1,711 Matching Annotations
  1. May 2019
    1. RFFIT is used for detennination of rabies virus neutralizing antibody (RVNA) titers. It is an in vitro cell culture based technique in which foci of virus-infected cells are observed by fluorescent antibody staining. In brief, mouse neuroblastoma (MNA) cells were cultured in T-25 tissue culture flasks in DMEM supplemented with 10% FCS at 35°C in humidified atmosphere of0.5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDT A in DMEM without FCS), centrifuged at 150 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T -25 flasks. Sera from immunized mice were heat inactivated at 56°C for 30 min and the RVNA titers were determined by RFFIT as described previously (Smith . et al., 1996). Briefly, 100 111 of various dilutions of the reference (Standard Rabies Immune Globulin, Biological Research and Reviews, FDA, Maryland, US) and the test sera were mixed with 100 111 Challenge Virus Strain-11 of rabies virus (containing 50 FFD50) in 8-well tissue culture chamber slides and incubated at 35°C in presence of 0.5% C02 for 90 min. After the incubation period, 0.2 ml of MNA cells ( 1 x 1 05) were added to each well and the slides incubated for 40 h following which these were fixed in chilled acetone and stained with FITC conjugated anti-rabies MAb (Centocor Inc, USA) for 45 min. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan). Data was expressed as neutralizing antibody titer that is the reciprocal of the serum dilution resulting in a 50% reduction in the number of the virus infected cells in the presence of the test serum.
    2. Single cell suspensions of splenocytes in RPMI-1640 medium were prepared from plasmid DNA immunized mice, on day 45, by mechanical disruption of the spleen. Red blood cells were lysed by exposing the cell pellet to 1 OX concentration of 50 mM PBS and immediately bringing the concentration to IX PBS by addition of water. Cells were diluted to a final concentration of 3 x 106 cells/ml in RPMI-1640 medium supplemented with l 0% FCS. A 100 J.ll aliquot of splenocytes was added to each well of a 96-well microtitration plate containing serial dilutions of refolded recombinant proteins (r-bmZP1, r-dZP3 orr-rG), diluted in the same medium, as a source of antigen. All assays were carried out in . triplicates. Three days after the addition of the cells, culture were pulsed with 1 J.lCi/well of eH] thymidine (NEN, Life Science Products, Boston, MA) for 16 h. Cells were lysed and harvested onto glass fibre filaments for liquid scintillation counting (Betaplate; Wallac,
    3. weight) as a general anesthetic and ovaries were snap frozen in liquid nitrogen. Ovarian sections of 5 J.lm thickness were cut in a cryostat at -20°C and fixed in chilled methanol for 15 min at RT. Sections passing through follicles were selected, washed with 50 mM PBS and blocked with 3% normal goat serum (NGS) in PBS (v/v) at RT for 1 h. Sections were then washed two times with PBS and incubated with 1: 1 0 dilution of immune serum samples. Ovarian sections incubated with 1:10 dilution of mouse preimmune or immune sera from mice immunized with VR1020 vector served as negative controls. After incubation, the sections were washed three times with PBS and incubated with 1:800 dilution of goat anti-mouse IgG conjugated to FITC (Sigma) for 1 hat RT. The slides were washed three times with PBS, mounted in glycerol : PBS (9 : 1 ), and examined under fluorescence microscope (Optiphot, Nikon, Japan).
    4. Ability of mouse polyclonal antibodies, generated subsequent to immunization with VRbmZP1 and VRdZP3 plasmid DNA, to recognize native ZP was evaluated by indirect immunofluorescence assay. A normal cycling female bonnet monkey and a female dog were ovariectomized after administration of ketamine hydrochloride (5 mg/kg body
    5. The antibody isotypes in the immune sera were determined, by indirect ELISA, using mouse MAb isotyping reagents (Sigma). The microtitration plates coated with r-dZP3 (400 ng/well) and blocked with 1% BSA, were incubated with doubling dilution of pooled serum samples of a group of immunized animals. All the incubations were carried out at 37°Cand were followed by three washings with PBST. The incubation was followed by addition of goat anti-mouse isotype specific antibodies at 1:1000 dilution. The binding was revealed by rabbit anti-goat lgG-HRPO conjugate (Pierce) at an optimized dilution of I: 10,000 and processed for enzymatic activity estimation as described earlier.
