CaseOPOPD-47: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.83 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1461C>G (p.Phe487Leu)

CAID: CA401366857 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1461C%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPOPD-52: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.13 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.1850T>G (p.Val617Gly)

CAID: CA401369628 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1850T%3EG

gnomAD: Not in gnomAD

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPM-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

CAID: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation, Nomenclature indicates Variants 1 and 2 are in cis and the other allele is Wildtype

CaseOPOPD-10: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

ClinVar: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation and One Pseudodeficency Mutation

CaseLP2-7: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.22 umol/hr/L, Serum CK at 89 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.752C>T (p.Ser251Leu)

ClinVar: 325781 https://www.ncbi.nlm.nih.gov/clinvar/variation/325781/

gnomAD: East Asian 2.760e-3, Overall 3.540e-4 http://gnomad.broadinstitute.org/variant/17-78081415-C-T

Variant2: NM_000152.4:c.761C>T (p.Ser254Leu)

ClinVar: 325782 https://www.ncbi.nlm.nih.gov/clinvar/variation/325782/

gnomAD: East Asian 2.759e-3, Overall 1.947e-4 http://gnomad.broadinstitute.org/variant/17-78081424-C-T

Variant3: NM_000152.4:c.1054C>T (p.Gln352Ter)

CAID: CA294891876 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA294891876

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

CaseOPOPD-67: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.93 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2236T>G (p.Trp746Gly)

ClinVar: 556431 https://www.ncbi.nlm.nih.gov/clinvar/variation/556431/

gnomAD: East Asian 6.410e-4, Overall 3.186e-5 http://gnomad.broadinstitute.org/variant/17-78090813-T-G

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele, 2 other patients have this genotype

CaseOPM-1: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.97 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation, Nomenclature indicates Variants 1 and 2 are in cis and the other allele is Wildtype

CaseIP2-6: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.02 umol/hr/L, Serum CK at 709 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates that Variant 1 and 2 are in cis and the patient is homozygous for this allele, 2 more patients also have the same genotype

Case39

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs*45)

CAID: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Infantile Onset Pompe Disease, 1 more patient has the same genotype

Case49

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.-32-17_-32-10delins TCCCTGCTGAGCCTCCTACAGGCCTCCCGC

CAID: CA913184750 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184750

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1447G>A (p.Gly483Arg)

ClinVar: 285157 https://www.ncbi.nlm.nih.gov/clinvar/variation/285157/

gnomAD: African 6.170e-5, Overall 7.972e-6 http://gnomad.broadinstitute.org/variant/17-78084535-G-A

CaseAddInfo: Infantile Onset Pompe Disease

Case77

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2560C>T (p.Arg854*)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case30

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1327-2A>C

CAID: CA401366173 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1327-2A%3EC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case53

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

CaseAddInfo: Juvenile Late Onset Pompe Disease

Case4

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.148_859-11del (p.Glu50Hisfs*37; exons2–4deletion)

CAID: CA658795223 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.148_859-11del

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.685_686insCGGC (p.Arg229fsProfs*102)

CAID: CA658795233 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.685_686insCGGC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease

Case64

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case60

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1445C>G (p.Pro482Arg)

CAID: CA401366794 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1445C%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease, 1 person more with the same genotype

Patient4: Male, 50yo

CasePresentingHPOs: HP:0003077, HP:0005978

HPOsFreeText: LOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 5yr follow-up MRI, 18yr disease duration, ERT lasted 130mo

CasePMIDs: PMID: 25614309

CasePreviousTesting: same as group

CaseGenotypingMethod: same as grou

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.3:c.1495T>A

CAID: CA198789, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA198789

gnomAD: n/a

Patient3: Male, 50yo

CasePresentingHPOs: HP:0003077, HP:0000822

HPOsFreeText: LOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 5yr follow-up MRI, 40yr disease duration, ERT lasted for 116mo

CasePMIDs: PMID: 25614309

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: c.2136-7delGT no ClinVar, no CAID

Patient18: Male, 49yo

CasePresentingHPOs:

HPOsFreeText: LOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 13yr disease duration, ERT lasted 84mo

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.3:c.794delG

CAID: CA658795237, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.794delG

gnomAD: n/a

Patient17: Female, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1935C>A (p.Asp645Glu)

ClinVar: 4029, https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: 0.0001721, http://exac.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4(GAA):c.2815_2816delGT (p.Val939Leufs)

ClinVar: 371481, https://www.ncbi.nlm.nih.gov/clinvar/variation/371481/

gnomAD: 1.653e-05, http://exac.broadinstitute.org/variant/17-78093082-CTG-C

Patient3: Male, northern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.3:c.2024A>G

CAID: CA401370120, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA401370120

gnomAD: n/a

Variant2: NM_000152.4(GAA):c.2132C>G (p.Thr711Arg)

ClinVar: 381006, https://www.ncbi.nlm.nih.gov/clinvar/variation/381006/

gnomAD: 0.0001488, http://exac.broadinstitute.org/variant/17-78087108-C-G

Patient19: Male, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1935C>A (p.Asp645Glu)

ClinVar: 4029, https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: 0.0001721, http://exac.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4(GAA):c.2815_2816delGT (p.Val939Leufs)

ClinVar: 371481, https://www.ncbi.nlm.nih.gov/clinvar/variation/371481/

gnomAD: 1.653e-05, http://exac.broadinstitute.org/variant/17-78093082-CTG-C

Patient11: Male, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD, survived beyond 2yo, left ventricular mass index and left ventricular posterior wall thickness decreased during ERT. Able to raise head, sit without support, stand, walk alone

CaseNotHPOs: no significant respiratory problems during ERT

NotHPOsFreeText:

CaseAddInfo: homozygous, only patient to receive ERT treatment (rhGAA) every 2wks beginning at 5mo of age. ERT lasted for 90wks.

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.4(GAA):c.1935C>A (p.Asp645Glu)

ClinVar: 4029, https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: 0.0001721, http://exac.broadinstitute.org/variant/17-78086721-C-A

Patient14: Male, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1411_1414delGAGA (p.Glu471Profs)

ClinVar: 188874, https://www.ncbi.nlm.nih.gov/clinvar/variation/188874/

gnomAD: 1.688e-05, http://exac.broadinstitute.org/variant/17-78083827-CGAGA-C

Variant2: NM_000152.3:c.2376_2377insCA

CAID: CA913184735, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184735

Patient8: Female, 8 year onset

CasePresentingHPOs: HP:0001324 (Muscle Weakness)

HPOsFreeText: GAA activity 3.2% from dried blood spot

CaseNotHPOs: HP:0002098, HP:0001640, HP:0002240 (Respiratory distress, Cardiomegaly, Hepatomegaly)

NotHPOsFreeText: No wheelchair needed, Respiratory Assistance not needed

CaseAddInfo: LOPD

Patient5: Female, 4 years report, 10 months onset

CasePresentingHPOs: HP:0001640, HP:0002240, HP:0001324 (Cardiomegaly, Hepatomegaly, Muscle weakness)

HPOsFreeText: GAA activity 2.4% from leukocyte

CaseNotHPOs: HP:0002098 (Respiratory distress)

