10,000 Matching Annotations
  1. Apr 2025
    1. Reviewer #2 (Public review):

      Summary:

      In this paper, Andriani and colleagues are examining the potential role of Zn flux in sperm and its effect on Slo3 channels. This is an interesting question that is likely critical to how sperm function properly and Slo3 channels are a possible candidate for a downstream molecule that is impacted by Zn. In this paper, the authors use Zn imaging, sperm motility assays, and electrophysiology to show that Zn flux impacts sperm function. They then go on to look at the impact Zn has on Slo3 current and propose a binding site based on MD simulations. While the ideas are interesting, the experiments are not well described in many places making understanding the results very difficult. In addition, critical controls are missing throughout the paper.

      Strengths:

      The question of how Zn flux impacts membrane potential and sperm motility is an important one. Moreover, Slo3 presents an interesting candidate or the target of Zn regulation. The combination of methods used here also has the potential to uncover mechanisms of Zn regulation of Slo3.

      Weaknesses:

      Much of the paper lacks experimental description which makes interpretation quite difficult, or a detailed discussion is missing. Examples include:

      (1) Figure 1, particularly the Zn imaging, is not sufficiently described. How is the fluorescence intensity measured? A representative ROI? The whole tail and head? Are the sperm immobile? If not, there is evidence that motion artifacts can significantly distort these sorts of measures from Calcium measurements in Cilia. Were there controls done? Is the small amount of Zn seen in the tail above the background?

      (2) The second half of Figure 1 is also not well described. What is the extracellular solution in the recordings? When you apply the Zn ionophore, do you expect influx or efflux? I assume efflux is based on the conclusions but this should be discussed explicitly.

      (3) Figure 2H labels the Y axis, "normalized current". Normalized to what? Why do neither of the curves end at 1? A better description of what this figure represents is needed.

      (4) The alpha fold simulations are not well described. How many Zn binding sites were found? Are all of the histidine mutations in Figure 4 Supplement 1 the ones that were found?

      (5) There is no discussion of physiological intracellular Zn concentration. How much Zn is inside the sperm? How much if likely Free vs buffered? Is 100uM a reasonable physiological concentration?

      There are a number of areas where the interpretation is not well supported by the data including:

      (6) You say in the Figure 4 supplement, that "we did not observe any significant decrease in the percentage of current inhibition." But that is a pretty misleading statement. There are large changes (increases) in the amount of zinc inhibition. These might be allosteric changes but I don't think you can safely eliminate these as relevant Zn binding sites. Also, some of these mutations appear to allow at least some unbinding of Zn.

      (7) Following up on the above point, it seems unfair to conclude that the D162S, E169A, and E205 mutants are part of the inhibitory binding site for Zn when the mutation has no effect on inhibition and only an effect on the washout. The mutations on the intracellular side also had an impact on the washout so it seems equally likely that they are the critical residues based on your data.

      (8) Nowhere in the paper do you make the specific link between Zn flux and membrane hyperpolariation via Slo3. You show that Zn flux changes the ability of the sperm to hyperpolarize and you show that Slo3 is inhibited by Zn but the connection between the two is not demonstrated. There appears to be a specific Slo3 blocker. If you use this in sperm, do you no longer see the Zn effect?

      (9) In the second half of Figure 1, the authors suggest that there is "no hyperpolization in 100uM Zn. That is not really true. It is reduced but not absent.

      (10) The claim that Lrcc52 with Slo3 shows a higher current inhibition at pH 7.5 than pH 8 is not well supported because there are only 3 replicates in the 7.5 case. In addition, the claim is made in the test that 100uM ZnCl2 "already inhibited mSlo3+Lrcc52 at pH7.5", contrasted with mSlo3 alone, is not tested statistically.

      In a number of places, better controls are needed.

      (11) How specific is this effect for Zn? Mg2+, for instance, is also a divalent cation that is in the hundreds of uM range inside the cell. Does it exert the same effect? Each ion certainly has unique preferred coordination geometries, does your predicted binding with MD show what you might expect for tetrahedral coordination with Zn? Did you test other divalent cations functionally or in silicon?

      (12) For the VCF experiments, a significantly higher concentration of Zn was used (10mM). What is the reason for this? There is no discussion of how much a "puff" is. Assuming you are using the RNA injector it is probably on the order of 50nL or less. Assuming the volume of an oocyte is 1uL that would argue that the final concentration is 500uM or higher. But this is also complicated by potential local effects of high Zn at the injection site, artifacts of injecting that much metal, and the fact that a great deal of the Zn will likely be bound to other things inside the cell. Better controls are needed for this experiment.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors report on the genomic correlates of the transition to the pathogenic lifestyle in Sordariomycetes. The pathogenic lifestyle was found to be better explained by the number of genes, and in particular effectors and tRNAs, but this was modulated by the type of interacting host (insect or not insect) and the ability to be vectored by insects.

      Strengths:

      The main strength of this study lies in the size of the dataset, and the potentially high number of lifestyle transitions in Sordariomycetes.

      Weaknesses:

      The main strength of the study is not the clarity of the conclusions.

      (1) This is due firstly to the presentation of the hypotheses. The introduction is poorly structured and contradictory in some places. It is also incomplete since, for example, fungus-insect associations are not mentioned in the introduction even though they are explicitly considered in the analyses.

      (2) The lack of clarity also stems from certain biases that are challenging to control in microbial comparative genomics. Indeed, defining lifestyles is complicated because many fungi exhibit different lifestyles throughout their life cycles (for instance, symbiotic phases interspersed with saprotrophic phases). In numerous fungi, the lifestyle referenced in the literature is merely the sampling substrate (such as wood or dung), which doesn't mean that this substrate is a crucial aspect of the life cycle. This issue is discussed by the authors, but they do not eliminate the underlying uncertainties.

    1. Reviewer #2 (Public review):

      Summary:

      The paper introduces the IBEX Knowledge-Base (KB), a shared online resource designed to help scientists working with immunofluorescence imaging. It acts as a central hub where researchers can find and share information about reagents, protocols, and imaging methods. The KB is not static like traditional publications; instead, it evolves as researchers contribute new findings and refinements. A key highlight is that it includes results of both successful and unsuccessful experiments, helping scientists avoid repeating failed experiments and saving time and resources. The platform is built on open-access tools ensuring that the information remains available to everyone. Overall, the KB aims to collaboratively accelerate research, improve reproducibility, and reduce wasted effort in imaging experiments.

      Strengths:

      (1) The IBEX KB is built entirely on open-source tools, ensuring accessibility and long-term sustainability. This approach aligns with FAIR data principles and ensures that the KB remains adaptable to future advancements.

      (2) The KB also follows strict data organization standards, ensuring that all information about reagents and protocols is clearly documented and easy to find with little ambiguity.

      (3) The KB allows scientists to report both positive and negative results, reducing duplication of effort and speeding up the research process.

      (4) The KB is helpful for all researchers, but even more so for scientists in resource-limited settings. It provides guidance on finding affordable alternatives to expensive or discontinued reagents, making it easier for researchers with fewer resources to perform high-quality experiments.

      (5) The KB includes a community discussion forum where scientists can ask for advice, share troubleshooting tips, and collaborate with others facing similar challenges.

      Weaknesses:

      (1) The potential impact of IBEX KB is very clear. However, the paper would benefit by also discussing more on KB maintenance and outreach, and how higher participation could be incentivized.

      (2) Use of resources like GitHub may limit engagement from non-coding members of the scientific community. Will there be alternative options like a user-friendly web interface to contribute more easily?

    1. Reviewer #2 (Public review):

      Summary:

      The authors harness single-cell RNAseq data from zebrafish and mice to identify Oct4 as a candidate driver of neurogenesis. They then use adeno-associated virus vectors to show that while Oct4 overexpression alone converts rare adult Müller glia (MG) to bipolar cells, it synergizes with Notch pathway inhibition to cause this neurogenesis (achieved by Cre-mediated knockout of Rbpj floxed allele). Importantly, they genetically lineage-mark adult MG using a GLAST-CreER transgene and a Sun-GFP reporter, so that any non-MG cells that convert can be identified unambiguously. This is crucial because several high-profile papers made erroneous claims using short promoters in the viral delivery vector itself to mark MG, but those promoters are leaky and mark other non-MG cell types, making it impossible to definitively state whether manipulations studied were actually causing neurogenesis, or were merely the result of expression in pre-existing neurons. Once the authors establish Oct4 + RbpjKO synergy they use snRNAseq/ATACseq to identify known and novel transcription factors that could play a role in driving neurogenesis.

      Strengths:

      The system to mark MG is stringent, so the authors are studying transdifferentiation, not artifactual effects due to leaky viral promoters. The synergy between Oct4 and Notch pathway blockade is notable. The single-cell results add the potential involvement of new players such as Rfx4 in adult-MG-neurogenesis.

      Weaknesses:

      The existing version is difficult to read due to an unusually high number of text errors (e.g. references to the wrong figure panels etc.). A fuller explanation for the fraction of non-MG cells seen in control scRNAseq assays is required, particularly because the neurogenic trajectory which is enhanced in the Oct4/Rbpj-KO context is also evident in the control retina. Claims regarding the involvement of transcription factors in adult neurogenesis (such as Rfx4) need to be toned down unless they are backed up with functional data. It is possible that such factors are important, but equally, they may have no role or a redundant role, and without functional tests, it's impossible to say one way or the other.

      Overall, the authors achieved what they set out to do, and have made new insights into how neurogenesis can be stimulated in MG. Ultimately, a major long-term goal in the field is to replace lost photoreceptors as this is most relevant to many human visual disorders, and while this paper (like all others before it) does not generate rods or cones, it opens new strategies to coax MG to form a related neuronal cell type. Their approach underscores the benefits of using a gold-standard approach for lineage tracing.

    1. Reviewer #2 (Public review):

      Summary:

      In this observational study, Barth et al. investigated the association between menopausal hormone therapy and brain health in middle- to older-aged women from the UK Biobank. The study evaluated detailed MHT data (never, current, or past user), duration of mHT use (age first/last used), history of hysterectomy with or without bilateral oophorectomy, APOEE4 genotype, and brain characteristics in a large, population-based sample. The researchers found that current mHT use (compared to never-users), but not past use, was associated with a modest increase in gray and white matter brain age gap (GM and WM BAG) and decrease in hippocampal volumes. No significant association was found between the age of mHT initiation and brain measures among mHT users. Longer duration of use and older age at last MHT use post-menopause were associated with higher GM and WM BAG, larger WMH volumes, and smaller hippocampal volumes. In a sub-sample, after adjusting for multiple comparisons, no significant associations were found between detailed mHT variables (formulations, route of administration, dosage) and brain measures. The association between mHT variables and brain measures was not influenced by APOEE4 allele carrier status. Women with a history of hysterectomy with or without bilateral oophorectomy had lower GM BAG compared to those without such history. Overall, these observational data suggest that the association between mHT use and brain health in women may vary depending on the duration of use and surgical history.

      Strengths:

      The study has several strengths, including a large, population-based sample of women in the UK, and comprehensive details of demographic variables such as menopausal status, history of oophorectomy/hysterectomy, genetic risk factors for Alzheimer's disease (APOE ε4 status), age at mHT initiation, age at last use, duration of mHT, and brain imaging data (hippocampus and WMH volume).

      In a sub-sample, the study accessed detailed mHT prescription data (formulations, route of administration, dosage, duration), allowing the researchers to study how these variables were associated with brain health outcomes. This level of detail is generally missing in observational studies investigating the association of mHT use with brain health.

      Weaknesses:

      While the study has many strengths, it also has some weaknesses. These weaknesses were properly discussed throughout the article. The manuscript has indicated that the need of mHT use which might be associated with these symptoms may be indicators of preexisting neurological changes, potentially reflecting worse brain health scores, including higher BAG and lower hippocampal volume and/or higher WMH. The authors noted that the UK Biobank lacks detailed information on menopausal symptoms and perimenopausal staging, limiting the study's ability to understand how these variables influence outcomes. The authors also highlighted that these results don't reflect causal relationships. The authors caution that these findings should not guide individual-level decisions regarding the benefits versus risks of mHT use. However, the study raises new questions that should be addressed by randomized clinical trials to investigate the varying effects of MHT on brain health and dementia risk.

    1. Reviewer #2 (Public review):

      The authors have conducted a valuable comparative analysis of perturbation responses in three nonlinear kinetic models of E. coli central carbon metabolism found in the literature. They aimed to uncover commonalities and emergent properties in the perturbation responses of bacterial metabolism. They discovered that perturbations in the initial concentrations of specific metabolites, such as adenylate cofactors and pyruvate, significantly affect the maximal deviation of the responses from steady-state values. Furthermore, they explored whether the network connectivity (sparse versus dense connections) influences these perturbation responses. The manuscript is reasonably well written.

      Comments on latest version:

      The authors have adequately addressed my concerns.

    1. Reviewer #2 (Public review):

      Park et al. set out to test two competing hypotheses about the role of the medial prefrontal cortex (PFC) in cognitive control, the ability to use task-relevant cues and ignore task-irrelevant cues to guide behavior. The "central computation" hypothesis assumes that cognitive control relies on computations performed by the PFC, which then interacts with other brain regions to accomplish the task. Alternatively, the "local computation" hypothesis suggests that computations necessary for cognitive control are carried out by other brain regions that have been shown to be essential for cognitive control tasks, such as the dorsal hippocampus and the thalamus. If the central computation hypothesis is correct, PFC lesions should disrupt cognitive control. Alternatively, if the local computation hypothesis is correct, cognitive control would be spared after PFC lesions. The task used to assess cognitive control is the active place avoidance task in which rats must avoid a sector of a rotating arena using the stationary room cues and ignoring the local olfactory cues on the rotating platform. Performance on this task has previously been shown to be disrupted by hippocampal lesions and hippocampal ensembles dynamically represent the room and arena depending on the animal's proximity to the shock zone. They found no group (lesion vs. sham) differences in the three behavioral parameters tested: distance traveled, latency to enter the shock zone, and number of shock zone entries for both the standard task and the "conflict" task in which the shock zone was rotated by 180 degrees. The only significant difference was the savings index; the lesion group entered the new shock zone more often than the sham group during the first 5 minutes of the second conflict session. This deficit was interpreted as a cognitive flexibility deficit rather than a cognitive control failure. Next, the authors compared cytochrome oxidase activity between sham and lesion groups in 14 brain regions and found that only the amygdala shows significant elevation in the lesion vs. sham group. Pairwise correlation analysis revealed a striking difference between groups, with many correlations between regions lost in the lesion group (between reuniens and hippocampus, reuniens and amygdala and a correlation between dorsal CA1 and central amygdala that appeared in the lesion group and were absent in the sham group. Finally, the authors assessed dorsal hippocampal representations of the spatial frame (arena vs. room) and found no differences between lesion and sham groups. The only difference in hippocampal activity was reduced overdispersion in the lesion group compared to the sham group on the pretraining session only and this difference disappeared after the task began. Collectively, the authors interpret their findings as supporting the local computation hypothesis; computations necessary for cognitive control occur in brain regions other than the PFC.

      Strengths:

      The data were collected in a rigorous way with experimental blinding and appropriate statistical analyses.<br /> Multiple approaches were used to assess differences between lesion and sham groups, including behavior, metabolic activity in multiple brain regions, and hippocampal single unit recording.

      Weaknesses:

      Only male rats were used with no justification provided for excluding females from the sample.

      The conceptual framework used to interpret the findings was to present two competing hypotheses with mutually exclusive predictions about the impact of PFC lesions on cognitive control. The authors then use mainly null findings as evidence in support of the local computation hypothesis. They acknowledge that some people may question the notion that the active place avoidance task indeed requires cognitive control, but then call the argument "circular" because PFC has to be involved in cognitive control. This assertion does not address the possibility that the active place avoidance task simply does not require cognitive control.

      The authors did not link the CO activity with the behavioral parameters even though the CO imaging was done on a subset of the animals that ran the behavioral task nor do they make any attempt to interpret these findings in light of the two competing hypotheses posed in the introduction. Moreover, the discussion is lacking any mechanistic interpretations of the findings. For example, there are no attempts to explain why amygdala activity and its correlation with dCA1 activity might be higher in the PFC lesioned group.

      Publishing null results is important to avoid wasting animals, time, and money. This study's results will have a significant impact on how the field views the role of the PFC in cognitive control. Whether or not some people reject the notion that the active place avoidance task measures cognitive control, the findings are solid and can serve as a starting point for generating hypotheses about how brain networks change when deprived of PFC input.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Obray et al. entitled "Adolescent alcohol exposure promotes mechanical allodynia and alters synaptic function at inputs from the basolateral amygdala to the prelimbic cortex" investigated how adolescent intermittent ethanol exposure (AIE) affects the BLA -> PL circuit, with an emphasis on PAG projecting PL neurons, and how AIE changes mechanical and thermal nociception. The authors found that AIE increased mechanical, but not thermal nociception, and an injection of an inflammatory agent did not produce changes in an ethanol-dependent manner. Physiologically, a variety of AIE-specific effects were found in PL neuron firing at BLA synapses, suggestive of AIE-induced alterations in neurotransmission at BLA-PVIN synapses.

      Strengths:

      This was a comprehensive examination of the effects of AIE on this neural circuit, with an in-depth dissection of the various neuronal connections within the PL.

      Sex was included as a biological variable, yet, there were little to no sex differences in AIE's effects, suggestive of similar adaptations in males and females.

      Comments on revisions:

      The authors addressed the reviews from the first submission which has substantially strengthened the conclusions of the study, including acknowledgement of unanswered questions for future studies to address.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide an important summary of ten years of Brain Initiative funding including a description of the historical development of the initiative, the specific funding mechanisms utilized, and examples of grants funded and work produced. The authors also conduct analyses of the impact on overall funding in Systems and Computational Neuroscience, the raw and field normalized bibliographic impact of the work, the social media impact of the funded work, and the popularity of some tools developed.

      Strengths:

      This is a useful perspective on an important funding initiative over a ten-year period. It is clearly written and the illustrations and analyses are mostly useful for understanding the impact of the initiative.

      Weaknesses:

      The major limitation is that the bibliographic analysis does not provide a comparison group of funded grants. Because work that successfully competes for funding is likely to be more impactful than all work in a given area, the normalization of citations to field medians may reflect this "grant review" effect, rather than anything special about the Brain Initiative. Hopefully, this speculation is incorrect (I would guess that it is), but it would be helpful to try to demonstrate this more directly by including a funded comparison group.

      There are also minor inconsistencies in the numbering of the figures that need to be cleared up.

    1. Reviewer #2 (Public review):

      Summary:

      The authors review the history of the team projects within the Brain initiative and analyze their success in progression to additional rounds of funding and their bibliographic impact.

      Strengths:

      The history of the team projects and the fact that many had renewed funding and produced impactful papers is well documented.

      Weaknesses:

      The core bibliographic and funding impact results have largely been reported in the companion manuscript and so represent "double dipping" I presume the slight disagreement in the number of grants (by one) represents a single grant that was not deemed to address systems/computational neuroscience. The single figure is relatively uninformative. The domains of study are sufficiently large and overlapping that there seems to be little information gained from the graphic and the Sankey plot could be simply summarized by rates of competing success.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Mondal and co-authors present the development of a computational model of homeostatic plasticity incorporating activity-dependent regulation of gating properties (activation, inactivation) of ion channels. The authors show that, similar to what has been observed for activity-dependent regulation of ion channel conductances, implementing activity-dependent regulation of voltage sensitivity participates in the achievement of a target phenotype (bursting or spiking). The results however suggest that activity-dependent regulation of voltage sensitivity is not sufficient to allow this and needs to be associated with the regulation of ion channel conductances in order to reliably reach the target phenotype. Although the implementation of this biologically relevant phenomenon is undeniably relevant, the main conclusions of the paper and the insights brought by this computational work are difficult to grasp.

      Strengths:

      (1) Implementing activity-dependent regulation of gating properties of ion channels is biologically relevant.

      (2) The modeling work appears to be well performed and provides results that are consistent with previous work performed by the same group.

      Weaknesses:

      (1) The writing is rather confusing, and the state of the art explaining the need for the study is unclear.

      (2) The main outcomes and conclusions of the study are difficult to grasp. What is predicted or explained by this new version of homeostatic regulation of neuronal activity?

    1. Reviewer #2 (Public review):

      Summary

      This paper reports histological, PET imaging, functional, and behavioural data evaluating the longevity of AAV2 infection in multiple brain areas of macaques in the context of DREADD experiments. The central aim is to provide unprecedented information about how long the expression of HM4di or HM3dq receptors is expressed and efficient in modulating brain functions after vector injections. The data show peak expression after 40 to 60 days of vector injection, and stable expressions for up to 1.5 years for hM4di, and that hM3dq remained mostly at 75% of peak after a year, declining to 50% after 2 years. DREADDs effectively modulated neuronal activity and behaviour for approximately two years, evaluated with behavioral testings, neural recordings, or FDG-PET. A statistical evaluation revealed that vector titers, DREADD type, and tags contribute to the measured peak level of DREADD expression.

      The article presents a thorough discussion of the limitations and specificities of chemogenetic approaches in monkeys.

      Strength

      These are unique data, in non-human primates (NHP), an animal model that not only features physiological and immunological characteristics similar to humans but also contribute to neurobiological functional studies on a long timescale with experiments spanning months or years. This evaluation of the long-term efficacy of DREADDs will be very important for all laboratories using this approach in NHP but also for future use of such approach in experimental therapies. The longevity estimates are based on multiple approaches including behavioural and neurophysiological ones, thus providing information on the functional efficacy of DREADD expression.

      Performing such evaluation requires specific tools like PET imaging that very few monkey labs have access to in the world. This study was done by the laboratory that has developed the radiotracer c11-DCZ used here, a radiotracer binding selectively to DREADDs and providing, using PET, quantitative in vivo measures of DREADD expression. This study and its data should thus be a reference in the field, providing estimates to plan future chemogenetic experiments.

      Publishing databases of experimental outcomes in NHP DREADD experiments is crucial for the community because such experiments are rare, expensive, and long. It contributes to refining experiments and reducing the number of animals overall used in the domain.

      Weaknesses

      This study is a meta-analysis of several experiments performed in one lab. The good side is that it combined a large amount of data that might not have been published individually; the downside is that all things were not planned and equated, creating a lot of unexplained variances in the data. This was yet judiciously used by the authors, but one might think that planned and organized multicentric experiments would provide more information and help test more parameters, including some related to inter-individual variability, and particular genetic constructs.

    1. Reviewer #2 (Public review):

      In addition to the study by Kaletsky et al. (2025), I read the bioRxiv and eLife versions, as well as the eLife reviewer comments, for Gainey et al. (2024), to which Kaletsky et al. respond.

      Kaletsky et al. provide detailed, rigorous, and reproducible protocols and results. The authors point out the critical methods that the Hunter group failed to follow/confirm (e.g. azide to paralyze animals during pathogenic learning/memory assays; the expression of the P11 small RNA that is both necessary and sufficient for TEI of avoidance behavior; a single condition for training - PA14 grown on plates at 25°C and training at 20°C for 24 hr - that the Hunter lab did not follow and could not reproduce). The Kaletsky et al. response is evidence-based, fair, level-headed and unbiased, which is in contrast to the Gainey et al. paper.

      Reading the eLife review of Gainey et al., I note that the reviewers repeatedly pointed out that authors did not follow published protocols by the Murphy lab.

      Public response by Gainey et al. to Reviewer 2: "It remains possible that we misunderstood the published Murphy lab protocols, but we were highly motivated to replicate the results so we could use these assays to investigate the reported RNAi-pathway dependent steps, thus we read every published version with extreme care."

      Public response by Gainey et al. to Reviewer 3: "We agree that our study was not exhaustive in our exploration of variables that might be interfering with our ability to detect F2 avoidance."

      Gainey et al. provide reasons/excuses for why they did not follow published methods - notably their subjective decision to exclude the paralyzing agent sodium azide from their choice assays, but their abstract reads "We conclude that this example of transgenerational inheritance lacks robustness." I strongly disagree with this conclusion.

    1. Reviewer #2 (Public review):

      Parkes et al. combined real-time keypoint tracking with transdermal activation of sensory neurons to examine the effects of recruitment of sensory neurons in freely moving mice. This builds on the authors' previous investigations involving transdermal stimulation of sensory neurons in stationary mice. They illustrate multiple scenarios in which their engineering improvements enable more sophisticated behavioral assessments, including (1) stimulation of animals in multiple states in large arenas, (2) multi-animal nociceptive behavior screening through thermal and optogenetic activation, and (3) stimulation of animals running through maze corridors. Overall, the experiments and the methodology, in particular, are written clearly. However, there are multiple concerns and opportunities to fully describe their newfound capabilities that, if addressed, would make it more likely for the community to adopt this methodology:

      The characterization of laser spot size and power density is reported as a coefficient of variation, in which a value of ~3 is interpreted as uniform. My interpretation would differ - data spread so that the standard deviation is three times larger than the mean indicates there is substantial variability in the data. The 2D polynomial fit is shown in Figure 2 - Figure Supplement 1A and, if the fit is good, this does support the uniformity claim (range of spot size is 1.97 to 2.08 mm2 and range of power densities is 66.60 to 73.80 mW). The inclusion of the raw data for these measurements and an estimate of the goodness of fit to the polynomials would better help the reader evaluate whether these parameters are uniform across space and how stable the power density is across repeated stimulations of the same location. Even more helpful would be an estimate of whether the variation in the power density is expected to meaningfully affect the responses of ChR2-expressing sensory neurons.

      While the error between the keypoint and laser spot error was reported as ~0.7 to 0.8 mm MAE in Figure 2L, in the methods, the authors report that there is an additional error between predicted keypoints and ground-truth labeling of 1.36 mm MAE during real-time tracking. This suggests that the overall error is not submillimeter, as claimed by the authors, but rather on the order of 1.5 - 2.5 mm, which is considerable given the width of a hind paw is ~5-6 mm and fore paws are even smaller. In my opinion, the claim for submillimeter precision should be softened and the authors should consider that the area of the paw stimulated may differ from trial to trial if, for example, the error is substantial enough that the spot overlaps with the edge of the paw.

      As the major advance of this paper is the ability to stimulate animals during ongoing movement, it seems that the Figure 3 experiment misses an opportunity to evaluate state-dependent whole-body reactions to nociceptor activation. How does the behavioral response relate to the animal's activity just prior to stimulation?

      Given the characterization of full-body responses to activation of TrpV1 sensory neurons in Figure 4 and in the authors' previous work, stimulation of TrpV1 sensory neurons has surprisingly subtle effects as the mice run through the alternating T maze. The authors indicate that the mice are moving quickly and thus that precise targeting is required, but no evidence is shared about the precision of targeting in this context beyond images of four trials. From the characterization in Figure 2, at max speed (reported at 241 +/- 53 mm/s, which is faster than the high speeds in Figure 2), successful targeting occurs less than 50% of the time. Is the initial characterization consistent with the accuracy in this context? To what extent does inaccuracy in targeting contribute to the subtlety of affecting trajectory coherence and speed? Is there a relationship between animal speed and disruption of the trajectory?

  2. Mar 2025
    1. Reviewer #2 (Public review):

      - Approach

      In this study, Yogesh et al. aimed at characterizing hemodynamic occlusion in two photon imaging, where its effects on signal fluctuations are underappreciated compared to that in wide field imaging and fiber photometry. The authors used activity-independent GFP fluorescence, GCaMP and GRAB sensors for various neuromodulators in two-photon and widefield imaging during a visuomotor context to evaluate the extent of hemodynamic occlusion in V1 and ACC. They found that the GFP responses were comparable in amplitude to smaller GCaMP responses, though exhibiting context-, cortical region-, and depth-specific effects. After quantifying blood vessel diameter change and surrounding GFP responses, they argued that GFP responses were highly correlated with changes in local blood vessel size. Furthermore, when imaging with GRAB sensors for different neuromodulators, they found that sensors with lower dynamic ranges such as GRAB-DA1m, GRAB-5HT1.0, and GRAB-NE1m exhibited responses most likely masked by the hemodynamic occlusion, while a sensor with larger SNR, GRAB-ACh3.0, showed much more distinguishable responses from blood vessel change. They thoroughly investigate other factors that could contribute to these signals and demonstrate hemodynamic occlusion is the primary cause.

      - Impact of revision

      This is an important update to the initial submission, adding much supplemental imaging and population data that provide greater detail to the analyses and increase the confidence in the authors conclusions.

      Specifically, inclusion of the supplemental figures 1 and 2 showing GFP expression across multiple regions and the fluorescence changes of thousands of individual neurons provides a clearer picture of how these effects are distributed across the population. Characterization of brain motion across stimulation conditions in supplemental figure 5 provides strong evidence that the fluorescence changes observed in many of the conditions are unlikely to be primarily due to brain motion associated imaging artifacts. The role of vascular area on fluorescence is further supported by addition of new analyses on vasoconstriction leading to increased fluorescence in Figures 4C1-4, complementing the prior analyses of vasodilation.

      The expansion of the discussion on other factors that could lead to these changes is thorough and welcome. The arguments against pH playing a factor in fluorescence changes of GFP, due to insensitivity to changes in the expected pH range are reasonable, as are the other discussed potential factors.

      With respect to the author's responses to prior critique, we agree that activity dependent hemodynamic occlusion is best investigated under awake conditions. Measurement of these dynamics under anesthesia could lead to an underestimation of their effects. Isoflurane anesthesia causes significant vasodilation and a large reduction in fluorescence intensity in non-functional mutant GRABs. This could saturate or occlude activity dependent effects.

      - Strengths

      This work is of broad interest to two photon imaging users and GRAB developers and users. It thoroughly quantifies the hemodynamic driven GFP response and compares it to previously published GCaMP data in a similar context, and illustrates the contribution of hemodynamic occlusion to GFP and GRAB responses by characterizing the local blood vessel diameter and fluorescence change. These findings provide important considerations for the imaging community and a sobering look at the utility of these sensors for cortical imaging.

      Importantly, they draw clear distinctions between the temporal dynamics and amplitude of hemodynamic artifacts across cortical regions and layers. Moreover, they show context dependent (Dark versus during visual stimuli) effects on locomotion and optogenetic light-triggered hemodynamic signals.

      The authors suggest that signal to noise ratio of an indicator likely affects the ability to separate hemodynamic response from the underlying fluorescence signal. With a new analysis (Supplemental Figure 4) They show that the relative degree of background fluorescence does not affect the size of the artifact.

      Most of the first generation neuromodulator GRAB sensors showed relatively small responses, comparable to blood vessel changes in two photon imaging, which emphasizes a need for improved the dynamic range and response magnitude for future sensors and encourages the sensor users to consider removing hemodynamic artifacts when analyzing GRAB imaging data.

      - Weaknesses

      The largest weakness of the paper remains that, while they convincingly quantify hemodynamic artifacts across a range of conditions, they provide limited means of correcting for them. However they now discuss the relative utility of some hemodynamic correction methods (e.g. from Ocana-Santero et al., 2024).

      The paper attributes the source of 'hemodynamic occlusion' primarily to blood vessel dilation, but leaves unanswered how much may be due to shifts in blood oxygenation. Figure 4 directly addresses the question of how much of the signal can be attributed to occlusion by measuring the blood vessel dilation, and has been improved by now showing positive fluorescence effects with vasoconstriction. They now also discuss the potential impact of oxygenation.

      Along these lines, the authors carefully quantified the correlation between local blood vessel diameter and GFP response (or neuropil fluorescence vs blood vessel fluorescence with GRAB sensors). We are left to wonder to what extent does this effect depend on proximity to the vessels? Do GFP/ GRAB responses decorrelate from blood vessel activity in neurons further from vessels (refer to Figure 5A and B in Neyhart et al., Cell Reports 2024)? The authors argue that the primary impact of occlusion is from blood vessels above the plane of imaging, but without a vascular reconstruction, their evidence for this is anecdotal.

      The choice of ACC as the frontal region provides a substantial contrast in location, brain movement, and vascular architecture as compared to V1. As the authors note, ACC is close to the superior sagittal sinus and thus is the region where the largest vascular effects are likely to occur. A less medial portion of M2 may have been a more appropriate comparison. The authors now include example imaging fields for ACC and interesting out-of-plane vascular examples in the supplementary figures that help assess these impacts.

      -Overall Assessment

      This paper is an important contribution to our understanding of how hemodynamic artifacts may corrupt GRAB and calcium imaging, even in two-photon imaging modes. While it would be wonderful if the authors were able to demonstrate a reliable way to correct for hemodynamic occlusion which did not rely on doing the experiments over with a non-functional sensor or fluorescent protein, the careful measurement and reporting of the effects here is, by itself, a substantial contribution to the field of neural activity imaging. It's results are of importance to anyone conducting two-photon or widefield imaging with calcium and GRAB sensors and deserves the attention of the broader neuroscience and in-vivo imaging community.

    1. Reviewer #3 (Public review):

      This paper addresses a long-standing problem in microbiology: the evolution of bacterial cell shape. Bacterial cells can take a range of forms, among the most common being rods and spheres. The consensus view is that rods are the ancestral form and spheres the derived form. The molecular machinery governing these different shapes is fairly well understood but the evolutionary drivers responsible for the transition between rods and spheres is not. Enter Yulo et al.'s work. The authors start by noting that deletion of a highly conserved gene called MreB in the Gram-negative bacterium Pseudomonas fluorescens reduces fitness but does not kill the cell (as happens in other species like E. coli and B. subtilis) and causes cells to become spherical rather than their normal rod shape. They then ask whether evolution for 1000 generations restores the rod shape of these cells when propagated in a rich, benign medium.

      The answer is no. The evolved lineages recovered fitness by the end of the experiment, growing just as well as the unevolved rod-shaped ancestor, but remained spherical. The authors provide an impressively detailed investigation of the genetic and molecular changes that evolved. Their leading results are:

      (1) The loss of fitness associated with MreB deletion causes high variation in cell volume among sibling cells after cell division;<br /> (2) Fitness recovery is largely driven by a single, loss-of-function point mutation that evolves within the first ~250 generations that reduces the variability in cell volume among siblings;<br /> (3) The main route to restoring fitness and reducing variability involves loss of function mutations causing a reduction of TPase and peptidoglycan cross-linking, leading to a disorganized cell wall architecture characteristic of spherical cells.

      The inferences made in this paper are on the whole well supported by the data. The authors provide a uniquely comprehensive account of how a key genetic change leads to gains in fitness and the spectrum of phenotypes that are impacted and provide insight into the molecular mechanisms underlying models of cell shape.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors investigate the optical properties of brochosomes produced by leafhoppers. They hypothesize that brochosomes reduce light reflection on the leafhopper's body surface, aiding in predator avoidance. Their hypothesis is supported by experiments involving jumping spiders. Additionally, the authors employ a variety of techniques including micro-UV-Vis spectroscopy, electron microscopy, transcriptome and proteome analysis, and bioassays. This study is highly interesting, and the experimental data is well-organized and logically presented.

      Strengths:

      The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage. This work provides the first biological evidence demonstrating that natural brochosomes can be used as a camouflage coating to reduce the leafhoppers' observability to their predators. The design of the experiments is novel.