    6. 492 run with 620 nm as the reference filter. The antibody response generated was represented as the geometric mean of the absorbance of individual mice sera in a group of immunized animals. b1 addition, the antibody titer against r-dZP3 was also determined by ELISA. The assay was carried out as described above except that 100 ~l of doubling dilutions of the serum samples (dilutions made in PBST supplemented with 0.1% BSA) were added per well in duplicate. For each serum sample tested, a reciprocal of dilution giving an absorbance of 1.0 was calculated by regression analysis and represented as antibody units (AU).
    7. Microtitration plates were coated with optimized concentration of r-bmZP1 (250 ng/well), r-dZP3 (400 ng/well) or r-rG (500 ng/well) in 50 mM PBS, pH 7.4, at 37°C for 1 h and then at 4°C, 0/N. The plates were washed once with PBS and incubated with 1% BSA, (200 Jll/ well) in PBS for 2 h at 37°C for blocking the non-specific sites. All subsequent incubations were carried out for 1 h at 37°C and each incubation was followed by three washings with PBS containing 0.05% Tween-20 (PBST). Post-blocking, the plates were incubated with 1 :50 dilution of either the preimmune or the immune serum samples obtained from mice immunized with the respective plasmid DNA. Antibodies bound tor-bmZP 1, r-dZP3 and r-rG were revealed with 1:2000 dilution of goat anti-mouse IgG (whole molecule) HRPO (Dako). Estimation of the enzymatic activity was carried out with 0.05% OPD in 50 mM citrate phosphate buffer, pH 5.0, containing 0.06% H202 as the substrate. The reaction was stopped with 50 Jll of 5 N H2S04 and the absorbance read at
    8. d) Particle delivery using the Helios gene gun A day prior to immunization, hair were removed from the abdominal region of mice using a commercial depilatory agent (Anne French cream). Two cartridges/mouse ( ~ 2 Jlg DNA) were shot under pressurized helium gas ( 400 psi) intradermally at the shaven area of the abdomen of mice using the Helios gene gun. Two boosters comprising of two cartridges each were given on days 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 Jlglmouse in saline). Mice were bled retro-orbitally on days 0, 45 and 52 for analysis of antibody response.
    9. tubing, which was cut into 0.5 inch pieces (cartridges). These cartridges were used to deliver DNA into epidermis of male/female mice. a) Preparation of DNA-gold microcarrier suspension Twenty five mg of gold microcarriers were weighed in a 1.5 ml eppendorf tube to which 100 J..Ll of 0.05 M spermidine was added and vortexed for 10 sec. To the above mixture 100 J..Ll of DNA (0.5 mg/ml) was added and vortexed for another 10 sec. While vortexing, 100 J..Ll of 1 M CaCh was added dropwise to the mixture and left at RT for 10 min to allow precipitation of DNA onto gold microcarriers. The DNA-gold pellet was collected by centrifuging at 12,000 X g for 1 min at RT. The pellet was washed thrice with 100% ethanol (freshly opened bottle), resuspended in 3 ml of 0.1mg/ml polyvinylpyrollidone (PVP) in ethanol and stored at -20°C till further use. b) Loading the DNA/microcarrier suspension into gold-coat tubing using the tubing prep station A 25 inch length of tubing was cut and fixed on tubing prep station, air dried by passing nitrogen gas through it for 15 min. The DNA/microcarrier suspension was vortexed and injected into the tubing using a 5 ml syringe and the microcarriers allowed to settle in the tubing for 3 min. Ethanol from the tubing was removed by slowly sucking into the syringe. The tubing was rotated, while passing the nitrogen gas, using the tubing prep station, for 20-30 sec to allow the microcarriers to evenly coat the inside of the tubing. c) Preparation of cartridges using the tubing cutter The tubing was cut into 0.5 inch long pieces (cartridges) by using the tubing cutter and cartridges stored at 4°C in vials containing desiccant pellets till further use.
