Reviewer #3 (Public Review):

In this study, the authors utilized the Adolescent Brain Cognitive Development dataset to investigate the relationship between structural and functional brain network patterns and dimensions of psychopathology. They identified multiple components, including a general psychopathology (p) factor that exhibited a strong association with multimodal imaging features. The connectivity signatures associated with the p factor and neurodevelopmental dimensions aligned with the sensory-to-transmodal axis of cortical organization, which is linked to complex cognition and psychopathology risk. The findings were consistent across two separate subsamples and remained robust when accounting for variations in analytical parameters, thus contributing to a better understanding of the biological mechanisms underlying psychopathology dimensions and offering potential brain-based vulnerability markers.

Strengths:<br /> - An intriguing aspect of this study is the integration of multiple neuroimaging modalities, combining structural and functional measures, to comprehensively assess the covariance with various symptom combinations. This approach provides a multidimensional understanding of the risk patterns associated with mental illness development.

- The paper delves deeper into established behavioral latent variables such as the p factor, internalizing, externalizing, and neurodevelopmental dimensions, revealing their distinct associations with morphological and intrinsic functional connectivity signatures. This sheds light on the neurobiological underpinnings of these dimensions.

- The robustness of the findings is a notable strength, as they were validated in a separate replication sample and remained consistent even when accounting for different parameter variations in the analysis methodology. This reinforces the generalizability and reliability of the results.

Weaknesses:

- Based on their findings, the authors suggest that the observed variations in resting-state functional connectivity may indicate shared neurobiological substrates specific to certain symptoms. However, it should be noted that differences in resting-state connectivity between groups can stem from various factors, as highlighted in the existing literature. For instance, discrepancies in the interpretation of instructions during the resting state scan can influence the results. Hence, while their findings may indicate biological distinctions, they could also reflect differences in behavior.

- The authors conducted several analyses to investigate the relationship between imaging loadings associated with latent components and the principal functional gradient. They found several associations between principal gradient scores and both within- and between-network resting-state functional connectivity (RSFC) loadings. Assessing the analysis presented here proves challenging due to the nature of relating loadings, which are partly based on the RSFC, to gradients derived from RSFC. Consequently, a certain level of correlation between these two variables would be expected, making it difficult to determine the significance of the authors' findings. It would be more intriguing if a direct correlation between the composite scores reflecting behavior and the gradients were to yield statistically significant results.

- Lastly, regarding the interpretation of the first identified latent component, I have some reservations. Upon examining the loadings, it appears that LC1 primarily reflects impulse control issues rather than representing a comprehensive p-factor. Furthermore, it is worth noting that within the field, there is an ongoing debate concerning the interpretation and utilization of the p-factor. An insightful publication on this topic is "The p factor is the sum of its parts, for now" (Fried et al, 2021), which explains that the p-factor emerges as a result of a positive manifold, but it does not necessarily provide insights into the underlying mechanisms that generated the data.

Reviewer #1 (Public Review):

In this manuscript, the authors present Tronko, a novel tool for performing phylogenetic assignment of DNA sequences using an approximate likelihood approach. Through a benchmark experiment utilizing several real datasets from mock communities with pre-known composition as well as simulated datasets, the authors show that Tronko is able to achieve higher accuracy than several existing best-practice methods with runtime comparable to the fastest existing method, albeit with significantly higher peak memory usage than existing methods. The benchmark experiment was thorough, and the results clearly support the authors' conclusions. However, the paper could be improved by exploring how certain design choices (e.g. tool selection and parameter choices) may impact Tronko's performance/accuracy, and some relevant existing phylogenetic placement tools are missing and should be included.

Reviewer #2 (Public Review):

This is, to my knowledge, the most scalable method for phylogenetic placement that uses likelihoods. The tool has an interesting and innovative means of using gaps, which I haven't seen before. In the validation the authors demonstrate superior performance to existing tools for taxonomic annotation (though there are questions about the setup of the validation as described below).

The program is written in C with no library dependencies. This is great. However, I wasn't able to try out the software because the linking failed on Debian 11, and the binary artifact made by the GitHub Actions pipeline was too recent for my GLIBC/kernel. It'd be nice to provide a binary for people stuck on older kernels (our cluster is still on Ubuntu 18.04). Also, would it be hard to publish your .zipped binaries as packages?

Thank you for publishing your source files for the validation on zenodo. Please provide a script that would enable the user to rerun the analysis using those files, either on zenodo or on GitHub somewhere.

The validations need further attention as follows.

First, the authors have not chosen data sets that are not well-aligned with real-world use cases for this software, and as a result, its applicability is difficult to determine. First, the leave-one-species-out experiment made use of COI gene sequences representing 253 species from the order Charadriiformes, which includes bird species such as gulls and terns. What is the reasoning for selecting this data set given the objective of demonstrating the utility of Tronko for large scale community profiling experiments which by their nature tend to include microorganisms as subjects? If the authors are interested in evaluating COI (or another gene target) as a marker for characterizing the composition of eukaryotic populations, is the heterogeneity and species distribution of bird species within order Charadriiformes comparable to what one would expect in populations of organisms that might actually be the target of a metagenomic analysis?

Second, It appears that experiments evaluating performance for 16S were limited to reclassification of sequencing data from mock communities described in two publications, Schirmer (2015, 49 bacteria and 10 archaea, all environmental), and Gohl (2016; 20 bacteria - this is the widely used commercial mock community from BEI, all well-known human pathogens or commensals). The authors performed a comparison with kraken2, metaphlan2, and MEGAN using both the default database for each as well as the same database used for Tronko (kudos for including the latter). This pair of experiments provide a reasonable high-level indication of Tronko's performance relative to other tools, but the total number of organisms is very limited, and particularly limited with respect to the human microbiome. It is also important to point out that these mock communities are composed primarily of type strains and provide limited species-level heterogeneity. The performance of these classification tools on type strains may not be representative of what one would find in natural samples. Thus, the leave-one-individual-out and leave-one-species-out experiments would have been more useful and informative had they been applied to extended 16S data sets representing more ecologically realistic populations.

Finally, the authors should describe the composition of the databases used for classification as well as the strategy (and toolchain) used to select reference sequences. What databases were the reference sequences drawn from and by what criteria? Were the reference databases designed to reflect the composition of the mock communities (and if so, are they limited to species in those communities, or are additional related species included), or have the authors constructed general purpose reference databases? How many representatives of each species were included (on average), and were there efforts to represent a diversity of strains for each species? The methods should include a section detailing the construction of the data sets: as illustrated in this very study, the choice of reference database influences the quality of classification results, and the authors should explain the process and design considerations for database construction.

Reviewer #3 (Public Review):

Pipes and Nielsen propose a valuable new computational method for assigning individual Next Generation Sequencing (NGS) reads to their taxonomic group of origin, based on comparison with a dataset of reference metabarcode sequences (i.e. using an existing known marker sequence such as COI or 16S). The underlying problem is an important one, with broad applications such as identifying species of origin of smuggled goods, identifying the composition of metagenomics/ microbiomics samples, or detecting the presence of pathogen variants of concern from wastewater surveillance samples. Pipes and Nielsen propose (and make available with open source software) new computational methods, apply those methods to a series of exemplar data analyses mirroring plausible real-life scenarios, and compare the new method's performance to that of various field-leading alternative methods.

In terms of methodology, the manuscript presents a novel computational analyses inspired by standard existing probabilistic phylogenetic models for the evolution of genome sequences. These form the basis for comparisons of each NGS read with a reference database of known examples spanning the taxonomic range of interest. The evolutionary aspects of the models are used (a) to statistically represent knowledge about the reference organisms (and uncertainty about their common ancestors) and their evolutionary relationships; and (b) to derive inferences about the relationship of the sample NGS reads that may be derived from reference organisms or from related organisms not represented in the reference dataset. This general approach has been considered previously and, while expected to be powerful in principle, the reliance of those methods on likelihood computations over a phylogenetic tree structure means they are slow to the point of useless on modern-sized problems that may have many thousands of reference sequences and many millions of NGS reads. Alternative methods that have been devised to be computationally feasible have had to sacrifice the phylogenetic approach, with a consequent loss of statistical power.

Pipes and Nielsen's methodology contribution in this manuscript is to make a series of approximations to the 'ideal' phylogenetic likelihood analysis, aimed at saving computational time and keeping computer memory requirements acceptable whilst retaining as much as possible of the expected power of phylogenetic methods. Their description of their novel methods is solid; as they are largely approximations to other existing methods, their value ultimately will rest with the success of the method in application.

Regarding the application of the new methods, to compare the accuracy of their method with a selection of existing methods the authors use 1) simulated datasets and 2) previously published mock community datasets to query sequencing reads against appropriate reference trees. The authors show that Tronko has a higher success at assigning query reads (at the species/genus/family level) than the existing tools with both datasets. In terms of computational performance, the authors show Tronko outperforms another phylogenetic tool, and is still within reasonable limits when compared with other 'lightweight' tools.

As a demonstration of the power of phylogeny-based methods for taxonomic assignment, this ms. could gain added importance by refocusing the community towards explicitly phylogenetic methods. We agree with the authors that this would be likely to give rise to the most powerful possible methods.

Strengths of this ms. are 1) the focus on phylogenetic approaches and 2) the reduction of a consequently difficult computational problem to a practical method (with freely available software); 3) the reminder that these approaches work well and are worthy of continued interest and development; and ultimately most-importantly 4) the creation of a powerful tool for taxonomic assignment that seems to be at least as good as any other and generally better.

Weaknesses of the manuscript at present are 1) lack of consideration of some other existing methods and approaches, as it would be interesting to know if other ideas had been tried and rejected, or were not compatible with the methods created; 2) some over-simplifications in the description of new methods, with some aspects difficult or impossible to reproduce and some claims unsubstantiated. Further, 3) we are not convinced enough weight has been given to the complexity of 'pre-processing' the reference dataset for each metabarcode (e.g. gene) of interest, which may give the impression that the method is easier to apply to new reference datasets than we think would be the case. Lastly, 4) we encountered some difficulties getting the software installed and running on our computers. It was not possible to resolve every issue in the time available to us to perform our review, and some processing options remain untested.

Overall, the methods that Pipes and Nielsen propose represent an important contribution that both creates a computational resource that is immediately valuable to the community, and emphasises the benefits of phylogenetic methods and provides encouragement for others to continue to work in this area to create still-better methods.

Reviewer #1 (Public Review):

In this manuscript, Perez-Lopez et al. examine the function of the chemokine CCL28, which is expressed highly in mucosal tissues during infection, but its role during infection is poorly understood. They find that CCL28 promotes neutrophil accumulation in the intestines of mice infected with Salmonella and in the lungs of mice infected with Acinetobacter. They find that Ccl28-/- mice are highly susceptible to Salmonella infection, and highly resistant and protected from lethality following Acinetobacter infection. They find that neutrophils express the CCL28 receptors CCR3 and CCR10. CCR3 was pre-formed and intracellular and translocated to the cell surface following phagocytosis or inflammatory stimuli. They also find that CCL28 stimulation of CCR3 promoted neutrophil antimicrobial activity, ROS production, and NET formation, using a combination of primary mouse and human neutrophils for their studies. Overall, the authors' findings provide new and fundamental insight into the role of the CCL28:CCR3 chemokine:chemokine receptor pair in regulating neutrophil recruitment and effector function during infection with the intestinal pathogen Salmonella Typhimurium and the lung pathogen Acinetobacter baumanii.

Reviewer #2 (Public Review):

In this manuscript by Perez-Lopez et al., the authors investigate the role of the chemokine CCL28 during bacterial infections in mucosal tissues. This is a well-written study with exciting results. They show a role for CCL28 in promoting neutrophil accumulation to the guts of Salmonella-infected mice and to the lung of mice infected with Acinetobacter. Interestingly, the functional consequences of CCL28 deficiency differ between infections with the two different pathogens, with CCL28-deficiency increasing susceptibility to Salmonella, but increasing resistance to Acinetobacter. The underlying mechanistic reasons for this suggest roles for CCL28 in enhanced neutrophil antimicrobial activity, production of reactive oxygen species, and formation of extracellular traps. However, additional experiments are required to shore up these mechanisms, including addressing the role of other CCL28-dependent cell types and further characterization of neutrophils from CCL28-deficient mice.

Reviewer #3 (Public Review):

The manuscript by Perez-Lopez and colleagues uses a combination of in vivo studies using knockout mice and elegant in vitro studies to explore the role of the chemokine CCL28 during bacterial infection on mucosal surfaces. Using the streptomycin model of Salmonella Typhimurium (S. Tm) infection, the authors demonstrate that CCL28 is required for neutrophil influx in the intestinal mucosa to control pathogen burden both locally and systemically. Interestingly, CCL28 plays the opposite role in a model lung infection by Acinetobacter baumanii, as Ccl28-/- mice are protected from Acinetobacter infection. Authors suggest that the mechanism by which CCL28 plays a role during bacterial infection is due to its role in modulating neutrophil recruitment and function.

The major strengths of the manuscript are:

The novelty of the findings that are described in the manuscript. The role of the chemokine CCL28 in modulating neutrophil function and recruitment in mucosal surfaces is intriguing and novel.

Authors use Ccl28-/- mice in their studies, a mouse strain that has only recently been available. To assess the impact of CCL28 on mucosal surfaces during pathogen-induced inflammation, the authors choose not one but two models of bacterial infection (S. Tm and A. baumanii). This approach increases the rigor and impact of the data presented.

Authors combine the elegant in vivo studies using Ccl28 -/- with in vitro experiments that explore the mechanisms by which CCL28 affects neutrophil function.

The major weaknesses of the manuscript in its present form are:

Authors use different time points in the S. Tm model to characterize the influx of immune cells and pathology. They do not provide a clear justification as to why distinct time points were chosen for their analysis.

Authors provide puzzling data that Ccl28-/- mice have the same numbers of CCR3 and CCR10-expressing neutrophils in the mucosa during infection. It is unclear why the lack of CCL28 expression would not affect the recruitment of neutrophils that express the ligands (CCR3 and CCR10) for this chemokine. Thus, these results need to be better explained.

The in vitro studies focus primarily on characterizing how CCL28 affects the function of neutrophils in response to S. Tm infection. There is a lack of data to demonstrate whether Acinetobacter affects CCR3 and CCR10 expression and recruitment to the cell surface and whether CCL28 plays any role in this process.

Reviewer #2 (Public Review):

This work describes a novel bipotent differentiation capacity of human muscle progenitors marked by CD56 and CD29. In addition to previously well-known myogenic differentiation potential, the authors discovered these progenitors could also be induced into tenocyte-like cells. They describe the sorted CD56+/CD29+ cells not only differentiate into tenocytes in vitro; they were also able to engraft into injured tendons and repair damaged tendons when transplanted into nude mice. Human MuSC transplantation improved the locomotor function and physiological strength of the tendon-injured mice. The authors further observed that this bipotent differentiation potential was specific to human MuSC, the same cell population isolated from mice remains unipotent to myogenic differentiation and not capable of tenocytic differentiation.

The discovery of the tenocyte differentiation potential of human CD56+/CD29+ MuSCs provides a potential cell therapeutic option for tendon injury. This work may have a significant clinical impact on improving treatment outcomes for patients suffering from tendon injury.

Strength of the paper:

Multimodal experimental approach using both in vitro and in vivo experiments provided strong proof for the differentiation capacity of the human MuSCs into tenocytes, and the potential clinical implication of these cells in the treatment of tendon injury in patients by in vivo transplantation assay. Using RNA sequencing to characterise the differentiated myocytic and tenocytic populations proved global expression profile data which have shown non-biased efficiency information to the in vitro differentiated cells.

The comparison of differentiation potentials of human and mouse MuSCs is interesting and clinically meaningful. This work illustrates that animal studies may not always be clinically relevant in studying human diseases and treatment modalities.

Weaknesses:

scRNAseq assay using total mononuclear cell population did not provide meaningful insight that enriched knowledge on CD56+/CD29+ cell population. CD56+/CD29+ cells information may have been lost due to the minority identity of these cells in the total skeletal muscle mononuclear population, especially given the total cell number used for scRNAseq was very low and no information on participant number and repeat sample number used for this assay. Using this data to claim a stem cell lineage relationship for MuSCs and tenocytes may not convincing, as seeing both cell types in the total muscle mononuclear population does not establish a lineage connection between them.

The TGF-b pathway assay uses a small molecular inhibitor of TGF-b to probe Smad2/3. The assay conclusion regarding Smad2/3 pathway responsible for tenocyte differentiation may be overinterpretation without Smad2/3 specific inhibitors being applied in the experiments.

Reviewer #3 (Public Review):<br /> Summary:

In this manuscript, the authors present compelling evidence that CD29+/CD56+ stem/progenitor cells from human muscle biopsies show tenogenic differentiation ability both in vitro and in vivo, alongside their myogenic potential.

Strengths:

The methodology and results are convincing. CD29+/CD56+ stem/progenitor cells were transplanted into immunodeficient mice with a tendon injury, and human cells expressing tenogenic markers contributed to the repair of the injured tendon. Furthermore, the authors also show better tendon biomechanical properties and plantarflexion force after transplantation.

Weaknesses:

This dual differentiation capability was not observed in mouse muscle stem cells.

Reviewer #1 (Public Review):

Through a combination of in vitro and in vivo analyses, the authors demonstrate that CD56/CD29 positive progenitor cells from human muscle can be driven towards muscle or tendon fate in vitro and are able to contribute to muscle and tendon fates following transplantation in injured mice. This is in contrast to Pax7-lineage cells from mice which do not contribute to tendon repair in vivo. While the data strongly support that a subset of cells captured by this sorting strategy has tenogenic potential, their claims of progenitor bi-potency are not fully supported by the data as currently presented.

As discussed below, some aspects of the data analysis and sample preparation are incomplete and should be clarified to fully support the claims of the paper.

For the colony analysis, it is unclear from the methods and main text whether the initial individual sorted colonies were split and subject to different conditions to support the claim of bi-potency. The finding that 40% of colonies displayed tenogenic differentiation, may instead suggest heterogeneity of the sorted progenitor population. The methods as currently described, suggest that two different plates were subject to different induction conditions. It is therefore difficult to assess the strength of the claim of bi-potency.

This group uses the well-established CD56+/CD29+ sorting strategy to isolate muscle progenitor cells, however recent work has identified transcriptional heterogeneity within these human satellite cells (ie Barruet et al, eLife 2020). Given that they identify a tenocyte population in their human muscle biopsy in Figure 1a, it is critical to understand the heterogeneity contained within the population of human progenitors captured by the authors' FACS strategy and whether tenocytes contained within the muscle biopsy are also CD56+/CD29+.

The bulk RNA sequencing data presented in Figure 3 to contrast the expression of progenitor cells under different differentiation conditions are not sufficiently convincing. In particular, it is unclear whether more than one sample was used for the RNAseq analyses shown in Figure 3. The volcano plots have many genes aligned on distinct curves suggesting that there are few replicates or low expression. There is also a concern that the sorted cells may contain tenocytes as tendon genes SCX, MKX, and THBS4 were among the genes upregulated in the myogenic differentiation conditions (shown in Figure 3b).

Reviewer #3 (Public Review):

Summary:

This study investigates the salt-dependent phase separation of A1-LCD, an intrinsically disordered region of hnRNPA1 implicated in neurodegenerative diseases. The authors employ all-atom molecular dynamics (MD) simulations to elucidate the molecular mechanisms by which salt influences A1-LCD phase separation. Contrary to typical intrinsically disordered protein (IDP) behavior, A1-LCD phase separation is enhanced by NaCl concentrations above 100 mM. The authors identify two direct effects of salt: neutralization of the protein's net charge and bridging between protein chains, both promoting condensation. They also uncover an indirect effect, where high salt concentrations strengthen pi-type interactions by reducing water availability. These findings provide a detailed molecular picture of the complex interplay between electrostatic interactions, ion binding, and hydration in IDP phase separation.

Strengths:

• Novel Insight: The study challenges the prevailing view that salt generally suppresses IDP phase separation, highlighting A1-LCD's unique behavior.<br /> • Rigorous Methodology: The authors utilize all-atom MD simulations, a powerful computational tool, to investigate the molecular details of salt-protein interactions.<br /> • Comprehensive Analysis: The study systematically explores a wide range of salt concentrations, revealing a nuanced picture of salt effects on phase separation.<br /> • Clear Presentation: The manuscript is well-written and logically structured, making the findings accessible to a broad audience.

Weaknesses:

• Limited Scope: The study focuses solely on the truncated A1-LCD, omitting simulations of the full-length protein. This limitation reduces the study's comparative value, as the authors note that the full-length protein exhibits typical salt-dependent behavior. A comparative analysis would strengthen the manuscript's conclusions and broaden its impact.

Overall, this manuscript represents a significant contribution to the field of IDP phase separation. The authors' findings provide valuable insights into the molecular mechanisms by which salt modulates this process, with potential implications for understanding and treating neurodegenerative diseases. While the study is well-conducted and clearly presented, further research is needed to validate the findings and explore their broader applicability.

Reviewer #1 (Public Review):

Summary:

The authors examined the salt-dependent phase separation of the low-complexity domain of hnRN-PA1 (A1-LCD). Using all-atom molecular dynamics simulations, they identified four distinct classes of salt dependence in the phase separation of intrinsically disordered proteins (IDPs), which can be predicted based on their amino acid composition. However, the simulations and analysis, in their current form, are inadequate and incomplete.

Strengths:

The authors attempt to unravel the mechanistic insights into the interplay between salt and protein phase separation, which is important given the complex behavior of salt effects on this process. Their effort to correlate the influence of salt on the low-complexity domain of hnRNPA1 (A1-LCD) with a range of other proteins known to undergo salt-dependent phase separation is an interesting and valuable topic.

Weaknesses:

(1) The simulations performed are not sufficiently long (Figure 2A) to accurately comment on phase separation behavior. The simulations do not appear to have converged well, indicating that the system has not reached a steady state, rendering the analysis of the trajectories unreliable.

(2) The majority of the data presented shows no significant alteration with changes in salt concentration. However, the authors have based conclusions and made significant comments regarding salt activities. The absence of error bars in the data representation raises questions about its reliability. Additionally, the manuscript lacks sufficient scientific details of the calculations.

(3) In Figures 2B and 2C, the changes in the radius of gyration and the number of contacts do not display significant variations with changes in salt concentration. The change in the radius of gyration with salt concentration is less than 1 Å, and the number of contacts does not change by at least 1. The authors' conclusions based on these minor changes seem unfounded.

Reviewer #2 (Public Review):

This is an interesting computational study addressing how salt affects the assembly of biomolecular condensates. The simulation data are valuable as they provide a degree of atomistic details regarding how small salt ions modulate interactions among intrinsically disordered proteins with charged residues, namely via Debye-like screening that weakens the effective electrostatic interactions among the polymers, or through bridging interactions that allow interactions between like charges from different polymer chains to become effectively attractive (as illustrated, e.g., by the radial distribution functions in Supplementary Information). However, this manuscript has several shortcomings: (i) Connotations of the manuscript notwithstanding, many of the authors' concepts about salt effects on biomolecular condensates have been put forth by theoretical models, at least back in 2020 and even earlier. Those earlier works afford extensive information such as considerations of salt concentrations inside and outside the condensate (tie-lines). But the authors do not appear to be aware of this body of prior works and therefore missed the opportunity to build on these previous advances and put the present work with its complementary advantages in structural details in the proper context. (ii) There are significant experimental findings regarding salt effects on condensate formation [which have been modeled more recently] that predate the A1-LCD system (ref.19) addressed by the present manuscript. This information should be included, e.g., in Table 1, for sound scholarship and completeness. (iii) The strengths and limitations of the authors' approach vis-à-vis other theoretical approaches should be discussed with some degree of thoroughness (e.g., how the smallness of the authors' simulation system may affect the nature of the "phase transition" and the information that can be gathered regarding salt concentration inside vs. outside the "condensate" etc.). Accordingly, this manuscript should be revised to address the following. In particular, the discussion in the manuscript should be significantly expanded by including references mentioned below as well as other references pertinent to the issues raised.

(1) The ability to use atomistic models to address the questions at hand is a strength of the present work. However, presumably because of the computational cost of such models, the "phase-separated" "condensates" in this manuscript are extremely small (only 8 chains). An inspection of Fig.1 indicates that while the high-salt configuration (snapshot, bottom right) is more compact and droplet-like than the low-salt configuration (top right), it is not clear that the 50 mM NaCl configuration can reasonably correspond to a dilute or homogeneous phase (without phase separation) or just a condensate with a lower protein concentration because the chains are still highly associated. One may argue that they become two droplets touching each other (the chains are not fully dispersed throughout the simulation box, unlike in typical coarse-grained simulations of biomolecular phase separation). While it may not be unfair to argue from this observation that the condensed phase is less stable at low salt, this raises critical questions about the adequacy of the approach as a stand-alone source of theoretical information. Accordingly, an informative discussion of the limitation of the authors' approach and comparisons with results from complementary approaches such as analytical theories and coarse-grained molecular dynamics will be instructive-even imperative, especially since such results exist in the literature (please see below).

(2) The aforementioned limitation is reflected by the authors' choice of using Dmax as a sort of phase-separation order parameter. However, no evidence was shown to indicate that Dmax exhibits a two-state-like distribution expected of phase separation. It is also not clear whether a Dmax value corresponding to the linear dimension of the simulation box was ever encountered in the authors' simulated trajectories such that the chains can be reliably considered to be essentially fully dispersed as would be expected for the dilute phase. Moreover, as the authors have noted in the second paragraph of the Results, the variation of Dmax with simulation time does not show a monotonic rank order with salt concentration. The authors' explanation is equivalent to stipulating that the simulation system has not fully equilibrated, inevitably casting doubt on at least some of the conclusions drawn from the simulation data.

(3) With these limitations, is it realistic to estimate possible differences in salt concentration between the dilute and condensed phases in the present work? These features, including tie-lines, were shown to be amenable to analytical theory and coarse-grained molecular dynamics simulation (please see below).

(4) In the comparison in Fig.2B between experimental and simulated radius of gyration as a function of [NaCl], there is an outlier among the simulated radii of gyration at [NaCl] ~ 250 mM. An explanation should be offered.

(5) The phenomenon of no phase separation at zero and low salt and phase separation at higher salt has been observed for the IDP Caprin1 and several of its mutants [Wong et al., J Am Chem Soc 142, 2471-2489 (2020) [https://pubs.acs.org/doi/full/10.1021/jacs.9b12208], see especially Fig.9 of this reference]. This work should be included in the discussion and added to Table 1.

(6) The authors stated in the Introduction that "A unifying understanding of how salt affects the phase separation of IDPs is still lacking". While it is definitely true that much remains to be learned about salt effects on IDP phase separation, the advances that have already been made regarding salt effects on IDP phase separation is more abundant than that conveyed by this narrative. For instance, an analytical theory termed rG-RPA was put forth in 2020 to provide a uniform (unified) treatment of salt, pH, and sequence-charge-pattern effects on polyampholytes and polyelectrolytes (corresponding to the authors' low net charge and high net charge cases). This theory offers a means to predict salt-IDP tie-lines and a comprehensive account of salt effect on polyelectrolytes resulting in a lack of phase separation at extremely low salt and subsequent salt-enhanced phase separation (similar to the case the authors studied here) and in some cases re-entrant phase separation or dissolution [Lin et al., J Chem Phys 152. 045102 (2020) [https://doi.org/10.1063/1.5139661]]. This work is highly relevant and it already provided a conceptual framework for the authors' atomistic results and subsequent discussion. As such, it should definitely be a part of the authors' discussion.

(7) Bridging interactions by small ions resulting in effective attractive interactions among polyelectrolytes leading to their phase separation have been demonstrated computationally by Orkoulas et al., Phys Rev Lett 90, 048303 (2003) [https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.90.048303]. This result should also be included in the discussion.

(8) More recently, the salt-dependent phase separations of Caprin1, its RtoK variants and phosphorylated variant (see item #5 above) were modeled (and rationalized) quite comprehensively using rG-RPA, field-theoretic simulation, and coarse-grained molecular dynamics [Lin et al., arXiv:2401.04873 [https://arxiv.org/abs/2401.04873]], providing additional data supporting a conceptual perspective put forth in Lin et al. J Chem Phys 2020 (e.g., salt-IDP tie-lines, bridging interactions, re-entrance behaviors etc.) as well as in the authors' current manuscript. It will be very helpful to the readers of eLife to include this preprint in the authors' discussion, perhaps as per the authors' discretion-along the manner in which other preprints are referenced and discussed in the current version of the manuscript.

Reviewer #2 (Public Review):

This manuscript offers significant insights into the impact of maternal obesity on oocyte methylation and its transgenerational effects. The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, to explore how high-fat diet (HFD)-induced obesity alters genomic methylation in oocytes and how these changes are inherited by subsequent generations. The findings suggest that maternal obesity induces hyper-methylation in oocytes, which is partly transmitted to F1 and F2 oocytes and livers, potentially contributing to metabolic disorders in offspring. Notably, the study identifies melatonin as a key regulator of this hyper-methylation process, mediated through the cAMP/PKA/CREB pathway.

Strengths:

The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, and provides convincing data.

Weaknesses:

The description in the results section is somewhat verbose. This section (lines 126~227) utilized transgenerational breeding experiments and methylation analysis to demonstrate that maternal obesity-induced alterations in oocyte methylation (including hyper-DMRs and hypo-DMRs) can be partially transmitted to F1 and F2 oocytes and livers. The authors should consider condensing and revising this section for clarity and brevity.

There is a contradiction with Reference 3, but the discrepancy is not discussed. In this study, the authors observed an increase in global methylation in oocytes from HFD mice, whereas Reference 3 indicates Stella insufficiency in oocytes from HFD mice. This Stella insufficiency should lead to decreased methylation (Reference 33). There should be a discussion of how this discrepancy can be reconciled with the authors' findings.

Reviewer #1 (Public Review):

With socioeconomic development, more and more people are obese which is an important reason for sub-fertility and infertility. Maternal obesity reduces oocyte quality which may be a reason for the high risk of metabolic diseases for offspring in adulthood. Yet the underlying mechanisms are not well elucidated. Here the authors examined the effects of maternal obesity on oocyte methylation. Hyper-methylation in oocytes was reported by the authors, and the altered methylation in oocytes may be partially transmitted to F2. The authors further explored the association between the metabolome of serum and the altered methylation in oocytes. The authors identified decreased melatonin. Melatonin is involved in regulating the hyper-methylation of high-fat diet (HFD) oocytes, via increasing the expression of DNMTs which is mediated by the cAMP/PKA/CREB pathway.

Strengths:

This study is interesting and should have significant implications for the understanding of the transgenerational inheritance of GDM in humans.

Weaknesses:

The link between altered DNA methylation and offspring metabolic disorders is not well elucidated; how the altered DNA methylation in oocytes escapes reprogramming in transgenerational inheritance is also unclear.

Reviewer #3 (Public Review):

Summary:

Maternal obesity is a health problem for both pregnant women and their offspring. Previous works including work from this group have shown significant DNA methylation changes for offspring of obese pregnancies in mice. In this manuscript, Chao et al digested the potential mechanisms behind the DNA methylation changes. The major observations of the work include transgenerational DNA methylation changes in offspring of maternal obesity, and metabolites such as methionine and melatonin correlated with the above epigenetic changes. Exogenous melatonin treatment could reverse the effects of obesity. The authors further hypothesized that the linkage may be mediated by the cAMP/PKA/CREB pathway to regulate the expression of DNMTs.

Strengths:

The transgenerational change of DNA methylation following HFD is of great interest for future research to follow. The metabolic treatment that could change the DNA methylation in oocytes is also interesting and has potential relevance to future clinical practice.

Weaknesses:

The HFD oocytes have more 5mC signal based on staining and sequencing (Fig 1A-1F). However, the authors also identified almost equal numbers of hyper- and hypo-DMRs, which raises questions regarding where these hypo-DMRs were located and how to interpret their behaviors and functions. These questions are also critical to address in the following mechanistic dissections as the metabolic treatments may also induce bi-directional changes of DNA methylation. The authors should carefully assess these conflicts to make the conclusions solid.

The transgenerational epigenetic modifications are controversial. Even for F0 offspring under maternal obesity, there were different observations compared to this work (Hou, YJ., et al. Sci Rep, 2016). The authors should discuss the inconsistencies with previous works.

In addition to the above inconsistencies, the DNA methylation analysis in this work was not carefully evaluated. Several previous works were evaluating the DNA methylation in mice oocytes, which showed global methylation levels of around 50% (Shirane K, et al. PLoS Genet, 2013; Wang L., et al, Cell, 2014). In Figure 1E, the overall methylation level is about 23% in control, which is significantly different from previous works. The authors should provide more details regarding the WGBS procedure, including but not limited to sequencing coverage, bisulfite conversion rate, etc.

Reviewer #3 (Public Review):

This study tests for dissociable neural representations of an observed action's kinematics vs. its physical effect in the world. Overall, it is a thoughtfully conducted study that convincingly shows that representations of action effects are more prominent in the anterior inferior parietal lobe (aIPL) than the superior parietal lobe (SPL), and vice versa for the representation of the observed body movement itself. The findings make a fundamental contribution to our understanding of the neural mechanisms of goal-directed action recognition, but there are a couple of caveats to the interpretation of the results that are worth noting:

(1) Both a strength of this study and ultimately a challenge for its interpretation is the fact that the animations are so different in their visual content than the other three categories of stimuli. On one hand, as highlighted in the paper, it allows for a test of action effects that is independent of specific motion patterns and object identities. On the other hand, the consequence is also that Action-PLD cross-decoding is generally better than Action-Anim cross-decoding across the board (Figure 3A) - not surprising because the spatiotemporal structure is quite different between the actions and the animations. This pattern of results makes it difficult to interpret a direct comparison of the two conditions within a given ROI. For example, it would have strengthened the argument of the paper to show that Action-Anim decoding was better than Action-PLD decoding in aIPL; this result was not obtained, but that could simply be because the Action and PLD conditions are more visually similar to each other in a number of ways that influence decoding. Still, looking WITHIN each of the Action-Anim and Action-PLD conditions yields clear evidence for the main conclusion of the study.

(2) The second set of analyses in the paper, shown in Figure 4, follows from the notion that inferring action effects from body movements alone (i.e., when the object is unseen) is easier via pantomimes than with PLD stick figures. That makes sense, but it doesn't necessarily imply that the richness of the inferred action effect is the only or main difference between these conditions. There is more visual information overall in the pantomime case. So, although it's likely true that observers can more vividly infer action effects from pantomimes vs stick figures, it's not a given that contrasting these two conditions is an effective way to isolate inferred action effects. The results in Figure 4 are therefore intriguing but do not unequivocally establish that aIPL is representing inferred rather than observed action effects.

Reviewer #1 (Public Review):

Summary:

The authors report a study aimed at understanding the brain's representations of viewed actions, with a particular aim to distinguish regions that encode observed body movements, from those that encode the effects of actions on objects. They adopt a cross-decoding multivariate fMRI approach, scanning adult observers who viewed full-cue actions, pantomimes of those actions, minimal skeletal depictions of those actions, and abstract animations that captured analogous effects to those actions. Decoding across different pairs of these actions allowed the authors to pull out the contributions of different action features in a given region's representation. The main hypothesis, which was largely confirmed, was that the superior parietal lobe (SPL) more strongly encodes movements of the body, whereas the anterior inferior parietal lobe (aIPL) codes for action effects of outcomes. Specifically, region of interest analyses showed dissociations in the successful cross-decoding of action category across full-cue and skeletal or abstract depictions. Their analyses also highlight the importance of the lateral occipito-temporal cortex (LOTC) in coding action effects. They also find some preliminary evidence about the organisation of action kinds in the regions examined.

Strengths:

The paper is well-written, and it addresses a topic of emerging interest where social vision and intuitive physics intersect. The use of cross-decoding to examine actions and their effects across four different stimulus formats is a strength of the study. Likewise, the a priori identification of regions of interest (supplemented by additional full-brain analyses) is a strength.

Weaknesses:

I found that the main limitation of the article was in the underpinning theoretical reasoning. The authors appeal to the idea of "action effect structures (AES)", as an abstract representation of the consequences of an action that does not specify (as I understand it) the exact means by which that effect is caused, nor the specific objects involved. This concept has some face validity, but it is not developed very fully in the paper, rather simply asserted. The authors make the claim that "The identification of action effect structure representations in aIPL has implications for theories of action understanding" but it would have been nice to hear more about what those theoretical implications are. More generally, I was not very clear on the direction of the claim here. Is there independent evidence for AES (if so, what is it?) and this study tests the following prediction, that AES should be associated with a specific brain region that does not also code other action properties such as body movements? Or, is the idea that this finding -- that there is a brain region that is sensitive to outcomes more than movements -- is the key new evidence for AES?

On a more specific but still important point, I was not always clear that the significant, but numerically rather small, decoding effects are sufficient to support strong claims about what is encoded or represented in a region. This concern of course applies to many multivariate decoding neuroimaging studies. In this instance, I wondered specifically whether the decoding effects necessarily reflected fully five-way distinction amongst the action kinds, or instead (for example) a significantly different pattern evoked by one action compared to all of the other four (which in turn might be similar). This concern is partly increased by the confusion matrices that are presented in the supplementary materials, which don't necessarily convey a strong classification amongst action kinds. The cluster analyses are interesting and appear to be somewhat regular over the different regions, which helps. However: it is hard to assess these findings statistically, and it may be that similar clusters would be found in early visual areas too.

Reviewer #2 (Public Review):

Summary:

This study uses an elegant design, using cross-decoding of multivariate fMRI patterns across different types of stimuli, to convincingly show a functional dissociation between two sub-regions of the parietal cortex, the anterior inferior parietal lobe (aIPL) and superior parietal lobe (SPL) in visually processing actions. Specifically, aIPL is found to be sensitive to the causal effects of observed actions (e.g. whether an action causes an object to compress or to break into two parts), and SPL to the motion patterns of the body in executing those actions.

To show this, the authors assess how well linear classifiers trained to distinguish fMRI patterns of response to actions in one stimulus type can generalize to another stimulus type. They choose stimulus types that abstract away specific dimensions of interest. To reveal sensitivity to the causal effects of actions, regardless of low-level details or motion patterns, they use abstract animations that depict a particular kind of object manipulation: e.g. breaking, hitting, or squashing an object. To reveal sensitivity to motion patterns, independently of causal effects on objects, they use point-light displays (PLDs) of figures performing the same actions. Finally, full videos of actors performing actions are used as the stimuli providing the most complete, and naturalistic information. Pantomime videos, with actors mimicking the execution of an action without visible objects, are used as an intermediate condition providing more cues than PLDs but less than real action videos (e.g. the hands are visible, unlike in PLDs, but the object is absent and has to be inferred). By training classifiers on animations, and testing their generalization to full-action videos, the classifiers' sensitivity to the causal effect of actions, independently of visual appearance, can be assessed. By training them on PLDs and testing them on videos, their sensitivity to motion patterns, independent of the causal effect of actions, can be assessed, as PLDs contain no information about an action's effect on objects.

These analyses reveal that aIPL can generalize between animations and videos, indicating that it is sensitive to action effects. Conversely, SPL is found to generalize between PLDs and videos, showing that it is more sensitive to motion patterns. A searchlight analysis confirms this pattern of results, particularly showing that action-animation decoding is specific to right aIPL, and revealing an additional cluster in LOTC, which is included in subsequent analyses. Action-PLD decoding is more widespread across the whole action observation network.

This study provides a valuable contribution to the understanding of functional specialization in the action observation network. It uses an original and robust experimental design to provide convincing evidence that understanding the causal effects of actions is a meaningful component of visual action processing and that it is specifically localized in aIPL and LOTC.

Strengths:

The authors cleverly managed to isolate specific aspects of real-world actions (causal effects, motion patterns) in an elegant experimental design, and by testing generalization across different stimulus types rather than within-category decoding performance, they show results that are convincing and readily interpretable. Moreover, they clearly took great care to eliminate potential confounds in their experimental design (for example, by carefully ordering scanning sessions by increasing realism, such that the participants could not associate animation with the corresponding real-world action), and to increase stimulus diversity for different stimulus types. They also carefully examine their own analysis pipeline, and transparently expose it to the reader (for example, by showing asymmetries across decoding directions in Figure S3). Overall, this is an extremely careful and robust paper.

Weaknesses:

I list several ways in which the paper could be improved below. More than 'weaknesses', these are either ambiguities in the exact claims made, or points that could be strengthened by additional analyses. I don't believe any of the claims or analyses presented in the paper show any strong weaknesses, problematic confounds, or anything that requires revising the claims substantially.

(1) Functional specialization claims: throughout the paper, it is not clear what the exact claims of functional specialization are. While, as can be seen in Figure 3A, the difference between action-animation cross-decoding is significantly higher in aIPL, decoding performance is also above chance in right SPL, although this is not a strong effect. More importantly, action-PLD cross-decoding is robustly above chance in both right and left aIPL, implying that this region is sensitive to motion patterns as well as causal effects. I am not questioning that the difference between the two ROIs exists - that is very convincingly shown. But sentences such as "distinct neural systems for the processing of observed body movements in SPL and the effect they induce in aIPL" (lines 111-112, Introduction) and "aIPL encodes abstract representations of action effect structures independently of motion and object identity" (lines 127-128, Introduction) do not seem fully justified when action-PLD cross-decoding is overall stronger than action-animation cross-decoding in aIPL. Is the claim, then, that in addition to being sensitive to motion patterns, aIPL contains a neural code for abstracted causal effects, e.g. involving a separate neural subpopulation or a different coding scheme? Moreover, if sensitivity to motion patterns is not specific to SPL, but can be found in a broad network of areas (including aIPL itself), can it really be claimed that this area plays a specific role, similar to the specific role of aIPL in encoding causal effects? There is indeed, as can be seen in Figure 3A, a difference between action-PLD decoding in SPL and aIPL, but based on the searchlight map shown in Figure 3B I would guess that a similar difference would be found by comparing aIPL to several other regions. The authors should clarify these ambiguities.

(2) Causal effect information in PLDs: the reasoning behind the use of PLD stimuli is to have a condition that isolates motion patterns from the causal effects of actions. However, it is not clear whether PLDs really contain as little information about action effects as claimed. Cross-decoding between animations and PLDs is significant in both aIPL and LOTC, as shown in Figure 4. This indicates that PLDs do contain some information about action effects. This could also be tested behaviorally by asking participants to assign PLDs to the correct action category. In general, disentangling the roles of motion patterns and implied causal effects in driving action-PLD cross-decoding (which is the main dependent variable in the paper) would strengthen the paper's message. For example, it is possible that the strong action-PLD cross-decoding observed in aIPL relies on a substantially different encoding from, say, SPL, an encoding that perhaps reflects causal effects more than motion patterns. One way to exploratively assess this would be to integrate the clustering analysis shown in Figure S1 with a more complete picture, including animation-PLD and action-PLD decoding in aIPL.

(3) Nature of the motion representations: it is not clear what the nature of the putatively motion-driven representation driving action-PLD cross-decoding is. While, as you note in the Introduction, other regions such as the superior temporal sulcus have been extensively studied, with the understanding that they are part of a feedforward network of areas analyzing increasingly complex motion patterns (e.g. Riese & Poggio, Nature Reviews Neuroscience 2003), it doesn't seem like the way in which SPL represents these stimuli are similarly well-understood. While the action-PLD cross-decoding shown here is a convincing additional piece of evidence for a motion-based representation in SPL, an interesting additional analysis would be to compare, for example, RDMs of different actions in this region with explicit computational models. These could be, for example, classic motion energy models inspired by the response characteristics of regions such as V5/MT, which have been shown to predict cortical responses and psychophysical performance both for natural videos (e.g. Nishimoto et al., Current Biology 2011) and PLDs (Casile & Giese Journal of Vision 2005). A similar cross-decoding analysis between videos and PLDs as that conducted on the fMRI patterns could be done on these models' features, obtaining RDMs that could directly be compared with those from SPL. This would be a very informative analysis that could enrich our knowledge of a relatively unexplored region in action recognition. Please note, however, that action recognition is not my field of expertise, so it is possible that there are practical difficulties in conducting such an analysis that I am not aware of. In this case, I kindly ask the authors to explain what these difficulties could be.

(4) Clustering analysis: I found the clustering analysis shown in Figure S1 very clever and informative. However, there are two things that I think the authors should clarify. First, it's not clear whether the three categories of object change were inferred post-hoc from the data or determined beforehand. It is completely fine if these were just inferred post-hoc, I just believe this ambiguity should be clarified explicitly. Second, while action-anim decoding in aIPL and LOTC looks like it is consistently clustered, the clustering of action-PLD decoding in SPL and LOTC looks less reliable. The authors interpret this clustering as corresponding to the manual vs. bimanual distinction, but for example "drink" (a unimanual action) is grouped with "break" and "squash" (bimanual actions) in left SPL and grouped entirely separately from the unimanual and bimanual clusters in left LOTC. Statistically testing the robustness of these clusters would help clarify whether it is the case that action-PLD in SPL and LOTC has no semantically interpretable organizing principle, as might be the case for a representation based entirely on motion pattern, or rather that it is a different organizing principle from action-anim, such as the manual vs. bimanual distinction proposed by the authors. I don't have much experience with statistical testing of clustering analyses, but I think a permutation-based approach, wherein a measure of cluster robustness, such as the Silhouette score, is computed for the clusters found in the data and compared to a null distribution of such measures obtained by permuting the data labels, should be feasible. In a quick literature search, I have found several papers describing similar approaches: e.g. Hennig (2007), "Cluster-wise assessment of cluster stability"; Tibshirani et al. (2001) "Estimating the Number of Clusters in a Data Set Via the Gap Statistic". These are just pointers to potentially useful approaches, the authors are much better qualified to pick the most appropriate and convenient method. However, I do think such a statistical test would strengthen the clustering analysis shown here. With this statistical test, and the more exhaustive exposition of results I suggested in point 2 above (e.g. including animation-PLD and action-PLD decoding in aIPL), I believe the clustering analysis could even be moved to the main text and occupy a more prominent position in the paper.

(5) ROI selection: this is a minor point, related to the method used for assigning voxels to a specific ROI. In the description in the Methods (page 16, lines 514-24), the authors mention using the MNI coordinates of the center locations of Brodmann areas. Does this mean that then they extracted a sphere around this location, or did they use a mask based on the entire Brodmann area? The latter approach is what I'm most familiar with, so if the authors chose to use a sphere instead, could they clarify why? Or, if they did use the entire Brodmann area as a mask, and not just its center coordinates, this should be made clearer in the text.

Reviewer #2 (Public Review):

Summary:

This work by Grogan and colleagues aimed to translate animal studies showing that acetylcholine plays a role in motivation by modulating the effects of dopamine on motivation. They tested this hypothesis with a placebo-controlled pharmacological study administering a muscarinic antagonist (trihexyphenidyl; THP) to a sample of 20 adult men performing an incentivized saccade task while undergoing electroengephalography (EEG). They found that reward increased vigor and reduced reaction times (RTs) and, importantly, these reward effects were attenuated by trihexyphenidyl. High incentives increased preparatory EEG activity (contingent negative variation), and though THP also increased preparatory activity, it also reduced this reward effect on RTs.