NotHPOsFreeText: No wheelchair needed, Respiratory Assistance not needed

CaseAddInfo: IOPD

Patient27: Female, 9 years report, 7 years onset

CasePresentingHPOs: N/A

HPOsFreeText: GAA activity 5.5% from leukocyte

CaseNotHPOs: HP:0002098, HP:0001324, HP:0001640, HP:0002240 (Respiratory distress, Muscle weakness, Cardiomegaly, Hepatomegaly)

NotHPOsFreeText: No wheelchair needed, Respiratory Assistance not needed

CaseAddInfo: LOPD

Patient37: Male, 25 years report, 8 year onset

CasePresentingHPOs: HP:0001324, HP:0002098 (Muscle weakness, Respiratory distress)

HPOsFreeText: GAA activity 9% from leukocyte, Wheelchair needed, Respiratory Assistance needed

CaseNotHPOs: HP:0001640, HP:0002240 (Cardiomegaly, Hepatomegaly)

NotHPOsFreeText: N/A

CaseAddInfo: LOPD

Patient17: Male, 75 years report, 72 year onset

CasePresentingHPOs: HP:0001324, HP:0002098 (Muscle weakness, Respiratory distress)

HPOsFreeText: GAA activity 4.8% from leukocyte, Respiratory Assistance needed

CaseNotHPOs: HP:0001640, HP:0002240 (Cardiomegaly, Hepatomegaly)

NotHPOsFreeText: Wheelchair not needed

CaseAddInfo: LOPD

Patient13: Male, 1 year onset

CasePresentingHPOs: HP:0001324, HP:0002098 (Muscle weakness, Respiratory distress)

HPOsFreeText: GAA activity 4.9% from leukocyte, Wheelchair needed, Respiratory Assistance needed

CaseNotHPOs: HP:0001640, HP:0002240 (Cardiomegaly, Hepatomegaly)

NotHPOsFreeText: N/A

CaseAddInfo: LOPD

Patient5: female, 53yo, adult onset

CasePresentingHPOs:

HPOsFreeText: LOPD, BMI = 21.1 / 21.1 / 22.5, WGMS = 3 / 3 / 3

CaseNotHPOs: HP:0002355

NotHPOsFreeText: did not require respiratory support

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.525delT (p.Glu176Argfs)

ClinVar: 4033, https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: 0.00009959, http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CasePD/Pathogenic-6: 4 weeks diagnosis

HPOsFreeText: GAA activity 8.8 (nmol · h−1 · mg−1), Mean percentage of normal 12.3%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Chromosomal code not provided

Variant3: NP_000143.2:p.N87Tfs*55

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 1 and 2 are in cis

CasePD/Pathogenic-10: 2 weeks diagnosis

HPOsFreeText: GAA activity 5.5 (nmol · h−1 · mg−1), Mean percentage of normal 7.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 https://www.ncbi.nlm.nih.gov/clinvar/variation/4020/

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Variant2: NM_000152.4:c.2161G>T (p.Glu721Ter)

CAID: CA401370611 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2161G%3ET

gnomAD: Not in gnomAD

Variant3: NM_000152.4:c.2237G>T (p.Trp746Leu)

ClinVar: 284776 https://www.ncbi.nlm.nih.gov/clinvar/variation/284776/

gnomAD: European (Non-Finnish) 1.244e-4, Overall 7.798e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-T

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 2 and 3 are in cis

CaseLOPD-15: 2 weeks diagnosis

HPOsFreeText: GAA activity 3.6 (nmol · h−1 · mg−1), Mean percentage of normal 5.1%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 http://www.ncbi.nlm.nih.gov/clinvar/variation/4020

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Chromosomal code not provided

Variant2: NP_000143.2:p.V740Gfs*55

ClinVar: N/A

gnomAD: N/A

Chromosomal code not provided and typo likely

Variant3: NP_000143.2:p.T234 mol/L

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease, Nomenclature claims Variant 1 and 2 are in cis

CaseLOPD-12: 2 weeks diagnosis

HPOsFreeText: GAA activity 2.0 (nmol · h−1 · mg−1), Mean percentage of normal 2.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Chromosomal code not provided and typo likely

Variant2: NP_000143.2:p.V350 mol/L

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease

Case#: Patient 14, male

CasePresentingHPOs: HP:0003236, HP:0003325

CaseAddInfo: 50yo at onset, 66yo at diagnosis

VariantAllele1: NM_000152.4(GAA):c.-32-13T>G

ClinVar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

VariantAllele2: c.2219-20dTG, p.Val740GfsX55 No ClinVar or CAID

Case#: Patient 6, female

CasePresentingHPOs: HP:0003236, HP:0003325

CaseAddInfo: 55yo at onset, 59yo at diagnosis

VariantAllele1: NM_000152.4(GAA):c.-32-13T>G

ClinVar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

VariantAllele2: NM_000152.4(GAA):c.1561G>A (p.Glu521Lys)

ClinVar: 4022, https://www.ncbi.nlm.nih.gov/clinvar/variation/4022/

gnomAD: 8.262e-06, http://exac.broadinstitute.org/variant/17-78084749-G-A

Case# Patient 1, male

CasePresentingHPOs: HP:0003236

CaseAddInfo: 14yo at onset, 16 at diagnosis

VariantAllele1: NM_000152.4(GAA):c.-32-13T>G

ClinVar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

VariantAllele2: NM_000152.4(GAA):c.1655T>C (p.Leu552Pro

ClinVar: 279811; https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: 1.663e-05; http://exac.broadinstitute.org/variant/17-78085800-T-C

Case#: Patient 1, female, 2.5 months of age at diagnosis, Hispanic

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001638, HP:0032988, HP:0001252, HP:0001270, HP:0002015, HP:0012378

(Cardiomyopathy, Persistent head lag, Muscular hypotonia, Motor delay, Dysphagia, Fatigue)

CaseHPOFreeText: NG tube feeding was left after Enzyme Replacement Therapy (ERT).

Cardiac status at base line was 160 LVMI g/m^2, after ERT IT WAS 81 LVMI g/m^2

Patient needed oxygen at baseline, no respiratory support at ERT.

one episode of Infusion Associated Reactions (IARs) to ERT.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting:

Variant 1: NM_000152.5(GAA):c.2608C>T (p.Arg870Ter)

ClinVar: 189009

CAID: CA274250

gnomAD: Highest population MAF= 0.00004888 (European non-Finnish)

ParentalGenotype:N/A

PreviouslyPublished:N/A

Patient 13 - IOPD - homozygous

Variant: NM_000152.3:c.1195-18_2190-20del

CAID: CA913184754, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184754

gnomAD: n/a

Patient 3

Variant1: NM_000152.3:c.2481+102_2646+31del

CAID: CA658795291, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.2481%2B102_2646%2B31del

gnomAD: n/a

Variant2: NM_000152.4(GAA):c.307T>G (p.Cys103Gly)

ClinVar: 92483, https://www.ncbi.nlm.nih.gov/clinvar/variation/92483/

gnomAD: n/a

Patient17: 65yo

CasePresentingHPOs: HP:0003325, HP:0002093, HP:0002870, HP:0020038, HP:0002637

HPOsFreeText: GAA = 6.8%, smoker, BMI = 27.1, right ventricular trigone retraction due to ischemia