    10. A day prior to immunization, hair were removed from both the hind limbs of the mice using a commercial depilatory agent (Anne French cream, Geoffrey Manners & Co. Ltd, Mumbai, India). Mice were immunized in a similar way as in the saline group but in addition, ten very short electric pulses were given at the site of injection immediately after DNA administration using a gas igniter (Upadhyay, 2001). Voltage delivered in each trigger was 18kV for 10-7s.
    11. Inbred male BALB/c.T mice (6-8 week, Small Experimental Animal Facility, National Institute of Immunology, New Delhi, India) were immunized intramuscularly (i.m.) with 100 J.lg of respective plasmid DNA or VR1020 vector in 100 J.ll saline (0.9% NaCl) in the anterior tibialis muscle in the hind limbs (each receiving 50 J.ll). Two booster injections of 100 J.lg DNA in saline were given on day 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 J.lg/mouse in saline). Mice were anesthetized and bled retro-orbitally on days 0, 45 and 52 for analysis of respective antibody responses.
    12. a) Purification oLin elusion bodies For the purification of inclusion bodies, the bacterial cell pellet from 1 liter culture was resuspended in 10 ml of Tris-HCl buffer (50 mM; pH 8.5) containing 5 mM EDTA and sonicated using Branson sonifier-450 for 8 cycles of 90 sec each (30 watt output; Branson Ultrasonic Corp., Danbury, CT, USA) on ice. The inclusion bodies were collected by centrifugation of the sonicate at 8000 X g for 30 min at 4°C. The pellet was washed twice with 15 ml of 50 mM Tris-HCl buffer with 5 mM EDTA containing 2% sodium deoxycholate in order to remove loosely bound E. coli proteins from the inclusion bodies. Subsequently, the inclusion body pellet was washed with 50 mM Tris-HCI buffer (pH 8.5), followed by a washing with the double distilled water. All the buffers used for the purification contained 20 mM of phenylmethyl sulphonyl fluoride (PMSF). b) Solubilization and renaturation The purified inclusion bodies were solubilized in 100 mM Tris-HCl (pH 12.0) containing 2M urea at RT for 30 min, and centrifuged at 8000 X g for 30 min at 4°C. The pH ofthe supernatant was brought down immediately to 8.5 with 1 N HCl and then extensively dialyzed against renaturation buffer (50 mM Tris-HCl buffer; pH 8.5, 1 mM EDT A, 0.1 mM reduced glutathione, 0.01 mM oxidized glutathione and 10% sucrose). The protein was finally dialyzed against 20 mM Tris-HCl, pH 8.5 and its concentration estimated using BCA.
    13. The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).
    14. For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600
    15. incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water
    16. The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent
    17. COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
    18. To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
    19. albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively
    20. Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum
    21. 6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.
    22. A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at
    23. stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells
    24. The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
    25. Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE
    26. collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.
    27. Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was
    28. The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated
    29. The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).
    30. The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.
    31. mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
    32. The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
    33. To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
    34. The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-
    35. Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.
    1. Thecapabilityofheadkidneyneutrophilstomovewasassayedbyamigration-under-agarosetechniquemodifiedfromNelsonetal.(1975).ThemethodhasbeendescribedbySaloetal.(1998).Thedistance,thecellshadmigratedfromthemarginofthewelltowardsthewellcontainingcasein(directedmigration)andintheopposite direction(randommigration)weremeasuredunderthemicroscope.
    2. Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.