      Weaknesses:

      (1) The observation that brochosome coatings become sparse after 25 days in both male and female leafhoppers, resulting in increased predation by jumping spiders, is intriguing. However, since leafhoppers consistently secrete and groom brochosomes, it would be beneficial to explore why brochosomes become significantly less dense after 25 days.

      (2) The authors demonstrate that brochosome coatings reduce UV (specular) reflection compared to surfaces without brochosomes, which can be attributed to the rough geometry of brochosomes as discussed in the literature. However, it would be valuable to investigate whether the proteins forming the brochosomes are also UV absorbing.

      (3) The experiments with jumping spiders show that brochosomes help leafhoppers avoid predators to some extent. It would be beneficial for the authors to elaborate on the exact mechanism behind this camouflage effect. Specifically, why does reduced UV reflection aid in predator avoidance? If predators are sensitive to UV light, how does the reduced UV reflectance specifically contribute to evasion?

      (4) An important reference regarding the moth-eye effect is missing. Please consider including the following paper: Clapham, P. B., and M. C. Hutley. "Reduction of lens reflection by the 'Moth Eye' principle." Nature 244: 281-282 (1973).

      (5) The introduction should be revised to accurately reflect the related contributions in literature. Specifically, the novelty of this work lies in the demonstration of the camouflage effect of brochosomes using jumping spiders, which is verified for the first time in leafhoppers. However, the proposed use of brochosome powder for camouflage was first described by R.B. Swain (R.B. Swain, Notes on the oviposition and life history of the leafhopper Oncometopta undata Fabr. (Homoptera: Cicadellidae), Entomol. News. 47: 264-266 (1936)). Recently, the antireflective and potential camouflage functions of brochosomes were further studied by Yang et al. based on synthetic brochosomes and simulated vision techniques (S. Yang, et al. "Ultra-antireflective synthetic brochosomes." Nature Communications 8: 1285 (2017)). Later, Lei et al. demonstrated the antireflective properties of natural brochosomes in 2020 (C.-W. Lei, et al., "Leafhopper wing-inspired broadband omnidirectional antireflective embroidered ball-like structure arrays using a nonlithography-based methodology." Langmuir 36: 5296-5302 (2020)). Very recently, Wang et al. successfully fabricated synthetic brochosomes with precise geometry akin to those natural ones, and further elucidated the antireflective mechanisms based on the brochosome geometry and their role in reducing the observability of leafhoppers to their predators (L. Wang et al. "Geometric design of antireflective leafhopper brochosomes." Proceedings of the National Academy of Sciences 121: e2312700121 (2024)).

      Comments on revisions:

      In this revision, the authors have addressed some of the key concerns I raised in our previous comments. However, a few issues remain unaddressed. Additionally, the new experimental data introduced in the manuscript require further clarification, which I outline below.

      (1) As I pointed out in my previous review comments, "The use of brochosomes as a camouflage coating has been hypothesized since 1936 (R.B. Swain, Entomol. News 47, 264-266, 1936) with evidence demonstrated by similar synthetic brochosome systems in a number of recent studies (S. Yang, et al. Nat. Commun. 8:1285, 2017; L. Wang, et al., PNAS. 121: e2312700121, 2024). However, direct biological evidence or relevant field studies have been lacking to directly support the hypothesis that brochosomes are used for camouflage." While the authors did cite the original hypothesis proposed by R.B. Swain (1936), they have omitted important references that provide evidence on the use of antireflective properties of brochosomes for camouflage in a synthetic setting (see for example, Fig. 5a of S. Yang, et al. Nat. Commun. 8:1285, 2017). The authors are recommended to revise the Abstract and Introduction accordingly to ensure a fair and accurate representation of the existing literature.

      (2) The antireflection mechanisms of brochosome structures have been discussed in detail, specifically, how their geometries (i.e., brochosome diameter and pore size) contribute to reducing UV reflectance (L. Wang, et al., PNAS. 121: e2312700121, 2024 and P. Banergee, et al., Advanced Photonics Research 4:2200343, 2023). The authors should incorporate these recent findings into their discussion (line 381 - line 383 of the manuscript).

      (3) The authors presented new data brochosomes deposited on a quartz slide and measured their reflectance across UV, visible light, and infrared wavelengths. Since reflectance is highly sensitive to the uniformity of brochosome coverage on the substrate, it is crucial to quantify this coverage across the measurement area for comparison. While the authors include SEM images to illustrate the packing of brochosomes on both the leafhopper wing and the quartz substrate (Fig. S7) at a microscopic scale (~10 um view), it would be beneficial to also provide SEM images at a larger scale (e.g., 100 um - 1 mm) and quantify the density of brochosomes per unit area for comparison.

      (4) For the negative control using acetone to remove the brochosomes the leafhopper wing, have the authors confirmed the absence of brochosomes after treatment? If so, the authors should explicitly indicate this for clarity.

    1. Reviewer #2 (Public review):

      Summary

      This manuscript explores the transcriptomic identities of olfactory ensheathing cells (OECs), glial cells that support life-long axonal growth in olfactory neurons, as they relate to spinal cord injury repair. The authors show that transplantation of cultured, immunopurified rodent OECs at a spinal cord injury site can promote injury-bridging axonal regrowth. They then characterize these OECs using single-cell RNA sequencing, identifying five subtypes and proposing functional roles that include regeneration, wound healing, and cell-cell communication. They identify one progenitor OEC subpopulation and also report several other functionally relevant findings, notably, that OEC marker genes contain mixtures of other glial cell type markers (such as for Schwann cells and astrocytes), and that these cultured OECs produce and secrete Reelin, a regrowth-promoting protein that has been disputed as a gene product of OECs.

      Strengths

      This manuscript offers an extensive, cell-level characterization of OECs, supporting their potential therapeutic value for spinal cord injury and suggesting potential underlying repair mechanisms. The authors use various approaches to validate their findings, providing interesting images that show the overlap between sprouting axons and transplanted OECs, and showing that OEC marker genes identified using single-cell RNA sequencing are present in vivo, in both olfactory bulb tissue and spinal cord after OEC transplantation.

      Concerns about quantification raised during the review were suitably addressed by the authors.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript, the authors ran a dual task. Subjects monitored a peripheral location for a target onset (to generate a saccade to), and they also monitored a foveal location for a foveal probe. The foveal probe could be congruent or incongruent with the orientation of the peripheral target. In this study, the authors manipulated the conspicuity of the peripheral target, and they saw changes in performance in the foveal task.

      Comments on revisions:

      The authors have addressed all comments. Thanks.

    1. Reviewer #2 (Public review):

      Summary:

      Velichko, et al. investigate the role played by the long intrinsically disordered protein Trecle in nucleolar morphology and function, with an interest in its potential ability to undergo condensation. The authors explore Treacle's role in core functions of the nucleolus (rRNA biogenesis and DNA repair), which has been a subject of continual investigation since it was identified that truncation of Treacle is the primary genetic cause of Treacher-Collins syndrome. They show that knock out of Treacle leads to de-mixing of canonical markers of the FC (UBF, RPA194) and DFC (FBL) phases of the nucleolus. They also show that replacing Treacle with mutants that either remove the central region of Treacle (∆83-1121) or reduce the segregation of charged residues by scrambling them (CS- Charge Scrambled) results in different FRAP behavior of the condensates that result from Treacle over-expression. These data give new insight into the role played by the charge-segregated central region of Treacle in terms of having the potential to undergo condensation.

      Strengths:

      The characterizations of changes to nuclear morphology upon Treacle knockout is the strength of this study. The authors characterized effects on the canonical markers of the FC and DFC phases support the idea that Treacle has a scaffolding function. While the effect of Treacle perturbations has been studied before, this has often been investigated in the context of organismal development or rRNA biogenesis and less often at the sub-cellular level, as the authors have carried out.

      Another strength of this study is its characterization of the effects of the charge scramble mutant. The authors find that replacing endogenous Treacle with this mutant reduces the bulk dynamics of Treacle as assessed by FRAP, de-mixes FBL from the DFC, lowers pre-rRNA synthesis, and abolishes the recruitment of the DNA-damage response factor TOPBP1.

      Weaknesses:

      The conclusion that Treacle is a core scaffold of the FC is weakly supported. Recombinant Treacle has intrinsic potential to condense, and its condensation is disrupted by the expected solution conditions (i.e., condensates fail to form at high salt but do form in the presence of an aliphatic alcohol). It should be kept in mind that all proteins will condense at sufficiently high concentrations and under crowding. The authors observed condensation at 100uM protein and 5% PEG8000.

    1. Reviewer #2 (Public review):

      Summary:

      The authors provide compelling evidence that stimulation of epidermal cells in Drosophila larvae results in the stimulation of sensory neurons that evoke a variety of behavioral responses. Further, the authors demonstrate that epidermal cells are inherently mechanoresponsive and implicate a role for store-operated calcium entry (mediated by Stim and Orai) in the communication to sensory neurons.

      Strengths:

      The study represents a significant advance in our understanding of mechanosensation. Multiple strengths are noted. First, the genetic analyses presented in the paper are thorough with appropriate consideration to potential confounds. Second, behavioral studies are complemented by sophisticated optogenetics and imaging studies. Third, identification of roles for store-operated calcium entry is intriguing. Lastly, conservation of these pathways in vertebrates raise the possibility that the described axis is also functional in vertebrates.

      Weaknesses:

      The study has a few conceptual weaknesses that are arguably minor. The involvement of store-operated calcium entry implicates ER calcium store release. Whether mechanical stimulation evokes ER calcium release in epidermal cells and how this might come about (e.g., which ER calcium channels, roles for calcium-induced calcium release etc.) remains unaddressed. On a related note, the kinetics of store-operated calcium entry is very distinct from that required for SV release. The link between SOC and epidermal cells-neuron transmission is not reconciled. Finally, it is not clear how optogenetic stimulation of epidermal cells results in the activation of SOC.

      Revised manuscript:

      The authors have adequately addressed my original concerns.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript proposes that the use of a latent cause model for the assessment of memory-based tasks may provide improved early detection of Alzheimer's Disease as well as more differentiated mapping of behavior to underlying causes. To test the validity of this model, the authors use a previously described knock-in mouse model of AD and subject the mice to several behaviors to determine whether the latent cause model may provide informative predictions regarding changes in the observed behaviors. They include a well-established fear learning paradigm in which distinct memories are believed to compete for control of behavior. More specifically, it's been observed that animals undergoing fear learning and subsequent fear extinction develop two separate memories for the acquisition phase and the extinction phase, such that the extinction does not simply 'erase' the previously acquired memory. Many models of learning require the addition of a separate context or state to be added during the extinction phase and are typically modeled by assuming the existence of a new state at the time of extinction. The Niv research group, Gershman et al. 2017, have shown that the use of a latent cause model applied to this behavior can elegantly predict the formation of latent states based on a Bayesian approach, and that these latent states can facilitate the persistence of the acquisition and extinction memory independently. The authors of this manuscript leverage this approach to test whether deficits in the production of the internal states, or the inference and learning of those states, may be disrupted in knock-in mice that show both a build-up of amyloid-beta plaques and a deterioration in memory as the mice age.

      Strengths:

      I think the authors' proposal to leverage the latent cause model and test whether it can lead to improved assessments in an animal model of AD is a promising approach for bridging the gap between clinical and basic research. The authors use a promising mouse model and apply this to a paradigm in which the behavior and neurobiology are relatively well understood - an ideal situation for assessing how a disease state may impact both the neurobiology and behavior. The latent cause model has the potential to better connect observed behavior to underlying causes and may pave a road for improved mapping of changes in behavior to neurobiological mechanisms in diseases such as AD.

      Weaknesses:

      I have several substantial concerns which I've detailed below. These include important details on how the behavior was analyzed, how the model was used to assess the behavior, and the interpretations that have been made based on the model.

      (1) There is substantial data to suggest that during fear learning in mice separate memories develop for the acquisition and extinction phases, with the acquisition memory becoming more strongly retrieved during spontaneous recovery and reinstatement. The Gershman paper, cited by the authors, shows how the latent causal model can predict this shift in latent states by allowing for the priors to decay over time, thereby increasing the posterior of the acquisition memory at the time of spontaneous recovery. In this manuscript, the authors suggest a similar mechanism of action for reinstatement, yet the model does not appear to return to the acquisition memory state after reinstatement, at least based on the examples shown in Figures 1 and 3. Rather, the model appears to mainly modify the weights in the most recent state, putatively the 'extinction state', during reinstatement. Of course, the authors must rely on how the model fits the data, but this seems problematic based on prior research indicating that reinstatement is most likely due to the reactivation of the acquisition memory. This may call into question whether the model is successfully modeling the underlying processes or states that lead to behavior and whether this is a valid approach for AD.

      (2) As stated by the authors in the introduction, the advantage of the fear learning approach is that the memory is modified across the acquisition-extinction-reinstatement phases. Although perhaps not explicitly stated by the authors, the post-reinstatement test (test 3) is the crucial test for whether there is reactivation of a previously stored memory, with the general argument being that the reinvigorated response to the CS can't simply be explained by relearning the CS-US pairing, because re-exposure the US alone leads to increase response to the CS at test. Of course there are several explanations for why this may occur, particularly when also considering the context as a stimulus. This is what I understood to be the justification for the use of a model, such as the latent cause model, that may better capture and compare these possibilities within a single framework. As such, it is critical to look at the level of responding to both the context alone and to the CS. It appears that the authors only look at the percent freezing during the CS, and it is not clear whether this is due to the contextual US learning during the US re-exposure or to increased response to the CS - presumably caused by reactivation of the acquisition memory. For example, the instance of the model shown in Figure 1 indicates that the 'extinction state', or state z6, develops a strong weight for the context during the reinstatement phase of presenting the shock alone. This state then leads to increased freezing during the final CS probe test as shown in the figure. By not comparing the difference in the evoked freezing CR at the test (ITI vs CS period), the purpose of the reinstatement test is lost in the sense of whether a previous memory was reactivated - was the response to the CS restored above and beyond the freezing to the context? I think the authors must somehow incorporate these different phases (CS vs ITI) into their model, particularly since this type of memory retrieval that depends on assessing latent states is specifically why the authors justified using the latent causal model.

      (3) This is related to the second point above. If the question is about the memory processes underlying memory retrieval at the test following reinstatement, then I would argue that the model parameters that are not involved in testing this hypothesis be fixed prior to the test. Unlike the Gershman paper that the authors cited, the authors fit all parameters for each animal. Perhaps the authors should fit certain parameters on the acquisition and extinction phase, and then leave those parameters fixed for the reinstatement phase. To give a more concrete example, if the hypothesis is that AD mice have deficits in differentiating or retrieving latent states during reinstatement which results in the low response to the CS following reinstatement, then perhaps parameters such as the learning rate should be fixed at this point. The authors state that the 12-month-old AD mice have substantially lower learning rate measures (almost a 20-fold reduction!), which can be clearly seen in the very low weights attributed to the AD mouse in Figure 3D. Based on the example in Figure 3D, it seems that the reduced learning rate in these mice is most likely caused by the failure to respond at test. This is based on comparing the behavior in Figures 3C to 3D. The acquisition and extinction curves appear extremely similar across the two groups. It seems that this lower learning rate may indirectly be causing most of the other effects that the authors highlight, such as the low σx, and the changes to the parameters for the CR. It may even explain the extremely high K. Because the weights are so low, this would presumably lead to extremely low likelihoods in the posterior estimation, which I guess would lead to more latent states being considered as the posterior would be more influenced by the prior.

      (4) Why didn't the authors use the latent causal model on the Barnes maze task? The authors mention in the discussion that different cognitive processes may be at play across the two tasks, yet reversal tasks have been suggested to be solved using latent states to be able to flip between the two different task states. In this way, it seems very fitting to use the latent cause model. Indeed, it may even be a better way to assess changes in σx as there are presumably 12 observable stimuli/locations.

    1. Reviewer #2 (Public review):

      Summary:

      The current dataset utilized a 2x2 factorial shuttle-escape task in combination with extracellular single-unit recording in the anterior cingulate cortex (ACC) of mice to determine ACC action coding. The contributions of neocortical signaling to action-outcome learning as assessed by behavioral tasks outside of the prototypical reward versus non-reward or punished vs non-punished is an important and relevant research topic, given that ACC plays a clear role in several human neurological and psychiatric conditions. The authors present useful findings regarding the role of ACC in action monitoring and learning. The core methods themselves - electrophysiology and behavior - are adequate; however, the analyses are incomplete since ruling out alternative explanations for neural activity, such as movement itself, requires substantial control analyses, and details on statistical methods are not clear.

      Strengths:

      (1) The factorial design nicely controls for sensory coding and value coding, since the same stimulus can signal different actions and values.

      (2) The figures are mostly well-presented, labeled, and easy to read.

      (3) Additional analyses, such as the 2.5/7.5s windows and place-field analysis, are nice to see and indicate that the authors were careful in their neural analyses.

      (4) The n-trial + 1 analysis where ACC activity was higher on trials that preceded correct responses is a nice addition, since it shows that ACC activity predicts future behavior, well before it happens.

      (5) The authors identified ACC neurons that fire to shuttle crossings in one direction or to crossings in both directions. This is very clear in the spike rasters and population-scaled color images. While other factors such as place fields, sensory input, and their integration can account for this activity, the authors discuss this and provide additional supplemental analyses.

      Weaknesses:

      (1) The behavioral data could use slightly more characterization, such as separating stay versus shuttle trials.

      (2) Some of the neural analyses could use the necessary and sufficient comparisons to strengthen the authors' claims.

      (3) Many of the neural analyses seem to utilize long time windows, not leveraging the very real strength of recording spike times. Specifics on the exact neural activity binning/averaging, tests, classifier validation, and methods for quantification are difficult to find.

      (4) The neural analyses seem to suggest that ACC neurons encode one variable or the other, but are there any that multiplex? Given the overwhelming evidence of multiplexing in the ACC a bit more discussion of its presence or absence is warranted.

    1. Reviewer #2 (Public review):

      This study provides some interesting observations on how different flavors of e-cigarettes can affect lung immunology, however there are numerous flaws including a low number of replicates and a lack of effective validation methods which reduces the robustness and rigor of the findings.

      Strengths:

      The strength of the study is the successful scRNA-seq experiment which gives good preliminary data that can be used to create new hypotheses in this area.

      Weaknesses:

      The major weakness is the low number of replicates and the limited analysis methods. Two biological n per group is not acceptable to base any solid conclusions. Any validatory data was too little (only cell % data) and did not always support the findings (e.g. Figure 4D does not match 4C). Often n seems to be combined and only one data point is shown, it is not at all clear how the groups were analysed and how many cells in each group were compared.

      Other specific weaknesses were identified in addition to the ones above:

      (1) Only 71,725 cells means only 7,172 per group, which is 3,586 per animal - how many of these were neutrophils, T-cells, and macrophages? This was not shown and could be too low.

      (2) The dynamic range of RNA measurement using scRNAseq is known to be limited - how do we know whether genes are not expressed or just didn't hit detection? This links into the Ly6G negative neutrophil comment, but in general, the lack of gene expression in this kind of data should be viewed with caution, especially with a low n number and few cells.

      (3) There is no rigorous quantification of Ly6G+ and Ly6G- cells int he flow cytometry data.

      (4) Eosinophils are heavily involved in lung biology but are missing from the analysis.

      (5) The figures had no titles so were difficult to navigate.

      (6) PGVG is not defined and not introduced early enough.

      (7) Neutrophils are not well known to proliferate, so any claims about proliferation need to be accompanied by validation such as BrdU or other proliferation assays.

      (8) It was not clear how statistics were chosen and why Table S2 had a good comparison (two-way ANOVA with gender as a variable) but this was not used for other data particularly when looking at more functional RNA markers (Table S2 also lacks the interaction statistic which is most useful here).

      (9) Many statistics are only vs air control, but it would be more useful as a flavour comparison to see these vs PGVG. In some cases, the carrier PGVG looks worse than some of the flavours (which have nicotine).

      (10) The n number is a large issue, but in Figures such as 4, 6, and 7 it could be a bigger factor. The number of significant genes identified has been determined by chance rather than any real difference, e.g. Is Il1b not identified in Fruit flavour vs air because there wasn't enough n, while in Air vs Tobacco, it randomly hit the significance mark. This is but an example of the problems with the analysis and conclusions

      (11) The data in Figure 7A is confusing, if this is a comparison to air, then why does air vs air not equal 1? Even if this was the comparison to the average of air between males and females, then this doesn't explain why CCL12 is >1 in both. Is this z-score instead? Regardless the data is difficult to interpret in this format.

      (12) Individual n was not shown for almost all experiments - e.g. Figure 1D - what is this representative of? Figure 2D - is this bulk-grouped data for all cells and all mice? The heatmaps are also pooled from 2n and don't show the variability.

    1. Reviewer #2 (Public review):

      Summary:

      The authors aimed to find out how - and how well - adult and adolescent mice discriminate tones of different frequencies and whether there are differences in processing at the level of the auditory cortex that might explain differences in behavior between the two groups. Adolescent mice were found to be worse at sound frequency discrimination than adult mice. The performance difference between the groups was most pronounced when the sounds were close in frequency and thus difficult to distinguish, and could, at least in part, be attributed to the younger mice's inability to withhold licking in no-go trials. By recording the activity of individual neurons in the auditory cortex when mice performed the task or were passively listening as well as in untrained mice the authors identified differences in the way that the adult and adolescent brains encode sounds and the animals' choice that could potentially contribute to the differences in behavior.

      Strengths:

      The study combines behavioural testing in freely-moving and head-fixed mice, optogenetic manipulation, and high-density electrophysiological recordings in behaving mice to address important open questions about age differences in sound-guided behavior and sound representation in the auditory cortex.

      Weaknesses:

      For some of the analyses that the authors conducted it is unclear what the rationale behind them is and, consequently, what conclusion we can draw from them. The results of the optogenetic manipulation, while very interesting, warrant a more in-depth discussion.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, Chittajallu and colleagues present compelling evidence that mu opioid receptor (MOR) activation can potentiate synaptic neurotransmission in a medial habenula to interpeduncular nucleus (mHb-IPN) subcircuit. While, projections from mHb tachykinin 1 (Tac1) neurons onto lateral IPN neurons show a canonical opioid-induced synaptic depression in glutamate release, excitatory neurotransmission in mHb choline acetyltransferase (ChAT) projections to the rostral IPN is potentiated by opioids. This process may require the inhibition of voltage-gated potassium channels (Kv1.2) and results in an augmented co-release of glutamate and acetylcholine. This function emerges around age P27 in mice, when MOR expression in the IPN peaks.

      Strengths:

      Carefully executed electrophysiological experiments with appropriate controls. Interesting description of a neurodevelopmental change in the effects of opioids on mHb-IPN signaling.

      Weaknesses:

      The genetic strategy used to target the mHb-IPN pathway (constitutive expression in all ChAT+ and Tac1+ neurons) is not specific to this projection. In addition, a braking mechanism involving Kv1.2 has not been identified.

    1. Reviewer #2 (Public review):

      Summary:

      The authors follow up their preclinical work on beta-glucan-induced trained immunity in murine tumor models that they published in Cell in 2020. In particular, they focus on the role of trained immunity and efferocytosis of cancer cells

      Strengths:

      While properly conducted, the work is underwhelming and fully depends on in vitro observations performed with co-cultures of bone marrow derived macrophages from beta-glucan-treated mice and tumor cell lines. From these in vitro studies, the authors conclude that trained immunity induction has no effect on antibody-dependent cellular phagocytosis, while it decreases efferocytosis.

      Weaknesses:

      It would be important to study these phenomena in tumor mouse models in vivo. The authors clearly have the expertise as they have shown in previous studies. Especially because the in vitro observation appears to conflict with the in vivo anti-tumor found in mice prophylactically treated with beta-glucan. Clearly, trained immunity is associated with diverse cellular responses and mechanisms, some of which may promote tumor growth, as the current manuscript suggests, but in the absence of in vivo studies, it is merely a mechanistic exercise of which the relevance is difficult to determine.

    1. Reviewer #2 (Public review):

      Summary:

      This study uses functional MRI to evaluate visual contrast sensitivity across the visual field at the level of the visual cortex, testing the method in a small group of normally sighted individuals and one with sight loss as proof of principle. The results suggest a promising technique to measure vision objectively across the visual field and overcomes the requirement for careful fixation which is often challenging in those with low vision or sight loss.

      Strengths:

      (1) Objective measure of central vision: The proposed method may provide a more comprehensive and objective assessment of residual visual function in individuals with sight loss. This may be particularly useful for those with central visual field loss without the requirement of stable fixation or subjective motor responses.

      (2) More sensitive measure: The use of slope to calculate contrast sensitivity across a range of contrasts within the brain is clever and likely more sensitive than single threshold measurements or standard clinical measures of visual acuity using letter charts. Standard supra-threshold (high contrast) tests are not ideal for capturing residual vision or partial vision loss.

      (3) Good agreement with standard atlas: The Benson atlas provides a good estimate of visual field maps within V1 based on anatomical landmarks, and the authors take steps to refine this informed by cortical magnification and V1 surface area (brain size) for each individual participant. This could allow the technique to be generalised without the need to collect lengthy individual mapping data from every participant.

      (4) Within-subject reproducibility: The measurements appear to be sensitive and reproducible, particularly in those with normal vision, and are consistent with known features of visual sensitivity differences in different parts of the visual field.

      (5) Potential tool to measure visual field sensitivity in controls: Even if the proposed methods are not ideal for widespread clinical translation, they do offer an exciting tool to test hypotheses about visual field differences in healthy controls. For example, there seems to be an increase in sensitivity on either side of the simulated ring scotoma (Figure 6 - perhaps due to the release of lateral inhibition?). Reliability measures suggest that individual differences are consistent in healthy controls (although not tested statistically, perhaps due to the small sample size?). Whether they reflect behaviourally meaningful differences in visual field sensitivity could be tested in individuals by comparing them to behavioural measures across the visual field.

      (6) Potential tool to test novel treatments: The proposed techniques could be used to test within-subject changes in visual function in environments that are equipped to measure and analyse fMRI data, including clinical trials aimed at determining the success of novel treatments. Further testing should reveal whether the method is suitable for testing low-vision patients with unstable fixation (e.g., nystagmus) and whether this affects slope and contrast sensitivity estimates. In theory, it should not have a substantial effect, except perhaps in regions near the stimulus edges.

      Weaknesses:

      (1) Questionable sensitivity to differences in patients. The variability in heat maps across healthy control participants is somewhat surprising. Do differences between individuals represent actual visual sensitivity differences, or are they an artifact of the measurement technique, e.g., due to signal-to-noise differences introduced by local variations in brain anatomy? Will the substantial variance across controls allow for a sufficiently stable baseline to detect meaningful differences in individual patients? Also, as the authors rightly point out, Benson atlas does not model differences along meridians, so upper/lower field differences might not be detectable.

      (2) Effects of unstable fixation/eye movements not explicitly tested: The methods state, 'In all tasks, participants were asked to report when the color of a central fixation dot changed', suggesting participants maintained fairly good fixation. Most of the results seem to pertain to measurements where central fixation is required. How does unstable fixation affect measurements?

      (3) Potential for clinical translation. Although it is a sensitive measure, functional MRI is costly, is not available in all clinical settings, requires significant post-processing analyses, and may be contraindicated in some individuals due to safety (e.g., metallic implants) or other concerns (e.g., claustrophobia). These could present significant barriers to widespread clinical translation if this were the ultimate goal of the study.

      (4) Limited range of spatial frequencies. The spatial frequencies tested were still quite low (0.3 and 3cpd) compared to measures such as visual acuity. Extending the measurements to higher spatial frequencies could allow better characterization of central vision, although necessarily for peripheral vision.

    1. Reviewer #2 (Public review):

      The paper is well-written overall. The findings are clearly presented, and the data seems solid overall. I do have, however, a few major and some minor comments representing some concerns. My major comments are below.

      (1) This may seem somewhat semantic, yet, it has implications on the way the data is presented and moreover on the conclusions drawn - a single ganglion cannot show fictive crawling. It can demonstrate rhythmic patterns of activity that may serve in the (fictive) crawling motor pattern. The latter is a result of the intrinsic within single-ganglion connectivity AND the inter-ganglia connections and interactions (coupling) among the sequential ganglia. It may be affected by both short-range and long-range connections (e.g., descending inputs) along the ganglia chain.

      (2) The point above is even more critical where the authors set to compare the motor pattern in single ganglia with the intact animals. It would have made much more sense to add a description of the motor pattern of a chain of interconnected ganglia. The latter would be expected to better resemble the intact animal. Furthermore, this project would have benefitted from a three-way comparison (isolated ganglion-interconnected ganglia-intact animal.

      (3) Two previous studies by the same group are repeatedly mentioned (Rela and Szczupak, 2003; Rodriguez et al., 2009) and serve as a basis for the current work. The aim of one of these previous studies was to assess the role of the NS neurons in regulating the function of motor networks. The other (Rodriguez et al., 2009) reported on a neuron (the NS) that can regulate the crawling motor pattern. LL 71-74 of the current report presents the aim of this study as evaluating the role of the known connectivity of the premotor NS neuron in shaping the crawling motor pattern. The authors should make it very clear what indeed served as background knowledge, what exactly was known about the circuitry beforehand, and what is different and new in the current study.

    1. Delegate Led Discussion - Big Bet Philanthropy

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Big Bet Philanthropy - Stop Reset Go - TPF - LCE - relevant to - event time conflict - with - Project Dandelion

    2. Delegate Led Discussion - Strategies for Action and Care

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Delegate Led Discussion - Strategies for Action and Care in Closing Civic Space - Stop Reset Go - Indyweb autonomy - relevant to - event time conflict - with - Project Dandelion

    3. Delegate Led Discussion - Tuning In: Music

      for - program event selection - 2025 - April 3 - 2-3:15pm GMT - Skoll World Forum - Delegate Led Discussion - Tuning In: Music, Deep Listening - Stop Reset Go - Deep Humanity BEing journeys - relevant to - event time conflict - with - Project Dandelion

    4. Creative Tensions: Collaboration, Compromise, and Convict

      for - program event selection - 2025 - April 3 - 10:30am-12pm GMT - Skoll World Forum - Creative Tension: Collaboration, Compromise and Conviction - Stop Reset Go - TPF - LCE - relevant to - event time conflict - with Aligning Profit and Purpose

    5. Aligning Profit and Purpose

      for - program event selection - 2025 - April 3 - 10:30am-12pm GMT - Skoll World Forum - Aligning Profit and Purpose - new portmanteau - greentruthing - opposite of greenwashing - Stop Reset Go - Deep Humanity - TPF - LCE - Greentruthing vs greenwashing - relevant to

    6. Delegate Led Discussion - The Changing State of AI, Media

      for - program event selection - 2025 - April 2 - 2-3:15pm GMT - Skoll World Forum - The Changing State of AI, Media - Indyweb - Stop Reset Go - TPF - Eric's project - Skoll's Participatory Media project - relevant to - adjacency - indyweb - Stop Reset Go - participatory news - participatory movie and tv show reviews - Eric's project - Skoll's Particiipatory Media - event time conflict - with - Leadership in Alien Times

      adjacency - between - Skoll's Participatory Media project - Global Witness - Indyweb - Stop Reset Go's participatory news idea - Stop Reset Go's participatory movie and TV show review idea - Eric's media project - adjacency relationship - Participatory media via Indyweb and idea of participatory news and participatory movie and tv show reviews - might be good to partner with Skoll Foundation's Participatory Media group

    7. Leadership in Alien Times

      for - program event selection - 2025 - April 2 - 2-3:30pm GMT - Skoll World Forum - Leadership in Alien Times - Stop Reset Go - Deep Humanity - LCE - transition - relevant to - event time conflict - with Building Comfort with Discomfort - solution - watch one live and the other recorded

    8. Comfort with Discomfort: Practices

      for - program event selection - 2025 - April 2 - 2-3:30 pm GMT - Skoll World Forum - Comfort with Discomfort: Practices for Lasting Social Change - Stop Reset Go - Deep Humanity - Common Human Denominators - LCE - relevant to - event time conflict - with - Leadership in Alien Times

    9. Philanthropy at a Crossroads: Can We Fund

      for - program event selection - 2025 - April 2 - 10:30am-12pm GMT - Skoll World Forum - Philanthropy at a Crossroads: Can we Fund at the Speed of Impacts? - Fellowship of the Sacred Commons - LCE - relevant to - event time conflict - with Building Citizen-led Movements - solution - watch one live and the other recorded - funding the commons

    10. Building Citizen-Led Movements to Reshape Civic Life

      for - program event selection - 2025 - April 2 - 10:30am-12pm GMT - Skoll World Forum - Building Citizen-ed Movements to Reshape Civic Life - Stop Reset Go - TPF - LCE - Building Citizen-Led Movements - relevant to

    Tags

    Annotators

    URL

    1. Reviewer #2 (Public Review):

      The main question asked by Umenati et al. is whether persister cells to ampicillin arise preferentially from dormant, non-dividing cells or from cells that are actively growing before antibiotic exposure. The authors tracked persister cells generated from populations at different growth phases and culture media using a microfluidic device coupled to fluorescence microscopy, which is a challenge due to the low frequency of these persister cells. One of the main conclusions is that the majority of persisters arising in exponentially-growing populations originated from actively-dividing cells before the antibiotic treatment, reinforcing the idea that dormancy is not a prerequisite for persister formation. The authors made use of a fluorescent reporter monitoring RpoS activity (RpoS-mCherry fusion) and observed that RpoS levels in these persister cells were low. In the few lineages that exhibited no growth before the ampicillin treatment, RpoS levels were low as well, indicating that RpoS is not a predictive marker for persistence. By performing the same experiment with early and late stationary phase cultures, the authors observed that the proportion of persister cells that originated from dormant cells before the ampicillin treatment is significantly increased under these conditions. In the late stationary phase condition, dormant cells were expressing high levels of RpoS. The authors suggested that RpoS-mCherry proteins form aggregates which were suggested by the authors to be a characteristic of 'deep dormancy'. These cells were mostly unable to restart growth after the antibiotic removal while others with the lowest levels of RpoS tended to be persister. Confirming that these cells indeed contain protein aggregates as well as determining the physiological state of these cells appears to be crucial.

    1. Reviewer #2 (Public review):

      Summary:

      Weiler et al use retrograde tracers, two-photon tomography, and automatic cell detection to provide a detailed quantitative description of the laminar and area sources of ipsi- and contralateral cortico-cortical inputs to two primary sensory areas and a primary motor area. They found considerable bilateral symmetry in the areas providing cortico-cortical inputs. However, although the same regions in both hemispheres tended to supply inputs, a larger proportion of inputs from contralateral areas originated from deeper layers (L5 and L6).

      Strengths:

      The study applies state-of-the-art anatomical methods, and the data is very effectively presented and carefully analyzed. The results provide many novel insights on the similarities and differences of inputs from the two hemispheres. While over the past decade there has been many studies quantitively and comprehensively describing cortico-cortical connections, by directly comparing inputs from the ipsi and contralateral hemispheres, this study fills in an important gap in the field. It should be of great utility and an important reference for future studies on inter hemispheric interactions.