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 22yr disease duration, variants in cis

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.1561G>A (p.Glu521Lys)

ClinVar: 4022, https://www.ncbi.nlm.nih.gov/clinvar/variation/4022/

gnomAD: 8.262e-06, http://exac.broadinstitute.org/variant/17-78084749-G-A

Patient20: 60yo

CasePresentingHPOs: HP:0003325, HP:0002093, HP:0000822, HP:0002870, HP:0020038

HPOsFreeText: GAA = 11%, BMI = 23.2, subcortical white matter lacunes

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 5yr disease duration, variants in cis

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.1561G>A (p.Glu521Lys)

ClinVar: 4022, https://www.ncbi.nlm.nih.gov/clinvar/variation/4022/

gnomAD: 8.262e-06, http://exac.broadinstitute.org/variant/17-78084749-G-A

Patient11: 62yo

CasePresentingHPOs: HP:0003325, HP:0002093, HP:0004887, HP:0000822

HPOsFreeText: GAA = 5.7%, smoker, BMI = 22.3, basilar artery fenestration, nucleo-capsular and temporo-insular lacunes

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 24yr disease duration, variants in cis

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.1551+1G>C

ClinVar: 554983, https://www.ncbi.nlm.nih.gov/clinvar/variation/554983/

gnomAD: n/a

Patient3: 53yo

CasePresentingHPOs: HP:0002870

HPOsFreeText: hyperCKemia, GAA = 16%, BMI = 27.7, left vertebral artery dominant, temporo-insular lacunes

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: 24yr disease duration

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Case#: Subject number 10(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 617 U/L (60-305 U/L is normal), Hex4: 6.6 mmol/mol Creatinine (≤20 mmol/mol Creatinine is normal)

glucosidase activity: GAA activity #1 was 0.84 micromole/L/h and GAA activity #2 (NBS) 0.49 in dried blood spots (>2.10 micromole/L/h is normal). 2.1 in confirmatory testing (>3.88 is normal).

Variant 1: NM_000152.5(GAA):c.1438-1G>C

Variant 1 ClinVarID: 189184

Variant 1 CAid: CA274472

Variant 2: NM_000152.5(GAA):c.-32-13T>G

Variant 2 ClinVarID: 4027

Variant 2 CAid: CA116606

Zygosity: compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 30(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

glucosidase activity: GAA activity #2 (NBS) 1.07 in dried blood spots (>2.10 micromole/L/h is normal).

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.-32-13T>G

Variant 2 ClinVarID: 4027

Variant 2 CAid: CA116606

Zygosity: homozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 12(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 464 U/L (60-305 U/L is normal)

glucosidase activity: 2.60 in confirmatory testing (>3.88 is normal). AST: 112 (22–71); ALT: 50 (7–50)

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.2238G>C

Variant 2 ClinVarID: 265160

Variant 2 CAid: CA8815665

Zygosity: compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 3(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 125 U/L (28-300 U/L is normal), AST: 56 U/L (24-72 U/L is normal), ALT: 49 U/L (17-63 U/L is normal), Hex4: 4.5 mmol/mol Creatinine (≤20 mmol/mol Creatinine is normal)

glucosidase activity: GAA activity #1 was 1.73 micromole/L/h and GAA activity #2 (NBS) 1.08 in dried blood spots (>2.10 micromole/L/h is normal). 3.6 in confirmatory testing (>6.7 is normal).

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.-32-13T>G

Variant 2 ClinVarID: 4027

Variant 2 CAid: CA116606

Zygosity: homozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 16(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 140 U/L (60-305 U/L is normal), AST: 73 U/L (22-71 U/L is normal), ALT: 39 U/L (7-50 U/L is normal), Hex4: 8.5 mmol/mol Creatinine (≤20 mmol/mol Creatinine is normal), BNP 99.8 pg/mL (0.0–100.0 pg/mL is normal)

glucosidase activity: GAA activity #1 was 1.06 micromole/L/h and GAA activity #2 (NBS) 0.26 in dried blood spots (>2.10 micromole/L/h is normal). 6.4 in confirmatory testing (>3.88 is normal).

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.-32-13T>G

Variant 2 ClinVarID: 4027

Variant 2 CAid: CA116606

Zygosity: homozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 8(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 365 U/L (60-305 U/L is normal), Hex4: 5.23 mmol/mol Creatinine (≤8.9 mmol/mol Creatinine is normal)

glucosidase activity: GAA activity #1 was 0.83 micromole/L/h and GAA activity #2 (NBS) 0.85 in dried blood spots (>2.10 micromole/L/h is normal). 0.93 in confirmatory testing (>3.88 is normal).

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.1655 T>C

Variant 2 ClinVarID: 279811

Variant 2 CAid: CA8815429

Zygosity: compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 1(L)

DiseaseAssertion: Late Onset Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: CK testing: 530 U/L (28-300 U/L is normal), AST: 72 U/L (24-72 U/L is normal), ALT: 41 U/L (17-63 U/L is normal), Hex4: 4.9 mmol/mol Creatinine (≤20 mmol/mol Creatinine is normal)

glucosidase activity: GAA activity #1 was 1.86 micromole/L/h and GAA activity #2 (NBS) 0.78 in dried blood spots (>2.10 micromole/L/h is normal). 3.1 in confirmatory testing (>6.7 is normal).

Variant 1: NM_000152.5(GAA):c.-32-13T>G

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.-32-13T>G

Variant 2 ClinVarID: 4027

Variant 2 CAid: CA116606

Zygosity: homozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Patient 1, woman, 58 years old, ethnicity unknown

DiseaseAssertion:Pompe disease

Was also misdiagnosed with adult-onset spinal muscular atrophy (SMA)

FamilyInfo: No family history of muscle disease

CasePresentingHPOs: HP:0003701, HP:0100284

(Proximal muscle weakness, EMG myotonic discharges)

CaseHPOFreeText: Denervation atrophy from a muscle biopsy

Weakness of hip flexion 2–3/5, hip abduction 2/5, and hip adduction 2/5

Myotonic discharges were in the lumbar paraspinals, vastus medialis, and tensor fasciae latae muscles.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: GAA enzyme activity assay was 1 pmol/punch/h (normal range 10–49 pmol/punch/h)

Her creatine kinase (CK) level at presentation had been elevated as high as 429 U/L (normal range 45–145)

Found with two mutations in the GAA gene

Variant: NM_000152.5(GAA):c.-32-13T>G

ClinVar: 4027

CAID: CA116606

gnomAD: Highest population MAF= 0.005541 (Ashkenazi Jewish)

Variant: NM_000152.5(GAA):c.525del (p.Glu176fs) Double check this variant

ClinVar: 4033

CAID: CA220406

gnomAD: N/A

ParentalGenotype:N/A

Previously Published: N/A

Case#: Subject number 3, male, 56 years (report), 30s years (onset), 48 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A ** CasePresentingHPOs**: HP:0000365 (hearing loss), HP:0000360 (tinnitus)

CaseHPOFreeText: ambulatory

CaseNotHPOs: HP:0002617, HP:0000939, HP:0009830, HP:0100647, HP:0010788, HP:0000821, HP:0002650, HP:0001638 (aneurysm, osteoporosis, peripheral neuropathy, Graves disease, Testicular cancer, hypothyroidism, scoliosis, cardiomyopathy)

CaseNotHPOFreeText: No infusion reaction, no tracheostomy, not on BiPAP

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.2431delC (p.Leu811TrpfsTer?)