    3. Thespleenswereremovedandhomogenisedindividuallythroughanylonnet(80mesh).Forisolationoflymphocytes,thetissuehomogenatewaslayeredonatwo-stepPercolldensitygradientandcentrifugedfor30minat400xg.Thelymphocyteswerecollectedatthe1.040-1.080g/cm3interface,washedtwice(400xg,10min)withrHbss,andresuspendedin2mlrRPMl.Cellswerecountedbytrypanblueexclusioninahaemocytometer(viability>95%)andthenumberoflymphocytesfrombloodandspleenwereadjustedto2x106/ml
    4. Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
    5. phosphoricacidformedisreducedbytheadditionof1-amino2napthol~4-sulphonicacid(ANSA)reagenttoproducethebluecolor.Theactivityofthebluecolorwasreadat680nmagainstreagentblankusingaU.V.Spectrophotometer.Suitablestandardswererunthrougheachbatchofassays.Theenzymeactivitywasexpressedintermsofpgofinorganicphosphorusformedhr'1mg'1protein.
    6. Aftereffluentexposure,thecontrolandeffluentexposedfishtissueswereremovedandplacedinabeakercontainingice-coldSEIbuffer(300mMsucrose,200mMNa2EDTA,50mMimidazole,pH7.23)foranalysisofNa+-K+ATPaseactivity.ThetissueswereimmediatelyfrozeninliquidN2andstoredat-80°Cuntilanalyzed. Thespecificactivitiesofsodium,potassium,magnesiumandcalciumdependentATPaseswereassayedaccordingtothemethodsdescribedbyWatsonandBeamish(1980)and Boeseetal.(1982).AdenosinetriphosphatasecatalysestheconversionofATPandADP.Duringthisconversion,onemolecule ofphosphorusisliberated.ATPaseAdenosinetriphosphate^...^Adenosinediphosphate+PTheinorganicphosphorusliberatedwasassayedaccordingtothemethodofFiskeandSubbarow(1925).Inthismethodtheproteinisprecipitatedwithtrichloroaceticacid.Theproteinfreefiltrateistreatedwithaceticacidmolybdatesolutionandthe
    7. Thereactionproduction,p-nitrophenolinacidphosphatewasmeasuredspectrophotometricallyat415nmagainstreagentblank.Theenzymeactivitywascalculatedfromthestandardcurveandexpressedasmicromolesofp-nitrophenolformedperhourpermilligramprotein.Therateofhydrolysisofp-nitrophenolphophateisproportionaltotheenzymepresentinthetissue.p-nitrophenylphosphate+NaoH—phosphat?-—>p -nitrophenol+phosphateThecolordevelopedinalkalinephosphataseactivitywasreadat410nmagainstreagentblankspectrophotometrically.Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein
    8. LDHisthekeyenzymeinvolvedinglycolysis,andisresponsiblefortheanaerobicconversionofpyruvicacidtolacticacid,theterminalstageintheEmbden-Meyerhofpathway.Theenzymeactivitywasdeterminedinthecontrolandeffluentexposedfishbrain,gill,muscle,liver,heart,kidneyandair-breathingorgansfollowingSrikantanandKrishnamurthi(1955).TheopticaldensitiesweremeasuredinaUVSpectrophotometerusing340 nmfilterandtheresultsare expressedaspmolesofformazanmg'1proteinhr’1
    9. Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1
    10. Aftereffluentexposure,thetissuesweredissectedout,weighedandhomogenizedin0.25Msucrose.Thehomogenateswerecentrifugedat10,000rev/minatatemperaturebelow8°C.AcetylcholinesteraseactivityofthesampleswasdeterminedatpH7.0usingafinalhomogenateconcentrationof25mgmf1at10°CwithmMacetylcholineiodideassubstrate and0.001or0.002NsodiumhydroxideastitrantfollowingHestron’smethodasgivenbyMetcalf(1951).ProteindeterminationsforalltheChEanalyseswereconductedonaliquotsofthehomogenatesusingamodificationoftheLowryetal.(1951)method.AchEactivityisexpressedinpmolesofacetylcholinechloridehydrolysedmgtissue'1hr'1
    11. Aftertheperiodofexposure,thecaudalfinwasseveredtogetthebloodforsmearing.BufferedLeishman'sstainofpH6.8gaveexcellentresults.Theworkreportedhereisbasedontheanalysisofslidesoffishestreatedwith7%effluentconcentrationsastheobservedchangesaremaximuminthesefishes.
