 ml of chilled 50 mM calcium chloride containing 20% glycerol. The competent cell suspension was immediately aliquoted in prechilled vials and stored at -70 °C.

Preparation of Competent Bacterial Cells

Compositions of the different solutions used in this study are described in appendix.

r-bZP3 was arsanilated using a modification of the procedure of Nisnoff (1967). Briefly, arsanilic acid (100 mg) was dissolved in 5 ml of I M HCI. A IO ml stock of NaN02 (10 mg/ml) was also prepared fresh and added dropwise to the arsanilic acid solution while vortexing. Activation of arsanilic acid was checked on starch-KI paper. The ice cold activated arsanilic acid solution was added dropwise to the protein solution (5 mg of r-bZP3 in 100 mM PB, pH 7.4) stirring constantly in an ice water bath, while pH was maintained between 9.0 and 9.5 with 10 N NaOH. The protein solution was dialyzed extensively against I 00 mM PB having 4 M urea. Arsanilation of r-bZP3 was checked by ELISA using ars-r-bZP3 for coating ( 1 flg/well) and using a 1:100 dilution of murine anti-ars MAb, R 16.7 (Durdik et al., 1 989). Bound Ab was revealed using anti-mouse HRPO conjugate (I :5000). Three monkeys previously immunized with r-bZP3-DT conjugate (MRA-375, MRA-640 and MRA-672) and 2 naive monkeys (MRA-446 and MRA-670) were immunized at 2 intramuscular sites with 250 flg of ars-bZP3 conjugate using Squalene:Arlacel A ( 4: 1) as an adjuvant. Boosters were administered at intervals of 20 days and bleeds were collected I 0 days post immunization. Bleeds were analyzed by ELISA using r-bZP3 and ars-BSA for coating to determine anti-bZP3 and anti-ars Ab titres as described earlier.

Arsanilation of r-bZP3

administered as and when required. Animals were put on continuous mating with males of proven fertility after administration of the three primary injections and monitored for menstrual cyclicity and conception. Ab titres were determined as described above except that anti-monkey HRPO conjugate was used as the revealing Ab.

Female bonnet monkeys (Macaca radiata) reared at the Primate Facility (Nil, New Delhi) were selected and serum progesterone levels were estimated for atleast three months in samples which were collected biweekly. Animals showing atleast two consecutive normal ovulatory peaks (serum progesterone levels >2 ng/ml) (Bamezai, 1986) were selected for fertility trials. Five animals (MRA 375, 515, 640, 672, 770) immunized with 250 Jlg equivalent of r-bZP3, expressed in SG I3009[pREP4] cells, conjugated to DT, was emulsified with Squalene and Arlacel A, adjuvants permitted for human use, in a ratio of 4: I and administered intramuscularly at two sites. In addition, the primary dose also contained I mg/animal of SPLPS as an additional adjuvant. Animals were boosted at intervals of 4-6 weeks depending on the Ab titers with 250 Jlg of r-bZP3-DT using Squalene and Arlacel A as adjuvants. A second group of 3 monkeys (MRA 384, 502, 661) were immunized using a slightly different protocol. The primary immunization consisted of 125 J.lg of r-bZP3-DT and 125 J.lg of r-bZP3-TT (expressed in BL2I(DE3) cells) using the same adjuvants and immunization protocols mentioned above except that boosters were administered alternately with 250 Jlg of r-bZP3-DT or -TT conjugates using Squalene and Arlacel A as adjuvants. Following completion of the primary immunization and 2 boosters at monthly intervals, bleeds (1-2 ml) were collected biweekly from the antecubital vein for estimation of progesterone levels and Ab titres. Boosters were