Variant 2 ClinVarID: N/A

Variant 2 CAid: CA628018649

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 16, male, 64 years (report), 56 years (onset), 60 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs:

CaseHPOFreeText: on BiPAP, ambulatory, assistive device (cane)

CaseNotHPOs: HP:0009830, HP:0000360, HP:0002650, HP:0000939, HP:0000821, HP:0000365, HP:0002617, HP:0100647, HP:0010788, HP:0001638 (peripheral neuropathy, tinnitus, scoliosis, osteoporosis, hypothyroidism, hearing loss, aneurysm, Graves disease, Testicular cancer, cardiomyopathy)

CaseNotHPOFreeText: no infusion reaction, no tracheostomy

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.307T>G

Variant 2 ClinVarID: 92483

Variant 2 CAid: CA220404

Zygosity: Compound heterozygous

ParentalGenotype: N/A

Case#: Subject number 8, female, 49 years (report), 20s years (onset), 42 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0000821 (hypothyroidism)

CaseHPOFreeText: ambulatory, assistive device (quad cane, wheelchair)

CaseNotHPOs: HP:0000365, HP:0002650, HP:0000360, HP:0002617, HP:0000939, HP:0009830, HP:0100647, HP:0010788, HP:0001638 (hearing loss, scoliosis, tinnitus, aneurysm, osteoporosis, peripheral neuropathy, Graves disease, Testicular cancer, cardiomyopathy)

CaseNotHPOFreeText: No infusion reaction, no tracheostomy, not on BiPAP

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.1437+2T>C

Variant 2 ClinVarID: 849313

Variant 2 CAid: CA401366685

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 5, male, 59 years (report), 10 years (onset), 33 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0000365 (hearing loss), HP:0000360 (tinnitus), HP:0000939 (osteoporosis)

CaseHPOFreeText: Tracheostomy, assistive device (wheelchair)

CaseNotHPOs: HP:0002650, HP:0002617, HP:0009830, HP:0100647, HP:0010788, HP:0000821, HP:0001638 (scoliosis, aneurysm, peripheral neuropathy, Graves disease, Testicular cancer, hypothyroidism, cardiomyopathy)

CaseNotHPOFreeText: No infusion reaction, no ambulatory, not on BiPAP

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.925G>A (p.Gly309Arg)

Variant 2 ClinVarID: 188797

Variant 2 CAid: CA273972

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 15, male, 42 years (report), 15 years (onset), 23 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs:

CaseHPOFreeText: on BiPAP, ambulatory

CaseNotHPOs: HP:0009830, HP:0000360, HP:0002650, HP:0000939, HP:0000821, HP:0000365, HP:0002617, HP:0100647, HP:0010788, HP:0001638 (peripheral neuropathy, tinnitus, scoliosis, osteoporosis, hypothyroidism, hearing loss, aneurysm, Graves disease, Testicular cancer, cardiomyopathy)

CaseNotHPOFreeText: no infusion reaction, no tracheostomy

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.1134C>G

Variant 2 ClinVarID: 595469

Variant 2 CAid: CA401365023

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 9, female, 74 years (report), 30s years (onset), 62 years (diagnosis)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0000365 (hearing loss), HP:0000360 (tinnitus)

CaseHPOFreeText: Infusion reaction, ambulatory, assistive device (cane for long distance)

CaseNotHPOs: HP:0000821, HP:0002650, HP:0002617, HP:0000939, HP:0009830, HP:0100647, HP:0010788, HP:0001638 (hypothyroidism, scoliosis, aneurysm, osteoporosis, peripheral neuropathy, Graves disease, Testicular cancer, cardiomyopathy)

CaseNotHPOFreeText: no tracheostomy, not on BiPAP

CasePreviousTesting: “documented deficiency of acid alpha-glucosidase enzyme activity”; on enzyme replacement therapy

Variant 1: NM_000152.5(GAA):c.-32-13T>G (p.Tyr766Ser)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.2655_2656delCG (p.Val886GlufsTer2)

Variant 2 ClinVarID: 597005

Variant 2 CAid: CA913191011

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Subject II-6: female, 56yo

CasePresentingHPOs: HP:0000822, HP:0003701, HP:0001611, HP:0003691, HP:0003700, HP:0009023, HP:0003307, HP:0002515, HP:0040081, HP:0003458

HPOsFreeText: altered DBS, treated with beta-blockers, occasional cramping of lower limbs, muscle atrophy of temporal, deltoids, and thigh muscle extensors, muscle strength was 5/5 proximal and distal for upper limbs and distal for lower limbs, and 4/5 on hip extension, diminished biceps, triceps, patellar, and ankle jerk reflexes. Intact pain, temperature, vibration, proprioception, and coordination. CK = 86 IU/L, AST = 33 IU/L, reduced GAA activity, reduced duration and amplitude of motor unit action potentials (mainly on thigh extensors), normal muscle biopsy

CaseNotHPOs: HP:0001291, HP:0002015, HP:0001618, HP:0003391, HP:0003487

NotHPOsFreeText: no Hoffmann sign, paraspinal complex repetitive discharges

CaseAddInfo: This patient's 5 daughters had DBS and GAA sequencing evaluations, only 2 (III-9 and III-10) had altered DBS and carried GAA variants

CasePMIDs:

CasePreviousTesting: DBS, EMG, muscle biopsy from thigh extensors

CaseGenotypingMethod: GAA genotyping

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.2560C>T (p.Arg854Ter)

ClinVar: 4034, https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: 0.0002090, http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Subject II-4: female

CasePresentingHPOs:

HPOsFreeText: normal GAA enzyme values

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: carrier status, clinically asymptomatic

CasePMIDs:

CasePreviousTesting: DBS

CaseGenotypingMethod: GAA genotyping

Variant: NM_000152.4(GAA):c.2560C>T (p.Arg854Ter)

ClinVar: 4034, https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: 0.0002090, http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Patient24: Female

CasePresentingHPOs: HP:0000365

HPOsFreeText: CRIM positive, heart normalization

CaseNotHPOs: HP:0004887, HP:0025156, HP:0002355, HP:0002546, HP:0001371

NotHPOsFreeText: infusion associated reaction

CaseAddInfo: variants in trans, symptom onset at 2yo, diagnosis at 3yo, ERT at 4yo

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1933G>A (p.Asp645Asn)