Strengths:

The researchers address a timely and potentially clinically relevant question with a within-subject pharmacological intervention and a strong task design. The results highlight the importance of the interplay between dopamine and other neurotransmitter systems in reward sensitivity and even though no Parkinson's patients were included in this study, the results could have consequences for patients with motivational deficits and apathy if validated in the future.

Weaknesses:

The main weakness of the study is the small sample size (N=20) that unfortunately is limited to men only. The generalizability and replicability of the conclusions remain to be assessed in future research with a larger and more diverse sample size and potentially a clinically relevant population. The EEG results do not shape a concrete mechanism of action of the drug on reward sensitivity.

Reviewer #1 (Public Review):

Summary:

The authors used a motivated saccade task with distractors to measure response vigor and reaction time (RT) in healthy human males under placebo or muscarinic antagonism. They also simultaneously recorded neural activity using EEG with event-related potential (ERP) focused analyses. This study provides evidence that the muscarinic antagonist Trihexyphenidyl (THP) modulates the motivational effects of reward on both saccade velocity and RT, and also increases the distractibility of participants. The study also examined the correlational relationships between reaction time and vigor and manipulations (THP, incentives) with components of the EEG-derived ERPs. While an interesting correlation structure emerged from the analyses relating the ERP biomarkers to behavior, it is unclear how these potentially epiphenomenal biomarkers relate to relevant underlying neurophysiology.

Strengths:

This study is a logical translational extension from preclinical findings of cholinergic modulation of motivation and vigor and the CNV biomarker to a normative human population, utilizing a placebo-controlled, double-blind approach.

While framed in the context of Parkinson's disease where cholinergic medications can be used, the authors do a good job in the discussion describing the limitations in generalizing their findings obtained in a normative and non-age-matched cohort to an aged PD patient population.

The exploratory analyses suggest alternative brain targets and/or ERP components that relate to the behavior and manipulations tested. These will need to be further validated in an adequately powered study. Once validated, the most relevant biomarkers could be assessed in a more clinically relevant population.

Weaknesses:

The relatively weak correlations between the main experimental outcomes provide unclear insight into the neural mechanisms by which the manipulations lead to behavioral manifestations outside the context of the ERP. It would have been interesting to evaluate how other quantifications of the EEG signal through time-frequency analyses relate to the behavioral outcomes and manipulations.

The ERP correlations to relevant behavioral outcomes were not consistent across manipulations demonstrating they are not reliable biomarkers to behavior but do suggest that multiple underlying mechanisms can give rise to the same changes in the ERP-based biomarkers and lead to different behavioral outcomes.

Reviewer #3 (Public Review):

Summary:

Grogan et al examine a role for muscarinic receptor activation in action vigor in a saccadic system. This work is motivated by a strong literature linking dopamine to vigor, and some animal studies suggesting that ACH might modulate these effects, and is important because patient populations with symptoms related to reduced vigor are prescribed muscarinic antagonists. The authors use a motivated saccade task with distractors to measure the speed and vigor of actions in humans under placebo or muscarinic antagonism. They show that muscarinic antagonism blunts the motivational effects of reward on both saccade velocity and RT, and also modulates the distractibility of participants, in particular by increasing the repulsion of saccades away from distractors. They show that preparatory EEG signals reflect both motivation and drug condition, and make a case that these EEG signals mediate the effects of the drug on behavior.

Strengths:

This manuscript addresses an interesting and timely question and does so using an impressive within-subject pharmacological design and a task well-designed to measure constructs of interest. The authors show clear causal evidence that ACH affects different metrics of saccade generation related to effort expenditure and their modulation by incentive manipulations. The authors link these behavioral effects to motor preparatory signatures, indexed with EEG, that relate to behavioral measures of interest and in at least one case statistically mediate the behavioral effects of ACH antagonism.

Weaknesses:

In full disclosure, I have previously reviewed this manuscript in another journal and the authors have done a considerable amount of work to address my previous concerns. However, I have a few remaining concerns that affect my interpretation of the current manuscript.

Some of the EEG signals (figures 4A&C) have profiles that look like they could have ocular, rather than central nervous, origins. Given that this is an eye movement task, it would be useful if the authors could provide some evidence that these signals are truly related to brain activity and not driven by ocular muscles, either in response to explicit motor effects (ie. Blinks) or in preparation for an upcoming saccade. For other EEG signals, in particular, the ones reported in Figure 3, it would be nice to see what the spatial profiles actually look like - does the scalp topography match that expected for the signal of interest?

A primary weakness of this paper is the sample size - since only 20 participants completed the study. The authors address the sample size in several places and I completely understand the reason for the reduced sample size (study halt due to COVID). That said, they only report the sample size in one place in the methods rather than through degrees of freedom in their statistical tests conducted throughout the results. In part because of this, I am not totally clear on whether the sample size for each analysis is the same - or whether participants were removed for specific analyses (ie. due to poor EEG recordings, for example). Beyond this point, but still related to the sample size, in some cases I worry that results are driven by a single subject. In particular, the interaction effect observed in Figure 1e seems like it would be highly sensitive to the single subject who shows a reverse incentive effect in the drug condition.

There are not sufficient details on the cluster-based permutation testing to understand what the authors did or whether it is reasonable. What channels were included? What metric was computed per cluster? How was null distribution generated?

The authors report that "muscarinic antagonism strengthened the P3a" - but I was unable to see this in the data plots. Perhaps it is because the variability related to individual differences obscures the conditional differences in the plots. In this case, event-related difference signals could be helpful to clarify the results.

For mediation analyses, it would be useful in the results section to have a much more detailed description of the regression results, rather than just reporting things in a binary did/did not mediate sort of way. Furthermore, the methods should also describe how mediation was tested statistically (ie. What is the null distribution that the difference in coefficients with/without moderator is tested against?).

Reviewer #1 (Public Review):

Summary:

In the manuscript entitled "Magnesium modulates phospholipid metabolism to promote bacterial phenotypic resistance to antibiotics", Li et al demonstrated the role of magnesium in promoting phenotypic resistance in V. alginolyticus. Using standard microbiological and metabolomic techniques, the authors have shown the significance of fatty acid biosynthesis pathway behind the resistance mechanism. This study is significant as it sheds light on the role of an exogenous factor in altering membrane composition, polarization, and fluidity which ultimately leads to antimicrobial resistance.

Strengths:

(1) The experiments were carried out methodically and logically.

(2) An adequate number of replicates were used for the experiments.

Weaknesses:

(1) The introduction section needs to be more informative and to the point.

(2) The weakest point of this paper is in the logistics through the results section. The way authors represented the figures and interpreted them in the results section (or the figure legends) does not match. The figures are difficult to interpret and are not at all self-explanatory.

(3) There are too many mislabeling of the figure panels in the main text which makes it difficult to find out which figures the authors are explaining. There should be more explanation on why and how they did the experiments and how the results were interpreted.

Reviewer #2 (Public Review):

Summary:

In this study, the authors aimed to identify if and how magnesium affects the ability of two particular bacteria species to resist the action of antibiotics. In my view, the authors succeeded in their goals and presented a compelling study that will have important implications for the antibiotic resistance research community. Since metals like magnesium are present in all lab media compositions and are present in the host, the data presented in this study certainly will inspire additional research by the community. These could include research into whether other types of metals also induce multi-drug resistance, whether this phenomenon can be observed in other bacterial species, especially pathogenic species that cause clinical disease, and whether the underlying molecular determinants (i.e. enzymes) of metal-induced phenotypic resistance could be new antimicrobial drug targets themselves.

Strengths:

This study's strengths include that the authors used a variety of methodologies, all of which point to a clear effect of exogenous Mg2+ on drug resistance in the targeted species. I also commend the authors for carrying out a comprehensive study, spanning evaluation of whole cell phenotypes, metabolic pathways, genetic manipulation, to enzyme activity level evaluation. The fact that the authors uncovered a molecular mechanism underlying Mg2+-induced phenotypic resistance is particularly important as the key proteins should be studied further.

Weaknesses:

I believe there are weaknesses in the manuscript, however. The authors take for granted that the reader is familiar with all the assays utilized, and do not properly explain some experiments, and thus I highly suggest that the authors add a brief statement in each situation describing the rationale for each selected methodology (more details are in the private review to the authors). The Results section is also quite long and bogs down at times, and I suggest that the authors reduce its length by 10 to 20%. In contrast, the Introduction is sparse and lacks key aspects, for example, there should be mention of the study's main purpose and approaches, plus an introduction to the authors' choice of species and their known drug resistance properties, as well as the drug of choice (balofloxacin). Another notable weakness is that the authors evaluated Mg2+-induced phenotypic resistance only against two closely related species, and thus the generalizability of this mechanism of drug resistance is not known. The paper would be strengthened if the authors could demonstrate this type of phenotypic resistance in at least one more Gram-negative species and at least one Gram-positive species (antimicrobial susceptibility evaluations would suffice), each of which should be pathogenic to humans. Demonstrating magnesium-induced phenotypic drug resistance in the WHO Priority Bacterial Pathogens would be particularly important.

In general, the conclusions drawn by the authors are justified by the data, except for the interpretation of some experiments. Importantly, this paper has discovered new antimicrobial resistance mechanisms and has also pointed to potential new targets for antimicrobials.

Reviewer #1 (Public Review):

I feel that the changes to the manuscript have significantly improved it. It's unfortunate that the single biotin/anti-biotin antibodies were not more illuminating but I think the attempts were worthwhile. My only comment is that the rebuttal to the second part of point 3 still does not fully deal with the issue. By marking proximal proteins other than the fusion with biotin, TurboID significantly increases the detectable signal, but it is formally no longer possible to be certain what the biotin is attached to. None of the controls that the authors suggest will actually give you certainty about what you are detecting while imaging. Mass spectrometry will give you an ensemble measurement of all the biotinylated proteins in the cell without being able to relate that back to what you are observing in a specific cellular region when you are imaging. Colocalization with a tagged protein/specific antibody could suggest that a portion of the signal could be attributable to the TurboID-biotin signal, but it could also be a tight binding partner or part of a larger protein complex. PLA assays would have similar issues- some of the protein could be labeled but it will be impossible to show what portion of the signal is attributable to the protein of interest and how much is attributable to other proximal proteins. I think the key thing here is that in this implementation, TurboID allows you to enhance the labeling of protein structures in cells, such as NUPS, but at the expense of certainty about the specific proteins you are labeling. I personally cannot think of a reasonable control that will allow you to avoid this issue. I feel that this point needs to be clearly made if people are going to use this method for signal enhancement, otherwise people may be misled about what they are actually looking at. The method should be useful, but the limitations need to be clear.

Reviewer #2 (Public Review):

I found the original paper to be of high quality and value. The revisions the authors have made (particularly with respect to the more cautious phraseology concerning the ability to track labelled proteins) are valuable additions. The other responses are well-argued and satisfactory to this reviewer.

Reviewer #1 (Public Review):

Summary:

This study demonstrates a key role of oxLDL in enhancing Ang II-induced Gq signaling by promoting the AT1/LOX1 receptor complex formation. Importantly, Gq-mediated calcium influx was only observed in LOX1 and AT1 both expressing cells, and AT1-LOX1 interaction aggravated renal damage and dysfunction under the condition of a high-fat diet with Ang II infusion, so this study indicated a new therapeutic potential of AT1-LOX1 receptor complex in CKD patients with dyslipidemia and hypertension.

Strengths:

This study is very exciting and the work is also very detailed, especially regarding the mechanism of LOX1-AT1 receptor interaction and its impact on oxidative stress, fibrosis, and inflammation.

Weaknesses:

The direct evidence for the interaction between AT1 and LOX1 receptors in cell membrane localization is relatively weak. Here I raise some questions that may further improve the study.

Major points:

(1) The authors hypothesized that in the interaction of AT1/LOX1 receptor complex in response to ox-LDL and AngII, there should be strong evidence of fluorescence detection of colocalization for these two membrane receptors, both in vivo and in vitro. Although the video evidence for AT1 internalization upon complex activation is shown in Figure S1, the more important evidence should be membrane interaction and enhanced signal of intracellular calcium influx.

(2) Co-IP experiment should be provided to prove the AT1/LOX1 receptor interaction in response to ox-LDL and AngII in AT1 and LOX1 both expressing cells but not in AT1 only expressing cells.

(3) The authors mentioned that the Gq signaling-mediated calcium influx may change gene expression and cellular characteristics, including EMT and cell proliferation. They also provided evidence that oxidative stress, fibrosis, and inflammation were all enhanced after activating both receptors and inhibiting Gq was effective in reversing these changes. However, single stimulation with ox-LDL or AngII also has strong effects on ROS production, inflammation, and cell EMT, which has been extensively proved by previous studies. So, how to distinguish the biased effect of LOX1 or AT1r alone or the enhanced effect of receptor conformational changes mediated by their receptor interaction? Is there any better evidence to elucidate this point?

(4) How does the interaction between AT1 and LOX1 affect the RAS system and blood pressure? What about the serum levels of rennin, angiotensin, and aldosterone in ND-fed or HFD-fed mice?

Reviewer #2 (Public Review):

Individuals with chronic kidney disease often have dyslipidemia, with the latter both a risk factor for atherosclerotic heart disease and a contributor to progressive kidney disease. Prior studies suggest that oxidized LDL (oxLDL) may cause renal injury through the activation of the LOX1 receptor. The authors had previously reported that LOX1 and AT1 interact to form a complex at the cell surface. In this study, the authors hypothesize that oxLDL, in the setting of angiotensin II, is responsible for driving renal injury by inducing a more pronounced conformational change of the AT1 receptor which results in enhanced Gq signaling.

They go about testing the hypothesis in a set of three studies. In the first set, they engineered CHO cell lines to express AT1R alone, LOX1 in combination with AT1R, or LOX1 with an inactive form of AT1R and indirectly evaluated Gq activity using IP1 and calcium activity as read-outs. They assessed activity after treatment with AngII, oxLDL, or both in combination and found that treatment with both agents resulted in the greatest level of activity, which could be effectively blocked by a Gq inhibitor but not a Gi inhibitor nor a downstream Rho kinase inhibitor targeting G12/13 signaling. These results support their hypothesis, though variability in the level of activation was dramatically inconsistent from experiment to experiment, differing by as much as 20-fold. In contrast, within the experiment, differences between the AngII and AngII/oxLDL treatments, while nominally significant and consistent with their hypothesis, generally were only 10-20%. Another example of unexplained variability can be found in Figures 1g-1j. AngII, at a concentration of 10-12, has no effect on calcium flux in one set of studies (Figure 1g, h) yet has induced calcium activity to a level as great as AngII + oxLDL in another (Figure 1i). The inconsistency of results lessens confidence in the significance of these findings. In other studies with the LOX1-CHO line, they tested for conformational change by transducing AT1 biosensors previously shown to respond to AngII and found that one of them in fact showed enhanced BRET in the setting of oxLDL and AngII compared to AngII alone, which was blocked by an antibody to AT1R. The result is supportive of their conclusions. Limiting enthusiasm for these results is the fact that there isn't a good explanation as to why only 1 sensor showed a difference, and the study should have included a non-specific antibody to control for non-specific effects.

The authors then repeated similar studies using publicly available rat kidney epithelial and fibroblast cell lines that have an endogenous expression of AT1R and LOX1. In these studies, oxLDL in combination with AngiI also enhanced Gq signaling, while knocking down either AT1R or LOX1, and treatment with inhibitors of Gq and AT1R blocked the effects. Like the prior set of studies, however, the effects are very modest and there was significant inter-experimental variability, reducing confidence in the significance of the findings. The authors then tested for evidence that the enhanced Gq signaling could result in renal injury by comparing qPCR results for target genes. While the results show some changes, their significance is difficult to assess. A more global assessment of gene expression patterns would have been more appropriate. In parallel with the transcriptional studies, they tested for evidence of epithelial-mesenchymal transition (EMT) using a single protein marker (alpha-smooth muscle actin) and found that its expression increased significantly in cells treated with oxLDL and AngII, which was blocked by inhibition of Gq inhibition and AT1R. While the data are sound, their significance is also unclear since EMT is a highly controversial cell culture phenomenon. Compelling in vivo studies have shown that most if not all fibroblasts in the kidney are derived from interstitial cells and not a product of EMT. In the last set of studies using these cell lines, the authors examined the effects of AngII and oxLDL on cell proliferation as assayed using BrdU. These results are puzzling---while the two agents together enhanced proliferation which was effectively blocked by an inhibitor to either AT1R or Gq, silencing of LOX1 had no effect.

The final set of studies looked to test the hypothesis in mice by treating WT and Lox1-KO mice with different doses of AngII and either a normal or high-fat diet (to induce oxLDL formation). The authors found that the combination of high dose AngII and a high-fat diet (HFD) increased markers of renal injury (urinary 8-ohdg and urine albumin) in normal mice compared to mice treated with just AngII or HFD alone, which was blunted in Lox1-KO mice). These results are consistent with their hypothesis. However, there are other aspects of these studies that are either inconsistent or complicating factors that limit the strength of the conclusions. For example, Lox1- KO had no effect on renal injury marker expression in mice treated with low-dose AngII and HFD. It also should be noted that Lox1-KO mice had a lower BP response to AngII, which could have reduced renal injury independent of any effects mediated by the AT1R/LOX1 interaction. Another confounding factor was the significant effect the HFD diet had on body weight. While the groups did not differ based on AngII treatment status, the HFD consistently was associated with lower total body weight, which is unexplained. Next, the authors sought to find more direct evidence of renal injury using qPCR of candidate genes and renal histology. The transcriptional results are difficult to interpret; moreover, there were no significant histologic differences between groups. They conclude the study by showing the pattern of expression of LOX1 and AT1R in the kidney by immunofluorescence and conclude that the proteins overlap in renal tubules and are absent from the glomerulus. Unfortunately, they did not co-stain with any other markers to identify the specific cell types. However, these results are inconsistent with other studies that show AT1R is highly expressed in mesangial cells, renal interstitial cells, near the vascular pole, JG cells, and proximal tubules but generally absent from most other renal tubule segments.

In sum, this study tackles an important clinical issue and provides some in vitro evidence to support a mechanism whereby dyslipidemia could accelerate renal functional decline through activation of the AT1R/LOX1 complex by oxLDL and AngII.

However, a very high degree of variability in the results, modest within-experiment differences, some internal inconsistencies that aren't explained, and the lack of compelling and strongly supportive in vivo results suggest this is still more a hypothesis than an established likely mechanism.

Reviewer #1 (Public Review):

Summary:

This article identifies ADGR3 as a candidate GPCR for mediating beige fat development. The authors use human expression data from the Human protein atlas and Gtex databases and combine this with experiments performed in mice and a murine cell line. They refer to a GPCR bioactivity screening tool PRESTO-Salsa, with which it was found that Hesperetin activates ADGR3. From their experiments, authors conclude that Hesperetin activates ADGR3, inducing a Gs-PKA-CREB axis resulting in adipose thermogenesis.

Strengths:

The authors analyze human data from public databases and perform functional studies in mouse models. They identify a new GPCR with a role in the thermogenic activation of adipocytes.

Weaknesses:

(1) Selection of ADGRA3 as a candidate GPCR relevant for mediating beiging in humans:

The authors identify genes upregulated in iBAT compared to iWAT in response to cold, and among these differentially expressed genes, they identify highly expressed GPCRs in human white adipocytes (visceral or subcutaneous). Finally, among these genes, they select a GPCR not previously studied in the literature.

If the authors are interested in beiging, why do they not focus on genes upregulated in iWAT (the depot where beiging is described to occur in mice), comparing thermoneutral to cold-induced genes? I would expect that genes induced in iWAT in response to cold would be extremely relevant targets for beiging. With their strategy, the authors exclude receptors that are induced in the tissue where beiging is actually described to occur.

Furthermore, the authors are comparing genes upregulated in cold in BAT (but not WAT) to highly expressed genes in human white adipocytes during thermoneutrality. Overall, the authors fail to discuss the logic behind their strategy and the obvious limitations of it.

(2) Relevance of ADGRA3 and comparison to established literature:

There has been a lot of literature and discussion about which receptor should be targeted in humans to recruit thermogenic fat. The current article unfortunately does not discuss this literature nor explain how it relates to their findings. For example, O'Mara et al (PMID: 31961826) demonstrated that chronic stimulation with the B3 adrenergic agonist, Mirabegron, resulted in the recruitment of thermogenic fat and improvement in insulin sensitivity and cholesterol. Later, Blondin et al (PMID: 32755608), highlighted the B2 adrenergic receptor as the main activation path of thermogenic fat in humans. There is also a recent report on an agonist activating B2 and B3 simultaneously (PMID: 38796310). Thus, to bring the literature forward, it would be beneficial if the current manuscript compared their identified activation path with the activation of these already established receptors and discussed their findings in relation to previous studies.

In Figures 1d and e, the authors show the expression of ADGRA3 in comparison to the expression of ADRB3. In human brown adipocytes, ADRB2 has been shown to be the main receptor through which adrenergic activation occurs (PMID: 32755608), thus authors should show the relative expression of this gene as well.

(3) Strategy to investigate the role of ADGRA3 in WAT beiging:

Having identified ADGRA3 as their candidate receptor, the authors proceed with investigations of this receptor in mouse models and the murine inguinal adipocyte cell line 3T3.

First of all, in Figure 1D, the authors show a substantially lower expression of ADGRA3 compared to ADRB3. It could thus be argued that a mouse would not be the best model system for studying this receptor. It would be interesting to see data from experiments in human adipocytes. Moreover, if the authors are interested in inducing beiging, why do they show expression in iBAT and not iWAT?

The authors perform in vivo experiments using intraperitoneal injections of shRNA or overexpression CMV-driven vectors and report effects on body temperature and glucose metabolism. It is here important to note that ADGRA3 is not uniquely expressed in adipocytes. A major advantage of databases like the Human Protein Atlas and Gtex, is that they give an overview of the gene expression across tissues and cell types. When looking up ADGRA3 in these databases, it is expressed in subcutaneous and visceral adipocytes. However, other cell types and tissues demonstrate an even higher expression. In the Human protein atlas, the enhanced cell types are astrocytes and hepatocytes. In the Gtex database tissues with the highest expression are Brain, Liver, and Thyroid.

With this information in mind, IP injections for modification of ADGRA3 receptor expression could be expected to affect any of these tissues and cells.

The manuscript report changes body temperature. However, temperature is regulated by the brain and also affected by thyroid activity. Did the authors measure the levels of circulating thyroid hormones? Gene expression changes in the brain? The authors report that Adgra3 overexpression decreased the TG level in serum and liver. The liver could be the primary targeted organ here, and the adipose effects might be secondary. The data would be easier to interpret if authors reported the effects on the liver, thyroid, and brain, and the gene expression across tissues should be discussed in the article.

Finally, the identification of Hesperetin using the PRESTO-Salsa tool, and how specific the effect of Hesperetin is on ADGRA3, is currently unclear. This should be better discussed, and authors should consider measuring the established effects of Hesperetin in their model systems, including apoptosis.

Reviewer #2 (Public Review):

Based on bioinformatics and expression analysis using mouse and human samples, the authors claim that the adhesion G-protein coupled receptor ADGRA3 may be a valuable target for increasing thermogenic activity and metabolic health. Genetic approaches to deplete ADGRA3 expression in vitro resulted in reduced expression of thermogenic genes including Ucp1, reduced basal respiration, and metabolic activity as reflected by reduced glucose uptake and triglyceride accumulation. In line, nanoparticle delivery of shAdgra3 constructs is associated with increased body weight, reduced thermogenic gene expression in white and brown adipose tissue (WAT, BAT), and impaired glucose and insulin tolerance. On the other hand, ADGRA3 overexpression is associated with an improved metabolic profile in vitro and in vivo, which can be explained by increasing the activity of the well-established Gs-PKA-CREB axis. Notably, a computational screen suggested that ADGRA3 is activated by hesperetin. This metabolite is a derivative of the major citrus flavonoid hesperidin and has been described to promote metabolic health. Using appropriate in vitro and in vivo studies, the authors show that hesperetin supplementation is associated with increased thermogenesis, UCP1 levels in WAT and BAT, and improved glucose tolerance, an effect that was attenuated in the absence of ADGRA3 expression.

Overall, the data suggest that ADGRA3 is a constitutively active Gs-coupled receptor that improves metabolism by activating adaptive thermogenesis in WAT and BAT. The conclusions of the paper are partly supported by the data, but some experimental approaches need further clarification.

(1) The in vivo approaches to modulate Adgra3 expression in mice are carried out using non-targeted nanoparticle-based approaches. The authors do not provide details of the composition of the nanomaterials, but it is highly likely that other metabolically active organs such as the liver are targeted. This is critical because Adgre3 is expressed in many organs, including the liver, adrenal glands, and gastrointestinal system. Therefore, many of the observed metabolic effects could be indirect, for example by modulating bile acids or corticosterone levels. Consistent with this, after digestion in the gastrointestinal tract, hesperetin is rapidly metabolized in intestinal and liver cells. Thus, hesperetin levels in the systemic circulation are likely to be insufficient to activate Adgra3 in thermogenic adipocytes/precursors. Overall, the authors need to repeat the key metabolic experiments in adipose-specific Adgra3 knockout/overexpression models to validate the reliability of the in vivo results. In addition, to validate the relevance of hesperetin supplementation for adaptive thermogenesis in BAT and WAT vivo, the levels of hesperetin present in the systemic circulation should be quantified.

(2) Standard measurements for energy balance are not presented. Quantitative data on energy expenditure, e.g. by indirect calorimetry, and food intake are missing and need to be included to validate the authors' claims.

(3) The thermographic images used to determine the BAT temperature are not very convincing. The distance and angle between the thermal camera and the BAT have a significant effect on the determination of the temperature, which is not taken into account, at least in the images presented.

(4) The 3T3-L1 cell line is not an adequate cell culture model to study thermogenic adipocyte differentiation. To validate their results, the key experiments showing that ADGRA3 expression modulates thermogenic marker expression in a hesperetin-dependent manner need to be performed in a reliable model, e.g. primary murine adipocytes.

(5) The experimental setup only allows the measurement of basal cellular respiration. More advanced approaches are needed to define the contribution of ADGRA3 versus classical adrenergic receptors to UCP1-dependent thermogenesis.

Reviewer #3 (Public Review):

Summary:

The manuscript by Zhao et al. explored the function of adhesion G protein-coupled receptor A3 (ADGRA3) in thermogenic fat biology.

Strengths:

Through both in vivo and in vitro studies, the authors found that the gain function of ADGRA3 leads to browning of white fat and ameliorates insulin resistance.

Weaknesses:

There are several lines of weak methodologies such as using 3T3-L1 adipocytes and intraperitoneal(i.p.) injection of virus. Moreover, as the authors stated that ADGRA3 is constitutively active, how could the authors then identify a chemical ligand?

Recommendations:

(1) Primary cultured cells should be used to perform gain and loss function analysis of ADGRA3, instead of using 3T3-L1. It is impossible to detect Ucp1 expression in 3T3-L1 cells.

(2) For virus treatment, the authors should consider performing local tissue injection, rather than IP injection. If it is IP injection, have the authors checked other tissues to validate whether the phenotype is fat-specific?

(3) The authors should clarify how constitutively active GPCR needs further ligands.

Reviewer #1 (Public Review):

Summary:

Qi and colleagues investigated the role of the Kallistatin pathway in increasing hippocampal amyloid-β plaque accumulation and tau hyperphosphorylation in Alzheimer's disease, linking the increased Kallistatin level in diabetic patients with a higher risk of Alzheimer's disease development. A Kallistatin-overexpressing animal model was utilized, and memory impairment was assessed using Morris water maze and Y-maze. Kallistatin-related pathway protein levels were measured in the hippocampus, and phenotypes were rescued using fenofibrate and rosiglitazone. The current study provides evidence of a novel molecular mechanism linking diabetes and Alzheimer's disease and suggests the potential use of fenofibrate to alleviate memory impairment. However, several issues need to be addressed before further consideration.

Strengths:

The findings of this study are novel. The findings will have great impacts on diabetes and AD research. The studies were well conducted, and the results were convincing.

Weaknesses:

(1) The mechanism by which fenofibrate rescues memory loss in Kallistatin-transgenic mice is unclear. As a PPARalpha agonist, does fenofibrate target the Kallistatin pathway directly or indirectly? Please provide a discussion based on literature supporting either possibility.

(2) The current study exclusively investigated the hippocampus. What about other cognitive memory-related regions, such as the prefrontal cortex? Including data from these regions or discussing the possibility of their involvement could provide a more comprehensive understanding of the role of Kallistatin in memory impairment.

(3) Fenofibrate rescued phenotypes in Kallistatin-transgenic mice while rosiglitazone, a PPARgamma agonist, did not. This result contradicts the manuscript's emphasis on a PPARgamma-associated mechanism. Please address this inconsistency.

(4) Most of the immunohistochemistry images are unclear. Inserts have similar magnification to the original representative images, making judgments difficult. Please provide larger inserts with higher resolution.

(5) The immunohistochemistry images in different figures were taken from different hippocampal subregions with different magnifications. Please maintain consistency, or explain why CA1, CA3, or DG was analyzed in each experiment.

(6) Figure 5B is missing a title. Please add a title to maintain consistency with other graphs.

(7) Please list statistical methods used in the figure legends, such as t-test or One-way ANOVA with post-hoc tests.

Reviewer #2 (Public Review):

Summary:

The study links Alzheimer's disease (AD) with metabolic disorders through elevated Kallistatin levels in AD patients. Kallistatin-overexpressing mice show cognitive decline, increased Aβ and tau pathology, and impaired hippocampal function. Mechanistically, Kallistatin enhances Aβ production via Notch1 and promotes tau phosphorylation through GSK-3β activation. Fenofibrate improves cognitive deficits by reducing Aβ and tau phosphorylation in these mice, suggesting therapeutic potential in AD linked to metabolic syndromes.

Strengths:

This study presents novel insights into AD pathogenesis and provides strong evidence about the mechanistic roles of Kallistatin, and the therapeutic potential of fenofibrate in AD.

Weaknesses:

It was suggested that Kallistatin is primarily produced by the liver. The study demonstrates increased Kallistatin levels in the hippocampus tissue of AD mice. It would be valuable to clarify if Kallistatin is also increased in the liver of AD mice, providing a comprehensive understanding of its distribution in disease states.

Does Kallistatin interact directly with Notch1 ligands? Clarifying this interaction mechanism would enhance understanding of how Kallistatin influences Notch1 signaling in AD pathology.

Is there any observed difference in AD phenotype between male and female Kallistatin-transgenic (KAL-TG) mice? Including this information would address potential gender-specific effects on cognitive decline and pathology.

It is recommended to include molecular size markers in Western blots for clarity and accuracy in protein size determination.

The language should be revised for enhanced readability and clarity, ensuring that complex scientific concepts are communicated effectively to a broader audience.

Reviewer #3 (Public Review):

Summary:

The authors investigated the role of kallistatin in metabolic abnormalities associated with AD. They found that Kallistatin promotes Aβ production by binding to the Notch1 receptor and upregulating BACE1 expression. They identified that Kallistatin is a key player that mediates Aβ accumulation and tau hyperphosphorylation in AD.

Strengths:

This manuscript not only provides novel insights into the pathogenesis of AD, but also indicates that the hypolipidemic drug fenofibrate attenuates AD-like pathology in Kallistatin transgenic mice.

Weaknesses:

The authors did not illustrate whether the protective effect of fenofibrate against AD depends on kallistatin.

The conclusions are supported by the results, but the quality of some results should be improved.

Reviewer #1 (Public Review):

Summary:

The authors report a study on how stimulation of receptive-field surround of V1 and LGN neurons affects their firing rates. Specifically, they examine stimuli in which a grey patch covers the classical RF of the cell and a stimulus appears in the surround. Using a number of different stimulus paradigms they find a long latency response in V1 (but not the LGN) which does not depend strongly on the characteristics of the surround grating (drifting vs static, continuous vs discontinuous, predictable grating vs unpredictable pink noise). They find that population responses to simple achromatic stimuli have a different structure that does not distinguish so clearly between the grey patch and other conditions and the latency of the response was similar regardless of whether the center or surround was stimulated by the achromatic surface. Taken together they propose that the surround-response is related to the representation of the grey surface itself. They relate their findings to previous studies that have put forward the concept of an 'inverse RF' based on strong responses to small grey patches on a full-screen grating. They also discuss their results in the context of studies that suggest that surround responses are related to predictions of the RF content or figure-ground segregation.

Strengths:

I find the study to be an interesting extension of the work on surround stimulation and the addition of the LGN data is useful showing that the surround-induced responses are not present in the feed-forward path. The conclusions appear solid, being based on large numbers of neurons obtained through Neuropixels recordings. The use of many different stimulus combinations provides a rich view of the nature of the surround-induced responses.

Weaknesses:

The statistics are pooled across animals, which is less appropriate for hierarchical data. There is no histological confirmation of placement of the electrode in the LGN and there is no analysis of eye or face movements which may have contributed to the surround-induced responses. There are also some missing statistics and methods details which make interpretation more difficult.

Reviewer #2 (Public Review):

Cuevas et al. investigate the stimulus selectivity of surround-induced responses in the mouse primary visual cortex (V1). While classical experiments in non-human primates and cats have generally demonstrated that stimuli in the surround receptive field (RF) of V1 neurons only modulate activity to stimuli presented in the center RF, without eliciting responses when presented in isolation, recent studies in mouse V1 have indicated the presence of purely surround-induced responses. These have been linked to prediction error signals. In this study, the authors build on these previous findings by systematically examining the stimulus selectivity of surround-induced responses.

Using neuropixels recordings in V1 and the dorsal lateral geniculate nucleus (dLGN) of head-fixed, awake mice, the authors presented various stimulus types (gratings, noise, surfaces) to the center and surround, as well as to the surround only, while also varying the size of the stimuli. Their results confirm the existence of surround-induced responses in mouse V1 neurons, demonstrating that these responses do not require spatial or temporal coherence across the surround, as would be expected if they were linked to prediction error signals. Instead, they suggest that surround-induced responses primarily reflect the representation of the achromatic surface itself.

The literature on center-surround effects in V1 is extensive and sometimes confusing, likely due to the use of different species, stimulus configurations, contrast levels, and stimulus sizes across different studies. It is plausible that surround modulation serves multiple functions depending on these parameters. Within this context, the study by Cuevas et al. makes a significant contribution by exploring the relationship between surround-induced responses in mouse V1 and stimulus statistics. The research is meticulously conducted and incorporates a wide range of experimental stimulus conditions, providing valuable new insights regarding center-surround interactions.

However, the current manuscript presents challenges in readability for both non-experts and experts. Some conclusions are difficult to follow or not clearly justified.

I recommend the following improvements to enhance clarity and comprehension:

(1) Clearly state the hypotheses being tested at the beginning of the manuscript.

(2) Always specify the species used in referenced studies to avoid confusion (esp. Introduction and Discussion).

(3) Briefly summarize the main findings at the beginning of each section to provide context.

(4) Clearly define important terms such as "surface stimulus" and "early vs. late stimulus period" to ensure understanding.

(5) Provide a rationale for each result section, explaining the significance of the findings.

(6) Offer a detailed explanation of why the results do not support the prediction error signal hypothesis but instead suggest an encoding of the achromatic surface.

These adjustments will help make the manuscript more accessible and its conclusions more compelling.

Reviewer #3 (Public Review):

Summary:

This paper explores the phenomenon whereby some V1 neurons can respond to stimuli presented far outside their receptive field. It introduces three possible explanations for this phenomenon and it presents experiments that it argues favor the third explanation, based on figure/ground segregation.

Strengths:

I found it useful to see that there are three possible interpretations of this finding (prediction error, interpolation, and figure/ground). I also found it useful to see a comparison with LGN responses and to see that the effect there is not only absent but actually the opposite: stimuli presented far outside the receptive field suppress rather than drive the neurons. Other experiments presented here may also be of interest to the field.

Weaknesses:

The paper is not particularly clear. I came out of it rather confused as to which hypotheses were still standing and which hypotheses were ruled out. There are numerous ways to make it clearer.

Reviewer #1 (Public Review):

Summary:

The study aimed to better understand the role of the H3 protein of the Monkeypox virus (MPXV) in host cell adhesion, identifying a crucial α-helical domain for interaction with heparan sulfate (HS). Using a combination of advanced computational simulations and experimental validations, the authors discovered that this domain is essential for viral adhesion and potentially a new target for developing antiviral therapies.

Strengths:

The study's main strengths include the use of cutting-edge computational tools such as AlphaFold2 and molecular dynamics simulations, combined with robust experimental techniques like single-molecule force spectroscopy and flow cytometry. These methods provided a detailed and reliable view of the interactions between the H3 protein and HS. The study also highlighted the importance of the α-helical domain's electric charge and the influence of the Mg(II) ion in stabilizing this interaction. The work's impact on the field is significant, offering new perspectives for developing antiviral treatments for MPXV and potentially other viruses with similar adhesion mechanisms. The provided methods and data are highly useful for researchers working with viral proteins and protein-polysaccharide interactions, offering a solid foundation for future investigations and therapeutic innovations.

Weaknesses:

However, some limitations are notable. Despite the robust use of computational methodologies, the limitations of this approach are not discussed, such as potential sources of error, standard deviation rates, and known controls for the H3 protein to justify the claims. Additionally, validations with methodologies like X-ray crystallography would further benefit the visualization of the H3 and HS interaction.

Reviewer #2 (Public Review):

Summary:

The manuscript presenting the discovery of a heparan-sulfate (HS) binding domain in monkeypox virus (MPXV) H3 protein as a new anti-poxviral drug target, presented by Bin Zhen and co-workers, is of interest, given that it offers a potentially broad antiviral substance to be used against poxviruses. Using new computational biology techniques, the authors identified a new alpha-helical domain in the H3 protein, which interacts with cell surface HS, and this domain seems to be crucial for H3-HS interaction. Given that this domain is conserved across orthopoxviruses, authors designed protein inhibitors. One of these inhibitors, AI-PoxBlock723, effectively disrupted the H3-HS interaction and inhibited infection with Monkeypox virus and Vaccinia virus. The presented data should be of interest to a diverse audience, given the possibility of an effective anti-poxviral drug. 

Strengths:

In my opinion, the experiments done in this work were well-planned and executed. The authors put together several computational methods, to design poxvirus inhibitor molecules, and then they test these molecules for infection inhibition.

Weaknesses:

One thing that could be improved, is the presentation of results, to make them more easily understandable to readers, who may not be experts in protein modeling programs. For example, figures should be self-explanatory and understood on their own, without the need to revise text. Therefore, the figure legend should be more informative as to how the experiments were done.

Reviewer #3 (Public Review):

Summary:

The article is an interesting approach to determining the MPOX receptor using "in silico" tools. The results show the presence of two regions of the H3 protein with a high probability of being involved in the interaction with the HS cell receptor. However, the α-helical region seems to be the most probable, since modifications in this region affect the virus binding to the HS receptor.

Strengths:

In my opinion, it is an informative article with interesting results, generated by a combination of "in silico" and wet science to test the theoretical results. This is a strong point of the article.

Weaknesses:

Has a crystal structure of the H3 protein been reported?

The following text is in line 104: "which may represent a novel binding site for HS". It is unclear whether this means this "new binding site" is an alternative site to an old one or whether it is the true binding site that had not been previously elucidated.

Reviewer #2 (Public Review):

In this manuscript, the authors analyze the shapes of cerebral cortices from several primate species, including subgroups of young and old humans, to characterize commonalities in patterns of gyrification, cortical thickness, and cortical surface area. The authors state that the observed scaling law shares properties with fractals, where shape properties are similar across several spatial scales. One way the authors assess this is to perform a "cortical melting" operation that they have devised on surface models obtained from several primate species. The authors also explore differences in shape properties between brains of young (~20 year old) and old (~80) humans. A challenge the authors acknowledge struggling with in reviewing the manuscript is merging "complex mathematical concepts and a perplexing biological phenomenon." This reviewer remains a bit skeptical about whether the complexity of the mathematical concepts being drawn from are justified by the advances made in our ability to infer new things about the shape of the cerebral cortex.

(1) The series of operations to coarse-grain the cortex illustrated in Figure 1 produces image segmentations that do not resemble real brains. The process to assign voxels in downsampled images to cortex and white matter is biased towards the former, as only 4 corners of a given voxel are needed to intersect the original pial surface, but all 8 corners are needed to be assigned a white matter voxel. The reason for introducing this bias (and to the extent that it is present in the authors' implementation) is not provided. The authors provide an intuitive explanation of why thickness relates to folding characteristics, but ultimately an issue for this reviewer is, e.g., for the right-most panel in Figure 2b, the cortex consists of several 4.9-sided voxels and thus a >2 cm thick cortex. A structure with these morphological properties is not consistent with the anatomical organization of typical mammalian neocortex.

(2) For the comparison between 20-year-old and 80-year-old brains, a well-documented difference is that the older age group possesses more cerebral spinal fluid due to tissue atrophy, and the distances between the walls of gyri becomes greater. This difference is born out in the left column of Figure 4b. It seems this additional spacing between gyri in 80 year olds requires more extensive down-sampling (larger scale values in Figure 4a) to achieve a similar shape parameter K as for the 20 year olds. The authors assert that K provides a more sensitive measure (associated with a large effect size) than currently used ones for distinguishing brains of young vs. old people. A more explicit, or elaborate, interpretation of the numbers produced in this manuscript, in terms of brain shape, might make this analysis more appealing to researchers in the aging field.

(3) In the Discussion, it is stated that self-similarity, operating on all length scales, should be used as a test for existing and future models of gyrification mechanisms. Given the lack of association between the abstract mathematical parameters described in this study and explicit properties of brain tissue and its constituents, it is difficult to envision how the coarse-graining operation can be used to guide development of "models of cortical gyrification."

(4) There are several who advocate for analyzing cortical mid-thickness surfaces, as the pial surface over-represents gyral tips compared to the bottoms of sulci in the surface area. The authors indicate that analyses of mid-thickness representations will be taken on in future work, but this seems to be a relevant control for accepting the conclusions of this manuscript.

Reviewer #3 (Public Review):

Summary: Through a rigorous methodology, the authors demonstrated that within 11 different primates, the shape of the brain followed a universal scaling law with fractal properties. They enhanced the universality of this result by showing the concordance of their results with a previous study investigating 70 mammalian brains, and the discordance of their results with other folded objects that are not brains. They incidentally illustrated potential applications of this fractal property of the brain by observing a scale-dependant effect of aging on the human brain.

Strengths:<br /> - New hierarchical way of expressing cortical shapes at different scales derived from previous report through implementation of a coarse-graining procedure<br /> - Investigation of 11 primate brains and contextualisation with other mammals based on prior literature<br /> - Proposition of tool to analyse cortical morphology requiring no fine tuning and computationally achievable<br /> - Positioning of results in comparison to previous works reinforcing the validity of the observation.<br /> - Illustration of scale-dependance of effects of brain aging in the human.

Weaknesses:<br /> - The notion of cortical shape, while being central to the article, is not really defined, leaving some interpretation to the reader<br /> - The organization of the manuscript is unconventional, leading to mixed contents in different sections (sections mixing introduction and method, methods and results, results and discussion...). As a result, the reader discovers the content of the article along the way, it is not obvious at what stages the methods are introduced, and the results are sometimes presented and argued in the same section, hindering objectivity.<br /> To improve the document, I would suggest a modification and restructuring of the article such that: 1) by the end of the introduction the reader understands clearly what question is addressed and the value it holds for the community, 2) by the end of the methods the reader understands clearly all the tools that will be used to answer that question (not just the new method), 3) by the end of the results the reader holds the objective results obtained by applying these tools on the available data (without subjective interpretations and justifications), and 4) by the end of the discussion the reader understands the interpretation and contextualisation of the study, and clearly grasps the potential of the method depicted for the better understanding of brain folding mechanisms and properties.

Reviewer #2 (Public Review):

Summary:

The manuscript focuses on comparison of two PLP-dependent enzyme classes that perform amino acyl decarboxylations. The goal of the work is to understand the substrate specificity and factors that influence catalytic rate in an enzyme linked to theanine production in tea plants.

Strengths:

The work includes x-ray crystal structures of modest resolution of the enzymes of interest. These structures provide the basis for design of mutagenesis experiments to test hypotheses about substrate specificity and the factors that control catalytic rate. These ideas are tested via mutagenesis and activity assays, in some cases both in vitro and in plants.

Weaknesses:

Although improved in a revision, the manuscript could be more clear in explaining the contents of the x-ray structures and how the complexes studied relate to the reactant and product complexes. Some of the figures lack sufficient clarity and description. Some of the claims about the health benefits of tea are not well supported by literature citations.

Reviewer #3 (Public Review):

In the manuscript titled "Structure and Evolution of Alanine/Serine Decarboxylases and the Engineering of Theanine Production," Wang et al. solved and compared the crystal structures of Alanine Decarboxylase (AlaDC) from Camellia sinensis and Serine Decarboxylase (SerDC) from Arabidopsis thaliana. Based on this structural information, the authors conducted both in vitro and in vivo functional studies to compare enzyme activities using site-directed mutagenesis and subsequent evolutionary analyses. This research has the potential to enhance our understanding of amino acid decarboxylase evolution and the biosynthetic pathway of the plant specialized metabolite theanine, as well as to further its potential applications in the tea industry.

Reviewer #2 (Public Review):

Significance:

Rubio et al. study the behavior of the transcription factor Hsf1 under ethanol stress, examining its distribution within the nucleus and the coalescence of heat shock response genes in budding yeast. In comparison to the heat shock response, the response to ethanol stress shows similar gene coalescence and Hsf1 binding. However, there is a notable delay in the transcriptional response to ethanol, and a disconnect between it and the appearance of irreversible Hsf1 condensates/puncta, highlighting important differences in how Hsf1 responds to these two related but distinct environmental stresses.

Overview and general concerns (from the original review):

The authors studied how yeast responds to ethanol stress (8.5%) and compared it to the heat shock response (from 25{degree sign}C to 39{degree sign}C). They observed a more gradual increase in the expression of heat shock response (HSR) genes during ethanol stress compared to heat shock. Additionally, the recruitment of Hsf1 and Pol II to HSR genes, and the inter- and intrachromosomal interactions among these genes, showed slower kinetics under ethanol stress. They attribute the delay in transcriptional response to chromatin compaction induced by ethanol. Despite this delay, these interactions persisted longer. Hsf1 clusters, previously documented during the heat shock response, were also observed during ethanol stress and persisted for an extended period. The conditional degradation of Hsf1 and Rpb1 eliminated most inter- and intrachromosomal interactions for heat shock responsive genes in both ethanol stress and heat shock conditions, indicating the importance of these factors for long distance interactions between HSR genes. Overall, this manuscript provides novel insights into the differential behavior of HSR genes under different stress conditions. This contributes to the broader understanding of how different stressors might elicit unique responses at the genomic and topographical level under the regulation of transcription factor Hsf1.