Immunization of Female Bonnet Monkeys

Progesterone levels were estimated from sera of bonnet monkeys which were bled biweekly using a radioimmunoassay employing reagents and protocol as prescribed by the W.H.O. Matched Assay Reagent Programme (Sufi et al., 1983). Each sample was run in duplicates. Progesterone was extracted from serum (0.1 ml) by the addition of 2 ml of ice-cold ether in each tube and vortexing for 2 min. The tube was immersed in liquid nitrogen in order to flash freeze the serum phase and the unfrozen ether phase which contained the extracted steroid hormone was decanted into another tube. The ether was allowed to evaporate 0/N and 0.5 ml of steroid assay buffer (0.1 M PBS, pH 7 .3, 0. 1% thiomersal and 0.1% gelatin) was added to the tubes and the tubes were incubated at 40°C for 30 min. Steroid sticking to the walls of the tubes was recovered by vigorous vortexing. 100 J..LI of anti-progesterone Ab (at a dilution giving -50% binding of tritiated p.rogesterone in the absence of unlabelled competing progesterone) was then added to the tubes followed by addition of 0.1 ml of 3H-progesterone ( -10,000 cpm/tube). The mixture was incubated for atleast 16 hrs at 4oc. Unbound progesterone

was separated by addition of 0.2 ml of ice cold assay buffer containing 0.625% activated charcoal and 0.0625% dextran and incubated for 30 min at 4oc. This was followed by centrifugation at 2500 rpm for I 5 min at 4°C. The supernatant was carefully decanted into scintillation vials and 4 ml of scintillation fluid (0.4% 2,5 diphenoxazole; 0.01% POPOP [1-4 bis(5-phenyl-2-oxazolyl)benzene] in sulfur free toluene) was added and counted in a liquid scintillation beta counter (Beckman Instruments, California, USA). The amount of progesterone per ml of serum was calculated from a standard curve with known amounts of progesterone in each assay.

Progesterone Radioimmunoassays

Human oocytes were washed twice with PBS containing 0.1 % BSA and then incubated with 1 :50 dilution of immune or pre-immune serum samples at RT for 30 min. Following washing with PBS (3 changes of 5 min each), the oocytes were treated with goat anti-rabbit Ig-FITC conjugate for 30 min at RT. After washing with PBS, the treated oocytes were mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.

Indirect Immunofluorescence on Human Oocytes

In addition, cryosections of an ovary from a normal cycling female (10 years) were also processed. Sections passing through a follicle were selected, washed in PBS and blocked for 30 min in 5% normal goat serum. The sections were incubated at 37°C with 1 :250 dilution of rabbit pre-immune and immune sera for 1 h, washed with PBS and incubated for 1 h with 1 :2000 dilution of goat anti-rabbit lg-FITC conjugate. Slides were washed with PBS and mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.

A 3 year old monkey was treated daily for 3 days with an intramuscular injection of 25 IU of PergonaJ® (Laboratoires Serono S.A., Aubonne, Switzerland). The monkey was ovarectomized on day 6, and the ovary was snap frozen in liquid nitrogen and sections of 5 J..Lm thickness were cut in a cryostat at -20°C and fixed for 20 min in chilled methanol.

Immunofluorescence on Bonnet Monkey Ovarian Sections

Porcine ZP3a. and ZP3P prepared as described previously (Yurewicz et al., 1987) and purified r-bZP3 were tested for their reactivity with rabbit anti-r-bZP3 Ab in the immunoblot by the same procedure as described above except that goat anti-rabbit Ig-HRPO conjugate was used.

Reactivity with Porcine ZP3

Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0

Titration of Rabbit Anti-bZP3 Sera

administered at two sites. In addition, the primary dose also contained 500 J..Lg of SPLPS as an additional adjuvant. This was followed by 2 booster at 4 weekly intervals with an equal amount of r-bZP3-DT conjugate.

Female New Zealand White rabbit (Small Animal Facility, National Institute of Immunology, New Delhi, India), 6 months of age was immunized intramuscularly with r-bZP3-DT conjugate equivalent to 125 Jlg of r-bZP3 (expressed in SG13009[pREP4] cells) in 0.9% saline emulsified with Squalene and Arlacel "A" in a ratio of 4: I and

Immunization of Rabbit

For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.

Purification and Conjugation

IMMUNOGENICITY AND IN VIVO CONTRACEPTIVE EFFICACY

Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).

Immunocytochemical Localization of Recombinant Proteins in Infected Cells

Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.

Analysis ofr-bZP3 in VI, V2, V3 and V4 Infected Cells and Supernatant

Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.

Radiolabeling of Recombinant Proteins in Infected S/9 Cells

Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.

Expression 'Of bZP3 in BEVS

For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.

Screening of the Recombinant Viruses

The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.

Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.