      Weaknesses:

      Overall, I do not find any major weakness in the analyses or their interpretation. However, one must keep in mind that the study only analyses inputs projecting to three areas. This is not an inherent flaw of the study; however, it warrants caution when extrapolating the results to callosal projections terminating in other areas. As inputs to two primary sensory areas and one is the primary motor cortex are studied, some of the conclusions could potentially be different for inputs terminating in high-order sensory and motor areas. Given that primary areas were injected, there are few instances of feedforward connections sampled in the ipsilateral hemisphere. The study finds that while ipsi- projections from visual cortex to barrel cortex are feedforward given its fILN values, those from the contralateral visual cortex are feedback instead. This is now acknowledged in the revised discussion.

      Another issue that is left unexplored is that, in the current analyses the barrel and primary visual cortex are analyzed as a uniform structure. It is well established that both the laminar sources of callosal inputs and their terminations differ in the monocular and binocular areas of the visual cortex (border with V2L). Similarly, callosal projections differ when terminating the border of S1 (A row of whiskers ) then in other parts of S1. Thus, some of the conclusions regarding the laminar sources of callosal inputs might depend on whether one is analyzing inputs terminating or originating in these border regions. This is now acknowledged in the revised version.

    1. Reviewer #2 (Public review):

      Summary:

      This study aimed to uncover the protein composition and evolutionary conservation of electrical synapses in retinal neurons. The authors employed two complementary BioID approaches: expressing a Cx35b-TurboID fusion protein in zebrafish photoreceptors and using GFP-directed TurboID in Cx36-EGFP-labeled mouse AII amacrine cells. They identified conserved ZO proteins and endocytosis components in both species, along with over 50 novel proteins related to adhesion, cytoskeleton remodeling, membrane trafficking, and chemical synapses. Through a series of validation studies¬-including immunohistochemistry, in vitro interaction assays, and immunoprecipitation - they demonstrate that novel scaffold protein SIPA1L3 interacts with both Cx36 and ZO proteins at electrical synapse. Furthermore, they identify and localize proteins ZO-1, ZO-2, CGN, SIPA1L3, Syt4, SJ2BP, and BAI1 at AII/cone bipolar cell gap junctions.

      Strengths:

      The study demonstrates several significant strengths in both experimental design and validation approaches. First, the dual-species approach provides valuable insights into the evolutionary conservation of electrical synapse components across vertebrates. Second, the authors compare two different TurboID strategies in mice and demonstrate that the HKamac promoter and GFP-directed approach can successfully target the electrical synapse proteome of mouse AII amacrine cells. Third, they employed multiple complementary validation approaches - including retinal section immunohistochemistry, in vitro interaction assays, and immunoprecipitation-providing evidence supporting the presence and interaction of these proteins at electrical synapses.

      Weaknesses:

      The conclusions of this paper are supported by data; however, some aspects of the quantitative proteomics analysis require clarification and more detailed documented. The differential threshold criteria (>3 log2 fold for mouse vs >1 log2 fold for zebrafish) will benefit from biological justification, particularly given the cross-species comparison. Additionally, providing details on the number of biological or technical replicates used in this study, along with analyses of how these replicates compare to each other, would strengthen the confidence in the identification of candidate proteins. Furthermore, including negative controls for the histological validation of proteins interacting with Cx36 could increase the reliability of the staining results.

      While the study successfully characterized the presence of candidate proteins at the electrical synapses between AII amacrine cells and cone bipolar cells, it did not compare protein compositions between the different types of electrical synapses within the circuit. Given that AII amacrine cells form both homologous (AII-AII) and heterologous (AII-cone bipolar cell) electrical synapses-connections that serve distinct functional roles in retinal signaling processing-a comparative analysis of their molecular compositions could have provided important insights into synapse specificity.

    1. Reviewer #2 (Public review):

      Summary

      The authors have used the UK Biobank data to interrogate the association between plasma metabolites and glaucoma.

      (1) They initially assessed plasma metabolites as predictors of glaucoma: The addition of NMR-derived metabolomic data to existing models containing clinical and genetic data was marginal.<br /> (2) They then determined whether certain metabolites might protect against glaucoma in individuals at high genetic risk: Certain molecules in bioenergetic pathways (lactate, pyruvate and citrate) conferred protection.<br /> (3) They provide support for protection conferred by pyruvate in a murine model.

      Weaknesses

      (1) Although it is an invaluable treasure trove of data, selection bias and self-reporting are inescapable problems when using the UK Biobank data for glaucoma research. The high-impact glaucoma-related GWAS publications (Ref 26 and 27) referenced in support of the method suffer the same limitations. This doesn't negate the conclusions but must be taken into consideration. The authors might note that it is somewhat reassuring that the proportion of glaucoma cases (4%) is close to what would be expected in a population-based study of 40-69-year-olds of predominantly white ethnicity.<br /> (2) As noted by the authors, a limitation is the predominantly white ethnicity profile that comprises the UK Biobank.<br /> (3) Also as noted by the authors, the study is cross-sectional and is limited by the "correlation does not imply causation" issue.<br /> (4) The optimal collection, transport and processing of the samples for NMR metabolite analysis is critical for accurate results. Strict policies were in place for these procedures, but deviations from protocol remain an unknown influence on the data.<br /> (5) In addition, all UK Biobank blood samples had unintended dilution during the initial sample storage process at UK Biobank facilities. (Julkunen, H. et al. Atlas of plasma NMR biomarkers for health and disease in 118,461 individuals from the UK Biobank. Nat Commun 14, 604 (2023) Samples from aliquot 3, used for the NMR measurements, suffered from 5-10% dilution. (Allen, Naomi E., et al. Wellcome Open Research 5 (2021): 222.) Julkunen et al. report that "The dilution is believed to come from mixing of participant samples with water due to seals that failed to hold a system vacuum in the automated liquid handling systems. While this issue is likely to have an impact on some of the absolute biomarker concentration values, it is expected to have limited impact on most epidemiological analyses."

      Strengths

      The huge sample size supports a powerful statistical analysis and the opportunity for the inclusion of multiple covariates and interactions without overfitting the models.<br /> The authors have constructed a robust methodology and statistical design.<br /> The manuscript is well-written, and the study is logically presented.<br /> The Figures are of good quality.

      Broadly, the conclusions are justified by the findings.

      Impact<br /> The findings advance personalized prognostics for glaucoma that combine metabolomic and genetic data. In addition, the protective effect of certain metabolites influences further research on novel therapeutic strategies.

      Comments on revisions:

      The authors have thoughtfully and comprehensively addressed my comments. I have no further comments.

    1. Reviewer #2 (Public review):

      Summary:

      This work assesses the genetic interaction between the Bmp signaling pathway and the factor Numb, which can inhibit Notch signalling. It follows up on the previous studies of the group (Tian, eLife, 2014; Tian, PNAS, 2014) regarding BMP signaling in controlling stem cell fate decision as well as on the work of another group (Sallé, EMBO, 2017) that investigated the function of Numb on enteroendocrine fate in the midgut. This is an important study providing evidence of a Numb-mediated back up mechanism for stem cell maintenance.

      Strengths:

      (1) Experiments are consistent with these previous publications while also extending our understanding of how Numb functions in the ISC.<br /> (2) Provides an interesting model of a "back up" protection mechanism for ISC maintenance.

      Weaknesses:<br /> (1) Aspects of the experiments could be better controlled or annotated:<br /> (a) As they "randomly chose" the regions analyzed, it would be better to have all from a defined region (R4 or R2, for example) or to at least note the region as there are important regional differences for some aspects of midgut biology.<br /> (b) It is not clear to me why MARCM clones were induced and then flies grown at 18{degree sign}C? It would help to explain why they used this unconventional protocol.

      (2) There are technical limitations with trying to conclude from double-knockdown experiments in the ISC lineage, such as those in Figure 1 where Dl and put are both being knocked down: depending on how fast both proteins are depleted, it may be that only one of them (put, for example) is inactivated and affects the fate decision prior to the other one (Dl) being depleted. Therefore, it is difficult to definitively conclude that the decision is independent of Dl ligand.

      (3) Additional quantification of many phenotypes would be desired.<br /> (a) It would be useful to see esg-GFP cells/total cells and not just field as the density might change (2E for example).<br /> (b) Similarly, for 2F and 2G, it would be nice to see the % of ISC/ total cell and EB/total cell and not only per esgGFP+ cell.<br /> (c) Fig1: There is no quantification - specifically it would be interesting to know how many esg+ are su(H)lacZ positive in Put- Dl- condition compared to WT or Put- alone. What is the n?<br /> (d) Fig2: Pros + cells are not seen in the image? Are they all DllacZ+?<br /> (e) Fig3: it would be nice to have the size clone quantification instead of the distribution between groups of 2 cell 3 cells 4 cell clones.<br /> (f) How many times were experiments performed?

      (4) The authors do not comment on the reduction of clone size in DSS treatment in Figure 6K. How do they interpret this? Does it conflict with their model of Bleo vs DSS?

      (5) There is probably a mistake on sentence line 314 -316 "Indeed, previous studies indicate that endogenous Numb was not undetectable by Numb antibodies that could detect Numb expression in the nervous system".

      Comments on revisions:

      The authors have by and large addressed my main points.

    1. Reviewer #2 (Public review):

      Summary:

      The authors used whole-network imaging to identify sensory neurons that responded to the repellant 1-octanol. While several olfactory neurons responded to the initial onset of odor pulses, two neurons consistently responded to all the pulses, ASH and AWC. ASH typically activates in response to repellants, and AWC typically activates in response to the removal of attractants. However, in this case, AWC activated in response to the removal of 1-octanol, which was unexpected because 1-octanol is a harmful repellant to the worm. The authors further investigated this phenomenon by testing different concentrations of 1-octanol in a chemotaxis assay and found that at lower (less harmful) concentrations the odor is actually an attractant, but becomes repulsive at higher concentrations. The amplitude of the ASH response appeared to be modulated by concentration, but this was not true for AWC. The authors propose a model where the behavioral response of the worm is the result of integrating these two opposing drives, where repulsion is a result of the increased ASH activity overriding the positive drive from AWC. The authors further tested this theory by testing mutants that ablated the AWC response (tax-4) or ASH response (osm-9), which produced results consistent with their hypothesis. While the interneuron(s) that integrate these signals to influence behavior were not identified, the authors did find that increasing concentrations of 1-octanol did increase the likelihood of AVA activity, a neuron that drives reversals (and hence, behavioral repulsion).

      Strengths:

      This was simple and elegant work that identified specific neurons of interest which generated a hypothesis, which was further tested with mutants that altered neuronal activity. The authors performed both neuronal imaging and behavioral experiments to verify their claims.

      Weaknesses:

      tax-4, but not osm-9 mutants were used in chemotaxis and imaging assays. It would have been nice to have osm-9 results as well for these assays. The mutants are not specific to AWC and ASH. Cell-specific rescue of these neurons would have strengthened the proposed model.

    1. Reviewer #3 (Public review):

      This manuscript reports interesting data on sex differences in expression across several somatic and reproductive tissues among 4 mice species or subspecies. The focus is on sex-biased expression in the somatic tissues, where the authors report high rates of turnover such that the majority of sex-biased genes are only sex-biased in one or two taxa. The authors show sex-biased genes have higher expression variance than unbiased genes but also provide some evidence that sex-bias is likely to evolve from genes with higher expression variance. The authors find that sex-biased genes (both female- and male-biased) experience more adaptive evolution (i.e., higher alpha values) than unbiased genes. The authors develop a summary statistic (Sex-Bias Index, SBI) of each individual's degree of sex-bias for a given tissue. They show that the distribution of SBI values often overlap considerably for somatic (but not reproductive) tissues and that SBI values are not correlated across tissues, which they interpret as indicating an individual can be relatively "male-like" in one tissue and relatively "female-like" in another tissue.

      Though the data are interesting, there are some disappointing aspects to how the authors have chosen to present the work. For example, their criteria for sex-bias requires an expression ratio of one sex to the other of 1.25. A reasonably large fraction of the "sex-biased genes" have ratios just beyond this cut-off (Fig. S1). A gene which has a ratio of 1.27 in taxa 1 can be declared as "sex-biased" but which has a ratio of 1.23 in taxa 2 will not be declared as "sex-biased". It is impossible to know from how the data are presented in the main text the extent to which the supposed very high turnover represents substantial changes in dimorphic expression. A simple plot of the expression sex ratio of taxa 1 vs taxa 2 would be illuminating but the authors declined this suggestion.

      I was particularly intrigued by the authors' inference of the proportion of adaptive substitutions ("alpha") in different gene sets. The show alpha is higher for sex-biased than unbiased genes and nicely shows that the genes that are unbiased in focal taxa but sex-biased in the sister taxa also have low alpha. It would be even stronger that sex-bias is associated with adaptive evolution to estimate alpha for only those genes that are sex-biased in the focal taxa but not in the sister taxa (the current version estimates alpha on all sex-biased genes within the focal taxa, both those that are sex-biased and those that are unbiased in the sister taxa).

      The author's Sex Bias Index is measured in an individual sample as: SBI = median(TPM of female-biased genes) - median(TPM of male-biased genes). This index has some strange properties when one works through some toy examples (though any summary statistic will have limitations). The authors do little to jointly discuss the merits and limitations of this metric. It would have been interesting to examine their two key points (degree of overlapping distributions between sexes and correlation across tissues) using other individual measures of sex-bias.

      Figure 5 shows symmetric gaussian-looking distributions of SBI but it makes me wonder to what extent this is the magic of model fitting software as there are only 9 data points underlying each distribution. Whereas Figure 5 shows many broadly overlapping distributions for SBI, Figure 6 seems to suggest the sexes are quite well separated for SBI (e.g., brain in MUS, heart in DOM).

      Fig. S1 should be shown as the log(F/M) ratio so it is easier to see the symmetry, or lack thereof, of female and male-biased genes.<br /> It is important to note that for the variance analysis that IQR/median was calculated for each gene within each sex for each tissue. This is a key piece of information that should be in the methods or legend of the main figure (not buried in Supplemental Table 17).

    1. Reviewer #3 (Public review):

      Summary:

      The article presents a meticulous and quantitative anatomical reconstruction of the compound eye of a tiny wasp at the level of subcellular structures, cellular and optical organization of the ommatidia and reveals the ectopic photoreceptors, which are decoupled from the eye's dioptrical apparatus.

      Strengths:

      The graphic material is of very high quality, beautifully organized and presented in a logical order. The anatomical analysis is fully supported by quantitative numerical data at all scales, from organelles to cells and ommatidia, which should be a valuable source for future studies in cellular biology and visual physiology. The 3D renders are highly informative and a real eye candy.

      Weaknesses:

      The claim that the large dorsal part of the eye is the dorsal rim area (DRA), supported by anatomical data on rhabdomere geometry and connectomics in authors' earlier work, would eventually greatly benefit from additional evidence, obtained by other methods.

      Comments on revisions:

      Thank you for considering my remarks and advice. All is fine.

    1. Reviewer #2 (Public review):

      Summary:

      In the manuscript entitled "Oviductin sets the species-specificity of the mammalian zona pellucida", de la Fuente et al analyze the species specificity of sperm-egg recognition by looking at sperm binding and penetration of zonae pellucidae from different mammalian species and find a role for the oviductal protein OVGP1 in determining species specificity.

      Strengths:

      By combining sperm, oocytes, zona pellucida (ZP), and oviductal fluid from different mammalian species, they elucidate the essential role of OVGP1 in conferring species-specific fertilization.

      Weaknesses:

      Mice with OVGP1 deletion are viable and fertile. It would be quite interesting to investigate the species-specificity of sperm-ZP binding in this model. That would indicate whether OVGP1 is the only glycoprotein involved in determining species-specificity. Alternatively, the authors could immunodeplete OVGP1 from oviductal fluid and then ascertain whether this depleted fluid retains the ability to impede cross-species fertilization.

      Comments on revisions:

      This resubmission addresses most of my comments and concerns.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors report that Nora virus, a natural Drosophila pathogen that also persistently infects many laboratory fly stocks, infects intestinal stem cells (ISCs), leading to a shorter life span and increased sensitivity to intestinal infection with the Pseudomonas bacterium. Nora virus infection was associated with an increased proliferation of ISC and disrupted gut barrier function. Genetically, the authors show that increased ISC division in Nora virus and Pseudomonas coinfected flies is driven by signaling through the JAK-STAT pathway and apoptosis.

      Accordingly, blocking apoptosis and JAK-STAT signaling reduces viral load, suggesting that in this context the JAK-STAT pathway is proviral in contrast to other previous observations in systemically infected flies. This work adds to the findings of another recent paper showing that another persistent fruit fly virus, Drosophila A virus, also increases ISC proliferation and decreases gut barrier function. Intestinal viruses should therefore be considered confounders in studies of fly intestinal physiology.

      Strengths:

      Overall, the data are convincing and robust, starting with two wildtype fly stocks (Ore-R strain) that differ in their Nora virus infection status, followed by experiments in which cleared stocks are reinfected with a purified Nora virus stock preparation. The conclusions of the paper will be of interest to scientists working on insect physiology, virology, and immunology, but should also serve as a warning for scientists that use the fly as a model to study gut physiology.

      Weaknesses:

      The title does not seem to be fully supported by the data. While the authors convincingly show the increased sensitivity to Pseudomonas infection, effects on another tested bacterium, Serratia marcescens, were not significantly different between Nora-virus-infected and non-infected flies. Thus effects of 'intestinal infection' seem to be too broad a claim. Also, whether the Nora virus increases sensitivity to oxidative stress is not so clear to me: the figure that supports this claim is the survival assay of Figure 5F. However, the difference in survival between control and paraquat-treated Nora (-) flies seems to be in the same order as between control and paraquat-treated Nora (+) flies. Rather, cause and effect seem to be the reverse: paraquat increases ISC proliferation, higher viral loads, and consequently shorter survival. I suggest rephrasing the title and conclusions accordingly.

      Quantification of immunofluorescence microscopy is missing, rendering the images somewhat anecdotal. Quantification should be provided. It will then also be of interest to quantify the number of Nora(+) cells and the Nora virus levels per infected cell (e.g. Figure 5H). Also, the claim that the Nora virus initially infects ISC and later (upon stress) infects enterocytes requires quantification.

      Genetic support for the role of the JAK-STAT pathway in driving ISC proliferation and supporting Nora virus replication is convincing. It would also be of interest to analyze other pathways implicated in ISC proliferation (e.g. JNK, EGFR), especially given the observations of Nigg et al, showing an involvement of STING/NF-kB and EGFR pathway in driving intestinal phenotypes of Drosophila A virus-infected flies (doi: 10.1016/j.cub.2024.05.009).

      Figure 5E: An intriguing observation is that GFP:Dicer2 seems to be unstable in Nora virus-infected cells. Here, GFP control driven by the same driver line would be required to confidently conclude that this is due to an effect on Dicer-2 specifically.

      Legends are mostly conclusive, and essential information about the experimental setup is missing in the captions of multiple figures, making the interpretation of the data difficult. See my private recommendations for suggestions to improve the data presentation.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have developed a behavioral paradigm to experimentally manipulate the sense of control experienced by the participants by changing the level of difficulty of a wheel-stopping task. In the first study, this manipulation is tested by administering the task in a factorial design with two levels of controllability and two levels of stressor intensity to a large number of participants online while simultaneously recording subjective ratings on perceived control, anxiety, and stress. In the second study, the authors used the wheel-stopping task to induce a high sense of controllability and test whether this manipulation buffers the response to a subsequent stress induction when compared to a neutral task, like looking at pleasant videos.

      Strengths:

      (1) The authors validate a method to manipulate stress.<br /> (2) The authors use an experimental manipulation to induce an enhanced sense of controllability to test its impact on the response to stress induction.<br /> (3) The studies involved big sample sizes.

      Weaknesses:

      (1) The study was not preregistered.

      (2) The control manipulation is conflated with task difficulty, and, therefore the reward rate. Although the authors acknowledge this limitation at the end of the discussion, it is a very important limitation, and its implications are not properly discussed. The discussion states that this is a common limitation with previous studies of control but omits that many studies have controlled for it using yoking.

      (3) The methods are not always clear enough, and it is difficult to know whether all the manipulations are done within-subjects or some key manipulations are done between subjects.

      (4) The analysis of internal consistency is based on splitting the data into odd/even sliders. This choice of data parcellation may cause missed drifts in task performance due to learning, practice effects, or tiredness, thus potentially inflating internal consistency.

      (5) Study 2 manipulates the effect of domain (win versus loss WS task), but the interaction of this factor with stressor intensity is not included in the analysis.

      This study will be of interest to psychologists and cognitive scientists interested in understanding how controllability and its subjective perception impact how people respond to stress exposure. Demonstrating that an increased sense of control buffers/protects against subsequent stress is important and may trigger further studies to characterize this phenomenon better. However, beyond the highlighted weaknesses, the current study only studied the effect of stress induction consecutive to the performance of the WS task on the same day and its generalizability is not warranted.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript follows up on a previously published paper (Busch and Hansel 2023) which proposed that the morphological variation of dendritic bifurcation in Purkinje cells in mouse and human is indicative of the number of climbing fiber inputs, with dendritic bifurcation at the level of the soma resulting in a proportion of these neurons being multi-innervated. The functional and anatomical climbing fiber data was obtained solely from mice, since all human tissue was embalmed and fixed, and the extension of these findings to human Purkinje cells was indirect. The current comparative anatomy study aims to resolve this question in human tissue more directly and to further analyse in detail the properties of adult human Purkinje cell dendritic morphology.

      Strengths:

      The authors have carried out a meticulous anatomical quantification of human Purkinje cell dendrites, in tissue preparations with better signal to noise ratio than their previous study, comparing them with those from mice. They show that human PC dendrites are much larger than would be expected from straightforward scaling to brain size and, importantly, they now present immunolabelling results that trace climbing fiber axons innervating human PCs in a subset of the data. As well as providing detailed analyses of spine properties and interesting and unexpected new findings of human PC dendritic length and spine types, the work suggests that human PCs that have two clearly distinct dendritic branches have an approximately 80% chance of receiving more than one CF input, segregated across the two branches. Albeit entirely observational, the data will be of widespread interest to the cerebellar field, in particular those building computational models of Purkinje cells.

      Weaknesses:

      The work is, by necessity, purely anatomical. It remains to be seen whether there are any functional differences in ion channel expression or functional mapping of granule inputs to human PCs compared with the mouse that might mitigate the major differences in electronic properties suggested.

      Comments on revisions:

      I am happy with the updated manuscript in response to my suggestions and I have no further comments.

    1. Reviewer #2 (Public review):

      The manuscript from Belato et al., used advanced NMR approaches and a mutagenesis campaign probe the conformational dynamics of the recognition lobe (Rec) of the CRISPR Cas9 enzyme from G. stearothermophilus (GeoCas9). Using truncated and full-length constructs they assess the impacts of two different point mutations have on the redistribution and timescale of these motions and assess gRNA recognition and specificity. Single point mutations in the Rec domain in a Cas9 from a related species had profound impacts on- and off-target DNA editing, therefore the authors reasoned analogous mutations in GeoCas9 would have similar effects. However, despite a redistribution of local motions and changes in global stability, their chosen mutations had little impact on DNA editing in the context of the full-length enzyme.

      In their revised manuscript, the authors were highly responsive to the reviewer's comments incorporating new experimental results including molecular dynamics simulations and RNA binding data using full-length GeoCas9, as well as reframing their discussion and conclusions in consideration of the new data. They were receptive to suggestions for clarification in both the text and methods section. With these changes, the manuscript has been significantly improved.

      Their studies highlight the species-specific complexity of interdomain communication and allosteric mechanisms used by these multi-domain endonucleases. The noted strengths of the article remain, and despite the negative results, their approach will garner interest from investigators interested in understanding how the activity and specificity of these enzymes can be engineered to tune activity and limit off-target cleavage by these enzymes. Generally, the manuscript highlights the challenges of studying the effect of allosteric networks on protein function, particularly in multidomain proteins, and thus will be of broad interest to the community.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Li and colleagues study the fate of endothelial cells in a mouse model of ischemic stroke. Using genetic lineage tracing approaches, they found that endothelial cells give rise to non-endothelial cells, which they term "E-pericytes." They further show that depleting these cells exacerbates blood-brain barrier leakage and worsens functional recovery. The authors also provide evidence that endothelial-to-mesenchymal transition, myeloid cell-derived TGFβ1, and endothelial TGFβRII are involved in this process. These are potentially interesting findings, however, the experimental evidence that endothelial cells undergo transdifferentiation to non-endothelial cells is weak, as is the evidence that these cells are pericytes. Addressing this foundational weakness will facilitate the interpretation of the other findings.

      Strengths:

      (1) The authors address an important question about blood vessel function and plasticity in the context of stroke.

      (2) The authors use a variety of genetic approaches to understand cell fate in the context of stroke. Particularly commendable is the use of several complementary lineage tracing strategies, including an intersectional strategy requiring both endothelial Cre activity and subsequent mural cell NG2 promoter activity.

      (3) The authors address upstream cellular and molecular mechanisms, including roles for myeloid-derived TGFβ.

      Weaknesses:

      (1) The authors use Cdh5-CreERT2; Ai47 mice to permanently label endothelial cells and their progeny with eGFP. They then isolate eGFP+ cells from control and MCAO RP7D and RP34D brains, and use single-cell RNA-seq to identify the resulting cell types. Theoretically, all eGFP+ cells should be endothelial cells or their progeny. This is a very powerful and well-conceived experiment. The authors use the presence of a pericyte cluster as evidence that endothelial-to-pericyte transdifferentiation occurs. However, pericytes are also present in the scRNA-seq data from sham mice, as are several other cell types such as fibroblasts and microglia. This suggests that pericytes and these other cell types might have been co-purified (e.g., as doublets) with eGFP+ endothelial cells during FACS and may not themselves be eGFP+. Pericyte-endothelial doublets are common in scRNA-seq given that these cell types are closely and tightly associated. Additionally, tight association (e.g., via peg-socket junctions) can cause fragments of endothelial cells to be retained on pericytes (and vice-versa) during dissociation. Finally, it is possible that after stroke or during the dissociation process, endothelial cells lyse and release eGFP that could be taken up by other cell types. All of these scenarios could lead to the purification of cells that were not derived (transdifferentiated) from endothelial cells. The authors note that the proportion of pericytes increased in the stroke groups, but it does not appear this experiment was replicated and thus this conclusion is not supported by statistical analysis. The results of pseudotime and trajectory analyses rely on the foundation that the pericytes in this dataset are endothelial-derived, which, as discussed above, has not been rigorously demonstrated.

      (2) I have the same concern regarding the inadvertent purification of cells that were not derived from endothelial cells in the context of the bulk RNA-seq experiment (Figure S4), especially given the sample-to-sample variability in gene expression in the RP34D, eGFP+ non-ECs-group (e.g., only 2/5 samples are enriched for mesenchymal transcription factor Tbx18, only 1/5 samples are enriched for mural cell TF Heyl). If the sorted eGFP+ non-ECs were pericytes, I would expect a strong and consistent pericyte-like gene expression profile.

      (3) The authors use immunohistochemistry to understand localization, morphology, and marker expression of eGFP+ cells in situ. The representative "E-pericytes" shown in Figure 3A-D are not associated with blood vessels, and the authors' quantification also shows that the majority of such cells are not vessel-associated ("avascular"). By definition, pericytes are a component of blood vessels and are embedded within the vascular basement membrane. Thus, concluding that these cells are pericytes ("E-pericytes") may be erroneous.

      (4) CD13 flow cytometry and immunohistochemistry are used extensively to identify pericytes. In the context of several complementary lineage tracing strategies noted in Strength #2, CD13 immunohistochemistry is the only marker used to identify putative pericytes (Figure S3J-M). In stroke, CD13 is not specific to pericytes; dendritic cells and other monocyte-derived cells express CD13 (Anpep) in mouse brain after stroke (PMID: 38177281, https://anratherlab.shinyapps.io/strokevis/).

      (5) The authors conclude that "EC-specific overexpression of the Tgfbr2 protein by a virus (Tgfbr2) decreases Evans blue leakage, promotes CBF recovery, alleviates neurological deficits and facilitates spontaneous behavioral recovery after stroke by increasing the number of E-pericytes." All data in Figure 10, however, compare endothelial Tgfbr2 overexpression to a DsRed overexpression control. There is no group in which Tgfbr2 is overexpressed but "E-pericytes" are eliminated with DTA (this is done in Figure 9B, but this experiment lacks the Tgfbr2 overexpression-only control). Thus, the observed functional outcomes cannot be ascribed to "E-pericytes"; it remains possible that endothelial Tgfbr2 overexpression affects EB leakage, CBF, and behavior through alternative mechanisms.

      (6) Single-cell and bulk RNA-seq data are not available in a public repository (such as GEO). Depositing these data would facilitate their independent reevaluation and reuse.

    1. Reviewer #2 (Public review):

      Summary:

      Jaber et al. describe the generation and characterization of a knock-in mouse strain expressing the p53 Y217C hot-spot mutation. While the homozygous mutant cells and mice reflect the typical loss-of-p53 functions, as expected, the Y217C mutation also appears to display gain-of function (GOF) properties, exemplified by elevated metastasis in the homozygous context (as noted with several hot-spot mutations). Interestingly, this mutation does not appear to exhibit any dominant-negative effects associated with most hot-spot p53 mutations, as determined by absence of differences in overall survival and tumor predisposition of the heterozygous mice, as well as target gene activation upon nutlin treatment.

      In addition, the authors noted a severe reduction in the female 217/217 homozygous progeny, significantly more than that observed with the p53 null mice, due to exencephaly, leading them to conclude that the Y217C mutation also has additional, non-cancer related GOFs. Thought this property has been well described and attributed to p53 functional impairment, the authors conclude that the Y217C has additional properties in accelerating the phenotype.<br /> Transcriptomic analyses of thymi found additional gene signature differences between p53 null and the Y217C strains, indicative of novel target gene activation, associated with inflammation.

      Strengths:

      Overall, the characterisation of the mice highlights the expected typical outcomes associated with most hot-spot p53 mutations published earlier. The quality of the work presented is well done and good, and the conclusions and reasonably well justified.

      Comments on revisions:

      Revised version has addressed most of our queries and is acceptable.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by Paturi and colleagues uses an approach that combines structural biology and biochemistry to probe protein-protein and protein-RNA interactions for two protein factors related to the dsRNA pathway in plants.

      Strengths:

      A key finding in the research is the direct demonstration of the ability of the single dsRBD (double-strand RNA binding domain) of DRB7.2 to interact simultaneously with dsRNA as well as the C-terminal domain of DRB4. The heterodimerization of DRB7.2 and DRB4 is demonstrated to make a high-affinity complex with dsRNA and it is proposed that this atypical use of the dsRBD domain to bridge the protein and RNA may contribute to the ability to prevent cleavage that would otherwise occur for dsRNA. The primary results for the interactions are generally well-supported by the data, and the conclusions are taken from the available results without excessive speculation.

      Weaknesses:

      There is a need for some statistical repeats, as well as a suggested movement of many protein characterization findings in the solution state to support data or to better indicate how these properties could play a role in the final proposed mechanism. There is also the need for certain measurement replicates, such as for the ITC data which are derived from single measurements and lack sufficient estimates of error.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents experiments using an ex vivo colonic tissue assay, clearly showing that fecal material promotes Salmonella cell invasion into the tissue. It also shows that serine and indole can modulate the invasion, although their effects are much smaller. In addition, the authors characterized the direct chemotactic responses of these cells to serine and indole using a capillary assay, demonstrating repellent and attractant responses elicited by indole and serine, respectively, and that serine can dominate when both are present. These behaviors are generally consistent with those observed in E. coli, as well as with the observed effects on cell invasion.

      Strengths:

      The most compelling finding reported here is the strong influence of fecal material on cell invasion. Also, the local and time-resolved capillary assay provides a new perspective on the cell's responses.

      Weaknesses:

      The weakness is that indole and serine chemotaxis does not seem to control the fecal-mediated cell invasion and thus the underlying cause of this effect remains unclear.

      In addition, the fact that serine alone, which clearly acts as a strong attractant, did not affect cell invasion (compared to buffer) is somewhat puzzling. Additionally, wild-type cells showed nearly a tenfold advantage even without any ligand (in buffer), suggesting that factors other than chemotaxis might control cell invasion in this assay, particularly in the serine and indole conditions. These observations should probably be discussed.

      Final comment. As shown in reference 12, Tar mediates attractant responses to indole, which appear to be absent here (Figure 3J). Is it clear why? Could it be related to receptor expression?

    1. Reviewer #2 (Public review):

      This manuscript describes a detailed model of bats flying together through a fixed geometry. The model considers elements that are faithful to both bat biosonar production and reception and the acoustics governing how sound moves in the air and interacts with obstacles. The model also incorporates behavioral patterns observed in bats, like one-dimensional feature following and temporal integration of cognitive maps. From a simulation study of the model and comparison of the results with the literature, the authors gain insight into how often bats may experience destructive interference of their acoustic signals and those of their peers, and how much such interference may actually negatively affect the groups' ability to navigate effectively. The authors use generalized linear models to test the significance of the effects they observe.

      In terms of its strengths, the work relies on a thoughtful and detailed model that faithfully incorporates salient features, such as acoustic elements like the filter for a biological receiver and temporal aggregation as a kind of memory in the system. At the same time, the authors' abstract features are complicating without being expected to give additional insights, as can be seen in the choice of a two-dimensional rather than three-dimensional system. I thought that the level of abstraction in the model was perfect, enough to demonstrate their results without needless details. The results are compelling and interesting, and the authors do a great job discussing them in the context of the biological literature.

      The most notable weakness I found in this work was that some aspects of the model were not entirely clear to me. For example, the directionality of the bat's sonar call in relation to its velocity. Are these the same? If so, what is the difference between phi_target and phi_tx in the model equations? What is a bat's response to colliding with a conspecific (rather than a wall)? From the statistical side, it was not clear if replicate simulations were performed. If they were, which I believe is the right way due to stochasticity in the model, how many replicates were used, and are the standard errors referred to throughout the paper between individuals in the same simulation or between independent simulations, or both?

      Overall, I found these weaknesses to be superficial and easily remedied by the authors. The authors presented well-reasoned arguments that were supported by their results, and which were used to demonstrate how call interference impacts the collective's roost exit as measured by several variables. As the authors highlight, I think this work is valuable to individuals interested in bat biology and behavior, as well as to applications in engineered multi-agent systems like robotic swarms.