The central finding of the study highlights the different dynamics of Hsf1, Pol II, and gene organization in response to heat shock versus ethanol stress. However, one important limitation to consider is that the two chosen conditions may not be directly comparable. For a balanced assessment, the authors should ideally expose yeast to various ethanol concentrations and different heat shock temperatures, ensuring the observed differences stem from the nature of the stressor rather than suboptimal stress intensity. At the very least, an additional single ethanol concentration point on each side of 8.5% should be investigated to ensure that 8.5% is near the optimum. In fact, comparing the number of Hsp104 foci in the two conditions in Fig. 1E and F suggests that the yeast is likely experiencing different intensities of stress for the chosen heat shock condition and ethanol concentration used in this study.

A second significant concern is the use of the term "Hsf1 condensate". Chowdhary et al.'s 2022 Molecular Cell study highlighted an inhomogeneous distribution and rapid dynamics of Hsf1 clustering upon heat shock, with sensitivity to 1,6-hexandiol, which is interpreted as evidence for condensation by LLPS. But this interpretation has been criticized severely by McSwiggen at al. Genes Dev 2019 and Mussacchio EMBO J 2022. It is important to mention that 1,6-hexandiol is known to affect chromatin organization (Itoh et al. Life Science Alliance 2021). Describing such clusters as 'condensates' without further experimental evidence is premature. I encourage authors to settle on their neutral term 'puncta' which they use interchangeably with 'condensate' so as not to confuse the reader. The dynamic binding and unbinding of the low-abundance Hsf1 at coalescent chromatin target sites might explain the liquid-like properties of these clusters without the need for invoking the phase-separation hypothesis. While Hsf1 clusters exhibit features consistent with phase-separated condensates, other equally plausible alternative mechanisms, such as dynamic site-specific interactions (Musacchio, EMBO J, 2022), should also be considered. This is best left for the discussion where the underlying mechanism for puncta formation can be addressed.

Comments on revised version:

The authors have addressed the majority of my comments effectively. The new Sis1 experiment provides a clear illustration of a distinctive response to ethanol and heat. This work offers a comprehensive perspective on Hsf1 in stress response from multiple angles. I have two additional comments to improve the paper without re-review:

(Original point #3) Could the authors clarify the differences between DPY1561 and the original strain used? There appears to be missing statistical analysis for Figure 1E at the bottom.

(Original point #4) In the new Figure 7F, '% transcription' and '% coalescence' are presented. My understanding is that Figures 7D and 7E aim to demonstrate the correlation between HSP104 transcription (a continuous variable) and HSP104-HSP12 coalescence (a binary variable) at the single-cell level. However, averaging the data across cells masks individual variations and potential anti-correlations. The authors could explore statistical methods that handle correlations between a continuous variable and a binary variable. Alternatively, consider converting 'HSP104 transcription' to a binary variable and then performing a chi-square test to assess the association.

Reviewer #3 (Public Review):

This is an interesting manuscript that builds off of this group's previous work focused on the interface between Hsf1, heat shock protein (HSP) mRNA production, and 3D genome topology. Here the group subjects the yeast Saccharomyces cerevisiae to either heat stress (HS) or ethanol stress (ES) and examines Hsf1 and Pol II chromatin binding, Histone occupancy, Hsf1 condensates, HSP gene coalescence (by 3C and live cell imaging), and HSP mRNA expression (by RT-qPCR and live cell imaging). The manuscript is well written, and the experiments seem well done, and generally rigorous, with orthogonal approaches performed to support conclusions. The main findings are that both HS and ES result in Hsf1/Pol II-dependent intergenic interactions, along with formation of Hsf1 condensates. Yet, while HS results in rapid and strong induction of HSP gene expression and Hsf1 condensate resolution, ES result in slow and weak induction of HSP gene expression without Hsf1 condensate resolution. Thus, the conclusion is somewhat phenomenological - that the same transcription factor can drive distinct transcription, topologic, and phase-separation behavior in response to different types of stress. While identifying a mechanistic basis for these results would be a tough task perhaps beyond the scope of this study, it would nevertheless be helpful to place these results in context with a series of other studies demonstrating across various organisms showing Hsf1 driving distinct activities dependent on the context of activation. Perhaps even more importantly, this work left out PMID: 32015439 which is particularly relevant considering that it shows that it is human HSF1 condensate resolution rather than simple condensate formation that is associated with HSF1 transcriptional activity - which are similar to the findings here with this particular dose of HS resulting in resolution and high transcriptional activity versus ES resulting in resolution failure and lower activity. It is also worth noting that the stresses themselves are quite different - ethanol can be used as a carbon source and so beyond inducing proteotoxic stress, the yeast are presumably adapting to this distinct metabolic state. Basically, it is not clear whether these differences are due to the dose of stress, versus we are looking at an early timepoint as ES initiates a genome-wide chromatin restructuring and gene expression reprogramming that goes beyond a response to proteotoxic stress. This reviewer is not suggesting a barrage of new experiments, but perhaps discussion points to contextualize results.

Comments on latest version:

The authors have addressed my concerns.

Reviewer #1 (Public Review):

(1) Significance of the findings:

Cell-to-cell communication is essential for higher functions in bacterial biofilms. Electrical signals have proven effective in transmitting signals across biofilms. These signals are then used to coordinate cellular metabolisms or to increase antibiotic tolerance. Here, the authors have reported for the first time coordinated oscillation of membrane potential in E. coli biofilms that may have a functional role in photoprotection.

(2) Strengths of the manuscript:

- The authors report original data.<br /> - For the first time, they showed that coordinated oscillations in membrane potential occur in E. Coli biofilms.<br /> - The authors revealed a complex two-phase dynamic involving distinct molecular response mechanisms.<br /> - The authors developed two rigorous models inspired by 1) Hodgkin-Huxley model for the temporal dynamics of membrane potential and 2) Fire-Diffuse-Fire model for the propagation of the electric signal.<br /> - Since its discovery by comparative genomics, the Kch ion channel has not been associated with any specific phenotype in E. coli. Here, the authors proposed a functional role for the putative gated-voltage-gated K+ ion channel (Kch channel) : enhancing survival under photo-toxic conditions.

(3) Weakness:

- Contrarily to what is stated in the abstract, the group of B. Maier has already reported collective electrical oscillations in the Gram-negative bacterium Neisseria gonorrhoeae (Hennes et al., PLoS Biol, 2023).<br /> - The data presented in the manuscript are not sufficient to conclude on the photo-protective role of the Kch channel. The authors should perform the appropriate control experiments related to Fig4D,E, i.e. reproduce these experiments without ThT to rule out possible photo-conversion effects on ThT that would modify its toxicity. In addition, it looks like the data reported on Fig 4E are extracted from Fig 4D. If this is indeed the case, it would be more conclusive to report the percentage of PI-positive cells in the population for each condition. This percentage should be calculated independently for each replicate. The authors should then report the average value and standard deviation of the percentage of dead cells for each condition.<br /> - Although Fig 4A clearly shows that light stimulation has an influence on the dynamics of ThT signal in the biofilm, it is important to rule out possible contributions of other environmental variations that occur when the flow is stopped at the onset of light stimulation. I understand that for technical reasons, the flow of fresh medium must be stopped for the sake of imaging. Therefore, I suggest to perform control experiments consisting in stopping the flow at different time intervals before image acquisition (30min or 1h before). If there is no significant contribution from environmental variations due to medium perfusion arrest, the dynamics of ThT signal must be unchanged regardless of the delay between flow stop and the start of light stimulation.<br /> - To precise the role of K+ in the habituation response, I suggest using the ionophore valinomycin at sub-inhibitory concentrations (5 or 10µM). It should abolish the habituation response. In addition, the Kch complementation experiment exhibits a sharp drop after the first peak but on a single point. It would be more convincing to increase the temporal resolution (1min->10s) to show that there are indeed a first and a second peak. Finally, the high concentration (100µM) of CCCP used in this study completely inhibits cell activity. Therefore, it is not surprising that no ThT dynamics was observed upon light stimulation at such concentration of CCCP.<br /> - Since TMRM signal exhibits a linear increase after the first response peak (Supp Fig1D), I recommend to mitigate the statement at line 78.<br /> - Electrical signal propagation is an important aspect of the manuscript. However, a detailed quantitative analysis of the spatial dynamics within the biofilm is lacking. At minima, I recommend to plot the spatio-temporal diagram of ThT intensity profile averaged along the azimuthal direction in the biofilm. In addition, it is unclear if the electrical signal propagates within the biofilm during the second peak regime, which is mediated by the Kch channel: I have plotted the spatio-temporal diagram for Video S3 and no electrical propagation is evident at the second peak. In addition, the authors should provide technical details of how R^2(t) is measured in the first regime (Fig 7E).<br /> - In the series of images presented in supplementary Figure 4A, no wavefront is apparent. Although the microscopy technics used in this figure differs from other images (like in Fig2), the wavefront should be still present. In addition, there is no second peak in confocal images as well (Supp Fig4B) .<br /> - Many important technical details are missing (e.g. biofilm size, R^2, curvature and 445nm irradiance measurements). The description of how these quantitates are measured should be detailed in the Material & Methods section.<br /> - Fig 5C: The curve in Fig 5D seems to correspond to the biofilm case. Since the model is made for single cells, the curve obtained by the model should be compared with the average curve presented in Fig 1B (i.e. single cell experiments).<br /> - For clarity, I suggest to indicate on the panels if the experiments concern single cell or biofilm experiments. Finally, please provide bright-field images associated to ThT images to locate bacteria.<br /> - In Fig 7B, the plateau is higher in the simulations than in the biofilm experiments. The authors should add a comment in the paper to explain this discrepancy.

Reviewer #2 (Public Review):

The authors use ThT dye as a Nernstian potential dye in E. coli. Quantitative measurements of membrane potential using any cationic indicator dye are based on the equilibration of the dye across the membrane according to Boltzmann's law.

Ideally, the dye should have high membrane permeability to ensure rapid equilibration. Others have demonstrated that E.coli cells in the presence of ThT do not load unless there is blue light present, that the loading profile does not look like it is expected for a cationic Nernstian dye. They also show that the loading profile of the dye is different for E.coli cells deleted for the TolC pump. I, therefore, objected to interpreting the signal from the ThT as a Vm signal when used in E.coli. Nothing the authors have said has suggested that I should be changing this assessment.

Specifically, the authors responded to my concerns as follows:

(1) 'We are aware of this study, but believe it to be scientifically flawed. We do not cite the article because we do not think it is a particularly useful contribution to the literature.' This seems to go against ethical practices when it comes to scientific literature citations. If the authors identified work that handles the same topic they do, which they believe is scientifically flawed, the discussion to reflect that should be included.

(2)'The Pilizota group invokes some elaborate artefacts to explain the lack of agreement with a simple Nernstian battery model. The model is incorrect not the fluorophore.'<br /> It seems the authors object to the basic principle behind the usage of Nernstian dyes. If the authors wish to use ThT according to some other model, and not as a Nernstian indicator, they need to explain and develop that model. Instead, they state 'ThT is a Nernstian voltage indicator' in their manuscript and expect the dye to behave like a passive voltage indicator throughout it.

(3)'We think the proton effect is a million times weaker than that due to potassium i.e. 0.2 M K+<br /> versus 10-7 M H+. We can comfortably neglect the influx of H+ in our experiments.'<br /> I agree with this statement by the authors. At near-neutral extracellular pH, E.coli keeps near-neutral intracellular pH, and the contribution from the chemical concentration gradient to the electrochemical potential of protons is negligible. The main contribution is from the membrane potential. However, this has nothing to do with the criticism to which this is the response of the authors. The criticism is that ThT has been observed not to permeate the cell without blue light. The blue light has been observed to influence the electrochemical potential of protons (and given that at near-neutral intracellular and extracellular pH this is mostly the membrane potential, as authors note themselves, we are talking about Vm effectively). Thus, two things are happening when one is loading the ThT, not just expected equilibration but also lowering of membrane potential. The electrochemical potential of protons is coupled via the membrane potential to all the other electrochemical potentials of ions, including the mentioned K+.

(4) 'The vast majority of cells continue to be viable. We do not think membrane damage is dominating.' In response to the question on how the authors demonstrated TMRM loading and in which conditions (and while reminding them that TMRM loading profile in E.coli has been demonstrated in Potassium Phosphate buffer). The request was to demonstrate TMRM loading profile in their condition as well as to show that it does not depend on light. Cells could still be viable, as membrane permeabilisation with light is gradual, but the loading of ThT dye is no longer based on simple electrochemical potential (of the dye) equilibration.

(5) On the comment on the action of CCCP with references included, authors include a comment that consists of phrases like 'our understanding of the literature' with no citations of such literature. Difficult to comment further without references.

(6) 'Shielding would provide the reverse effect, since hyperpolarization begins in the dense centres of the biofilms. For the initial 2 hours the cells receive negligible blue light. Neither of the referee's comments thus seem tenable.'<br /> The authors have misunderstood my comment. I am not advocating shielding (I agree that this is not it) but stating that this is not the only other explanation for what they see (apart from electrical signaling). The other I proposed is that the membrane has changed in composition and/or the effective light power the cells can tolerate. The authors comment only on the light power (not convincingly though, giving the number for that power would be more appropriate), not on the possible changes in the membrane permeability.

(7) 'The work that TolC provides a possible passive pathway for ThT to leave cells seems slightly niche. It just demonstrates another mechanism for the cells to equilibrate the concentrations of ThT in a Nernstian manner i.e. driven by the membrane voltage.' I am not sure what the authors mean by another mechanism. The mechanism of action of a Nernstian dye is passive equilibration according to the electrochemical potential (i.e. until the electrochemical potential of the dye is 0).

(8) 'In the 70 years since Hodgkin and Huxley first presented their model, a huge number of similar models have been proposed to describe cellular electrophysiology. We are not being hyperbolic when we state that the HH models for excitable cells are like the Schrödinger<br /> equation for molecules. We carefully adapted our HH model to reflect the currently understood electrophysiology of E. coli.'

I gave a very concrete comment on the fact that in the HH model conductivity and leakage are as they are because this was explicitly measured. The authors state that they have carefully adopted their model based on what is currently understood for E.coli electrophysiology. It is not clear how. HH uses gKn^4 based on Figure2 here https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1392413/pdf/jphysiol01442-0106.pdf, i.e. measured rise and fall of potassium conductance on msec time scales. I looked at the citation the authors have given and found a resistance of an entire biofilm of a given strain at 3 applied voltages. So why n^4 based on that? Why does unknown current have gqz^4 form? Sodium conductance in HH is described by m^3hgNa (again based on detailed conductance measurements), so why unknown current in E.coli by gQz^4? Why leakage is in the form that it is, based on what measurement?

Throughout their responses, the authors seem to think that collapsing the electrochemical gradient of protons is all about protons, and this is not the case. At near neutral inside and outside pH, the electrochemical potential of protons is simply membrane voltage. And membrane voltage acts on all ions in the cell.

Authors have started their response to concrete comments on the usage of ThT dye with comments on papers from my group that are not all directly relevant to this publication. I understand that their intention is to discredit a reviewer but given that my role here is to review this manuscript, I will only address their comments to the publications/part of publications that are relevant to this manuscript and mention what is not relevant.

Publications in the order these were commented on.

(1) In a comment on the paper that describes the usage of ThT dye as a Nernstian dye authors seem to talk about a model of an entire active cell.<br /> 'Huge oscillations occur in the membrane potentials of E. coli that cannot be described by the SNB model.' The two have nothing to do with each other. Nernstian dye equilibrates according to its electrochemical potential. Once that happens it can measure the potential (under the assumption that not too much dye has entered and thus lowered too much the membrane potential under measurement). The time scale of that is important, and the dye can only measure processes that are slower than that equilibration. If one wants to use a dye that acts under a different model, first that needs to be developed, and then coupled to any other active cell model.

(2) The part of this paper that is relevant is simply the usage of TMRM dye. It is used as Nernstian dye, so all the above said applies. The rest is a study of flagellar motor.

(3) The authors seem to not understand that the electrochemical potential of protons is coupled to the electrochemical potentials of all other ions, via the membrane potential. In the manuscript authors talk about, PMF~Vm, as DeltapH~0. Other than that this publication is not relevant to their current manuscript.

(4) The manuscript in fact states precisely that PMF cannot be generated by protons only and some other ions need to be moved out for the purpose. In near neutral environment it stated that these need to be cations (K+ e.g.). The model used in this manuscript is a pump-leak model. Neither is relevant for the usage of ThT dye.

Further comments include, along the lines of:

'The editors stress the main issue raised was a single referee questioning the use of ThT as an indicator of membrane potential. We are well aware of the articles by the Pilizota group and we believe them to be scientifically flawed. The authors assume there are no voltage-gated ion channels in E. coli and then attempt to explain motility data based on a simple Nernstian battery model (they assume E. coli are unexcitable<br /> matter). This in turn leads them to conclude the membrane dye ThT is faulty, when in fact it is a problem with their simple battery model.'

The only assumption made when using a cationic Nernstian dye is that it equilibrates passively across the membrane according to its electrochemical potential. As it does that, it does lower the membrane potential, which is why as little as possible is added so that this is negligible. The equilibration should be as fast as possible, but at the very least it should be known, as no change in membrane potential can be measured that is faster than that.

This behaviour should be orthogonal to what the cell is doing, it is a probe after all. If the cell is excitable, a Nernstian dye can be used, as long as it's still passively equilibrating and doing so faster than any changes in membrane potential due to excitations of the cells. There are absolutely no assumptions made on the active system that is about to be measured by this expected behaviour of a Nernstian dye. And there shouldn't be, it is a probe. If one wants to use a dye that is not purely Nernstian that behaviour needs to be described and a model proposed. As far as I can find, authors do no such thing.

There is a comment on the use of a flagellar motor as a readout of PMF, stating that the motor can be stopped by YcgR citing the work from 2023. Indeed, there is a range of references such as https://doi.org/10.1016/j.molcel.2010.03.001 that demonstrate this (from around 2000-2010 as far as I am aware). The timescale of such slowdown is hours (see here Figure 5 https://www.cell.com/cell/pdf/S0092-8674(10)00019-X.pdf). Needless to say, the flagellar motor when used as a probe, needs to stay that in the conditions used. Thus one should always be on the lookout at any other such proteins that could slow it down and we are not aware of yet or make the speed no longer proportional to the PMF. In the papers my group uses the motor the changes are fast, often reversible, and in the observation window of 30min. They are also the same with DeltaYcgR strain, which we have not included as it seemed given the time scales it's obvious, but certainly can in the future (as well as stay vigilant on any conditions that would render the motor a no longer suitable probe for PMF).

Reviewer #3 (Public Review):

This manuscript by Akabuogu et al. investigates membrane potential dynamics in E. coli. Membrane potential fluctuations have been observed in bacteria by several research groups in recent years, including in the context of bacterial biofilms where they have been proposed to play a role in cellular communication. Here, these authors investigate membrane potential in E. coli, in both single cells and biofilms. I have reviewed the revised manuscript provided by the authors, as well as their responses to the initial reviews; my opinion about the manuscript is largely unchanged. I have focused my public review on those issues that I believe to be most pressing, with additional comments included in the review to authors. Although these authors are working in an exciting research area, the evidence they provide for their claims is inadequate, and several key control experiments are still missing. In some cases, the authors allude to potentially relevant data in their responses to the initial reviews, but unfortunately these data are not shown. Furthermore, I cannot identify any traveling wavefronts in the data included in this manuscript. In addition to the challenges associated with the use of Thioflavin-T (ThT) raised by the second reviewer, these caveats make the work presented in this manuscript difficult to interpret.

First, some of the key experiments presented in the paper lack required controls:

(1) This paper asserts that the observed ThT fluorescence dynamics are induced by blue light. This is a fundamental claim in the paper, since the authors go on to argue that these dynamics are part of a blue light response. This claim must be supported by the appropriate negative control experiment measuring ThT fluorescence dynamics in the absence of blue light- if this idea is correct, these dynamics should not be observed in the absence of blue light exposure. If this experiment cannot be performed with ThT since blue light is used for its excitation, TMRM can be used instead.

In response to this, the authors wrote that "the fluorescent baseline is too weak to measure cleanly in this experiment." If they observe no ThT signal above noise in their time lapse data in the absence of blue light, this should be reported in the manuscript- this would be a satisfactory negative control. They then wrote that "It appears the collective response of all the bacteria hyperpolarization at the same time appears to dominate the signal." I am not sure what they mean by this- perhaps that ThT fluorescence changes strongly only in response to blue light? This is a fundamental control for this experiment that ought to be presented to the reader.

(2) The authors claim that a ∆kch mutant is more susceptible to blue light stress, as evidenced by PI staining. The premise that the cells are mounting a protective response to blue light via these channels rests on this claim. However, they do not perform the negative control experiment, conducting PI staining for WT the ∆kch mutant in the absence of blue light. In the absence of this control it is not possible to rule out effects of the ∆kch mutation on overall viability and/or PI uptake. The authors do include a growth curve for comparison, but planktonic growth is a very different context than surface-attached biofilm growth. Additionally, the ∆kch mutation may have impacts on PI permeability specifically that are not addressed by a growth curve. The negative control experiment is of key importance here.

Second, the ideas presented in this manuscript rely entirely on analysis of ThT fluorescence data, specifically a time course of cellular fluorescence following blue light treatment. However, alternate explanations for and potential confounders of the observed dynamics are not sufficiently addressed:

(1) Bacterial cells are autofluorescent, and this fluorescence can change significantly in response to stress (e.g. blue light exposure). To characterize and/or rule out autofluorescence contributions to the measurement, the authors should present time lapse fluorescence traces of unstained cells for comparison, acquired under the same imaging conditions in both wild type and ∆kch mutant cells. In their response to reviewers the authors suggested that they have conducted this experiment and found that the autofluorescence contribution is negligible, which is good, but these data should be included in the manuscript along with a description of how these controls were conducted.

(2) Similarly, in my initial review I raised a concern about the possible contributions of photobleaching to the observed fluorescence dynamics. This is particularly relevant for the interpretation of the experiment in which catalase appears to attenuate the decay of the ThT signal; this attenuation could alternatively be due to catalase decreasing ThT photobleaching. In their response, the authors indicated that photobleaching is negligible, which would be good, but they do not share any evidence to support this claim. Photobleaching can be assessed in this experiment by varying the light dosage (illumination power, frequency, and/or duration) and confirming that the observed fluorescence dynamics are unaffected.

Third, the paper claims in two instances that there are propagating waves of ThT fluorescence that move through biofilms, but I do not observe these waves in any case:

(1) The first wavefront claim relates to small cell clusters, in Fig. 2A and Video S2 and S3 (with Fig. 2A and Video S2 showing the same biofilm.) I simply do not see any evidence of propagation in either case- rather, all cells get brighter and dimmer in tandem. I downloaded and analyzed Video S3 in several ways (plotting intensity profiles for different regions at different distances from the cluster center, drawing a kymograph across the cluster, etc.) and in no case did I see any evidence of a propagating wavefront. (I attempted this same analysis on the biofilm shown in Fig. 2A and Video S2 with similar results, but the images shown in the figure panels and especially the video are still both so saturated that the quantification is difficult to interpret.) If there is evidence for wavefronts, it should be demonstrated explicitly by analysis of several clusters. For example, a figure of time-to-peak vs. position in the cluster demonstrating a propagating wave would satisfy this. Currently, I do not see any wavefronts in this data.

(2) The other wavefront claim relates to biofilms, and the relevant data is presented in Fig. S4 (and I believe also in what is now Video S8, but no supplemental video legends are provided, and this video is not cited in text.) As before, I cannot discern any wavefronts in the image and video provided; Reviewer 1 was also not able to detect wave propagation in this video by kymograph. Some mean squared displacements are shown in Fig. 7. As before, the methods for how these were obtained are not clearly documented either in this manuscript or in the BioRXiv preprint linked in the initial response to reviewers, and since wavefronts are not evident in the video it is hard to understand what is being measured here- radial distance from where? (The methods section mentions radial distance from the substrate, this should mean Z position above the imaging surface, and no wavefronts are evident in Z in the figure panels or movie.) Thus, clear demonstration of these wavefronts is still missing here as well.

Fourth, I have some specific questions about the study of blue light stress and the use of PI as a cell viability indicator:

(1) The logic of this paper includes the premise that blue light exposure is a stressor under the experimental conditions employed in the paper. Although it is of course generally true that blue light can be damaging to bacteria, this is dependent on light power and dosage. The control I recommended above, staining cells with PI in the presence and absence of blue light, will also allow the authors to confirm that this blue light treatment is indeed a stressor- the PI staining would be expected to increase in the presence of blue light if this is so.

(2) The presence of ThT may complicate the study of the blue light stress response, since ThT enhances the photodynamic effects of blue light in E. coli (Bondia et al. 2021 Chemical Communications). The authors could investigate ThT toxicity under these conditions by staining cells with PI after exposing them to blue light with or without ThT staining.

(3) In my initial review, I wrote the following: "In Figures 4D - E, the interpretation of this experiment can be confounded by the fact that PI uptake can sometimes be seen in bacterial cells with high membrane potential (Kirchhoff & Cypionka 2017 J Microbial Methods); the interpretation is that high membrane potential can lead to increased PI permeability. Because the membrane potential is largely higher throughout blue light treatment in the ∆kch mutant (Fig. 3[BC]), this complicates the interpretation of this experiment." In their response, the authors suggested that these results are not relevant in this case because "In our experiment methodology, cell death was not forced on the cells by introducing an extra burden or via anoxia." However, the logic of the paper is that the cells are in fact dying due to an imposed external stressor, which presumably also confers an increased burden as the cells try to deal with the stress. Instead, the authors should simply use a parallel method to confirm the results of PI staining. For example, the experiment could be repeated with other stains, or the viability of blue light-treated cells could be addressed more directly by outgrowth or colony-forming unit assays.

The CFU assay suggested above has the additional advantage that it can also be performed on planktonic cells in liquid culture that are exposed to blue light. If, as the paper suggests, a protective response to blue light is being coordinated at the biofilm level by these membrane potential fluctuations, the WT strain might be expected to lose its survival advantage vs. the ∆kch mutant in the absence of a biofilm.

Fifth, in several cases the data are presented in a way that are difficult to interpret, or the paper makes claims that are different to observe in the data:

(1) The authors suggest that the ThT and TMRM traces presented in Fig. S1D have similar shapes, but this is not obvious to me- the TMRM curve has very little decrease after the initial peak and only a modest, gradual rise thereafter. The authors suggest that this is due to increased TMRM photobleaching, but I would expect that photobleaching should exacerbate the signal decrease after the initial peak. Since this figure is used to support the use of ThT as a membrane potential indicator, and since this is the only alternative measurement of membrane potential presented in text, the authors should discuss this discrepancy in more detail.

(2) The comparison of single cells to microcolonies presented in figures 1B and D still needs revision:

First, both reviewer 1 and I commented in our initial reviews that the ThT traces, here and elsewhere, should not be normalized- this will help with the interpretation of some of the claims throughout the manuscript.

Second, the way these figures are shown with all traces overlaid at full opacity makes it very difficult to see what is being compared. Since the point of the comparison is the time to first peak (and the standard deviation thereof), histograms of the distributions of time to first peak in both cases should be plotted as a separate figure panel.<br /> Third, statistical significance tests ought to be used to evaluate the statistical strength of the comparisons between these curves. The authors compare both means and standard deviations of the time to first peak, and there are appropriate statistical tests for both types of comparisons.

(3) The authors claim that the curve shown in Fig. S4B is similar to the simulation result shown in Fig. 7B. I remain unconvinced that this is so, particularly with respect to the kinetics of the second peak- at least it seems to me that the differences should be acknowledged and discussed. In any case, the best thing to do would be to move Fig. S4B to the main text alongside Fig. 7B so that the readers can make the comparison more easily.

(4) As I wrote in my first review, in the discussion of voltage-gated calcium channels, the authors refer to "spiking events", but these are not obvious in Figure S3E. Although the fluorescence intensity changes over time, these fluctuations cannot be distinguished from measurement noise. A no-light control could help clarify this.

(5) In the lower irradiance conditions in Fig. 4A, the ThT dynamics are slower overall, and it looks like the ThT intensity is beginning to rise at the end of the measurement. The authors write that no second peak is observed below an irradiance threshold of 15.99 µW/mm2. However, could a more prominent second peak be observed in these cases if the measurement time was extended? Additionally, the end of these curves looks similar to the curve in Fig. S4B, in which the authors write that the slow rise is evidence of the presence of a second peak, in contrast to their interpretation here.

Additional considerations:

(1) The analysis and interpretation of the first peak, and particularly of the time-to-fire data is challenging throughout the manuscript the time resolution of the data set is quite limited. It seems that a large proportion of cells have already fired after a single acquisition frame. It would be ideal to increase the time resolution on this measurement to improve precision. This could be done by imaging more quickly, but that would perhaps necessitate more blue light exposure; an alternative is to do this experiment under lower blue light irradiance where the first spike time is increased (Figure 4A).

(2) The authors suggest in the manuscript that "E. coli biofilms use electrical signalling to coordinate long-range responses to light stress." In addition to the technical caveats discussed above, I am missing a discussion about what these responses might be. What constitutes a long-range response to light stress, and are there known examples of such responses in bacteria?

(3) The presence of long-range blue light responses can also be interrogated experimentally, for example, by repeating the Live/Dead experiment in planktonic culture or the single-cell condition. If the protection from blue light specifically emerges due to coordinated activity of the biofilm, the ∆kch mutant would not be expected to show a change in Live/Dead staining in non-biofilm conditions. The CFU experiment I mentioned above could also implicate coordinated long-range responses specifically, if biofilms and liquid culture experiments can be compared (although I know that recovering cells from biofilms is challenging.)

4. At the end of the results section, the authors suggest a critical biofilm size of only 4 μm for wavefront propagation (not much larger than a single cell!) The authors show responses for various biofilm sizes in Fig. 2C, but these are all substantially larger (and this figure also does not contain wavefront information.) Are there data for cell clusters above and below this size that could support this claim more directly?

(5) In Fig. 4C, the overall trajectories of extracellular potassium are indeed similar, but the kinetics of the second peak of potassium are different than those observed by ThT (it rises minutes earlier)- is this consistent with the idea that Kch is responsible for that peak? Additionally, the potassium dynamics also include the first ThT peak- is this surprising given that the Kch channel has no effect on this peak according to the model?

Detailed comments:

Why are Fig. 2A and Video S2 called a microcluster, whereas Video S3, which is smaller, is called a biofilm?

"We observed a spontaneous rapid rise in spikes within cells in the center of the biofilm" (Line 140): What does "spontaneous" mean here?

"This demonstrates that the ion-channel mediated membrane potential dynamics is a light stress relief process.", "E. coli cells employ ion-channel mediated dynamics to manage ROS-induced stress linked to light irradiation." (Line 268 and the second sentence of the Fig. 4F legend): This claim is not well-supported. There are several possible interpretations of the catalase experiment (which should be discussed); this experiment perhaps suggests that ROS impacts membrane potential but does not indicate that these membrane potential fluctuations help the cells respond to blue light stress. The loss of viability in the ∆kch mutant might indicate a link between these membrane potential experiments and viability, but it is hard to interpret without the no light controls I mention above.

"The model also predicts... the external light stress" (Lines 338-341): Please clarify this section. Where does this prediction arise from in the modeling work? Second, I am not sure what is meant by "modulates the light stress" or "keeps the cell dynamics robust to the intensity of external light stress" (especially since the dynamics clearly vary with irradiance, as seen in Figure 4A).

"We hypothesized that E. coli not only modulates the light-induced stress but also handles the increase of the ROS by adjusting the profile of the membrane potential dynamics" (Line 347): I am not sure what "handles the ROS by adjusting the profile of the membrane potential dynamics" means. What is meant by "handling" ROS? Is the hypothesis that membrane potential dynamics themselves are protective against ROS, or that they induce a ROS-protective response downstream, or something else? Later the authors write that changes in the response to ROS in the model agree with the hypothesis, but just showing that ROS impacts the membrane potential does not seem to demonstrate that this has a protective effect against ROS.

"Mechanosensitive ion channels (MS) are vital for the first hyperpolarization event in E. coli." (Line 391): This is misleading- mechanosensitive ion channels totally ablate membrane potential dynamics, they don't have a specific effect on the first hyperpolarization event. The claim that mechanonsensitive ion channels are specifically involved in the first event also appears in the abstract.

Also, the apparent membrane potential is much lower even at the start of the experiment in these mutants (Fig. 6C-D)- is this expected? This seems to imply that these ion channels also have a blue light-independent effect.

Throughout the paper, there are claims that the initial ThT spike is involved in "registering the presence of the light stress" and similar. What is the evidence for this claim?

"We have presented much better quantitative agreement of our model with the propagating wavefronts in E. coli biofilms..." (Line 619): It is not evident to me that the agreement between model and prediction is "much better" in this work than in the cited work (reference 57, Hennes et al. 2023). The model in Figure 4 of ref. 57 seems to capture the key features of their data.

In methods, "Only cells that are hyperpolarized were counted in the experiment as live" (Line 745): what percentage of cells did not hyperpolarize in these experiments?

Some indication of standard deviation (error bars or shading) should be added to all figures where mean traces are plotted.

Video S8 is very confusing- why does the video play first forwards and then backwards? It is easy to misinterpret this as a rise in the intensity at the end of the experiment.

Reviewer #1 (Public Review):

Summary:

In this study of metabolism using Xenopus, explanted porcine hearts and limbs, and human organs-on-chips, Sperry et al studied the ability of WB3 to slow metabolism and mobility. The group developed WB3, an analog of SNC80, void of SNC80's delta-opioid receptor binding capacity and studied its metabolic impact. The authors concluded that SNC80 and its analog WB3 can induce "biostasis" and produce a hypometabolic state which holds promise for prolonging organ viability in transplant surgery as well as other potential clinical benefits.

Strengths:

This study also opens new avenues for therapeutic possibilities in areas such as trauma, acute infection, and brain injuries. The overall methodology is acceptable, but certain concerns should be addressed.

Weaknesses:

Major comments:

(1) In cardiac and renal transplantation, cold preservation in ice remains a common practice for transporting explanted hearts to donors which remains a cheap and easily accessible way of preserving organs. While ex-vivo mechanical circulatory platforms have been developed and are increasingly being utilized to prolong organ viability, cold preservation remains widely used. The authors perfused explanted hearts with oxygenated perfusion preservation devices at subnormothermic temperatures (20-23C) which is even much lower than routinely used in clinical cardiopulmonary bypass scenarios (28-32C) (in the discussion, the authors allude to SNC80's possible "protective effect" in cardiac bypass). It is unclear how much of the hypometabolic state is related to WB3 administration versus hypothermia. The study will benefit from a comparison of WB3 administration and hypothermia in Xenopus, explanted porcine organs versus cold preservation alone to show distinction in biostasis parameters.

(2) The authors selected SNC80 based on a literature survey where it was identified based on its ability to induce hypothermia and protect against the effects of spinal cord ischemia in rodents. While this makes sense, were other drugs (eg. Puerarin) considered? The induction of hypothermia and spinal cord protective effect of SNC80 may be multifactorial and not necessarily related to its biostatic effects as the authors describe. Please provide some more context into the background of SNC80.

(3) In most of the models, the primary metric that the authors utilize to characterize metabolic activity is oxygen consumption, which is a somewhat limited indicator. For instance, this does not provide any information, however, on anaerobic metabolic activity. In addition, the ATP/ADP ratio was found to decrease in the organ chips where SNC80 was utilized, but similar findings were not presented for the other models.

(4) The authors should provide a more detailed explanation of SNC80's mechanisms of interaction with proteins related to transmembrane transport, mitochondrial activity, and metabolic processes. What is the impact of SNC80 on mitochondrial function, particularly ATP production and mitochondrial respiration? Are there changes in mitochondrial membrane potential, electron transport chain activity, or oxidative phosphorylation? In this context, authors discuss the potential role of NCX1 as a binding target for SNC80 and its various mechanisms in slowing metabolism. However, no experiments have been done to confirm this binding in the present study. Co-immunoprecipitation studies using appropriate antibodies against SNC80 and NCX1 should be considered to demonstrate their direct binding. Additionally, surface plasmon resonance (SPR) or isothermal titration calorimetry (ITC) experiments could be employed to quantify the binding affinity between SNC80 and NCX1, providing further evidence of their interaction. These experiments would elucidate the binding mechanism between SNC80 and NCX1 and reveal more information on the mechanism of action for SNC80.

(5) The manuscript notes that histological analysis was conducted, but it seems that only example images are provided, such as Fig 4f. Quantified histological data would provide a more thorough understanding of tissue integrity.

(6) Some of the points mentioned in the discussion and conclusion are rather strong and based on possible associations such as SNC80's potential vasodilatory capacity conferring a cardioprotective effect, ability to reversibly suppress metabolism across different temperatures and species. Please tone this down and stay limited to the organs studied. Further, the reversibility of the findings may be more objectively assessed by biomarkers with decreased immunofluorescence in response to ischemia such as troponin I for heart and albumin for liver. Additionally, an investigation of proteins involved in inflammation, hypoxia, and key cell death pathways using immunohistochemistry analysis can better describe the impact of treatment on apoptosis/necroptosis.

(7) What could be the underlying cause of the observed increase in intercellular spacing after SNC80 administration in porcine limbs which also seems to be evident in the heart histology samples? This seems to be more prominent in the SNC80 compared to the vehicle group.

(8) In the Discussion section, it would be valuable to provide a concise interpretation of the lipidomic data, particularly explaining how changes in acylcarnitine and cholesterol ester levels may relate to tadpole metabolism, hibernation, or other biological processes.

(9) What are the limitations or disadvantages of the study? Does SNC80 possess any immunomodulatory properties that might affect the outcomes of organ transplantation? Are there specific organs for which SNC80 may not be a suitable preservation agent, and if so, what are the reasons behind this?

Comments on revised version:

The authors have satisfactorily addressed our comments in the rebuttal letter. The limitations described by the authors in point #9, however, need to be incorporated in the revised manuscript in detail as they are important in guiding interpretation of the present data. Congratulations again on the important study.

Reviewer #2 (Public Review):

Summary:

This manuscript titled "Identification of pharmacological inducers of a reversible hypometabolic state for whole organ preservation" reports the effects of delta opioid receptor activator SNC80 and its modified analog WB3 with ~1,000 times less delta opioid receptor binding activity on metabolic state.

Strengths:

This is an interesting study with potentially broad implications for organ preservation.

Weaknesses:

However, there are several limitations which raise concerns.

(1) The authors developed an analog of a known delta opioid receptor activator SNC80 with three orders of magnitude lesser binding with the delta opioid receptor WB3. This will likely reduce the undesirable effects of SNC80 while preserving metabolic slowing needed for organ preservation. Yet, most experiments were done with SNC80, not the superior modification, WB3, shown in only a limited set of experiments, Figure 3.

(2) The heart is one of the most challenging organs to preserve, and some experiments are done to establish the metabolic effects of SNC80. However, the biodistribution study, shown in Figure 2, conspicuously omitted the heart.

(3) I do not understand the design of the electrophysiology and contractility experiments with the porcine hearts. How did you defibrillate the hearts after removal and establishing perfusion? Lines 173-175 on Page 7 state: "After defibrillation with epinephrine, the P and QRS waveforms were visible in ECGs from 3 of 4 SNC80-treated hearts (Table S1), suggesting that those hearts regain atrial and ventricular polarization." Please clarify. Defibrillation is done with an electric shock. Also, please show the ECG recordings to support your conclusions about "polarization." What did you mean by "polarization"? Depolarization? Repolarization? Or resting potential. To establish a normal physiological state, please show ECG waveforms and present data on basic ECG characteristics: heart rate, PQ and QT intervals, and P and QRS durations. I recommend perfusion of the porcine heart with WB3, not only SNC80.

(4) Pathology data also raises concerns. The histology images shown in Figure 4f are not quantified, and they show apparently higher levels of tissue disruption in SNC80-treated tissue vs vehicle-treated. The test (lines 169-171) confirms this concern: "In some hearts treated with SNC80, greater waviness of muscle fibers was observed, possibly indicating a state of muscle contraction." It will be helpful to measure markers of apoptosis and necrosis and to apply TTC viability staining.

(5) The apparent state of contracture suggests a higher degree of myocardial damage and a high intracellular calcium level in SNC80-treated hearts. The authors suggested that the sodium-calcium exchanger NCX is a possible target of SNC80 and could be responsible for the "hypometabolic state." However, NCX1 is critically important in the extrusion of cytosolic Ca2+ during the diastolic phase. Failure to remove excessive calcium and restore ionic homeostasis would lead to calcium overload and heart failure.

(6) I am surprised the authors did not consider using the gold standard assay for measuring mitochondrial function in cells by the Seahorse Cell Mito Stress Test.

Comments on revised version:

I am satisfied with the revisions. The authors addressed major concerns with new data and/or provided satisfactory rebuttal.

Reviewer #3 (Public Review):

Summary:

Plasmacytoid dendritic cells (pDCs) represent a specialized subset of dendritic cells (DCs) known for their role in producing type I interferons (IFN-I) in response to viral infections. It was believed that pDCs originated from common DC progenitors (CDP). However, recent studies by Rodrigues et al. (Nature Immunology, 2018) and Dress et al. (Nature Immunology, 2019) have challenged this perspective, proposing that pDCs predominantly develop from lymphoid progenitors expressing IL-7R and Ly6D. A minor subset of pDCs arising from CDP has also been identified as functionally distinct, exhibiting reduced IFN-I production but a strong capability to activate T cell responses. On the other hand, clonal lineage tracing experiments, as recently reported by Feng et al. (Immunity, 2022), have demonstrated a shared origin between pDCs and conventional DCs (cDCs), suggesting a contribution of common DC precursors to the pDC lineage.

In this context, Araujo et al. investigated the heterogeneity of pDCs in terms of both development and function. Their findings revealed that approximately 20% of pDCs originate from lymphoid progenitors common to B cells. Using Mb1-Cre x Bcl11a floxed mice, the authors demonstrated that the development of this subset of pDCs, referred to as "B-pDCs," relied on the transcription factor BCL11a. Functionally, B-pDCs exhibited a diminished capacity to produce IFN-I in response to TLR9 agonists but secreted more IL-12 compared to conventional pDCs. Moreover, B-pDCs, either spontaneously or upon activation, exhibited increased expression of activation markers (CD80/CD86/MHC-II) and a heightened ability to activate T cell responses in vitro compared to conventional pDCs. Finally, Araujo et al. characterized these B-pDCs at the transcriptomic level using bulk and single-cell RNA sequencing, revealing them as a unique subset of pDCs expressing certain B cell markers such as Mb1, as well as specific markers (Axl) associated with cells recently described as transitional DCs.<br /> Thus, in contrast to previous findings, this study posits that a small proportion of pDCs derive from B cell-committed lymphoid progenitors, and this subset of B-pDCs exhibits distinct functional characteristics, being less specialized in IFN-I production but rather in T cell activation.

Strengths:

Previously, the same research group delineated the significance of BCL11a as a critical transcription factor in pDC development (Ippolito et al., PNAS, 2014). This study elucidates the precise stage during hematopoiesis at which BCL11a expression becomes essential for the emergence of a distinct subset of pDCs, substantiated by robust genetic evidence in vivo. Furthermore, it underscores the shared developmental origin between pDCs and B cells, reinforcing prior research in the field that suggests a lymphoid origin of pDCs. Finally, this works attributes specific functional properties to pDCs originating from these lymphoid progenitors shared with B cells, emphasizing the early imprinting of functional heterogeneity during their development.

Weaknesses:

Using their Mb1-reporter mice, the authors demonstrate that YFP pDCs originating from lymphoid progenitors are functionally distinct from conventional pDCs, mostly in vitro, but their in vivo relevance remains unknown. As underlined by both reviewers I believe that it is crucial to investigate how Bcl11a conditional deficiency in Mb1 expressing cells affects the anti-viral immune response, for example, using the M-CoV infection model as described by Sulczewski et al. in Nature Immunology, 2023. The current in vivo data using TLR9 agonist and in vitro data using B-pDCs co-cultures with T cells insufficiently address what B-pDCs might be doing in infectious contexts.

Revisions:

I thank the authors for their responses to my questions and for addressing most of my comments clearly and thoroughly. However, one major question remains unanswered: What is the functional relevance of the subset of B-pDCs that they have characterized? This key question, also highlighted by the other reviewer, requires further investigation. The current in vivo data using TLR9 agonist and in vitro data using B-pDCs co-cultures with T cells insufficiently address what B-pDCs might be doing in infectious contexts.

Reviewer #1 (Public Review):

Summary:<br /> In this study the authors advance their previous findings on the role of the SLAM-SAP signaling pathway in the development and function of multiple innate-like gamma-delta T cell subsets. Using high throughput single cell proteogenomics approach, the authors uncover SAP-dependent developmental checkpoints, and the role of SAP signaling in regulating the diversion of γδ T cells into the αβ T cell developmental pathway. Finally, the authors define TRGV4/TRAV13-4(DV7)-expressing T cells as a novel, SAP-dependent Vγ4 γδT1 subset.

Strengths:<br /> This study furthers our understanding of the importance and complexity of the SLAM-SAP signaling pathway not only in the development of innate-like γδ T cells but also the how it potentially balances the γδ/αβ T cell lineage commitment. Additionally, this study reveals the role of SAP-dependent events in generation of γδ TCR repertoire.

Comments on revised version:

The conclusions of the study are supported by well thought-out experiments and compelling data.

Weaknesses:<br /> There are no major weakness in the study.

A few minor points:<br /> (1) In the subsets of the γδ T cells that exhibit reduced BLK expression in B6. SAP KO mice, have the authors examined the expression of Lck and/or Fyn?<br /> (2) Does BLK directly associate with SLAM F1 and or SLAM F6 receptors?<br /> (3) Given the emerging role of γδ T cells in host immunity, it will be useful if the authors add a discussion of how their findings are relevant in disease conditions such as in cancer.

The author has adequately addressed all the reviewers' comments.

Reviewer #2 (Public Review):

Summary:<br /> Mistri et al explore the role of SLAM-SAP signaling in the developmental programming of innate-like gd T cell subsets. Using proteo-genomics, they determined that abrogation of SLAM-SAP signaling altered that programming, reducing some IL-17 producing subsets, including a novel Vγ4 γδT1 subset, and diverting gdTCR-expressing precursors to the ab fate. Altogether, this is a very thorough, thoughtfully interpreted study that adds significantly to our understanding of the contribution of the SLAM-SAP pathway to lineage specification. A particularly interesting element is the role of SLAM-SAP in preventing gd17 progenitors from switching fates and adopting the ab fate.

Comments on revised version:

The authors have addressed the minor issues raised in the original submission.