Plaque Assay for Isolating Viruses

Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.

Construction of Recombinant Viruses

AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.

Cell Culture Techniques

650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.

The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at

Screening of the Recombinant Transfer Vector

(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.

Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect

Plasmid Construction

EXPRESSION IN BACULOVIRUS

Peptide antisera were generated in the laboratory against peptides PI, 23-45 aa residues with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVL VE), P2, 300-322 aa residues (CSFSKSSNSWFPVEGPADICQCC) and P3, 324-347 aa residues (KGDCGTPSHSRRQPHVVSQWSRSA) corresponding to bZP3 precursor protein in rabbits and were used to determine their reactivity with the r-bZP3 protein expressed in E. coli in an enzyme linked immunosorbent assay (ELISA). Microtitration plates were coated with 200 ng of r-bZP3 or I J.tg/well of the peptide. HRPO conjugated goat anti-rabbit Ig at I :5000 dilution was used as revealing Ab.

Reactivity with Anti-peptide Sera

E. coli strains deficient in specific proteases were used to study their influence on the expression of r-bZP3. BL21 (DE3) and BL21 (pLysS) deficient in ompT and ion proteases and DF5 carrying a targeted mutation of the ptr gene, were transformed with the pQE-bZP3 plasmid. Colonies obtained were grown 0/N and subcultured next morning and grown till A6oo=0.7. Cultures were then induced with 0.5 mM IPTG for 3 h. Harvested cells were checked by SDS-P AGE and immunoblotting.

Expression of r-bZP3 in Different E. coli Strains

Conditions for expression of r-bZP3 in SG 13009[pREP4] cells transformed with the pQE-bZP3 plasmid were standardized. Cells were grown till A6oo=0.7 and induced with different concentrations of IPTG (0.5, 1, 2, or 4 mM) for a constant time period (3h) or induced with a 0.5 mM IPTG for different time periods (0, 1, 2, 3 or 5 h). Cells were harvested and analyzed by SDS-PAGE and immunoblot as described above.

Standardization of Expression Conditions

A I 00 ml culture was grown and induced according to the procedure mentioned above. The culture was divided into 2 aliquots and cells were pelleted down. For cytosolic localization, one pellet was resuspended in 5 ml of sonication buffer (50 mM Na-phosphate, pH 7.8, 300 mM NaCI). The sample was frozen and then thawed in ice-water and cells lysed by brief sonication. The sample was centrifuged at I 0,000 g for 20 min. The soup and the pellet represent the soluble and insoluble components of the cell pellet. In order to check for periplasmic localization, the 2nd aliquot of cells was resuspended in I 0 ml of hypertonic solution (30 mM Tris, pH 8, 20% sucrose, 1 mM EDT A) and incubated at RT for 10 min with shaking. Cells were centrifuged at 8,000 g for 10 min. The pellet was subjected to osmotic shock in 5 mM MgS04. Cells were stirred for 10 min in an ice water bath, centrifuged at 8000 g at 4°C for I 0 min. The soup collected represented the periplasmic fraction. The fractions were analyzed by 0.1% SDS-1 0% PAGE and Western blotting as described above.

Intracellular Localization

The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.

SDS-PAGE and Immunoblot

The pQE-bZP3 plasmid was transformed in Ml5[pREP4] and SG13009[pREP4] bacterial strains provided with the kit. The transformed colonies were analyzed for expression. A single transformed colony was inoculated and grown overnight at 37oc in 1 ml of LB containing 100 J..Lg/ml of ampicillin and 25 J..Lg/ml of kanamycin. Cells were subcultured 1:10, next morning and grown until cell density reached an A600 of approximately 0.6-0.7. The cells were further grown in the presence of isopropyl P-D thiogalactopyranoside (IPTG) to induce expression of the fusion protein under the T -5 promoter. The cells were collected by centrifugation at 13,000 g for 60 sec and the resulting pellet was stored at -700C until used.

Expression in MJS[pREP4] and SG13009[pREP4] E. coli Strains

vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.

Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B

PCR Amplification and Cloning in pQE30 Vector

CLONING AND EXPRESSION IN E. coli

The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).

Analysis of Sequence

Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.

Sequencing of bZP3

centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.