    12. Bloodsampleswereobtainedbycuttingthecaudalpeduncleandanalysedforlacticacidusinganenzymatictechnique(SigmaCo,1974)MeasurementsweremadeinQuartzcuvettesat340nmwithaBeckmanAVSpectrophotometer.Standardcurvesweremadeonthedaythebloodlacticaciddeterminationsweremade.
    13. BloodglucosewasestimatedbyFolin-Wumethod(KlontzandSmith,1968).Glucoseonboilingwithalkalinecoppersolution,reducescopperfromthecuprictothecuprousstate(cuprousoxide).Thecuprousoxidesoformedreducesphosphomolybdicacidtothebluecoloredmolybdenumblue,whichismeasuredcolorimeterically.TheintensityofthebluecolorisproportionaltoglucoseconcentrationanditiscolorimetricallydeterminedinaBoschandLombSpectrophotometerat620nm
    14. MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC
    15. BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated
    16. Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes
    17. HaemoglobinwasdeterminedbySahlimethod.HaemoglobinisconvertedtoacidhaematinbytheactionofHC1.Theacidhaematinsolutionisfurtherdilutedwiththeaciduntilitscolormatchesexactlythatofthepermanentstandardofthecomparatorblock.TheHbconcentrationisreaddirectlyfromthecalibrationcurve.
    18. TheO2consumptionofthetissueswasmeasuredbymanometrictechniquesinaWarburgconstantvolumerespirometer(Gallenkemp,England)aspertheproceduresgivenbyUmbreitetal.(1959).Thecontrolandeffluentexposedfisheswerekilledandthebrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereisolated.ThetissueswereslicedandplacedinWarburgflasks(60-80mgtissuesflask)containing2.5mloffishringersolutionwithphosphatebufferatpH7.5asthesuspensionmediumforthetissuesand0.2ml15%KOH.Temperaturewas28°CduringO2uptakedetermination.Inordertocomparedatafromthedifferentseriesoftreatment,arespiratoryindexwascalculatedusingthefollowingformula:KO2treated-KO2controlr=100-------------------------------------x100KO2controlWhere,K=O2consumptioninpi/100mgwettissue/hrThisindexindicatespercentrespirationoftreatedtissuesrelatedtothecontrolvalues ofthesameseries.
    19. ThecircadianrhythmofbimodalO2uptakeofcontrolandeffluenttreatedfisheswerestudiedseparatelyat28°±1°C.TheamountsofO2extractedfromwaterandairwereseparatelydeterminedforadayatregularintervalsof3hreach.TotalO2uptakeateachtimewasobtainedbysummingupthevaluesforaquaticandaerialrespirationobtainedatthecorrespondingtime.Throughoutthepresentstudy,theinitialO2contentofthewaterwaskeptconstant(6±0.5mgF1)
    20. Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm
    21. Theexperimentalsetup(Figure8and9)forthedeterminationofO2uptakesimultaneouslyfromairandwaterwassimilartothatusedearlierbyNatarajan(1972),Rani(1994)andVijayalakshmi(1996).Aclosedglassrespirometerof5litrecapacitywasfilledwith3.5litrefreshtapwater.Athermocolfloatwithasemicircularholeatitsperipherywasplacedoverthewater,whichseparatedtheair-waterinterphaseoftherespirometer.Theair-phaseoftherespirometerwasattachedtoafluidmanometer.Asthefishcomestothewatersurfaceandtakesair-gulp,thereisapressurechangeintheair-phasecausinganimbalanceinthemanometricfluid.AgraduatedsyringefilledwithpureO2(takenfrommedicalO2cylinder)isusedtorestoretheimbalanceofthemanometricfluid.TheamountthusneededshowstheaerialO2uptakeofthefish.TheexpiredCO2wasabsorbedbythepelletsofKOHinthepetridishoverthemanometricfluid.Theconcentrationofdissolvedoxygenoftheambientwaterwasestimatedbefore