    1. Reviewer #2 (Public review):

      In this manuscript, Mella et al. investigate the effect of GFP tagging on the localization and stability of the nuclear-localized tail-anchored (TA) protein Emerin. A previous study from this group showed that C-terminally GFP-tagged Emerin protein traffics to the plasma membrane and reaches lysosomes for degradation. It is suggested that the C-terminal tagging of tail-anchored proteins shifts their insertion from the post-translational TRC/GET pathway to the co-translational SRP-mediated pathway. The authors of this paper found that C-terminal GFP tagging causes Emerin to localize to the plasma membrane and eventually reach lysosomes. They investigated the mechanism by which Emerin-GFP moves to the secretory pathway. By manipulating the cytosolic domain and the hydrophobicity of the transmembrane domain (TMD), the authors identify that an ER retention sequence and strong TMD hydrophobicity contribute to Emerin trafficking to the secretory pathway. Overall, the data are solid, and the knowledge will be useful to the field. However, the authors do not fully answer the question of why C-terminally GFP-tagged Emerin moves to the secretory pathway. Importantly, the authors did not consider the possible roles of GFP in the ER lumen influencing Emerin trafficking to the secretory pathway.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript by García-Vázquez et al identifies the G2 and S phases expressed protein 1(GTSE1) as a substrate of the CycD-CDK4/6 complex. CycD-CDK4/6 is a key regulator of the G1/S cell cycle restriction point, which commits cells to enter a new cell cycle. This kinase is also an important therapeutic cancer target by approved drugs including Palbocyclib. Identification of substrates of CycD-CDK4/6 can therefore provide insights into cell cycle regulation and the mechanism of action of cancer therapeutics. A previous study identified GTSE1 as a target of CycB-Cdk1 but this appears to be the first study to address the phosphorylation of the protein by Cdk4/6.

      The authors identified GTSE1 by mining an existing proteomic dataset that are elevated in AMBRA1 knockout cells. The AMBRA1 complex normally targets D cyclins for degradation. From this list they then identified proteins that contain a CDK4/6 consensus phosphorylation site and were responsive to treatment with Palbocyclib.

      The authors show CycD-CDK4/6 overexpression induces a shift in GTSE1 on phostag gels that can be reversed by Palbocyclib. In vitro kinase assays also showed phosphorylation by CDK4. The phosphorylation sites were then identified by mutagenizing the predicted sites and phostag gets to see which eliminated the shift.

      The authors go on to show that phosphorylation of GTSE1 affects the steady state level of the protein. Moreover, they show that expression and phosphorylation of GTSE1 confer growth advantage on tumor cells and correlate with poor prognosis in patients.

      Strengths:

      The biochemical and mutagenesis evidence presented convincingly show that the GTSE1 protein is indeed a target of the CycD-CDK4 kinase. The follow-up experiments begin to show that the phosphorylation state of the protein affect function and have an impact on patient outcome.

      Weaknesses:

      It is not clear at which stage in the cell cycle GTSE1 is being phosphorylated and how this is affecting the cell cycle. Considering that the protein is also phosphorylated during mitosis by CycB-Cdk1, it is unclear which phosphorylation events may be regulating the protein.

      Additional comments for the revised manuscript

      The authors have made many modifications to the manuscript in response to the reviewer comments, including the addition of new data that have clarified some of the conclusions. Some of the questions regarding the phase of the cell cycle affected have been addressed with flow cytometry.

      There is one issue raised in the first review that can be better addressed. As the authors mentioned in their rebuttal letter, all the reviewers and editor concluded from the original manuscript that GTSE1 was being proposed as a physiological target of CycD-Cdk4 even in non-transformed cells. The authors believe that GTSE1 is likely only a target in cancerous cells that overexpress CycD and have made alterations in the abstract and main text making this point more clear.

      Some additional evidence that GTSE1 phosphorylation is occurring in CycD overexpressing tumor cells would strengthen this argument beyond the overexpression experiments presented in the manuscript. For example, in Supplemental Fig 4A of the revised manuscript, bubble plots from CPTAC data is used to show that total protein levels of GTSE1 correlate with proteins associated with proliferation and metastasis. Do levels of GTSE1 correlate with CycD in this data set?

    1. Reviewer #2 (Public review):

      Summary:

      The work aims to further understand the role of macrophages in lung precancer/lung cancer evolution

      Strengths:

      (1) The use of single-cell RNA seq to provide comprehensive characterisation.

      (2) Characterisation of cross-talk between macrophages and the lung precancerous cells.

      (3) Functional validation of the effects of S100a4+ cells on lung precancerous cells using in vitro assays.

      (4) Validation in human tissue samples of lung precancer / invasive lesions.

      Weaknesses identified previously:

      (1) The authors need to provide clarification of several points in the text.

      (2) The authors need to carefully assess their assumptions regarding the role of macrophages in angiogenesis in precancerous lesions.

      (3) The authors should discuss more broadly the current state of anti-macrophage therapies in the clinic.

      Comments on revised version:

      The authors have adequately addressed all of my comments.

    1. Reviewer #3 (Public review):

      Summary:

      The relationships of proteins and lipids: it's complicated. This paper illustrates how cardiolipins can stabilize membrane protein subunits - and not surprisingly, positively charged residues play an important role here. But more and stronger binding of such structural lipids does not necessarily translate to stabilization of oligomeric states, since many proteins have alternative binding sites for lipids which may be intra- rather than intermolecular. Mutations which abolish primary binding sites can cause redistribution to (weaker) secondary sites which nevertheless stabilize interactions between subunits. This may be at first sight counterintuitive but actually matches expectations from structural data and MD modelling. An analogous cardiolipin binding site between subunits is found in E.coli tetrameric GlpG, with cardiolipin (thermally) stabilizing the protein against aggregation.

      Strengths:

      The use of the artificial scaffold allows testing of hypothesis about the different roles of cardiolipin binding. It reveals effects which are at first sight counterintuitive and are explained by the existence of a weaker, secondary binding site which unlike the primary one allows easy lipid-mediated interaction between two subunits of the protein. Introducing different mutations either changes the balance between primary and secondary binding sites or introduced a kink in a helix - thus affecting subunit interactions which are experimentally verified by native mass spectrometry.

      [Editors' note: The reviewers agreed that the authors addressed all reviewer comments adequately and rigorously.]

    1. Reviewer #2 (Public review):

      This paper describes an interesting observation that ER-targeted misfolded proteins are trapped within vesicles inside nucleus to facilitate quality control during cell division. This work supports the concept that transient sequestration of misfolded proteins is a fundamental mechanism of protein quality control. The authors satisfactorily addressed several points asked in the review of first submission. The manuscript is improved but still unable to fully address the mechanisms.

      Strengths:

      The observations in this manuscript are very interesting and open up many questions on proteostasis biology.

      Weaknesses:

      Despite inclusions of several protein-level experiments, the manuscript remained a microscopy-driven work and missed the opportunity to work out the mechanisms behind the observations.

    1. Reviewer #2 (Public review):

      Summary:

      Identifying an important role for Integrator complex in repressing HIV transcription and suggesting that by targeting subunits of this complex specifically, INTS12, reversal of latency with and without latency reversal agents can be enhanced.

      Strengths:

      The strengths of the paper include the general strategy for screening targets that may activate HIV latency and the rigor of exploring the mechanism of INTS12 repression of HIV transcriptional elongation.

      Weaknesses:

      Minor point-there was an opportunity to examine a larger panel of latency reversal agents that reactivate by different mechanisms to determine whether INTS12 and transcriptional elongation are limiting for a broad spectrum of latency reversal agents.

      Comments on revisions:

      I feel the authors have adequately addressed the original questions and concerns.

    1. Reviewer #2 (Public review):

      This paper shows and analyzes an interesting phenomenon. It shows that when people are exposed to sequences of moving dots (That is moving dots in one direction, followed by another direction etc.), that showing either the starting movement direction, or ending movement direction causes a coarse-grained brain response that is similar to that elicited by the complete sequence of 4 directions. However, they show by decoding the sensor responses that this brain activity actually does not carry information about the actual sequence and the motion directions, at least not on the time scale of the initial sequence. They also show a reverse reply on a highly-compressed time scale, which is elicited during the period of elevated activity, and activated by the first and last elements of the sequence, but not others. Additionally, these replays seem to occur during periods of cortical ripples, similar to what is found in animal studies.

      These results are intriguing. They are based on MEG recordings in humans, and finding such replays in humans is novel. Also, this is based on what seems to be sophisticated statistical analysis. The statistical methodology seems valid, but due to its complexity it is not easy to understand. The methods especially those described in figures 3 and 4 should be explained better.

    1. Reviewer #2 (Public review):

      Summary:

      The authors investigate the problem of olfactory search in turbulent environments using artificial agents trained using tabular Q-learning, a simple and interpretable reinforcement learning (RL) algorithm. The agents are trained solely on odor stimuli, without access to spatial information or prior knowledge about the odor plume's shape. This approach makes the emergent control strategy more biologically plausible for animals navigating exclusively using olfactory signals. The learned strategies show parallels to observed animal behaviors, such as upwind surging and crosswind casting. The approach generalizes well to different environments and effectively handles the intermittency of turbulent odors.

      Strengths:

      * The use of numerical simulations to generate realistic turbulent fluid dynamics sets this paper apart from studies that rely on idealized or static plumes.<br /> * A key innovation is the introduction of a small set of interpretable olfactory states based on moving averages of odor intensity and sparsity, coupled with an adaptive temporal memory.<br /> * The paper provides a thorough analysis of different recovery strategies when an agent loses the odor trail, offering insights into the trade-offs between various approaches.<br /> * The authors provide a comprehensive performance analysis of their algorithm across a range of environments and recovery strategies, demonstrating the versatility of the approach.<br /> * Finally, the authors list an interesting set of real-world experiments based on their findings, that might invite interest from experimentalists across multiple species.

      Weaknesses:

      * Using tabular Q-learning is both a strength and a limitation. It's simple and interpretable, making it easier to analyze the learned strategies, but the discrete action space seems somewhat unnatural. In real-world biological systems, actions (like movement) are continuous rather than discrete. Additionally, the ground-frame actions may not map naturally to how animals navigate odor plumes (e.g. insects often navigate based on their own egocentric frame).

    1. Reviewer #2 (Public review):

      Summary:

      In this study by Sánchez-León and colleagues, the authors attempted to determine the influence of neuronal orientation on the efficacy of cerebellar tDCS in modulating neural activity. To do this, the authors made recordings from Purkinje cells, the primary output neurons of the cerebellar cortex, and determined the inter-dependency between the orientation of these cells and the changes in their firing rate during cerebellar tDCS application.

      Strengths:

      (1) A major strength is the in vivo nature of this study. Being able to simultaneously record neural activity and apply exogenous electrical current to the brain during both an anesthetized state and during wakefulness in these animals provides important insight into physiological underpinnings of tDCS.<br /> (2) The authors provide evidence that tDCS can modulate neural activity in multiple cell types. For example, there is a similar pattern of modulation in Purkinje cells and non-Purkinje cells (excitatory and inhibitory interneurons). Together, these data provide wholistic insight into how tDCS can affect activity across different populations of cells, which is important implications for basic neuroscience, but also clinical populations where there may be non-uniform or staged effects of neurological disease on these various cell types.<br /> (3) There is systematic investigation into the effects of tDCS on neural activity across multiple regions of the cerebellum. The authors demonstrate that the pattern of modulation is dependent on the target region. These findings have important implications for determining the expected neuromodulatory effects of tDCS when applying this technique over different target regions non-invasively in animals and humans.<br /> (4) The authors provide a thorough background, rationale, and interpretation regarding the expected and observed influence of neuronal orientation on excitability modulation by electrical stimulation.

    1. Reviewer #2 (Public review):

      Summary:

      This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during expected test suggests a memory verification process, whereas the prolonged spatial bias during unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

      Strengths:

      The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

      Weaknesses:

      The authors addressed the identified weaknesses in a thorough revision during the review process.

    1. Reviewer #2 (Public review):

      Li, Zhang, Wu, and colleagues investigated the non-canonical localization of IDH1 in the cell nucleus and its unconventional functions, expanding our understanding of the roles of metabolic enzymes such as IDH1. To study its nuclear function, they generated a HUDEP2 cell line with a specific deletion of nuclear IDH1. They found that the loss of nuclear IDH1 led to abnormalities in nuclear morphology and chromatin organization, particularly in H3K79me3. By integrating ChIP-seq, ATAC-seq, and RNA-seq analyses, they identified SIRT1 as a key regulatory factor mediating IDH1's role in nuclear morphology regulation during the terminal stages of erythroid differentiation.

      Notably, abnormalities in H3K79me3 were also observed in AML/MDS patients harboring IDH1 mutations, offering new perspectives for disease diagnosis and treatment. To robustly determine the nuclear distribution of IDH1 in erythroid cells, the authors employed multiple approaches, including immunofluorescence and nucleus-cytoplasm fractionation. The development of a HUDEP2 cell line lacking nuclear IDH1 was pivotal for studying its non-canonical nuclear functions.

      Experimental results, including euchromatin/heterochromatin observations, histone modification analyses, ChIP-seq, and ATAC-seq, indicated that the deletion of IDH1 disrupts the chromatin landscape. While the authors have identified SIRT1 as a key gene affected by the deficiency of IDH1, the mechanisms underlying IDH1's nuclear function are worth further exploration in future studies.

      Overall, this study advances our understanding of the non-canonical localization of metabolic enzymes and their nuclear functions, shedding new light on their roles in cellular regulation.

    1. Reviewer #2 (Public review):

      Summary:

      Carabalona and colleagues investigated the role of the membrane-deforming cytoskeletal regulator protein Abba (MTSS1L/MTSS2) in cortical development to better understand the mechanisms of abnormal neural stem cell mitosis. The authors used short hairpin RNA targeting Abba20 with a fluorescent reporter coupled with in utero electroporation of E14 mice to show changes to neural progenitors. They performed flow cytometry for in-depth cell cycle analysis of Abba-shRNA impact to neural progenitors and determined an accumulation in S phase. Using culture rat glioma cells and live imaging from cortical organotypic slides from mice in utero electroporated with Abba-shRNA, the authors found Abba played a prominent role in cytokinesis. They then used a yeast-two-hybrid screen to identify three high confidence interactors: Beta-Trcp2, Nedd9, and Otx2. They used immunoprecipitation experiments from E18 cortical tissue coupled with C6 cells to show Abba requirement for Nedd9 localization to the cleavage furrow/cytokinetic bridge. The authors performed an shRNA knockdown of Nedd9 by in utero electroporation of E14 mice and observed similar results as with the Abba-shRNA. They tested a human variant of Abba using in utero electroporation of cDNA and found disorganized radial glial fibers and misplaced, multipolar neurons, but lacked the impact of cell division seen in the shRNA-Abba model.

      Strengths:

      Fundamental question in biology about the mechanics of neural stem cell division.<br /> Directly connecting effects in Abba protein to downstream regulation of RhoA via Nedd9.<br /> Incorporation of human mutation in ABBA gene.<br /> Use of novel technologies in neurodevelopment and imaging.

      Weaknesses:

      Unexplored components of the pathway (such as what neurogenic populations are impacted by Abba mutation) and unleveraged aspects of their data (such as the live imaging) limit the scope of their findings and left significant questions about the effect of ABBA on radial glia development.

      (1) Claim of disorganized radial glial fibers lacks quantifications.<br /> -On page 11, the authors claim that knockdown of Abba lead to changes in radial glial morphology observed with vimentin staining. Here they claim misoriented apical processes, detached end feet, and decreased number of RGP cells in the VZ. However, they no not provide quantification of process orientation to better support their first claim. Measurements of radial glia fiber morphology (directionality, length) and of angle of division would be metrics that can be applied to data. Some of these analysis could be done in their time-lapse microscopy images, such as to quantify the number of cell division during their period of analysis (though that is short-15 hours).

      (2) Unclear where effect is:<br /> -in RG or neuroblasts? Is it in cell cleavage that results in accumulation of cells at VZ (as sometimes indicated by their data like in Fig 2A or 4D)? Interrogation of cell death (such as by cleaved caspase 3) would also help. Given their time lapse, can they identify what is happening to the RG fiber? The authors describe a change in "migration" but do not show evidence for this for either progenitor or neuroblast populations. Given they have nice time-lapse imaging data, could they visualize progenitor versus young neuron migration? Analysis of neuroblasts (such as with doublecortin expression in the tissue) would also help understand any issues in migration (of neurons v stem cells).<br /> -at cleaveage furrow? In abscission? There is high resolution data that highlights the cleavage furrow as the location of interest (fig 3A), however there is also data (fig 3B) to suggest Abba is expressed elsewhere as well and there is an overall soma decrease. More detail of the localization of Abba during the division process would be helpful-for example, could cleavage furrow proteins, such as Aurora B, co-localization (and potentially co-IP) help delineate subpopulations of Abba protein? Furthermore, the FRET imaging is unique way to connect their mutation with function-could they measure/quantify differences at furrow compared to rest of soma to further corroborate that Abba-associated RhoA effect was furrow-enriched?<br /> -The data highlights nicely that a furrow doesn't clearly form when ABBA expression and subsequent RhoA activity are decreased (in Fig 3 or 5A). Does this lead to cells that can't divide because of poor abscission, especially since "rounding" still occurs? Or abnormal progenitors (with loss of fiber or inability to support neuroblast migration)? Or abnormal progression of progenitors to neuroblasts?

      (3) Limited to a singular time point of mouse cortical development<br /> On page 13, the authors outline the results of their Y2H screen with the identification of three high confidence interactors. Notably, they used a E10.5-E12.5 mouse brain embryo library rather than one that includes E14, the age of their in utero electroporation mice. Many of the authors' claims focus on in utero electroporation of shRNA-Abba of E14 mice that are then evaluated at E16-18. Justification for the focus on this age range should be included to support that their findings can then be applied to all of mouse corticogenesis.

      (4) Detail of the effect of the human variant of the ABBA mutation in mouse is lacking.<br /> Their identification of the R671W mutation is interesting and the IUE model warrants more characterization, as they did with their original KD experiments.<br /> -Could they show that Abba protein levels are decreased (in either cell lines or electroporated tissue)?<br /> -While time-lapse morphology might not have been performed, more analysis on cell division phenotype (such as plane of division and radial glia morphology) would be helpful.

      The resubmission has addressed many of the questions raised.

      I have a few comments that should be addressed:

      (1) The authors maintain a deficit in "migration of immature neurons" which remains unsubstantiated. In their resonse, they state: "we believe that the data showing the accumulation of migrating electroporated cells in the ventricular (V) and subventricular (SV) zones provide compelling evidence of abnormal migration in ABBA-shRNA electroporated cells. "<br /> -Firstly, they do not demonstrate that it's immature neurons, not RGs, that are affected. Secondly, accumulation of cells at the V-SVZ could be due to soley the inability for the RGC to undergo mitosis, therefore remaining stuck"<br /> The commentary of migration, especially of neurons, should be modified.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors show that depletion of MARK2 alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation.

      Impact:

      The Golgi apparatus is a key organelle in cell migration- post translationally modifying and sorting cargo for directed trafficking, acting as a signalling hub, whilst functioning as a nucleation site for microtubules. These functions are essential to establish cell polarity during migration, highlighting the importance of understanding how cells reorient their Golgi in response to different environmental cues.

      The study will be of interest to fundamental biologists investigating Golgi function, and positioning, particularly in the context of different cell migration settings. It may also interest scientists investigating the loss of polarity in cancer or the maintenance of epithelial tissue architecture. I am a cell biologist with expertise in cell trafficking, cytoskeleton, and cell migration- during processes spanning development, homeostasis and cancer.

      Comments on latest version:

      Labelling of graphs - many of the graphs are comparing HT1080 cells with two conditions: parental and KO i.e. Figure 2F, H, I. The labels the authors use are "HT1080 and CAMSAP2 KO". This is confusing and should be changed to "parental and CAMSAP2 KO", the cell type HT1080 could be listed in the figure legend or on the graph below the conditions. (Similar to the labelling in Figure 3 H, I where they use "control and siRNA").

      The method section needs improvement - particularly around analysis methods, and statistical details for experiments. I recommend a supplementary table outlining exactly where the data is from (pooled, biological/technical repeats, n definitions, tests of normality etc).

    1. Reviewer #2 (Public review):

      Summary:

      This work provides a comprehensive understanding of cellular immunity in bivalves. To precisely describe the hemocytes of the oyster C. gigas, the authors morphologically characterized seven distinct cell groups, which they then correlated with single-cell RNA sequencing analysis, also resulting in seven transcriptional profiles. They employed multiple strategies to establish relationships between each morphotype and the scRNAseq profile. The authors correlated the presence of marker genes from each cluster identified in scRNAseq with hemolymph fractions enriched for different hemocyte morphotypes. This approach allowed them to correlate three of the seven cell types, namely hyalinocytes (H), small granule cells (SGC), and vesicular cells (VC). A macrophage-like (ML) cell type was correlated through the expression of macrophage-specific genes and its capacity to produce reactive oxygen species. Three other cell types correspond to blast-like cells, including an immature blast cell type from which distinct hematopoietic lineages originate to give rise to H, SGC, VC, and ML cells. Additionally, ML cells and SGCs demonstrated phagocytic properties, with SGCs also involved in metal homeostasis. On the other hand, H cells, non-granular cells, and blast cells expressed antimicrobial peptides. This study thus provides a complete landscape of oyster hemocytes with functional validation linked to immune activities. This resource will be valuable for studying the impact of bacterial or viral infections in oysters.

      The main strength of this study lies in its comprehensive and integrative approach, combining single-cell RNA sequencing, cytological analysis, cell fractionation and functional assays to provide a robust characterization of hemocyte populations in Crassostrea gigas.

      (1) The innovative use of marker genes, quantifying their expression within specific cell fractions, allows for precise annotation of different cellular clusters, bridging the gap between morphological observations and transcriptional profiles.

      (2)The study provides detailed insights into the immune functions of different hemocyte types, including the identification of professional phagocytes, ROS-producing cells, and cells expressing antimicrobial peptides.

      (3) The identification and analysis of transcription factors specific to different hemocyte types and lineages offer crucial insights into cell fate determination and differentiation processes in oyster immune cells.

      (4) The authors significantly advance the understanding of oyster immune cell diversity by identifying and characterizing seven distinct hemocyte transcriptomic clusters and morphotypes.

      These strengths collectively make this study a significant contribution to the field of invertebrate immunology, providing a comprehensive framework for understanding oyster hemocyte diversity and function.

      Conclusion:

      The authors largely achieved their primary objective of providing a comprehensive characterization of oyster immune cells. They successfully integrated multiple approaches to identify and describe distinct hemocyte types. The correlation of these cell types with specific immune functions represents a significant advancement in understanding oyster immunity. The authors are aware of the limitations of their study, particularly with regards to the pseudotime analysis, which provides a conceptual framework for understanding lineage relationships but requires further experimental validation to confirm its findings.

      This study is likely to have a significant impact on the field of invertebrate immunology, particularly in bivalve research. It provides a new standard for comprehensive immune cell characterization in invertebrates. The identification of specific markers for different hemocyte types will facilitate future research on oyster immunity. The proposed model of hemocyte lineages, while requiring further validation, offers a framework for studying hematopoiesis in bivalves.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript reconsiders the "general form" of Hamilton's rule, in which "benefit" and "cost" are defined as regression coefficients. It points out that there is no reason to insist on Hamilton's rule of the form -c+br>0, and that, in fact, arbitrarily many terms (i.e. higher-order regression coefficients) can be added to Hamilton's rule to reflect nonlinear interactions. Furthermore, it argues that insisting on a rule of the form -c+br>0 can result in conditions that are true but meaningless and that statistical considerations should be employed to determine which form of Hamilton's rule is meaningful for a given dataset or model.

      Strengths:

      The point is an important one. While it is not entirely novel-the idea of adding extra terms to Hamilton's rule has arisen sporadically (Queller 1985, 2011; Fletcher & Zwick 2006; van Veelen et al. 2017)--it is very useful to have a systematic treatment of this point. I think the manuscript can make an important contribution by helping to clarify a number of debates in the literature. I particularly appreciate the heterozygote advantage example in the SI.

      Weaknesses:

      Although the mathematical analysis is rigorously done and I largely agree with the conclusions, I feel there are some issues regarding terminology, some regarding the state of the field, and the practice of statistics that need to be clarified if the manuscript is truly to resolve the outstanding issues of the field. Otherwise, I worry that it will in some ways add to the confusion.

      (1) The "generalized" Price equation: I agree that the equations labeled (PE.C) and (GPE.C) are different in a subtle yet meaningful way. But I do not see any way in which (GPE.C) is more general than (PE.C). That is, I cannot envision any circumstance in which (GPE.C) applies but (PE.C) does not. A term other than "generalized" should be used.

      (2) Regression vs covariance forms of the Price equation

      I think the author uses "generalized" in reference to what Price called the "regression form" of his equation. But to almost everyone in the field, the "Price Equation" refers to the covariance form. For this reason, it is very confusing when the manuscript refers to the regression form as simply "the Price Equation".

      As an example, in the box on p. 15, the manuscript states "The Price equation can be generalized, in the sense that one can write a variety of Price-like equations for a variety of possible true models, that may have generated the data." But it is not the Price equation (covariance form) that is being generalized here. It is only the regression that Price used that is being generalized.

      To be consistent with the field, I suggest the term "Price Equation" be used only to refer to the covariance form unless it is otherwise specified as in "regression form of the Price equation".

      (3) Sample covariance: The author refers to the covariance in the Price equation as "sample covariance". This is not correct, since sample covariance has a denominator of N-1 rather than N (Bessel's correction). The correct term, when summing over an entire population, is "population covariance". Price (1972) was clear about this: "In this paper we will be concerned with population functions and make no use of sample functions". This point is elaborated on by Frank (2012), in the subsection "Interpretation of Covariance".

      Of course, the difference is negligible when the population is large. However, the author applies the covariance formula to populations as small as N=2, for which the correction factor is significant.

      The author objects to using the term "population covariance" (SI, pp. 8-9) on the grounds that it might be misleading if the covariance, regression coefficients, etc. are used for inference because in this case, what is being inferred is not a population statistic but an underlying relationship. However, I am not convinced that statistical inference is or should be the primary use of the Price equation (see next point). At any rate, avoiding potential confusion is not a sufficient reason to use incorrect terminology.

      Relatedly, I suggest avoiding using E for the second term in the Price equation, since (as the ms points out), it is not the expectation of any random variable. It is a population mean. There is no reason not to use something like Avg or bar notation to indicate population mean. Price (1972) uses "ave" for average.

      I should add, however, that the distinction between population statistics vs sample statistics goes away for regression coefficients (e.g. b, c, and r in Hamilton's rule) since in this case, Bessel's correction cancels out.

      (4) Descriptive vs. inferential statistics

      When discussing the statistical quantities in the Price Equation, the author appears to treat them all as inferential statistics. That is, he takes the position that the population data are all generated by some probabilistic model and that the goal of computing the statistical quantities in the Price Equation is to correctly infer this model.

      It is worth pointing out that those who argue in favor of the Price Equation do not see it this way: "it is a mistake to assume that it must be the evolutionary theorist, writing out covariances, who is performing the equivalent of a statistical analysis." (Gardner, West, and Wild, 2011); "Neither data nor inferences are considered here" (Rousset 2015). From what I can tell, to the supporters of the Price equation and the regression form of Hamilton's rule, the statistical quantities involved are either population-level *descriptive* statistics (in an empirical context), or else are statistics of random variables (in a stochastic modeling context).

      In short, the manuscript seems to argue that Price equation users are performing statistical inference incorrectly, whereas the users insist that they are not doing statistical inference at all.

      The problem (and here I think the author would agree with me) arises when users of the Price equation go on to make predictive or causal claims that would require the kind of statistical analysis they claim not to be doing. Claims of the form "Hamilton's rule predicts.." or use of terms like "benefit" and "cost" suggest that one has inferred a predictive or causal relationship in the given data, while somehow bypassing the entire theory of statistical inference.

      There is also a third way to use the Price equation which is entirely unobjectionable: as a way to express the relationship between individual-level fitness and population-level gene frequency change in a form that is convenient for further algebraic manipulation. I suspect that this is actually the most common use of the Price equation in practice.

      For a paper that aims to clarify these thorny concepts in the literature, I think it is worth pointing out these different interpretations of statistical quantities in the Price equation (descriptive statistics vs inferential statistics vs algebraic manipulation). One can then critique the conclusions that are inappropriately drawn from the Price equation, which would require rigorous statistical inference to draw. Without these clarifications, supporters of the Price equation will again argue that this manuscript has misunderstood the purpose of the equation and that they never claimed to do inference in the first place.

      (5) "True" models

      Even if one accepts that the statistical quantities in the Price equation are inferential in nature, the author appears to go a step further by asserting that, even in empirical populations, there is a specific "true" model which it is our goal to infer. This assumption manifests at many points in the SI when the author refers to the "true model" or "true, underlying population structure" in the context of an empirical population.

      I do not think it is necessary or appropriate, in empirical contexts, to posit the existence of a Platonic "true" model that is generating the data. Real populations are not governed by mathematical models. Moreover, the goal of statistical inference is not to determine the "true model" for given data but to say whether a given statistical model is justified based on this data. Fitting a linear model, for example, does not rule out the possibility there may be higher-order interactions - it just means we do not have a statistical basis to infer these higher-order interactions from the data (say, because their p-scores are insignificant), and so we leave them out.

      What we can say is that if we apply the statistical model to data generated by a probabilistic model, and if these models match, then as the number of observations grows to infinity, the estimators in the statistical model converge to the parameters of the data-generating one. But this is a mathematical statement, not a statement about real-world populations.

      A resolution I suggest to points 3, 4, and 5 above is:<br /> *A priori, the statistical quantities in the Price Equation are descriptive statistics, pertaining only to the specific population data given.<br /> *If one wishes to impute any predictive power, generalizability, or causal meaning to these statistics, all the standard considerations of inferential statistics apply. In particular, one must choose a statistical model that is justified based on the given data. In this case, one is not guaranteed to obtain the standard (linear) Hamilton's rule and may obtain any of an infinite family of rules.<br /> *If one uses a model that is not justified based on the given data, the results will still be correct for the given population data but will lack any meaning or generalizability beyond that.<br /> *In particular, if one considers data generated by a probabilistic model, and applies a statistical model that does not match the data-generating one, the results will be misleading, and will not generalize beyond the randomly generated realization one uses.

      Of course, the author may propose a different resolution to points 3-5, but they should be resolved somehow. Otherwise, the terminology in the manuscript will be incorrect and the ms will not resolve confusion in the field.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors use AlphaFold2 to identify potential binding partners of nuage localizing proteins.

      Strengths:

      The main strength of the paper is that the authors experimentally verify a subset of the predicted interactions.

      Many studies have been performed to predict protein-protein interactions in various subsets of proteins. The interesting story here is that the authors (i) focus on an organelle that contains quite some intrinsically disordered proteins and (ii) experimentally verify some (but not all) predictions.

      Weaknesses:

      Identification of pairwise interactions is only a first step towards understanding complex interactions. It is pretty clear from the predictions that some (but certainly not all) of the pairs could be used to build larger complexes. This is Done only for some cases and could be extended to the entire network.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, the authors investigate the molecular mechanism behind kinesin-1's coordinated movement along microtubules, with a focus on how ATP binding, hydrolysis, and microtubule attachment/detachment are regulated in the leading and trailing heads. Using pre-steady state kinetics and single-molecule assays, they show that the neck linker's conformation modulates nucleotide affinity and detachment rates in each head differently, establishing an asynchronous chemo-mechanical cycle that prevents simultaneous detachment. Supported by cryo-EM structural data, their findings suggest that strain-induced conformational changes in the nucleotide-binding pockets are crucial for kinesin's hand-over-hand movement, presenting a detailed kinetic model of its stepping mechanism. The manuscript is well-crafted, technically rigorous, and should be of significant interest to cell biology and cytoskeletal motor researchers.

      Significance:

      All conclusions are well-supported by the provided data. The findings address a critical gap in our understanding of how kinesin's two motor domains coordinate their movements, offering insights into the molecular basis of its stepping mechanism. This work should be of significant interest to the cytoskeletal research community.

      Comments on latest version:

      The authors have satisfactorily addressed my comments, although I recommend the addition of the following reference:

      Lu Rao, Jan O. Wirth, Jessica Matthias, and Arne Gennerich. 2025. A Two-Heads-Bound State Drives KIF1A Superprocessivity. bioRxiv 2025.01.14.632505

      This paper provides conclusive evidence that kinesin-1 predominantly adopts a one-head-bound state at limiting ATP concentrations and remains in this state for a significant portion of its enzymatic cycle even at saturating ATP. This limits its processivity compared to KIF1A, which predominantly adopts a two-heads-bound state under saturating ATP conditions. These findings directly support the authors' conclusion that trailing head dissociation is favored over leading head detachment.

    1. Reviewer #2 (Public review):

      This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

      This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

      While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

      (1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

      (2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

      (3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

      (4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

      (5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

      (6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

      (7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

    1. Reviewer #2 (Public review):

      Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

      (1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

      (2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

      (3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

      (4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

      (5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

      (6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

    1. Reviewer #2 (Public review):

      Summary

      This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

      Strengths

      This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

      The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

      The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

      Weaknesses

      As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

      As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

      This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

      However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of a fed vs hungry state on food decision-making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings:

      Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

    1. Reviewer #2 (Public review):

      Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

      Strengths:<br /> The potential application to dentin regeneration is interesting.

      Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

      (1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

      (2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

      (3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

      (4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

      (5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

    1. Reviewer #2 (Public review):

      Summary:

      For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

      Strengths:

      By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

    1. Reviewer #2 (Public review):

      Summary:

      Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

      Strengths:

      Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

      Weaknesses:

      The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

    1. Reviewer #2 (Public review):

      It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

    1. Reviewer #2 (Public review):

      Summary:

      Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

      Strengths:

      The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

      Weaknesses:

      (1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

      (2) There is no statement for the upper limitation of the expandability.

      (3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

    1. Reviewer #2 (Public review):

      Summary:

      The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

      Strengths:

      (1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

      (2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

      (3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

      Weaknesses:

      (1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

      (2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

      (3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

    1. Reviewer #2 (Public review):

      The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

      Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

      (1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

      (2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

      (3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

      (4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

      (5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

      To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

    1. Reviewer #2 (Public review):

      Summary and strengths:

      Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

      They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

      Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

      Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

      Strengths:

      The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

      Weaknesses:

      Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

    1. Reviewer #2 (Public review):

      Summary:

      The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

      Strengths:

      The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

      Weaknesses:

      Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

    1. Reviewer #3 (Public review):

      Summary:

      Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

      Strengths:

      The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

      Weaknesses:

      A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

    1. Reviewer #3 (Public review):

      Summary:

      The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

      Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

      Strengths:

      The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

      Weaknesses:

      The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

      Strengths:

      These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

      Weaknesses:

      There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

      Comments on the current version: The authors have addressed my concerns adequately

    1. Reviewer #3 (Public review):

      Summary:

      The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

      Strengths:

      The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

      Comments on revisions:

      I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

    1. Reviewer #2 (Public review):

      This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

      The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

      The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

      The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

      The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

      The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

      One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

      In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

      Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

      Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

      Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    1. Different regions can have unique soilcompositions due to variations in geology, climate, and vegetation.

      "Since soil composition differs by mineral, organic, and environmental components"

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    1. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.

    1. Reviewer #2 (Public Review):

      • A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

      • An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

      Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

      • An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

      • A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

    1. Reviewer #2 (Public review):

      In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

      Major points

      (1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

      (2) The rationale regarding the PR8 hybrid is not well described and should be described better.

      (3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

      (4) Figure 5A and 7A: Negative controls are missing.

      (5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

    1. Reviewer #2 (Public review):

      This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

      The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

      Strengths:

      The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

      Comments on revised version:

      In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

      In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

      Additional comments:

      The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    1. Reviewer #2 (Public review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

      In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

      (1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

      Strengths:

      To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

      Weaknesses:

      However, several critical points need to be addressed.