ClinVar: 188728, https://www.ncbi.nlm.nih.gov/clinvar/variation/188728/

gnomAD: 0.000008250, http://gnomad.broadinstitute.org/variant/17-78086719-G-A

Variant2: NM_000152.3:c.1822C>T

CAID: CA8815488, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.1822C%3ET

gnomAD: 0.00001806, http://gnomad.broadinstitute.org/variant/17-78086444-C-T

Patient27: Male

CasePresentingHPOs: HP:0000365

HPOsFreeText: CRIM positive, Anti-rh GGA antibodies maximum titer = ≤ 1:400, moderate periventricular white matter abnormalities (hypomyelination), progressive deterioration of MRI parameters

CaseNotHPOs: HP:0004887, HP:0025156, HP:0002355, HP:0002546, HP:0001371

NotHPOsFreeText: infusion associated reaction, heart normalization

CaseAddInfo: variants in trans, symptom onset at birth, diagnosis at 3yo, ERT at 4yo

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1465G>A (p.Asp489Asn)

ClinVar: 92465, https://www.ncbi.nlm.nih.gov/clinvar/variation/92465/

gnomAD: 0.00001195, http://gnomad.broadinstitute.org/variant/17-78084553-G-A

Variant2: NM_000152.3:c.40_47del

CAID: CA913184761, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184761

gnomAD: n/a

Patient4: Female

CasePresentingHPOs: HP:0004887, HP:0002194, HP:0001522

HPOsFreeText: ERT dosage = 20 mg/kg/2 w, able to hold objects, CRIM negative

CaseNotHPOs:

NotHPOsFreeText: no reversal of HCM

CaseAddInfo: Symptom onset and diagnosis at 2mo, ERT at 3.5mo, ERT lasted for 8mo, ventilation required at 11mo, died at 12mo

CasePMIDs: 22252923, 27629047

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.3:c.1657C>T

CAID: CA401368835, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.1657C%3ET

gnomAD: n/a

Patient18: Male

CasePresentingHPOs: HP:0004887, HP:0003819

HPOsFreeText: ERT dosage = 20mg/kg/2w, able to hold objects, CRIM negative

CaseNotHPOs:

NotHPOsFreeText: No HCM reversal

CaseAddInfo: Symptom onset at 6mo, diagnosis and ERT at 12mo, ERT lasted for 9mo, required ventilation at 34mo, died at 42mo

CasePMIDs: 22252923, 27629047

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.3:c.1657C>T

CAID: CA401368835, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.1657C%3ET

gnomAD: n/a

Case14: Female, 15 years onset, 16 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 16, GAA Activity at ~8 pmol/min/mg before ERT and ~12 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1927G>A (p.Gly643Arg)

ClinVar: 4023 https://www.ncbi.nlm.nih.gov/clinvar/variation/4023/

gnomAD: European (Non-Finnish) 3.667e-5, Overall 2.479e-5 http://gnomad.broadinstitute.org/variant/17-78086713-G-A

CaseAddInfo: Late Onset Pompe Disease

Case7: Male, Danish, 20 years report, 1 year onset

HPOsFreeText: MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 5.6/5.3 (L), Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.2228A>G (p.Gln743Arg)

CAID: CA401324753 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2228A%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.2237G>C (p.Trp746Ser)

ClinVar: 188484 https://www.ncbi.nlm.nih.gov/clinvar/variation/188484/

gnomAD: African 3.210e-4, Overall 7.089e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-C

Variant3: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

Case4: Male, French, 65 years report, 55 years onset

HPOsFreeText: 6-min walk test achieved 540 m, MRC score is 5/5 (thigh/calf), Forced vital capacity sitting/supine is 2.7/1.8 (L), On the medications Statin and Allopurinol, Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.3G>A

CAID: CA401359809 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.3G%3EA

gnomAD: European (Non-Finnish) 8.945e-6, Overall 4.041e-6 http://gnomad.broadinstitute.org/variant/17-78078388-G-A

CaseAddInfo: Late Onset Pompe Disease

Case#: Subject number 20, female, 29 years (diagnosis), 40 years (baseline visit), 40 years (ERT), 39 (age at ventilation)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness), HP:0002098 (respiratory distress)

CaseHPOFreeText: mechanical ventilation at Baseline Visit, mechanical ventilation at last visit

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea)

CaseNotHPOFreeText:

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 26, male, 35 years (diagnosis), 51 years (baseline visit), 51 years (ERT), 49 (age at ventilation)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness), HP:0002098 (respiratory distress)

CaseHPOFreeText: mechanical ventilation at Baseline Visit, mechanical ventilation at last visit

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea)

CaseNotHPOFreeText:

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 15, female, 35 years (diagnosis), 51 years (baseline visit), 46 years (ERT), 46 (ventilation)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness), HP:0002098 (respiratory distress)

CaseHPOFreeText: mechanical ventilation at Baseline Visit, mechanical ventilation at last visit

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea)

CaseNotHPOFreeText:

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 24, female, 42 years (diagnosis), 57 years (baseline visit), 55 years (ERT), 54 (age at ventilation)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness), HP:0002098 (respiratory distress)

CaseHPOFreeText: mechanical ventilation at Baseline Visit, mechanical ventilation at last visit

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea)

CaseNotHPOFreeText:

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 27, male, 35 years (diagnosis), 51 years (baseline visit)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness)

CaseHPOFreeText:

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea), HP:0002098 (respiratory distress)

CaseNotHPOFreeText: no mechanical ventilation at Baseline Visit, no mechanical ventilation at last visit

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 11, male, 23 years (diagnosis), 31 years (baseline visit), 24 years (ERT), 23 (ventilation)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness), HP:0002098 (respiratory distress)

CaseHPOFreeText: mechanical ventilation at Baseline Visit, mechanical ventilation at last visit

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea)

CaseNotHPOFreeText:

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 12, female, 20 years (diagnosis), 46 years (baseline visit), 39 years (ERT)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness)

CaseHPOFreeText:

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea), HP:0002098 (respiratory distress)

CaseNotHPOFreeText: no mechanical ventilation at Baseline Visit, no mechanical ventilation at last visit

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Case#: Subject number 29, female, 40 years (diagnosis), 54 years (baseline visit), 48 (ERT)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001324 (Muscle Weakness)

CaseHPOFreeText:

CaseNotHPOs: HP:0003236 (Elevated circulating creatine kinase concentration), HP:0002870 (obstructive sleep apnea), HP:0002098 (respiratory distress)

CaseNotHPOFreeText: no mechanical ventilation at Baseline Visit, no mechanical ventilation at last visit

CasePreviousTesting: "reduced enzymatic activity on fibroblasts, blood leukocytes or skeletal muscle and/or the presence of two known mutations in the GAA gene"

PreviouslyPublished: N/A

Patient8: Female, 41yo at diagnosis, 48yo at ERT

CasePresentingHPOs:

HPOsFreeText: anti rh-GAA antibodies titre = 1:1600, enzyme (μmol/g/h) = 0.23 (2-10), mobility aid required before and after ERT

CaseNotHPOs:

NotHPOsFreeText: NIV not required

CaseAddInfo: 7yr disease duration, variants in trans

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.3:c.482_483del

CAID: CA8814879, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA8814879

gnomAD: 1.729e-05, http://exac.broadinstitute.org/variant/17-78078864-TCC-T

Variant2: NM_000152.4(GAA):c.692+5G>T

ClinVar: 562532, https://www.ncbi.nlm.nih.gov/clinvar/variation/526532/

gnomAD: 8.596e-06, http://exac.broadinstitute.org/variant/17-78079698-G-T

Patient7: Female, 49yo at diagnosis, 50yo at ERT

CasePresentingHPOs:

HPOsFreeText: anti rh-GAA antibodies titre = 1:1600, enzyme (μmol/g/h) = 0.78 (3-20)

CaseNotHPOs:

NotHPOsFreeText: NIV and mobility aid not required

CaseAddInfo: 25yr disease duration, variants in trans

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4(GAA):c.525delT (p.Glu176Argfs)

ClinVar: 4033, https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: 7.041e-05, http://exac.broadinstitute.org/variant/17-78078909-CT-C

Case#: Patient 4, male, diagnosed 2015 (not given age of diagnosis), age 42 during study period

DiseaseAssertion: Pompe Disease

FamilyInfo: None given

CasePresentingHPOs: None given

CaseHPOFreeText: None given

CaseNotHPOs: None given

CaseNotHPOFreeText: None given

CasePreviousTesting: None given

Variant 1: NM_000152.5:c.-32-13T>A (unclear variant nomenclature)

Variant 1 ClinVarID: N/A

Variant 1 CAid: CA913184742

Variant 2: NM_000152.5:c.525del

Variant 2 ClinVarID: 4033

Variant 2 CAid: CA220406

ParentalGenotype: Not provided

Case#: Patient 3, female, diagnosed 2015 (not given age of diagnosis), age 40 during study period

DiseaseAssertion: Pompe Disease

FamilyInfo: None given

CasePresentingHPOs: None given

CaseHPOFreeText: None given

CaseNotHPOs: None given

CaseNotHPOFreeText: None given

CasePreviousTesting: None given

Variant 1: NM_000152.5:c.-32-13T>G (unclear variant nomenclature, homozygous)

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

ParentalGenotype: Not provided

Case3: Female, 22 years diagnosis, 19 years onset

CasePresentingHPOs: HP:0009073, HP:0003198 (Progressive proximal muscle weakness, Myopathy)

HPOsFreeText: Electromyography showed myogenic damage, Vacuolar myopathy, Serum CK is 73.5 U/L

Case#: Patient 2

DiseaseAssertion: Pompe Disease

FamilyInfo: None given

CasePresentingHPOs: None

CaseHPOFreeText: None

CaseNotHPOs: None

CaseNotHPOFreeText: None

CasePreviousTesting: Single gene sequencing with Ion Torrent Persional Genome Machine

Glucosidase activity: 0.0 nmol 5MU/hr/mL

Variant 1: NM_000152.5:c.596A>G

Variant 1 ClinVarID: 92486

Variant 1 CAid: CA145785

Variant 2: NM_000152.5:c.668G>A

Variant 2 ClinVarID: 92488

Variant 2 CAid: CA145791

ParentalGenotype: Not provided

Case#: Patient 3

DiseaseAssertion: Pompe Disease

FamilyInfo: None given

CasePresentingHPOs: None

CaseHPOFreeText: None

CaseNotHPOs: None

CaseNotHPOFreeText: None

CasePreviousTesting: Single gene sequencing with Ion Torrent Persional Genome Machine

Glucosidase activity: 0.0 nmol 5MU/hr/mL

Variant 1: NM_000152.5:c.596A>G

Variant 1 ClinVarID: 92486

Variant 1 CAid: CA145785

Variant 2: NM_000152.5:c.668G>A

Variant 2 ClinVarID: 92488

Variant 2 CAid: CA145791

ParentalGenotype: Not provided

Case#: P 23, Female, 4.7 months old when started ERT (45.8months old when last reported), German

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 , HP:0001252 , HP:0003701, HP:0006532, HP:0002650

(Hypertrophic cardiomyopathy, Muscular hypotonia, Proximal muscle weakness, Recurrent Pneumonia, Scoliosis)

CaseHPOFreeText: Scoliosis and recurrent pneumonia were complications during ERT

No motor activity achieved

Requiered ventilation and tube feeding

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

Variant: NM_000152.3:c.1456G>C (p.Ala486Pro)

ClinVar: N/A

CAID: CA401366835

gnomAD: N/A

ParentalGenotype: Both the paternal and maternal allele carried the NM_000152.3:c.1456G>C Variant

PreviouslyPublished:N/A

Case#: P 22, Female, 0.2 months old when started ERT (47.0 months old when last reported), German

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 , HP:0001252 , HP:0003701, HP:0001371

(Hypertrophic cardiomyopathy, Muscular hypotonia, Proximal muscle weakness, Flexion contracture )

CaseHPOFreeText: Flexion contractures were a complication during ERT

CaseNotHPOs: N/A

CaseNotHPOFreeText: No tube feeding nor ventilation needed

CasePreviousTesting: CRIM status is unknown

Antibody titer is 1:1.800

Variant 1: NM_000152.3:c.2004C>A

ClinVar: N/A

CAID: CA401370054

gnomAD: N/A

Variant: c.541545delTTAC

ClinVar: N/A

CAID: N/A

gnomAD: N/A

ParentalGenotype: Maternal allele carried the c.2004 C>A Variant

The paternal allele carried the c.541545delTTAC

PreviouslyPublished: N/A

Case#: P 18, Male, 1.4 months old when started ERT (Died at 36.4 months old)

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0001639 , HP:0001252 , HP:0003701, HP:0006532

(Hypertrophic cardiomyopathy, Muscular hypotonia, Proximal muscle weakness, Recurrent Pneumonia)

CaseHPOFreeText: Recurrent pneumonia was a complication during ERT

Best motor status was walking

CaseNotHPOs: N/A

CaseNotHPOFreeText: Did not required ventilation nor tube feeding

CasePreviousTesting: CRIM status was positive

Antibody titer was unknown

Variant: NM_000152.5(GAA):c.896T>C (p.Leu299Pro)

ClinVar: 180144

CAID: CA273686

gnomAD: N/A

ParentalGenotype: Both the paternal and maternal allele carried the variant NM_000152.5(GAA):c.896T>C (p.Leu299Pro)

PreviouslyPublished: N/A

Case#: Subject number 18, female, 79 years (report)

DiseaseAssertion: Pompe disease

FamilyInfo: Family member with PD

CasePresentingHPOs:

CaseHPOFreeText: Asymptomatic

CaseNotHPOs: HP:0002153 (hyperkalemia), HP:0001324 (muscle weakness), HP:0003326 (Myalgia), HP:0002015 (dysphagia), HP:0001252 (Hypotonia), HP:0001638 (cardiomyopathy), HP:0002098 (respiratory distress), HP:0003546 (Exercise intolerance), HP:0002094 (dyspnoea)

CaseNotHPOFreeText: no biopsy

CasePreviousTesting: "Enzymatic activity was detected by fluorometric techniques" "The GAA sequence was performed in all patients whose enzyme activity measured in DBS and lymphocytes was decreased."

glucosidase activity: GAA activity was 0.65 mol/Lh in dried blood spots (normal range >0.75).