andaftertheexperimenttomeasuretheaquaticO2uptakebythefish.ThedifferenceintheDOandtheamountofwaterindicatestheactualaquaticO2uptake.Winkler’svolumetricmethod(Welch,1948)wasusedtoestimatetoDOofthewatersamples.Darkenedrespiratorychamberswereusedwithdimensionsthatwereclosetothoseofthefishinorderthatthefishshouldremaininmoreorlessthesamepositionbut havesufficientroomtomoveitsopercula.Theflowofwaterthroughtherespirometer wasregulatedandmeasuredbymeansofaflowmeter.APhilipsO2electrode(PI1056)waskeptinawaterjacketmaintainedatthesametemperatureastheclosedcirculation.SamplesoftheinflowandoverflowwatercouldalsobeledovertheO2electrode
    22. Theexperimentalfishwasacclimatedtoglassrespirometersforabout24hrandtheywerenotgivenanyfoodduringthisperiod.TheeffluentexposedfishesalongwiththecontrolsweresubjectedtoO2consumptionseparately.Theexperimentswereperformedinaninsulatedroombetween8to10AMwithlightson.TherateoftotalO2uptakethroughgillsfromflowingwaters(DO=7.2mg021'1)wasmeasuredinfishesofdifferent body weights.Forthis,acylindricalglassrespirometerof2litrecapacitywasused.Thefishwasintroducedintherespirometerwhichwasconnectedtoalargeconstantlevelwatertanktomaintaintheflowofwaterunderconstanthydrostaticpressure.Thewaterenteredtherespirometeratonesideanditsflowperminutewasmeasuredasitlefttheotherside.Theflowwasadjustedaccordingtothesizeofthefish.Thefishwasacclimatizedtotherespirometeratleast12hrbeforereadingswere taken.ConcentrationofdissolvedoxygeninthesampleswasmeasuredbyWinkler’svolumetricmethod(Welch,1948).ThedifferenceinO?levelsbetweentheambientwaterandthatsuppliedtotherespirometeraswellaswiththerateofwaterflowandtheweightofthefishwasusedtocalculatetherateof O2uptakeintermsoftime(ml02hr'1)withthehelpoftheequation:V02=Vw(Ci02CE02)Where,VO2=02uptake(ml02hr'1)Vw=water(mlm'1)andCi02-CE02respectivelythe02concentrationofinletandoutletwaters.Arespirometercontainingnoanimalsservedasacontrolforadjustingcalculationsfor02uptakeinthewater.Uponremoval,fisheswereblottedwithpapertoweling, andweighed
    23. SamplesofC.punctataweretakenfromtheacclimationtanksandslightlyblottedonpapertowelstoremoveexcesswater.TheywereplacedindividuallyonaWhatmanfilterpaperinaonelitreglassbeaker.Theindividualswereimmediatelytransferredtobigglassdesiccatorscontaining250mlofthefollowingsolutionsfordesiredhumiditylevelsusinggradedsolutionsofKOHasdescribedbySolomon(1951).Watergiving95to97%relativehumidity(RH),mean95%;sodiumchloridegiving72to76%relativehumidity,mean75%;calciumchloridegiving28to31%relativehumidity,mean35%.Thedesiccatorswereplacedinanincubatorataconstanttemperatureof28°±1°Cwithdeterminationsofsurvivalandbodyweightatregularintervals.Thecontainerswereweighedatintervalstothenearest0.1mgandweightlosswasassumedtoequalwater loss
    24. Thefishessurvivedwithoutanymortalityintheeffluentconcentration ofnominalvalues2%,5%and7%.The30,60,90and120dayschronicexposurewith20fishaddedrandomlytoeachof60by40by240cmplastictankswasbegunwithfishfromthesameoriginastheseandintheinitialacutebioassays.Flowratesmaintainedtothetanksallowedfor twovolumesturnovers24hr.