      (1) Use of Liftoff for GTF Annotation

      The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

      (2) Transcript Filtering and Potential Biases

      The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

      (3) Data Integration with Harmony

      The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

    1. Reviewer #3 (Public review):

      In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

      Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

    1. Reviewer #2 (Public review):

      Summary:

      This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

      Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

      Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

      Strengths:

      The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

      The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

      Weaknesses:

      This study is not, however, without caveats and several specific conclusions are not fully convincing.

      First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

      Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

      Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

      For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

      TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

      In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

      Strengths:

      (1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

      (2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

      Weaknesses:

      (1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

      (2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

      (3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

      (4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

      (5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

      (6) L214, ablations of individual features are missing.

      (7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

      (8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

      (9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

      (10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

      The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

      Strengths:

      The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

      This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

      Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

      Weaknesses:

      Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

      A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

      It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

      The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

      The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

    1. Reviewer #2 (Public review):

      Summary:

      The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

      Strengths:

      The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

      Weaknesses:

      The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

    1. Reviewer #2 (Public review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

      Strengths:

      The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

      That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

      The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

      The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

      I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

      Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

      The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

      Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

      Strengths:

      I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

      Weaknesses:

      The weakness of the study revolves around two aspects:

      (1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

      (2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

      Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

    1. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript Bohra et al. measure the effects of estrogen responsive gene expression upon induction on nearby target genes using a TAD containing the genes TFF1 and TFF3 as a model. The authors propose that there is a sort competition for transcriptional machinery between TFF1 (estrogen responsive) and TFF3 (not responsive) such that when TFF1 is activated and machinery is recruited, TFF3 is activated after a time delay. The authors attribute this time delay to transcriptional machinery that was being sequestered at TFF1 becomes available to the proximal TFF3 locus. The authors demonstrate that this activation is not dependent on contact with the TFF1 enhancer through deletion, instead they conclude that it is dependent on a phase-separated condensate which can sequester transcriptional machinery. Although the manuscript reports an interesting observation that there is a dose dependence and time delay on the expression of TFF1 relative to TFF3, there is much room for improvement in the analysis and reporting of the data. Most importantly there is no direct test of condensate formation at the locus in the context of this study: i.e. dissolution upon the enhancer deletion, decay in a temporal manner, and dependence of TFF1 expression on condensate formation. Using 1,6' hexanediol to draw conclusion on this matter is not adequate to draw conclusions on the effect of condensates on a specific genes activity given current knowledge on its non-specificity and multitude of indirect effects. Thus, in my opinion the major claim that this effect of a time delayed expression of TFF3 being dependent on condensates in not supported by the current data.

      Strengths:

      The depends of TFF1 expression on a single enhancer and the temporal delay in TFF3 is a very interesting finding.

      The non-linear dependence of TFF1 and TTF3 expression on ER concentration is very interesting with potentially broader implications.

      The combined use of smFISH, enhancer deletion, and 4C to build a coherent model is a good approach.

      Weaknesses:

      There is no direct observation of a condensate at the TFF1 and TFF3 locus and how this condensate changes over time after E2 treatment, upon enhancer deletion, whether transcriptional machinery is indeed concentrated within it, and other claims on condensate function and formation made in the manuscript. The use of 1,6' HD is not appropriate to test this idea given how broadly it acts.

      Comments on latest version:

      I don't think the response to Reviewer 2's comment on LLPS condensates on TFF1 are adequate and given this point is essential to the claims of the manuscript they must be addressed. Namely, the data from Saravavanan, 2020 actually suggest that condensate formation at the locus is not very predictive and barely enriched over random spots. The claims in the manuscript on the dependence of the condensate being responsible for sequestering transcriptional machinery are quite strong and the crux of the current model. To continue to make this claim (which I don't think is necessary since there are other possible models) the authors must test if the condensate at his locus (1) shows time dependent behavior, (2) is not present or weakened at the locus in cells that show high TFF3 expression, (3) is indeed enriched for transcriptional machinery when TFF1 peaks. The use of 1,6 hexanediol is not appropriate as pointed out by reviewer 2 and is no longer considered as an appropriate experiment by many as the whole notion of LLPS forming nuclear condensates is now under question. Such condensates can form through a variety of mechanisms as reviewed for example by Mittaj and Pappu (A conceptual framework for understanding phase separation and addressing open questions and challenges, Molecular Cell, 2022). Furthermore, given the distance between TFF1 and TFF3 it is hard to imagine that if a condensate that concentrates machinery in a non-stoichiometric manner was forming how it would not boost expression on both genes and be just specific to one. There must be another mechanism in my opinion.

      I would recommend the authors remove this aspect of their manuscript/model and simply report their interesting findings that are actually supported by data: The temporal delay of TFF3 expression, the dependence on ER concentration, and the enhancer dependence.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents a valuable finding on the impact of FRMD8 loss on tumor progression and the resistance to tamoxifen therapy. The author conducted systematic experiments to explore the role of FRMD8 in breast cancer and its potential regulatory mechanisms, confirming that FRMD8 could serve as a potential target to revere tamoxifen resistance.

      The research is logically coherent and persuasive. The results support their conclusions and have achieved the research objectives.

    1. Reviewer #2 (Public review):

      Summary:

      In the presented work by Wu et al, the authors investigate the role of the transcription factor Pu.1 in the survival and maintenance of microglia, the tissue-resident macrophage population in the brain. To this end, they generated a sophisticated new conditional pu.1 allele in zebrafish using CRISPR-mediated genome editing which allows visual detection of expression of the mutant allele through a switch from GFP to dsRed after Cre-mediated recombination. Using EdU pulse-chase labelling, they first estimated the daily turnover rate of microglia in the adult zebrafish brain which was found to be higher than rates previously estimated for mice and humans. After conditional deletion of pu.1 in coro1a positive cells, they do not find a difference in microglia number at 2 and 8 days or 1-month post-injection of Tamoxifen. However, at 3 months post-injection, a strong decrease in mutant microglia could be detected. While no change in microglia number was detected at 1mpi, an increase in apoptotic cells and decreased proliferation as observed. RNA-seq analysis of WT and mutant microglia revealed an upregulation of tp53, which was shown to play a role in the depletion of pu.1 mutant microglia as deletion in tp53-/- mutants did not lead to a decrease in microglia number at 3mpi. Through analysis of microglia number in pU.1 mutants, the authors further show that the depletion of microglia in the conditional mutants is dependent on the presence of WT microglia. To show that the phenomenon is conserved between species, similar experiments were also performed in mice.

      This work expands on previous in vitro studies using primary human microglia. The majority of conclusions are well supported by the data, addition of controls and experimental details would strengthen the conclusions and rigor of the paper.

      Strengths:

      Generation of an elegantly designed conditional pu.1 allele in zebrafish that allows for the visual detection of expression of the knockout allele.

      The combination of analysis of pu.1 function in two model systems, zebrafish and mouse, strengthens the conclusions of the paper.

      Confirmation of the functional significance of the observed upregulation of tp53 in mutant microglia through double mutant analysis provides some mechanistic insight.

      Weaknesses:

      (1) The presented RNA-Seq analysis of mutant microglia is underpowered and details on how the data was analyzed are missing. Only 9-15 cells were analyzed in total (3 pools of 3-5 cells each). Further, the variability in relative gene expression of ccl35b.1, which was used as a quality control and inclusion criterion to define pools consisting of microglia, is extremely high (between ~4 and ~1600, Figure S7A).

      (2) The authors conclude that the reduction of microglia observed in the adult brain after cKO of pu.1 in the spi-b mutant background is due to apoptosis (Lines 213-215). However, they only provide evidence of apoptosis in 3-5 dpf embryos, a stage at which loss of pu.1 alone does lead to a complete loss of microglia (Figure 2E). A control of pu.1 KI/d839 mutants treated with 4-OHT should be added to show that this effect is indeed dependent on the loss of spi-b. In addition, experiments should be performed to show apoptosis in the adult brain after cKO of pu.1 in spi-b mutants as there seems to be a difference in the requirement of pu.1 in embryonic and adult stages.

      (3) The number of microglia after pu.1 knockout in zebrafish did only show a significant decrease 3 months after 4-OHT injection, whereas microglia were almost completely depleted already 7 days after injection in mice. This major difference is not discussed in the paper.

      (4) Data is represented as mean +/-.SEM. Instead of SEM, standard deviation should be shown in all graphs to show the variability of the data. This is especially important for all graphs where individual data points are not shown. It should also be stated in the figure legend if SEM or SD is shown.

    1. Reviewer #2 (Public review):

      Summary:

      The goal of this proposal was to understand how two separate projection neurons from the medial prefrontal cortex, those innervating the basolateral amygdala (BLA ) and nucleus accumbens (NAc), contribute to the encoding of emotional behaviors. The authors record the activity of these different neuron classes across three different behavioral environments. They propose that, although both populations are involved in emotional behavior, the two populations have diverging activity patterns in certain contexts. A subset of projections to the NAc appears particularly important for social behavior. They then attempt to link these changes to the emotional state of the animal and changes in synaptic connectivity.

      Strengths:

      The behavioral data builds on previous studies of these projection neurons supporting distinct roles in behavior and extend upon previous work by looking at the heterogeneity within different projection neurons across contexts.

      Weaknesses:

      The diversity of neurons mediating these projections and their targeting within the BLA and NAc is not explored. These are not homogeneous structures and so one possibility is that some of the diversity within their findings may relate to targeting of different sub-structures within each region. The electrophysiological data have significant experimental confounds and more methodological information is required to support other conclusions related to these data.

    1. Reviewer #2 (Public review):

      Summary:

      Telomeres are key genomic structures linked to everything from aging to cancer. These key structures at the end of chromosomes protect them from degradation during replication and rely on a complex made up of human telomerase RNA gene (hTERC) and human telomerase reverse transcriptase (hTERT). While hTERC is expressed in all cells, the amount of hTERT is tightly controlled. The main hypothesis being tested is whether telomere length itself could regulate the hTERT enzyme. The authors conducted several experiments with different methods to alter telomere length and measured the binding of key regulatory proteins to this gene. It was generally observed that the shortening of telomere length leads to the recruitment of factors that reduce hTERT expression and lengthening of telomeres has the opposite effect. To rule out direct chromatin looping between telomeres and hTERT as driving this effect artificial constructs were designed and inserted a significant distance away and similar results were obtained.

      Overall, the claims of telomere length-dependent regulation of hTERT are supported throughout the manuscript.

      Strengths:

      The paper has several important strengths. Firstly, it uses several methods and cell lines that consistently demonstrate the same directionality of the findings. Secondly, it builds on established findings in the field but still demonstrates how this mechanism is separate from that which has been observed. Specifically, designing and implementing luciferase assays in the CCR5 locus supports that direct chromatin looping isn't necessary to drive this effect with TRF2 binding. Another strength of this paper is that it has been built on a variety of other studies that have established principles such as G4-DNA in the hTERT locus and TRF2 binding to these G4 sites.

      Weaknesses:

      The largest technical weakness of the paper is that minimal replicates are used for each experiment. I understand that these kinds of experiments are quite costly, and many of the effects are quite large, however, experiments such as the flow cytometry or the IPSC telomere length and activity assays appear to be based on a single sample, and several are based upon two maximum three biological replicates. If samples were added the main effects would likely hold, and many of the assays using GAPDH as a control would result in significant differences between the groups. This unnecessarily weakens the strength of the claims.

      Another detail that weakens the confidence in the claims is that throughout the manuscript there are several examples of the control group with zero variance between any of the samples: e.g. Figure 2K, Figure 3N, and Figure 6G. It is my understanding that a delta delta method has been used for calculation (though no exact formula is reported and would assist in understanding). If this is the case, then an average of the control group would be used to calculate that fold change and variance would exist in the group. The only way I could understand those control group samples always set to 1 is if a tube of cells was divided into conditions and therefore normalized to the control group in each case. A clearer description in the figure legend and methods would be required if this is what was done and repeated measures ANOVA and other statistics should accompany this.

      A final technical weakness of the paper is the data in Figure 5 where the modified hTERT promoter was inserted upstream of the luciferase gene. Specifically, it is unclear why data was not directly compared between the constructs that could and could not form G4s to make this point. For this reason, the large variance in several samples, and minimal biological replicates, this data was the least convincing in the manuscript (though other papers from this laboratory and others support the claim, it is not convincing standalone data).

      The second largest weakness of the paper is formatting.

      When I initially read the paper without a careful reading of the methods, I thought that the authors did not have appropriate controls meaning that if a method is applied to lengthen, there should be one that is not lengthened, and when a method is applied to shorten, one which is not shortened should be analysed as well. In fact, this is what the authors have done with isogenic controls. However, by describing all samples as either telomere short or telomere long, while this simplifies the writing and the colour scheme, it makes it less clear that each experiment is performed relative to an unmodified. I would suggest putting the isogenic control in one colour, the artificially shortened in another, and the artificially lengthened in another.

      Similarly, the graphs, in general, should be consistent with labelling. Figure 2 was the most confusing. I would suggest one dotted line with cell lines above it, and then the method of either elongation or shortening below it. I.e. HT1080 above, hTERC overexpression below, MDAMB-231 above guanine terminal repeats below, like was done on the right. Figure 2 readability would also be improved by putting hTERT promoter GAPDH (-ve control) under each graph that uses this (Panel B and Panel C not just Panel C). All information is contained in the manuscript but one must currently flip between figure legends, methods, and figures to understand what was done and this reduces clarity for the reader.

    1. for - Christine Wamsler - Lund University - homepage - from - youtube - Mindfulness World Community - Awareness, Care and Sustainability for Our Earth - https://hyp.is/GCUJ1APHEfCcr_vvv3lAFw/www.youtube.com/watch?v=CTUc_0GroGM

      research areas - sustainable cities - collaborative governance - city-citizen collaboration - citizen participation - sustainability and wellbeing - sustainability transformation - inner development goals - inner transformation - inner transition - existential sustainability

    1. Reviewer #2 (Public review):

      This work offers an insightful contribution for researchers in computational biology, immunology, and machine learning. By employing a 3-mer embedding and CNN architecture, the authors demonstrate that it is possible to extend sequence context without exponentially increasing the model's complexity.

      Key findings include:

      (1) Efficiency and Performance: Thrifty CNNs outperform traditional 5-mer models and match the performance of significantly larger models like DeepSHM.

      (2) Neutral Mutation Data: A distinction is made between using synonymous mutations and out-of-frame sequences for model training, with evidence suggesting these methods capture different aspects of SHM, or different biases in the type of data.

      (3) Open Source Contributions: The release of a Python package and pre-trained models adds practical value for the community.

      However, readers should be aware of the limitations. The improvements over existing models are modest, and the work is constrained by the availability of high-quality out-of-frame sequence data. The study also highlights that more complex modeling techniques, like transformers, did not enhance predictive performance, which underscores the role of data availability in such studies.

    1. Reviewer #2 (Public review):

      Summary:

      This study used an unbiased approach to evaluate epigenetic dynamics during the differentiation of granule neuron precursors, the cell of origin for Shh-MB. These profiling findings led to the focus on H3K27me3 dynamics, which correlate with the remodeling of epigenetic landscape associated with neuronal differentiation gene activation.

      Strengths:

      Depletion of EZH2, an enzymatic subunit of PRC2, resulted in premature neuronal differentiation in the developing cerebellum.

      Weaknesses:

      Little information is shown about the specific genetic programs disrupted by EZH2 depletion. This is a crucial weakness as existing PRC2 inhibitors do not effectively cross the blood-brain barrier. Further studies are necessary to identify downstream targets of PRC2 that could be targeted to induce neuronal differentiation in MB cells.

    1. Reviewer #3 (Public review):

      Summary:

      This study attempts to reconstruct the history of the COVID-19 epidemic, with its successive waves of viral variants from SARS-CoV-2 seroprevalence during 2021 and 2022 among blood donors in different regions of Bolivia. By using serological tests "specific" for the various variants the authors try to achieve a "colour" vision that is not provided by standard "black-and-white" serology.

      Strengths and Weaknesses:<br /> I am not an expert on the performance of SARS-CoV-2 serological tests, so may overlook certain weaknesses. Instead I tried to assess whether the authors, in this manuscript, have managed to substantiate their claims that "seroprevalence studies are a valuable adjunct to active surveillance because they allow analysis of the level of immunity of a population to a specific pathogen without the need for prospective testing" , and that "genomic surveillance and serology offer distinct yet complementary insights thus far." I think they succeeded, as they paint a credible and interesting history of the epidemic in Bolivia using (to me) novel methodology that certainly will stimulate extensive discussion, controversies, and follow-up studies (for which the authors might make some suggestions).

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

      Strengths:

      Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

      Weaknesses:

      (a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

      Comments on revised verson:

      Several of the points were addressed in the revised manuscript, but the following issues remain:

      Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

      Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

      Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

      Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

      Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

    1. Reviewer #3 (Public review):

      Summary:

      The authors aim to establish that cipargamin can be used for the treatment of infection caused by Babesia organisms.

      Strengths:

      The study provides strong evidence that cipargamin is effective against various Babesia species. In vitro growth assays were used to establish that cipargamin is effective against Babesia bovis and Babesia gibsoni. Infection of mice with Babesia microti demonstrated that cipargamin is as effective as the combination of atovaquone plus azithromycin. Cipargamin protected mice from lethal infection with Babesia rodhaini. Mutations that confer resistance to cipargamin were identified in the gene encoding ATP4, a P-type Na ATPase that is found in other apicomplexan parasites, thereby validating ATP4 as the target of cipargamin. A 7-day treatment of cipagarmin, when combined with a single dose of tafenoquine, was sufficient to eradicate Babesia microti in a mouse model of severe babesiosis caused by lack of adaptive immunity.

      Weaknesses:

      Cipargamin was tested in vivo at a single dose administered daily for 7 days. Despite the prospect of using cipargamin for the treatment of human babesiosis, there was no attempt to identify the lowest dose of cipagarmin that protects mice from Babesia microti infection. In the SCID mouse model, cipargamin was tested in combination with tafenoquine but not with atovaquone and/or azithromycin, although the latter combination is often used as first-line therapy for human babesiosis caused by Babesia microti.

    1. Reviewer #2 (Public review):

      Summary:

      Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to use humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

      In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

      Strengths:

      (1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debateble, these description is valuable knowledge for this field of research.

      (2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

      Weaknesses:

      (1) In this manuscript, such as Fig. 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

      The authors added the data about FOXP3 expression among Tfh/Tph cells in the revised manuscript. This improved our data interpretation.

      (2) The definition of "Disease" discussed after Fig. 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

      The authors appropriately modified the manuscript and provided sufficient information about the definition of diseases.

      (3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Fig. 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

      The authors correctly cited their previous findings about the TCR repertoire variation. This strengthened the discussion of this study.

    1. Reviewer #2 (Public review):

      Summary:

      The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

      Strengths:

      Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

      Provides relevant information on the multivariate organization of serotoninergic system in the brain.

      Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

      Comments on revisions:

      I thank the authors for carefully addressing my comments and in particular for the interesting insights added to the discussion.

      I have just one last remark pertaining to the point of the sample size: rats undergoing the MDMA acute challenge constitute a relatively small sample (N=11); I feel there is a certain risk the results presented might not be particularly replicable. Could the authors prove the stability of their (main) results by randomly iterating the individuals included in their sample (e.g. via permutation tests)? Alternatively, including at least a justification of the sample size in the context of the available evidence would be valuable.

    1. Reviewer #2 (Public review):

      In this manuscript, the authors seek to demonstrate that it is possible to sequence antibody variable domains from cryoEM reconstructions in combination with bottom-up LC-MSMS. In particular, they extract de novo sequences from single particle-cryo-EM-derived maps of antibodies using the "deep-learning tool ModelAngelo", which are run through the program Stitch to try to select the top scoring V-gene and construct a placeholder sequence for the CDR3 of both the heavy and light chain of the antibody under investigation. These reconstructed variable domains are then used as templates to guide the assembly of de novo peptides from LC-MS/MS data to improve the accuracy of the candidate sequence.

      Using this approach the authors claim to have demonstrated that "cryoEM reconstructions of monoclonal antigen-antibody complexes may contain sufficient information to accurately narrow down candidate V-genes and that this can be integrated with proteomics data to improve the accuracy of candidate sequences".

    1. Reviewer #3 (Public review):

      Summary:

      This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

      Strengths:

      The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

      Weakness:

      The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

    1. Reviewer #2 (Public review):

      Summary:

      An initial screening of pretreatment with different stress treatments of K. pneumoniae allowed the identification of heat stress as a protection factor against the infection of the lytic phage Kp11. Then experiments prove that this is mediated not by an increase of phage-resistant bacteria but due to an increase in phage transient tolerant population, which the authors identified as bacteriophage persistence in analogy to antibiotic persistence. Then they proved that phage persistence mediated by heat shock enhanced the evolution of bacterial resistance against the phage. The same trait was observed using other lytic phages, their combinations, and two clinical strains, as well as E. coli and two T phages, hence the phenomenon may be widespread in enterobacteria.

      Next, the elucidation of heat-induced phage persistence was done, determining that phage adsorption was not affected but phage DNA internalization was impaired by the heat pretreatment, likely due to alterations in the bacterial envelope, including the downregulation of envelope proteins and of LPS; furthermore, heat treated bacteria were less sensitive to polymyxins due to the decrease in LPS.

      Finally, cyclic exposure to heat stress allowed the isolation of a mutant that was both resistant to heat treatment, polymyxins, and lytic phage, that mutant had alterations in PspA protein that allowed a gain of function and that promoted the reduction of capsule production and loss of its structure; nevertheless this mutant was severely impaired in immune evasion as it was easily cleared from mice blood, evidencing the tradeoffs between phage/heat and antibiotic resistance and the ability to counteract the immune response.

      Strengths:

      The experimental design and the sequence in which they are presented are ideal for the understanding of their study and the conclusions are supported by the findings, also the discussion points out the relevance of their work particularly in the effectiveness of phage therapy, and allows the design of strategies to improve their effectiveness.

      Weaknesses:

      In its present form, it lacks the incorporation of some relevant previous work that explored the role of heat stress in phage susceptibility, antibiotic susceptibility, tradeoffs between phage resistance and resistance against other kinds of stress, virulence, etc., and the fact that exposure to lytic phages induces antibiotic persistence.

    1. Reviewer #2 (Public review):

      Summary:

      The authors study a panel of sparsely labeled neuronal lines in Drosophila that each form multiple synapses. Critically, each axonal branch can be injured without affecting the others, allowing the authors to differentiate between injuries that affect all axonal branches versus those that do not, creating spared branches. This is a highly powerful model. Axonal injuries are known to cause Wnd (mammalian DLK)-dependent retrograde signals to the cell body, culminating in a transcriptional response. This work identifies a fascinating new phenomenon that this injury response is not all-or-none. If even a single branch remains uninjured, the injury signal is not activated in the cell body. The authors rule out that this could be due to changes in the abundance of Wnd (perhaps if incrementally activated at each injured branch) by Wnd, Hiw's known negative regulator. Thus there is both a yet-undiscovered mechanism to regulate Wnd signaling, and more broadly a mechanism by which the neuron can integrate the degree of injury it has sustained. It will now be important to tease apart the mechanism(s) of this fascinating phenomenon. But even absent a clear mechanism, this is a new biology that will inform the interpretation of injury signaling studies across species.

      Strengths:

      - A conceptually beautiful series of experiments that reveal a fascinating new phenomenon is described, with clear implications (as the authors discuss in their Discussion) for injury signaling in mammals.<br /> - Suggests a new mode of Wnd regulation, independent of Hiw.

      Weaknesses:

      -The use of a somatic transcriptional reporter for Wnd activity is powerful, however, the reporter indicates whether the transcriptional response was activated, not whether the injury signal was received. It remains possible that Wnd is still activated in the case of a spared branch, but that this activation is either local within the axons (impossible determine in the absence of a local reporter) or that the retrograde signal was indeed generated but it was somehow insufficient to activate transcription when it entered the cell body. This is more of a mechanistic detail (and likely an extreme technical challenge to assess) and should not detract from the overall importance of the study

      -That the protective effect of a spared branch is independent of Hiw, the known negative regulator of Wnd, is fascinating. But this leaves open a key question: what is the signal?

      Comments on revisions:

      I appreciate your discussion about the potential bi-modal regulation of the puckered transcriptional reporter and think that readers would benefit from a short discussion of this.

    1. Reviewer #2 (Public review):

      Summary:

      The group around Prof. Scheiffele has made seminal discoveries reg. alternative splicing that is reflected by a current ERC advanced grant and landmark papers in eLife (2015), Science (2016), and Nature Neuroscience (2019). Recently, the group investigated proteins that contain an RRM motif in the mouse cortex. One of them, termed RBM20, was originally thought be muscle-specific and involved in alternative splicing in cardiomyocytes. However, upon close inspection, RBP20 is expressed in a particular set of interneurons (PV positive cells of the somatosensory cortex) in the cortex as well as in mitral cells of the olfactory bulb (OB). Importantly, they used CLIP to identify targets in the OB and heart. Next and quite importantly, they generated a knock-in mouse line with a His-biotin acceptor peptide and a HA epitope to perform specific biochemistry. Not surprisingly, this allowed them to specifically identify transcripts with long introns, however, most of the intronic binding sites were very distant to the splice sites. Closer GO term inspection revealed that RBM20 specifically regulates synapse-related transcripts. In order to get in vivo insight into its function in the brain, the authors generated both global as well as conditional KO mice. Surprisingly, there were no significant differences in in RBM20 PV interneurons, however, 409 transcripts were deregulated in in OB glutamatergic neurons. Here, CLIP sites were mostly found to be very distant from differentially expressed exons. Furthermore, loss-of-function RBM20 primarily yields loss of transcripts, whereas upregulation appears to be indirect. Together, these results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Strengths:

      The quality of the data and the figures is high, impressive and convincing. The reported results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Weaknesses:

      In their revised manuscript, the authors significantly improved the intro and results section, which is now much better suited for the general public and allows better to follow the logic of the experiments. Also, the discussion has now been expanded doing better justice to the importance of the findings presented.

      In my opinion, the revised manuscript clearly improved and represents a timely and important study, which provides major new insight into the expression and possible function of RBM20 in tissues outside of muscle.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a combined experimental and theoretical workflow to study partitioning noise arising during cell division. Such quantifications usually require time-lapse experiments, which are limited in throughput. To bypass these limitations, the authors propose to use flow-cytometry measurements instead and analyse them using a theoretical model of partitioning noise. The problem considered by the authors is relevant and the idea to use statistical models in combination with flow cytometry to boost statistical power is elegant. The authors demonstrate their approach using experimental flow cytometry measurements and validate their results using time-lapse microscopy. However, while I appreciate the overall goal and motivation of this work, I was not entirely convinced by the strength of this contribution. The approach focuses on a quite specific case, where the dynamics of the labelled component depend purely on partitioning. As such it seems incompatible with studying the partitioning noise of endogenous components that exhibit production/turnover. The description of the methods was partly hard to follow and should be improved. In addition, I have several technical comments, which I hope will be helpful to the authors.

      Comments:

      (1) In the theoretical model, copy numbers are considered to be conserved across generations. As a consequence, concentrations will decrease over generations due to dilution. While this consideration seems plausible for the considered experimental system, it seems incompatible with components that exhibit production and turnover dynamics. I am therefore wondering about the applicability/scope of the presented approach and to what extent it can be used to study partitioning noise for endogenous components. As presented, the approach seems to be limited to a fairly small class of experiments/situations.

      (2) Similar to the previous comment, I am wondering what would happen in situations where the generations could not be as clearly identified as in the presented experimental system (e.g., due to variability in cell-cycle length/stage). In this case, it seems to be challenging to identify generations using a Gaussian Mixture Model. Can the authors comment on how to deal with such situations? In the abstract, the authors motivate their work by arguing that detecting cell divisions from microscopy is difficult, but doesn't their flow cytometry-based approach have a similar problem?

      (3) I could not find any formal definition of division asymmetry. Since this is the most important quantity of this paper, it should be defined clearly.

      (4) The description of the model is unclear/imprecise in several parts. For instance, it seems to me that the index "i" does not really refer to a cell in the population, but rather a subpopulation of cells that has undergone a certain number of divisions. Furthermore, why is the argument of Equation 11 suddenly the fraction f as opposed to the component number? I strongly recommend carefully rewriting and streamlining the model description and clearly defining all quantities and how they relate to each other.

      (5) Similarly, I was not able to follow the logic of Section D. I recommend carefully rewriting this section to make the rationale, logic, and conclusions clear to the reader.

      (6) Much theoretical work has been done recently to couple cell-cycle variability to intracellular dynamics. While the authors neglect the latter for simplicity, it would be important to further discuss these approaches and why their simplified model is suitable for their particular experiments.

      (7) In the discussion the authors note that the microscopy-based estimates may lead to an overestimation of the fluctuations due to limited statistics. I could not follow that reasoning. Due to the gating in the flow cytometry measurements, I could imagine that the resulting populations are more stringently selected as compared to microscopy. Could that also be an explanation? More generally, it would be interesting to see how robust the results are in terms of different gating diameters.

      (8) It would be helpful to show flow cytometry plots including the identified subpopulations for all cell lines, currently, they are shown only for HCT116 cells. More generally, very little raw data is shown.

      (9) The title of the manuscript could be tailored more to the considered problem. At the moment it is very generic.

    1. Reviewer #2 (Public review):

      Summary:

      This paper investigates the idea that the protracted maturation of the prefrontal cortex - often viewed as a developmental limitation - may actually confer advantages for conceptual learning in children. The authors focus on semantic control processes, which govern the context-sensitive application of conceptual knowledge, and are closely associated with late-developing regions of the prefrontal cortex.

      Drawing on a computational model, the paper formally tests whether delayed maturation of semantic control promotes the acquisition of conceptual knowledge. The simulations demonstrate that when semantic control and anatomical connectivity mature later, conceptual learning is accelerated without compromising the integrity of the learned representations. Notably, the benefit is most apparent when control connections target intermediate layers in the computational model, suggesting a nuanced interplay between control processes and the underlying conceptual network.

      To validate these computational insights in a human developmental context, the authors conduct a meta-analysis of the classic triadic matching task - a paradigm where participants decide which of two choices best matches a reference concept based on either taxonomic or thematic relations. Critically, when these relations conflict, semantic control is required to select the context-appropriate match. Results indicate that context-sensitive semantic control develops more slowly than basic conceptual knowledge, showing marked improvements between 3 and 6 years of age.

      Overall, the paper argues that the delayed development of prefrontal cortex-based control processes allows for a period of less constrained learning, ultimately enhancing conceptual acquisition. The findings challenge the traditional view of late PFC maturation as solely disadvantageous and instead position it as an adaptive feature for building robust conceptual frameworks in early childhood.

      Strengths:

      (1) Novel Theoretical Contribution<br /> The paper offers a compelling, counterintuitive argument that a developmental lag in the maturation of control processes might be beneficial for semantic learning. This stands in contrast to the conventional framing of late prefrontal cortex (PFC) development as purely disadvantageous (e.g., a "necessary but unfortunate" constraint).

      (2) Well-Grounded Computational Approach<br /> The authors propose a neural network model that is both theoretically driven (hub-and-spoke framework) and systematically tested under various conditions (different timelines for control onset, and different connectivity patterns). Their simulations replicate and extend previous findings about how insulating the multimodal hub from direct control inputs helps preserve abstract conceptual representations.

      (3) Neuro-anatomical basis<br /> The paper connects its computational claims to empirical neuroanatomy, particularly the lack of direct structural connectivity between ventral ATL (the "hub") and the PFC in humans. This lends biological plausibility to the argument that control signals likely reach the ATL via intermediate regions (e.g., posterior temporal cortex).

      (4) Meta-Analysis of Triadic Match-to-Sample<br /> The authors leverage decades of developmental data on conceptual matching tasks, reframing them in terms of semantic control vs. semantic representation. Their analysis nicely illustrates that children can identify semantic relationships (taxonomic or thematic) at age 2 if the task does not require them to select between conflicting semantic relations. In contrast, the ability to choose a task-relevant relation only emerges more robustly in 3-6 years. This developmental pattern aligns with the computational model's predictions.

      Weaknesses:

      The contribution of the paper might be considered rather specialist, and might not appeal to a broad public, which should be typical of a generalist journal. Moreover, the scope of the model is fairly narrow - its relatively small, controlled training environment raises questions about scalability to more naturalistic, high-dimensional data. Finally, the meta-analysis does not test directly the model predictions in terms of specific outcomes of the task, error patterns, or model fit, but only the developmental pattern which was an already observed phenomenon that in part motivated the hypothesis and the model itself.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present data from a single-center cohort of African-American and Hispanic/Latinx individuals with atrial fibrillation (AF). This study provides insight into the incidences and clinical impact of missense variants in the Titin (TTN) gene in this population. In addition, the authors identified a single amino acid TTN missense variant (TTN-T32756I) that was further studied using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). These studies demonstrated that the Four-and-a-Half Lim domains 2 (FHL2), has increased binding with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I-iPSC-aCMs, enhancing the slow delayed rectifier potassium current (Iks) and is a potential mechanism for atrial fibrillation. Finally, the authors demonstrate that suppression of FHL2 could normalize the Iks current.

      Strengths:

      The strengths of this manuscript/study are listed below:

      (1) This study includes a previously underrepresented population in the study of the genetic and mechanistic basis of AF.<br /> (2) The authors utilize current state-of-the-art methods to investigate the pathogenicity of a specific TTN missense variant identified in this underrepresented patient population.<br /> (3) The findings of this study identify a potential therapeutic for treating atrial fibrillation.

      Weaknesses:

      (1) The authors do not include a non-AF group when evaluating the incidence and clinical significance of TTN missense variants in AF patients.

      (2) The authors do not provide evidence that TTN-T32756I-iPSC-aCMs are arrhythmogenic only that there is an increase in the Iks current and associated action potential changes. More specifically, the authors report "compared to the WT, TTN-T32756I-iPSC-aCMs exhibited increased arrhythmic frequency" yet is it is unclear what they are referring to by "arrhythmic frequency".

      (3) There seem to be discrepancies regarding the impact of the TTN-T32756I variant on mechanical function. Specifically, the authors report "both reduced contraction and abnormal relaxation in TTN-T32756I-iPSC-aCMs" yet, separately report "the contraction amplitude of the mutant was also increased . . . suggesting an increased contractile force by the TTN-T32756I-iPSC-aCMs and TTN-T32756I-iPSC-CMs exhibited similar calcium transient amplitudes as the WT."

    1. Reviewer #2 (Public review):

      Summary:

      The authors of this paper note that although polyphosphate (polyP) is found throughout biology, the biological roles of polyP have been under-explored, especially in multicellular organisms. The authors created transgenic Drosophila that expressed a yeast enzyme that degrades polyP, targeting the enzyme to different subcellular compartments (cytosol, mitochondria, ER, and nucleus, terming these altered flies Cyto-FLYX, Mito-FLYX, etc.). The authors show the localization of polyP in various wild-type fruit fly cell types and demonstrate that the targeting vectors did indeed result in the expression of the polyP degrading enzyme in the cells of the flies. They then go on to examine the effects of polyP depletion using just one of these targeting systems (the Cyto-FLYX). The primary findings from the depletion of cytosolic polyP levels in these flies are that it accelerates eclosion and also appears to participate in hemolymph clotting. Perhaps surprisingly, the flies seemed otherwise healthy and appeared to have little other noticeable defects. The authors use transcriptomics to try to identify pathways altered by the cyto-FLYX construct degrading cytosolic polyP, and it seems likely that their findings in this regard will provide avenues for future investigation. And finally, although the authors found that eclosion is accelerated in pupae of Drosophila expressing the Cyto-FLYX construct, the reason why this happens remains unexplained.