A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,

Large Scale Plasmid DNA Isolation

mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.

Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents

Small Scale Plasmid DNA Isolation

E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.

Preparation of Competent Cells and Transformation

All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.

Media Composition and Bacterial Culture

ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.

The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and

Agarose Gel Electrophoresis, Digestion and Ligation

Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.

PCR Amplification of bZP3

CLONING AND SEQUENCING OF bZP3

~hCG and HBsAg sequences were accessed from GenBank or NBRF database on a Microvax II computer and sequence analysis performed using the HPLOT and AMPHI programmes. HPLOT is based on the algorithm of Kyte and Doolittle ( 1982 ) and plots the hydrophobic and hydrophilic segments of the protein by scanning the whole length of the sequence in blocks of a few residues. The window size used was 6 amino acids. AMPHI is based on the algorithm of Margalit et al., ( 1985 ) and predicts the amphipathic segments of the proetin which correspond to alpha helices and are therefore, likely candidates for being T cell epitopes.

Computer analysis.

for 3 hours at room temperature or OIN at 4 °c. The excess antibody was washed by washing the filters with PBST for 15 minutes with at least three changes. The filters were subsequently incubated in the appropriate dilution of the second antibody for one hour at room temperature. Dilutions of the primary as well as secondary antibody were made in 3 % BSA in PBST. Following incubation with the second antibody, the filters were washed vigorously with PBST for 5 minutes. The washing was repeated 5-6 times. Finally, the filters were washed twice in PBS and colour developed with DAB ( 0.5 mg I ml in PBS ) containing 6 ul I 10 ul of 30 % H2o2. The colour reaction was stopped after 5 -10 minutes by washing the filters with distilled water.

apparatus. At the end of the run, the gel was equilibrated for 15 minutes in the transfer buffer ( 25 mM Tris base,, 192 mM glycine, 20% V/V methanol). Immunoblotting was performed essentially as described by Towbin et al., 1979 ) . The proteins-were blotted on to nitrocellulose Schleicher and Schuell ) for 16 hours in LKB Transphor apparatus. After the completion of electric transfer of proteins, the nitrocellulose paper was washed with PBS 10 mM sodium phosphate buffer, pH 7.4, 0.9 % saline for 10 minutes at room temperature, with gentle rocking to wash off any adhering traces of acrylamide gel. The filter was then stained with a dilute solution of amide black. This was made by diluting 5 fold with water, a solution of 0. 2 % ami do black containing 45 % v;v methanol and 10 % v;v acetic acid. The staining was done for 5 10 seconds and the filter washed immediately with distilled water. The proteins transferred to the gel could be seen at this stage. The lane containing protein molecular weight standards was cut out and . preserved by drying and storage in dark. The filter could be cut into appropriate lanes at this stage. The filter was destained by repeated washing with PBS containing 0.2 % Tween-20 ( PBST ) . After the filter destained completely, it was incubated with 3 % BSA made in PBST for 1 hour at room temperature. During this and in all the subsequent steps, incubation of the filter was performed on a rocker platform to ensure a uniform treatment. The filters were then incubated in the appropriate dilution of the primary antibody

Electrophoretic separation of protein samples was carried out on 12.5 % SDS-PAGE in a discontinuous system as described by Laemmli ( 1970 ). The samples were reduced by boiling for 3 minutes in sample buffer containing J3-mercaptoethanol. The samples were then centrifuged for 5 minutes at 10,000 rpm to pellet down all particulate matter, prior to loading on the gel. Electrophoresis was carried out at 100 volts in a LKB vertical slab gel electrophoresis

Western blot.

The culture supernates containing the assiociated hCG heterodimer as described above, were tested for their ability to inhibit hCG induced testosterone production by Leydig cells. Leydig cell suspensions were prepared from NMRI inbred adult male mice essentially by the procedure of Van Damme et al., 1974 with modifications. The procedure has been described previously Pal, 1989 and involved the measu~ement of the testosterone produced by the Leydig cells following stimulation with culture supernate containing the associated alpha and beta subunits of hCG.

Leydig cell bioassay.

then estimated by monitoring its competitive binding to the hCG recepto~ in the presence of radiolabelled hCG. The testes homogenates from 10 -14 week old Wistar outbred rats were prepared by the method of Dighe and Moudgal ( 1983 ), and the receptor assay 1975 ), with 1989 ) .