Reviewer #1 (Public Review):

Summary:

The manuscript by van Heerden et al. reports growth rate variations in the cell cycle of E. coli and links this variation to uneven ribosome concentrations in the cell at birth that arise from an uneven division of cell volumes between the daughter cells. The authors propose a model to explain the experimental data, whose main premises are the exclusion of ribosomes from the nucleoid volume and a linear dependence of the growth rate on ribosome concentration in the cell.

Strengths:

(1) The manuscript highlights an interesting aspect of growth rate variability in bacteria and proposes a mechanism for how this variation is homeostatically corrected.

(2) A sophisticated modeling to explain the experimental data.

Weaknesses:

(1) The experiments lack controls. A partially functional label (L9-mCherry) can make ribosomes much more limiting for growth than are not labeled ribosomes.

(2) The large variation of interdivision times 72-89 min in repeat experiments in Glc is problematic. Some parameters in the measurements related to cell growth appear not properly controlled. It is problematic for a work that aims to establish a new universal behavior related to cell growth.

(3) The authors have not provided convincing evidence that cells in their experiment grow in a steady state.

4) The findings are over-generalized. The existing data show the effects only at some growth rates, but the findings are presented as a new universal principle.

5) The model relies on many assumptions that are not clearly brought out and the choice of model parameters is questionable (in some cases, the parameters seem to contradict well-established experimental data, including the one from the experiments from the very same work). Small changes in parameters and various approximations can have large effects on the model's outcomes; without understanding these responses, the model has a rather limited value.

6) There appears to be a qualitative discrepancy between the model and the experimental data in Glc (the main condition studied). The model predicts that the cells born large have a specific elongation rate that is smaller than the average growth rate of cells, but it grows in time at the beginning of the cell cycle, while the experiments show a decreasing growth rate (Figure 1C, SI Figure S2).

Reviewer #2 (Public Review):

Summary:

This work demonstrates that when E. coli cells divide, and division is not quite symmetric, the smaller cell has a higher growth rate than the larger cell at the beginning, but not the end, of the cell cycle. The authors then demonstrate that smaller cells have a higher ribosome concentration than larger cells, which is consistent with the idea that the two cells receive roughly equal numbers of ribosomes at division because, as they also observe, ribosomes are excluded by the nucleoid from the middle of the mother cell. The experimental observations are reproduced by a mathematical model that assumes growth is driven by ribosome concentration, with contributions from metabolism and active feedback.

Strengths:

The work provides strong evidence in support of the growing consensus that cells correct size fluctuations by modulating growth rate, within a cell cycle and on a single-cell basis. It also offers a plausible explanation for the correction mechanism by showing that ribosomes are excluded from the middle of a mother cell and have a higher concentration in the smaller daughter cell. The work is clearly written and benefits from a strong coupling between the experimental and modeling results. It provides a solid contribution to the field of single-cell bacterial growth control.

Weaknesses:

Although the results strongly suggest it, the work does not explicitly demonstrate (e.g. by direct perturbation) that higher ribosome concentration is the cause of the higher growth rate. Also, it is unclear why an active compensation mechanism is needed in the model, i.e., why size-dependent growth (via ribosome concentration) does not correct growth rate perturbations within a cell cycle automatically.

Reviewer #1 (Public Review):

This article by Navratna et al. reports the first structure of human HGSNAT in an acetyl-CoA-bound state. Through careful structural analysis, the authors propose potential reasons why certain human mutations lead to lysosomal storage disorders and outline a catalytic mechanism. The structural data are of good quality, and the manuscript is clearly written. This study represents an important step toward understanding the mechanism of HGSNAT and is valuable to the field. I have the following suggestions:

(1) The authors should characterize whether the purified protein is active. Otherwise, how does one know if the detergent used maintains the protein in a biologically relevant state? The authors should at least attempt to do so. If these prove to be challenging, at the very least, the authors should try a cell-based assay to demonstrate that the GFP tag does not interfere with the function.

(2) In Figure 5, the authors present a detailed schematic of the catalytic cycle, which I find to be too speculative. There is no evidence to suggest that this enzyme undergoes isomerization, similar to a transporter, between open-to-lumen and open-to-cytosol states. Could it not simply involve some movements of side chains to complete the acetyl transfer?

Reviewer #2 (Public Review):

Summary:

This work describes the structure of Heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), a lysosomal membrane protein that catalyzes the acetylation reaction of the terminal alpha-D-glucosamine group required for degradation of heparan sulfate (HS). HS degradation takes place during the degradation of the extracellular matrix, a process required for restructuring tissue architecture, regulation of cellular function and differentiation. During this process, HS is degraded into monosaccharides and free sulfate in lysosomes.

HGSNAT catalyzes the transfer of the acetyl group from acetyl-CoA to the terminal non-reducing amino group of alpha-D-glucosamine. The molecular mechanism by which this process occur has not been described so far. One of the main reasons to study the mechanism of HGSNAT is that multiple mutations spanning the entire sequence of the protein, such as, nonsense mutations, splice-site variants, and missense mutations lead to dysfunction that causes abnormal accumulation of HS within the lysosomes. This accumulation is a cause of mucopolysaccharidosis IIIC (MPS IIIC), an autosomal recessive neurodegenerative lysosomal storage disorder, for which there are no approved drugs or treatment strategies.<br /> This paper provides a 3.26A structure of HGSNAT, determined by single-particle cryo-EM. The structure reveals that HGSNAT is a dimer in detergent micelles, and a density assigned to acetyl-CoA. The authors speculate about the molecular mechanism of the acetylation reaction, map the mutations known to cause MPS IIIC on the structure and speculate about the nature of the HGSNAT disfunction caused by such mutations.

Strengths:

The paper describes a structure of HGSNAT a member of the transmembrane acyl transferase (TmAT) superfamily. The high-resolution of a HGSNAT bound to acetyl-CoA is important for our understanding of HGSNAT mechanism. The density map is of high-quality, except for the luminal domain. The location of the acetyl-CoA allows speculation about the mechanistic role of multiple residues surrounding this molecule. The authors thoroughly describe the architecture of HGSNAT and map the mutations leading to MPS IIIC.

Reviewer #3 (Public Review):

Summary:

Navratna et al. have solved the first structure of a transmembrane N-acetyltransferase (TNAT), resolving the architecture of human heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT) in the acetyl-CoA bound state using single particle cryo-electron microscopy (cryoEM). They show that the protein is a dimer, and define the architecture of the alpha- and beta-GSNAT fragments, as well as convincingly characterizing the binding site of acetyl-CoA.

Strengths:

This is the first structure of any member of the transmembrane acyl transferase superfamily, and as such it provides important insights into the architecture and acetyl-CoA binding site of this class of enzymes.

The structural data is of a high quality, with an isotropic cryoEM density map at 3.3Å facilitating building of a high-confidence atomic model. Importantly, the density for the acetyl-CoA ligand is particularly well-defined, as are the contacting residues within the transmembrane domain.

The structure of HSGNAT presented here will undoubtedly lay the groundwork for future structural and functional characterization of the reaction cycle of this class of enzymes.

Weaknesses:

While the structural data for the state presented in this work is very convincing, and clearly defines the binding site of acetyl-CoA, to get a complete picture of the enzymatic mechanism of this family, additional structures of other states will be required.

A weakness of the study is the lack of functional validation. The enzymatic activity of the enzyme characterized was not measured, and the enzyme lacks native proteolytic processing, so it is a little unclear whether the structure represents an active enzyme.

Reviewer #2 (Public Review):

Summary:

This paper utilizes a neural network model to investigate how the brain employs an adaptive chunking strategy to effectively enhance working memory capacity, which is a classical and significant question in cognitive neuroscience. By integrating perspectives from both the 'slot model' and 'limited resource models,' the authors adopted a neural network model encompassing the prefrontal cortex and basal ganglia, introduced an adaptive chunking strategy, and proposed a novel hybrid model. The study demonstrates that the brain can adaptively bind various visual stimuli into a single chunk based on the similarity of color features (a continuous variable) among items in visual working memory, thereby improving working memory efficiency. Additionally, it suggests that the limited capacity of working memory arises from the computational characteristics of the neural system, rather than anatomical constraints.

Strengths:

The neural network model utilized in this paper effectively integrates perspectives from both slot models and resource models (i.e., resource-like constraints within a slot-like system). This methodological innovation provides a better explanation for the limited capacity of working memory. By simulating the neural networks of the prefrontal cortex and basal ganglia, the model demonstrates how to optimize working memory storage and retrieval strategies through reinforcement learning (i.e., the efficient management of access to and from working memory). This biologically plausible simulation offers a novel perspective on human working memory and potentially provides a novel explanation for the working memory difficulties observed in patients with Parkinson's disease and other disorders. Furthermore, the effectiveness of the model is validated through computational simulation experiments, yielding reliable and robust predictions.

Weaknesses:

The model employs a spiking neural network, which is relatively complex. Additionally, while this paper validates the effectiveness of chunking strategies used by the brain to enhance working memory efficiency through computational simulations, further comparison with related phenomena observed in cognitive neuroscience experiments on limited working memory capacity, such as the recency effect, is necessary to verify its generalizability.

Reviewer #1 (Public Review):

Summary:

In this research, Soni and Frank investigate the network mechanisms underlying capacity limitations in working memory from a new perspective, with a focus on visual working memory (VWM). The authors have advanced beyond the classical neural network model, which incorporates the prefrontal cortex and basal ganglia (PBWM), by introducing an adaptive chunking variant. This model is trained using a biologically plausible, dopaminergic reinforcement learning framework. The adaptive chunking mechanism is particularly well-suited to the VWM tasks involving continuous stimuli and elegantly integrates the 'slot' and 'resource' theories of working memory constraints. The chunk-augmented PBWM operates as a slot-like system with resource-like limitations.

Through numerical simulations under various conditions, Soni and Frank demonstrate the performance of the chunk-augmented PBWM model surpasses the no-chunk control model. The improvements are evident in enhanced effective capacity, optimized resource management, and reduced error rates. The retention of these benefits, even with increased capacity allocation, suggests that working memory limitations are due to a combination of factors, including the efficient credit assignments that are learned flexibly through reinforcement learning. In essence, this work addresses fundamental questions related to a computational working memory limitation using a biologically-inspired neural network, and thus has implications for clinical conditions in which working memory is affected, such as Parkinson's disease, ADHD, and schizophrenia.

Strengths:

The integration of mechanistic flexibility, reconciling two theories for WM capacity into a single unified model, results in a neural network that is both more adaptive and human-like. Building on the PBWM framework ensures the robustness of the findings. The addition of the chunking mechanism tailors the original model for continuous visual stimuli. Chunk-stripe mechanisms contribute to the 'resource' aspect, while input-stripes contribute to the 'slot' aspect. This combined network architecture enables flexible and diverse computational functions, enhancing performance beyond that of the classical model.

Moreover, unlike previous studies that design networks for specific task demands, the proposed network model can dynamically adapt to varying task demands by optimizing the chunking gating policy through RL.

The implementation of a dopaminergic reinforcement learning protocol, as opposed to a hard-wired design, leads to the emergence of strategic gating mechanisms that enhance the network's computational flexibility and adaptability. These gating strategies are vital for VWM tasks and are developed in a manner consistent with ecological and evolutionary learning held by humans. Further examination of how reward prediction error signals, both positive and negative, collaborate to refine gating strategies reveals the crucial role of reward feedback in fine-tuning the working memory computations and the model's behavior, aligning with the current neuroscientific understanding that reward matters.

Furthermore, assessing the impact of a healthy balance of dopaminergic reward prediction error signals on information manipulation holds implications for patients with altered striatal dopaminergic signaling.

Weaknesses:

While I appreciate the novelty of the idea presented in this paper, which aligns with common interests in cognitive neuroscience, I believe there are several areas that require further clarification.

First, the method section appears somewhat challenging to follow. To enhance clarity, it might be beneficial to include a figure illustrating the overall model architecture. This visual aid could provide readers with a clearer understanding of the overall network model.

Additionally, the structure depicted in Figure 2 could be potentially confusing. Notably, the absence of an arrow pointing from the thalamus to the PFC and the apparent presence of two separate pathways, one from sensory input to the PFC and another from sensory input to the BG and then to the thalamus, may lead to confusion. While I recognize that Figure 2 aims to explain network gating, there is room for improvement in presenting the content accurately.

Still, for the method part, it would enhance clarity to explicitly differentiate between predesigned (fixed) components and trainable components. Specifically, does the supplementary material state that synaptic connection weights in striatal units (Go&NoGo) are trained using XCAL, while other components, such as those in the PFC and lateral inhibition, are not trained (I found some sentences in 'Limitations and Future Directions')?

I'm not sure about the training process shown in Figure 8. It appears that the training may not have been completed, given that the blue line representing the chunk stripe is still ascending at the endpoint. The weights depicted in panel d) seem to correspond with those shown in panels b) and c), no? Then, how is the optimization process determined to be finished? Alternatively, could it be stated that these weight differences approach a certain value asymptotically? It would be better to clarify the convergence criteria of the optimization process.

Reviewer #1 (Public Review):

Summary:

This manuscript reports the effects of a heterozygous mutation in the KCNT1 potassium channels on the properties of ion currents and firing behavior of excitatory and inhibitory neurons in the cortex of mice expressing KCNT1-Y777H. In humans, this mutation as well as multiple other heterozygotic mutations produce very severe early-onset seizures and produce a major disruption of all intellectual function. In contrast, in mice, this heterozygous mutation appears to have no behavioral phenotype or any increased propensity to seizures. A relevant phenotype is, however, evident in mice with the homozygous mutation, and the authors have previously published the results of similar experiments with the homozygotes. As perhaps expected, the neuronal effects of the heterozygous mutation presented in this manuscript are generally similar but markedly smaller than the previously published findings on homozygotes. There are, however, some interesting differences, particularly on PV+ interneurons, which appear to be more excitable than wild type in the heterozygotes but more excitable in the heterozygotes. This raises the interesting question, which has been explicitly discussed by the authors in the revised manuscript, as to whether the reported changes represent homeostatic events that suppress the seizure phenotype in the mouse heterozygotes or simply changes in excitability that do not reach the threshold for behavioral outcomes.

Strengths and Weaknesses:

(1) The authors find that the heterozygous mutation in PV+ interneurons increases their excitability, a result that is opposite from their previous observation in neurons with the corresponding homozygous mutation. They propose that this results from the selective upregulation of a persistent sodium current INaP in the PV+ interneurons. These observations are very interesting ones, and they raised some issues in the original submission:

A) The protocol for measuring the INaP current could potentially lead to results that could be (mis)interpreted in different ways in different cells. First, neither K currents nor Ca currents are blocked in these experiments. Instead, TTX is applied to the cells relatively rapidly (within 1 second) and the ramp protocol is applied immediately thereafter. It is stated that, at this time, Na currents and INaP are fully blocked but that any effects on Na-activated K currents are minimal. In theory this would allow the pre- to post- difference current to represent a relatively uncontaminated INaP. This would, however, only work if activation of KNa currents following Na entry is very slow, taking many seconds. A good deal of literature has suggested that the kinetics of activation of KNa currents by Na influx vary substantially between cell types, such that single action potentials and single excitatory synaptic events rapidly evoke KNa currents in some cell types. This is, of course, much faster than the time of TTX application. Most importantly, the kinetics of KNa activation may be different in different neuronal types, which would lead to errors that could produce different estimates of INaP in PV+ interneurons vs other cell types.

In their revised manuscript, the authors have provided good data demonstrating that, at least for the PV and SST neurons, loss of KNa currents after TTX application is slow relative to the time course of loss of INaP, justifying the use of this protocol for these neuronal types.

B) As the authors recognize, INaP current provides a major source of cytoplasmic sodium ions for the activation. An expected outcome of increased INaP is, therefore, further activation of KNa currents, rather than a compensatory increase in an inward current that counteracts the increase in KNa currents, as is suggested in the discussion.

The authors comment in the rebuttal that, despite the fact that sodium entry through INaP is known to activate KNa channels, an increase in INaP does not necessarily imply increased KNa current. This issue should be addressed directly somewhere in the text, perhaps most appropriately in the discussion.

C) The numerical simulations, in general, provide a very useful way to evaluate the significance of experimental findings. Nevertheless, while the in-silico modeling suggests that increases in INaP can increase firing rate in models of PV+ neurons, there is as yet insufficient information on the relative locations of the INaP channels and the kinetics of sodium transfer to KNa channels to evaluate the validity of this specific model.

The authors have now put in all of the appropriate caveats on this very nicely in the revised manuscript.

(2) The effects of the KCNT1 channel blocker VU170 on potassium currents are somewhat larger and different from those of TTX, suggesting that additional sources of sodium may contribute to activating KCNT1, as suggested by the authors. Because VU170 is, however, a novel pharmacological agent, it may be appropriate to make more careful statements on this. While the original published description of this compound reported no effect on a variety of other channels, there are many that were not tested, including Na and cation channels that are known to activate KCNT1, raising the possibility of off-target effects.

In the revised version, the authors have added more to the manuscript on this issue and have added a very clear discussion of this to the text (in the discussion section).

This is a very clear and thorough piece of work, and the authors are to be congratulated on this. My one remaining suggestion would be to make an explicit statement about whether increased sodium influx through INaP channels, which is thought to activate KNa channels, would be likely to increase KNa current in these neurons (see comment 1B).

Reviewer #2 (Public Review):

Summary:

In this manuscript, Shore et al. investigate the consequent changes in excitability and synaptic efficacy of diverse neuronal populations in an animal model of juvenile epilepsy. Using electrophysiological patch-clamp recordings from dissociated neuronal cultures, the authors find diverging changes in two major populations of inhibitory cell types, namely somatostatin (SST)- and parvalbumin (PV)-positive interneurons, in mice expressing a variant of the KCNT1 potassium channel. They further suggest that the differential effects are due to a compensatory increase in the persistent sodium current in PV interneurons in pharmacological and in silico experiments. It remains unclear why this current is selectively enhanced in PV-interneurons.

Strengths:

(1) Heterozygous KCNT1 gain of function variant was used which more accurately models the human disorder.

(2) The manuscript is clearly written, and the flow is easy to follow. The authors explicitly state the similarities and differences between the current findings and the previously published results in the homozygous KCNT1 gain of function variant.

(3) This study uses a variety of approaches including patch clamp recording, in silico modeling and pharmacology that together make the claims stronger.

(4) Pharmacological experiments are fraught with off-target effects and thus it bolsters the authors' claims when multiple channel blockers (TTX and VU170) are used to reconstruct the sodium-activated potassium current.

Weaknesses:

(1) This study mostly relies on recordings in dissociated cortical neurons. Although specific WT interneurons showed intrinsic membrane properties like those reported for acute brain slices, it is unclear whether the same will be true for those cells expressing KCNT1 variants, especially when the excitability changes are thought to arise from homeostatic compensatory mechanisms. The authors do confirm that mutant SST-interneurons are hypoexcitable using an ex vivo slice preparation which is consistent with work for other KCTN1 gain of function variants (e.g. Gertler et al., 2022). However, the key missing evidence is the excitability state of mutant PV-interneurons, given the discrepant result of reduced excitability of PV cells reported by Gertler et al in acute hippocampal slices.

Reviewer #3 (Public Review):

Summary:

The present manuscript by Shore et al. entitled Reduced GABAergic Neuron Excitability, Altered Synaptic Connectivity, and Seizures in a KCNT1 Gain-of-Function Mouse Model of Childhood Epilepsy" describes in vitro and in silico results obtained in cortical neurons from mice carrying the KCNT1-Y777H gain-of-function (GOF) variant in the KCNT1 gene encoding for a subunit of the Na+-activated K+ (KNa) channel. This variant corresponds to the human Y796H variant found in a family with Autosomal Dominant Nocturnal Frontal lobe epilepsy. The occurrence of GOF variants in potassium channel encoding genes is well known, and among potential pathophysiological mechanisms, impaired inhibition has been documented as responsible for KCNT1-related DEEs. Therefore, building on a previous study by the same group performed in homozygous KI animals, and considering that the largest majority of pathogenic KCNT1 variants in humans occur in heterozygosis, the Authors have investigated the effects of heterozygous Kcnt1-Y777H expression on KNa currents and neuronal physiology among cortical glutamatergic and the 3 main classes of GABAergic neurons, namely those expressing vasoactive intestinal polypeptide (VIP), somatostatin (SST), and parvalbumin (PV), crossing KCNT1-Y777H mice with PV-, SST- and PV-cre mouse lines, and recording from GABAergic neurons identified by their expression of mCherry (but negative for GFP used to mark excitatory neurons).

The results obtained revealed heterogeneous effects of the variant on KNa and action potential firing rates in distinct neuronal subpopulations, ranging from no change (glutamatergic and VIP GABAergic) to decreased excitability (SST GABAergic) to increased excitability (PV GABAergic). In particular, modelling and in vitro data revealed that an increase in persistent Na current occurring in PV neurons was sufficient to overcome the effects of KCNT1 GOF and cause an overall increase in AP generation.

Strengths:

The paper is very well written, the results clearly presented and interpreted, and the discussion focuses on the most relevant points.<br /> The recordings performed in distinct neuronal subpopulations (both in primary neuronal cultures and, for some subpopulations, in cortical slices, are a clear strength of the paper. The finding that the same variant can cause opposite effects and trigger specific homeostatic mechanisms in distinct neuronal populations is very relevant for the field, as it narrows the existing gap between experimental models and clinical evidence.

Weaknesses:

My main concern regarding the epileptic phenotype of the heterozygous mice investigated has been clarified in the revision, where the infrequent occurrence of seizures is more clearly stated. Also, a more detailed statistical analysis of the modeled neurons has been added in the revision.

Reviewer #1 (Public Review):

Summary:

Using chromaffin cells as a powerful model system for studying secretion, the authors study the regulatory role of complexin in secretion. Complexin is still enigmatic in its regulatory role, as it both provides inhibitory and facilitatory functions in release. The authors perform an extensive structure-function analysis of both the C- and N-terminal regions of complexin. There are several interesting findings that significantly advances our understanding of cpx/SNARe interactions in regulating release. C-terminal amphipathic helix interferes with SNARE complex assembly and thus clamps fusion. There are acidic residues in the C-term that may be seen as putative interaction partners for Synaptotagmin. The N-terminus of Complexin promoting role may be associated with an interaction with Syt1. In particular the putative interaction with Syt1 is of high interest and supported by quite strong functional and biochemical evidence. The experimental approaches are state of the art, and the results are of the highest quality and convincing throughout. They are adequate and intelligently discussed in the rich context of the standing literature. Whilst there are some concerns about whether the facilitatory actions of complexion have to be tightly linked to Syt1 interactions, the proposed model will significantly advance the field by providing new directions in future research.

Reviewer #2 (Public Review):

Summary:

Complexin (Cplx) is expressed at nearly all chemical synapses. Mammalian Cplx comes in four different paralogs which are differentially expressed in different neurons or secretory cell types, either selectively or in combination with one or two other Cplx isoforms. Cplx binds with high affinity to assembled SNARE complexes and promotes evoked synchronous release. Cplx is assumed to preclude premature SV fusion by preventing full SNARE assembly, thereby arresting subsequent SNARE-driven fusion ("fusion-clamp" theory). The protein has multiple domains, the functions of which are controversially discussed. Cplx's function has been studied in a variety of model organisms including mouse, fly, worm, and fish with seemingly conflicting results which led to partly contradicting conclusions.<br /> Makee et al. study the function of mammalian Cplx2 in chromaffin cells by making use of Cplx2 ko mice to overexpress and functionally characterize mutant Cplx2 forms in cultured chromaffin cells. The main conclusion of the present study are:

The hydrophobic character of the amphipathic helix in Cplx's C-terminal domain is essential for inhibiting premature vesicle fusion at a [Ca2+]i of several hundreds of nM (pre-flash [Ca2+]i). The Cplx-mediated inhibition of fusion under these conditions does not rely on expression of either Syt1 or Syt7.

Slow-down of exocytosis by N-terminally truncated Cplx mutants in response to a [Ca2+]i of several µM (peak flash [Ca2+]i) occurs regardless of the presence or absence of Syt7 demonstrating that Cplx2 does not act as a switch favoring preferential assembly of the release machinery with Syt1,2 rather than the "slow" sensor Syt7.

Cplx's N-terminal domain is required for the Cplx2-mediated increase in the speed of exocytosis and faster onset of exocytosis which likely reflect an increased apparent Ca2+ sensitivity and faster Ca2+ binding of the release machinery.

Strengths:

The authors perform systematic truncation/mutational analyses of Cplx2. They analyze the impact of single and combined deficiencies for Cplx2 and Syt1 to establish interactions of both proteins.<br /> State-of-the-art methods are employed: Vesicle exocytosis is assayed directly and with high resolution using capacitance measurements. Intracellular [Ca2+] is controlled by loading via the patch-pipette and by UV-light induced flash-photolysis of caged [Ca2+]. The achieved [Ca2+ ] is measured with Ca2+ -sensitive dyes.<br /> The data is of high quality and the results are compelling.

Weaknesses:

With the exception of mammalian retinal ribbon synapses (and some earlier RNAi knock down studies which had off-target effects), there is little experimental evidence for a "fusion-clamp"-like function of Cplxs at mammalian synapses. At conventional mammalian synapses, genetic loss of Cplx (i.e. KO) consistently decreases AP-evoked release, and generally either also decreases spontaneous release rates or does not affect spontaneous release, which is inconsistent with a "fusion-clamp" theory. This is in stark contrast to invertebrate (D. m. and C. e.) synapses where genetic Cplx loss is generally associated with a strong upregulation of spontaneous release.

There are alternative scenarios explaining how Cplx may phenomenological "clamp" vesicle fusion rates without mechanistically assigning a "clamping" function to Cplx (Neher 2010, Neuron). In fact, changes in asynchronous release kinetics following conditioning AP trains observed at Cplx1 ko calyx of Held synapses do not favor a "fusion clamp" model (Chang et al., 2015, J.Neurosci.), while an alternative model, assigning Cplx the role of a "checkpoint" protein in SNARE assembly, quantitatively reproduces all experimental observations (Lopez et al., 2024, PNAS). It might be helpful for a reader to mention such alternative scenarios.

Reviewer #1 (Public Review):

Summary:

This paper represents a huge amount of work on a condition whose patients' health and well-being have not always been prioritized, and only relatively recently has the immune dysregulation seen in patients with Down Syndrome (DS) been garnering major research interest.

This paper provides an unparalleled examination of immune disorders in patients with DS. The authors also report the results from a clinical trial with the JAK inhibitor tofacitinib in DS patients.

Strengths:

This manuscript reports a herculean effort and provides an unparalleled examination of immune disorders in a large number of patients with DS.

Weaknesses:

Not a major weakness but, apart from finding an elevation of CD4 T central memory cells and more differentiated plasmablast, several of the alterations reported in this manuscript had already been suggested by a few case reports and a very small series. On the other hand, the number of patients (and controls) utilized for this study is remarkable and allows for drawing much firmer conclusions.

Reviewer #2 (Public Review):

In this manuscript, Rachubinski and colleagues provide a comprehensive clinical, immunological, and autoantibody assessment of autoimmune/inflammatory manifestations of patients with Down syndrome (DS) in a large number of patients with this disorder. These analyses confirm prior results of excess interferon and cytokine signals in DS patients and extend these observations to highlight early-onset immunological aberrancies, far before symptoms occur, as well as characterizing novel autoantibody reactivities in this patient population. Then, the authors report the interim analysis of an open-label, Phase II, clinical trial of the JAK1/3 inhibitor, tofacitinib, that aims to define the safety, clinical efficacy, and immunological outcomes of DS patients who suffer from inflammatory conditions of the skin. The clinical trial analysis indicates that the treatment is tolerated without serious adverse effects and that the majority of patients have experienced clinical improvement or remission in their corresponding clinical cutaneous manifestations as well as improvement or normalization of aberrant immunological signals such as cytokines.

The major strength of the study is the recruitment and uniform, systematic evaluation of an impressive number of DS patients. Moreover, the promising early results from the tofacitinib clinical trial pave the way for analysis of a larger number of patients within the Phase II trial and otherwise, which may lead to improved clinical outcomes for affected patients. An inherent weakness of such studies is the descriptive nature of several parameters and the relatively small size of tofacitinib-treated DS patients. However, the descriptive nature of some of the correlative research analyses is of scientific interest and is useful to generate hypotheses for future additional (including mechanistic) work, and treatment of 10 DS patients in a formal clinical trial at interim analysis is not a trivial task for a disease like this. The manuscript achieves the aims of the authors and the results support their conclusions. The authors appropriately acknowledge areas that require more research and areas that are not well understood. The results are represented in a useful manner and statistical methods and analyses appear sound.

Reviewer #3 (Public Review):

Summary:

Individuals with Down syndrome (DS) have high rates of autoimmunity and can have exaggerated immune responses to infection that can unfortunately cause significant medical complications. Prior studies from these authors and others have convincingly demonstrated that individuals with DS have immune dysregulation including increased Type I IFN activity, elevated production of inflammatory cytokines (hypercytokinemia), increased autoantibodies, and populations of dysregulated adaptive immune cells that pre-dispose to autoimmunity. Prior studies have demonstrated that using JAK inhibitors to treat patient samples in vitro, in small case series of patients, and in mouse models of DS leads to improvement of immune phenotype and/or clinical disease. This manuscript provides two major advances in our understanding of immune dysregulation and therapy for patients. First, they perform deep immune phenotyping on several hundred individuals with DS and demonstrate that immune dysregulation is present from infancy. Second, they report a promising interim analysis of a Phase II clinical trial of a JAK inhibitor in 10 people with DS and moderate to severe skin autoimmunity.

Strengths and weaknesses:

The relatively large cohort and careful clinical annotation here provide new insights into the immune phenotype of patients with DS. For example, it is interesting that regardless of autoimmune disease or autoantibody status, individuals with DS have elevated cytokines and CRP. Analysis of the cohorts by age demonstrated that some cytokines are significantly elevated in people with DS starting in infancy (e.g., IL-9 and IL-17C). Nearly all adults with DS in this study had autoantibodies (98%) and most had six or more autoantibodies (63%), which differed significantly from euploid study participants. This implies that all patients with DS might benefit from early intervention with therapy to reduce inflammation. However, it is also worth considering that an alternative interpretation that since hypercytokinemia does not vary based on disease state in individuals with DS, this may not be a key factor driving autoimmunity (although it may be relevant for other clinical symptoms such as neuroinflammation).

Small case series have suggested the benefit of JAK inhibitors to treat autoimmunity in DS. This is the first report of a prospective clinical trial to test a JAK inhibitor in this setting. The clinical trial entry criteria included moderate to severe autoimmune skin disease in patients aged 12-50 years with DS, and treatment was with the JAK1/3 inhibitor tofacitinib. This clinical trial is a critically important step for the field. The early results support that treatment is well tolerated with an improvement of interferon scores in patients and reduction of autoantibodies. Most patients experienced clinical improvement, with alopecia areata having the greatest response. Treatment may not affect all skin diseases equally, for example of the 5 patients with hidradenitis suppurativa, only 1 showed clinical improvement based on skin score. While very promising, the clinical trial results reported here are preliminary and based on an interim analysis of 10 patients at 16 weeks. Individuals with DS have a lifelong risk of immune dysregulation and thus it is unclear how long therapy, if of benefit, would need to be continued. The results of longer-term therapy will be informative when considering the risks/benefits of this therapy.

Joint Public Review

Cav1.4 calcium channels control voltage-dependent calcium influx at photoreceptor synapses, and congenital loss of Cav1.4 function causes stationary night blindness CSNB2. Based on a broad portfolio of methodological approaches - genetic mouse models, immunolabeling and microscopic imaging, serial block-face-SEM, ERGs, and electrophysiology - the authors show that cone photoreceptor synapse development is strongly perturbed in the absence of Cav1.4 protein, and that expression of a nonconducting Cav1.4 channel mitigates these perturbations. Further data indicate that Cav3 channels are present, which, according to the authors, may compensate for the loss of Cav1.4 calcium currents and thus maintain cone synaptic transmission. These data, which are in agreement with a similar study by the same authors on rod photoreceptor synapses, help to explain what functional defects exactly cause CSNB2 and why it is accompanied by only mild visual impairment.

The strengths of the present study are its conceptual and experimental soundness, the broad spectrum of cutting-edge methodological approaches pursued, and the convincing differential analysis of mutant phenotypes. Weaknesses mainly concern the mechanism by which Cav3 channels might partially compensate for the loss of Cav1.4 calcium currents.

Reviewer #1 (Public Review):

Summary:<br /> In this manuscript the authors use the model organism Drosophila to explore sex and age impacts of a TBI method. They find age and sex differences: older age is susceptible to mild TBI and females are also more susceptible. In particular, they pursue a finding that virgin vs mated females show different responses: virgins are protected but mated females succumb to TBI with climbing deficits. In fact, virgin females compared to mated females are largely protected. They discover this is associated with exposure of the females to Sex Peptide in the reproductive neurons of the female reproductive tract. When they extend to RNAseq of brains, they show that there are very few genes in common between males, mated females, virgins and females mated with males lacking sex peptide. But what the few chronic genes associated with mated females seem associated with the immune system. These findings suggest that mated females have a compromised immune system, which might make them more vulnerable. In a bigger context, these findings point to the idea that the life status of the animal/individual may have an important impact on the outcome of a TBI - here illustrated by the differential state of virgin vs mated females in Drosophila.

Strengths:<br /> This is an interesting paper that allows a detailed comparison of sex and age in TBI which is largely only possible in such a simple model, where large numbers and many variations can be addressed. Overall the findings are interesting.

Weaknesses:<br /> Although the findings beyond Sex peptide are observational, the work sets the stage for more detailed studies to pursue the role of the genes they find by RNAseq and whether for example, boosting the innate immune system would protect the mated females, among other experiments.

Reviewer #2 (Public Review):

Summary:<br /> In this manuscript, the authors use the Drosophila model system to study the impact of mild head trauma on sex-dependent brain deficits. They identify Sex Peptide as a modulator of greater negative outcomes in female flies. Additionally, they observe that increased age at the time of injury results in worse outcomes, especially in females, and that this is due to chronic suppression of innate immune defense networks in mated females. The results demonstrate a novel signaling pathway that promotes age- and sex-dependent outcomes after head injury.

Strengths:<br /> The authors have modified their previously reported TBI model in flies to mimic mild TBI, which is novel. Methods are explained in detail, allowing for reproducibility. Experiments are rigorous with appropriate statistics. A number if important controls are included. The work tells a complete mechanistic story and adds important data to increase our understanding of sex-dependent differences in recovery after TBI. The Discussion is comprehensive and puts the work in context of the field.

Weaknesses: None<br /> The authors answered the following concerns, and I have no other concerns:<br /> A very minor weakness is that exact n values should be included in the figure legends. There should also be confirmation of knockdown by RNAi in female flies either by immunohistochemistry or qRT-PCR if possible.

Reviewer #3 (Public Review):

Summary:<br /> In this manuscript, the authors used a Drosophila model to show that exposure to repetitive mild TBI causes neurodegenerative conditions that emerge late in life and disproportionately affect females. In addition to the well-known age-dependent impact, the authors identified Sex Peptide (SP) signaling as a key factor in female susceptibility to post-injury brain deficits.

Strengths:<br /> The authors have presented a compelling set of results showing that female sex peptide signaling adversely affects late-life neurodegeneration after early-life exposure to repetitive mild head injury in Drosophila. They have compared the phenotypes of adult male and female flies sustaining TBI at different ages, and the phenotypes of virgin females and mated females, 2) compared the phenotypes of eliminating SP signaling in mating females and introducing SP-signaling into virgin females, 3) compared transcriptomic changes of different groups in response to TBI. The results are generally consistent and robust.

Weaknesses:<br /> The authors have made their claims largely based on assaying climbing index and vacuole formation as the only indicators of late-life neurodegeneration after TBI. Furthermore, it is also really surprising to see so few DEGs even in wild-type males and mated females and to see that none of DEGs overlap among groups or are even related to the SP-signaling. The authors state that the reason is their TBI is very minor. It is critical to independently verify their RNA-sequencing results and to add some more molecular evidence to support their conclusion. Finally, since similar sex peptide signaling is not present in mammalians or humans, its implication in humans remains unclear.

Reviewer #1 (Public Review):

The manuscript by Hong-Qian Chen and collaborators describes the development of a mouse model that co-expresses a fluorescent protein ZsGreen marker in gene fusion with the Fshr gene.

The authors are correct in that there is a lack of reliable antibodies against many of the GPCR family members. The approach is novel and interesting, with a potential to help understand the expression pattern of gonadotropin receptors. There has been a very long debate about the expression of gonadotropin receptors in other tissues other than gonads. While their expression of the Fshr in some of those tissues has been detected by a variety of methods, their physiological, or pathophysiological, function(s) remain elusive.

The authors in this manuscript assume that the expression of ZsGren and the Fshr are equal. While this is correct genetically (transcription->translation) it does not go hand in hand to other posttranslational processes.

One of the shocking observations in this manuscript is the expression of Fshr in Leydig cells. Other observations are in the osteoblasts and endothelial cells as well as epithelial cells in different organs. The expression of ZsGreen in these tissues seems high and one shall start questioning if there are other mechanisms at play here.

First, the turnover of fluorescent proteins is long, longer than 48h, which means that they accumulate at a different speed than the endogenous Fshr. This means that ZsGreen will accumulate in time while the Fshr receptor might be degraded almost immediately. This correlated with mRNA expression (by the authors) but does not with the results of other studies in single-cell sequencing (see below).

Then, the expression of ZsGreen in Leydig cells seems much higher than in Sertoli cells, this is "disturbing" to put it mildly. This is visible in both, the ZsGreen expression and the FISH assay (Fig 2 B-D).

The expression in WAT and BAT is also questionable as the expression of ZsGreen is high everywhere. What makes it difficult to actually believe that the images are truly informative? For example, the stainings of the aorta show the ZsGreen expression where elastin and collagen fibres are - these are not "cells" and therefore are not expressing ZsGreen.

FISH expression (for Fshr) in WT mice is missing.

Also, the tissue sections were stained with the IgG only (neg control) but in practice both the KI and the WT tissues should be stained with the primary and secondary antibodies.

The only control that I could think of to truly get a sense of this would be a tagged receptor (N-terminal) that could then be analysed by immunohistochemistry.

The authors also claim:<br /> To functionally prove the presence of Fshr in osteoblasts/osteocytes, we also deleted Fshr in osteocytes using an inducible model. The conditional knockout of Fshr triggered a much more profound increase in bone mass and decrease in fat mass than blockade by Fsh antibodies (unpublished data)

This would be a good control for all their images. I think it is necessary to make the large claim of extragonadal expression, as well as intragonadal such as Leydig cells.

Claiming that the under-developed Leydig cells in FSHR KO animals is due to a direct effect of the FSHR, and not via a cross-talk between Sertoli and Leydig cells, is too much of a claim. It might be speculated to some degree but as written at the moment is suggests this is "proven".

We also do not know if this Fshr expressed is a spliced form that would also result in the expression of ZsGreen but in a non-functional Fshr, or whether the Fshr is immediately degraded after expression. The insertion of the ZsGreen might have disturbed the epigenetics, transcription or biosynthesis of the mRNA regulation.

The authors should go through single-cell data of WT mice to show the existence of the Fshr transcript(s). For example here:<br /> https://www.nature.com/articles/sdata2018192

Comments after revision:

The response by the authors does not seem sufficient or adequate, by any length, for what one would expect for a work having such a large claim as the expression of the Fshr in multiple cell types and organs. It is not the fact that Fshr might be expressed extragonadally or even by other cells in the gonads, but the surprising images where virtually every cell in the provided tissues, and not only cells but structures, glows green.

It is not possible to know, as a reviewer, whether the excitation intensity and exposure for all images is equal. We believe that they cannot be, as control organs such as fat, testes, ovaries, and vasculature have a natural fluorescence background.

Leydig cells cannot simply express more Fshr than Sertoli cells, that would go against what we have known for >50 years in physiology. While it is scientific to question 'old' data, to make extraordinary claims there is a need for "extraordinary evidence". There is very low expression in Sertoli cells (Fig 2) while Leydig cells and spermatozoa glow vividly.

Moreover, even the tails of spermatozoa glow! This is not cytoplasm and cannot contain a soluble fluorescent protein.

The controls should be shown side-by-side to the experimental images. It would be a lot more credible if the WT and the KI tissues were placed on the same slide, with images taken from them side by side not only for ZsGreen but antibody immunofluorescence staining.

Moreover, I noticed that the entire manuscript is based on a single founder mouse, which is not acceptable as an error - either multiple integrations other than in the correct locus or genetic instability created by the KI integration would result in promiscuous expression. The founder mouse is not well enough characterised as it is only performed by Southern blots and PCR, while additional integrations cannot be detected by such. Other methods should be used such as FISH or even whole genome sequencing. Yet, several lines should be used to ensure no other effects exist.

In Fig 5, the section of aorta shows low staining in the elastin/collagen fibres, while there is clearly in Suppl Data 2. In the same figure, the 2nd lung images show green fluorescence in the mucosa (centre) which should not be as there is no cells there.

The additional single-cell data does not truly support their claims, in the sense that while some of the data might go in line e.g. Leydig cells showing as high expression as "tubules", there are many other cell types that show no expression such as hepatocytes and skeletal muscle, where the authors claim to have high expression of Fshr. Moreover, in the datasets presented organs like "ovary" have almost no Fshr expression, which should question the validity of such.

The authors use an Fshr antibody without enough validation. The Fshr KO animals should be used for this. In fact, one of the very first statements in the manuscript is that antibodies against GPCRs in general, and gonadotropin receptors more specifically, are unreliable. The fact that controls show the same pattern as transgenic animals questions the validity, as no single acceptable antibody against FSHR recognises Leydig cells.

The detection of Fshr in e.g. adipocytes of B6 mice is as questionable as many other claims of gonadotropin receptors in extragonadal tissues, which has been questioned a number of times by many researchers.

One question we should ask is, is there any tissue on these mice that does not 'express' (Fshr)-ZsGreen? Because from what I see every single tissue analysed has 'Fshr". Which might be the problem why it is so difficult to find.

Some images seem to be duplicated such as in Fig 2C where the first row and the 3rd row seem to be the same image.

Reviewer #1 (Public Review):

Summary:

Ctnnb1 encodes β-catenin, an essential component of the canonical Wnt signaling pathway. In this study, the authors identify an upstream enhancer of Ctnnb1 responsible for the specific expression level of β-catenin in the gastrointestinal tract. Deletion of this promoter in mice and analyses of its association with human colorectal tumors support that it controls the dosage of Wnt signaling critical to the homeostasis in intestinal epithelia and colorectal cancers.

Strengths:

This study has provided convincing evidence to demonstrate the functions of a gastrointestinal enhancer of Ctnnb1 using combined approaches of bioinformatics, genomics, in vitro cell culture models, mouse genetics, and human genetics. The results support the idea that the dosage of Wnt/β-catenin signaling plays an important role in the pathophysiological functions of intestinal epithelia. The experimental designs are solid and the data presented are of high quality. This study significantly contributes to the research fields of Wnt signaling, tissue-specific enhancers, and intestinal homeostasis.

Weaknesses:

One weakness of this manuscript is an insufficient discussion on the Ctnnb1 enhancers for different tissues. For example, do specific DNA motifs and transcriptional factors contribute to the tissue-specificity of the neocortical and gastrointestinal enhancers? It is also worth discussing the potential molecular mechanisms controlling the gastrointestinal expression of Ctnnb1 in different species since the identified human and mouse enhancers don't seem to share significant similarities in primary sequences.

Reviewer #2 (Public Review):

Wnt signaling is the name given to a cell-communication mechanism that cells employ to inform on each other's position and identity during development. In cells that receive the Wnt signal from the extracellular environment, intracellular changes are triggered that cause the stabilization and nuclear translocation of β-catenin, a protein that can turn on groups of genes referred to as Wnt targets. Typically these are genes involved in cell proliferation. Genetic mutations that affect Wnt signaling components can therefore affect tissue expansion. Loss of function of APC is a drastic example: APC is part of the β-catenin destruction complex, and in its absence, β-catenin protein is not degraded and constitutively turns on proliferation genes, causing cancers in the colon and rectum. And here lies the importance of the finding: β-catenin has for long been considered to be regulated almost exclusively by tuning its protein turnover. In this article, a new aspect is revealed: Ctnnb1, the gene encoding for β-catenin, possesses tissue-specific regulation with transcriptional enhancers in its vicinity that drive its upregulation in intestinal stem cells. The observation that there is more active β-catenin in colorectal tumors not only because the broken APC cannot degrade it, but also because transcription of the Ctnnb1 gene occurs at higher rates, is novel and potentially game-changing. As genomic regulatory regions can be targeted, one could now envision that mutational approaches aimed at dampening Ctnnb1 transcription could be a viable additional strategy to treat Wnt-driven tumors.

Reviewer #3 (Public Review):

The authors of this paper identify an enhancer upstream of the Ctnnb1 gene that selectively enhances expression in intestinal cells. This enhancer sequence drives expression of a reporter gene in the intestine and knockout of this enhancer attenuates Ctnnb1 expression in the intestine while protecting mice from intestinal cancers. The human counterpart of this enhancer sequence is functional and involved in tumorigenesis. Overall, this is an excellent example of how to fully characterize a cell-specific enhancer. The strength of the study is the thorough nature of the analysis and the relevance of the data to the development of intestinal tumors in both mice and humans. A minor weakness is that the loss of this enhancer does not completely compromise the expression of the Ctnnb1 gene in the intestine, suggesting that other elements are likely involved. Adding some discussion on that point would be helpful.

The paper describes a program developed to identify PPI-hot spots using the free protein structure and compares it to FTMap and SPOTONE, two webservers that they consider as competitive approaches to the problem. We appreciate the effort in providing a new webserver that can be tested by the community but we continue to have major concerns:

(1) The comparison to the FTMap program is problematic. The authors misinterpret the article they refer to, i.e., Zerbe et al. "Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces" J. Chem. Inf. Model. 52, 2236-2244, (2012). FTMap identifies hot spots that bind small molecular ligands. The Zerbe et al. article shows that such hot spots tend to interact with hot spot residues on the partner protein in a protein-protein complex (emphasis on "partner"). Thus, the hot spots identified by FTMap are not the hot spots defined by the authors. In fact, because the Zerbe paper considers the partner protein in a complex, the results cannot be compared to the results of Chen et al. This difference is missed by the authors, and hence the comparison of the FTMap is invalid.

(2) Chen et al. use a number of usual features in a variety of simple machine-learning methods to identify hot spot residues. This approach has been used in the literature for more than a decade. Although the authors say that they were able to find only FTMap and SPOTONE as servers, there are dozens of papers that describe such a methodology. Some examples are given here: (Higa and Tozzi, 2009; Keskin, et al., 2005; Lise, et al., 2011; Tuncbag, et al., 2009; Xia, et al., 2010). There are certainly more papers. Thus, while the web server is a potentially useful contribution, the paper does not provide a fundamentally novel approach.