Variant 1: NM_000152.5(GAA):c.854C>G (p.Pro285Arg)

Variant 1 ClinVarID: 225114

Variant 1 CAid: CA358045

Variant 2: N/A

Variant 2 ClinVarID: N/A

Variant 2 CAid: N/A

Zygosity: Heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 6, male, 19 years (report)

DiseaseAssertion: Pompe disease

FamilyInfo: Family member with PD

CasePresentingHPOs:

CaseHPOFreeText: Asymptomatic

CaseNotHPOs: HP:0001638 (cardiomyopathy), HP:0002153 (hyperkalemia), HP:0001324 (muscle weakness), HP:0003546 (Exercise intolerance), HP:0001252 (Hypotonia), HP:0003326 (Myalgia), HP:0002015 (dysphagia), HP:0002098 (respiratory distress), HP:0002094 (dyspnoea)

CaseNotHPOFreeText: no biopsy

CasePreviousTesting: "Enzymatic activity was detected by fluorometric techniques" "The GAA sequence was performed in all patients whose enzyme activity measured in DBS and lymphocytes was decreased."

glucosidase activity: GAA activity was 0.37 mol/Lh in dried blood spots (normal range >0.75).

Variant 1: NM_000152.5(GAA):c.-32-13T>C

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.281_282delCT (p.Pro94ArgfsTer?)

Variant 2 ClinVarID: 370458

Variant 2 CAid: CA16041881

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case#: Subject number 7, male, 31 years (report)

DiseaseAssertion: Pompe disease

FamilyInfo: No known family member with PD

CasePresentingHPOs: HP:0002153 (hyperkalemia), HP:0001324 (muscle weakness)

CaseHPOFreeText:

CaseNotHPOs: HP:0001638 (cardiomyopathy), HP:0003546 (Exercise intolerance), HP:0001252 (Hypotonia), HP:0003326 (Myalgia), HP:0002015 (dysphagia), HP:0002098 (respiratory distress), HP:0002094 (dyspnoea)

CaseNotHPOFreeText: no biopsy, not asymptomatic

CasePreviousTesting: "Enzymatic activity was detected by fluorometric techniques" "The GAA sequence was performed in all patients whose enzyme activity measured in DBS and lymphocytes was decreased."

glucosidase activity: GAA activity was 0.27 mol/Lh in dried blood spots (normal range >0.75).

Variant 1: NM_000152.5(GAA):c.-32-13T>C

Variant 1 ClinVarID: 4027

Variant 1 CAid: CA116606

Variant 2: NM_000152.5(GAA):c.1655T>C (p.Leu552Pro)

Variant 2 ClinVarID: 279811

Variant 2 CAid: CA8815429

Zygosity: Compound heterozygous

ParentalGenotype: N/A

PreviouslyPublished: N/A

Case5: Female, 11 months report and onset, Algeria, African

CasePresentingHPOs: HP:0002098, HP:0002883, HP:0000961, HP:0030829, HP:0001290, HP:0003236, HP:0003198, HP:0002878 (Respiratory distress, Rapid breathing, Cyanosis, Abnormal breath sound, Generalized Hypotonia, Increased serum CK, Myopathy, Respiratory failure)

HPOsFreeText: Intercostal and subcostal retraction, Diffuse infiltrative process involving the left lung field, CK rate was 3 times the normal value and AST and ALT were 2 times the normal value, GAA activity was deficient

CaseNotHPOs: HP:0030148, HP:0011675, HP:0001315, HP:0001291, HP:0003115 (Heart murmur, Arrhythmia, Decreased/absent deep tendon reflexes, Cranial nerve abnormality, Abnormal ECG)

CaseAddInfo: Proband was the second born child of healthy consanguineous parents, Pregnancy was uneventful,

Case6: Male, 5 months report, birth onset, Algeria, African

CasePresentingHPOs: HP:0001635, HP:0001639, HP:0008872, HP:0002015, HP:0000961, HP:0003324, HP:0008936, HP:0000158, HP:0001315, HP:0001263, HP:0000467, HP:0002240, HP:0001640, HP:0002878, HP:0011950, HP:0001270, HP:0001290 (Heart failure, Hypertrophic cardiomyopathy, Feeding difficulties in infancy, Swallowing difficulties, Cyanosis, Generalized weakness, Axial hypotonia, Macroglossia, Decreased/absent deep tendon reflexes, Global developmental delay, Neck muscle weakness, Hepatomegaly, Cardiomegaly, Respiratory failure, Bronchiolitis, Motor delay, Generalized hypotonia)

HPOsFreeText: Intercostal and subcostal retraction, cardiothoracic ratio of about 0, 78%, CK, ALT, and AST rates were normal, GAA level is null

CaseAddInfo: Died at 11 months

Patient2: female, 29 yo, Caucasian

CasePresentingHPOs: HP:0003724, HP:0008988, HP:0003691, HP:0003391, HP:0003551, HP:0040081, HP:0002910, HP:0003557, HP:0100295, HP:0100295, HP:0009051, HP:0004356, HP:0002111

HPOsFreeText: paravertebral muscle atrophy, atrophies with paresis grade of 3-4 MRC, cannot stand from squatting position, impaired overhead work, CK = 1390 U/l, AST = 65 U/l, ALAT = 72 U/L, symmetrical atrophy of thigh muscle, fatty deposits in m. adductor magnus, flause signal elevation in the mm. semimembranosus and mm. biceps femoris bilateral, reticulation in the proximal vastus intermedius and vastus lateralis, vacuolated muscle fibres, PAS-positive glycogen storage with enhanced lysosomal activity in the PAS staining, increased lysosomal activity, GAA activity = 0.22nmol/spot x 21hrs

CaseNotHPOs: HP:0001639

CaseAddInfo:

CasePreviousTesting: MRI of thigh muscle, muscle biopsy of mm. vastus lateralis, hematoxylin and eosin stain, Peri acid-Schiff reaction, Acid phosphatase staining, transthoracic echocardiogram, respiratory function test

CaseGenotypingMethod: Sanger Sequencing

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Case32: Female, 45 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 533 meters, Forced Vital Capacity at 77%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1888+1G>A

CAID: CA8815511 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1888%2B1G%3EA

gnomAD: European (Non-Finnish) 9.843e-6, Overall 4.375e-6 http://gnomad.broadinstitute.org/variant/17-78086511-G-A

CaseAddInfo: Late Onset Pompe Disease

Case9: Female, 34 years report

HPOsFreeText: 6 years of ERT completed, 6 Minute Walking Test at 452 meters, Forced Vital Capacity at 76%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

Variant2: NM_000152.4:c.1688A>T (p.Gln563Leu)

CAID: CA401368995 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1688A%3ET

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case19: Male, 57 years report

HPOsFreeText: 8 years of ERT completed, 6 Minute Walking Test at 273 meters, Forced Vital Capacity at 77%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1819_1836del (p.Gly607_His612del )

CAID: CA658795266 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1819_1836del

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case16: Male, 6 years onset, 12.5 years diagnosis, 13 years report

CasePresentingHPOs: HP:0003325, HP:0003327, HP:0003236, HP:0003691 (Limb-girdle muscle weakness, Axial muscle weakness, Increased serum CK, Scapula alata)