      Strengths:

      The authors capitalize on the work of other investigators who had previously shown that expression of recombinant yeast exopolyphosphatase could be targeted to specific subcellular compartments to locally deplete polyP, and they also use a recombinant polyP binding protein (PPBD) developed by others to localize polyP. They combine this with the considerable power of Drosophila genetics to explore the roles of polyP by depleting it in specific compartments and cell types to tease out novel biological roles for polyP in a whole organism. This is a substantial advance.

      Weaknesses:

      Page 4 of the Results (paragraph 1): I'm a bit concerned about the specificity of PPBD as a probe for polyP. The authors show that the fusion partner (GST) isn't responsible for the signal, but I don't think they directly demonstrate that PPBD is binding only to polyP. Could it also bind to other anionic substances? A useful control might be to digest the permeabilized cells and tissues with polyphosphatase prior to PPBD staining and show that the staining is lost.

      In the hemolymph clotting experiments, the authors collected 2 ul of hemolymph and then added 1 ul of their test substance (water or a polyP solution). They state that they added either 0.8 or 1.6 nmol polyP in these experiments (the description in the Results differs from that of the Methods). I calculate this will give a polyP concentration of 0.3 or 0.6 mM. This is an extraordinarily high polyP concentration and is much in excess of the polyP concentrations used in most of the experiments testing the effects of polyP on clotting of mammalian plasma. Why did the authors choose this high polyP concentration? Did they try lower concentrations? It seems possible that too high a polyP concentration would actually have less clotting activity than the optimal polyP concentration.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Chaguza et al. presents a novel perspective on pneumococcal growth kinetics, suggesting that the overall genetic background of Streptococcus pneumoniae, rather than specific loci, plays a more dominant role in determining growth dynamics. Through a genome-wide association study (GWAS) approach, the authors propose a shift in how we understand growth regulation, differing from earlier findings that pinpointed individual genes, such as wchA or cpsE, as key regulators of growth kinetics. This study highlights the importance of considering the cumulative impact of the entire genetic background rather than focusing solely on individual genetic loci.

      The study emphasizes the cumulative effects of genetic variants, each contributing small individual impacts, as the key drivers of pneumococcal growth. This polygenic model moves away from the traditional focus on single-gene influences. Through rigorous statistical analyses, the authors persuasively advocate for a more holistic approach to understanding bacterial growth regulation, highlighting the complex interplay of genetic factors across the entire genome. Their findings open new avenues for investigating the intricate mechanisms underlying bacterial growth and adaptation, providing fresh insights into bacterial pathogenesis.

      Strengths:

      This study exemplifies a holistic approach to unraveling key factors in bacterial pathogenesis. By analyzing a large dataset of whole-genome sequences and employing robust statistical methodologies, the authors provide strong evidence to support their main findings. Which is a leap forward from previous studies focused on a relatively smaller number of strains. Their integration of genome-wide association studies (GWAS) highlights the cumulative, polygenic influences on pneumococcal growth kinetics, challenging the traditional focus on individual loci. This comprehensive strategy not only advances our understanding of bacterial growth regulation but also establishes a foundation for future research into the genetic underpinnings of bacterial pathogenesis and adaptation. The amount of data generated and corresponding approaches to analyze the data are impressive as well as convincing. The figures are convincing and comprehensible too.

      Weaknesses:

      Despite the strong outcomes of the GWAS approach, this study leaves room for differing interpretations. A key point of contention lies in the title, which initially gives the impression that the research addresses growth kinetics under both in vitro and in vivo conditions. However, the study is limited to in vitro growth kinetics, with the assumption that these findings are equally applicable to in vivo scenarios-a premise that is not universally valid. To more accurately reflect the study's scope and avoid potential misrepresentation, the title should explicitly specify "in vitro" growth kinetics. This clarification would better align the title with the study's actual focus and findings.

      This study suggests that the entire genetic background significantly influences bacterial growth kinetics. However, to transform these predictions into established facts, extensive experimental validation is necessary. This would involve "bench experiments" focusing on generating and studying mutant variants of serotypes or strains with diverse genomic variations, such as targeted deletions. The growth phenotypes of these mutants should be analyzed, complemented by complementation assays to confirm the specific roles of the deleted regions. These efforts would provide critical empirical evidence to support the findings from the GWAS approach and enhance understanding of the genetic basis of bacterial growth kinetics.

      In the discussion section, the authors state that "the influence of serotype appeared to be higher than the genetic background for the average growth rate" (lines 296-298). Alongside references 13-15, this emphasizes the important role of capsular variability, which is a key determinant of serotypes, in influencing growth kinetics. However, this raises the question: why isn't a specific locus like cps, which is central to capsule biogenesis, considered a strong influencer of growth kinetics in this study?

      One plausible explanation could be the absence of "elevated signals" for cps in the GWAS analysis. GWAS relies on identifying loci with statistically significant associations to phenotypes. The lack of such signals for cps may indicate that its contribution, while biologically important, does not stand out genome-wide. This might be due to the polygenic nature of growth kinetics, where the overall genetic background exerts a cumulative effect, potentially diluting the apparent influence of individual loci like cps in statistical analyses.

    1. Reviewer #2 (Public review):

      Summary:

      This paper by Wang et al. uses rich brain, behaviour, and genetics data from the ABCD cohort to ask how well cognitive abilities can be predicted from mental-health-related measures, and how brain and genetics influence that prediction. They obtain an out-of-sample correlation of 0.4, with neuroimaging (in particular task fMRI) proving the key mediator. Polygenic scores contributed less.

      Strengths:

      This paper is characterized by the intelligent use of a superb sample (ABCD) alongside strong statistical learning methods and a clear set of questions. The outcome - the moderate level of prediction between the brain, cognition, genetics, and mental health - is interesting. Particularly important is the dissection of which features best mediate that prediction and how developmental and lifestyle factors play a role.

      Weaknesses:

      There are relatively few weaknesses to this paper. It has already undergone review at a different journal, and the authors clearly took the original set of comments into account in revising their paper. Overall, while the ABCD sample is superb for the questions asked, it would have been highly informative to extend the analyses to datasets containing more participants with neurological/psychiatric diagnoses (e.g. HBN, POND) or extend it into adolescent/early adult onset psychopathology cohorts. But it is fair enough that the authors want to leave that for future work.

      In terms of more practical concerns, much of the paper relies on comparing r or R2 measures between different tests. These are always presented as point estimates without uncertainty. There would be some value, I think, in incorporating uncertainty from repeated sampling to better understand the improvements/differences between the reported correlations.

      The focus on mental health in a largely normative sample leads to the predictions being largely based on the normal range. It would be interesting to subsample the data and ask how well the extremes are predicted.

      A minor query - why are only cortical features shown in Figure 3?

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes novel technique development and experiments to track the social gaze of marmosets. The authors used video tracking of multiple cameras in pairs of marmosets to infer head orientation and gaze and then studied gaze direction as a function of distance between animals, relationships, and social conditions/stimuli.

      Strengths:

      Overall the work is interesting and well done. It addresses an area of growing interest in animal social behavior, an area that has largely been dominated by research in rodents and other non-primate species. In particular, this work addresses something that is uniquely primate (perhaps not unique, but not studied much in other laboratory model organisms), which is that primates, like humans, look at each other, and this gaze is an important social cue of their interactions. As such, the presented work is an important advance and addition to the literature that will allow more sophisticated quantification of animal behaviors. I am particularly enthusiastic with how the authors approach the cone of uncertainty in gaze, which can be both due to some error in head orientation measurements as well as variable eye position.

      Weaknesses:

      There are a few technical points in need of clarification, both in terms of the robustness of the gaze estimate, and possible confounds by gaze to non-face targets which may have relevance but are not discussed. These are relatively minor, and more suggestions than anything else.

    1. Reviewer #2 (Public review):

      The authors introduce MorphCellSorter, an open-source tool available on GitHub, designed for automated morphometric analysis of microglia. Current understanding suggests that microglia represent a heterogeneous population, especially in non-steady adult states, better characterized as a continuum rather than distinct cell groups.

      This tool was developed to classify microglia along this continuum. Using stained brain sections and microscope imaging, individual microglia are binarized and processed with MorphCellSorter, which categorizes them based on 20 morphological parameters. Notably, the tool is versatile, as it can be applied to both fluorescent and brightfield brain sections, as demonstrated by the authors. Additionally, it has been tested across various setups (both fixed and live tissues) and biological contexts (including embryonic stages, Alzheimer's disease models, stroke, and primary cell cultures), showcasing its versatility and adaptability. Overall, the study is well-conceived and could have some value in the field.

      Numerous similar tools already exist, and the number is likely to grow, especially with advancements in AI. These tools have limited scientific utility as they provide descriptive rather than informative outputs. Microglial morphology varies due to external influences (such as developmental stages and injuries), but the significance of these variations remains largely hypothetical.

    1. Reviewer #2 (Public review):

      Summary:

      In this article, Ruyle and colleagues assessed the contribution of central and peripheral mu opioid receptors in mediating fentanyl-induced respiratory depression using both nalaxone and nalaxone methiodide, which does not cross the blood brain barrier. Both compounds prevented and reversed fentanyl-induced respiratory depression to a comparable degree. The advantage of peripheral treatments is that they circumvent the withdrawal-like effects of nalaxone. Moreover, neurons located in the nucleus of the solitary tract are no longer activated by fentanyl when nalaxone methiodide is administered, suggesting that these responses are mediated by peripheral mu opioid receptors. The results delineate a role for peripheral mu opioid receptors in fentanyl-derived respiratory depression and identify a potentially advantageous approach to treating overdoses without inflicting withdrawal on the patients.

      Strengths:

      The strengths of the article include the intravenous delivery of all compounds, which increases the translational value of the article. The authors address both prevention and reversal of fentanyl-derived respiratory depression. The experimental design and data interpretation are rigorous and appropriate controls were used in the study. Multiple doses were screened in the study and the approaches were multipronged. The authors demonstrated activation of NTS cells using multiple techniques and the study links peripheral activation of mu opioid receptors to central activation of NTS cells. Both males and females were used in the experiments. The authors demonstrate the peripheral restriction of nalaxone methiodide.

      Weaknesses:

      Nalaxone is already broadly used to prevent overdoses from opioids so in some respects, the effects reported here are somewhat incremental.

      Comments on the latest version:

      I think the authors have adequately addressed previous critiques and I don't have any additional comments.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Barzo and colleagues aim to establish an appraisal for the development of basal electrophysiology of human layer 2/3 pyramidal cells across life and compare their morphological features at the same ages.

      Strengths:

      The authors have generates recordings from an impressive array of patient samples, allowing them to directly compare the same electrophysiological features as a function of age and other biological features. These data are extremely robust and well organised.

      The authors group patient ages into developmentally organised bins, which are elaborated on in supplementary analysis - exemplifying the importance of determining early postnatal development on human neuron function

      Weaknesses:

      The author's use of (perhaps) arbitrary categorisation of spine morphology could limit the full usefulness of these data.

      Overall, the authors achieve their aims by assessing the physiological and morphological properties of human L2/3 pyramidal neurons across life. Their findings have extremely important ramifications for our understanding of human brain development and implications for how different neuronal properties may influence life and disease associated with neurological conditions.

      Comments on revisions:

      Overall, the authors have satisfied my concerns. I fully appreciate their candour with their data and the potential limitations. I especially appreciate their supplementary data inclusions which I believe truly strengthen their conclusions and are a valuable resource for the field,

      I agree whole-heartedly with the authors assertion that it is perhaps better to use the most sophisticated equipment, not always being most appropriate. However, statistical rigour should still be standard. As such, my one remaining concern relates to inappropriate replicate choice of spine morphology data in figure 6. I commend the authors inclusion of additional reconstructions and morphology data from further cells in this data set. However, to me, these still represent data from 3 cells and 1 patient/age - as to the best of my interpretation. I feel it would be more helpful to plot cell averages +/- SD for each cell - even if side-by-side with data from all spines. Likewise, it is unclear what statistical test was performed on these data and did it take into account the fact that these values are a) from 3 technical replicates per group, or b) that many of the data sets consist of many zero-values (would a categorical test be more appropriate?).

    1. Reviewer #2 (Public Review):

      Summary:

      This work presents new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      Strengths:

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells, and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      Weaknesses:

      The scenario where the lines would demonstrate their full potential compared to existing models has not been tested. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. Therefore, a demonstration of the efficient deletion of multiple floxed alleles in a mosaic fashion would be a valuable addition.

      In addition, a drawback of this line is the constitutive expression of Cre. When combined with the confetti line, the reporter cassette will continue flipping, potentially leading to misleading lineage tracing results. Constitutive expression of Cre is also associated with toxicity, as discussed by the authors in the introduction. These drawbacks should be acknowledged.

    1. Reviewer #2 (Public review):

      The authors provide valuable findings characterizing a Prosapip1 conditional knockout mouse and the effects of knockout on hippocampal excitatory transmission, NMDAR transmission, and several learning behaviors. Furthermore, the authors selectively and conditionally knockout Prosapip1 in the dorsal hippocampus and show that it is required for the same spatial learning and memory assessed in the conditional knockout mice. The study uncovers how Prosapip1 is involved PSD organization and is a functional and critical player in dorsal Hippocampal LTP via its interaction with GluN2B subunits. The study is well controlled, detailed, and data in the paper match the conclusions.

      Comments on revisions:

      The authors have addressed all concerns.

    1. Reviewer #2 (Public review):

      Summary:

      The current paper consists of two parts. The first part is the rigorous feature optimization of the MEG signal to decode individual finger identity performed in a sequence (4-1-3-2-4; 1~4 corresponds to little~index fingers of the left hand). By optimizing various parameters for the MEG signal, in terms of (i) reconstructed source activity in voxel- and parcel-level resolution and their combination, (ii) frequency bands, and (iii) time window relative to press onset for each finger movement, as well as the choice of decoders, the resultant "hybrid decoder" achieved extremely high decoding accuracy (~95%). This part seems driven almost by pure engineering interest in gaining as high decoding accuracy as possible.<br /> In the second part of the paper, armed with the successful 'hybrid decoder,' the authors asked more scientific questions about how neural representation of individual finger movement that is embedded in a sequence, changes during a very early period of skill learning and whether and how such representational change can predict skill learning. They assessed the difference in MEG feature patterns between the first and the last press 4 in sequence 41324 at each training trial and found that the pattern differentiation progressively increased over the course of early learning trials. Additionally, they found that this pattern differentiation specifically occurred during the rest period rather than during the practice trial. With a significant correlation between the trial-by-trial profile of this pattern differentiation and that for accumulation of offline learning, the authors argue that such "contextualization" of finger movement in a sequence (e.g., what-where association) underlies the early improvement of sequential skill. This is an important and timely topic for the field of motor learning and beyond.

      Strengths:

      Each part has its own strength. For the first part, the use of temporally rich neural information (MEG signal) has a significant advantage over previous studies testing sequential representations using fMRI. This allowed the authors to examine the earliest period (= the first few minutes of training) of skill learning with finer temporal resolution. Through the optimization of MEG feature extraction, the current study achieved extremely high decoding accuracy (approx. 94%) compared to previous works. For the second part, the finding of the early "contextualization" of the finger movement in a sequence and its correlation to early (offline) skill improvement is interesting and important. The comparison between "online" and "offline" pattern distance is a neat idea.

      Weaknesses:

      Despite the strengths raised, the specific goal for each part of the current paper, i.e., achieving high decoding accuracy and answering the scientific question of early skill learning, seems not to harmonize with each other very well. In short, the current approach, which is solely optimized for achieving high decoding accuracy, does not provide enough support and interpretability for the paper's interesting scientific claim. This reminds me of the accuracy-explainability tradeoff in machine learning studies (e.g., Linardatos et al., 2020). More details follow.

      There are a number of different neural processes occurring before and after a key press, such as planning of upcoming movement and ahead around premotor/parietal cortices, motor command generation in primary motor cortex, sensory feedback related processes in sensory cortices, and performance monitoring/evaluation around the prefrontal area. Some of these may show learning-dependent change and others may not.

      Given the use of whole-brain MEG features with a wide time window (up to ~200 ms after each key press) under the situation of 3~4 Hz (i.e., 250~330 ms press interval) typing speed, these different processes in different brain regions could have contributed to the expression of the "contextualization," making it difficult to interpret what really contributed to the "contextualization" and whether it is learning related. Critically, the majority of data used for decoder training has the chance of such potential overlap of signal, as the typing speed almost reached a plateau already at the end of the 11th trial and stayed until the 36th trial. Thus, the decoder could have relied on such overlapping features related to the future presses. If that is the case, a gradual increase in "contextualization" (pattern separation) during earlier trials makes sense, simply because the temporal overlap of the MEG feature was insufficient for the earlier trials due to slower typing speed.

      Several direct ways to address the above concern, at the cost of decoding accuracy to some degree, would be either using the shorter temporal window for the MEG feature or training the model with the early learning period data only (trials 1 through 11) to see if the main results are unaffected would be some example.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Catani et al. have immunized mice with 17 recombinant N1 neuraminidases (NAs) from human isolates circulating between 2009-2020 to investigate antigenic diversity. NA inhibition (NAI) titers revealed two groups that were antigenically and phylogenetically distinct. Machine learning was used to estimate the antigenic distances between the N1 NAs and mutations at residues K432E and I321V were identified as key determinants of N1 NA antigenicity.

      Strengths:

      Observation of mutations associated with N1 antigenic drift.

      Weaknesses:

      Validation that K432E and I321V are responsible for antigenic drift was not determined in a background strain with native K432 and I321 or the restitution of antibody binding by reversion to K432 and I321 in strains that evaded sera.

    1. Reviewer #2 (Public review):

      This work present new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      The study and the new models have also some limitations. The demonstration of efficient deletion of multiple floxed alleles in a mosaic fashion, a scenario where the lines would demonstrate their full potential compared to existing models, has not been tested in the current study. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. In addition, as discussed by the authors, a limitation of this line is the constitutive expression of Cre, which is associated with toxicity in some cases.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors examined the representational geometry of orientation representations during visual perception and working memory along the visual hierarchy. Using representational similarity analysis, they found that similarity was relatively evenly distributed among all orientations during perception, while higher around oblique orientations during WM. There were some noticeable differences along the visual hierarchy. IPS showed the most pronounced oblique orientation preferences during WM but no clear patterns during perception, likely due to the different task demands for the WM orientation task and the perception contrast discrimination task. The authors proposed two models to capture the differences. The veridical model estimated the representational geometry in perception by assuming an efficient coding framework, while the categorical model estimated the pattern in WM using psychological distances to measure the differences among orientations (including estimates from a separate psychophysical study performed outside the scanner). Therefore, I think this work is valuable and advances our understanding of the transition from perception to memory.

      Strengths:

      The use of RSA to identify representational biases goes beyond simply relying on response patterns and helps identify how representational formats change from perception to WM. The study nicely leverages ideas about efficient coding to explain perceptual representations that are more veridical, while leaning on ideas about abstractions of percepts that are more categorical-psychological in nature (but see (1) below). Moreover, the match between memory biases of orientation and the patterns estimated with RSA were compelling (but see (2) below). I found the analyses showing how RSA and decoding (eg, cross-generalization) are associated and how/why they may differ to be particularly interesting.

      Weaknesses:

      (1) The idea that later visual maps (ie, IPS0) encode perceptions of orientation in a veridical form and then in a categorical form during WM is an attractive idea. However, the support is somewhat weakened by a few issues. The RSA plots in Figure 1C for IPS0 appear to show a similar pattern, but just of lower amplitude during perception. But in the model fits either for orientation statistics or estimated from the psychophysics task, the Veridical model fits best for perception and the Categorical model fits best for memory in IPS0. By my eye, the modeled RSMs in Figures 2 & 3 do not look like the observed ones in Figure 1C. Those modeled RSMs look way more categorical than the observed IPS0. They look like something in between.

      (2) My biggest concern is the omission of the in-scanner behavioral data. Yes, on the one hand, they used the N=17 outside the scanner psychophysics dataset for the analyses in Figure 3. On the other hand, they do not even mention the behavioral data collected in the scanner along with the BOLD data. Those data had clear oblique effects if I recall correctly. Why use the data from the psychophysics experiment? Also, perhaps a missed opportunity; I wonder if the Veridical/Categorical models fit a single subject's RSA data matches that subject's behavioral biases. That would really be compelling if found.

      The data were collected (reanalysis of published study) without consideration for the aims of the current study, and are therefore not optimized to test their goals. The biggest issue is that "The distractors are really distracting me." I'm somewhat concerned about how the distractors may have impacted the results. I honestly did not notice that the authors were using delay periods that had 11s of distractor stimuli until way into the paper. On the one hand, the "patterns" of the model fits across the ROIs appear to be qualitatively similar. That's good if you want to pool data like the authors did. But, while the authors state on line 350 "..we also confirmed that the presence of distractors during the delay did not impact the pattern of results in the memory task (Supplementary Figure 5)." When looking at Supplementary Figure 5, I noticed that there are a couple of exceptions to this. In the Gratings distractor data, V1 shows a better fit to the Veridical model, while V4 and IPS0 shows no better fit to either model. And in the Noise distractor data, neither model fits better for any ROI. At first glance, I was concerned, but then looking at the No distractor data, the pattern is identical to that of the combined data. Thus, this can be seen as a glass half full/empty issue as almost all of the ROIs show a similar pattern, but still it would concern me if I were leading this study. This gets me to my key question, why even use the distractor trials at all, where the interpretation can get dicey? For instance, the authors have shown in this exact data that the impact of distraction affects the fidelity of representations differently along the visual hierarchy (Rademaker, 2019), consistent with several other studies (eg., Bettencourt & Xu, 2016; Lorenc, 2018; Hallenbeck et al., 2022) and with one of the author's preprints (Rademaker & Serences, 2024). My guess is that without the full dataset, some of the RSA analyses are underpowered. If that is the case, I'm fine with it, but it might be nice to state that.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes synaptic connectivity in the Songbird cortex's four main classes of sensory neuron afferents onto three known classes of projection neurons of the pre-motor cortical region HVC. HVC is a region associated with the generation of learned bird songs. Investigators here use all male zebra finches to examine the functional anatomy of this region using patch clamp methods combined with optogenetic activation of select neuronal groups.

      Strengths:

      The quality of the recordings is extremely high and the quantity of data is on a very significant scale, this will certainly aid the field.

      Weaknesses:

      The authors could make the figures a little easier to navigate. Most of the figures use actual anatomical images but it would be nice to have this linked with a zebra finch atlas in more of a cartoon format that accompanied each fluro image. Additionally, for the most part, figures showing the labeling lack scale bar values (in um). These should be added not just shown in the legends.

      The authors could make it clear in the abstract that this is all male zebra finches - perhaps this is obvious given the bird song focus, but it should be stated. The number of recordings from each neuron class and the overall number of birds employed should be clearly stated in the methods (this is in the figures, but it should say n=birds or cells as appropriate).

      The authors should consider sharing the actual electrophysiology records as data.

    1. Reviewer #2 (Public review):

      Summary:

      The author provide evidence that helps resolve long-standing questions about the differential involvement of frontal and posterior cortex in working memory. They show that whereas early visual cortex shows stronger decoding of memory content in a memorization task vs a more complex categorization task, frontal cortex shows stronger decoding during categorization tasks than memorization tasks. They find that task-optimized RNNs trained to reproduce the memorized orientations show some similarities in neural decoding to people. Together, this paper presents interesting evidence for differential responsibilities of brain areas in working memory.

      Strengths:

      This paper was overall strong. It had a well-designed task, best-practice decoding methods, and careful control analyses. The neural network modeling adds additional insight into the potential computational roles of different regions.

      Weaknesses:

      Few. The RNN-fMRI correspondence could be a little more comprehensive, but the paper contributes a compelling set of empirical findings and interpretations that can inform future research.

    1. Reviewer #2 (Public review):

      Dierks et al. investigate the impact of m6A RNA modifications on the mRNA life cycle, exploring the links between transcription, cytoplasmic RNA degradation and subcellular RNA localization. Using transcriptome-wide data and mechanistic modelling of RNA metabolism, the authors demonstrate that a simplified model of m6A primarily affecting cytoplasmic RNA stability is sufficient to explain the nuclear-cytoplasmic distribution of methylated RNAs and the dynamic changes in m6A levels upon perturbation. Based on multiple lines of evidence, they propose that passive mechanisms based on the restricted decay of methylated transcripts in the cytoplasm play a primary role in shaping condition-specific m6A patterns and m6A dynamics. The authors support their hypothesis with multiple large-scale datasets and targeted perturbation experiments. Overall, the authors present compelling evidence for their model which has the potential to explain and consolidate previous observations on different m6A functions, including m6A-mediated RNA export.

    1. Reviewer #2 (Public review):

      In this manuscript, the authors present an approach to correct GRIN lens aberrations, which primarily cause a decrease in signal-to-noise ratio (SNR), particularly in the lateral regions of the field-of-view (FOV), thereby limiting the usable FOV. The authors propose to mitigate these aberrations by designing and fabricating aspherical corrective lenses using ray trace simulations and two-photon lithography, respectively; the corrective lenses are then mounted on the back aperture of the GRIN lens.

      This approach was previously demonstrated by the same lab for GRIN lenses shorter than 4.1 mm (Antonini et al., eLife, 2020). In the current work, the authors extend their method to a new class of GRIN lenses with lengths exceeding 6 mm, enabling access to deeper brain regions as most ventral region of the mouse brain. Specifically, they designed and characterized corrective lenses for GRIN lenses measuring 6.4 mm and 8.8 mm in length. Finally, they applied these corrected long micro-endoscopes to perform high-precision calcium signal recordings in the olfactory cortex.

      Compared with alternative approaches using adaptive optics, the main strength of this method is that it does not require hardware or software modifications, nor does it limit the system's temporal resolution. The manuscript is well-written, the data are clearly presented, and the experiments convincingly demonstrate the advantages of the corrective lenses.

      The implementation of these long corrected micro-endoscopes, demonstrated here for deep imaging in the mouse olfactory bulb, will also enable deep imaging in larger mammals such as rats or marmosets.

      Comments on revisions:

      The authors have clearly addressed all my comments.

    1. Reviewer #2 (Public review):

      Summary:

      The authors sought to evaluate whether analyses of large-scale electrophysiology data obtained from 10 different individual laboratories are reproducible when they use standardized procedures and quality control measures. They were able to reproduce most of their experimental findings across all labs. Despite attempting to target the same brain areas in each recording, variability in electrode targeting was a source of some differences between datasets.

      Strengths:

      This paper gathered a standardized dataset across 10 labs and performed a host of state-of-the-art analyses on it. Their ability to assess the reproducibility of each analysis across this kind of data is an important contribution to the field.

      Comments on revisions:

      The authors have addressed almost all of the concerns that I raised in this revised version. The new RIGOR notebook is helpful, as are the new analyses.

      This paper attributes much error in probe insertion trajectory planning to the fact that the Allen CCF and standard stereotaxic coordinate systems are not aligned. Consequently, it would be very helpful for the community if this paper could recommend software tools, procedures, or code to do trajectory planning that accounts for this.

      I think it would still be helpful for the paper to have some discussion comparing/contrasting the use of the RIGOR framework with existing spike sorting statistics. They mention in their response to reviewers that this is indeed a large space of existing approaches. Most labs performing Neuropixels recordings already do some type of quality control, but these approaches are not standardized. This work is well-positioned to discuss the advantages and disadvantages of these alternative approaches (even briefly) but does not currently do so-it does not need to run any of these competing approaches to helpfully mention ideas for what a reader of the paper should do for quality control with their own data.

    1. Reviewer #2 (Public review):

      This is a comprehensive analysis of Salmonella Dublin genomes that offers insights into the global spread of this pathogen and region-specific traits that are important to understand its evolution. The phenotyping of isolates of ST10 and ST74 also offer insights into the variability that can be seen in S. Dublin, which is also seen in other Salmonella serovars, and reminds the field that it is important to look beyond lab-adapted strains to truly understand these pathogens. This is a valuable contribution to the field. The only limitation, which the authors also acknowledge, is the bias towards S. Dublin genomes from high income settings. However, there is no selection bias; this is simply a consequence of publicly available sequences.

    1. Reviewer #2 (Public review):

      Summary:

      The study highlights the role of CRISP1 and CRISP3, two epididymal proteins, in early embryo development through DNA integrity. The authors demonstrate that C1/C3 DKO sperm exhibit defects in the DNA integrity, probably due to Ca2+ dysregulation in the epididymis. However, direct evidence for this mechanism requires further experiments. The finding of the involvement of the epididymal environment in embryogenesis is significant, but some results on sperm fertilizing ability of C1/C3 DKO mice were similar to the previous report. Thus, this point raises concern about the perspective of novelty.

      Strengths:

      The authors demonstrate that CRISP1 and CRISP3 regulate Ca2+ in the epididymal fluid, and loss of CRISP1 and CRISP3 disrupts Ca2+ regulation in the epididymal fluid, leading to sperm DNA fragmentation and impaired embryonic development after fertilization. This proposed mechanism is both novel and intriguing, offering valuable insights into the epididymal control of sperm quality.

      Weaknesses:

      The evidence supporting the mechanism of CRISP1 and CRISP3 in calcium regulation within epididymis and its contribution to the sperm DNA damage remains limited.

      Major comments:

      The data provided in this manuscript (Figure 2A and B) appear to overlap with data in previously published paper (PMID:33037689), despite differences in the duration of in vivo fertilization after mating. The results in both studies show similar findings, raising concerns about potential data redundancy.

      As shown in Figure 6A, while wild-type sperm were exposed to the epididymal fluid of C1/C3 DKO mice, the wild-type sperm exhibited DNA fragmentation. Additionally, when wild-type sperm were exposed to the epididymal fluid of wild-type mice with 10 mM Ca2+, DNA fragmentation is still observed. Therefore, the authors conclude that the DNA fragmentation in C1/C3 DKO sperm is due to the increased level of the Ca2+. However, the connection between the DNA damage in wild-type sperm exposed to the epididymal fluid of C1/C3 DKO mice and the increased levels of Ca2+ remains unclear. To clarify this, it is suggested that intracellular calcium levels in the wild type sperm should be analyzed before and after exposure to the epididymal fluid of C1/C3 DKO mice (or before and after adding 10 mM Ca2+ into wild-type fluid). Furthermore, the author should explain detailed information on epididymal fluid collection, because Ca2+ levels vary between different sections of the epididymis.

      In lines 321-323, the authors mention the selection system of the female reproductive tract that only allows high-quality sperm to reach the eggs (Cummins and Yanagimachi 1982), but this paper is not listed in the bibliography. It is important to ensure proper referencing.

      The discussion section is too long and difficult to follow well because there is redundancy of the results in many parts. It is recommended to shorten it by focusing only on relevant and important information.

    1. Reviewer #2 (Public review):

      In their manuscript entitled "BEND2 is a crucial player in oogenesis and reproductive aging", the authors present their findings that full-length BEND2 is important for repair of meiotic double strand break repair in spermatocytes, regulation of LINE-1 elements in spermatocytes, and proper oocyte meiosis and folliculogenesis in females. The manuscript utilizes an elegant system to specifically ablate the full-length form of BEND2 which has been historically difficult to study due to its location on the X chromosome and male sterility of global knockout animals.

      The authors have been extremely responsive to reviewer critiques and have presented strong data and appropriate conclusions, making it an excellent addition to the field.

    1. Reviewer #2 (Public review):

      Summary:

      The authors investigated DG neuronal activity at the population and single cell level across sleep/wake periods. They found an infraslow oscillation (0.01-0.03 Hz) in both granule cells (GC) and mossy cells (MC) during NREM sleep. The important findings are:

      (1) The antiparallel temporal dynamics of DG neuron activities and serotonin neuron activities/extracellular serotonin levels during NREM sleep<br /> (2) The GC Htr1a-mediated GC infraslow oscillation.

      Strengths:

      (1) The combination of polysomnography, Ca-fiber photometry, two-photon microscopy and gene depletion is technically sound. The coincidence of microarousals and dips in DG population activity is convincing. The dip in activity in upregulated cells is responsible for the dip at the population level.

      (2) DG GCs express excitatory Htr4 and Htr7 in addition to inhibitory Htr1a, but deletion of Htr1a is sufficient to disrupt DG GC infraslow oscillation, supporting the importance of Htr1a in DG activity during NREM sleep.

      Weaknesses from the original round of review:

      (1) The current data set and analysis are insufficient to interpret the observation correctly [...].

      (2) It is acceptable that DG Htr1a KO induces the reduced freezing in the CFC test (Fig. 6E, F), but it is too much of a stretch that the disruption of DG ISO causes impaired fear memory. There should be a correlation.

      (3) It is necessary to describe the extent of AAV-Cre infection. The authors injected AAV into the dorsal DG (AP -1.9 mm), but the histology shows the ventral DG (Supplementary Fig. 4), which reduces the reliability of this study.

      Comments on revisions:

      Thank you for the clarification of the detection criteria and the quantification of the specific events. This reviewer can now follow the authors' interpretation.

    1. Reviewer #2 (Public review):

      Summary:

      In this well-conceived and timely study, the authors assess the controllability of emotions in a quantitative way using the framework of control theory. They use a controlled distancing intervention halfway through an emotion rating task where emotion-inducing short videos from a validated database are shown and find that the intervention enables a better controllability of externally induced emotions in the experimental group.

      Strengths:

      It is a highly original idea to address the external controllability of emotions using the formal framework of control theory. It is also a very propitious approach to take what could be called a 'micro-therapeutic' perspective which looks at the immediate effect of an intervention instead of the 'macro-therapeutic' mid- or long-term effect of a whole course of therapy.

      Weaknesses:

      Acquiring data online inevitably gives rise to selection and self-selection effects. This needs to be acknowledged clearly. Exacerbating this, participant remuneration seems low at an amount below the minimum or living wage in Western countries (do the authors know where their participants came from?).

      Another concern is that the intervention does not simply take place before the second block begins but is ongoing during the whole of the second block in that it is integrated into the phrasing of the task on each trial. It is therefore somewhat misleading to speak of a period 'after the intervention', and it would have been interesting to assess the effect of this by including a third group where the phrasing does not change, but the floating leaves intervention takes place.

      As mentioned in the Limitations section, observation noise was assumed and not estimated. While this is understandable in this case, the effect of this assumption could have been assessed by simulation with varying levels of observation (and process) noise.

      Relatedly, the reliance on formal model comparison is unfortunate since the outcome of such comparisons is easily influenced by slight changes to assumptions such as noise levels. An alternative approach would have been to develop a favoured model based on its suitability to address the research question and its ability, established by simulation, to distill relevant changes of behaviour into reliable parameter estimates.