Reviewer #1 (Public Review):

Summary:

This study addresses the question of how task-relevant sensory information affects activity in the motor cortex. The authors use various approaches to address this question, looking at single units and population activity. They find that there are three subtypes of modulation by sensory information at the single unit level. Population analyses reveal that sensory information affects the neural activity orthogonally to motor output. The authors then compare both single unit and population activity to computational models to investigate how encoding of sensory information at the single unit level is coordinated in a network. They find that an RNN that displays similar orbital dynamics and sensory modulation to the motor cortex also contains nodes that are modulated similarly to the three subtypes identified by the single unit analysis.

Strengths:

The strengths of this study lie in the population analyses and the approach of comparing single-unit encoding to population dynamics. In particular, the analysis in Figure 3 is very elegant and informative about the effect of sensory information on motor cortical activity. The task is also well designed to suit the questions being asked and well controlled.

It is commendable that the authors compare single units to population modulation. The addition of the RNN model and perturbations strengthen the conclusion that the subtypes of individual units all contribute to the population dynamics. However, the subtypes (PD shift, gain, and addition) are not sufficiently justified. The authors also do not address that single units exhibit mixed modulation, but RNN units are not treated as such.

Weaknesses:

The main weaknesses of the study lie in the categorization of the single units into PD shift, gain, and addition types. The single units exhibit clear mixed selectivity, as the authors highlight. Therefore, the subsequent analyses looking only at the individual classes in the RNN are a little limited. Another weakness of the paper is that the choice of windows for analyses is not properly justified and the dependence of the results on the time windows chosen for single-unit analyses is not assessed. This is particularly pertinent because tuning curves are known to rotate during movements (Sergio et al. 2005 Journal of Neurophysiology).

This paper shows sensory information can affect motor cortical activity whilst not affecting motor output. However, it is not the first to do so and fails to cite other papers that have investigated sensory modulation of the motor cortex (Stavinksy et al. 2017 Neuron, Pruszynski et al. 2011 Nature, Omrani et al. 2016 eLife). These studies should be mentioned in the Introduction to capture better the context around the present study. It would also be beneficial to add a discussion of how the results compare to the findings from these other works.

This study also uses insights from single-unit analysis to inform mechanistic models of these population dynamics, which is a powerful approach, but is dependent on the validity of the single-cell analysis, which I have expanded on below.

I have clarified some of the areas that would benefit from further analysis below:

(1) Task:<br /> The task is well designed, although it would have benefited from perhaps one more target speed (for each direction). One monkey appears to have experienced one more target speed than the others (seen in Figure 3C). It would have been nice to have this data for all monkeys.

(2) Single unit analyses:<br /> In some analyses, the effects of target speed look more driven by target movement direction (e.g. Figures 1D and E). To confirm target speed is the main modulator, it would be good to compare how much more variance is explained by models including speed rather than just direction. More target speeds may have been helpful here too.

The choice of the three categories (PD shift, gain addition) is not completely justified in a satisfactory way. It would be nice to see whether these three main categories are confirmed by unsupervised methods.

The decoder analyses in Figure 2 provide evidence that target speed modulation may change over the trial. Therefore, it is important to see how the window considered for the firing rate in Figure 1 (currently 100ms pre - 100ms post movement onset) affects the results.

(3) Decoder:<br /> One feature of the task is that the reach endpoints tile the entire perimeter of the target circle (Figure 1B). However, this feature is not exploited for much of the single-unit analyses. This is most notable in Figure 2, where the use of a SVM limits the decoding to discrete values (the endpoints are divided into 8 categories). Using continuous decoding of hand kinematics would be more appropriate for this task.

(4) RNN:<br /> Mixed selectivity is not analysed in the RNN, which would help to compare the model to the real data where mixed selectivity is common. Furthermore, it would be informative to compare the neural data to the RNN activity using canonical correlation or Procrustes analyses. These would help validate the claim of similarity between RNN and neural dynamics, rather than allowing comparisons to be dominated by geometric similarities that may be features of the task. There is also an absence of alternate models to compare the perturbation model results to.

Reviewer #2 (Public Review):

Summary:

In this manuscript, Zhang et al. examine neural activity in the motor cortex as monkeys make reaches in a novel target interception task. Zhang et al. begin by examining the single neuron tuning properties across different moving target conditions, finding several classes of neurons: those that shift their preferred direction, those that change their modulation gain, and those that shift their baseline firing rates. The authors go on to find an interesting, tilted ring structure of the neural population activity, depending on the target speed, and find that (1) the reach direction has consistent positioning around the ring, and (2) the tilt of the ring is highly predictive of the target movement speed. The authors then model the neural activity with a single neuron representational model and a recurrent neural network model, concluding that this population structure requires a mixture of the three types of single neurons described at the beginning of the manuscript.

Strengths:

I find the task the authors present here to be novel and exciting. It slots nicely into an overall trend to break away from a simple reach-to-static-target task to better characterize the breadth of how the motor cortex generates movements. I also appreciate the movement from single neuron characterization to population activity exploration, which generally serves to anchor the results and make them concrete. Further, the orbital ring structure of population activity is fascinating, and the modeling work at the end serves as a useful baseline control to see how it might arise.

Weaknesses:

While I find the behavioral task presented here to be excitingly novel, I find the presented analyses and results to be far less interesting than they could be. Key to this, I think, is that the authors are examining this task and related neural activity primarily with a single-neuron representational lens. This would be fine as an initial analysis since the population activity is of course composed of individual neurons, but the field seems to have largely moved towards a more abstract "computation through dynamics" framework that has, in the last several years, provided much more understanding of motor control than the representational framework has. As the manuscript stands now, I'm not entirely sure what interpretation to take away from the representational conclusions the authors made (i.e. the fact that the orbital population geometry arises from a mixture of different tuning types). As such, by the end of the manuscript, I'm not sure I understand any better how the motor cortex or its neural geometry might be contributing to the execution of this novel task.

Main Comments:

My main suggestions to the authors revolve around bringing in the computation through a dynamics framework to strengthen their population results. The authors cite the Vyas et al. review paper on the subject, so I believe they are aware of this framework. I have three suggestions for improving or adding to the population results:

(1) Examination of delay period activity: one of the most interesting aspects of the task was the fact that the monkey had a random-length delay period before he could move to intercept the target. Presumably, the monkey had to prepare to intercept at any time between 400 and 800 ms, which means that there may be some interesting preparatory activity dynamics during this period. For example, after 400ms, does the preparatory activity rotate with the target such that once the go cue happens, the correct interception can be executed? There is some analysis of the delay period population activity in the supplement, but it doesn't quite get at the question of how the interception movement is prepared. This is perhaps the most interesting question that can be asked with this experiment, and it's one that I think may be quite novel for the field--it is a shame that it isn't discussed.

(2) Supervised examination of population structure via potent and null spaces: simply examining the first three principal components revealed an orbital structure, with a seemingly conserved motor output space and a dimension orthogonal to it that relates to the visual input. However, the authors don't push this insight any further. One way to do that would be to find the "potent space" of motor cortical activity by regression to the arm movement and examine how the tilted rings look in that space (this is actually fairly easy to see in the reach direction components of the dPCA plot in the supplement--the rings will be highly aligned in this space). Presumably, then, the null space should contain information about the target movement. dPCA shows that there's not a single dimension that clearly delineates target speed, but the ring tilt is likely evident if the authors look at the highest variance neural dimension orthogonal to the potent space (the "null space")--this is akin to PC3 in the current figures, but it would be nice to see what comes out when you look in the data for it.

(3) RNN perturbations: as it's currently written, the RNN modeling has promise, but the perturbations performed don't provide me with much insight. I think this is because the authors are trying to use the RNN to interpret the single neuron tuning, but it's unclear to me what was learned from perturbing the connectivity between what seems to me almost arbitrary groups of neurons (especially considering that 43% of nodes were unclassifiable). It seems to me that a better perturbation might be to move the neural state before the movement onset to see how it changes the output. For example, the authors could move the neural state from one tilted ring to another to see if the virtual hand then reaches a completely different (yet predictable) target. Moreover, if the authors can more clearly characterize the preparatory movement, perhaps perturbations in the delay period would provide even more insight into how the interception might be prepared.

Reviewer #3 (Public Review):

Summary:

This experimental study investigates the influence of sensory information on neural population activity in M1 during a delayed reaching task. In the experiment, monkeys are trained to perform a delayed interception reach task, in which the goal is to intercept a potentially moving target.

This paradigm allows the authors to investigate how, given a fixed reach endpoint (which is assumed to correspond to a fixed motor output), the sensory information regarding the target motion is encoded in neural activity.

At the level of single neurons, the authors found that target motion modulates the activity in three main ways: gain modulation (scaling of the neural activity depending on the target direction), shift (shift of the preferred direction of neurons tuned to reach direction), or addition (offset to the neural activity).

At the level of the neural population, target motion information was largely encoded along the 3rd PC of the neural activity, leading to a tilt of the manifold along which reach direction was encoded that was proportional to the target speed. The tilt of the neural manifold was found to be largely driven by the variation of activity of the population of gain-modulated neurons.<br /> Finally, the authors studied the behaviour of an RNN trained to generate the correct hand velocity given the sensory input and reach direction. The RNN units were found to similarly exhibit mixed selectivity to the sensory information, and the geometry of the « neural population » resembled that observed in the monkeys.

Strengths:

- The experiment is well set up to address the question of how sensory information that is directly relevant to the behaviour but does not lead to a direct change in behavioural output modulates motor cortical activity.

- The finding that sensory information modulates the neural activity in M1 during motor preparation and execution is non trivial, given that this modulation of the activity must occur in the nullspace of the movement.

- The paper gives a complete picture of the effect of the target motion on neural activity, by including analyses at the single neuron level as well as at the population level. Additionally, the authors link those two levels of representation by highlighting how gain modulation contributes to shaping the population representation.

Weaknesses:

- One of the main premises of the paper is the fact that the motor output for a given reach point is preserved across different target motions. However, as the authors briefly mention in the conclusion, they did not record muscle activity during the task, but only hand velocity, making it impossible to directly verify how preserved muscle patterns were across movements. While the authors highlight that they did not see any difference in their results when resampling the data to control for similar hand velocities across conditions, this seems like an important potential caveat of the paper whose implications should be discussed further or highlighted earlier in the paper.

- The main takeaway of the RNN analysis is not fully clear. The authors find that an RNN trained given a sensory input representing a moving target displays modulation to target motion that resembles what is seen in real data. This is interesting, but the authors do not dissect why this representation arises, and how robust it is to various task design choices. For instance, it appears that the network should be able to solve the task using only the motion intention input, which contains the reach endpoint information. If the target motion input is not used for the task, it is not obvious why the RNN units would be modulated by this input (especially as this modulation must lie in the nullspace of the movement hand velocity if the velocity depends only on the reach endpoint). It would thus be important to see alternative models compared to true neural activity, in addition to the model currently included in the paper. Besides, for the model in the paper, it would therefore be interesting to study further how the details of the network setup (eg initial spectral radius of the connectivity, weight regularization, or using only the target position input) affect the modulation by the motion input, as well as the trained population geometry and the relative ratios of modulated cells after training.

- Additionally, it is unclear what insights are gained from the perturbations to the network connectivity the authors perform, as it is generally expected that modulating the connectivity will degrade task performance and the geometry of the responses. If the authors wish the make claims about the role of the subpopulations, it could be interesting to test whether similar connectivity patterns develop in networks that are not initialized with an all-to-all random connectivity or to use ablation experiments to investigate whether the presence of multiple types of modulations confers any sort of robustness to the network.

- The results suggest that the observed changes in motor cortical activity with target velocity result from M1 activity receiving an input that encodes the velocity information. This also appears to be the assumption in the RNN model. However, even though the input shown to the animal during preparation is indeed a continuously moving target, it appears that the only relevant quantity to the actual movement is the final endpoint of the reach. While this would have to be a function of the target velocity, one could imagine that the computation of where the monkeys should reach might be performed upstream of the motor cortex, in which case the actual target velocity would become irrelevant to the final motor output. This makes the results of the paper very interesting, but it would be nice if the authors could discuss further when one might expect to see modulation by sensory information that does not directly affect motor output in M1, and where those inputs may come from. It may also be interesting to discuss how the findings relate to previous work that has found behaviourally irrelevant information is being filtered out from M1 (for instance, Russo et al, Neuron 2020 found that in monkeys performing a cycling task, context can be decoded from SMA but not from M1, and Wang et al, Nature Communications 2019 found that perceptual information could not be decoded from PMd)?

Reviewer #3 (Public Review):

Summary:

In this manuscript, the authors show that impairment of hind limb muscle contraction by cast immobilization suppresses skeletal muscle thermogenesis and activates thermogenesis in brown fat. They also propose that free BCAAs derived from skeletal muscle are used for BAT thermogenesis, and identify IL-6 as a potential regulator.

Strengths:

The data support the conclusions for the most part.

Weaknesses:

The data provided in this manuscript are largely descriptive. It is therefore difficult to assess the potential significance of the work. Moreover, many of the described effects are modest in magnitude, questioning the overall functional relevance of this pathway. There are no experiments that directly test whether BCAAs derived from adipose tissue are used for thermogenesis, which would require more robust tracing experiments. In addition, the rigor of the work should be improved. It is also recommended to put the current work in the context of the literature.

Reviewer #1 (Public Review):

Summary:

Heat production mechanisms are flexible, depending on a wide variety of genetic, dietary, and environmental factors. The physiology associated with each mechanism is important to understand since loss of flexibility is associated with metabolic decline and disease.

The phenomenon of compensatory heat production has been described in some detail in publications and reviews, notably by modifying BAT-dependent thermogenesis (for example by deleting UCP1 or impairing lipolysis, cited in this paper).

These authors chose to eliminate exercise as an alternative means of maintaining body temperature. To do this, they cast either one or both mouse hindlimbs.

This paper is set up as an evaluation of a loss of function of muscle on the functionality of BAT.

Strengths:

The study is supported by a variety of modern techniques and procedures.

Weaknesses:

The authors show that cast immobilization (CI) does not work as a (passive) loss of function, instead, this procedure produces a dramatic gain of function, putting the animal under considerable stress, inducing b-adrenergic effectors, increased oxygen consumption, and IL6 expression in a variety of tissues, together with commensurate cachectic effects on muscle and fat. The BAT is put under considerable stress, super-induced but relatively poor functioning.

Thus within hours and days of CI, there is massive muscle loss (leading to high circulating BCAAs), and loss of lipid reserves in adipose and liver. The lipid cycle that maintains BAT thermogenesis is depleted and the mouse is unable to maintain body temperature.

I cannot agree with these statements in the Discussion:

"We have here shown that cast immobilization suppressed skeletal muscle thermogenesis, resulting in failure to maintain core body temperature in a cold environment."<br /> • This result could also be attributed to high stress and decreased calorie reserves. Note also: CI suppresses 50% of locomotor activity, but the actual work done by the mouse carrying bilateral casts is not taken into account.

"Thermoregulatory system in endotherms cannot be explained by thermogenesis based on muscle contraction alone, with nonshivering thermogenesis being required as a component of the ability to tolerate cold temperatures in the long term."<br /> • This statement is correct, and it clearly showcases how difficult it is to interpret results using this CI strategy. The question to the author is- which components of muscle thermogenesis are actually inhibited by CI, and what is the relative heat contribution?

This conclusion is overinterpreted:

"In conclusion, we have shown that cast immobilization induced thermogenesis in BAT that was dependent on the utilization of free amino acids derived from skeletal muscle, and that muscle-derived IL-6 stimulated BCAA metabolism in skeletal muscle. Our findings may provide new insights into the significance of skeletal muscle as a large reservoir of amino acids in the regulation of body temperature".

In terms of the production of the article - the data shown in the heat maps has oddly obscure log10 dimensions. The changes are minimal, approx. 1.5x increase/decrease and therefore significance would be key to reporting these data. Fig.3C heatmap is not suitable. What are the 6 lanes to each condition? Overall, this has little/no information.

Rather than cherry-picking for a few genes, the results could be made more rigorous using RNA-seq profiling of BAT and muscle tissues.

Reviewer #2 (Public Review):

Summary:

In this study, the authors identified a previously unrecognized organ interaction where limb immobilization induces thermogenesis in BAT. They showed that limb immobilization by cast fixation enhances the expression of UCP1 as well as amino acid transporters in BAT, and amino acids are supplied from skeletal muscle to BAT during this process, likely contributing to increased thermogenesis in BAT. Furthermore, the experiments with IL-6 knockout mice and IL-6 administration to these mice suggest that this cytokine is likely involved in the supply of amino acids from skeletal muscle to BAT during limb immobilization.

Strengths:

The function of BAT plays a crucial role in the regulation of an individual's energy and body weight. Therefore, identifying new interventions that can control BAT function is not only scientifically significant but also holds substantial promise for medical applications. The authors have thoroughly and comprehensively examined the changes in skeletal muscle and BAT under these conditions, convincingly demonstrating the significance of this organ interaction.

Weaknesses:

Through considerable effort, the authors have demonstrated that limb-immobilized mice exhibit changes in thermogenesis and energy metabolism dynamics at their steady state. However, The impact of immobilization on the function of skeletal muscle and BAT during cold exposure has not been thoroughly analyzed.

On responding to the first round of reviews, the authors have nicely adjusted their wording and fairly describe the results of their study. Certain markers were identified for further investigation. Yet, an overall non-obvious relationship between immune markers and HIV reservoirs has been shown previously, and despite the attempt to leverage powerful ML algorithms, they are not magical and cannot reveal strong relationships that fundamentally do not exist. In addition, categorical classification is for now hard to interpret and the more powerful ML algorithms do not seem to outperform more classic regression methods. Therefore, it remains relatively hard to evaluate the utility of this kind of study.

Initial summary:

Semenova et al. have studied a large cross-sectional cohort of people living with HIV on suppressive ART, N=115, and performed high dimensional flow-cytometry to then search for associations between immunological and clinical parameters and intact/total HIV DNA levels.

A number of interesting data science/ML approaches were explored on the data and the project seems a serious undertaking. However, like many other studies that have looked for these kinds of associations, there was not a very strong signal. Of course the goal of unsupervised learning is to find new hypotheses that aren't obvious to human eyes, but I felt in that context, there were (1) results slightly oversold, (2) some questions about methodology in terms mostly of reservoir levels, and (3) results were not sufficiently translated back into meaning in terms of clinical outcomes.

Strengths:

The study is evidently a large and impressive undertaking and combines many cutting edge statistical techniques with a comprehensive experimental cohort of people living with HIV, notably inclusive of populations underrepresented in HIV science. A number of intriguing hypotheses are put forward that could be explored further. Data will be shared and could be a useful repository for more specific analyses.

Weaknesses:

Despite the detailed experiments and methods, there was not a very strong signal for variable(s) predicting HIV reservoir size. The spearman coefficients are ~0.3, (somewhat weak, and acknowledged as such) and predictive models reach 70-80% prediction levels, though of sometimes categorical variables that are challenging to interpret.

There are some questions about methodology, as well as some conclusions that are not completely supported by results, or at minimum not sufficiently contextualized in terms of clinical significance. Edit, authors have substantially revised the text.

On associations: the false discovery rate correction was set at 5%, but data appear underdetermined with fewer observations than variables (144vars > 115ppts), and it isn't always clear if/when variables are related (e.g inverses of one another, for instance %CD4 and %CD8).

The modeling of reservoir size was unusual, typically intact and defective HIV DNA are analyzed on a log10 scale (both for decays and predicting rebound). Also sometimes in this analysis levels are normalized (presumably to max/min?, e.g. S5), and given the large within-host variation of level we see in other works, it is not trivial to predict any downstream impact of normalization across population vs within person. Edit, fixed.

Also, the qualitative characterization of low/high reservoir is not standard, and naturally will split by early/later ART if done as above/below median. Given the continuous nature of these data it seems throughout that predicting above/below median is a little hard to translate into clinical meaning.

Lastly, work is comprehensive and appears solid, but the code was not shared to see how calculations were performed. Edit, fixed.

Reviewer #1 (Public Review):

Summary:<br /> Ever-improving techniques allow the detailed capture of brain morphology and function to the point where individual brain anatomy becomes an important factor. This study investigated detailed sulcal morphology in the parieto-occipital junction. Using cutting-edge methods, it provides important insights into local anatomy, individual variability, and local brain function. The presented work advances the field and will stimulate future research into this important area.

Strengths:<br /> Detailed, very thorough methodology. Multiple raters mapped detailed sulci in a large cohort. The identified sulcal features and their functional and behavioural relevance are then studied using various complementary methods. The results provide compelling evidence for the importance of the described sulcal features and their proposed relationship to cortical brain function.

Comments on revised version:

The revised manuscript addresses all my concerns.

Reviewer #2 (Public Review):

Summary:<br /> After manually labelling 144 human adult hemispheres in the lateral parieto-occipital junction (LPOJ), the authors 1) propose a nomenclature for 4 previously unnamed highly variable sulci located between the temporal and parietal or occipital lobes, 2) focus on one of these newly named sulci, namely the ventral supralateral occipital sulcus (slocs-v) and compare it to neighbouring sulci to demonstrate its specificity (in terms of depth, surface area, gray matter thickness, myelination, and connectivity), 3) relate the morphology of a subgroup of sulci from the region including the slocs-v to the performance in a spatial orientation task, demonstrating behavioural and morphological specificity. In addition to these results, the authors propose an extended reflection on the relationship between these newly named landmarks and previous anatomical studies, a reflection about the slocs-v related to functional and cytoarchitectonic parcellations as well as anatomic connectivity and an insight about potential anatomical mechanisms relating sulcation and behaviour.

Strengths:<br /> - To my knowledge, this is the first study addressing the variable tertiary sulci located between the superior temporal sulcus (STS) and intra-parietal sulcus (IPS).<br /> - This is a very comprehensive study addressing altogether anatomical, architectural, functional and cognitive aspects.<br /> - The definition of highly variable yet highly reproductible sulci such as the slocs-v feeds the community with new anatomo-functional landmarks (which is emphasized by the provision of a probability map in supp. mat., which in my opinion should be proposed in the main body).<br /> - The comparison of different features between the slocs-v and similar sulci is useful to demonstrate their difference.<br /> - The detailed comparison of the present study with state of the art contextualises and strengthens the novel findings.<br /> - The functional study complements the anatomical description and points towards cognitive specificity related to a subset of sulci from the LPOJ<br /> - The discussion offers a proposition of theoretical interpretation of the findings<br /> - The data and code are mostly available online (raw data made available upon request).

Weaknesses:<br /> - While the identification of the sulci has been done thoroughly with expert validation, the sulci have not been labelled in a way that enables the demonstration of the reproducibility of the labelling.

The proposed methodology is convincing in identifying and studying the relationship between highly variable sulci and cognition. This improves our refined understanding of the general anatomical variability in the LPOJ and its potential functional/cognitive correlates. This work is important to the understanding of sulcal variability and its implications on functional and cognitive aspects.

Comments on revised version:

Thank you for the elegant and informative work.

Reviewer #3 (Public Review):

Summary:<br /> 72 subjects, and 144 hemispheres, from the Human Connectome Project had their parietal sulci manually traced. This identified the presence of previous undescribed shallow sulci. One of these sulci, the ventral supralateral occipital sulcus (slocs-v), was then demonstrated to have functional specificity in spatial orientation. The discussion furthermore provides an eloquent overview of our understanding of the anatomy of the parietal cortex, situating their new work into the broader field. Finally, this paper stimulates further debate about the relative value of detailed manual anatomy, inherently limited in participant numbers and areas of the brain covered, against fully automated processing that can cover thousands of participants but easily misses the kinds of anatomical details described here.

Strengths:<br /> - This is the first paper describing the tertiary sulci of the parietal cortex with this level of detail, identifying novel shallow sulci and mapping them to behaviour and function.<br /> - It is a very elegantly written paper, situating the current work into the broader field.<br /> - The combination of detailed anatomy and function and behaviour is superb.

Weaknesses:<br /> - the numbers of subjects are inherently limited both in number as well as in being typically developing young adults.<br /> - while the paper begins by describing four new sulci, only one is explored further in greater detail.<br /> - there is some tension between calling the discovered sulci new vs acknowledging they have already been reported, but not named.<br /> - the anatomy of the sulci, as opposed to their relation to other sulci, could be described in greater detail.

Overall, to summarize, I greatly enjoyed this paper and believe it to be a highly valued contribution to the field.

Reviewer #1 (Public Review):

Summary:

In this manuscript, the authors report that activation of excitatory DREADDs in the mid-cervical spinal cord can increase inspiratory activity in mice and rats. This is an important first step toward an ultimate goal of using this, or similar, technology to drive breathing in disorders associated with decreased respiratory motor output, such as spinal injury or neurodegenerative disease.

Strengths:

Strengths of this study include a comparison of non-specific DREADD expression in the mid-cervical spinal cord versus specific targeting to ChAT-positive neurons, and the measurement of multiple respiratory-related outcomes, including phrenic inspiratory output, diaphragm EMG activity, and ventilation. The data show convincingly that DREADDs can be used to drive phrenic inspiratory activity, which in turn increases diaphragm EMG activity and ventilation.

Weaknesses:

The main limitation is that the ligand, J60, was not given to control animals without spinal DREADD expression. Since J60 may have off-target effects (PMID: 37530882), a discussion of this limitation is warranted, particularly in light of the one rat that was reported to not have detectible mCherry expression in the mid-cervical spinal cord, yet had robust increases in diaphragm output after J60 administration.

In experiments in ChAT-Cre animals, several neuronal types will express DREADDs, including non-phrenic motor neurons and some interneurons. As such, these experiments do not specifically "target" phrenic motor neurons any more so than experiments in WT animals. Experiments in ChAT-Cre animals also do not avoid inducing "non-specific expression in the vicinity of the phrenic motor nucleus". This is not a study design flaw per se, but an overinterpretation of findings.

Reviewer #2 (Public Review):

Summary:

This study shows that when excitatory DREADD receptors are expressed in the ventral area of the cervical spinal cord containing phrenic motoneurons, the systemic administration of the DREADD ligand J60 increases diaphragm EMG activity without altering respiratory rate. The authors took a non-selective expression approach in wild-type mice, as well as a more selective Cre-dependent approach in Chat-Cre mice and Chat-Cre rats to stimulate cervical motoneurons in the spinal cord. This is a proof of principle study that supports the use of DREADD technology to stimulate the motor output to the diaphragm.

Strengths:

The strengths of the study lie in the use of both mice and rats and testing activation of diaphragmatic activity with multiple experimental approaches to show that diaphragm EMG and tidal volume are increased.

Weaknesses:

Weaknesses of the study consist in the lack of some important control experiments to consolidate the findings: a test of DREADD ligand effects in the absence of viral construct; repeated respiratory challenges within the same recording session in whole body plethysmographs that could compromise the behaving experiments; and lastly, a limited qualitative analysis of the histological data that does not allow for confirmation of expression in phrenic motoneurons.

Reviewer #1 (Public Review):

Summary:

In the manuscript entitled "Rtf1 HMD domain facilitates global histone H2B monoubiquitination and regulates morphogenesis and virulence in the meningitis-causing pathogen Cryptococcus neoformans" by Jiang et al., the authors employ a combination of molecular genetics and biochemical approaches, along with phenotypic evaluations and animal models, to identify the conserved subunit of the Paf1 complex (Paf1C), Rtf1, and functionally characterize its critical roles in mediating H2B monoubiquitination (H2Bub1) and the consequent regulation of gene expression, fungal development, and virulence traits in C. deneoformans or C. neoformans. Specially, the authors found that the histone modification domain (HMD) of Rtf1 is sufficient to promote H2B monoubiquitination (H2Bub1) and the expression of genes related to fungal mating and filamentation, and restores the fungal morphogenesis and pathogenicity defects caused by RTF1 deletion.

Strengths:

The manuscript is well-written and presents the findings in a clear manner. The findings are interesting and contribute to a better understanding of Rtf1-mediated epigenetic regulation of fungal morphogenesis and pathogenicity in a major human fungal pathogen, and potentially in other fungal species, as well.

Weaknesses:

A major limitation of this study is the absence of genome-wide information on Rtf1-mediated H2B monoubiquitination (H2Bub1), as well as a lack of detail regarding the function of the Plus3 domain. Although overexpression of HMD in the rtf1Δ mutant restored global H2Bub1 levels, it did not rescue certain critical biological functions, such as growth at 39{degree sign}C and melanin production (Figure 4C-D). This suggests that the precise positioning of H2Bub1 is essential for Rtf1's function. A comprehensive epigenetic landscape of H2Bub1 in the presence of HMD or full-length Rtf1 would elucidate potential mechanisms and shed light on the function of the Plus3 domain.

Reviewer #2 (Public Review):

Summary:

The authors set out to determine the role of Rtf1 in Cryptococcal biology, and demonstrate that Rtf1 acts independently of the Paf1 complex to exert regulation of Histone H2B monoubiquitylation (H2Bub1). The biological impact of the loss of H2Bub1 was observed in defects in morphogenesis, reduced production of virulence factors, and reduced pathogenic potential in animal models of cryptococcal infection.

Strengths:

The molecular data is quite compelling, demonstrating that the Rtf1-depednent functions require only this histone modifying domain of Rtf1, and are dependent on nuclear localization. A specific point mutation in a residue conserved with the Rtf1 protein in the model yeast demonstrates the conservation of that residue in H2Bub1 modification. Interestingly, whereas expression of the HMD alone suppressed the virulence defect of the rtf1 deletion mutant, it did not suppress defects in virulence factor production.

Weaknesses:

The authors use two different species of Cryptococcus to investigate the biological effect of Rtf1 deletion. The work on morphogenesis utilized C. deneoformans, which is well-known to be a robust mating strain. The virulence work was performed in the C. neoformans H99 background, which is a highly pathogenic isolate. The study would be more complete if each of these processes were assessed in the other strain to understand if these biological effects are conserved across the two species of Cryptococcus. H99 is not as robust in morphogenesis, but reproducible results assessing mating and filamentation in this strain have been performed. Similarly, C. deneoformans does produce capsule and melanin.

There are some concerns with the conclusions related to capsule induction. The images reported in Figure B are purported to be grown under capsule-inducing conditions, yet the H99 panel is not representative of the induced capsule for this strain. Given the lack of a baseline of induction, it is difficult to determine if any of the strains may be defective in capsule induction. Quantification of a population of cells with replicates will also help to visualize the capsular diversity in each strain population.

The authors demonstrate that for specific mating-related genes, the expression of the HMD recapitulated the wild-type expression pattern. The RNA-seq experiments were performed under mating conditions, suggesting specificity under this condition. The authors raise the point in the discussion that there may be differences in Rtf1 deposition on chromatin in H99, and under conditions of pathogenesis. The data that overexpression of HMD restores H2Bub1 by western is quite compelling, but does not address at which promoters H2Bub1 is modulating expression under pathogenesis conditions, and when full-length Rtf1 is present vs. only the HMD.

Reviewer #3 (Public Review):

Summary:

In this very comprehensive study, the authors examine the effects of deletion and mutation of the Paf1C protein Rtf1 gene on chromatin structure, filamentation, and virulence in Cryptococcus.

Strengths:

The experiments are well presented and the interpretation of the data is convincing.

Weaknesses:

Yet, one can be frustrated by the lack of experiments that attempt to directly correlate the change in chromatin structure with the expression of a particular gene and the observed phenotype. For example, the authors observed a strong defect in the expression of ZNF2, a known regulator of filamentation, mating, and virulence, in the rtf1 mutant. Can this defect explain the observed phenotypes associated with the RTF1 mutation? Is the observed defect in melanin production associated with altered expression of laccase genes and altered chromatin structure at this locus?

Reviewer #1 (Public Review):

Summary:

In this manuscript, Jiao D et al reported the induction of synthetic lethal by combined inhibition of anti-apoptotic BCL-2 family proteins and WSB2, a substrate receptor in CRL5 ubiquitin ligase complex. Mechanistically, WSB2 interacts with NOXA to promote its ubiquitylation and degradation. Cancer cells deficient in WSB2, as well as heart and liver tissues from Wsb2-/- mice exhibit high susceptibility to apoptosis induced by inhibitors of BCL-2 family proteins. The anti-apoptotic activity of WSB2 is partially dependent on NOXA.

Overall, the finding, that WSB2 disruption triggers synthetic lethality to BCL-2 family protein inhibitors by destabilizing NOXA, is rather novel. The manuscript is largely hypothesis-driven, with experiments that are adequately designed and executed. However, there are quite a few issues for the authors to address, including those listed below.

Specific comments:

(1) At the beginning of the Results section, a clear statement is needed as to why the authors are interested in WSB2 and what brought them to analyze "the genetic co-dependency between WSB2 and other proteins".

(2) In general, the biochemical evidence supporting the role of WSB2 as a SOCS box-containing substrate-binding receptor of CRL5 E3 in promoting NOXA ubiquitylation and degradation is relatively weak. First, since NOXA2 binds to WSB2 on its SOCS box, which consists of a BC box for Elongin B/C binding and a CUL5 box for CUL5 binding, it is crucial to determine whether the binding of NOXA on the SOCS box affects the formation of CRL5WSB2 complex. The authors should demonstrate the endogenous binding between NOXA and the CRL5WSB2 complex. Additionally, the authors may also consider manipulating CUL5, SAG, or ElonginB/C to assess if it would affect NOXA protein turnover in two independent cell lines. Second, in all the experiments designed to detect NOXA ubiquitylation in cells, the authors utilized immunoprecipitation (IP) with FLAG-NOXA/NOXA, followed by immunoblotting (IB) with HA-Ub. However, it is possible that the observed poly-Ub bands could be partly attributed to the ubiquitylation of other NOXA binding proteins. Therefore, the authors need to consider performing IP with HA-Ub and subsequently IB with NOXA. Alternatively, they could use Ni-beads to pull down all His-Ub-tagged proteins under denaturing conditions, followed by the detection of FLAG-tagged NOXA using anti-FLAG Ab. The authors are encouraged to perform one of these suggested experiments to exclude the possibility of this concern. Furthermore, an in vitro ubiquitylation assay is crucial to conclusively demonstrate that the polyubiquitylation of NOXA is indeed mediated by the CRL5WSB2 complex.

(3) In their attempt to map the binding regions between NOXA and WSB2, the authors utilized exogenous proteins of both WSB2 and NOXA. To strengthen their findings, it would be more convincing to perform IP with exogenous wt/mutant WSB2 or NOXA and subsequently perform IB to detect endogenous NOXA or WSB2, respectively. Additionally, an in vitro binding assay using purified proteins would provide further evidence of a direct binding between NOXA and WSB2.

Reviewer #2 (Public Review):

Summary:

Exploring the DEP-MAP database and two drug-screen databases, the authors identify WSB2 as an interactor of several BCL2 proteins. In follow-up experiments, they show that CRL5/WSB2 controls NOXA protein levels via K48 ubiquitination following direct protein-protein interaction, and cell death sensitivity in the context of BH3 mimetic treatment, where WSB2 depletion synergizes with drug treatment.

Strengths:

The authors use a set of orthogonal methods across different model cell lines and a new WSB2 KO mouse model to confirm their findings. They also manage to correlate WSB2 expression with poor prognosis in prostate and liver cancer, supporting the idea that targeting WSB2 may sensitize cancers for treatment with BH3 mimetics.

Weaknesses:

The conclusions drawn based on the findings in cancer patients are very speculative, as regulation of NOXA cannot be the sole function of CRL5/WSB2 and it is hence unclear what causes correlation with patient survival. Moreover, the authors do not provide a clear mechanistic explanation of how exactly higher levels of NOXA promote apoptosis in the absence of WSB2. This would be important knowledge, as usually high NOXA levels correlate with high MCL1, as they are turned over together, but in situations like this, or loss of other E3 ligases, such as MARCH, the buffering capacity of MCL1 is outrun, allowing excess NOXA to kill (likely by neutralizing other BCL2 proteins it usually does not bind to, such as BCLX). Moreover, a necroptosis-inducing role of NOXA has been postulated. Neither of these options is interrogated here.

Reviewer #1 (Public Review):

Summary:

Building upon their famous tool for the deconvolution of human transcriptomics data (EPIC), Gabriel et al. implemented a new methodology for the quantification of the cellular composition of samples profiled with Assay for Transposase-Accessible Chromatin sequencing (ATAC-seq). To build a signature for ATAC-seq deconvolution, they first created a compendium of ATAC-seq data and derived chromatin accessibility marker peaks and reference profiles for 12 cell types, encompassing immune cells, endothelial cells, and fibroblasts. Then, they coupled this novel signature with the EPIC deconvolution framework based on constrained least-square regression to derive a dedicated tool called EPIC-ATAC. The method was then assessed using real and pseudo-bulk ATAC-seq data from human peripheral blood mononuclear cells (PBMC) and, finally, applied to ATAC-seq data from breast cancer tumors to show it accurately quantifies their immune contexture.

Strengths:

Overall, the work is of very high quality. The proposed tool is timely; its implementation, characterization, and validation are based on rigorous methodologies and results in robust estimates. The newly-generated, validation data and the code are publicly available and well-documented. Therefore, I believe this work and the associated resources will greatly benefit the scientific community.

Weaknesses:

In the benchmarking analysis, EPIC-ATAC was compared also to deconvolution methods that were originally developed for transcriptomics and not for ATAC-seq data. However, the authors described in detail the specific settings used to analyze this different data modality as robustly as possible, and they discussed possible limitations and ideas for future improvement.

Reviewer #2 (Public Review):

Summary:

The manuscript expands the current bulk sequencing data deconvolution toolkit to include ATAC-seq. The EPIC-ATAC tool successfully predicts accurate proportions of immune cells in bulk tumour samples and EPIC-ATAC seems to perform well in benchmarking analyses. The authors achieve their aim of developing a new bulk ATAC-seq deconvolution tool.

Strengths:

The manuscript describes simple and understandable experiments to demonstrate the accuracy of EPIC-ATAC. They have also been incredibly thorough with their reference dataset collections and have been robust in their benchmarking endeavours and measured EPIC-ATAC against multiple datasets and tools. This tool will be valuable to the community it serves.

Reviewer #1 (Public Review):

Summary:

Previous research from the Margoliash laboratory has demonstrated that the intrinsic electrophysiological properties of one class of projection neurons in the song nucleus HVC, HVCX neurons, are similar within birds and differ between birds in a manner that relates to the bird's song. The current study builds on this research by addressing how intrinsic properties may relate to the temporal structure of the bird's song and by developing a computational model for how this can influence sequence propagation of activity within HVC during singing.

First, the authors identify that the duration of the song motif is correlated with the duration of song syllables and particularly the length of harmonic stacks within the song. They next found positive correlations between some of the intrinsic properties, including firing frequency, sag ratio, and rebound excitation area with the duration of the birds' longest harmonic syllable and some other measure of motif duration. These results were extended by examining measures of firing frequency and sag ratio between two groups of birds that were experimentally raised to learn songs that only differed by the addition of a long terminal harmonic stack in one of the groups. Lastly, the authors present an HH-based model elucidating how the timing and magnitude of rebound excitation of HVCX neurons can function to support previously reported physiological network properties of these neurons during singing.

Strengths:

By trying to describe how intrinsic properties (IPs) may relate to the structure of learned behavior and providing a potentially plausible model (see below for more on this) for how differences in IPs can relate to sequence propagation in this neural network, this research is addressing an important and challenging issue. An understanding of how cell types develop IPs and how those IPs relate to the function and output of a network is a fundamental issue. Tackling this in the zebra finch HVC is an elegant approach because it provides a quantifiable and reliable behavior that is explicitly tied to the neurons that the authors are studying. Nonetheless, this is a difficult problem, and kudos to the authors for trying to unravel this.

Correlations between harmonic stack durations and song durations are well-supported and interesting. This provides a new insight that can and will likely be used by other research groups in correlating neuronal activity patterns to song behavior and motif duration. Additionally, correlations between IPs associated with rebound excitation are also well supported in this study.

The HH-model presented is important because it meaningfully relates how high or low rebound excitation can set the integration time window for HVCX neurons. Further, the synaptic connectivity of this model provides at least one plausible way in how this functions to permit the bursting activity of HVCX neurons during singing (and potentially during song playback experiments in sleeping birds). Thus, this model will be useful to the field for understanding how this network activity intersects with 'learned' IPs in an important class of neurons in this circuit.

Weaknesses:

The main weakness of the study is that there is somewhat of a disconnect between the physiological measurements described and the key components of the circuit model presented at the end of the paper. Thus, better support could be provided to link the magnitude of rebound excitation with song temporal structure. The rebound excitation area is shown to be positively correlated with the longest harmonic stack. Does this correlation hold when the four birds with unusually long stacks (>150ms) are excluded? Is rebound excitation area positively correlated with motif duration? Additionally, rebound excitation was not considered when examining experimentally tutored birds. Further analysis of these correlations can better link this research to the model presented.

The HH model is of general interest, but I am concerned about the plausibility of some of this circuitry, particularly because synaptic connectivity underlying information flow is a central component of the model. At several steps in the model, excitatory drive onto HVCX neurons is coming from another HVCX neuron. Although disynaptic inhibition between HVCX neurons and between HVCRA and HVCX neurons is well established, I am not aware of any data indicating direct synaptic connections between HVCX neurons.

Thus, how does the model change if all excitatory drive onto HVCX neurons are coming from HVCRA neurons? Currently, the model is realized through neurons being active at syllable or gesture transitions. What does the model predict about the distribution of HVCRA neurons activity across songs if they are the exclusive excitatory input to HVCX neurons? A better consideration of these issues can improve the suitability of the model in the context of known connectivity.

If I understand the model and ideas correctly, birds with longer motifs should exhibit longer pauses in the activity of tonically active HVC interneurons during singing and they should exhibit longer post-rebound integration windows. Experimental evidence supporting either of these ideas is not provided and would strengthen this research.

Reviewer #2 (Public Review):

Intrinsic properties of a neuron refer to the ion channels that a neuron expresses. These ion channels determine how a neuron responds to its inputs. How intrinsic properties link to behavior remains poorly understood. Medina and Margoliash address this question using the zebra finch, a well-studied songbird. Previous studies from their lab and other labs have shown that the intrinsic properties of adult songbird basal-ganglia projecting premotor neurons, are more similar within a bird than across birds. Across birds, this similarity is related to the extent of similarity in the songs; the more similar the song between two birds, the more similar the intrinsic properties between the neurons of these two birds. Finally, the intrinsic properties of these neurons change over the course of development and are sensitive to intact auditory feedback. However, the song features that relate to these intrinsic properties and the function of the within-bird homogeneity of intrinsic properties are unclear.

In this manuscript, the authors address these two questions by examining the intrinsic properties of basal-ganglia projecting premotor neurons in zebra finch brain slices. Specifically, they focus on the Ih current (as this is related to rhythmic activity in many pattern-generating circuits) and correlate the properties of the Ih current with song features. They find that the sag ratio (a measure of the driving force of the Ih current) and the rebound area (a measure of the post-inhibitory depolarisation) are both correlated with the temporal features of the song. First, they show the presence of correlations between the length of the song motif and the length of the longest syllable (most often a harmonic stack syllable). Based on this, they conclude that longer song motifs are composed of longer syllables. Second, they show that HVCX neurons within a bird have more similar sag ratios and rebound areas than across birds. Third, the mean sag ratio and mean rebound areas across birds were correlated with the duration of the longest harmonic stack within the song. These two results suggest that IPs are correlated with the temporal structure of the song. To further test this, the authors used natural and experimental tutoring procedures to have birds that learned two different types of songs that only differed in length; the longer song had an extra harmonic stack at the end. Using these two sets of birds, the authors find larger sag ratios and higher firing frequencies in birds with longer songs. Fifth, they show that the post-inhibitory rebound area allows neurons to respond to excitatory inputs and produce spikes. Neurons with a larger rebound area have a larger time window for responding to excitatory inputs. Based on this, they speculate that HVCX neurons with larger rebound areas integrate over larger time windows. Finally, they make a network model of HVC and show that one specific model could explain sequence-specific bursting of HVCX neurons.

Strengths

The question being addressed is an interesting question and the authors use appropriate techniques. The authors find a new temporal structure within the song, specifically, they find that longer songs typically have more syllables and longer syllables. As far as I know, this has not been shown earlier. The authors build on existing literature to suggest that IPs of HVCX neurons are correlated with the temporal structure of songs.

Weaknesses

I have a number of concerns with the statistics and interpretation of the results, insufficient controls for one experiment, and the specifics of the model that affect the implications of these results. These concerns are listed in the recommendations for the authors.

Reviewer #3 (Public Review):

It is rare to find systems in neuroscience where a detailed mechanistic link can be made between the biophysical properties of individual neurons and observable behaviors. In this study, Medina and Margoliash examined how the intrinsic physiological properties of a subclass of neurons in HVC, the main nucleus orchestrating the production of birdsong, might have an effect on the temporal structure of a song. This builds on prior work from this lab demonstrating that intrinsic properties of these neurons are highly consistent within individual animals and more similar between animals with similar songs, by identifying specific acoustic features of the song that covary with intrinsic properties and by setting forth a detailed biophysical network model to explain the relationship.

The main experimental finding is that excitability, hyperpolarization-evoked sag, and rebound depolarization are correlated with song duration and the duration of long harmonic elements. This motivates the hypothesis that rebound depolarization acts as a coincidence detector for the offset of inhibition associated with the previous song element and excitation associated with the start of the next element, with the delay and other characteristics of the window determined primarily by Ih. The idea is then that the temporal sensitivity of coincidence detection, which is common to all HVCx neurons, sets a global tempo that relates to the temporal characteristics of a song. This model is supported by some experimental data showing variation in the temporal integration of rebound spiking and by a Hodgkin-Huxley-based computational model that demonstrates proof of principle, including the emergence of a narrow (~50 ms) post-inhibitory window when excitatory input from other principal neurons can effectively evoke spiking.

Overall, the data are convincing and the model is compelling. The manuscript plays to the strengths of zebra finch song learning and the well-characterized microcircuitry and network dynamics of HVC. Of particular note, the design for the electrophysiology experiments employed both a correlational approach exploiting the natural variation in zebra finch song and a more controlled approach comparing birds that were tutored to produce songs that differed primarily along a single acoustical dimension. The modeling is based on Hodgkin-Huxley ionic conductances that have been pharmacologically validated, and the connections and functional properties of the network are consistent with prior work. This makes for a level of mechanistic detail that will likely be fruitful for future work.

There are some minor to moderate weaknesses. A minor weakness in the analysis of the experimental data relates to the handling of multiple correlations. There are several physiological variables that covary and several acoustical variables that covary, which makes it difficult to interpret standard Pearson correlation coefficients between any two individual variables. This is a minor concern because the results of the correlational analysis were confirmed in separate experiments with controlled tutoring, but a partial correlation analysis or latent factor analysis would be a more rigorous way of analyzing the natural live tutoring data.