Culture supernate from stable clones secreting alpha hCG was mixed with the culture supernate from stable clones showing J3hCG activity. The mixing was done with shaking at 37°C for 16 hours, to allow the two subunits to associate. The presence of the heterodimer in the culture supernate was

Radioreceptor assay.

The RIA for alpha hCG was similar to that used to estimate ~hCG. A monoclonal antibody specific to alpha hCG ( Gupta et al. , 1985 was used for the assay. The standard used was total hCG.

RIA for alpha hCG.

added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.

J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was

Quantitative determination of alpha hCG or J3hCG was performed by RIA using subunit specific antisera.

Radioimmunoassays.

conjugated to fluorescene isothiocyanate ( FITC ) or horse radish peroxidase HRP ) , added. In case of the FITC staining, the cells were finally mounted in a medium containing 0. 1 % para-phenylenediamine PPD and 90 % glycerol in NKH buffer, to retard fading of the fluorescent label. In case of HRP staining, the colour was developed with 0. 05 % DAB ( 3', 3-diaminobenzidine tetrahydrochloride ) in NKH buffer with 0. 002 % hydrogen peroxide. The colour was developed for 15 mins. and the reaction stopped by rinsing in phosphate buffer. The cells were examined under a standard 1 ight microscope for HRP staining or a fluorescent microscope ( for FITC staining ) .

Cells were grown to subconfluence on polylysine coated glass coverslips contained in plastic dishes. After washing with NKH buffer ( 145 mM NaCl, 5 mM KCl, 15 mM Hepes, pH 7. 4 ) , the cells were fixed for 10 mins. in 70 % ethanol at room temperature. The cells were again rinsed extensively in NKH buffer and the appropriate dilution of primary antibody added. Following OIN incubation at 4°c, the cells were washed 3 X with NKH buffer and the appropriate second antibody,

Immunocytochemistry.

Following transfection with calcium phosphate or lipofectin, the cells were selected for neomycin resistance by using the analogue G418 Geniticin in the culture medium. After 48 ·hours post -transfection, the cells were harvested and replated at a lower density ( 0.5 x 104 cells I 60 mm dish). Culture medium containing G418 was then added to the cells. G418 was used at two concentrations -400 ug I ml and 500 ug 1 ml. The cells were cultured in G418 containing medium for 2 - 3 weeks. During this period, the mock transfected cells and the cells transfected with plasmid lacking neo gene, died and the transformed cells formed colonies. Individual G418 resistant colonies were picked up and propagated as independent clones. The culture supernates from these clones were analysed by RIA for BhCG. The stability of the BhCG secreting clones was assessed by culturing with several passages over a few weeks in media with or without G418.

Isolation of stable clones.

Lipofectin was kindly provided by Syntex, Inc., USA as an aqueous solution containing 1 mg I ml of 1 ipid ( DOTMA DOPE; 50 50 ). The procedure used was as described by Feigner et al., 1987 with appropriate I modifications as suggested in the user s notes. Lipofection was done with 0.5 x 106 cells seeded on a 60 mm plate. For each plasmid, the lipofection was performed in duplicate. The amount and quality of the plasmid DNA used ranged from 400 ng of crude DNA prepared by the mini prep method, to 5 ug of highly purified, cesium banded DNA. The appropriate amount of DNA was suspended in 1.5 ml of serum free DMEM. In another tube, 30 ug of lipofectin was suspended in 1.5 ml of serum free DMEM. The two solutions were mixed. The cells were washed twice with HBSS to totally wash off all traces of serum. The DNA 1 lipofectin mix was then applied to the cells and the cells incubated for 4 hours at 37°C. Next, 3 ml of media containing 10 % FCS was added and the incubation continued at 3 7°C for 16 hours. The culture supernate was then aspirated off and fresh medium added to the cells. The selection for stable clones was started after 48 hours by the procedure described below.

Using lipofectin.

PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.

Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with

Using calcium phosphate.

Stable transfection was performed into CHO-K1 cells by the following procedures

stable transfection.

rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.

ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were

1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass

Transient expression of the cloned gene product was studied by transfection performed with

Transient expression.