    25. Thefisheswereexposedtodifferentconcentrationsofeffluentandthenumberoffishineachconcentrationwasrecorded.Thedataweresubjectedtoprobitanalysis(Finney,1964)andDragstedtandBehven’sequation(Carpenter,1975)todetermineLC50values.Apresumableharmlessconcentration(C)oftheeffluentwasalsocalculatedbyusingthesafefactororapplicationfactor(Sprague,1971)employingtheformulaC=Where,48hrLC50xAS24 hrLC50S= -------------------48hr LC50A=0.3(constant)Thesafeconcentrationisausefulunitofmeasurementofacceptableamountoftheeffluent,whichhasnolethalityandstresstotheanimalexposed.Approximately1/3ofLCsoofvalueofeffluentwasselectedassublethalconcentrationinthepresentstudy.Fishesweredividedinto4groupsandkeptin401glassaquariacontaining wellwaterofpH7.2.GroupI,IIandIDwerekeptin2%,5%and7%ofeffluents(Figure7)respectivelyandexposedto24,48and72(short-term)periods.Allacutelethalitytestswereconductedaccordingtothe methodsofthe AmericanPublicHealthAssociation(1985).GroupIVservedascontrol.
    26. Thetapwaterusedforacclimationandexperimentationhadthefollowingaveragecharacteristics:temperature(28°-30°C),pH(7.2-7.4),dissolvedoxygen(7.8-8.0ppm),CO2(2.08mll'1),salinity(0.190gF1)hardness(154ppmasCaCCF?),alkalinity(68ppmasCaC03)andconductivity(0.56mMhos).
    27. Thefisheswerefedadlibitumwithboiledhen’seggsontwodaysinaweekandearthwormsontheremainingdays.Feedingwasstopped24hrpriortoexperimentation.Noprophylactictreatmentforanydiseaseproblemwasnecessaryatanytimeduring acclimationandtest
    28. Theywereheld(28°±0.5°C;naturalphotoperiod)in240litretapwatertanks(1x1x0.3m)andacclimatedtothelaboratoryconditionsforaweekbeforeexperimentation.Agentlecontinuouswaterflowwasmaintainedthroughtheaquariaforconstantwaterrenewal.

    Tags

    Annotators

    URL

    1. 54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
    2. until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4
    3. Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing
    4. smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
    5. fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
    6. GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
    7. Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
    8. Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}
    9. Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).
    1. otal RNA was isolated from cell lines after 48 hrs of transfection using trizol (Invitrogen, U.S.A.). 32p labeled antisense HBx mRNA was in vitro transcribed using T7 RNA Polymerase and Riboprobe kit (Promega, U.S.A.), as described earlier. For generating antisense HBx probe, plasmid DNA was linearized with Bam HI and subjected to transcription. Total RNA was quantitated and equal concentration (15-20 pg) was loaded after adding loading dye (50%glycerol, 1 mM EDTA, 0.25% bromophenol blue, 0.25% xylene cyanol FF) on 1% formaldehyde-agarose gel and 1X MOPS was used as the running buffer. The gel was then run at 5 V /em length of the gel. The gel was then treated with 2.5% HCl for 15 min for depurination, 0.4N NaOH for another 15 min and then in 3 M sodium acetate for 15 min, before the transfer was set. Also the nylon membrane prior to transfer was first treated with distilled water for 5 min and then in 0.4 N NaOH for 20 min. The overnight transfer was set up using 20X sse buffer as the transfer buffer at room temperature. Thereafter, the membrane was cross-linked by uv and then dipped in 2X sse for 20 min. For pre-hybridization the membrane was soaked in Rapid hybridization buffer (Amersham Biosciences, U.K.) for 2 hr at 65oC in the hybridizing oven. The probe was then added and further incubation for 4 hrs was carried out. Post hybridization the membrane was washed thrice with 6X sse at 37oC on a shaker. The membrane was then dried on a filter paper and wrapped in a saran wrap. The membrane was then analyzed by autoradiography. For ensuring the equal loading, the formaldehyde-agarose gel was also stained with EtBr for 23s and 18s rRNA