Reviewer #1 (Public Review):

The authors propose a UPEC TA system in which a metabolite, c-di-GMP, acts as the AT with the toxin HipH. The idea is novel, but several key ideas are missing in regard to the relevant literature, and the experimental design is flawed. Moreover, they are absolutely not studying persister cells as Figure 1b clearly shows they are merely studying dying cells since no plateau in killing (or anything close to a plateau) was reached. So in no way has persistence been linked to c-di-GMP. Moreover, I do not think the authors have shown how the c-di-GMP sensor works. Also, there is no evidence that c-di-GMP is an antitoxin as no binding to HipH has been shown. So at best, this is an indirect effect, not a new toxin/antitoxin system as for all 7 TAs, a direct link to the toxin has been demonstrated for antitoxins.

Weaknesses:

(1) L 53: biofilm persisters are no different than any other persisters (there is no credible evidence of any different persister cells) so this reviewer suggests changing 'biofilm persisters' to 'persisters' throughout the text.

(2) L 51: persister cells do not mutate and, once resuscitated, mutate like any other growing cell so this sentence should be deleted as it promotes an unnecessary myth about persistence.

(3) L 69: please include the only metabolic model for persister cell formation and resuscitation here based on single cells (e.g., doi.org/10.1016/j.bbrc.2020.01.102 , https://doi.org/10.1016/j.isci.2019.100792 ); otherwise, you write as if there are no molecular mechanisms for persistence/resuscitation.

(4) The authors should cite in the Intro or Discussion that others have proposed similar novel TAs including a ppGpp metabolic toxin paired with an enzymatic antitoxin SpoT that hydrolyzes the toxin (http://dx.doi.org/10.1016/j.molcel.2013.04.002).

(5) Figure 1b: there are no results in this paper related to persister cells. Figure 1b simply shows dying cells were enumerated. Hence, the population of stressed cells increased, not 'persister cells' (Figure 1f), in the course of these experiments.

(6) Figure S1: I see no evidence that the authors have shown this c-di-GMP detects different c-di-GMP levels since there appears to be no data related to varying c-di-GMP concentrations with a consistent decrease. Instead, there is a maximum. What are the concentration of c-di-GMP on the X-axis for panels C, D, and E? How were c-di-GMP levels varied such that you know the c-di-GMP concentration?

(7) The viable portion of the VBNC population are persister cells so there is no reason to use VBNC as a separate term. Please see the reported errors often made with nucleic acid staining dyes in regard to VBNCs.

Reviewer #2 (Public Review):

Summary:

Hebin et al reported a fascinating story about antibiotic persistence in the biofilms. First, they set up a model to identify the increased persisters in the biofilm status. They found that the adhesion of bacteria to the surface leads to increased c-di-GMP levels, which might lead to the formation of persisters. To figure out the molecular mechanism, they screened the E.coli Keio Knockout Collection and identified the HipH. Finally, the authors used a lot of data to prove that c-di-GMP not only controls HipH over-expression but also inhibits HipH activity, though the inhibition might be weak.

Strengths:

They used a lot of state-of-the-art technologies, such as single-cell technologies as well as classical genetic and biochemistry approaches to prove the concept, which makes the conclusions very solid. Overall, it is a very interesting and solid story that might attract diverse readers working with c-di-GMP, persisters, and biofilm.

Weaknesses:

(1) Is HipH the only target identified by screening the E.coli Keio Knockout Collection?

(2) Since the story is complicated, a diagrammatic picture might be needed to illustrate the whole story. And the title does not accurately summarize the novelty of this study.

(3) The ratio of mVenus NB to mScarlet-I (R) negatively correlates with the concentration of c-di-GMP. Therefore, R -1 demonstrates a positive correlation with the concentration of c-di-GMP. Is this method validated with other methods to quantify c-di-GMP， or used in other studies？

(4) References are missing throughout the manuscript. Please add enough references for every conclusion.

(5) The novelty of this study should be clearly written and compared with previous references. For example, is it the first study to report the mechanism that the adhesion of bacteria to the surface leads to increased persister formation?

(6) in vitro DNA cleavage assay. Why not use bacterial genomic DNA to test the cleaving of HipH on the bacterial genome?

(7) C-di-gmp -HipH is not a TA, it does not fit in the definition of the TA systems. You can say C-di-gmp is an antitoxin based on your study, but C-di-gmp -HipH is not a TA pair.

Reviewer #1 (Public Review):

The authors introduce DIPx, a deep learning framework for predicting synergistic drug combinations for cancer treatment using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset. While the approach is innovative, I have the following concerns and comments which hopefully will improve the study's rigor and applicability, making it a more powerful tool in the real clinical world.

(1) Test Set 1 comprises combinations already present in the training set, likely leading overfitting issue. The model might show inflated performance metrics on this test set due to prior exposure to these combinations, not accurately reflecting its true predictive power on unknown data, which is crucial for discovering new drug synergies. The testing approach reduces the generalizability of the model's findings to new, untested scenarios.

(2) The model struggles with predicting synergies for drug combinations not included in its training data (showing only a Spearman correlation of 0.26 in Test Set 2). This limits its potential for discovering new therapeutic strategies. Utilizing techniques such as transfer learning or expanding the training dataset to encompass a wider range of drug pairs could help to address this issue.

(3) The use of pan-cancer datasets, while offering broad applicability, may not be optimal for specific cancer subtypes with distinct biological mechanisms. Developing subtype-specific models or adjusting the current model to account for these differences could improve prediction accuracy for individual cancer types.

(4) Line 127, "Since DIPx uses only molecular data, to make a fair comparison, we trained TAJI using only molecular features and referred to it as TAJI-M.". TAJI was designed to use both monotherapy drug-response and molecular data, and likely won't be able to reach maximum potential if removing monotherapy drug-response from the training model. It would be critical to use the same training datasets and then compare the performances. From Figure 6 of TAJI's paper (Li et al., 2018, PMID: 30054332) , i.e., the mean Pearson correlation for breast cancer and lung cancer is around 0.5 - 0.6.

The following 2 concerns have been included in the Discussion section which is great:

(1) Training and validating the model using cell lines may not fully capture the heterogeneity and complexity of in vivo tumors. To increase clinical relevance, it would be beneficial to validate the model using primary tumor samples or patient-derived xenografts.

(2) The Pathway Activation Score (PAS) is derived exclusively from primary target genes, potentially overlooking critical interactions involving non-primary targets. Including these secondary effects could enhance the model's predictive accuracy and comprehensiveness.

Reviewer #2 (Public Review):

Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects. While the authors address an important question, more rigor is required to understand the full behavior of the model.

Major Points

(1) The authors compare DIPx to the winning method of the DREAm challenge, TAJI to show that from molecular features alone they retrain TAJI to create TAJI-M without the monotherapy data inputs. They mention that "of course, we could also use such data in DIPx...", but they never show the behaviour of DIPx with these data. The authors need to demonstrate that this statement holds true or else compare it to the full TAJI.

(2) It would be neat to see how the DIPx feature importance changes with monotherapy input. For most realistic scenarios in which these models are used robust monotherapy data do exist.

(3) In Figure 2, the authors compare DIPx and TAJI-M on various test sets. If I understood correctly, they also bootstrapped the training set with n=100 and reported all the model variants in many of the comparisons. While this is a nice way of showing model robustness, calculating p-values with bootstrapped data does not make sense in my opinion as by increasing the value of n, one can make the p-value arbitrarily small. The p-value should only be reported for the original models.

(4) From Figures 2 and 3, it appears DIPx is overfit on the training set with large gaps in Spearman correlations between Test Set 2/ONeil set and Test Set 1. It also features much better in cases where it has seen both compounds. Could the authors also compare TAJI on the ONeil dataset to show if it is as much overfit?

Reviewer #3 (Public Review):

Summary:

Predicting how two different drugs act together by looking at their specific gene targets and pathways is crucial for understanding the biological significance of drug combinations. Such combinations of drugs can lead to synergistic effects that enhance drug efficacy and decrease resistance. This study incorporates drug-specific pathway activation scores (PASs) to estimate synergy scores as one of the key advancements for synergy prediction. The new algorithm, Drug synergy Interaction Prediction (DIPx), developed in this study, uses gene expression, mutation profiles, and drug synergy data to train the model and predict synergy between two drugs and suggests the best combinations based on their functional relevance on the mechanism of action. Comprehensive validations using two different datasets and comparing them with another best-performing algorithm highlight the potential of its capabilities and broader applications. However, the study would benefit from including experimental validation of some predicted drug combinations to enhance its reliability.

Strengths:

The DIPx algorithm demonstrates the strengths listed below in its approach for personalized drug synergy prediction. One of its strengths lies in its utilization of biologically motivated cancer-specific (driver genes-based) and drug-specific (target genes-based) pathway activation scores (PASs) to predict drug synergy. This approach integrates gene expression, mutation profiles, and drug synergy data to capture information about the functional interactions between drug targets, thereby providing a potential biological explanation for the synergistic effects of combined drugs. Additionally, DIPx's performance was tested using the AstraZeneca-Sanger (AZS) DREAM Challenge dataset, especially in Test Set 1, where the Spearman correlation coefficient between predicted and observed drug synergy was 0.50 (95% CI: 0.47-0.53). This demonstrates the algorithm's effectiveness in handling combinations already in the training set. Furthermore, DIPx's ability to handle novel combinations, as evidenced by its performance in Test Set 2, indicates its potential for extrapolating predictions to new and untested drug combinations. This suggests that the algorithm can adapt to and make accurate predictions for previously unencountered combinations, which is crucial for its practical application in personalized medicine. Overall, DIPx's integration of pathway activation scores and its performance in predicting drug synergy for known and novel combinations underscore its potential as a valuable tool for personalized prediction of drug synergy and exploration of activated pathways related to the effects of combined drugs.

Weaknesses:

While the DIPx algorithm shows promise in predicting drug synergy based on pathway activation scores, it's essential to consider its limitations. One limitation is that the algorithm's performance was less accurate when predicting drug synergy for combinations absent from the training set. This suggests that its predictive capability may be influenced by the availability of training data for specific drug combinations. Additionally, further testing and validation across different datasets (more than the current two datasets) would be necessary to assess the algorithm's generalizability and robustness fully. It's also important to consider potential biases in the training data and ensure that DIPx predictions are validated through empirical studies including experimental testing of predicted combinations. Despite these limitations, DIPx represents a valuable step towards personalized prediction of drug synergy and warrants continued investigation and improvement. It would benefit if the algorithm's limitations are described with some examples and suggest future advancement steps.

Reviewer #1 (Public Review):

Munday, Rosello, and colleagues compared predictions from a group of experts in epidemiology with predictions from two mathematical models on the question of how many Ebola cases would be reported in different geographical zones over the next month. Their study ran from November 2019 to March 2020 during the Ebola virus outbreak in the Democratic Republic of the Congo. Their key result concerned predicted numbers of cases in a defined set of zones. They found that neither the ensemble of models nor the group of experts produced consistently better predictions. Similarly, neither model performed consistently better than the other, and no expert's predictions were consistently better than the others. Experts were also able to specify other zones in which they expected to see cases in the next month. For this part of the analysis, experts consistently outperformed the models. In March, the final month of the analysis, the models' accuracy was lower than in other months and consistently poorer than the experts' predictions.

A strength of the analysis is the use of consistent methodology to elicit predictions from experts during an outbreak that can be compared to observations, and that are comparable to predictions from the models. Results were elicited for a specified group of zones, and experts were also able to suggest other zones that were expected to have diagnosed cases. This likely replicates the type of advice being sought by policymakers during an outbreak.

A potential weakness is that the authors included only two models in their ensemble. Ensembles of greater numbers of models might tend to produce better predictions. The authors do not address whether a greater number of models could outperform the experts.

The elicitation was performed in four months near the end of the outbreak. The authors address some of the implications of this. A potential challenge to the transferability of this result is that the experts' understanding of local idiosyncrasies in transmission may have improved over the course of the outbreak. The model did not have this improvement over time. The comparison of models to experts may therefore not be applicable to the early stages of an outbreak when expert opinions may be less well-tuned.

This research has important implications for both researchers and policy-makers. Mathematical models produce clearly-described predictions that will later be compared to observed outcomes. When model predictions differ greatly from observations, this harms trust in the models, but alternative forms of prediction are seldom so clearly articulated or accurately assessed. If models are discredited without proper assessment of alternatives then we risk losing a valuable source of information that can help guide public health responses. From an academic perspective, this research can help to guide methods for combining expert opinion with model outputs, such as considering how experts can inform models' prior distributions and how model outputs can inform experts' opinions.

Reviewer #2 (Public Review):

Summary:

The manuscript by Munday et al. presents real-time predictions of geographic spread during an Ebola epidemic in north-eastern DRC. Predictions were elicited from individual experts engaged in outbreak response and from two mathematical models. The authors found comparable performance between experts and models overall, although the models outperformed experts in a few dimensions.

Strengths:

Both individual experts and mathematical models are commonly used to support outbreak response but rarely used together. The manuscript presents an in-depth analysis of the accuracy and decision-relevance of the information provided by each source individually and in combination.

Weaknesses:

A few minor methodological details are currently missing.

Reviewer #3 (Public Review):

Summary

The authors show that ELS induces a number of brain and behavioral changes in the adult lateral amygdala. These changes include enduring astrocytic dysfunction, and inducing astrocytic dysfunction via genetic interventions is sufficient to phenocopy the behavioral and neural phenotypes. This suggests that astrocyte dysfunction may play a causal role in ELS-associated pathologies.

Strengths:

A strength is the shift in focus to astrocytes to understand how ELS alters adult behavior.

Weaknesses:

The mechanistic links between some of the correlates - altered astrocytic function, changes in neural excitability, and synaptic plasticity in the lateral amygdala and behaviour - are underdeveloped.

Reviewer #1 (Public Review):

Summary:

The manuscript asks the question of whether astrocytes contribute to behavioral deficits triggered by early life stress. This question is tested by experiments that monitor the effects of early life stress on anxiety-like behaviors, long-term potentiation in the lateral amygdala, and immunohistochemistry of astrocyte-specific (GFAP, Cx43, GLT-1) and general activity (c-Fos ) markers. Secondarily, astrocyte activity in the lateral amygdala is impaired by viruses that suppress gap-junction coupling or reduce astrocyte Ca2+ followed by behavioral, synaptic plasticity, and c-Fos staining. Early life stress is found to reduce the expression of GFAP and Cx43 and to induce translocation of the glucocorticoid receptor to astrocytic nuclei. Both early life stress and astrocyte manipulations are found to result in the generalization of fear to neutral auditory cues. All of the experiments are done well with appropriate statistics and control groups. The manuscript is very well-written and the data are presented clearly. The authors' conclusion that lateral amygdala astrocytes regulate amygdala-dependent behaviors is strongly supported by the data. However, the extent to which astrocytes contribute to behavioral and neuronal consequences of early life stress remains open to debate.

Strengths:

A strong combination of behavioral, electrophysiology, and immunostaining approaches is utilized and possible sex differences in behavioral data are considered. The experiments clearly demonstrate that disruption of astrocyte networks or reduction of astrocyte Ca2+ provokes generalization of fear and impairs long-term potentiation in the lateral amygdala. The provocative finding that astrocyte dysfunction accounts for a subset of behavioral effects of early life stress (e.g. not elevated plus or distance traveled observations) is also perceived as a strength.

Weaknesses:

The main weakness is the absence of more direct evidence that behavioral and neuronal plasticity after early life stress can be attributed to astrocytes. It remains unknown what would happen if astrocyte activity were disrupted concurrently with early life stress or if the facilitation of astrocyte Ca2+ would attenuate early life stress outcomes. As is, the only evidence that early life stress involves astrocytes is nuclear translocation of GR and downregulation of GFAP and Cx43 in Figure 3 which may or may not provoke astrocyte Ca2+ or astrocyte network activity changes.

Reviewer #2 (Public Review):

Summary:

In this manuscript, Guayasamin et al. show that early-life stress (ELS) can induce a shift in fear generalisation in mice. They took advantage of a fear conditioning paradigm followed by a discrimination test and complemented learning and memory findings with measurements for anxiety-like behaviors. Next, astrocytic dysfunction in the lateral amygdala was investigated at the cellular level by combining staining for c-Fos with astrocyte-related proteins. Changes in excitatory neurotransmission were observed in acute brains slices after ELS suggesting impaired communication between neurons and astrocytes. To confirm the causality of astrocytic-neuronal dysfunction in behavioral changes, viral manipulations were performed in unstressed mice. Occlusion of functional coupling with a dominant negative construct for gap junction connexin 43 or reduction in astrocytic calcium with CalEx mimicked the behavioral changes observed after ELS suggesting that dysfunction of the astrocytic network underlies ELS-induced memory impairments.

Strengths:

Overall, this well-written manuscript highlights a key role for astrocytes in regulating stress-induced behavioral and synaptic deficits in the lateral amygdala in the context of ELS. Results are innovative, and methodological approaches relevant to decipher the role of astrocytes in behaviors. As mentioned by the authors, non-neuronal cells are receiving increasing attention in the neuroscience, stress, and psychiatry fields.

Weaknesses:

I do have several suggestions and comments to address that I believe will improve the clarity and impact of the work. For example, there is currently a lack of information on the timeline for behavioral experiments, tissue collection, etc.

Reviewer #1 (Public Review):

Summary:<br /> The authors demonstrate that, while the loss of Ezrin increases lysosomal biogenesis and function, its presence is required for the specific endocytosis of EGFR. Upon further investigation, the authors reveal that Ezrin is a crucial intermediary protein that links EGFR to AKT, leading to the phosphorylation and inhibition of TSC. TSC is a critical negative regulator of the mTORC1 complex, which is dysregulated in various diseases, making their findings a valuable addition to multiple fields of study. Their cell signaling findings are translatable to an in vivo Medaka fish model and suggest that Ezrin may play a crucial role in retinal degeneration.

Strengths:<br /> Giamundo, Intartaglia, et al. utilized unbiased proteomic and transcriptomic screens in Ezrin KO cells to investigate the mechanistic function of Ezrin in lysosome and cell signaling pathways. The authors' findings are consistent with past literature demonstrating Ezrin's role in the EGFR and mTORC1 signaling pathways. They used several cell lines, small molecule inhibitors, and cellular and in vivo knockout models to validate signaling changes through biochemical and microscopy assays. Their use of multiple advanced microscopy techniques is also impressive.

Weaknesses:<br /> While the authors demonstrated activation of TSC1 (lysosomal accumulation) and inactivation of Akt (decreased phosphorylation in TSC1), as well as decreased mTORC1 signaling in Ezrin knockout cells, direct experiments showing the rescue of mTORC1 activity by AKT and TSC1 mutants are required to confirm the linear signaling pathway and establish Ezrin as a mediator of EGFR-AKT-TSC1-mTORC1 signaling. Although the authors presented representative images from advanced microscopy techniques to support their claims, there is insufficient quantification of these experiments. Additionally, several immunoblots in the manuscript lack vital loading controls, such as input lanes for immunoprecipitations and loading controls for western blots.

Reviewer #2 (Public Review):

Summary:<br /> The authors begin with the stated goal of gaining insight into the known repression of autophagy by Ezrin, a major membrane-actin linker that assembles signaling complexes on membranes. RNA and protein expression analysis is consistent with upregulation of lysosomal proteins in Ezrin-deficient MEFs, which the authors confirm by immunostaining and western blotting for lysosomal markers. Expression analysis also implicates EGF signaling as being altered downstream of Ezrin loss, and the authors demonstrate that Ezrin promotes relocalization of EGFR from the plasma membrane to endosomes. Ezrin loss impacts downstream MAPK/Akt/mTORC1 signaling, although the mechanistic links remain unclear. An Ezrin mutant Medaka fish line wa then generated to test Ezrin's role in retinal cells, which are known to be sensitive to changes in autophagy regulation. Phenotypes in this model appear generally consistent with observations made in cultured cells, though mild overall.

Strengths:<br /> Data on the impact of Ezrin-loss on relocalization of EGFR from the plasma membrane are extensive, and thoroughly demonstrate that Ezrin is required for EGFR internalization in response to EGF.

A new Ezrin-deficient in vivo model (Medaka fish) is generated.

Strong data demonstrates that Ezrin loss suppresses Akt signaling. Ezrin loss also clearly suppresses mTORC1 signaling in cell culture, although examination of mTORC1 activity is notably missing in Ezrin-deficient fish.

Weaknesses:<br /> LC3 is used as a readout of autophagy, however the lipidated/unlipidated LC3 ratio generally does not appear to change, thus there does not appear to be evidence that Ezrin loss is affecting autophagy in this study.

The conclusion is drawn that Ezrin loss suppresses EGF signaling, however this is complicated by a strong increase in phosphorylation of the p38 MAPK substrate MK2. Without additional characterization of MAPK and Erk signaling, the effect of Ezrin loss remains unclear.

Causative conclusions between effects on MAPK, Akt, and mTORC1 signaling are frequently drawn, but the data only demonstrate correlations. For example, many signaling pathways can activate mTORC1 including MAPK/Erk, thus reduced mTORC1 activity upon Ezrin-loss cannot currently be attributed to reduced Akt signaling. Similarly, other kinases can phosphorylate TSC2 at the sites examined here, so the conclusion cannot be drawn that Ezrin-loss causes a reduction in Akt-mediated TSC2 phosphorylation. In Figure 7, the conclusion cannot be drawn that retinal degeneration results from aberrant EGFR signaling.

It is unclear why TSC1 is highlighted in the title, as there does not appear to be any specific regulation of TSC1 here.

In Figure 1 the conclusion is drawn that there is an increase in lysosome number with Ezrin KO, however it does not appear that the current analysis can distinguish an increased number from increased lysosome size or activity. Similarly, conclusions about increased lysosome "biogenesis" could instead reflect decreased turnover.

Immunoprecipitation data for a role for Ezrin as a signaling scaffold appear minimal and seem to lack important controls.

In Figure 3A it seems difficult to conclude that EGFR dimerization is reduced since the whole blot, including the background between lanes, is lighter on that side.

In Figure 6C specificity controls for the TSC1 and TSC2 antibodies are not included, but seem necessary since their localization patterns appear very different from each other in WT cells.

In Figure 7 the signaling effects in Ezrin-deficient fish are mild compared to cultured cells, and effects on mTORC1 are not examined. Further data on the retinal cell phenotypes would strengthen the conclusions.

In Figure 7F there appears to be more EGFR throughout the cell, so it is difficult to conclude that more EGFR at the PM in Ezrin-/- fish means reduced internalization.

Reviewer #3 (Public Review):

Summary:<br /> In this study, the authors have attempted to demonstrate a critical role for the cytoskeletal scaffold protein Ezrin, in the upstream regulation of EGFR/AKT/MTOR signaling. They show that in the absence of Ezrin, ligand-induced EGFR trafficking and activation at the endosomes is perturbed, with decreased endosomal recruitment of the TSC complex, and a corresponding decrease in AKT/MTOR signaling.

Strengths:<br /> The authors have used a combination of novel imaging techniques, as well as conventional proteomic and biochemical assays to substantiate their findings. The findings expand our understanding of the upstream regulators of the EGFR/AKT MTOR signaling and lysosomal biogenesis, appear to be conserved in multiple species, and may have important implications for the pathogenesis and treatment of diseases involving endo-lysosomal function, such as diabetes and cancer, as well as neuro-degenerative diseases like macular degeneration. Furthermore, pharmacological targeting of Ezrin could potentially be utilized in diseases with defective TFEB/TFE3 functions like LSDs. While a majority of the findings appear to support the hypotheses, there are substantial gaps in the findings that could be better addressed. Since Ezrin appears to directly regulate MTOR activity, the effects of Ezrin KO on MTOR-regulated, TFEB/TFE3 -driven lysosomal function should be explored more thoroughly. Similarly, a more convincing analysis of autophagic flux should be carried out. Additionally, many immunoblots lack key controls (Control IgG in co-IPs) and many others merit repetition to either improve upon the quality of the existing data, validate the findings using orthogonal approaches, or provide a more rigorous quantitative assessment of the findings, as highlighted in the recommendation for authors.

Reviewer #1 (Public Review):

This manuscript validates and extends upon the sigh-generating circuit between the NMB/GRP+ RTN/parafacial neurons and the NMBR/GRPR+ preBötC neurons established in Li et al., 2016. The authors generate multiple transgenic lines that enable selective targeting of these various sub-populations of cells and demonstrate the sufficiency of each type in generating a sigh breath. Additionally, they show that NMBR and GPRP preBötC neurons are glutamatergic, have overlapping and distinct expressions, and do not express SST. Beyond this validation, the authors show that ectopic stimulation of SST neurons is sufficient to evoke sighs and that they are necessary for NMB/GRP-induced sighing. This data is the first time that preBötC neurons downstream of NMBR/GRPR neurons have been identified.

The five conclusions stated at the end of the introduction are supported by the data, but a strong emphasis throughout the manuscript is the identification of an unsubstantiated slow sigh rhythm that is produced by NMBR/GRPR neurons. To make such a novel (and quite surprising) claim requires many more studies and the conclusion is dependent on how the authors have defined a sigh. Moreover, some data within the paper conflicts with this idea.

In summary, the optogenetic and chemogenetic characterization of the neuropeptide pathway transgenic lines nicely aligns with and provides important validation of the previous study by Li et. al., 2016 and the SST neuron studies provide a new mechanism for the transformation of NMBR/GRPR neuropeptide activation into a sigh. These are important findings and they should be the points emphasized. The proposal of a slow sigh rhythm should be more rigorously established with new experiments and analysis or should be more carefully described and discussed.

Reviewer #2 (Public Review):

Summary:

This study investigates in mice neural mechanisms generating sighs, which are periodic large-amplitude breaths occurring during normal breathing that subserve physiological pulmonary functions and are associated with emotional states such as relief, stress, and anxiety. Sighs are generated by a structure called the preBötzinger complex (preBötC) in the medulla oblongata that generates various forms of inspiratory activity including sighs. The authors have previously described a circuit involving neurons producing bombesin-related peptides Neuromedin B (NMB) and gastrin-releasing peptide (GRP) that project to preBötC neurons expressing receptors for NMB (NMBRs) and GRP (GRPRs) and that activation of these preBötC neurons via these peptide receptors generates sighs. In this study, the authors further investigated mechanisms of sigh generation by applying optogenetic and chemogenetic strategies to selectively activate the subpopulations of preBötC neurons expressing NMBRs and/or GRPRs, and a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs. The authors present convincing evidence that sigh-like inspirations can be evoked by photostimulation of the preBötC neurons expressing NMBRs or GRPRs. Photostimulation of SST neurons can independently evoke sighs, and chemogenetic inhibition of these neurons can abolish sighs. The results presented support the authors' conclusion that the preBötC neurons expressing NMBRs or GRPRs produce sighs via pathways to downstream SST neurons. Thus, these studies have identified some of the preBötC cellular elements likely involved in generating sighs.

Strengths:

(1) This study employs an effective combination of electrophysiological, transgenic, optogenetic, chemogenetic, pharmacological, and neuron activity imaging techniques to investigate sigh generation by distinct subpopulations of preBötC neurons in mice.

(2) The authors extend previous studies indicating that there is a peptidergic circuit consisting of NMB and GRP expressing neurons that project from the parafacial (pF) nucleus region to the preBötC and provides sufficient input to generate sighs, since photoactivation of either pF NMB or GRP neurons evoke ectopic sighs in this study.

(3) Convincing evidence is presented that sighs can be evoked by direct photostimulation of preBötC neurons expressing NMBRs and/or GRPRs, and also a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs.

(4) The mRNA-expression data presented from in situ hybridization indicates that most preBötC neurons expressing NMBR, GRPR (or both) are glutamatergic and excitatory.

(5) Measurements in slices in vitro indicate that only the NMBR-expressing neurons are normally rhythmically active during normal inspiratory activity and endogenous sigh activity.

(6) Evidence is presented that activation of preBötC NMBRs and/or GRPRs is not necessary for sigh production, suggesting that sighs are not the unique product of the preBötC bombesin-peptide signaling pathway.

(7) The novel conclusion is presented that the preBötC neurons expressing NMBRs and/or GRPRs produce sighs via the separate downstream population of preBötC SST neurons, which the authors demonstrate can independently generate sighs, whereas chemogenetic inhibition of preBötC SST neurons selectively abolishes sighs generated by activating NMBRs and GRPRs.

Weaknesses:

(1) While these studies have identified subpopulations of preBötC neurons capable of episodically evoking sigh-like inspiratory activity, mechanisms producing the normal slow sigh rhythm were not investigated and remain unknown.

(2) Several key technical aspects of the study require further clarification to aid in interpreting the experimental results, including issues relating to the validation of the transgenic mouse lines and virally transduced expressions of proteins utilized for optogenetic and chemogenetic experiments, as well as justifying the optogenetic photostimulation paradigms used to evoke sighs.

Reviewer #3 (Public Review):

Summary:

This manuscript by Cui et al., studies the mechanisms for the generation of sighing, an essential breathing pattern. This is an important and interesting topic, as sighing maintains normal pulmonary function and is associated with various emotional conditions. However, the mechanisms of its generation remain not fully understood. The authors employed different approaches, including optogenetics, chemogenetics, intersectional genetic approach, slice electrophysiology, and calcium imaging, to address the question, and found several neuronal populations are sufficient to induce sighing when activated. Furthermore, ectopic sighs can be triggered without the involvement of neuromedin B (NMB) or gastrin-releasing peptide (GRP) or their receptors in the preBötzinger Complex (preBötC) region of the brainstem. Additionally, activating SST neurons in the preBötC region induces sighing, even when other receptors are blocked. Based on these results, the authors concluded that increased excitability in certain neurons (NMBR or GRPR neurons) activates pathways leading to sigh generation, with SST neurons serving as a downstream component in converting regular breaths into sighs

Strengths:

The authors employed a combination of various sophisticated approaches, including optogenetics, chemogenetics, intersectional genetic approach, slice electrophysiology and calcium imaging, to precisely pinpoint the mechanism responsible for sigh generation. They utilized multiple genetically modified mouse lines, enabling them to selectively manipulate and observe specific neuronal populations involved in sighing.

Using genetics and calcium imaging, the authors record the neuronal activity of NMBR and GRPR neurons, respectively, and identify their differences in activity patterns. Furthermore, by applying the intersectional approach, the authors were able to genetically target and manipulate several distinct neuronal populations, such as NMBR+, GRPR- neurons, and GRPR+, NMBR- neurons, and conducted a detailed characterization of their functions in influencing sighing.

Weaknesses:

The authors combined multiple approaches in this manuscript; however, the rationale and experimental details require further explanation, and their impacts on the conclusion require clarification. For instance, how and why the variability in optogenetic activation conditions could impact the experimental outcomes. Additionally, a more detailed characterization of the viral labeling efficiency and specificity is necessary to validate the claims made in these experiments. Without this, the results could be compromised by potential discrepancies in the number of labeled neurons or unintended labeling of other populations.

Moreover, the conclusion that preBötC NMBR and GRPR activations are unnecessary for sighing is not fully supported by the current experimental design. While the study shows that sighing can still be induced despite pharmacological inhibition of NMBR and GRPR, this does not conclusively prove that these receptors are not required under natural conditions. The artificial activation of downstream pathways through optogenetic or chemogenetic methods does not negate the potential physiological role of these receptors in sigh production. Therefore, the interpretation of these findings should be approached with caution, and further investigation is warranted to definitively determine the necessity of NMBR and GRPR activations in the natural sighing process.

Reviewer #1 (Public Review):

Summary:

Fats and lipids serve many important roles in cancers, including serving as important fuels for energy metabolism in cancer cells by being oxidized in the mitochondria. The process of fatty acid oxidation is initiated by the enzyme carnitine palmitoyltransferase 1A (CPT1A), and the function and targetability of CPT1A in cancer metabolism and biology have been heavily investigated. This includes studies that have found important roles for CPT1A in colorectal cancer growth and metastasis.

In this study, Chen and colleagues use analysis of patient samples and functional interrogation in animal models to examine the role CPT1A plays in colorectal cancer (CRC). The authors find that CPT1A expression is decreased in CRC compared to paired healthy tissue and that lower expression correlates with decreased patient survival over time, suggesting that CPT1A may suppress tumor progression. To functionally interrogate this hypothesis, the authors both use CRISPR to knockout CPT1A in a CRC cell line that expresses CPT1A and overexpress CPT1A in a CRC cell line with low expression. In both systems, increased CPT1A expression decreased cell survival and DNA repair in response to radiation in culture. Further, in xenograft models, CPT1A decreased tumor growth basally and radiotherapy could further decrease tumor growth in CPT1A-expressing tumors. As CRC is often treated with radiotherapy, the authors argue this radiosensitization driven by CPT1A could explain why CPT1A expression correlates with increased patient survival.

Lastly, Chen and colleagues sought to understand why CPT1A suppresses CRC tumor growth and sensitizes the tumors to radiotherapy in culture. The antioxidant capacity of cells can increase cell survival, so the authors examine antioxidant gene expression and levels in CPT1A-expressing and non-expressing cells. CPT1A expression suppresses the expression of antioxidant metabolism genes and lowers levels of antioxidants. Antioxidant metabolism genes can be regulated by the FOXM1 transcription factor, and the authors find that CPT1A expression regulates FOXM1 levels and that antioxidant gene expression can be partially rescued in CPT1A-expressing CRC cells. This leads the authors to propose the following model: CPT1A expression downregulates FOXM1 (via some yet undescribed mechanism) which then leads to decreased antioxidant capacity in CRC cells, thus suppressing tumor progression and increasing radiosensitivity. This is an interesting model that could explain the suppression of CPT1A expression in CRC, but key tenets of the model are untested and speculative.

Strengths:

• Analysis of CPT1A in paired CRC tumors and non-tumor tissue using multiple modalities combined with analysis of independent datasets rigorously show that CPT1A is downregulated in CRC tumors at the RNA and protein level.

• The authors use paired cell line model systems where CPT1A is both knocked out and overexpressed in cell lines that endogenously express or repress CPT1A respectively. These complementary model systems increase the rigor of the study.

• The finding that a metabolic enzyme generally thought to support tumor energetics actually is a tumor suppressor in some settings is theoretically quite interesting.

Weaknesses:

• The authors propose that CPT1A expression modulates antioxidant capacity in cells by suppressing FOXM1 and that this pathway alters CRC growth and radiotherapy response. However, key aspects of this model are not tested. The authors do not show that FOXM1 contributes to the regulation of antioxidant levels in CRC cells and tumors or if FOXM1 suppression is key to the inhibition of CRC tumor growth and radiosensitization by CPT1A. Thus, the model the authors propose is speculative and not supported by the existing data.

• The authors propose two mechanisms by which CPT1A expression triggers radiosensitization: decreasing DNA repair capacity (Figure 3) and decreasing antioxidant capacity (Figure 5). However, while CPT1A expression does alter these capacities in CRC cells, neither is functionally tested to determine if altered DNA repair or antioxidant capacity (or both) are the reason why CRC cells are more sensitive to radiotherapy or are delayed in causing tumors in vivo. Thus, this aspect of the proposed model is also speculative.

• The authors find that CPT1A affects radiosensitization in cell culture and assess this in vivo. In vivo, CPT1A expression slows tumor growth even in the absence of radiotherapy, and radiotherapy only proportionally decreases tumor growth to the same extent as it does in CPT1A non-expressing CRC tumors. The authors propose from this data that CPT1A expression also sensitizes tumors to radiotherapy in vivo. However, it is unclear whether CPT1A expression causes radiosensitization in vivo or if CPT1A expression acts as an independent tumor suppressor to which radiotherapy has an additive effect. Additional experiments would be necessary to differentiate between these possibilities.

• The authors propose in Figure 3 that DNA repair capacity is inhibited in CRC cells by CPT1A expression. However, the gH2AX immunoblots performed in Figure 3H-I that measure DNA repair kinetics are not convincing that CPT1A expression impairs DNA repair kinetics. Separate blots are shown for CPT1A expressing and non-expressing cell lines, not allowing for rigorous comparison of gH2AX levels and resolution as CPT1A expression is modulated.

• There are conflicting studies (PMID: 37977042, 29995871) that suggest that CPT1A is overexpressed in CRC and contributes to tumor progression rather than acting as a tumor suppressor as the authors propose. It would be helpful for readers for the authors to discuss these studies and why there is a discrepancy between them.

Reviewer #2 (Public Review):

The manuscript by Chen et al. describes how low levels of CPT1A in colorectal cancer (CRC) confer radioresistance by expediting radiation-induced ROS clearance. The authors propose that this mechanism of ROS homeostasis is regulated through FOXM1. CPT1A is known for its role in fatty acid metabolism via beta-oxidation of long-chain fatty acids, making it important in many metabolic disorders and cancers.

Previous studies have suggested that the upregulation of CPT1A is essential for the tumor-promoting effect in colorectal cancers (CRC) (PMID: 32913185). For example, CPT1A-mediated fatty acid oxidation promotes colorectal cancer cell metastasis (PMID: 2999587), and repression of CPT1A activity renders cancer cells more susceptible to killing by cytotoxic T lymphocytes (PMID: 37722058). Additionally, inhibition of CPT1A-mediated fatty-acid oxidation (FAO) sensitizes nasopharyngeal carcinomas to radiation therapy (PMID: 29721083). While this suggests a tumor-promoting effect for CPT1A, the work by Chen et al. suggests instead a tumor-suppressive function for CPT1A in CRC, specifically that loss or low expression of CPT1A confers radioresistance in CRC. This makes the findings important given that they oppose the previously proposed tumorigenic function of CPT1A. However, the data presented in the manuscript is limited in scope and analysis.

Major Limitations:

(1) Analysis of Patient Samples

- Figure 1D shows that CPT1A levels are significantly lower in COAD and READ compared to normal tissues. It would be beneficial to show whether CPT1A levels are also significantly lower in CRC compared to other tumor types using TCGA data.<br /> - The analysis should include a comparison of closely related CPT1 isoforms (CPT1B and CPT1C) to emphasize the specific importance of CPT1A silencing in CRC.<br /> - Figure 2 lacks a clear description of how IHC scores were determined and the criteria used to categorize patients into CPT1A-high and CPT1A-low groups. This should be detailed in the text and figure legend.<br /> - None of Figure 2B or 2C show how many patients were assigned to the CPT1A-low and CPT1A-high groups.

(2) Model Selection and Experimental Approaches

- The authors primarily use CPT1A knockout (KO) HCT116 cells and CPT1A overexpression (OE) SW480 cells for their experiments, which poses major limitations.<br /> - The genetic backgrounds of the cell lines (e.g., HCT116 being microsatellite instable (MSI) and SW480 not) should be considered as they might influence treatment outcomes. This should be acknowledged as a major limitation.<br /> - Regardless of their CPT1A expression levels, for the experiments with HCT116 and SW480 cells in Figure 3C-F, it would be useful to see whether HCT116 cells can be further sensitized to radiotherapy in overexpression and whether SW480 cells can be desensitized through CPT1A KO.<br /> - The use of only two CRC cell lines is insufficient to draw broad conclusions. Additional CRC cell lines should be used to validate the findings and account for genetic heterogeneity. The authors should repeat key experiments with additional CRC cell lines to strengthen their conclusions.

(3) Pharmacological Inhibition

Several studies have reported beneficial outcomes of using CPT1 pharmacological inhibition to limit cancer progression (e.g., PMID: 33528867, PMID: 32198139), including its application in sensitization to radiation therapy (PMID: 30175155). Since the authors argue for the opposite case in CRC, they should show this through pharmacological means such as etomoxir and whether CPT1A inhibition phenocopies their observed genetic KO effect, which would have important implications for using this inhibitor in CRC patients.

(4) Data Representation and Statistical Analysis

- The relative mRNA expression levels across the seven cell lines (Supplementary Figure 1C) differ greatly from those reported in the DepMap (https://depmap.org/portal/). This discrepancy should be addressed.<br /> - The statistical significance of differences in mRNA and protein levels between RT-sensitive and RT-resistant cells should be shown (Supplementary Figure 1C, D).

Conclusion

The study offers significant insights into the role of CPT1A in CRC radioresistance, proposing a tumor-suppressive function. However, the scope and depth of the analysis need to be expanded to fully validate these claims. Additional CRC cell lines, pharmacological inhibition studies, and a more detailed analysis of patient samples are essential to strengthen the conclusions.

Reviewer #3 (Public Review):

Summary:

The study aims to elucidate the role of CPT1A in developing resistance to radiotherapy in colorectal cancer (CRC). The manuscript is a collection of assays and analyses to identify the mechanism by which CPT1A leads to treatment resistance through increased expression of ROS-scavenging genes facilitated by FOXM1 and provides an argument to counter this role, leading to a reversal of treatment resistance.

Strengths:

The article is well written with sound scientific methodology and results. The assays performed are well within the scope of the hypothesis of the study and provide ample evidence for the role of CPT1A in the development of treatment resistance in colorectal cancer. While providing compelling evidence for their argument, the authors have also rightfully provided limitations of their work.

Weaknesses:

The primary weakness of the study is acknowledged by the authors at the end of the Discussion section of the manuscript. The work heavily relies on bioinformatics and in vitro work with little backing of in vivo and patient data. In terms of animal studies, it is to be noted that the model they have used is nude mice with non-orthotopic, subcutaneous xenograft, which may not be the best recreation of the patient tumor.

Reviewer #1 (Public Review):

In this paper, the authors provide data to support the existence of a regulatory pathway starting with SPI1-driven ZFP36L1 expression, that goes on to downregulate HDAC3 expression at the transcript level, leading to PD-L1 upregulation due to implied enhanced acetylation of its promoter region. This is therefore an interesting pathway that adds to our understanding of how PD-L1 expression is controlled in gastric cancer. However, this is likely one of many possible pathways that impact PD-L1 expression, which is likely equally important. Thus, while potentially interesting, this is more additive information to the literature rather than a fundamentally new concept/finding.

Overall, there are many experiments presented, which appear to be of good quality, however, there are a number of issues with this that need attention. Moreover, the text is often difficult to follow, partly due to the standard of English, but mainly due to the sparsity of detail in the results section and figure legends. Thus providing an overall assessment of data conclusiveness is not possible at this time. This is exacerbated by frequently extrapolating conclusions beyond what is actually shown in an individual experiment.

Major issues:

(1) All the figure legends need to expand significantly, so it is clear what is being presented. All experiments showing data quantification need the numbers of independent biological replicates to be added, plus an indication of what the P-values are associated with the asterisks (and the tests used).

(2) Related to point 1, the description of the data in the text needs to expand significantly, so the figure panels are interpretable. Examples are given below but this is not an exhaustive list.

(3) The addition of "super-enhancer-driven" to the title is a distraction. This is the starting point but the finding is portrayed by the last part of the title. Moreover, it is not clear why this is a super enhancer rather than just a typical enhancer as only one seems to be relevant and functional. I suggest avoiding this term after initial characterisations.

(4) The descriptions of Figures 1B, C, and D are very poor. How for example do you go from nearly 2000 SE peaks to a couple of hundred target genes? What are the other 90% doing? What is the definition of a target gene? This whole start section needs a complete overhaul to make it understandable and this is important as is what leads us to ZFP36L1 in the first place.

(5) It is impossible to work out what Figures 1F, H, and I are from the accompanying text. The same applies to supplementary Figure S1D. Figure 1G is not described in the results.

(6) What is Figure 2A? There is no axis label or description.

(7) Why is CD274 discussed in the text from Figure 2E but none of the other genes? The rationale needs expanding.

(8) Figure 2G needs zooming in more over the putative SE region and the two enhancers labelling. This looks very strange at the moment and does not show typical peak shapes for histone acetylation at enhancers.

(9) The use of JQ1 does not prove something is a super enhancer, just that it is BRD4 regulated and might be a typical enhancer.

(10) An explanation of how the motifs were identified in E1 is needed. Enrichment over what? Were they purposefully looking for multiple motifs per enhancer? Otherwise what it all comes down to later in the figure is a single motif, and how can that be "enriched"?

(11) A major missing experiment is to deplete rather than over-express SPI1 for the various assays in Figure 4.

(12) The authors start jumping around cell lines, sometimes with little justification. Why is MGC803 used in Figure 4I rather than MKN45? This might be due to more endogenous SPI1. However, this does not make sense in Figure 5M, where ZFP36L is overexpressed in this line rather than MKN45. If SPI1 is already high in MGC803, then the prediction is that ZFP36L1 should already be high. Is this the case?

(13) In Figure 5, HDAC3 should also be depleted to show opposite effects to over-expression (as the latter could be artefactual). Also, direct involvement should be proven by ChIP.

(14) Figure 5G and H are not discussed in the text.

(15) Figure 6C needs explaining. Why are three patients selected here? Are these supposed to be illustrative of the whole cohort? What sub-type of GC are these?

(16) In Figure 6E onwards, they switch to MFC cell line. They provide a rationale but the key regulatory axis should be sown to also be operational in these cells to use this as a model system.

Reviewer #2 (Public Review):

Summary:

This manuscript by Wei et al studies the role of ZFP36L1, an RNA-binding protein, in promoting PD-L1 expression in gastric cancer (GC). They used human gastric cancer tissues from six patients and performed H3K27ac CUT&Tag to unbiasedly identify SE specific for the infiltrative type. They identified an SE driving the expression of ZFP36L1 and immune evasion through upregulation of PD-L1. Mechanistically, they show that SPI1 binds to ZFP36L1-SE and ZFP36L1 in turn regulates PD-L1 expression through modulation of the 3'UTR of HDAC3. This mechanism of PD-L1 regulation in gastric cancer is novel, and ZFP36L1 has not been previously implicated in GC progression. However, the data presented are largely correlations and no direct proof is presented that the identified SE regulates ZFP36L1 expression. Furthermore, the effect of ZFP36L1 manipulation elicited a modest effect on PDL1 expression. In fact, several cell lines (XGC1, MNK45) express abundant ZFP36L1 but no PD-L1, suggesting the ZFP36L1 per se is not a key stimulant of PD-L1 expression as IFNg is. Thus, the central conclusions are not supported by the data.

Strengths:

Use of human GC specimens to identify SE regulating PD-L1 expression and immune evasion.

Weaknesses:

Major comments:

(1) The difference in H3K27ac over the ZFP36L1 locus and SE between the expanding and infiltrative GC is marginal (Figure 2G). Although the authors establish that ZFP36L1 is upregulated in GC, particularly in the infiltrative subtype, no direct proof is provided that the identified SE is the source of this observation. CRISPR-Cas9 should be employed to delete the identified SE to prove that it is causatively linked to the expression of ZFP36L1.

(2) In Figure 3C the impact of shZFP36L1 on PD-L1 expression is marginal and it is observed in the context of IFNg stimulation. Moreover, in XGC-1 cell line the shZFP36L1 failed to knock down protein expression thus the small decrease in PD-L1 level is likely independent of ZFP36L1. The same is the case in Figure 3D where forced expression of ZFP36L1 does not upregulate the expression of PDL1 and even in the context of IFNg stimulation the effect is marginal.

(3) In Figure 4, it is unclear why ELF1 and E2F1 that bind ZFP36L1-SE do not upregulate its expression and only SPI1 does. In Figure 4D the impact of SPI overexpression on ZFP36L1 in MKN45 cells is marginal. Likewise, the forced expression of SPI did not upregulate PD-L1 which contradicts the model. Only in the context of IFNg PD-L1 is expressed suggesting that whatever role, if any, ZFP36L1-SPI1 axis plays is secondary.