      The statistical analyses clearly show the limitations of classical statistical testing with highly complex models of the kind the authors (commendably) use. Hunting for statistically significant interactions in a multivariate repeated-measures design relying on inputs from time series-derived point estimates is a difficult proposition. While the authors make the best of the bad situation they create by using null-hypothesis significance testing, a more promising approach would have been to estimate parameters using a sampler like Stan or PyMC and then draw conclusions based on posterior predictive simulations.

    1. Reviewer #2 (Public review):

      Summary:

      The report by Kohwi-Shigematsu et al. describes the key observation that SATB1 binds directly to so-called BUR elements. This is in contrast to several other reports describing SATB1 binding to promoters and enhancers. This discrepancy is explained by the authors to depend on the features of the ChIP technique being used. Urea-ChIP, innovated by the authors, strips off protein-protein interactions that are maintained in conventional ChIP. The authors convincingly make the case that SATB1 and the key genome organiser CTCF co-localize by conventional ChIP but not urea ChIP, as particularly evident in Figure 2A. SATB1 controls long-range interactions in thymocytes and the expression of gene clusters. This feature is independent of TADs, as the knockdown of SATB1 expression does not affect the TAD patterns.

      Strengths:

      A new and innovative adaptation of the urea ChIP-seq technique has enabled the authors to reveal a new aspect of SATB1 binding to the genome. The authors provide a wealth of data to reinforce their claims. This report thus sheds new light on SATB1 function, which is particularly important given its role in metastasising cancer cells.

      Weaknesses:

      No weaknesses were identified by this reviewer.

    1. Reviewer #2 (Public review):

      Summary:

      This study identifies a key role for bodywide canonical Wnt gradients in controlling the outcome of regeneration within planarians, likely acting in parallel to injury-induced cues that also use tissue asymmetry to control this process. In S. Mediterranea a central part of this decision process is the asymmetric expression of the Wnt inhibitor notum specifically at injury sites facing in the anterior direction to promote head formation and inhibit tail formation through regulation of canonical Wnt signaling pathways. Leveraging classic studies by T.H. Morgan over a century ago, which found that amputated thin transverse fragments occasionally incorrectly regenerate 2 heads rather than a head and a tail in a species of Girardia planarians, this study identifies a closely related species G. Sinensis which undergoes errors to regeneration specificity under similar challenges. Morgan had proposed that his results might arise from the use of a "gradient of materials" providing axis information across the body axis such that small tissue fragments are too narrow to interpret gradient differences, leading to head/tail polarity defects in regeneration. The authors show very convincingly that this species of planaria undergoes notum expression after injury, but unlike in S. Mediterranea, this occurs symmetrically at the onset of regeneration. Using RNAi, they show notum participates in the regeneration of mispolarized heads (though interestingly apparently not in normal head regeneration unlike in Smeds, at least under these conditions). G. Sinensis planarians, like many organisms, have abundant expression of Wnt genes posteriorly. To test whether this gradient of Wnts may participate in the regeneration distinct from any Wnt signals activated after injury, the authors use chemical inhibition to reduce Wnt signaling prior to injury and then alleviate inhibition following injury by removal of the drug and confirming successful washout of the drug using mass spec. They also raise a new antibody that can detect beta-catenin-1 in this species in order to monitor the body-wide cWnt gradient after these treatments, and correlate this with outcomes on the head/tail regeneration decision. Using this approach, they find that homeostatic inhibition of porcupine (required for Wnt secretion) could dampen the cWnt/beta-catenin gradient and increase the incidence of inappropriate head regeneration at posterior-facing wounds. In addition, they find that the cWnt gradient is less steep in larger animals that also concurrently have a higher incidence of mistakes in regeneration specificity. Together, the paper presents compelling experiments and analysis to support the conclusion that cWnt gradients are an important determinant of head/tail identity determination decisions in G. Sinensis, and thereby proposes a plausible model that the notum asymmetry present in S. Mediterranea could act in parallel to support the higher regeneration robustness observed in that species.

      Strengths:

      This is a great paper, an instant classic. It addresses an enduring problem that Morgan and others initiated more than a century ago and brings a new synthesis of ideas to clarify an important mechanism. I also like the term "regeneration specificity" which can provide a nice unification and generalization of ideas that other authors have variously described as regeneration patterning or regeneration polarity. The work is a tour de force that creatively builds new tools and observations to leverage a new model of planarian species for unraveling general mechanisms of regeneration decision-making. The experiments are rigorously conducted and I find the overall data to be quite compelling. I have some comments for the authors to consider below for drawing out the interpretation and also clarifying the underlying mechanism.

      Comments:

      (1) The G. Sinesis species showed accurate head/tail specificity in 2mm thick fragments but was strongly impaired at 1 mm thick. I am assuming that outcomes of pieces greater than 2mm would make similarly robust head/tail choices, implying a rather sharp transition occurring between 1 and 2 mm. In that case, in the gradient model, are there theoretical reasons to predict that polarity outcomes would decline sharply rather than gradually as size thickness decreases? I think the muscle fibers themselves are thought to have lengths on the order of 200 microns, so I wonder what could account for the characteristic length of less than 1mm here? From the lab's prior analysis of beta-cat gradient, is this perhaps the minimal length where a difference in bcat protein levels can be detected? This is not essential to resolve in this draft (in my view), just a very interesting question arising from the present study. Relatedly, it seems that the slope of cWnt at the wound site itself might not be enough information for polarity because at a highly granular level, this should be identical at posterior-facing wounds from trunk fragments versus thin transverse fragments obtained at the same AP position, yet trunk fragments succeed at regeneration specificity whereas thin transverse fragments fail.

      (2) The paper nicely shows strong evidence that notum expression is definitely symmetric at the first occurrence of its expression by 6 hours in D. Sinensis, and this is a really important result of the paper. At 12 hours, it does look to me in the FISH experiments that there is more persistence of expression at the anterior-facing wound versus the posterior-facing wounds (Fig 2D), although the methods for quantification in Fig2E/F do not show a difference in expression at the two wound sites at this time point. Could this difference arise from differences in the perdurance or timing of early wound-induced signaling at the two wound sites that was perhaps too subtle to detect in the quantification methods used? Or perhaps these images do not represent the population? On a related note, the quantification method seems to fail to show that in 6h Smeds, notum expression is indeed asymmetric. Probably the issue here is not the data in the FISH images themselves which strongly support the author's interpretations, but rather a deficiency or limitation of the quantification method used, which should be resolved so that the conclusions from the single FISH images can be interpreted robustly. For example, some authors have used a method of counting notum+ cells and I wonder if this could provide better quantitative information here.

      (3) Given that the double-headed phenotype is observed from thin transverse fragments, ideally, the symmetry of notum could be established to occur in those types of fragments as well. This experiment would clarify that notum is expressed at posterior-facing wounds in the very same types of fragments that undergo the highest levels of mistakes in regeneration specificity.

      (4) Is wnt1 expressed symmetrically at wound sites in this species? It seems there are cases like acoels where wound-induced Wnt activation can occur asymmetrically but through preferential expression of Wnts at posterior-facing wounds, rather than notum. It would be interesting to know although I also think the work the authors already have done in this study itself already constitutes a very comprehensive advance and could be the subject of future work.

      (5) I agree that notum is relatively much more strongly expressed at the far posterior region in D. Senesis than in Smeds, but it does seem from the RNAseq data it also has some locally enriched expression at the anterior pole. Because the RNAseq analysis involves scaling expression across the regions for each gene, it is difficult to know if the anterior expression is relatively lower or perhaps even about the same level of expression as the anterior pole expression of this gene in Smeds. Though not essential to make the desired arguments, in situs on notum in the intact animals would be helpful to clarify this. Relatedly it would be fascinating to know whether D. Senesis notum undergoes anterior-pole expression around the 72 hour or similar timepoint as in Smeds.

      (6) The assessment of beta-catenin gradients was done through protein extractions from whole tissue fragments. However, it has been shown in other planarian species that beta-catenin can have strong tissue-specific expression in, for example, the pharynx, brain, and reproductive systems. Some supporting evidence or argument should be presented to clarify the interpretation that the graded expression observed by western blotting cannot be fully explained by this kind of tissue-specific expression of beta-catenin rather than representing a true signaling gradient as interpreted by the authors. For example, if this antibody could be used in immunostaining, this could support the beta-catenin signaling gradient. Alternatively, information about the location of the pharynx or any other posterior reproductive tissues in D. Sinensis could be calibrated with respect to the fragment bins used for the gradient--perhaps a portion of the C59-dependent body-wide gradient measured here occurs fully within tail tissue that lacks other regionalized tissue that could be a potential additional source of beta-catenin. Further discussion and interpretation, or additional experiments, should be included to rule out alternative confounding sources of beta-catenin in order to clarify the interpretation of the western blot as representing a beta-catenin signaling gradient.

      (7) I find the analysis in Figure 5 to be quite compelling for showing the importance of cWnt/Bcat gradients in contributing to head/tail determination, and I also think that the author's discussion of the limitations of the approach are well articulated and considered. Based on prior literature, it also seems very likely that there is a third redundantly acting component to regeneration specificity, which is the amplification of small differences in cWnt in a directional-dependent manner early in the regeneration process (24-72 hours in Smeds). This would explain why post-amputation with porcupine inhibitor in D. Sinensis caused 100% penetrant defects in regeneration specificity while the pre-treatment paradigm caused a weaker effect (25-40% for larger animals). In Smeds, it is known already that delivery of dsRNAs against beta-catenin-1, wnt1, and notum only after injury caused polarity defects, and thus all three genes certainly have a function relevant for head/tail after injury (Petersen and Reddien 2008, 2009, 2011- please note these experiments were reported in the text of these studies and not in individual figures). This evidence, combined with extensive FISH and complementary RNAi studies in the field, strongly suggests that some combination of the 6-18h injury-induced phase but also very likely the subsequent "pole-specific phase" of wnt1 expression is likely to be important for driving or enacting the tail fate program and is therefore a component of the regeneration specificity mechanism described here.

      (8) Prior work has also demonstrated roles for Wnt genes expressed in gradients to participate in regeneration specificity. In particular, inhibition of the wntP-2/wnt11-5 gene, which is expressed in an animal-wide gradient, strongly enhanced the effects of inhibition of wnt1, which is the earliest wound-activated Wnt gene, to cause 100% penetrant posterior head regeneration phenotypes in S. mediterranea (Petersen and Reddien 2009). These observations are complementary to the present study by implicating Wnts expressed in bodywide gradients in the process of regeneration decision-making. Given that this study also showed that wnt1 is necessary for new wntP-2 expression during the wound-induced early phase and that wnt1 activation does not require beta-catenin for its expression, collectively suggest a more complex process involved in gradient detection and the involvement of wound signals likely beyond only autoregulation of the cWnt gradient or notum asymmetry mechanisms. Although this paper is cited already, framing the present study more fully in context with this and other relevant prior work would be helpful to contextualize the advance for the field.

    1. Reviewer #2 (Public review):

      Summary:

      This study introduces a set of genetically encoded tools for the selective and reversible ablation of excitatory and inhibitory synapses. Previously, the authors developed GFE3, a tool that efficiently ablates inhibitory synapses by targeting an E3 ligase to the inhibitory scaffolding protein Gephyrin via GPHN.FingR, a recombinant, antibody-like protein (Gross et al., 2016). Building on this work, they now present three new ablation tools: PFE3, which targets excitatory synapses, and two new versions of GFE3-paGFE3 and chGFE3-that are photoactivatable and chemically inducible, respectively. These tools enable selective and efficient synapse ablation in specific cell types, providing valuable methods for disrupting neural circuits. This approach holds broad potential for investigating the roles of specific synaptic input onto genetically determined cells.

      Strengths:

      The primary strength of this study lies in the rational design and robust validation of each tool's effectiveness, building on previous work by the authors' group (Gross et al., 2016). Each tool serves distinct research needs: PFE3 enables efficient degradation of PSD-95 at excitatory synapses, while paGFE3 and chGFE3 allow for targeted degradation of Gephyrin, offering spatiotemporal control over inhibitory synapses via light or chemical activation. These tools are efficiently validated through robust experiments demonstrating reductions in synaptic markers (PSD-95 and Gephyrin) and confirming reversibility, which is crucial for transient ablation. By providing tools with both optogenetic and chemical control options, this study broadens the applicability of synapse manipulation across varied experimental conditions, enhancing the utility of E3 ligase-based approaches for synapse ablation.

      Weaknesses:

      While this study provides valuable tools and addresses many critical points for varidation, examining potential issues with specificity and background ubiquitination in further detail could strengthen the paper. For PFE3, the study demonstrates reductions in both PSD-95 and GluA1. In their previous work, GFE3 selectively reduced Gephyrin without affecting major Gephyrin interactors or other PSD proteins. Clarifying whether PFE3 affects additional PSD proteins beyond GluA1 would be important for accurately interpreting results in experiments using PFE3. Additionally, further insight into PFE3's impact on inhibitory synapses would be valuable to assess the excitatory specificity and potential for circuit-level applications. For paGFE3 and chGFE3, the E3 ligase (RING domain of Mdm2) is overexpressed and thus freely diffusible within the cell as a separate construct. Although the authors show that Gephyrin is not significantly reduced without light or chemical activation, it remains possible that other proteins, particularly non-synaptic proteins, could be ubiquitinated due to the presence of freely diffusing E3 ligase in cytosol. Addressing these points would clarify the strengths and limitations of tools, providing users with valuable information.

    1. Reviewer #2 (Public review):

      Summary:

      By measuring intracellular changes in membrane voltage from a single neuron of the medulla the authors describe a method for determining the balance of excitatory and inhibitory synaptic drive onto a single neuron within this important brain region.

      Strengths:

      This data-driven approach to exploring neural circuits is well described and could be valuable in identifying microcircuits that generate rhythms. Importantly, perhaps, this inference method could enable microcircuits to be studied without the need for time consuming anatomical tracing or other more involved electrophysiological techniques. Therefore, I definitely can see the value in developing an approach of this type.

      Weaknesses:

      There are many assumptions that need to be accepted in order to successfully apply this technique and I was pleased to see that several of these assumption have been explored by the authors in this study.

      For example, this approach involves assuming the reversal potential that is associated with the different permeant ions that underlie the excitation and inhibition as well as the application of Ohms law to estimate the contribution of excitation and inhibitory conductance. My first concern was that this approach relies on a linear I-V relationship between the measured voltage and the estimated reversal potential. However, open rectification is a feature of any I-V relationship generated by asymmetric distributions of ions (see the GHK current equation) and will therefore be a particular issue for the inhibition resulting from asymmetrical Cl- ion gradients across GABA-A receptors. The mixed cation conductance that underlies most synaptic excitation will also generate a non-linear I-V relationship due to the inward rectification associated with polyamine block of AMPA receptors. The authors present evidence that over most of the voltage range examined the I-V relationship is linear and this is a helpful addition.

      This approach has similarities to earlier studies undertaken in the visual cortex that estimated the excitatory and inhibitory synaptic conductance changes that contributed to membrane voltage changes during receptive field stimulation. However, these approaches also involved the recording of transmembrane current changes during visual stimulation that were undertaken in voltage-clamp at various command voltages to estimate the underlying conductance changes. Molkov et al have attempted to essentially deconvolve the underlying conductance changes without this information and I am concerned that this simply may not be possible.

      The current balance equation (1) cited in this study is based upon the parallel conductance model developed by Hodgkin & Huxley. One key element of the HH equations is the inclusion of an estimate of the capacitive current generated due to the change in voltage across the membrane capacitance. While the present study takes into account the impact of membrane capacitance, a deeper discussion on how variations in capacitance across different neuron types might affect inference accuracy would be useful. Differences in capacitance could introduce variability in inferred conductances, potentially influencing model predictions.

      Studies using acute slicing preparations to examine circuit effects have often been limited to the study of small microcircuits - especially feedforward and feedback interneuron circuits. It is widely accepted that any information gained from this approach will always be compromised by the absence of patterned afferent input from outside the brain region being studied. In this study, descending control from the Pons and the neocortex will not be contributing much to the synaptic drive and ascending information from respiratory muscles will also be absent completely. This may not have been such a major concern if this study was limited to demonstrating the feasibility of a methodological approach. However, this limitation does need to be considered when using an approach of this type to speculate on the prevalence of specific circuit motifs within the medulla (Figure 4). Therefore, I would argue that some discussion of this limitation should be included in this manuscript.

    1. Reviewer #2 (Public review):

      Summary:

      The study examined 10 congenitally blind patients who recovered vision through the surgical removal of bilateral dense cataracts, measuring neural activity and neuro chemical profiles from the visual cortex. The declared aim is to test whether restoring visual function after years of complete blindness impacts excitation/inhibition balance in the visual cortex. The manuscript reports precious behavioural, electrophysiological and magnetic resonance data from a rare population. Although the findings are useful for stimulating further research in the field, they only provide incomplete support to the authors' claims.

      The main claim is that sight recovery impacts the excitation/inhibition balance in the visual cortex; however, the paradigm does not allow to distinguish the effects of sight recovery from those of visual deprivation (i.e. in patients who were born blind but recovered vision after several months/years vs. patients who were born blind and never recovered vision); moreover, the link between electrophysiological findings and cortical excitation/inhibition is tentative and its interpretation remains speculative.

      Strengths:

      The findings are undoubtedly useful for the community, as they contribute towards characterising the many ways in which this special population differs from normally sighted individuals. The combination of MRS and EEG measures is a promising strategy to estimate a fundamental physiological parameter - the balance between excitation and inhibition in the visual cortex, which animal studies show to be heavily dependent upon early visual experience. Thus, the reported results pave the way for further studies, which may use a similar approach to evaluate more patients and control groups.

      Weaknesses:

      The main methodological limitation is the lack of an appropriate comparison group or condition to delineate the effect of sight recovery (as opposed to the effect of congenital blindness). Few previous studies suggested that Excitation/Inhibition ratio in the visual cortex is increased in congenitally blind patients; the present study reports that E/I ratio decreases instead. The authors claim that this implies a change of E/I ratio following sight recovery. However, supporting this claim would require showing a shift of E/I after vs. before the sight-recovery surgery, or at least it would require comparing patients who did and did not undergo the sight-recovery surgery (as common in the field).

      There are also more technical limitations related to the correlation analyses, which are partly acknowledged in the manuscript. A bland correlation between GLX/GABA and the visual impairment is reported, but this is specific to the patients group (N=10) and would not hold across groups (the correlation is positive, predicting the lowest GLX/GABA ratio values for the sighted controls - opposite of what is found). There is also a strong correlation between GLX concentrations and the EEG power at the lowest temporal frequencies. Although this relation is intriguing, it only holds for a very specific combination of parameters (of the many tested): only with eyes open, only in the patients group.

      Conclusions:

      The main claim of the study is that sight recovery impacts the excitation/inhibition balance in the visual cortex, estimated with MRS or through indirect EEG indices. However, due to the weaknesses outlined above, the study cannot distinguish the effects of sight recovery from those of visual deprivation. Moreover, many aspects of the results are interesting but their validation and interpretation require additional experimental work.

      Comments on revisions:

      The authors' revisions did not substantially alter the manuscript. As such, my assessment above remains unaltered.

    1. Reviewer #3 (Public review):

      Summary:

      The authors investigate the extent to which the responses of different layers of a vision model (VGG-11) can be linked to the cascade of responses (namely, type-I, type-II and N400) in the human brain when reading words. To achieve maximal consistency between, they add noisy-activations to VGG and finetune it on a character recognition task. In this setup, they observe various similarities between the behavior of VGG and the brain when presented with various transformations of the words (added noise, font modification etc).

      Strengths:<br /> - The paper is well written and well presented<br /> - The topic studied is interesting.<br /> - The fact that the response of the CNN on unseen experimental contrasts such as adding noise correlated with previous results on the brain is compelling.

      Weaknesses:<br /> - The paper is rather qualitative in nature. In particular, the authors show that some resemblance exists between the behavior of some layers and some parts of the brain, but it is hard to quantitively understand how strong the resemblences are in each layer, and the exact impact of experimental settings such as the frequency balancing (which seems to only have a very moderate effect according to figure 5)<br /> - The experiments only consider a rather outdated vision model (VGG)

      Comments on revisions:

      After rebuttal, the authors significantly strengthened their results. I now find the paper much more convincing, and thank the author for their careful consideration of the reviewers' suggestions.

    1. Reviewer #2 (Public review):

      Wolbachia are maternally transmitted bacteria that can manipulate host reproduction in various ways. Some Wolbachia induce male killing (MK), where the sons of infected mothers are killed during development. Several MK-associated genes have been identified in Homona magnanima, including Hm-oscar and wmk-1-4, but the mechanistic links between these Wolbachia genes and MK in the native host are still unclear.

      In this manuscript, Arai et al. show that Hm-oscar is the gene responsible for Wolbachia-induced MK in Homona magnanima. They provide evidence that Hm-Oscar functions through interactions with the sex determination system. They also found that Hm-Oscar disrupts sex determination in male embryos by inducing female-type dsx splicing and impairing dosage compensation. Additionally, Hm-Oscar suppresses the function of Masc. The manuscript is well-written and presents intriguing findings. The results support their conclusions regarding the diversity and commonality of MK mechanisms, contributing to our understanding of the mechanisms and evolutionary aspects of Wolbachia-induced MK.

    1. Reviewer #2 (Public review):

      This paper examines the reproducibility of results reported by the Murphy lab regarding transgenerational inheritance of a learned avoidance behavior in C. elegans. It has been well established by multiple labs that worms can learn to avoid the pathogen pseudomonas aeruginosa (PA14) after a single exposure. The Murphy lab has reported that learned avoidance is transmittable to 4 generations and dependent on a small RNA expressed by PA14 that elicits the transgenerational silencing of a gene in C. elegans. The Hunter lab now reports that although they can reproduce inheritance of the learned behavior by the first generation (F1), they cannot reproduce inheritance in subsequent generations.

      This is an important study that will be useful for the community. Although they fail to identify a "smoking gun", the study examine several possible sources for the discrepancy, and their findings will be useful to others interested in using these assays. The preference assay appears to work in their hands in as much as they are able to detect the learned behavior in the P0 and F1 generations, suggesting that the failure to reproduce the transgenerational effect is not due to trivial mistakes in the protocol. The authors provide a full protocol and highlight key deviations from the Murphy lab protocol. The authors provide good evidence that no single protocol modification was sufficient on its own to explain the divergent results. It remains possible that protocol differences affected the assay cumulatively or that other uncontrolled factors were responsible. Nevertheless, the authors provide good evidence that the trans-generational effect reported by the Murphy lab lacks experimental robustness, calling into question its ecological relevance in the wild.

    1. Reviewer #3 (Public review):

      Chen et al have identified a new candidate gene for high myopia, ZC3H11A, and using a knock-out mouse model, have attempted to validate it as a myopia gene and explain a potential mechanism. They identified 4 heterozygous missense variants in highly myopic teenagers. These variants are in conserved regions of the protein, and predicted to be damaging, but the only evidence the authors provide that these specific variants affect protein function is a supplement figure showing decreased levels of IκBα after transfection with overexpression plasmids (not specified what type of cells were transfected). This does not prove that these mutations cause loss of function, in fact it implies they have a gain-of-function mechanism. They then created a knock-out mouse. Heterozygotes show myopia at all ages examined but increased axial length only at very early ages. Unfortunately, the authors do not address this point or examine corneal structure in these animals. They show that the mice have decreased B-wave amplitude on electroretinogram (a sign of retinal dysfunction associated with bipolar cells), and decreased expression of a bipolar cell marker, PKCα. On electron microscopy, there are morphologic differences in the outer nuclear layer (where bipolar, amacrine, and horizontal cell bodies reside). Transcriptome analysis identified over 700 differentially expressed genes. The authors chose to focus on the PI3K-AKT and NF-κB signaling pathways and show changes in expression of genes and proteins in those pathways, including PI3K, AKT, IκBα, NF-κB, TGF-β1, MMP-2 and IL-6, although there is very high variability between animals. They propose that myopia may develop in these animals either as a result of visual abnormality (decreased bipolar cell function in the retina) or by alteration of NF-κB signaling. These data provide an interesting new candidate variant for development of high myopia, and provide additional data that MMP2 and IL6 have a role in myopia development. For this revision, none of my previous suggestions have been addressed.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a straightforward and convincing demonstration of a reagent and workflow that they collectively term "MagIC-cryo-EM", in which magnetic nanobeads combined with affinity linkers are used to specifically immobilize and locally concentrate complexes that contain a protein-of-interest. As a proof of concept, they localize, image, and reconstruct H1.8-bound nucleosomes reconstructed from frog egg extracts. The authors additionally devised an image-processing workflow termed "DuSTER", which increases the true positive detections of the partially ordered NPM2 complex. The analysis of the NPM2 complex {plus minus} H1.8 was challenging because only ~60 kDa of protein mass was ordered. Overall, single-particle cryo-EM practitioners should find this study useful.

      Strengths:

      The rationale is very logical and the data are convincing.

      Weaknesses:

      I have seen an earlier version of this study at a conference. The conference presentation was much easier to follow than the current manuscript. It is as if this manuscript had undergone review at another journal and includes additional experiments to satisfy previous reviewers. Specifically, the NPM2 results don't seem to add much to the main story (MagIC-cryo-EM) and read more like an addendum. The authors could probably publish the NPM2 results separately, which would make the core MagIC results (sans DusTER) easier to read.

      Comments on revisions:

      The authors have addressed my concerns. Congratulations!

    1. Reviewer #3 (Public review):

      Summary:

      Previous studies have analyzed the binding of ZapD to FtsZ and provided images of negatively stained toroids and straight bundles, where FtsZ filaments are presumably crosslinked by ZapD dimers. Toroids without ZapD have also been previously formed by treating FtsZ with crowding agents. The present study is the first to apply cryoEM tomography, which can resolve the structure of the toroids in 3D. This shows a complex mixture of filaments and sheets irregularly stacked in the Z direction and spaced radially. The most important interpretation would be to distinguish FtsZ filaments from ZapD crosslinks, This is less convincing. The authors seem aware of the ambiguity: "However, we were unable to obtain detailed structural information about the ZapD connectors due to the heterogeneity and density of the toroidal structures, which showed significant variability in the conformations of the connections between the filaments in all directions." Therefore, the reader may assume that the crosslinks identified and colored red are only suggestions, and look for their own structural interpretations. But readers should also note some inconsistencies in stoichiometry and crosslinking arrangements that are detailed under "weaknesses."

      Strengths.

      This is the first cryoEM tomography to image toroids and straight bundles of FtsZ filaments bound to ZapD. A strength is the resolution, which. at least for the straight bundles. is sufficient to resolve the ~4.5 nm spacing of ZapD dimers attached to and projecting subunits of an FtsZ filament. Another strength is the pelleting assay to determine the stoichiometry of ZapD:FtsZ (although this also leads to weaknesses of interpretation).

      Weaknesses

      The stoichiometry presents some problems. Fig. S5 uses pelleting to convincingly establish the stoichiometry of ZapD:FtsZ. Although ZapD is a dimer, the concentration of ZapD is always expressed as that of its subunit monomers. Fig. S5 shows the stoichiometry of ZapD:FtsZ to be 1:1 or 2:1 at equimolar or high concentrations of ZapD. Thus at equimolar ZapD, each ZapD dimer should bridge two FtsZ's, likely forming crosslinks between filaments. At high ZapD, each FtsZ should have it's own ZapD dimer. However, this seems contradicted by later statements in Discussion and Results. (1) "At lower concentrations of ZapD, .. toroids are the most prominent structures, containing one ZapD dimer for every four to six FtsZ molecules." Shouldn't it be one ZapD dimer for every two FtsZ? (2) "at the high ZapD concentration...a ZapD dimer binds two FtsZ molecules connecting two filaments." Doesn't Fig. S5 show that each FtsZ subunit has its own ZapD dimer? And wouldn't this saturate the CTD sites with dimers and thus minimize crosslinking?

      A major weakness is the interpretation of the cryoEM tomograms, specifically distinguishing ZapD from FtsZ. The distinction of crosslinks seems based primarily on structure: long continuous filaments (which often appear as sheets) are FtsZ, and small masses between filaments are ZapD. The density of crosslinks seems to vary substantially over different parts of the figures. More important, the density of ZapD's identified and colored red seem much lower than the stoichiometry detailed above. Since the mass of the ZapD monomer is half that of FtsZ, the 1:1 stoichiometry in toroids means that 1/3 of the mass should be ZapD and 2/3 FtsZ. However, the connections identified as ZapD seem much fewer than the expected 1/3 of the mass. The authors conclude that connections run horizontally, diagonally and vertically, which implies no regularity. This seems likely, but as I would suggest that readers need to consider for themselves what they would identify as a crosslink.

      In contrast to the toroids formed at equimolar FtsZ and ZapD, thin bundles of straight filaments are assembled in excess ZapD. Here the stoichiometry is 2:1, which would mean that every FtsZ should have a bound ZapD DIMER. The segmentation of a single filament in Fig. 5e seems to agree with this, showing an FtsZ filament with spikes emanating like a picket fence, with a 4.5 nm periodicity. This is consistent with each spike being a ZapD dimer, and every FtsZ subunit along the filament having a bound ZapD dimer. But if each FtsZ has its own dimer, this would seem to eliminate crosslinking. The interpretative diagram in Fig. 6, far right, which shows almost all ZapD dimers bridging two FtsZs on opposite filaments, would be inconsistent with this 2:1 stoichiometry.

      In the original review I suggested a control that might help identify the structures of ZapD in the toroids. Popp et al (Biopolymers 2009) generated FtsZ toroids that were identical in size and shape to those here, but lacking ZapD. These toroids of pure FtsZ were generated by adding 8% polyvinyl chloride, a crowding agent. The filamentous substructure of these toroids in negative stain seemed very similar to that of the ZapD toroids here. CryoET of these toroids lacking ZapD might have been helpful in confirming the identification of ZapD crosslinks in the present toroids. However, the authors declined to explore this control.

      Finally, it should be noted that the CTD binding sites for ZapD should be on the outside of curved filaments, the side facing the membrane in the cell. All bound ZapD should project radially outward, and if it contacted the back side of the next filament, it should not bind (because the CTD is on the front side). The diagram second to right in Fig. 6 seems to incorporate this abortive contact.

    1. Reviewer #2 (Public review):

      Summary:

      The authors carry out a careful and rigorous quantitative analysis of RecB transcript and protein levels at baseline and in response to DNA damage. Using single-molecule FISH and Halo-tagging in order to achieve sensitive measurements, they provide evidence that enhanced RecB protein levels in response to DNA damage are achieved through a post-transcriptional mechanism mediated by the La-like RNA binding protein, Hfq. In terms of biological relevance, the authors suggest that this mechanism provides a way to control the optimum level of RecB expression as both deletion and over-expression are deleterious. In addition, the proposed mechanism provides a new framework for understanding how transcriptional noise can be suppressed at the protein level.

      Strengths:

      Strengths of the manuscript include the rigorous approaches and orthogonal evidence to support the core conclusions, for example, the evidence that altering either Hfq or its recognition sequence on the RNA similarly enhance the protein to RNA ratio of RecB. The writing is clear and the experiments are well-controlled. The modeling approaches provide essential context to interpret the data, particularly given the small numbers of molecules per cell. The interpretations are careful and well supported. The findings

      Weaknesses:

      Future studies (and possibly new experimental tools) will be needed to provide further insight into the relevance of the findings to more subtle changes in RecB levels than that occurring in response to extensive DNA damage.

    1. Reviewer #2 (Public review):

      Summary:

      Many aspects of the study are carefully done, and in the grand scheme this is a solid contribution. I have no "big-picture" concerns about the approach or methodology. However, in numerous places the manuscript is unnecessarily vague, ambiguous, or confusing. Tightening up the presentation will magnify their impact.

      Strengths:

      (1) The study includes urine donors from males of three strains each with three social states, as well as females in two states. This diversity significantly enhances their ability to interpret their results.

      (2) Several distinct analyses are used to explore the question of whether AOB MCs are biased towards specific states or different between estrus and non-estrus females. The results of these different analyses are self-reinforcing about the main conclusions of the study.

      (3) The presentation maintains a neutral perspective throughout while touching on topics of widespread interest.

      Weaknesses:

      (1) Introduction:<br /> The discussion of the role of the VNS and preferences for different male stimuli should perhaps include Wysocki and Lepri 1991

      (2) Results:<br /> a) Given the 20s gap between them, the distinction between sample application and sympathetic nerve trunk stimulation needs to be made crystal clear; in many places, "stimulus application" is used in places where this reviewer suspects they actually mean sympathetic nerve trunk stimulation.<br /> b) There appears to be a mismatch between the discussion of Figure 3 and its contents. Specifically, there is an example of an "adjusted" pattern in 3A, not 3B.<br /> c) The discussion of patterns neglects to mention whether it's possible for a neuron to belong to more than one pattern. For example, it would seem possible for a neuron to simultaneously fit the "ICR pattern" and the "dominant adjusted pattern" if, e.g., all ICR responses are stronger than all others, but if simultaneously within each strain the dominant male causes the largest response.

      (3) Discussion:<br /> a) The discussion of chemical specificity in urine focuses on volatiles and MUPs (citation #47), but many important molecules for the VNS are small, nonvolatile ligands. For such molecules, the corresponding study is Fu et al 2015.<br /> b) "Following our line of reasoning, this scarcity may represent an optimal allocation of resources to separate dominant from naïve males": 1 unit out of 215 is roughly consistent with a single receptor. Surely little would be lost if there could be more computational capacity devoted to this important axis than that? It seems more likely that dominance is computed from multiple neuronal types with mixed encoding.

      (4) Methods:<br /> a) Male status, "were unambiguous in most cases": is it possible to put numerical estimates on this? 55% and 99% are both "most," yet they differ substantially in interpretive uncertainty.<br /> b) Surgical procedures and electrode positioning: important details of probes are missing (electrode recording area, spacing, etc).<br /> c) Stimulus presentation procedure: Are stimuli manually pipetted or delivered by apparatus with precise timing?<br /> d) Data analysis, "we applied more permissive criteria involving response magnitude": it's not clear whether this is what's spelled out in the next paragraph, or whether that's left unspecified. In either case, the next paragraph appears to be about establishing a noise floor on pattern membership, not a "permissive criterion."<br /> e) Data analysis, method for assessing significance: there's a lot to like about the use of pooling to estimate the baseline and the use of an ANOVA-like test to assess unit responsiveness.<br /> But:<br /> i) for a specific stimulus, at 4 trials (the minimum specified in "Stimulus presentation procedure") kruskalwallis is questionable. They state that most trials use 5, however, and that should be okay.<br /> ii) the methods statement suggests they are running kruskalwallis individually for each neuron/stimulus, rather than once per neuron across all stimuli. With 11 stimuli, there is a substantial chance of a false-positive if they used p < 0.05 to assess significance. (The actual threshold was unstated.) Were there any multiple comparison corrections performed? Or did they run kruskalwallis on the neuron, and then if significant assess individual stimuli? (Which is a form of multiple-comparisons correction.)