CaseAddInfo: Late-Onset Pompe Disease

PatientF1P1: Female, 30 years onset, 40 years diagnosis, Caucasian

CasePresentingHPOs: HP:0007340, HP:0002172 (Leg weakness, Postural instability)

HPOsFreeText: History of hyperCKemia greater than 1,000 U/L (control 30–220 U/L), Showed deficient muscle acid GAA activity (0.05 µmol/min/g, control >0.42 µmol/min/g)

CaseAddInfo: First cousin twice removed of F1P3, Proband

Case#: Case 1, Boy, Death at 6-7 months old, Hispanic

DiseaseAssertion: Pompe disease

FamilyInfo: N/A

CasePresentingHPOs: HP:0002240, HP:0001640, 0000961, HP:0002090, HP:0001270, HP:0031664, HP:0200128, HP:0001252

(Hepatomegaly, Cardiomegaly, Cyanosis, Pneumonia, Motor delay, Systolic heart murmur, Biventricular hypertrophy, Muscular Hypotonia)

CaseHPOFreeText: Heart failure, Systolic murmur grade II-III, Enlarged, EKG showed an inverted T wave from V4-V6 as well as AVF, suggesting left systolic overload.

CaseNotHPOs:

CaseNotHPOFreeText:

CasePreviousTesting: Ejection fraction of 52%

Serum creatine kinase was 386 IU/L (mildly elevated)

GAA activity on dried blood spot was decreased (1.08 nmol/L; normal range: 1.5-10 nmol/L)

Whole exon and exon-intron boundaries direct sequencing revealed a homozygous single base deletion c.1987delC

Variant: c.1987delC

ClinVar: N/A

CAID: N/A

gnomAD: N/A

ParentalGenotype: N/A

PreviouslyPublished: N/A

Patient3: Male, northern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.3:c.2024A>G

CAID: CA401370120, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA401370120

gnomAD: n/a

Variant2: NM_000152.4(GAA):c.2132C>G (p.Thr711Arg)

ClinVar: 381006, https://www.ncbi.nlm.nih.gov/clinvar/variation/381006/

gnomAD: 0.0001488, http://exac.broadinstitute.org/variant/17-78087108-C-G

Patient22: Female, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.3:c.1241del

CAID: CA913184736, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184736

gnomAD: n/a

Variant2: NM_000152.4(GAA):c.2662G>T (p.Glu888Ter)

ClinVar: 578595, https://www.ncbi.nlm.nih.gov/clinvar/variation/578595/

gnomAD: 1.65e-05, http://exac.broadinstitute.org/variant/17-78092467-G-T

Patient12: Male, Southern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.3:c.2585del

CAID: CA913184734, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184734

gnomAD: n/a

Variant2: NM_000152.4(GAA):c.2815_2816delGT (p.Val939Leufs)

ClinVar: 371481, https://www.ncbi.nlm.nih.gov/clinvar/variation/371481/

gnomAD: 1.653e-05, http://exac.broadinstitute.org/variant/17-78093082-CTG-C

Patient18: Male, Northern China

CasePresentingHPOs:

HPOsFreeText: IOPD

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo:

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.1935C>A (p.Asp645Glu)

ClinVar: 4029, https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: 0.0001721, http://exac.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4(GAA):c.796C>T (p.Pro266Ser)

ClinVar: 556117, https://www.ncbi.nlm.nih.gov/clinvar/variation/556117/

gnomAD: n/a

Case31: Male, 41yo (at enrollment and onset)

CasePresentingHPOs: HP:0002094, HP:0003701, HP:0003327, HP:0003236, HP:0002098, HP:0002111, HP:0003458, HP:0100284

HPOsFreeText: asymmetric weakness of extremities, CK = 573 IU/L, required use of ventilator, FVC = 33.7%, unspecific myopathic changes present in muscle pathology, DBS GAA activity = .05, mixed leukocyte GAA activity = 1.40

CaseNotHPOs: HP:0001627

NotHPOsFreeText:

CaseAddInfo:

CasePreviousTesting: clinical history, laboratory data, DBS and ML assays to measure GAA activity, electromyography, muscle pathology analysis

CaseGenotypingMethod: full sequencing of GAA gene

VariantAllele1: NM_000152.3:c.1822C>T

CAID: CA8815488, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3%3Ac.1822C%3ET

gnomAD: 0.00001806, http://gnomad.broadinstitute.org/variant/17-78086444-C-T

VariantAllele2: NM_000152.4(GAA):c.2238G>C (p.Trp746Cys)

ClinVar: 265160, https://www.ncbi.nlm.nih.gov/clinvar/variation/265160/

gnomAD: 0.0002987, http://exac.broadinstitute.org/variant/17-78090815-G-C

Patient2: Female, 34 years report, Iranian, Iran

CasePresentingHPOs: HP:0002098, HP:0003236, HP:0002910 (Respiratory distress, Increased serum CK, Increased transaminases)

HPOsFreeText: GAA measurement from dried blood specimen at pH 3.8 was 0.13 nmol/spot * 21 h (ref 0.9-7.2) with acarbose and 0.65 nmol/spot * 21 h (ref 1.5-10) without acarbose and 3.84 nmol/spot * 21 h at pH 7.0 (ref 1.8-17.1), AST levels at 165 (ref 0-45), ALT levels at 261 (ref 5-40), CPK levels at 1212 (ref 25-200), FEV1 at 0.83, FEV1/FVC at 90.25

CaseAddInfo: Sibling of P1

Patient5: Male, Hispanic, 14yo

CasePresentingHPOs:

HPOsFreeText: IOPD, rhGAA IgG antibody titer = 200, CRIM positive

CaseNotHPOs:

NotHPOsFreeText: no infusion associated reactions

CaseAddInfo: homozygous, 6.8mo at diagnosis, 7.3mo at ERT start

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant: NM_000152.4(GAA):c.2297A>C (p.Tyr766Ser)

ClinVar: 420102, https://www.ncbi.nlm.nih.gov/clinvar/variation/420102/

gnomAD: 0.000003998, https://gnomad.broadinstitute.org/variant/17-78090874-A-C

Patient3: Male, Caucasian, 11yo

CasePresentingHPOs:

HPOsFreeText: IOPD, negative rhGAA IgG antibody titer, CRIM positive

CaseNotHPOs:

NotHPOsFreeText: no infusion associated reactions

CaseAddInfo: diagnosed at birth, 15days old at ERT start

CasePMIDs:

CasePreviousTesting: same as group

CaseGenotypingMethod: same as group

Variant1: NM_000152.4(GAA):c.525delT (p.Glu176Argfs)

ClinVar: 4033, https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: 0.00009959, https://gnomad.broadinstitute.org/variant/17-78078909-CT-C

Variant2: NM_000152.5(GAA):c.1642G>T (p.Val548Phe)

ClinVar: 5973381, https://www.ncbi.nlm.nih.gov/clinvar/variation/597381/

gnomAD: n/a

Variant3: NM_000152.5(GAA):c.1880C>T (p.Ser627Phe)

ClinVar: 597382, https://www.ncbi.nlm.nih.gov/clinvar/variation/597382/

gnomAD: n/a