(4) The data presented in Figure 6 are not convincing. First, there is no difference in the tumor growth (Figure 6E). IHC in Figure 6I for CD8a is misleading. Can the authors provide insets to point CD8a cells? This figure also needs quantification and review from a pathologist.

Reviewer #1 (Public Review):<br /> The manuscript by Lucie Oriol et al. revisits the understanding of interneurons in the ventral tegmental area (VTA). The study challenges the traditional notion that VTA interneurons exclusively form local synapses within the VTA. Key findings of the study indicate that VTA GABA and glutamate projection neurons also make local synapses within the VTA. This evidence suggests that functions previously attributed to VTA interneurons could be mediated by these projection neurons.

The study tested four genetic markers-Parvalbumin (PV), Somatostatin (SST), Mu-opioid receptor (MOR), and Neurotensin (NTS)-to determine if they selectively label VTA interneurons. The findings indicate that these markers label VTA projection neurons rather than selectively identifying interneurons. Using a combination of anatomical tracing and brain slice physiological recordings, the study demonstrates that VTA projection neurons make functional inhibitory or excitatory synapses locally within the VTA. These data challenge the conventional view that VTA GABA neurons are purely interneurons and suggest that inhibitory projection neurons can serve functions previously attributed to VTA interneurons. Thus, some functions traditionally ascribed to interneurons may be carried out by projection neurons with local synapses. This has significant implications for understanding the neural circuits underlying reward, motivation, and addiction.

Reviewer #2 (Public Review):

Summary:

In this manuscript, the authors use a combination of transgenic animals, intersectional viruses, retrograde tracing, and ex-vivo slice electrophysiology to show that VTA projection neurons synapse locally. First, the authors injected a cre-dependent channelrhodopsin into the VTA of PV, SST, MOR, and NTS-Cre mice. Importantly, PV, SST, MOR, and NTS are molecular markers previously used to describe VTA interneurons. Imaging of known VTA target regions identified that these neurons are not localized to the VTA and instead project to the PFC, NAc, VP, and LHb. Next, the authors used an intersectional viral strategy to label projection neurons with both GFP (membrane localized) and Syn:Ruby (release sites). These experiments identified that VTA projection neurons also make intra-VTA synapses. Finally, the authors use a combination of optogenetics and ex-vivo slice electrophysiology to show that neurons projecting from the VTA to the NAc/VP/PFC also synapse locally. Overall, most of the conclusions seem to be well supported by the data.

Strengths:

Previous literature has described Pvalb, Sst, Oprm1, and Nts as selective markers of VTA interneurons. Here, the authors make use of cre driver lines to show that neurons defined by these genes are not interneurons and project to known VTA target regions. Additionally, the authors convincingly use intersectional viral approaches and slice electrophysiology to show that projection neurons synapse onto neighboring cells within the VTA

Weaknesses:

While the authors use several cre driver lines to identify GABAergic projection neurons, they then use wild-type mice to show that projection neurons synapse onto neighboring cells within the VTA. This does not seem to lend evidence to the idea that previously described "interneurons" are projection neurons that collateralize within the VTA.

Reviewer #3 (Public Review):

Summary:

This study from Oriol et al. first uses transgenic animals to examine projection targets of specific subtypes of VTA GABA neurons (expressing PV, SST, MOR, or NTS). They follow this with a set of optogenetic experiments showing that VTA projection neurons (regardless of genetic subtype) make local functional connections within the VTA itself. Both of these findings are important advances in the field. Notably, both GABAergic and glutamatergic neurons in the VTA likely exhibit these combined long/short-range projections.

Strengths:

The main strength of this study is the series of optogenetic/electrophysiological experiments that provide detailed circuit connectivity of VTA neurons. The long-range projections to the VP (but not other targets) are also verified to have functional excitatory and inhibitory components. Overall, the experiments are well executed and the results are very relevant in light of the rapidly growing knowledge about the complexity and heterogeneity of VTA circuitry.

Another strength of this study is the well-written and thoughtful discussion regarding the current findings in the context of the long-standing question of whether the VTA does or does not have true interneurons.

Weaknesses:

This study has a few modest shortcomings, of which the first is likely addressable with the authors' existing data, while the latter items will likely need to be deferred to future studies:

(1) Some key anatomical details are difficult to discern from the images shown. In Figure 1, the low-magnification images of the VTA in the first column, while essential for seeing what overall section is being shown, are not of sufficient resolution to distinguish soma from processes. A supplemental figure with higher-resolution images could be helpful. Also, where are the insets shown in the second column obtained from? There is not a corresponding marked region on the low-magnification images. Is this an oversight, or are these insets obtained from other sections that are not shown? Lastly, there is a supplemental figure showing the NAc injection sites corresponding to Figure 5, but not one showing VP or PFC injection sites in Figure 6. Why not?

(2) Because multiple ChR2 neurons are activated in the optogenetic experiments, it is not clear how common is it for any specific projection neuron to make local connections. Are the observed synaptic effects driven by just a few neurons making extensive local collateralizations (while other projection neurons do not), or do most VTA projection neurons have local collaterals? I realize this is a complex question, that may not have an easy answer.

(3) There is something of a conceptual disconnect between the early and later portions of this paper. Whereas Figures 1-4 examine forebrain projections of genetic subtypes of VTA neurons, the optogenetic studies do not address genetic subtypes at all. I do realize that is outside of the scope of the author's intent, but it does give the impression of somewhat different (but related) studies being stitched together. For example, the MOR-expressing neurons seem to project strongly to the VP, but it is not addressed whether these are also the ones making local projections. Also, after showing that PV neurons project to the LHb, the opto experiments do not examine the LHb projection target at all.

Reviewer #1 (Public Review):

In this study, Franke et al. explore and characterize color response properties across primary visual cortex, revealing specific color opponent encoding strategies across the visual field. The authors use awake 2P imaging to define the spectral response properties of visual interneurons in layer 2/3. They find that opponent responses are more pronounced at photopic light levels, and that diversity in color opponent responses exists across the visual field, with green ON/ UV OFF responses more strongly represented in the upper visual field. This is argued to be relevant for the detection of certain features that are more salient when using chromatic space, possibly due to noise reduction. In the revised version, Franke et al. have addressed the potential pitfalls in the discussion, which is an important point for the non-expert reader. Thus, this study provides a solid characterization of the color properties of V1 and is a valuable addition to visual neuroscience research.

Reviewer #2 (Public Review):

Summary:

Franke et al. characterize the representation of color in the primary visual cortex of mice, highlighting how this changes across the visual field. Using calcium imaging in awake, head-fixed mice, they characterize the properties of V1 neurons (layer 2/3) using a large center-surround stimulation where green and ultra-violet colors were presented in random combinations. Clustering of responses revealed a set of functional cell-types based on their preference to different combinations of green and UV in their center and surround. These functional types were demonstrated to have different spatial distributions across V1, including one neuronal type (Green-ON/UV-OFF) that was much more prominent in the posterior V1 (i.e. upper visual field). Modelling work suggests that these neurons likely support the detection of predator-like objects in the sky.

Strengths:

The large-scale single-cell resolution imaging used in this work allows the authors to map the responses of individual neurons across large regions of the visual cortex. Combining this large dataset with clustering analysis enabled the authors to group V1 neurons into distinct functional cell types and demonstrate their relative distribution in the upper and lower visual fields. Modelling work demonstrated the different capacity of each functional type to detect objects in the sky, providing insight into the ethological relevance of color opponent neurons in V1.

Weaknesses:

It is unfortunate the authors were unable to provide stronger mechanistic insights into how color opponent neurons in V1 are formed.

Overall, this study will be a valuable resource for researchers studying color vision, cortical processing, and the processing of ethologically relevant information. It provides a useful basis for future work on the origin of color opponency in V1 and its ethological relevance.

Reviewer #3 (Public Review):

This paper improves our understanding of the coding of chromatic signals in mouse visual cortex. Calcium responses of a large collection of cells are measured in response to a simple spot stimulus. These responses are used to estimate chromatic tuning properties - specifically sensitivity to UV and green stimuli presented in a large central spot or a larger still surrounding region. Cells are divided based on their responses to these stimuli into luminance or chromatic sensitive groups.

The paper has improved substantially in revisions and makes an important contribution to how color is coded in mouse V1. The revisions have nicely clarified a few limitations of the current study, and that serves to emphasize the strengths of the data and clear conclusions that can be drawn from it.

Reviewer #3 (Public Review):

Summary:<br /> Animals can evaluate food quality in many ways. In contrast to the rapid sensory evaluation with smell and taste, the mechanism of slow nutrient sensation and its impact on food choice is unexplored. The authors utilize C. elegans larvae and their bacterial food as an elegant model to tackle this question and reveal the detailed molecular mechanism to avoid nutrient-poor foods.

Strength:<br /> The strength of this study is that they identified the molecular identities of the critical players in bacterial food and C. elegans using unbiased approaches, namely metabolome analysis, E. coli mutant screening, and RNA sequencing. Furthermore, they strengthened their findings by thorough experiments combining multiple methods such as genetics, fluorescent reporter analysis, and Western blot.

Weakness:<br /> The major caveat of this study is the reporter genes; specifically, transcriptional reporters used to monitor the UPRER and immune responses in the intestine of C. elegans. However, their tissue-specific rescue experiments suggest that the genes in the UPRER and immune response function in the neurons. Thus, we should carefully interpret the results of the reporter genes. Another point to be aware of is that although they show that lack of carbohydrates elicits the response to "low-quality" food, carbohydrate supplementation with heat-killed E. coli was insufficient to support animal growth.

Overall, this work provides convincing data to support their model. In the C. elegans field, the behaviors of larvae are not well studied compared to adults. This work will pose an interesting question about the difference between larvae and adults in nutrition sensing in C. elegans and provide a framework and candidate molecules to be studied in other organisms.

Reviewer #2 (Public Review):

Summary:<br /> In this work, the authors aim to better understand how C. elegans detects and responds to heat-killed (HK) E. coli, a low-quality food. They find that HK food activates two canonical stress pathways, ER-UPR and innate immunity, in the nervous system to promote food aversion. Through the creative use of E. coli genetics and metabolomics, the authors provide evidence that the altered carbohydrate content of HK food is the trigger for the activation of these stress responses and that supplementation of HK food with sugars (or their biosynthetic product, vitamin C), reduces stress pathway induction and food avoidance. This work makes a valuable addition to the literature on metabolite detection as a mechanism for evaluation of nutritional value; it also provides some new insight into physiologically relevant roles of well-known stress pathways in modulating behavior.

Strengths:<br /> -The work addresses an important question by focusing on understanding how the nervous system evaluates food quality and couples this to behavioral change.<br /> -The work takes full advantage of the tools available in this powerful system and builds on extensive previous studies on feeding behavior and stress responses in C. elegans.<br /> -Creative use of E. coli genetics and metabolite profiling enabled identification of carbohydrate metabolism as a candidate source of food-quality signals.<br /> -For the most part, the studies are rigorous and logically designed, providing good support for the authors' model.

Weaknesses:<br /> -The authors' claim that they can detect induction of hsp-4 and irg-5 expression in neurons (Fig 1-S2A) requires further support. The two tail cells shown are quite a bit larger than would by typically expected for neurons. The rescue they observe by neuronal expression is largely convincing, so it's quite possible that these pathways do indeed function in neurons, but that their level of induction in the nervous system is below reporter detection limits (or is 'swamped out' by much higher levels of expression in the intestine).<br /> -The authors conclude that "the induction of Pirg-5::GFP was abolished in pmk-1 knockdown animals fed with HK-E. coli" (Fig 2D). Because a negative control for induction (e.g., animals fed with control E. coli) is not shown, this conclusion must be regarded as tentative.<br /> -The effect sizes in the food-preference assay shown in Figure 5 are extremely small and do not provide strong support for the strong conclusions about the role of stress response pathways in food preference behavior.

Summary:

This paper studies the genetic factors contributing to childhood obesity. Through a comprehensive analysis integrating genome-wide association study (GWAS) data with 3D genomic datasets across 57 human cell types, consisting of Capture-C/Hi-C, ATAC-seq, and RNA-seq, the study identifies significant genetic contributions to obesity using stratified LD score regression, emphasizing the enrichment of genetic signals in pancreatic alpha cells and identification of significant effector genes at obesity-associated loci such as BDNF, ADCY3, TMEM18, and FTO. Additionally, the study implicated ALKAL2, a gene responsive to inflammation in nerve nociceptors, as a novel effector gene at the TMEM18 locus. This suggests a role for inflammatory and neurological pathways in obesity's pathogenesis which was supported through colocalization analysis using eQTL derived from the GTEx dataset. This comprehensive genomic analysis sheds light on the complex genetic architecture of childhood obesity, highlighting the importance of cellular context for future research and the development of more effective strategies.

Strengths:

Overall, the paper has several strengths, including leveraging large-scale, multi-modal datasets, using computational reasonable tools, and having an in-depth discussion of the significant results.

Weaknesses:

(1) The results are somewhat inconclusive or not validated.

The overall results are carefully designed, but most of the results are descriptive. While the authors are able to find additional evidence either from the literature or explain the results with their existing knowledge, none of the results have been biologically validated. Especially, the last three result sections (signaling pathways, eQTLs, and TF binding) further extended their findings, but the authors did not put the major results into any of the figures in the main text.

(2) Some technical details are missing.

While the authors described all of their analysis steps, a lot of the time, they did not mention the motivation. Sometimes, the details were also omitted. For example:

- The manuscript would benefit from a detailed explanation of the methods used to define cREs, particularly the process of intersecting OCRs with chromatin conformation data. The current description does not fully clarify how the cREs are defined.

- How did the authors define a contact region?

- The manuscript would benefit from an explanation regarding the rationale behind the selection of the 57 human cell types analyzed. it is essential to clarify whether these cell types have unique functions or relevance to childhood development and obesity.

- I wonder whether the used epigenome datasets are all from children. Although the authors use literature to support that body weight and obesity remain stable from infancy to adulthood, it remains uncertain whether epigenomic data from other life stages might overlook significant genetic variants that uniquely contribute to childhood obesity.

- Given that the GTEx tissue samples are derived from adult donors, there appears to be a mismatch with the study's focus on childhood obesity. If possible, identifying alternative validation strategies or datasets more closely related to the pediatric population could strengthen the study's findings.

(3) The writing needs to improve.

Reviewer #1 (Public Review):

Based on previous publications suggesting a potential role for miR-26b in the pathogenesis of metabolic dysfunction-associated steatohepatitis (MASH), the researchers aim to clarify its function in hepatic health and explore the therapeutical potential of lipid nanoparticles (LNPs) to treat this condition. First, they employed both whole-body and myeloid cell-specific miR-26b KO mice and observed elevated hepatic steatosis features in these mice compared to WT controls when subjected to WTD. Moreover, livers from whole-body miR-26b KO mice also displayed increased levels of inflammation and fibrosis markers. Kinase activity profiling analyses revealed distinct alterations, particularly in kinases associated with inflammatory pathways, in these samples. Treatment with LNPs containing miR-26b mimics restored lipid metabolism and kinase activity in these animals. Finally, similar anti-inflammatory effects were observed in the livers of individuals with cirrhosis, whereas elevated miR-26b levels were found in the plasma of these patients in comparison with healthy control. Overall, the authors conclude that miR-26b plays a protective role in MASH and that its delivery via LNPs efficiently mitigates MASH development.

The study has some strengths, most notably, its employ of a combination of animal models, analyses of potential underlying mechanisms, as well as innovative treatment delivery methods with significant promise. However, it also presents numerous weaknesses that leave the research work somewhat incomplete. The precise role of miR-26b in a human context remains elusive, hindering direct translation to clinical practice. Additionally, the evaluation of the kinase activity, although innovative, does not provide a clear molecular mechanisms-based explanation behind the protective role of this miRNA.

Therefore, to fortify the solidity of their conclusions, these concerns require careful attention and resolution. Once these issues are comprehensively addressed, the study stands to make a significant impact on the field.

Reviewer #2 (Public Review):

Summary:

This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

Strengths:

The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

Weaknesses:

Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

(1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

(2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

(3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

(4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

(5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

(6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

(7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

Reviewer #1 (Public Review):

The manuscript by Li et al. investigates the metabolism-independent role of nuclear IDH1 in chromatin state reprogramming during erythropoiesis. The authors describe accumulation and redistribution of histone H3K79me3, and downregulation of SIRT1, as a cause for dyserythropoiesis observed due to IDH1 deficiency. The authors studied the consequences of IDH1 knockdown, and targeted knockout of nuclear IDH1, in normal human erythroid cells derived from hematopoietic stem and progenitor cells and HUDEP2 cells respectively. They further correlate some of the observations such as nuclear localization of IDH1 and aberrant localization of histone modifications in MDS and AML patient samples harboring IDH1 mutations. These observations are intriguing from a mechanistic perspective and they hold therapeutic significance, however there are major concerns that make the inferences presented in the manuscript less convincing.

(1) The authors show the presence of nuclear IDH1 both by cell fractionation and IF, and employ an efficient strategy to knock out nuclear IDH1 (knockout IDH1/ Sg-IDH1 and rescue with the NES tagged IDH1/ Sg-NES-IDH1 that does not enter the nucleus) in HUDEP2 cells. However, some important controls are missing.<br /> A) In Figure 3C, for IDH1 staining, Sg-IDH1 knockout control is missing.<br /> B) Wild-type IDH1 rescue control (ie., IDH1 without NES tag) is missing to gauge the maximum rescue that is possible with this system.

(2) Considering the nuclear knockout of IDH1 (Sg-NES-IDH1 referenced in the previous point) is a key experimental system that the authors have employed to delineate non-metabolic functions of IDH1 in human erythropoiesis, some critical experiments are lacking to make convincing inferences.<br /> A) The authors rely on IF to show the nuclear deletion of Sg-NES-IDH1 HUDEP2 cells. As mentioned earlier since a knockout control is missing in IF experiments, a cellular fractionation experiment (similar to what is shown in Figure 2F) is required to convincingly show the nuclear deletion in these cells.<br /> B) Since the authors attribute nuclear localization to a lack of metabolic/enzymatic functions, it is important to show the status of ROS and alpha-KG in the Sg-NES-IDH1 in comparison to control, wild type rescue, and knockout HUDEP2 cells. The authors observe an increase of ROS and a decrease of alpha-KG upon IDH1 knockdown. If nuclear IDH1 is not involved in metabolic functions, is there only a minimal or no impact of the nuclear knockout of IDH1 on ROS and alpha-KG, in comparison to complete knockout? These studies are lacking.<br /> C) Authors show that later stages of terminal differentiation are impacted in IDH1 knockdown human erythroid cells. They also report abnormal nuclear morphology, an increase in euchromatin, and enucleation defects. However, the authors only report abnormal nuclear morphology in Sg-NES-IDH1 cells, as evaluated by cytospins. It is important to show the status of the other phenotypes (progression through terminal differentiation, euchromatin %, and enucleation) similar to the quantitations in the IDH1 knockdown cells.

(3) The authors report abnormal nuclear phenotype in IDH1 deficient erythroid cells. It is not clear what parameters are used here to define and quantify abnormal nuclei. Based on the cytospins (eg., Figure 1A, 3D) many multinucleated cells are seen in both shIDH1 and Sg-NES-IDH1 erythroid cells, compared to control cells. Importantly, this phenotype and enucleation defects are not rescued by the administration of alpha-KG (Figures 1E, F). The authors study these nuclei with electron microscopy and report increased euchromatin in Figure 4B. However, there is no discussion or quantification of polyploidy/multinucleation in the IDH1 deficient cells, despite their increased presence in the cytospins.

A) PI staining followed by cell cycle FACS will be helpful in gauging the extent of polyploidy in IDH1 deficient cells and could add to the discussions of the defects related to abnormal nuclei.<br /> B) For electron microscopy quantification in Figures 4B and C, how the quantification was done and the labelling of the y-axis (% of euchromatin and heterochromatin) in Figure 4 C is not clear and is confusingly presented. The details on how the quantification was done and a clear label (y-axis in Figure 4C) for the quantification are needed.<br /> C) As mentioned earlier, what parameters were used to define and quantify abnormal nuclei (e.g. Figure 1A) needs to be discussed clearly. The red arrows in Figure 1A all point to bi/multinucleated cells. If this is the case, this needs to be made clear.

(4) The authors mention that their previous study (reference #22) showed that ROS scavengers did not rescue dyseythropoiesis in shIDH1 cells. However, in this referenced study they did report that vitamin C, a ROS scavenger, partially rescued enucleation in IDH1 deficient cells and completely suppressed abnormal nuclei in both control and IDH1 deficient cells, in addition to restoring redox homeostasis by scavenging reactive oxygen species in shIDH1 erythroid cells. In the current study, the authors used ROS scavengers GSH and NAC in shIDH1 erythroid cells and showed that they do not rescue abnormal nuclei phenotype and enucleation defects. The differences between the results in their previous study with vitamin C vs GSH and NAC in the context of IDH1 deficiency need to be discussed.

(5) The authors describe an increase in euchromatin as the consequential abnormal nuclei phenotype in shIDH1 erythroid cells. However, in their RNA-seq, they observe an almost equal number of genes that are up and down-regulated in shIDH1 cells compared to control cells. If possible, an RNA-Seq in nuclear knockout Sg-NES-IDH1 erythroid cells in comparison with knockout and wild-type cells will be helpful to tease out whether a specific absence of IDH1 in the nucleus (ie., lack of metabolic functions of IDH) impacts gene expression differently.

(6) In Figure 8, the authors show data related to SIRT1's role in mediating non-metabolic, chromatin-associated functions of IDH1.<br /> A) The authors show that SIRT1 inhibition leads to a rescue of enucleation and abnormal nuclei. However, whether this rescues the progression through the late stages of terminal differentiation and the euchromatin/heterochromatin ratio is not clear.<br /> B) In addition, since the authors attribute a role of SIRT1 in mediating non-metabolic chromatin-associated functions of IDH1, documenting ROS levels and alpha-KG is important, to compare with what they showed for shIDH1 cells.

(7) In Figure 4 and Supplemental Figure 8, the authors show the accumulation and altered cellular localization of H3K79me3, H3K9me3, and H3K27me2, and the lack of accumulation of other three histone modifications they tested (H3K4me3, H3K35me4, and H3K36me2) in shIDH1 cells. They also show the accumulation and altered localization of the specific histone marks in Sg-NES-IDH1 HUDEP2 cells.<br /> A) To aid better comparison of these histone modifications, it will be helpful to show the cell fractionation data of the three histone modifications that did not accumulate (H3K4me3, H3K35me4, and H3K36me2), similar to what was shown in Figure 4E for H3K79me3, H3K9me3, and H3K27me2).<br /> B) Further, the cell fractionation and staining for histone marks is done in human primary erythroid cells on day15 of terminal differentiation, and these studies revealed that H3K79me3, H3K9me3, and H3K27me2 were retained in the nucleus in shIDH1 cells unlike a cellular localization observed in control cells. The authors cite reference #40 in relation to the cellular localization of histones - in this study, it was shown that the cellular export of histone to cytosol happens during later stages of terminal differentiation. In the current manuscript, the authors observe nuclear IDH1 throughout erythropoiesis and have shown this at both early and late time points of differentiation (between day7 to day15 of differentiation in primary erythroid cells, between day0 to day8 in HUDEP2 cells) in Figure 2. To help correlate the dynamics of localization and to discuss the mechanism for the retention of histone marks in the nucleus in IDH1 deficient cells, it will be helpful to show the cellular location of histone marks using cell fractionations for both early and late time points in terminal erythroid differentiation, similar to what they showed for IDH1 localization studies.<br /> C) Among the three histone marks that are dysregulated in IDH1 deficient cells (H3K79me3, H3K9me3, and H3K27me2), the authors show via ChIP-seq (Fig5) that H3K79me3 is the critical factor. However, the ChIP-seq data shown here lacks many details and this makes it hard to interpret the data. For example, in Figure 5A, they do not mention which samples the data shown correspond to (are these differential peaks in shIDH1 compared to shLuc cells?). There is also no mention of how many replicates were used for the ChIP seq studies.

Reviewer #2 (Public Review):

Li and colleagues investigate the enzymatic activity-independent function of IDH1 in regulating erythropoiesis. This manuscript reveals that IDH1 deficiency in the nucleus leads to the redistribution of histone marks (especially H3K79me3) and chromatin state reprogramming. Their findings suggest a non-typical localization and function of the metabolic enzyme, providing new insights for further studies into the non-metabolic roles of metabolic enzymes. However, there are still some issues that need addressing:

(1) Could the authors show the RNA and protein expression levels (without fractionation) of IDH1 on different days throughout the human CD34+ erythroid differentiation?

(2) Even though the human CD34+ erythroid differentiation protocol was published and cited in the manuscript, it would be helpful to specify which erythroid stages correspond to cells on days 7, 9, 11, 13, and 15.

(3) It is important to mention on which day the lentiviral knockdown of IDH1 was performed. Will the phenotype differ if the knockdown is performed in early vs. late erythropoiesis? In Figures 1C and 1D, on which day do the authors begin the knockdown of IDH1 and administer NAC and GSH treatments?

(4) The authors validate that IDH1 regulates erythropoiesis in an enzymatic activity-independent manner by adding ROS scavengers or α-KG. Given the complexity of metabolic pathways, these two strategies may not suffice. Mutating the enzymatic active site could provide a clearer explanation for this point.

(5) While the cell phenotype of IDH1 deficiency is quite dramatic, yielding cells with larger nuclei and multi-nuclei, the authors only attribute this phenotype to defects in chromatin condensation. Is it possible that IDH1-knockdown cells also exhibit primary defects in mitosis/cytokinesis (not just secondary to the nuclear condensation defect)?), given the function of H3K79Me in cell cycle regulation?

(6) Why are there two bands of Histone H3 in Figure 4A?

(7) Are the density and localization of histone modifications (not just H3K79me3) in Sg-NEG-IDH1 HuDEP2 cells similar to those in IDH1-shRNA erythroid cells compared to control cells?

(8) Displaying a heatmap and profile plots in Figure 5A between control and IDH1-deficient cells will help illustrate changes in H3K79me3 density in the nucleus after IDH1 knockdown.

(9) Are the distribution and intensity of H3K79me3 in primary healthy erythroid cells in the bone marrow similar to or distinct from those in AML and MDS cells? The authors could present at least one sample of healthy donor cells for comparison.

(10) In Figure 7E, why are the bands of Luciferase-shRNA in the input and probe both light, while the bands of IDH1-shRNA are both dark? This suggests that the expression of KLF1 is much higher in IDH1-shRNA cells than in control cells. Therefore, this result may not strongly support the increased binding of KLF1 at the SIRT1 promoter after IDH1 knockdown.

Reviewer #3 (Public Review):

Li, Zhang, Wu, and colleagues describe a new role for nuclear IDH1 in erythroid differentiation independent from its enzymatic function. IDH1 depletion results in a terminal erythroid differentiation defect with polychromatic and orthochromatic erythroblasts showing abnormal nuclei, nuclear condensation defects, and an increased proportion of euchromatin, as well as enucleation defects. Using ChIP-seq for the histone modifications H3K79me3, H3K27me2, and H3K9me3, as well as ATAC-seq and RNA-seq in primary CD34-derived erythroblasts, the authors elucidate SIRT1 as a key dysregulated gene that is upregulated upon IDH1 knockdown. They furthermore show that chemical inhibition of SIRT1 partially rescues the abnormal nuclear morphology and enucleation defect during IDH1-deficient erythroid differentiation. The phenotype of delayed erythroid maturation and enucleation upon IDH1 shRNA-mediated knockdown was described in the group's previous co-authored study (PMID: 33535038). The authors' new hypothesis of an enzyme- and metabolism-independent role of IDH1 in this process is currently not supported by conclusive experimental evidence as discussed in more detail further below. On the other hand, while the dependency of IDH1 mutant cells on NAD+, as well as cell survival benefit upon SIRT1 inhibition, has already been shown (see, e.g, PMID: 26678339, PMID: 32710757), previous studies focused on cancer cell lines and did not look at a developmental differentiation process, which makes this study interesting.

(1) The central hypothesis that IDH1 has a role independent of its enzymatic function is interesting but not supported by the experiments. One of the author's supporting arguments for their claim is that alpha-ketoglutarate (aKG) does not rescue the IDH1 phenotype of reduced enucleation. However, in the group's previous co-authored study (PMID: 33535038), they show that when IDH1 is knocked down, the addition of aKG even exacerbates the reduced enucleation phenotype, which could indicate that aKG catalysis by cytoplasmic IDH1 enzyme is important during terminal erythroid differentiation. A definitive experiment to test the requirement of IDH1's enzymatic function in erythropoiesis would be to knock down/out IDH1 and re-express an IDH1 catalytic site mutant. The authors perform an interesting genetic manipulation in HUDEP-2 cells to address a nucleus-specific role of IDH1 through CRISPR/Cas-mediated IDH1 knockout followed by overexpression of an IDH1 construct containing a nuclear export signal. However, this system is only used to show nuclear abnormalities and (not quantified) accumulation of H3K79me3 upon nuclear exclusion of IDH1. Otherwise, a global IDH1 shRNA knockdown approach is employed, which will affect both forms of IDH1, cytoplasmic and nuclear. In this system and even the NES-IDH1 system, an enzymatic role of IDH1 cannot be excluded because (1) shRNA selection takes several days, prohibiting the assessment of direct effects of IDH1 loss of function (only a degron approach could address this if IDH1's half-life is short), and (2) metabolic activity of this part of the TCA cycle in the nucleus has recently been demonstrated (PMID: 36044572), and thus even a nuclear role of IDH1 could be linked to its enzymatic function, which makes it a challenging task to separate two functions if they exist.

(2) It is not clear how the enrichment of H3K9me3, a prominent marker of heterochromatin, upon IDH1 knockdown in the primary erythroid culture (Figure 4), goes along with a 2-3-fold increase in euchromatin. Furthermore, in the immunofluorescence (IF) experiments presented in Figure 4Db, it seems that H3K9me3 levels decrease in intensity (the signal seems more diffuse), which seems to contrast the ChIP-seq data. It would be interesting to test for localization of other heterochromatin marks such as HP1gamma. As a related point, it is not clear at what stage of erythroid differentiation the ATAC-seq was performed upon luciferase- and IDH1-shRNA-mediated knockdown shown in Figure 6. If it was done at a similar stage (Day 15) as the electron microscopy in Figure 4B, then the authors should explain the discrepancy between the vast increase in euchromatin and the rather small increase in ATAC-seq signal upon IDH1 knockdown.

(3) The subcellular localization of IDH1, in particular its presence on chromatin, is not convincing in light of histone H3 being enriched in the cytoplasm on the same Western blot. H3 would be expected to be mostly localized to the chromatin fraction (see, e.g., PMID: 31408165 that the authors cite). The same issue is seen in Figure 4A.

(4) This manuscript will highly benefit from more precise and complete explanations of the experiments performed, the material and methods used, and the results presented. At times, the wording is confusing. As an example, one of the "Key points" is described as "Dyserythropoiesis is caused by downregulation of SIRT1 induced by H3K79me3 accumulation." It should probably read "upregulation of SIRT1".

Reviewer #1 (Public Review):

Summary:

The authors applied a domain adaptation method using the principal of optimal transport (OT) to superimpose read count data onto each other. While the title suggests that the presented method is independent from and performs better than other methods of bias correction, the presented work uses a self-implemented version of GC bias correction apart of the OT domain adaptation. Performance comparisons were done both on normalized read counts as well as on copy number profiles which is already the complete set of presented use cases. Results involving copy number profiles from iChorCNA were also subjected to the bias correction measures implemented there. It is not clear at many points which correction method actually causes the observed performance.

Strengths:

The quality of superimposing distributions of normalized read counts (and copy number profiles) was sufficiently shown using uniformly distributed p-values in the interval of 0 to 1 for healthy controls D7 and D8 which differed in the choice of library preparation kit.

The ability to select a sample from the source domain for samples in the target domain was demonstrated.

Weaknesses:

Experiment Design:

The chosen bias correction methods are not explicitly designed for nor aimed at domain adaptation. The benchmark against GC bias correction while doing GC bias correction during the OT procedure is probably the most striking flaw of the entire work. GC bias correction has the purpose of correction GC biases, wherever present, NOT correcting categorical pre-analytical variables of undefined character. A more thorough examination of the presented results should address why plain iChor CNA is the best performing "domain adaptation" in some cases. Also, the extent to which the implemented GC bias correction is contributing to the performance increase independent of the OT procedure should be assessed separately in each case.<br /> Moreover, the center-and-scale standardization is probably not the most relevant contestant in domain adaptation that is out there.

Comparison of cohorts (domains) - especially healthy from D7 and D8 - it is not described which type of ChIP analysis was done for the healthy controls of the D7 domain. The utilized library preparation kit implies that D7 represents a subset of available cfDNA in a plasma sample by precipitating only certain cfDNA fragments to which undisclosed type of protein was bound. Even if the type of protein turns out to be histones, the extracted subset of cfDNA should not be regarded as coming from the same distribution of cfNDAs. For example, fragments with sub-mononucleosomal length would be depleted in the ChIP-seq data set while these could be extracted in an untargeted cfDNA sequencing data set. It needs to be clarified why the authors deem D7 and D8 healthy controls to be identical with regards to SCNA analysis. Best start with the protein targets of D7 ChIP-seq samples.

From the Illumina TruSeq ChIP product description page:<br /> "TruSeq ChIP Libary Preparation Kits provide a simple, cost-effective solution for generating chromatin immunoprecipitation sequencing (ChIP-Seq) libraries from ChIP-derived DNA. ChIP-seq leverages next-generation sequencing (NGS) to quickly and efficiently determine the distribution and abundance of DNA-bound protein targets of interest across the genome."

Redundancy:

Some parts throughout the results and discussion part reappear in the methods. The description of the methodology should be concentrated in the method section and only reiterated in a summarizing fashion where absolutely necessary.<br /> Unnecessary repetition inflate the presented work which is not appealing to the reader. Rather include more details of the utilized materials and methods in the corresponding section.

Transparency:

At the time point of review, the code was not available under the provided link.<br /> A part of the healthy controls from D8 is not contained under the provided accession (367 healthy samples are available in the data base vs. sum of D7 and D8 healthy controls is 499)

Neither in the paper nor in reference 4 is an explanation of what was targeted with the ChIP-seq approach.

Consistency:

It is not evident why a ChIP-seq library prep kit was used (sample cohorts designated as D7). The DNA isolation procedure was not presented as having an immunoprecipitation step. Furthermore, it is not clear which DNA bound proteins were targeted during ChIP seq, if such an immunoprecipitation was actually carried out.The authors self-implemented a GC bias correction procedure although they already mentioned other procedures earlier like LIQUORICE. Also, there already exist tools that can be used to correct GC bias, like deepTools (github.com/deeptools/deepTools). Other GC bias correction algorithms designed specifically for cfDNA would be Griffin (github.com/adoebley/Griffin) and GCparagon (github.com/BGSpiegl/GCparagon). When benchmarking against state-of-the-art cfDNA GC bias correction, these algorithms should appear in a relevant scientific work, somewhere other than the introduction, preferably in the results section. It should be shown that the chosen GC bias correction method is performing best under the given circumstances.

Accuracy:

Use clear labels for each group of samples. The domain number is not sufficient to effectively distinguish sample groups. Already the source name plus a simple enumeration would improve the clarity at some points.

The healthy controls of D7 and D8 are described but the numbers do not add up (257 healthy controls in line 227 vs. 260 healthy controls in line 389). Please double check this and use representative sample cohort labels in the materials description for improved clarity!

Avoid statements like "the rest" when talking about a mixed set of samples. It is not clear how many samples from which domain are addressed.

For optimal transport, knowledge about the destination is required ("where do I want to transport to?") and, thus, the proposed method can never be unsupervised. It is always necessary to know the label of both the source and target domains. In practice, this is not often the case and users might fall prey to the error of superimposing data that is actually separated by valid differences in some experimental variables.

Seemingly arbitrary cutoff values are mentioned. For example, it is not clear if choosing "the cutoff that produced the highest MCCs" is meant across methods or for each method separately (are the results for each method reported that also resulted in the highest MCC for that method?).

The Euclidean metric for assessing the similarity of (normalized) read counts is questionable for a high dimensional space: read counts are assessed for 1 Mb genomic intervals which yields around 3000 intervals (dimensions), depending on the number of excluded intervals (which was not described in more detail). There might be more appropriate measures in this high dimensional space.

It is sometimes not clear what data actually is presented. An example would be the caption of Figure 2, (C): it is suggested that all (320) ovarian cancer cases are shown in one copy number profile.

Furthermore, the authors do not make a distinction between male and female samples. A clarification is needed why the authors think SCNAs of ovarian cancer samples should be called against a reference set that contains male controls.<br /> The procedure would likely benefit from a strict separation of male and female cases which would also allow for chrX (and chrY) being included in downstream analysis.

The GC bias and mappability correction implicitly done by iChorCNA for the SCNA profile comparison is presented as "no correction" which is highly misleading. (for clarification, this is also deemed inappropriate, not just inaccurate))

The majority of interpretations presented procedure does not give any significant improvement regarding the similarity of copy number profiles are off and in many instances favor the OT procedure in an unscientific and highly inappropriate manner.

Apart of duplicate marking (which is not specified any further - provide the command(s)!), there is no information on which read (pairs) were used (primary, secondary, supplementary, mapped in a proper pair, fragment length restrictions, clipping restrictions, etc.). The authors should explain why base quality score re-calibration was done as this might be an unnecessary step if the base quality values are not used later on.

The adaptation method presented as "center-and-scale standardization" is inappropriate for unbalanced cancer profiles since it assumes the presence of identical SCNAs in all samples belonging to the same cancer entity.<br /> Please explain why normalizing 1 Mb genomic intervals to the average copy number across different cancer samples should be valid or use another domain adaptation method for performance comparison.

Statements like in line 83 (unsupervised DA) are plain wrong because transport from one domain to another requires the selection of a target domain based on a label, e.g., based on health status, cancer entity, or similar.

Relevance and Appropriateness:

Many of the presented results are not relevant or details of the procedure were incomprehensible or incomplete: the results presented in table 2 - sample assignment. The Euclidean metric seems to be inappropriate for high dimensional data. Also the selection of the cutoff based on Euclidean distance seems to enable the optimization in favor of the OT procedure. It is hypothesized that there might exist other cutoff values for which the selection of samples form the source domain would also work for other correction methods but this is not further described. It could simply be the case that OT can assign a relationship between domains

The statement that there are no continuous pre-analytical variables is wrong (304). The effect of target depth-of-coverage (DoC) was not analyzed although this represents one of the most common (continuous) and difficult to control variables in NGS data analysis. The inclusion of multiple samples from a single patient in a cohort likely represents introduction of a confounding factor ["contamination"] to the model training procedure: the temporal difference that lies between the taken samples of that patient represents leakage of information. As far as can be told from the presented data, this potential bias has not been ruled out (e.g., exclusion of all samples beyond the first from each patient or alternatively: picking all samples of a patient either for the training set or the test set).

Conscientiousness:

Statements like "good"/"best" on their own should be avoided. A clear description of why a certain procedure/methodology/algorithm performs better should be preferred in scientific writing (e.g., "highest MCC values" instead of "best MCC values").<br /> Otherwise, such statements represent mere opinions of the author rather than an unbiased evaluation of the results.<br /> The domain D8 of healthy controls seems to contain samples from multiple sources (some published other in-house). Contrary to the data availability statement (533), not all healthy control samples of the HEMA data set are available from ArrayExpress

Other Major Concerns:

Potential Irrelevance:

The manuscript represents a mere performance assessment of the proposed sWGS per-bin-read-count fitting procedure and, thus, a verification in its character, not a validation (although the model training itself was "validated" - but this is to be viewed separately from the validity of the achieved correction in a biological context). A proper (biological) validation is missing.

It is of utmost importance that parameters of the adapted (transported) samples -that lie outside of what has been optimized to be highly similar- are checked to actually validate the procedure. Especially biological signals and genome-wide parameters (GC content distribution before/after transport) need to be addressed also in hindsight of the rampant criticism towards GC bias correction by the authors. At no point in the manuscript was GC bias addressed properly, i.e., how much of an improvement is expected from GC bias correction if there is no significant GC bias?

The (potential - not clear so far) ability of making ChIP-seq data look like cfDNA data (even if only the copy number profiles SCNAs appear highly similar) raises the concern of potential future users of the tool to superimpose domains that should not be superimposed form a biological point of view because the true domain the superimposed cohorts belong to are different. The ability to superimpose anything onto anything s troubling. There is no control mechanism that allows for failure in cases where the superposition is invalid.

Chromosome X was excluded which could be avoided if data sets were split according to biological sex.

The difference between the distributions was never attributed to GC bias, hence, the benchmark against GC bias correction tools might not be relevant in the first place.

Stability of OT data transformation:

The authors state that the straight forward choice of lambda resulted in many occasions where disruptions (of unspecified nature and amplitude) are introduced in the copy number profiles of transformed data. It is not evident from the proposed work to which extent this behavior was removed from the procedure and if it can occur and how the user could resolve such a problem on their own.

In summary, the presented work needs considerable adaptation and additions before it can actually be considered a valuable contribution to the liquid biopsy field.

Reviewer #2 (Public Review):

The authors present a computational methodology for de-biasing/denoising high-throughput genomic signals using optimal transport techniques, thus allowing disparate datasets to be merged and jointly analysed. They apply this methodology on liquid biopsy data and they demonstrate improved performance (compared to simpler bias-correcting approaches) for cancer detection using common machine learning algorithms. This is a theoretically interesting and potentially useful approach for addressing a very common practical problem in computational genomics.

I have the following recommendations:

(1) When comparing performance metrics between different approaches (e.g., tables 3 and 4), 95% confidence intervals should also be provided and a pairwise statistical test should be applied to establish whether the observed difference in each performance metric between the proposed method and the alternatives is statistically significant, thus justifying the claim that the proposed method offers an improvement over existing methodologies.

(2) The commonly used center-and-scale and GC debias approaches presented by the authors are fairly simple. How does their methodology compare to more elaborate approaches, such as tangent normalisation (https://academic.oup.com/bioinformatics/article/38/20/4677/6678978) and robust PCA (https://github.com/mskilab-org/dryclean)?

(3) What is the computational cost of the proposed methodology and how does it compare to the alternatives?

(4) The proposed approach relies on a reference dataset, against which a given dataset is adapted. What are the implications for cross-validation experiments (which are essential for assessing the out-of-sample error of every methodology), particularly with regards to the requirement to avoid information leakage between training and validation/test data sets?

In conclusion, this is an interesting and potentially useful paper and I would like to encourage the authors to address the above points, which hopefully will strengthen their case.

Reviewer #1 (Public Review):

Summary:

The paper sets out to examine the social recognition abilities of a 'solitary' jumping spider species. It demonstrates that based on vision alone spiders can habituate and dishabituate to the presence of conspecifics. The data support the interpretation that these spiders can distinguish between conspecifics on the basis of their appearance.

Strengths:

The study presents two experiments. The second set of data recapitulates the findings of the first experiment with an independent set of spiders, highlighting the strength of the results. The study also uses a highly quantitative approach to measuring relative interest between pairs of spiders based on their distance.

Weaknesses:

The study design is overly complicated, missing key controls, and the data presented in the figures are not clearly connected to the study. The discussion is challenging to understand and appears to make unsupported conclusions.

(1) Study design: The study design is rather complicated and as a result, it is difficult to interpret the results. The spiders are presented with the same individual twice in a row, called a habituation trial. Then a new individual is presented twice in a row. The first of these is a dishabituation trial and the second is another habituation trial (but now habituating to a second individual). This is done with three pairings and then this entire structure is repeated over three sessions. The data appear to show the strong effects of differences between habituation and dishabituation trials in the first session. The decrease in differential behavior between the so-called habituation and dishabituation trials in sessions 2 and 3 is explained as a consequence of the spiders beginning to habituate in general to all of the individuals. The claim that the spiders remember specific individuals is somewhat undercut because all of the 'dishabituation' trials in session 2 are toward spiders they already met for 14 minutes previously but seemingly do not remember in session 2. In session 3 it is ambiguous what is happening because the spiders no longer differentiate between the trial types. This could be due to fatigue or familiarity. A second experiment is done to show that introducing a totally novel individual, recovers a large dishabituation response, suggesting that the lack of differences between 'habituation' and 'dishabituation' trials in session 3 is the result of general habituation to all of the spiders in the session rather than fatigue. As mentioned before, these data do support the claim that spiders differentiate among individuals.

The data from session 1 are easy to interpret. The data from sessions 2 and 3 are harder to understand, but these are the trials in which they meet an individual again after a substantial period of separation. Other studies looking at recognition in ants and wasps (cited by the authors) have done a 4 trial design in which focal animal A meets B in the first trial, then meets C in the second trial, meets B again in the third trial, and then meets D in the last trial. In that scenario trials 1, 2, and 4 are between unfamiliar individuals and trial 3 is between potentially familiar individuals. In both the ants and wasps, high aggression is seen in species with and without recognition on trial 1, with low aggression specifically for trials with familiar individuals in species with recognition. Across different tests, species or populations that lack recognition have shown a general reduction in aggression towards all individuals that become progressively less aggressive over time (reminiscent of the session 2 and 3 data) while others have maintained modest levels of aggression across all individuals. The 4 session design used in those other studies provides an unambiguous interpretation of the data while controlling for 'fatigue'. That all trials in sessions 2 and 3 are always with familiar individuals makes it challenging to understand how much the spiders are habituating to each other versus having some kind of associative learning of individual identity and behavior.

The data presentation is also very complicated. How is it the case that a negative proportion of time is spent? The methods reveal that this metric is derived by comparing the time individuals spent in each region relative to the previous time they saw that individual. At the very least, data showing the distribution of distances from the wall would be much easier to interpret for the reader.

(2) "Long-term social memory": It is not entirely clear what is meant by the authors when they say 'long-term social memory', though typically long-term memory refers to a form of a memory that requires protein synthesis. While the precise timing of memory formation varies across species and contexts, a general rule is that long-term memory should last for > 24 hours (e.g., Dreier et al 2007 Biol Letters). The longest time that spiders are apart in this trial setup is something like an hour. There is no basis to claim that spiders have long-term social memory as they are never asked to remember anyone after a long time apart. The odd phrasing of the 'long-term dishabutation' trial makes it seem that it is testing a long-term memory, but it is not. The spiders have never met. The fact that they are very habituated to one set of stimuli and then respond to a new stimulus is not evidence of long-term memory. To clearly test memory (which is the part really lacking from the design), the authors would need to show that spiders - upon the first instance of re-encountering a previously encountered individual are already 'habituated' to them but not to some other individuals. The current data suggest this may be the case, but it is just very hard to interpret given the design does not directly test the memory of individuals in a clear and unambiguous manner.

