The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)
58 Matching Annotations
- May 2019
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
-
Insert DNA preparation
-
The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.
-
Determination of DNA quantity and purity
-
as well as commercial methods (MN kit, Germany; Mo-Bio kit, CA, USA; Zymo soil DNA kit, CA, USA) according to the manufacturer’s protocols and compared in terms of DNA yield and purity.
-
The soil DNA from Pantnagar and Lonar soil samples were also extracted by various manual (Desai and Madamwar, 2007; Agarwal et al., 2001; Yamamoto et al., 1998
-
Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.
-
Commercial kits
-
Comparison of yield and purity of crude DNA
-
Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min
-
PROTOCOL FOR OPTIMIZATION OF HUMIC ACID-FREE DNA FROM ALKALINE SOILS
Tags
- method-1-material-3-material-3
- method-1-material-3-material-1
- method-3-method-1
- method-1-material-3-material-1 detail
- method-1-material-3-material-2 detail
- method-3-method-1-detail
- method-1-material-3
- method-1-material-3-detail
- method-1-material-3-material-3 detail
- method-1-material-3-material-2
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.
-
Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,
-
Generation of ascites from mice
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
-
Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
-
Plasmid Construction
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
Media Composition and Bacterial Culture
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
-
solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
-
Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
-
Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)
-
incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
-
For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
-
Maintenance and revival of L.donovani culture
-
mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-Dmannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-Dgalactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
-
Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
-
(Scheme 13 of Results and Discussion)
-
Synthesis of S'-hemiacetal analogue90 of Gal 1,4~-Man-aphosphate acceptor
-
was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
-
[14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
-
Synthesis of [14C] labeled Stearyl linked Gal 1,4 f3 Man phosphate (Scheme 12 of Results and Discussion)
-
5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-aD-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
-
1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-Dmannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
-
Synthesis of Stearyl linked Gal 1,4 ~ Man phosphate (synthetic substrate for elongating-MPT activity)
-
Synthesis of Radiolabeled Exogenous Precursor of Phosphoglycan Biosynthesis
-
Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
-
Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
-
Synthesis of phosphoglycans by polycondensation
Tags
- Method-3-Method-3-Method-1-detail
- Method-2-Method-1-Method-3-detail
- Method-3-Method-1-Method-2-detail
- Method-3-Method-3-Method-1
- Method-4-Method-1-Method-3
- Method-3-Method-1-Method-1-detail
- Method-3-Method-1
- Method-3-Method-1-Method-2
- Method-4-Method-1-Method-3-detail
- Method-3-Method-2-Method-1
- Method-3-Method-2-Method-1-detail
- Method-3-Method-1-Method-1
- Method-2-Method-1-Method-3
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
-
Localization of the expressed recombinant protein in COS-1 cells
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
PCR amplification of rG cDNAs
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
-
fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
-
GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
-
Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
-
Expression analysis of Drosophila Embryos
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
A total of 150 fungal and 150 bacterial isolates were screened qualitatively and quantitatively for their ability to produce the enzyme, tannase.
-
Screening and selection of potential tannase producers
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
For high fidelity PCR, Herculase II fusion DNA polymerase (AgilentTechnologies)was used. Approximately 0.5μg of chromosomal DNAwas used as a template in a 50μl reaction volume
-
The PCRs were normally performed using Taqpolymerasefrom Roche or Fermentas. Approximately 1-5ng of plasmid or 5-100ng of chromosomal DNA was used as a template in a50μlreaction volume containing 200μM of each dNTP, 20pM each of the forward and reverse primers and 1 unit of Taq DNA polymerase. For colony PCR E. coli cells from a freshly grown plate were resuspended in 10μl of sterile Milli-Q water to get a cell suspension and this was used as a template in a PCR reaction at a final volume of 50μl. The samples were typically subjected to 30 cycles of amplification with the following general conditions: Initial denaturation 95ºC5minutes Denaturation 95ºC 1 minute Annealing 55ºC 1 minute Extension 72ºC 1 minute/kb of DNA template to be amplified Final extension 72ºC 10 minutes
-
Polymerase Chain Reaction (PCR)
-
desired temperaturefor 45 minutes and plated on an appropriate selective medium at various dilutions. An aliquot of cell suspension to which plasmid DNA was not added served as a negative control. B. Inoue method i. Preparation of high efficiency competent cells Competent cells for high efficiency transformation were prepared by the method of (Inoueet al., 1990)with few modifications. An overnight culture of the strain (routinely DH5α) was subculturedinto fresh sterile LB broth in 1:100 dilutions and grown at 18ºC to anA600of 0.55. The cells were harvested by centrifugation at 2500rpm for 10 minutes at4ºC. Thesecells wereresuspended in0.4 volumes of INOUE buffer andincubated in ice for 10 minutes. The cells were recovered by centrifugation at 2500rpm at 4ºC for 10 minutes and finally resuspended in 0.01 volume of the same buffer. Sterile DMSO was added to a final concentration of 7%. After incubating for 10 minutes in ice, the cells were aliquoted in 100μl volumes, snap frozen in liquid nitrogen and stored at –80ºC. ii. Transformation protocolFor transformation, the required number of vials wasthawed on ice and the transformation protocol as described for CaCl2method was employed
-
A. Calcium chloride(CaCl2)method For routine plasmid transformation, following method which is a modification of that described by(Cohenet al.,1972)was used. An overnight culture of recipient strain was subcultured 1:100 in fresh LB medium and grown till mid-exponential phase. The culture was chilled on ice for 20 minutes, and the steps thereafter performed at 4ºC. 10 ml of culture was centrifuged and pelletwas resuspended in 5 ml of 0.1M CaCl2. After 5 minutes of incubation on ice, the cells were again centrifuged and resuspended in 1ml of 0.1M CaCl2. The suspension was incubated onice for 45 minutes. To the 100μl aliquot of the cellsuspension plasmid DNA (20-200ng in less than 10μl volumes) was added, incubated for 30-40 minutes on ice and given a heat shock for 90 seconds at 42ºC. The cultures were rapidly chilled for 1 minute, mixed with 0.9ml of LB broth and incubated at
-
Transformation
-