(3) Lack of a functional explanation and the emphasis on 'asociality': It is entirely plausible that recognition is a pleitropic byproduct of the overall visual cognition abilities in the spiders. However, the discussion that discounts territoriality as a potential explanation is not well laid out. First, many species that are 'asocial' nevertheless defend territories. It is perhaps best to say such species are not group living, but they have social lives because they encounter conspecifics and need to interact with them. Indeed, there are many examples of solitary living species that show the dear enemy effect, a form of individual recognition, towards familiar territorial neighbors. The authors in this case note that territorial competition is mediated by the size or color of the chelicerae (seemingly a trait that could be used to distinguish among individuals). Apparently, because previous work has suggested that territorial disputes can be mediated by a trait in the absence of familiarity has led them to discount the possibility that keeping track of the local neighbors in a potentially cannibalistic species could be a sufficient functional reason. In any event, the current evidence presented certainly does not warrant discounting that hypothesis.

Reviewer #2 (Public Review):

Summary:

In this manuscript, the authors investigated whether a salticid spider, Phidippus regius, recognizes other individuals of the same species. The authors placed each spider inside a container from which it could see another spider for 7 minutes, before having its view of the other spider occluded by an opaque barrier for 3 minutes. The spider was then either presented with the same individual again (habituation trial) or a different individual (dishabituation trial). The authors recorded the distance between the two spiders during each trial. In habituation trials, the spiders were predicted to spend more time further away from each other and, in dishabituation trials, the spiders were predicted to spend more time closer to each other. The results followed these predictions, and the authors then considered whether the spiders in habituation trials were generally fatigued instead of being habituated to the appearance of the other spider, which may have explained why they spent less time near the other individual. The authors presented the spiders with a different (novel) individual after a longer period of time (which they considered to be a long-term dishabituation trial), and found that the spiders switched to spending more time closer to the other individual again during this trial. This suggested that the spiders had recognized and had habituated to the individual that they had seen before and that they became dishabituated when they encountered a different individual.

Strengths:

It is interesting to consider individual recognition by Phidippus regius. Other work on individual recognition by an invertebrate has been, for instance, known for a species of social wasp, but Phidippus regius is a different animal. Importantly and more specifically, P. regius is a salticid spider, and these spiders are known to have exceptional eyesight for animals of their size, potentially making them especially suitable for studies on individual recognition. In the current study, the results from experiments were consistent with the authors' predictions, suggesting that the spiders were recognizing each other by being habituated to individuals they had encountered before and by being dishabituated to individuals they had not encountered before. This is a good start in considering individual recognition by this species.

Weaknesses:

The experiments in this manuscript (habituation/dishabituation trials) are a good start for considering whether individuals of a salticid species recognize each other. I am left wondering, however, what features the spiders were specifically paying attention to when recognizing each other. The authors cited Sheehan and Tibbetts (2010) who stated that "Individual recognition requires individuals to uniquely identify their social partners based on phenotypic variation." Also, recognition was considered in a paper on another salticid by Tedore and Johnsen (2013).

Tedore, C., & Johnsen, S. (2013). Pheromones exert top-down effects on visual recognition in the jumping spider Lyssomanes viridis. The Journal of Experimental Biology, 216, 1744-1756. doi: 10.1242/jeb.071118

In this elegant study, the authors presented spiders with manipulated images to find out what features matter to these spiders when recognizing individuals.

Part of the problem with using two living individuals in experiments is that the behavior of one individual can influence the behavior of the other, and this can bias the results. However, this issue can be readily avoided because salticids are well known, for example, to be highly responsive to lures (e.g. dead prey glued in lifelike posture onto cork disks) and to computer animation. These methods have already been successful and helpful for standardizing the different stimuli presented during many different experiments for many different salticid spiders, and they would be helpful for better understanding how Phidippus regius might recognize another individual on the basis of phenotypic variation. There are all sorts of ways in which a salticid might recognize another individual. Differences in face or body structure, or body size, or all of these, might have an important role in recognition, but we won't know what these are using the current methods alone. Also, I didn't see any details about whether body size was standardized in the current manuscript.

For another perspective, my thoughts turn to a paper by Cross et al.

Cross, F. R., Jackson, R. R., & Taylor, L. A. (2020). Influence of seeing a red face during the male-male encounters of mosquito-specialist spiders. Learning & Behavior, 48, 104-112. doi: 10.3758/s13420-020-00411-y

These authors found that males of Evarcha culicivora, another salticid species that is known to have a red face, become less responsive to their own mirror images after having their faces painted with black eyeliner than if their faces remained red. In all instances, the spiders only saw their own mirror images and never another spider, and these results cannot be interpreted on the basis of habituation/dishabituation because the spiders were not responding differently when they simply saw their mirror image again. Instead, it was specifically the change to the spider's face which resulted in a change of behavior. The findings from this paper and from Tedore and Johnsen can help give us additional perspectives that the authors might like to consider. On the whole, I would like the authors to further consider the features that P. regius might use to discern and recognize another individual.

Reviewer #3 (Public Review):

Summary:

Jumping spiders (family Salticidae) have extraordinarily good eyesight, but little is known about how sensitive these small animals might be to the identity of other individuals that they see. Here, experiments were carried out using Phidippus regius, a salticid spider from North America. There were three steps in the experiments; first, a spider could see another spider; then its view of the other spider was blocked; and then either the same or a different individual spider came into view. Whether it was the same or a different individual that came into view in the third step had a significant effect on how close together or far apart the spiders positioned themselves. It has been demonstrated before that salticids can discriminate between familiar and unfamiliar individuals while relying on chemical cues, but this new research on P. regius provides the first experimental evidence that a spider can discriminate by sight between familiar and unfamiliar individuals.

Clark RJ, Jackson RR (1995) Araneophagic jumping spiders discriminate between the draglines of familiar and unfamiliar conspecifics. Ethology, Ecology and Evolution 7:185-190

Strengths:

This work is a useful step toward a fuller understanding of the perceptual and cognitive capacities of spiders and other animals with small nervous systems. By providing experimental evidence for a conclusion that a spider can, by sight, discriminate between familiar and unfamiliar individuals, this research will be an important milestone. We can anticipate a substantial influence on future research.

Weaknesses:

(1) The conclusions should be stated more carefully.

(2) It is not clearly the case that the experimental methods are based on 'habituation (learning to ignore; learning not to respond). Saying 'habituation' seems to imply that certain distances are instances of responding and other distances are instances of not responding but, as a reasonable alternative, we might call distance in all instances a response. However, whether all distances are responses or not is a distracting issue because being based on habituation is not a necessity.

(3) Besides data related to distances, other data might have been useful. For example, salticids are especially well known for the way they communicate using distinctive visual displays and, unlike distance, displaying is a discrete, unambiguous response.

(4) Methods more aligned with salticids having extraordinarily good eyesight would be useful. For example, with salticids, standardising and manipulating stimuli in experiments can be achieved by using mounts, video playback, and computer-generated animation.

(5) An asocial-versus-social distinction is too imprecise, and it may have been emphasised too much. With P. regius, irrespective of whether we use the label asocial or social, the important question pertains to the frequency of encounters between the same individuals and the consequences of these encounters.

(6) Hypotheses related to not-so-strictly adaptive factors are discussed and these hypotheses are interesting, but these considerations are not necessarily incompatible with more strictly adaptive influences being relevant as well.

Reviewer #1 (Public Review):

Summary:

The authors aimed to develop a mean-field model that captures the key aspects of activity in the striatal microcircuit of the basal ganglia. They start from a spiking network of individual neuron models tuned to fit striatal data. They show that an existing mean-field framework matches the output firing rates generated by the spiking network both in static conditions and when the network is subject to perfectly periodic drive. They introduce a very simplified representation of dopaminergic cortico-striatal plasticity and show that simulated dopamine exposure makes model firing rates go up or down, in a way that matches the design of the model. Finally, they aim to test the performance of the model in a reinforcement learning scenario, with two very simplified channels corresponding to the selection between two actions. Overall, I do not find that this work will be useful for the field or provide novel insights.

Strengths:

The mean-field model dynamics match well with the spiking network dynamics in all scenarios shown. The authors also introduce a dopamine-dependent synaptic plasticity rule in the context of their reinforcement learning task, which can nicely capture the appropriate potentiation or depression of corticostriatal synapses when dopamine levels change.

Weaknesses:

From the title onwards, the authors refer to a "multiscale" model. They do not, in fact, work with a multiscale model; rather, they fit a spiking model to baseline data and then fit a mean-field model to the spiking model. The idea is then to use the mean-field model for subsequent simulations.

The mean-field modeling framework that is used was already introduced previously by the authors, so that is not a novel aspect of this work in itself. The model includes an adaptation variable for each population in the network. Mean-field models with adaptation already exist, and there is no discussion of why this new framework would be preferable to those. Moreover, as presented, the mean-field model is not a closed system. It includes a variable w (in equation 7) that is never defined.

Overall, the paper shows that a mean-field model behaves similarly to a spiking model in several scenarios. A much stronger result would be to show that the mean-field model captures the activity of neurons recorded experimentally. The spiking model is supposedly fit to data from recordings in some sort of baseline conditions initially, but the quality of this fit is not adequately demonstrated; the authors just show a cursory comparison of data from a single dSPN neuron with the activity of a single model dSPN, for one set of parameters.

The authors purport to test their model via its response to "the main brain rhythms observed experimentally". In reality, this test consists of driving the model with periodic input signals. This is far too simplistic to achieve the authors' goals in this part of the work.

The work also presents model responses to simple simulations of dopamine currents, treated as negative or positive inputs to different model striatal populations. These are implemented as changes in glutamate conductance and possibly in an additional depolarizing/hyperpolarizing current, so the results that are shown are guaranteed to occur by the direct design of the simulation experiment; nothing new is learned from this. The consideration of dopamine also points out that the model is apparently designed and fit in a way that does not explicitly include dopamine, even though the fitting is done to control (i.e., with-dopamine) data, so it's not clear how this modeling framework should be adapted for dopamine-depleted scenarios.

For the reinforcement learning scenario, the model network considered is extremely simplified. Moreover, the behavior generated is unrealistic, with action two selected several times in succession independent of reward outcomes and then an instant change to a pattern of perfectly alternating selection of action 1 and action 2.

Finally, various aspects of the paper are sloppily written. The Discussion section is especially disappointing, because it is almost entirely a summary of the results of the paper, without an actual discussion of their deeper implications, connections to the existing literature, predictions that emerge, caveats or limitations of the current work, and natural directions for future study, as one would expect from a usual discussion section.

Reviewer #2 (Public Review):

Summary:

The present article by Tesler et al proposes a 3-population model of the striatum input-output function including the direct pathway (D1) striatal projection neurons (dSPNs), the indirect pathway (D2) striatal projection neurons (iSPNs), and the fast-spiking striatal interneurons. The authors derive a mean-field version of the model where the firing rate of each population follows the transfer function obtained from a spiking (AdEx) neuron model for each cell population. They report the response of the mean-field circuit to oscillatory inputs from the cortex, the effect of dopamine on dSPNs and iSPNs, and how a simple reinforcement learning rule at cortico-striatal synapses would adapt the model's output in the face of 2 distinct inputs.

Strengths:

The model is simple and easy to understand.

Weaknesses:

Feedforward inhibition from FSI and interconnections between dSPNs and iSPNs does not seem to have any significant impact on the input-output response of dSPNs and iSPNs to cortical inputs. Therefore, all of the results shown can be derived relatively easily from the basic knowledge we have about mean-field neuronal models and their responses to external inputs: all populations have an output that linearly follows the input. Concerning the reinforcement learning paradigm, showing that 2 distinct inputs can be associated with opposite outputs based on a tri-partite synaptic learning rule does not appear new either. As it is, it's unclear to me how this model contributes to new knowledge concerning striatal neuronal activity. Moreover, the assumptions made concerning the effect of dopamine and the synaptic plasticity rules appear rather simplistic and relatively outdated.

Many of the goals set in the introduction do not appear met:

"understanding and modelling the complex dynamics and functions of the striatum constitutes a very relevant and challenging task".<br /> I'm not sure if the authors aim to understand and model the complex dynamics of the striatum here: there are no complex dynamics that are revealed or explained in the model, as the dSPNs and iSPNs mainly appear to have a linear relationship to their inputs (with added noise) in 3 for example. I did not find any non-trivial dynamics highlighted in the presentation of the results either.

"modelling and studying the functions of the striatum and its associated neuronal dynamics requires to investigate these cellular/microcircuits mechanisms, and how the small-scale mechanisms affect large-scale behavior"<br /> I also did not find a statement about the effect of cellular/microcircuit mechanisms on behavior or large-scale activity in the results or discussion. The effects of micro-circuits are rather transparent as dSPNs and iSPNs do not seem to differ from feedforward responses to cortical inputs.

"existing mean-fields are based on generic models (sometimes inspired by cortical circuits) [7, 8], which do not consider the rich and specific cellular and synaptic variability observed along brain regions."<br /> The authors argue here that specific input-output relationships of striatal neurons may contribute to the circuit dynamics. However, the input-output they derive from a spiking neuron model (AdEx) in Figure 2, are very typical IF curves used in most mean-field models. Apart from a slight saturation effect at large rates (which is incorporated in many mean-field models and may not even be relevant here given the max firing of these cells), the I-F curve looks exactly like what is expected from the most basic rate model neuron with a rectifying transfer function in the presence of synaptic noise. What cellular or synaptic properties would the authors like to highlight here? Linking to molecular and cellular parameters, as advertised in the intro, seems much beyond the current achievements of the present model.

"This approach permits an efficient transition between scales and, furthermore, it allows to explore the effects of cellular parameters at the network level, as we will show for the case of dopaminergic effects in the striatum."<br /> If the authors mean the excitation of D1 SPNS and the inhibition of D2 SPNs by dopamine, this statement seems slightly oversold. It's very well known that dopaminergic effects cannot simply be resumed by a change in excitability as it acts on non-linear currents and complex synaptic parameters. They model it as follows: "To model these effects of dopamine in dSPN cells we will assume the increase of excitability due to D1 activation in dPSNs can be described as an increase in the glutamatergic conductance (Qe in our model) together with the action of a depolarizing current" Which basically means an additional excitatory input and a depolarizing current. The expected effect on the firing rate of these 2 effects is rather simple and does not require circuit modelling I believe.

This effect of dopamine is referred to in the discussion as: "This analysis allowed us to show how modifications at the cellular level can be incorporated within the mean-field model which can in turn predict and capture the emergent changes at the network level generated by them, and in addition has provided further validation to our model."<br /> Again, I don't see any emergent property or model validation here. Maybe the authors can be a bit more precise about what emergent property they refer to.

"In addition it illustrates how changes at the cellular level can lead to emerging effects at the network level, which can be captured by the mean-field model"<br /> I did not find any description of 'emerging effects at the network level" in the results or discussion. Maybe the authors could elaborate on what they mean here.

"shows the capabilities of the model to reproduce specific brain functions"<br /> The capacity of a network to associate stim A to a positive output and stim B to a negative one through reward-driven synaptic plasticity is rather well described and is a bit far from 'specific brain functions'. Concerning the discussion, it highlights how the model 'could be useful' rather than highlighting any strength of the model or relation to existing work. In particular, the (large) literature on circuit modelling in the striatum and BG circuits is not cited at all beyond self-citations, except in one book chapter (Houk et al, 1995) and one paper (Bogacz, 2020).

"The RL model proposed can very easily be improved to capture more biologically complex scenarios"<br /> Why did the authors not implement such an 'easy' improvement?

Reviewer #2 (Public Review):

Summary:

In the manuscript "Metabolic heterogeneity of colorectal cancer as a prognostic factor: insights gained from fluorescence lifetime imaging" by Komarova et al., the authors used fluorescence lifetime imaging and quantitative analysis to assess the metabolic heterogeneity of colorectal cancer. Generally, this work is logically well-designed, including in vitro and in vivo animal models and ex vivo patient samples. Although the key parameter (BI index) used in this study was already published by this group, it was shown that heterogeneity of patients' samples had associations with clinical characteristics of tumors. Additional samples from 8 patients were added to the data pool during the revision process, which is helpful and important for the conclusions that the authors are trying to draw. Overall, the revisions that the authors have made greatly strengthen this study.

Strengths:

(1) Solid experiments are performed and well-organized, including in vitro and in vivo animal models and ex vivo patient samples;

(2) Attempt and efforts to build the association between the metabolic heterogeneity and prognosis for colorectal cancer.

Weaknesses:

(1) Although additional data acquired from 8 patients were collected, maybe more patients should be involved in the future for reliable diagnosis and prognosis.

Reviewer #1 (Public Review):

Summary:

In this study, Komarova et al. investigate the clinical prognostic ability of cell-level metabolic heterogeneity quantified via the fluorescence lifetime characteristics of NAD(P)H. Fluorescence lifetime imaging microscopy (FLIM) has been studied as a minimally invasive approach to measure cellular metabolism in live cell cultures, organoids, and animal models. Its clinical translation is spearheaded though macroscopic implementation approaches that are capable of large sampling areas and enable access to otherwise constrained spaces but lack cellular resolution for a one-to-one transition with traditional microscopy approaches, making the interpretation of the results a complicated task. The merit of this study primarily lies in its design by analyzing with the same instrumentation and approach colorectal samples in different research scenarios, namely in vitro cells, in vivo animal xenografts, and ex vivo tumor tissue from human patients. These conform to a valuable dataset to explore the translational interpretation hurdles with samples of increasing levels of complexity. For human samples, which exhibited the highest degree of heterogeneity from the experiments presented, the study specifically investigates the prediction ability of NAD(P)H fluorescence metrics for the binary classification of tumors of low and advanced stage, with and without metastasis, and low and high grade. They find that NAD(P)H fluorescence properties have a strong potential to distinguish between high- and low-grade tumors and a moderate ability to distinguish advanced stage tumors from low stage tumors. This study provides valuable results contributing to the deployment of minimally invasive optical imaging techniques to quantify tumor properties and potentially migrating into tools for human tumor characterization and clinical diagnosis.

Strengths:

The investigation of colorectal samples under multiple imaging scenarios with the same instrument and approach conforms to a valuable dataset that can facilitate interpretation of results across the spectrum of sample complexity.

The manuscript provides a strong discussion reviewing studies that investigated cellular metabolism with FLIM and the metabolic heterogeneity of colorectal cancer in general.

The authors do a thorough acknowledgement of the experimental limitations of investigating human samples ex vivo, and the analytical limitation of manual segmentation, for which they provide a path forward for higher throughput analysis.

Weaknesses:

NAD(P)H fluorescence provides a partial picture of the cell/tissue metabolic characteristics. Including fluorescence from flavins would comprise a more compelling dataset. These additional data should enable the quantification of redox metrics, which could positively contribute to the prognosis potential of metabolic heterogeneity. The authors did attempt to incorporate flavin fluorescence, unfortunately they could not find strong enough signal to proceed with the analysis.

Reviewer #1 (Public Review):

Summary:

Starting from an unbiased search for somatic mutations (from COSMIC) likely disrupting binding of clinically approved antibodies the authors focus on mutations known to disrupt binding between two ERBB2 mutations and Pertuzamab. They use a combined computational and experimental strategy to nominate position which when mutated could result in restoring the therapeutic activity of the antibody. Using in vitro assays the authors confirm that the engineered antibody binds to the mutant ERBB2 and prevents ERBB3 phosphorylation

Strengths:

(1) In my assessment, the data sufficiently demonstrates that a modified version of Pertuzamab can bind both the wild-type and S310 mutant forms of ERBB2.

(2) The engineering strategy employed is rational and effectively combines computational and experimental techniques.

(3) Given the clinical activity of HER2-targeting ADCs, antibodies unaffected by ERBB2 mutations would be desired

Weaknesses:

(1) There is no data showing that the engineered antibody is equally specific as Pertuzamab i.e. that it does not bind to other (non-ERBB2) proteins.

(2) There is no data showing that the engineered antibody has the desired pharmacokinetics/pharmacodynamics properties or efficacy in vivo.

(3) Computational approaches are only used to design a phage-screen library, but not used to prioritize mutations that are likely to improve binding (e.g. based on predicted impact on the stability of the interaction). A demonstration how computational pre-screening or lead optimization can improve the time-intensive process would be a welcome advance.

Comments on revised version:

I have nothing to add beyond my first review, because no substantial changes, additional experiments and/or data, have been made to the manuscript.

Reviewer #2 (Public Review):

Summary:

Peled et al identified HER2 mutations in connection with resistance to the anti-HER2 antibody Pertuzumab-mediated therapy. After constructing a yeast display library of Pertuzumab variants with 3.86×10^11 sequences for targeted screening of variant combinations in chosen 6 out of 14 residues, the authors performed experimental screening to obtain the clones that bind to HER2 WT and/or mutants (S310Y and S310F), and then combined new variations to obtain antibodies with a broad spectrum binding to both WT and two HER2 mutants. These are interesting studies of clinical impact and translational potential.

Strengths:

(1) Deep computational analyses of large datasets of clinical data provide useful information about HER2 mutations and their potential relevance to antibody therapy resistance.

(2) There is valuable information analyzing the residues within or near the interface between the antigen HER2 and the Pertuzumab antibody (heavy chain).<br /> The experimental antibody library screening obtained 90+ clones from 3.86×10^11 sequences for further functional validation.

Weaknesses:

(1) There is lack of assessment for antibody variant functions in cancer cell phenotypes in vitro (proliferation, cell death, motility) or in vivo (tumor growth and animal survival). The only assay was the western blotting of phosphopho-HER3 in Figure 4. However, HER2 levels and phosphor-HER2 were not analyzed.

(2) There is misleading impression from the title of computational engineering of a therapeutic antibody and the statement in the abstract "we designed a multi-specific version of Pertuzumab that retains original function while also bindings these HER2 variants" for a few reasons:

a. The primary method used for variant antibody identification for HER2 mutant binding is rather traditional experimental screening based on yeast display instead of computational design of a multi-specific version of Pertuzumab.

b. There is insufficient or lack of computational power in the antibody design or prioritization in choosing variant residues for the library construction of 3.86×1011 sequences. It seems random combinations from 6 residues out of 4 groups with 20 amino acid options.<br /> c. The final version of tri-binding variant is a combination of screened antibody clones instead of computation design from scratch.<br /> d. There is incomplete experimental evidence about the therapeutic values of newly obtained antibody clones.

Comments on revised version:

Two major comments remain and have not been well addressed. Comment 1 is expecting any cellular phenotypic analysis if not in vivo. Comment 2 requires some modifications to avoid overstating.

Reviewer #2 (Public Review):

This work makes substantial progress towards understanding physical aspects of formation locomotion, notably the hydrodynamic stability of groups of flappers and the modifications to energy costs associated with flow interactions.

Major strengths pertain to the fact that this topic is timely, interesting and complex, and the authors have advanced the understanding through their characterizations.

The weaknesses may relate to the many idealizations employed in the simulations and models, which may raise questions about how to interpret their results and whether the outcomes hold generally. But given the complexity of the problem, simplifications are necessary. The authors have certainly provided a clear presentation with appropriate details and caveats that will help the reader extract the main messages and form their own conclusions.

Overall, the work is a positive addition to the growing set of studies into schooling, flocking and related problems where unsteady flow interactions lead to interesting collective effects.

Reviewer #1 (Public Review):

Summary:<br /> The study seeks to establish accurate computational models to explore the role of hydrodynamic interactions on energy savings and spatial patterns in fish schools. Specifically, the authors consider a system of (one degree-of-freedom) flapping airfoils that passively position themselves with respect to the streamwise direction, while oscillating at the same frequency and amplitude, with a given phase lag and at a constant cross-stream distance. By parametrically varying the phase lag and the cross-stream distance, they systematically explore the stability and energy costs of emergent configurations. Computational findings are leveraged to distill insights into universal relationships and clarify the role of the wake of the leading foil.

Strengths:<br /> (1) The use of multiple computational models (computational fluid dynamics, CFD, for full Navier-Stokes equations and computationally-efficient inviscid vortex sheet, VS, model) offers an extra degree of reliability of the observed findings and backing to the use of simplified models for future research in more complex settings.

(2) The systematic assessment of the stability and energy savings in multiple configurations of pairs and larger ensembles of flapping foils is an important addition to the literature.

(3) The discovery of a linear phase-distance relationship in the formation attained by pairs of flapping foils is a significant contribution, which helps compare different experimental observations in the literature.

(4) The observation of a critical size effect for in-line formations, above which cohesion and energetic benefits are lost at once, is a new discovery to the field.

Weaknesses:<br /> (1) The extent to which observations on one-degree-of-freedom flapping foils could translate to real fish schools is presently unclear, so that some of the conclusions on live fish schools are likely to be overstated and would benefit from some more biological framing.

(2) The analysis of non-reciprocal coupling is not as novel as the rest of the study and potentially not as convincing due to the chosen linear metric of interaction (that is, the flow agreement).

Overall, this is a rigorous effort on a critical topic: findings of the research can offer important insight into the hydrodynamics of fish schooling, stimulating interdisciplinary research at the interface of computational fluid mechanics and biology.

reply to u/IamOkei at https://new.reddit.com/r/Zettelkasten/comments/1eg8jhe/how_different_is_bob_dotos_a_system_for_writing/?%24deep_link=true&correlation_id=f06f9a20-472b-4d1d-9820-65a28e4efb04&post_fullname=t3_1eg8jhe&post_index=0&ref=email_digest&ref_campaign=email_digest&ref_source=email&utm_content=post_title&%243p=e_as&utm_medium=Email%20Amazon%20SES

Doto's book is far more focused, well-written, and actually edited. Scheper's less well written and in need of heavy editing. Save yourself the extra 400 pages and spend that time practicing the craft instead.

If you were starting from scratch without any knowledge of the area, I would highly recommend Doto's work, possibly mention Ahrens in passing, and not suffer anyone to mention Scheper's book. If you're an academic, I would recommend Umberto Eco or perhaps if a historian, one of the many books on historical method like Barzun, Gottschalk, or Goutor.

As background, both Scheper and Doto sent me pre-publication drafts of their work-in-progress to read. I've also read the majority of other books, papers, articles, and works in the space over the past 150+ years including nearly 100% of the references footnoted the two texts referenced. See also: https://boffosocko.com/research/zettelkasten-commonplace-books-and-note-taking-collection/

Reviewer #2 (Public Review):

Summary:

This was a well-executed and well-written paper. The authors have provided important new datasets that expand on previous investigations substantially. The discovery that changes in diet are not so closely correlated with the presence of alkaloids (based on the expanded sampling of non-defended species) is important, in my opinion.

Strengths:

Provision of several new expanded datasets using cutting edge technology and sampling a wide range of species that had not been sampled previously. A conceptually important paper that provides evidence for the importance of intermediate stages in the evolution of chemical defense and aposematism.

Weaknesses:

There were some aspects of the paper that I thought could be revised. One thing I was struck by is the lack of discussion of the potentially negative effects of toxin accumulation, and how this might play out in terms of different levels of toxicity in different species. Further, are there aspects of ecology or evolutionary history that might make some species less vulnerable to the accumulation of toxins than others? This could be another factor that strongly influences the ultimate trajectory of a species in terms of being well-defended. I think the authors did a good job in terms of describing mechanistic factors that could affect toxicity (e.g. potential molecular mechanisms) but did not make much of an attempt to describe potential ecological factors that could impact trajectories of the evolution of toxicity. This may have been done on purpose (to avoid being too speculative), but I think it would be worth some consideration.

In the discussion, the authors make the claim that poison frogs don't (seem to) suffer from eating alkaloids. I don't think this claim has been properly tested (the cited references don't adequately address it). To do so would require an experimental approach, ideally obtained data on both lifespan and lifetime reproductive success.

Reviewer #1 (Public Review):

This is a very relevant study, clearly with the potential of having a high impact on future research on the evolution of chemical defense mechanisms in animals. The authors present a substantial number of new and surprising experimental results, i.e., the presence in low quantities of alkaloids in amphibians previously deemed to lack these toxins. These data are then combined with literature data to weave the importance of passive accumulation mechanisms into a 4-phases scenario of the evolution of chemical defense in alkaloid-containing poison frogs.

In general, the new data presented in the manuscript are of high quality and high scientific interest, the suggested scenario compelling, and the discussion thorough. Also, the manuscript has been carefully prepared with a high quality of illustrations and very few typos in the text. Understanding that the majority of dendrobatid frogs, including species considered undefended, can contain low quantities of alkaloids in their skin provides an entirely new perspective to our understanding of how the amazing specializations of poison frogs evolved. Although only a few non-dendrobatids were included in the GCMS alkaloid screening, some of these also included minor quantities of alkaloids, and the capacity of passive alkaloid accumulation may therefore characterize numerous other frog clades, or even amphibians in general.

While the overall quality of the work is exceptional, major changes in the structure of the submitted manuscript are necessary to make it easier for readers to disentangle scope, hypotheses, evidence and newly developed theories.

Reviewer #1 (Public Review):

Summary:

Mutational analysis of diffuse midline glioma (DMG) found that ACVR1 mutations, which up-regulate BMP signaling pathway are found in most H3.1K27M, but not H3.3K27M DMG cases. In this manuscript, Huchede et al attempted to determine whether the BMP signaling pathway has any role in H3.3K27M DMG tumors. They found that the BMP signaling is activated to a similar level in H3.3K27M DMG cells with wild type ACVR1 compared to ACVR1 DMG cells, likely due to the expression of BMP7 or BMP2. They went on to test whether cells treated with BMP7 or BMP2 treatments affected the gene expression and cell fitness of tumor cells with H3.3K27M mutation. They concluded that BMP2/7 synergizes with H3.3K27M to induce a transcriptomic rewiring associated with a quiescent but invasive cell state. The major issue for this conclusion is that the authors did not use the right models/controls to obtain results to support this conclusion as detailed below. Therefore, in order to strengthen the conclusion, the authors need to address the major concerns below.

Strength:<br /> Address an important question in DMG field.

Major concerns/weakness:<br /> (1) All the results in Fig. 2 utilized two glioma lines SF188 and Res259. The authors should repeat all these experiments in a couple of H3.3K27M DMG lines by deleting H3.3K27M mutation first.<br /> (2) Fig. 3. The experiments of BMP2 treatment should be repeated in another H3.3K27M DMG line using H3.1K27M ACVR1 mutant tumor lines as controls.

Minor concerns<br /> Fig.2A. BMP2 expression increased in H3.3K27M SF188 cells. Therefore, the statement "whereas BMP2 and BMP4 expressions are not significantly modified (Figure 2A and Figure 2-figure supplement A-B)"is not accurate

Comments on revised version:

I had three issues listed above on the initial version. The authors did not address my major concerns of #1 and #2, which are re-listed above.

Reviewer #1 (Public Review):

The authors developed an extension to the pairwise sequentially Markov coalescent model that allows to simultaneously analyze multiple types of polymorphism data. In this paper, they focus on SNPs and DNA methylation data. Since methylation markers mutate at a much faster rate than SNPs, this potentially gives the method better power to infer size history in the recent past. Additionally, they explored a model where there are both local and regional epimutational processes.

Integrating additional types of heritable markers into SMC is a nice idea which I like in principle. However, a major caveat to this approach seems to be a strong dependence on knowing the epimutation rate. In Fig. 6 it is seen that, when the epimutation rate is known, inferences do indeed look better; but this is not necessarily true when the rate is not known. (See also major comment #1 below about the interpretation of these plots.) A roughly similar pattern emerges in Supp. Figs. 4-7; in general, results when the rates have to be estimated don't seem that much better than when focusing on SNPs alone. This carries over to the real data analysis too: the interpretation in Fig. 7 appears to hinge on whether the rates are known or estimated, and the estimated rates differ by a large amount from earlier published ones.

Overall, this is an interesting research direction, and I think the method may hold more promise as we get more and better epigenetic data, and in particular better knowledge of the epigenetic mutational process.

Reviewer #2 (Public Review):

A limitation in using SNPs to understand recent histories of genomes is their low mutation frequency. Tellier et al. explore the possibility of adding hypermutable markers to SNP based methods for better resolution over short time frames. In particular, they hypothesize that epimutations (CG methylation and demethylation) could provide a useful marker for this purpose. Individual CGs in Arabidopsis tends to be either close to 100% methylated or close to 0%, and are inherited stably enough across generations that they can be treated as genetic markers. Small regions containing multiple CGs can also be treated as genetic markers based on their cumulative methylation level. In this manuscript, Tellier et al develop computational methods to use CG methylation as a hypermutable genetic marker and test them on theoretical and real data sets. They do this both for individual CGs and small regions. My review is limited to the simple question of whether using CG methylation for this purpose makes sense at a conceptual level, not at the level of evaluating specific details of the methods. I have a small concern in that it is not clear that CG methylation measurements are nearly as binary in other plants and other eukaryotes as they are in Arabidopsis. However, I see no reason why the concept of this work is not conceptually sound. Especially in the future as new sequencing technologies provide both base calling and methylating calling capabilities, using CG methylation in addition to SNPs could become a useful and feasible tool for population genetics in situations where SNPs are insufficient.

Reviewer #1 (Public Review):

Clostridium thermocellum serves as a model for consolidated bioprocessing (CBP) in lignocellulosic ethanol production. The primary ethanol production pathway involves the enzyme aldehyde-alcohol dehydrogenase (AdhE), which exhibits complex regulation, forming long oligomeric structures known as spirosomes.

The present study describes the cryo-EM structure of C. thermocellum AdhE, resolved at 3.28 Å resolution. By integrating cryo-EM data with molecular dynamics simulations, this study showed that the aldehyde intermediate resides longer in the channel of the extended form, supporting the mechanistic model in which the extended spirosome conformation represents the active form of AdhE.

These findings advance the understanding of the function and regulation of AdhE, a key enzyme involved in the ethanol biosynthesis pathway in Clostridium thermocellum, a model organism for ethanol production in consolidated bioprocessing.

Reviewer #2 (Public Review):

Summary:

The manuscript by Ziegler et al, entitled 'Structural characterization and dynamics of AdhE ultrastructure from Clostridium thermocellum: A containment strategy for toxic intermediates?" presents the atomic resolution cryo-EM structure of C. thermocellum AdhE showing that it show dominantly an extended form while E.coli AdhE shows dominantly a compact form. With comparative analysis of their C. thermocellum structure and the previous E.coli AdhE structure, they tried to reveal the mechanism by which C.thermocellum and E.coli show different dominant conformations. In addition, they also analyzed the substrate channel by comparative and computational approaches. Lastly, their computational analysis using CryoDRGN reveals conformational heterogeneity in the sample. Despite this the manuscript is very descriptive and does not provide a mechanistic understanding by which AdhE works, this work will provide structural frame works to further investigate the function and mechanism of AdhE dynamics.

Strengths:

This manuscript provides the first C. thermocellum (Ct) AdhE structure and comparatively analyzed this structure with E.coli AdhE.

Weaknesses:

This work is very descriptive and does not provide mechanistic understanding of the function and dynamics of AdhE.

Reviewer #1 (Public Review):

The development of effective computational methods for protein-ligand binding remains an outstanding challenge to the field of drug design. This impressive computational study combines a variety of structure prediction (AlphaFold2) and sampling (RAVE) tools to generate holo-like protein structures of three kinases (DDR1, Abl1, and Src kinases) for binding to type I and type II inhibitors. Of central importance to the work is the conformational state of the Asp-Phy-Gly "DFG motif" where the Asp points inward (DFG-in) in the active state and outward (DFG-out) in the inactive state. The kinases bind to type I or type II inhibitors when in the DFG-in or DFG-out states, respectively.

It is noted that while AlphaFold2 can be effective in generating ligand-free apo protein structures, it is ineffective at generating holo structures appropriate for ligand binding. Starting from the native apo structure, structural fluctuations are necessary to access holo-like structures appropriate for ligand-binding. A variety of methods, including reduced multiple sequence alignment (rMSA), AF2-cluster, and AlphaFlow may be used to create decoy structures. However, those methods can be limited in the diversity of structures generated and lack a physics-based analysis of Boltzmann weight critical to their relative evaluation.

To address this need, the authors combine AlphaFold2 with the Reweighted Autoencoded Variational Bayes for Enhanced Sampling (RAVE) method, to explore metastable states and create a Boltzmann ranking. With that variety of structures in hand, grid-based docking methods Glide and Induced-Fit Docking (IFD) were used to generate protein-ligand (kinase-inhibitor) complexes.

The authors demonstrate that using AlphaFold2 alone, there is a failure to generate DFG-out structures needed for binding to type II inhibitors. By applying the AlphaFold2 with rMSA followed by RAVE (using short MD trajectories, SPIB-based collective variable analysis, and enhanced sampling using umbrella sampling), metastable DFG-out structures with Boltzmann weighting are generated enabling protein-ligand binding. Moreover, the authors found that the successful sampling of DFG-out states for one kinase (DDR1) could be used to model similar states for other proteins (Abl1 and Src kinase). The AF2RAVE approach is shown to result in a set of holo-like protein structures with a 50% rate of docking type II inhibitors.

Overall, this is excellent work and a valuable contribution to the field that demonstrates the strengths and weaknesses of state-of-the-art computational methods for protein-ligand binding. The authors also suggest promising directions for future study, noting that potential enhancements in the workflow may result from the use of binding site prediction models and free energy perturbation calculations.

Reviewer #2 (Public Review):

This manuscript explores the utility of AlphaFold2 (AF2) and the author's own AF2-RAVE method for drug discovery. As has been observed elsewhere, the predictive power of docking against AF2 structures is quite limited, particularly for proteins like kinases that have non-trivial conformational dynamics. However, using enhanced sampling methods like RAVE to explore beyond AF2 starting structures leads to a significant improvement.

Comments on revised version:

I'm happy with the changes made.

Reviewer #3 (Public Review):

In this manuscript, the authors aim to enhance AlphaFold2 for protein conformation-selective drug discovery through the integration of AlphaFold2 and physics-based methods, focusing on improving the accuracy of predicting protein structures ensemble and small molecule binding of metastable protein conformations to facilitate targeted drug design.

The major strength of the paper lies in the methodology, which includes the innovative integration of AlphaFold2 with all-atom enhanced sampling molecular dynamics and induced fit docking to produce protein ensembles with structural diversity. Moreover, the generated structures can be used as reliable crystal-like decoys to enrich metastable conformations of holo-like structures. The authors demonstrate the effectiveness of the proposed approach in producing metastable structures of three different protein kinases and perform docking with their type I and II inhibitors. The paper provides strong evidence supporting the potential impact of this technology in drug discovery. However, limitations may exist in the generalizability of the approach across other structures, especially complex structures such as protein-protein or DNA-protein complexes.

The authors largely achieved their aims by demonstrating that the AF2RAVE-Glide workflow can generate holo-like structure candidates with a 50% successful docking rate for known type II inhibitors. This work is likely to have a significant impact on the field by offering a more precise and efficient method for predicting protein structure ensemble, which is essential for designing targeted drugs. The utility of the integrated AF2RAVE-Glide approach may streamline the drug discovery process, potentially leading to the development of more effective and specific medications for various diseases.

Comments on revised version:

The revised manuscript looks great to me. I have no further comments.

Reviewer #1 (Public Review):

The study shows a new mechanism of NFkB-p65 regulation mediated by Vangl2-dependent autophagic targeting. Autophagic regulation of p65 has been reported earlier; this study brings an additional set of molecular players involved in this important regulatory event, which may have implications for chronic and acute inflammatory conditions.

Reviewer #2 (Public Review):

Vangl2, a core planar cell polarity protein involved in Wnt/PCP signaling, cell proliferation, differentiation, homeostasis, and cell migration. Vangl2 malfunctioning has been linked to various human ailments, including autoimmune and neoplastic disorders. Interestingly, it was shown that Vangl2 interacts with the autophagy regulator p62, and autophagic degradation limits the activity of inflammatory mediators, such as p65/NF-κB. However, the possible role of Vangl2 in inflammation has not been investigated. In this manuscript, Lu et al. describe that Vangl2 expression is upregulated in human sepsis-associated PBMCs and that Vangl2 mitigates experimental sepsis in mice by negatively regulating p65/NF-κB signaling in myeloid cells. Their mechanistic studies further revealed that Vangl2 recruits the E3 ubiquitin ligase PDLIM2 to promote K63-linked poly-ubiquitination of p65. Vangl2 also facilitated the recognition of ubiquitinated p65 by the cargo receptor NDP52. These molecular processes caused selective autophagic degradation of p65. Indeed, abrogation of PDLIM2 or NDP52 functions rescued p65 from autophagic degradation, leading to extended p65/NF-κB activity in myeloid cells. Overall, the manuscript presents convincing evidence for novel Vangl2-mediated control of inflammatory p65/NF-kB activity. The proposed pathway may expand interventional opportunities restraining aberrant p65/NF-kB activity in human ailments.

IKK is known to mediate p65 phosphorylation, which instructs NF-kB transcriptional activity. In this manuscript, Vangl2 deficiency led to an increased accumulation of phosphorylated p65 and IKK also at 30 minutes post-LPS stimulation; however, autophagic degradation of p-p65 may not have been initiated at this early time point. Therefore, this set of data put forward the exciting possibility that Vangl2 could also be regulating the immediate early phase of inflammatory response involving the IKK-p65 axis - a proposition that may be tested in future studies.

Reviewer #3 (Public Review):

Lu et al. describe Vangl2 as a negative regulator of inflammation in myeloid cells. The primary mechanism appears to be through binding p65 and promoting its degradation, albeit in an unusual autolysosome/autophagy dependent manner. Overall, these findings are novel, valuable and the crosstalk of PCP pathway protein Vangl2 with NF-kappaB is of interest.

Comments on latest version:

Lu et al. now address all my comments. All data included for the reviewers should be included in the main manuscript or Supplement and should be available to the readers. Please ensure that this criteria is met. I have no further comments.

Reviewer #1 (Public Review):

The manuscript presents a framework for studying biomechanical principles and their links to morphology and provides interesting insights into a particular question regarding terrestrial locomotion and speed. The goal of the paper is to derive general principals of directed terrestrial locomotion, speed, and symmetry.

Major strengths:

The manuscript is a unique and creative work that explores performance spaces of a complicated question through computational modeling. Overall, the paper is well written and well crafted and was a pleasure to read.

The methods presented here (variable agents used to represent ultra-simplified body configurations that are not inherently constrained) are interesting and there's significant potential in them for a properly constrained question. For the data that is present here their hypotheses (while they can be anticipated from first principles) are very well validated and serve as a robust validation of these expectations and can help.

Of particular interest was the discussion of the transferability of morphologies designed under one system and moving to another. From a deep-time perspective, of particular interest is the transition from subaqueous to terrestrial locomotion which we know was a major earth life transition. The results of this study show that the best suited morphologies for subaqueous movement are ill-suited (from a locomotor speed standpoint at least) to fully terrestrial locomotion which begs the questions on if there are a suite of forms that have balanced performance in both and how that would differ from aquatic morphologies.

Major weaknesses:

(1) There is a major disagreement between target and parameters.

From a biomechanics perspective the target of this study, Directed Locomotion, is a fairly broad behavioral mode. However, what the authors are ultimately evaluating their model organisms on is a single performance parameter (speed, or distance traveled after 30s). Statements such as "bilateral symmetry showed to be a law-like pattern in animal evolution for efficient directed locomotion purposes" (p 12 line 365-366) are problematic for this reason.

Attaining the highest possible speed is a relevant but limited subset of ways one might interpret performance for directed locomotion. Efficiency, power generation, and limb loading/strain are equally relevant components.

The focus on speed coupled with selection for only the highest performing morphologies, rather than setting a minimum performance threshold fundamentally restricts the dynamics of the system in a way that is not representative of their specified target and pulls the simulations toward a specific, anticipatable, result.

Locomotor efficiency is alluded to later in the manuscript as one of the observed outcomes, but speed is not equivalent to locomotor efficiency (in much the same way that it is not the sole metric for describing performance with respect to directed locomotion). Energy/work/power have not been accounted for in the manuscript so this is not a parameter this study weighs in on.

The data and analyses the others present do show an interesting validation of these methods in assessing first order questions relating the shape of a single performance surface to a theoretical morphology, which has significant potential value.

(2) There is significant population and/or sample size and biasing.

Thirty simulations of a population of 101 morphologies seems small for a study of this kind, particularly looking to investigate such a broad question at an abstract level. Particularly when the top 50% of morphologies are chosen to mutate. It would be very easy for artificial biases to rapidly propagate through this system depending on the parameters bounding the formation of the initial generation.

This strong selection choosing the best 50 morphologies and mutating them enforces an aggressive effect that simulates and even more potent phylogenetic inertia than one might anticipate for an actual evolutionary history (it's no surprise then that all of the simulations were able to successfully retrieve a suite of morphotypes that recovered the performance peak for this system within 1500 generations)

Similarly, why is it that a 4^3 voxel limit was chosen? One can imagine that an increase in this voxel limit would allow for the development of more extreme geometries, which might be successful. It is likely that there might be computational resource constraints involved in this, it would be useful for the authors to add additional context here.

Review of resubmission:

I appreciate the clarification of points dealing with the details of computational modeling and methods and clarifications throughout the text.

However, the authors have failed to address the major weaknesses that were previously identified, specifically regarding the broader conclusions of the work, that either 1) the authors need to use an additional metric besides average speed, or 2) the conclusions need to be significantly reigned in to reflect the very narrow nature of the work.

Reviewer #2 (Public Review):

Summary:<br /> I believe the authors have done a wonderful job at dissecting a very complex topic, starting with basic building blocks of locomotion and introducing a powerful simulation approach to the exploring the landscape of growth and form in intelligent behavior.

Strengths:<br /> This is a very original, timely, and robust piece of work that I believe can inspire further computational studies in evo-devo-etho.

Weaknesses:<br /> More detail on the simulations and also greater clarity regarding the generalizability of their claims would improve the message and further studies.

Reviewer #1 (Public Review):

This study offers valuable insights into host-virus interactions, emphasizing the adaptability of the immune system. Readers should recognize the significance of MDA5 in potentially replacing RIG-I and the adversarial strategy employed by 5'ppp-RNA SCRV in degrading MDA5 mediated by m6A modification in different species, further indicating that m6A is a conservational process in the antiviral immune response.<br /> However, caution is warranted in extrapolating these findings universally, given the dynamic nature of host-virus dynamics. The study provides a snapshot into the complexity of these interactions, but further research is needed to validate and extend these insights, considering potential variations across viral species and environmental contexts.

Reviewer #2 (Public Review):

Panel 2N and 2O should have been done with and without SCRV treatment, so that the reader can assess whether SCRV induces additional IFN activation (on top of MDA5 and STING autoactivation). I would recommend the authors include a sentence in the text to explain that ectopic expression of MDA5 or STING (i.e. overexpression from a plasmid) induces autoactivation of these proteins. Therefore, the IFN induction that is seen in panel 2N is likely due to MDA5/STING overexpression. SCRV treatment may further boost IFN induction, but this cannot be assessed without the 'mock' conditions. This information will help the readers to interpret Fig. 2N and 2O correctly.