    1. Reviewer #2 (Public review):

      Summary:

      Pinho et al. developed a new auditory-visual sensory preconditioning procedure in mice and examined the contribution of the dorsal and ventral hippocampus to learning in this task. Using photometry they observed activation of the dorsal and ventral hippocampus during sensory preconditioning and conditioning. Finally, the authors combined their sensory preconditioning task with DREADDs to examine the effect of inhibiting specific cell populations (CaMKII and PV) in the DH on the formation and retrieval/expression of mediated learning.

      Strengths:

      The authors provide one of the first demonstrations of auditory-visual sensory preconditioning in male mice. Research on the neurobiology of sensory preconditioning has primarily used rats as subjects. The development of a robust protocol in mice will be beneficial to the field, allowing researchers to take advantage of the many transgenic mouse lines. Indeed, in this study, the authors take advantage of a PV-Cre mouse line to examine the role of hippocampal PV cells in sensory preconditioning.

      Weaknesses:

      (1) The authors report that sensory preconditioning was observed in both male and female mice. However, their data only supports sensory preconditioning in male mice. In female mice, both paired and unpaired presentations of the light and tone in stage 1 led to increased freezing to the tone at test. In this case, fear to the tone could be attributed to factors other than sensory preconditioning, for example, generalization of fear between the auditory and visual stimulus.

      (2) In the photometry experiment, the authors report an increase in neural activity in the hippocampus during both phase 1 (sensory preconditioning) and phase 2 (conditioning). In the subsequent experiment, they inhibit neural activity in the DH during phase 1 (sensory preconditioning) and the probe test, but do not include inhibition during phase 2 (conditioning). It was not clear why they didn't carry forward investigating the role of the hippocampus during phase 2 conditioning. Sensory preconditioning could occur due to the integration of the tone and shock during phase two, or retrieval and chaining of the tone-light-shock memories at test. These two possibilities cannot be differentiated based on the data. Given that we do not know at which stage the mediate learning is occurring, it would have been beneficial to additionally include inhibition of the DH during phase 2.

      (3) In the final experiment, the authors report that inhibition of the dorsal hippocampus during the sensory preconditioning phase blocked mediated learning. While this may be the case, the failure to observe sensory preconditioning at test appears to be due more to an increase in baseline freezing (during the stimulus off period), rather than a decrease in freezing to the conditioned stimulus. Given the small effect, this study would benefit from an experiment validating that administration of J60 inhibited DH cells. Further, given that the authors did not observe any effect of DREADD inhibition in PV cells, it would also be important to validate successful cellular silencing in this protocol.

    1. Reviewer #2 (Public review):

      Streptococcus pyogenes, or group A streptococci (GAS) can cause diseases ranging from skin and mucosal infections, to plasma invasion, and post-infection autoimmune syndromes. M proteins are essential GAS virulence factors that include an N-terminal hypervariable region (HVR). M proteins are known to bind to numerous human proteins; a small subset of M proteins were reported to bind collagen, which is thought to promote tissue adherence. In this paper, the authors characterize M3 interactions with collagen and its role in biofilm formation. Specifically, they screened different collagen type II and III variants for full-length M3 protein binding using an ELISA-like method, detecting anti-GST antibody signal. By statistical analysis, hydrophobic amino acids and hydroxyproline were found to positively support binding, whereas acidic residues and proline negatively impacted binding (Table 1). The authors applied X-ray crystallography to determine the structure of the N-terminal domain (42-151 amino acids) of M3 protein (M3-NTD). M3-NTD dimmer (PDB 8P6K) forms a T-shaped structure with three helices (H1, H2, H3), which are stabilized by a hydrophobic core, inter-chain salt bridges and hydrogen bonds on H1, H2 helices, and H3 coiled coil. The conserved Gly113 serves as the turning point between H2 and H3 (Figure 5). The M3-NTD is co-crystalized with a 24-residue peptide, JDM238, to determine the structure of M3-collagen binding. The structure (PDB 8P6J) shows that two copies of collagen in parallel bind to H1 and H2 of M3-NTD. Among the residues involved in binding, conserved Try96 is shown to play a critical role supported by structure and isothermal titration calorimetry (ITC). The authors also apply a crystal-violet assay and fluorescence microscopy to determine that M3 is involved in collagen type I binding, but not M1 or M28 (Figure 9). Tissue biopsy staining indicates that M3 strains co-localize with collagen IV-containing tissue, while M1 strains do not. The authors provide generally compelling evidence to show that GAS M3 protein binds to collagen, and plays a critical role in forming biofilms, which contribute to disease pathology. This is a very well-executed study and a well-written report relevant to understanding GAS pathogenesis and approaches to combatting disease; data are also applicable to emerging human pathogen Streptococcus dysgalactiae. One caveat that was not entirely resolved is if/how different collagen types might impact M3 binding and function. Due to the technical constraints, the in vitro structure and other binding assays use type II collagen whereas in vivo, biofilm formation assays and tissue biopsy staining use type I and IV collagen; it was unclear if this difference is significant. One possibility is that M3 has an unbiased binding to all types of collagens, only the distribution of collagens leads to the finding that M3 binds to type IV (basement membrane) and type I (varies of tissue including skin), rather than type II (cartilage).

    1. Reviewer #2 (Public review):

      Summary:

      In "Founder effects arising from gathering dynamics systematically bias emerging pathogen surveillance" Bradford and Hang present an extension to the SIR model to account for the role of larger than pairwise interactions in infectious disease dynamics. They explore the impact of accounting for group interactions on the progression of infection through the various sub-populations that make up the population as a whole. Further, they explore the extent to which interaction heterogeneity can bias epidemiological inference from surveillance data in the form of IFR and variant growth rate dynamics. This work advances the theoretical formulation of the SIR model and may allow for more realistic modeling of infectious disease outbreaks in the future.

      Strengths:

      (1) This work addresses an important limitation of standard SIR models. While this limitation has been addressed previously in the form of network-based models, those are, as the authors argue, difficult to parameterize to real-world scenarios. Further, this work highlights critical biases that may appear in real-world epidemiological surveillance data. Particularly, over-estimation of variant growth rates shortly after emergence has led to a number of "false alarms" about new variants over the past five years (although also to some true alarms).

      (2) While the results presented here generally confirm my intuitions on this topic, I think it is really useful for the field to have it presented in such a clear manner with a corresponding mathematical framework. This will be a helpful piece of work to point to to temper concerns about rapid increases in the frequency of rare variants.

      (3) The authors provide a succinct derivation of their model that helps the reader understand how they arrived at their formulation starting from the standard SIR model.

      (4) The visualizations throughout are generally easy to interpret and communicate the key points of the authors' work.

      (5) I thank the authors for providing detailed code to reproduce manuscript figures in the associated GitHub repo.

      Weaknesses:

      (1) The authors argue that network-based SIR models are difficult to parameterize (line 66), however, the model presented here also has a key parameter, mainly P_n, or the distribution of risk groups in the population. I think it is important to explore the extent to which this parameter can be inferred from real-world data to assess whether this model is, in practice, any easier to parameterize.

      (2) The authors explore only up to four different risk groups, accounting for only four-wise interactions. But, clearly, in real-world settings, there can be much larger gatherings that promote transmission. What was the justification for setting such a low limit on the maximum group size? I presume it's due to computational efficiency, which is understandable, but it should be discussed as a limitation.

      (3) Another key limitation that isn't addressed by the authors is that there may be population structure beyond just risk heterogeneity. For example, there may be two separate (or, weakly connected) high-risk sub-groups. This will introduce temporal correlation in interactions that are not (and can not easily be) captured in this model. My instinct is that this would dampen the difference between risk groups shown in Figure 2A. While I appreciate the authors's desire to keep their model relatively simple, I think this limitation should be explicitly discussed as it is, in my opinion, relatively significant.

    1. Reviewer #2 (Public review):

      Summary:

      The study introduces new tools for measuring intracellular Ca2+ concentration gradients around retinal rod bipolar cell (rbc) synaptic ribbons. This is done by comparing the Ca2+ profiles measured with mobile Ca2+ indicator dyes versus ribbon-tethered (immobile) Ca2+ indicator dyes. The Ca2+ imaging results provide a straightforward demonstration of Ca2+ gradients around the ribbon and validate their experimental strategy. This experimental work is complemented by a coherent, open-source, computational model that successfully describes changes in Ca2+ domains as a function of Ca2+ buffering. In addition, the authors try to demonstrate that there is heterogeneity among synaptic ribbons within an individual rbc terminal.

      Strengths:

      The study introduces a new set of tools for estimating Ca2+ concentration gradients at ribbon AZs, and the experimental results are accompanied by an open-source, computational model that nicely describes Ca2+ buffering at the rbc synaptic ribbon. In addition, the dissociated retinal preparation remains a valuable approach for studying ribbon synapses. Lastly, excellent EM.

      Weaknesses:

      Heterogeneity in the spatiotemporal dynamics of Ca2+ influx was not convincingly related to ribbon size, nor was the functional relevance of Ca2+ dynamics to rod bipolars demonstrated (e.g., exocytosis to different postsynaptic targets). In addition, the study would benefit from the inclusion of the Ca2+ currents that were recorded in parallel with the Ca2+ imaging.

    1. Reviewer #2 (Public review):

      Summary:

      The study offers a thorough analysis of the prevalence of pain in women with polycystic ovary syndrome (PCOS) and its associations with health outcomes across various racial groups. Furthermore, the research investigates the prevalence of PCOS and pain among different racial demographics, as well as the increased risk of developing various conditions in comparison to individuals who have PCOS alone.

      Strengths:

      The study emphasizes pain as a significant comorbidity of PCOS, an area that is critically underexplored in existing literature. The findings regarding the increased prevalence of some of the diseases in the PCOS + pain group provide valuable direction for future research and clinical care. I believe physicians should incorporate pain score assessments into their clinical practice to improve patient's quality of life and raise awareness about pain management. If future research focuses on the mechanisms of pain, it would provide a better understanding of pain and allow for a focus on the underlying causes rather than just symptomatic management. The study also highlights the association between PCOS+pain and various comorbidities, such as obesity, hypertension, and type 2 diabetes, as well as conditions like infertility and ovarian cysts, offering a holistic view of the burden of PCOS.

      Weaknesses:

      Due to the nature of the retrospective study, some data may not be readily available in the system. Instead of simply categorizing participants based on whether they experience pain, it would be more useful to employ a pain scale or questionnaire to better understand the severity and type of patients' pain. This approach would allow for a more thorough analysis of pain improvement following treatment with the three widely used medications for PCOS. Additionally, it would be beneficial for the authors to specify subtypes of the disease rather than generalizing conditions, such as mentioning specific digestive system disorders or mental health disorders. The lack of detailed analysis of specific disorders limits the depth of the findings. This may cause authors to make incorrect conclusions.

    1. Reviewer #2 (Public review):

      The present study, led by Thomas and collaborators, aims to describe the firing activity of individual motor units in mice during locomotion. To achieve this, they implanted small arrays of eight electrodes in two heads of the triceps and performed spike sorting using a custom implementation of Kilosort. Simultaneously, they tracked the positions of the shoulder, elbow, and wrist using a single camera and a markerless motion capture algorithm (DeepLabCut). Repeated one-minute recordings were conducted in six mice at five different speeds, ranging from 10 to 27.5 cm·s⁻¹.

      From these data, the authors reported that:

      (1) a significant portion of the identified motor units was not consistently recruited across strides,<br /> (2) motor units identified from the lateral head of the triceps tended to be recruited later than those from the long head,<br /> (3) the number of spikes per stride and peak firing rates were correlated in both muscles, and<br /> (4) the probability of motor unit recruitment and firing rates increased with walking speed.

      The authors conclude that these differences can be attributed to the distinct functions of the muscles and the constraints of the task (i.e., speed).

      Strengths:

      The combination of novel electrode arrays to record intramuscular electromyographic signals from a larger muscle volume with an advanced spike sorting pipeline capable of identifying populations of motor units.

      Weaknesses:

      (1) There is a lack of information on the number of identified motor units per muscle and per animal.

      (2) All identified motor units are pooled in the analyses, whereas per-animal analyses would have been valuable, as motor units within an individual likely receive common synaptic inputs. Such analyses would fully leverage the potential of identifying populations of motor units.

      (3) The current data do not allow for determining which motor units were sampled from each pool. It remains unclear whether the sample is biased toward high-threshold motor units or representative of the full pool.

      (4) The behavioural analysis of the animals relies solely on kinematics (2D estimates of elbow angle and stride timing). Without ground reaction forces or shoulder angle data, drawing functional conclusions from the results is challenging.

      Major comments:

      (1) Spike sorting

      The conclusions of the study rely on the accuracy and robustness of the spike sorting algorithm during a highly dynamic task. Although the pipeline was presented in a previous publication (Chung et al., 2023, eLife), a proper validation of the algorithm for identifying motor unit spikes is still lacking. This is particularly important in the present study, as the experimental conditions involve significant dynamic changes. Under such conditions, muscle geometry is altered due to variations in both fibre pennation angles and lengths.

      This issue differs from electrode drift, and it is unclear whether the original implementation of Kilosort includes functions to address it. Could the authors provide more details on the various steps of their pipeline, the strategies they employed to ensure consistent tracking of motor unit action potentials despite potential changes in action potential waveforms, and the methods used for manual inspection of the spike sorting algorithm's output?

      (2) Yield of the spike sorting pipeline and analyses per animal/muscle

      A total of 33 motor units were identified from two heads of the triceps in six mice (17 from the long head and 16 from the lateral head). However, precise information on the yield per muscle per animal is not provided. This information is crucial to support the novelty of the study, as the authors claim in the introduction that their electrode arrays enable the identification of populations of motor units.

      Beyond reporting the number of identified motor units, another way to demonstrate the effectiveness of the spike sorting algorithm would be to compare the recorded EMG signals with the residual signal obtained after subtracting the action potentials of the identified motor units, using a signal-to-residual ratio.

      Furthermore, motor units identified from the same muscle and the same animal are likely not independent due to common synaptic inputs. This dependence should be accounted for in the statistical analyses when comparing changes in motor unit properties across speeds and between muscles.

      (3) Representativeness of the sample of identified motor units

      However, to draw such conclusions, the authors should exclusively compare motor units from the same pool and systematically track violations of the recruitment order. Alternatively, they could demonstrate that the motor units that are intermittently active across strides correspond to the smallest motor units, based on the assumption that these units should always be recruited due to their low activation thresholds.

      One way to estimate the size of motor units identified within the same muscle would be to compare the amplitude of their action potentials, assuming that all motor units are relatively close to the electrodes (given the selectivity of the recordings) and that motoneurons innervating more muscle fibres generate larger motor unit action potentials.

      Currently, the data seem to support the idea that motor units that are alternately recruited across strides have recruitment thresholds close to the level of activation or force produced during slow walking. The fact that recruitment probability monotonically increases with speed suggests that the force required to propel the mouse forward exceeds the recruitment threshold of these "large" motor units. This pattern would primarily reflect spatial recruitment following the size principle rather than flexible motor unit control.

      (4) Analysis of recruitment and firing rates

      The authors currently report active duration and peak firing rates based on spike trains convolved with a Gaussian kernel. Why not report the peak of the instantaneous firing rates estimated from the inverse of the inter-spike interval? This approach appears to be more aligned with previous studies conducted to describe motor unit behaviour during fast movements (e.g., Desmedt & Godaux, 1977, J Physiol; Van Cutsem et al., 1998, J Physiol; Del Vecchio et al., 2019, J Physiol).

      (5) Additional analyses on behaviour

      The authors currently analyse motor unit recruitment in relation to elbow angle. It would be valuable to include a similar analysis using the angular velocity observed during each stride, as higher velocity would place each muscle in a less favourable position on the force-velocity relationship for generating the required force. More broadly, comparing stride-by-stride changes in firing rates with changes in elbow angular velocity would further strengthen the final analyses presented in the results section.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the role of spinal astrocytes in mediating stress-induced pain hypersensitivity, focusing on the LC (locus coeruleus)-to-SDH (spinal dorsal horn) circuit and its mechanisms. The authors aimed to delineate how LC activity contributes to spinal astrocytic activation under stress conditions, explore the role of noradrenaline (NA) signaling in this process, and identify the downstream astrocytic mechanisms that influence pain hypersensitivity.

      The authors provide strong evidence that 1-hour restraint stress-induced pain hypersensitivity involves the LC-to-SDH circuit, where NA triggers astrocytic calcium activity via alpha1a adrenoceptors (alpha1aRs). Blockade of alpha1aRs on astrocytes - but not on Vgat-positive SDH neurons - reduced stress-induced pain hypersensitivity. These findings are rigorously supported by well-established behavioral models and advanced genetic techniques, uncovering the critical role of spinal astrocytes in modulating stress-induced pain.

      However, the study's third aim - to establish a pathway from astrocyte alpha1aRs to adenosine-mediated inhibition of SDH-Vgat neurons - is less compelling. While pharmacological and behavioral evidence is intriguing, the ex vivo findings are indirect and lack a clear connection to the stress-induced pain model. Despite these limitations, the study advances our understanding of astrocyte-neuron interactions in stress-pain contexts and provides a strong foundation for future research into glial mechanisms in pain hypersensitivity.

      Strengths:

      The study is built on a robust experimental design using a validated 1-hour restraint stress model, providing a reliable framework to investigate stress-induced pain hypersensitivity. The authors utilized advanced genetic tools, including retrograde AAVs, optogenetics, chemogenetics, and subpopulation-specific knockouts, allowing precise manipulation and interrogation of the LC-SDH circuit and astrocytic roles in pain modulation. Clear evidence demonstrates that NA triggers astrocytic calcium activity via alpha1aRs, and blocking these receptors effectively reduces stress-induced pain hypersensitivity.

      Weaknesses:

      Despite its strengths, the study presents indirect evidence for the proposed NA-to-astrocyte(alpha1aRs)-to-adenosine-to-SDH-Vgat neurons pathway, as the link between astrocytic adenosine release and stress-induced pain remains unclear. The ex vivo experiments, including NA-induced depolarization of Vgat neurons and chemogenetic stimulation of astrocytes, are challenging to interpret in the stress context, with the high CNO concentration raising concerns about specificity. Additionally, the role of astrocyte-derived D-serine is tangential and lacks clarity regarding its effects on SDH Vgat neurons. The astrocyte calcium signal "dip" after LC optostimulation-induced elevation are presented without any interpretation.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Yamaguchi et al. provides compelling evidence for the formation of a 3:3 complex between the ectodomain of ADAM22 and LGI1, as demonstrated using single-particle cryo-EM and HS-AFM. This represents the first instance in which the 3:3 complex has been resolved sufficiently to enable molecular modeling, allowing the authors to identify key interfaces mediating ADAM22-LGI1 interactions. HS-AFM revealed weak interactions within the 3:3 complexes, suggesting the dynamic nature of ADAM22-LGI1 interactions, which may play a role in modulating synaptic activity.

      Strength:

      A strength of this study lies in the novel identification of the 3:3 complexes, captured at an unprecedented level of resolution and validated by HS-AFM. This discovery, together with the authors' previous findings demonstrating a 2:2 stoichiometry, gives rise to an intriguing hypothesis regarding the dynamic nature of the ADAM22-LGI1 complex in regulating both cis- and trans-synaptic interactions.

      Weakness:

      The functional significance of these two complexes in the context of synapse remains speculative. Additionally, the structural presentations in Figures 1-3 (especially Figures 2-3) lack the clarity needed for general readers to fully understand the authors' key points. Enhancing the quality of these visual representations would greatly improve accessibility and comprehension.

    1. Reviewer #2 (Public review):

      Summary:

      Autophagy (macroautophagy) is known to be essential for muscle function in flies and mammals. To date, many mitophagy (selective mitochondrial autophagy) receptors have been identified in mammals and other species. While the loss of mitophagy receptors has been shown to impair mitochondrial degradation (e.g., OPTN and NDP52 in Parkin-mediated mitophagy and NIX and BNIP3 in hypoxia-induced mitophagy) at the level of cultured cells, it remains unclear, especially under physiological conditions in vivo. In this study, the authors revealed that one of the receptors BNIP3 plays a critical role in mitochondrial degradation during muscle remodeling in vivo.

      Overall, the manuscript provides solid evidence that BNIP3 is involved in mitophagy during muscle remodeling with in vivo analyses performed. In particular, all experiments in this study are well-designed. The text is well written and the figures are very clear.

      Strengths:

      (1) In each experiment, appropriate positive and negative controls are used to indicate what is responsible for the phenomenon observed by the authors: e.g. FIP200, Atg18, Stx17 siRNAs during DIOM remodeling in Figure 2 and Full, del-LIR, del-MER in Figure 5.

      (2) Although the transcriptional dynamics of DIOM remodeling during metamorphosis is autophagy-independent, the transcriptome data obtained by the authors would be valuable for future studies.

      (3) In addition to the simple observation that loss of BNIP3 causes mitochondrial accumulation, the authors further observed that, by combining siRNA against STX17, which is required for fusion of autophagosomes with lysosomes, BNIP3 KO abolishes mitophagosome formation, which will provide solid evidence for BNIP3-mediated mitophagy. Furthermore, using a Gal80 temperature-sensitive approach, the authors showed that mitochondria derived from larval muscle, but not those synthesized during hypertrophy, remain in BNIP3 KO fly muscles.

      Weaknesses:

      (1) Because BNIP3 KO causes mitochondrial accumulation, it is expected that adult flies will have some physiological defects, but this has not been fully analyzed or sufficiently mentioned in the manuscript.

      (2) In Figure 5, the authors showed that BNIP3 binds to Atg18a by co-IP, but no data are provided on whether MER-mut or del-MER attenuates the affinity for Atg18a.

    1. Reviewer #2 (Public review):

      This manuscript addresses a fundamental problem of immunology - the persistence mechanisms of tissue-resident memory T cells (TRMs). It introduces a novel quantitative methodology, combining the in vivo tracing of T-cell cohorts with rigorous mathematical modeling and inference. Interestingly, the authors show that immigration plays a key role in maintaining CD4+ TRM populations in both skin and lamina propria (LP), with LP TRMs being more dependent on immigration than skin TRMs. This is an original and potentially impactful manuscript. However, several aspects were not clear and would benefit from being explained better or worked out in more detail.

      (1) The key observations are as follows:

      a) When heritably labeling cells due to CD4 expression, CD4+ TRM labeling frequency declines with time. This implies that CD4+ TRMs are ultimately replenished from a source not labeled, hence not expressing CD4. Most likely, this would be DN thymocytes.

      b) After labeling by Ki67 expression, labeled CD4+ TRMs also decline - This is what Figure 1B suggests. Hence they would be replaced by a source that was not in the cell cycle at the time of labeling. However, is this really borne out by the experimental data (Figure 2C, middle row)? Please clarify.

      (2) For potential source populations (Figure 2D): Please discuss these data critically. For example, CD4+ CD69- cells in skin and LP start with a much lower initial labeling frequency than the respective TRM populations. Could the former then be precursors of the latter? A similar question applies to LN YFP+ cells. Moreover, is the increase in YFP labeling in naïve T cells a result of their production from proliferative thymocytes? How well does the quantitative interpretation of YFP labeling kinetics in a target population work when populations upstream show opposite trends (e.g., naïve T cells increasing in YFP+ frequency but memory cells in effect decreasing, as, at the time of labeling, non-activated = non-proliferative T cells (and hence YFP-) might later become activated and contribute to memory)?

      (3) Please add a measure of variation (e.g., suitable credible intervals) to the "best fits" (solid lines in Figure 2).

      (4) Could the authors better explain the motivation for basing their model comparisons on the Leave-One-Out (LOO) cross-validation method? Why not use Bayesian evidence instead?

    1. Reviewer #2 (Public review):

      Summary:

      Sleep plays a critical role in memory consolidation, but the neural mechanisms underlying this relationship remain poorly understood. The authors present novel findings implicating two small neuronal groups with inhibitory connections, PAM-a1 to DPM, in sleep regulation and LTM consolidation. However, whether the PAM-a1 to DPM microcircuit promotes LTM consolidation through sleep regulation requires further investigation.

      Strengths:

      The authors report several novel findings. Brief activation or inhibition of PAM-a1 neurons, or brief inhibition of DPM neurons during the first few hours after training, impairs 24-hour LTM. Notably, these brief manipulations disrupt sleep for many hours afterward, particularly at night. Interestingly, disruption of PAM-a1 and DPM neurons impairs sleep and appetitive memory consolidation only under starvation conditions, and pharmacological induction of sleep during the night rescues the LTM defects. These findings suggest that PAM-a1 and DPM neurons are involved in sleep regulation and LTM consolidation under starvation. These are important findings that advance our understanding of the link between sleep and memory consolidation.

      Weaknesses:

      Some claims lack sufficient evidence or clarity:

      (1) All sleep experiments are conducted under the "training" (temperature-change) condition. While genotypic controls are helpful, additional no-training controls are required to confirm that the observed differences are due to training rather than unknown genotype-related factors. The fact that experimental genotypes exhibit significantly altered sleep even before "training" (e.g., Figs. 7H, J, K, 8A, B, D) highlights the necessity of these controls.

      (2) Previous studies on disrupted memory due to sleep reduction have primarily examined conditions with severe sleep deprivation. In contrast, this report claims that relatively small decreases in total sleep accompanied by sleep fragmentation are responsible for impaired memory consolidation. It remains unclear whether sleep fragmentation at this level is truly critical for memory consolidation. The authors should cause sleep loss and fragmentation of similar magnitude through other means and determine whether it can impair LTM.

      (3) The authors employed a neural activity reporter to show that starvation increases the basal activity of PAM-a1 but not DPM neurons in untrained flies (Figures 9C-E). They observed small increases in the activity of both neuron groups immediately after training but not one hour later. Given the inhibitory connection from PAM-a1 to DPM, it is unclear why both neuron groups show increased activity after training. Additionally, as the authors acknowledge, it is puzzling how the inactivation of PAM-a1 produces similar effects on sleep and memory as DPM inhibition and PAM-a1 activation. Further experiments are needed to clarify these findings, such as manipulating PAM-a1 activity during the one-hour post-training period and evaluating the effect on DPM activity. Including data from training under fed conditions would provide a more comprehensive understanding of state-dependent neural activity. Even if certain experiments are not feasible, these issues warrant further discussion. It is also important to clarify that the term "synchronized" does not imply single-spike-level synchrony.

      (4) The authors considered that PAM-a1 and DPM might function in parallel, independent pathways for sleep and LTM. They rejected this possibility based on the lack of additive effects when both neuronal groups were simultaneously inactivated. However, they found that MB299B-labelled neurons exert stronger memory effects than MB043B-labelled neurons, while MB043B neurons have stronger sleep effects. If sleep is a primary driver of memory consolidation, a stronger correlation between memory and sleep effects would be expected. This observation merits further discussion.

      (5) Given prior knowledge that PAM neurons are heterogeneous and that the R58E02 driver is broadly expressed, data in Figures 1-5 concerning PAM are outdated. The use of more restricted PAM-a1 drivers from the outset would make the manuscript easier to read and interpret.

      (6) Some figures lack relevant data, certain experiments are missing necessary controls, and anomalies are present in some data sets.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript, the authors apply tissue expansion and tiling light sheet microscopy to study allometric growth and regeneration in planaria. They developed image analysis pipelines to help them quantify different neuronal subtypes and muscles in planaria of different sizes and during regeneration. Among the strengths of this work, the authors provide beautiful images that show the potential of the approaches they are taking and their ability to quantify specific cell types in relatively large numbers of whole animal samples. Many of their findings confirm previous results in the literature, which helps validate the techniques and pipelines they have applied here. Among their new observations, they find that the body wall muscles at the anterior and posterior poles of the worm are organized differently and show that the muscle pattern in the posterior head of beta-catenin RNAi worms resembles the anterior muscle pattern. They also show that glial cell processes appear to be altered in beta-catenin or insulin receptor-1 RNAi worms. Weaknesses include some over-interpretation of the data and lack of consideration or citation of relevant previous literature, as discussed below.

      Strengths:

      This method of tissue expansion will be useful for researchers interested in studying this experimental animal. The authors provide high-quality images that show the utility of this technique. Their analysis pipeline permits them to quantify cell types in relatively large numbers of whole animal samples.

      The authors provide convincing data on changes in total neurons and neuronal sub-types in different-sized planaria. They report differences in body wall muscle pattern between the anterior and posterior poles of the planaria, and that these differences are lost when a posterior head forms in beta-catenin RNAi planaria. They also find that glial cell projections are reduced in insulin receptor-1 RNAi planaria.

      Comments on revisions:

      The authors have satisfactorily addressed the major concerns of the previous reviewers.

    1. Reviewer #2 (Public review):

      Summary:

      This work reports the discovery of a new rhodopsin from reef-building corals that is characterized experimentally, spectroscopically, and by simulation. This rhodopsin lacks a carboxylate-based counterion, which is typical for this family of proteins. Instead, the authors find that a chloride ion stabilizes the protonated Schiff base and thus serves as a counterion.

      Strengths:

      This work focuses on the rhodopsin Antho2a, which absorbs in the visible spectrum with a maximum at 503 nm. Spectroscopic studies under different pH conditions, including the mutant E292A and different chloride concentrations, indicate that chloride acts as a counterion in the dark. In the photoproduct, however, the counterion is identified as E292.

      These results lead to a computational model of Antho2a in which the chloride is modeled in addition to the Schiff base. This model is improved using the hybrid QM/MM simulations. As a validation, the absorption maximum is calculated using the QM/MM approach for the protonated and deprotonated E292 residue as well as the E292A mutant. The results are in good agreement with the experiment. However, there is a larger deviation for ADC(2) than for sTD-DFT. Nevertheless, the trend is robust since the wt and E292A mutant models have similar excitation energies. The calculations are performed at a high level of theory that includes a large QM region.

      Weaknesses:

      I have a couple of questions about this study:

      (1) I find it suspicious that the absorption maximum is so close to that of rhodopsin when the counterion is very different. Is it possible that the chloride creates an environment for the deprotonated E292, which is the actual counterion?

      (2) The computational protocol states that water molecules have been added to the predicted protein structure. Are there water molecules next to the Schiff base, E292, and Cl-? If so, where are they located in the QM region?

      (3) If the E292 residue is the counterion in the photoproduct state, I would expect the retinal Schiff base to rotate toward this side chain upon isomerization. Can this be modeled based on the recent XFEL results on rhodopsin?

    1. Reviewer #2 (Public review):

      Summary:

      Immune assays enable the analysis of immune responses in vitro. These assays generate time series image data across several experimental conditions. The imaging parameters such as the imaging modality and the number of channels can vary across experiments. A challenge in the field is the lack of (open source) tools to process and analyze these data. R. Torro, et. al. developed an open source end-to-end pipeline for the analysis of image data from these immune assays. The pipeline is designed with a GUI and is suited for experimental biologists with no coding experience. The authors have incorporated several existing methods and tools for individual tasks such as for segmentation and cell tracking, and incorporated them with custom methods where necessary such as for tracking cell state transitions.

      Strengths:

      (1) The tool is extremely well-documented and easy to install.

      (2) Applicable to a wide variety of imaging modalities and analysis.

      (3) There are several different options for each step, such as segmentation using traditional methods or deep learning methods, and all the analysis steps are integrated in one place with a GUI. The no-coding requirement makes this a very powerful tool for biologists and has the potential to enable a wide variety of analyses.

      Weakness:

      (1) It would be good to provide documentation on how to make the tool applicable for applications and analysis other than for immune profiling since most methods integrated here are applicable well beyond immune profiling. For example, a user might want to use the tool just for the segmentation of their IF microscopy-images.

      (2) They applied Celldetective to two immune assays. The authors present the results from these assays and use the results to validate their assay. However, they have not included data that demonstrates results obtained via this pipeline are comparable to results obtained with other pipelines and/or if these results are consistent with what is expected in the literature.

    1. Reviewer #2 (Public Review):

      This is a nice paper illustrating the use of equilibrium/non-equilibrium MD simulations to explore allosteric communication in the Spike protein. The results are described in detail and suggest a complex network of signal transmission patterns. The topic is not completely novel as it has been studied before by the same authors and the impact of glycosylation is moderated and localized at the furin site, so not many new conclusions emerge here. It is suggested that mutations are commonly found in the communication pathway which is interesting, but the authors fail to provide evidence that this is related to a positive selection and not simply to a random effect related to mutations at points that are not crucial for stability or function. One interesting point is the connection of the FA site with an additional site binding heme group. It will be interesting to see reversibility, i.e. removal of the ligand at this site is producing perturbation at the FA site?, does it produce other effects suggesting a cascade of allosteric effects? Finally, the paper lacks details to help reproducibility, in particular, I do not see details on D-NEMD calculations. One interesting point is the connection of the FA site with an additional site binding heme group.

    1. Reviewer #2 (Public review):

      Summary

      ZFHX3 is a transcription factor expressed in discrete populations of adult SCN and was shown by the authors previously to control circadian behavioral rhythms using either a dominant missense mutation in Zfhx3 or conditional null Zfhx3 mutation using the Ubc-Cre line (Wilcox et al., 2017). In the current manuscript, the authors assess the function of ZFHX3 by using a multi-omics approach including ChIPSeq in wildtype SCNs and RNAseq of SCN tissues from both wildtype and conditional null mice. RNAseq analysis showed a loss of oscillation in Bmal1 and changes in expression levels of other clock output genes. Moreover, a phase advance gene transcriptional profile using the TimeTeller algorithm suggests the presence of a regulatory network that could underlie the observed pattern of advanced activity onset in locomotor behavior in knockout mice.

      In Figure 1, the authors identified the ZFHX3 bound sites using ChIPseq and compared the loci with other histone marks that occur at promoters, TSS, enhancers and intergenic regions. And the analysis broadly points to a role for ZFHX3 in transcriptional regulation. The vast majority of nearly 40000 peaks overlapped H3K4me3 and K27ac marks, active promoters which also included genes falling under the GO category circadian rhythms. However, no significant differential ZFHX3 bound peaks were detected between ZT3 and ZT15. In these experiments, it is not clear if and how the different ChIP samples (ZFHX3 and histone PTM ChIPs) were normalized/downsampled for analysis. Moreover, it seems that ZFHX3 binding or recruitment has little to do with whether the promoters are active.

      Based on an enrichment of ARNT domains next to K4Me3 and K27ac PTMs, the authors propose a model where the core-clock TFs and ZFHX3 interact. If the authors develop other assays beyond just predictions to test their hypothesis, it would strengthen the argument for a role in circadian transcription in the SCN. It would be important in this context to perform a ChIP-seq experiment for ZFHX3 in the knockout animal (described from Figure 2 onwards) to eliminate the possibility of non-specific enrichment of signal from "open chromatin'. Alternatively, a ChIPseq analysis for BMAL1 or CLOCK could also strengthen this argument to identify the sites co-occupied by ZFHX3 and core-clock TFs.

      Next, they compared locomotor activity rhythms in floxed mice with or without tamoxifen treatment. As reported before in Wilcox et al 2017, the loss of ZFHX3 led to a shorter free running period and reduced amplitude and earlier onset of activity. Overall, the behavioral data in Figure 2 and supplementary figure 2 has been reported before and are not novel.

      Next, the authors performed RNAseq at 4hr intervals on wildtype and knockout animals maintained in light/dark cycles to determine the impact of loss of ZFHX3. Overall transcriptomic analysis indicated changes in gene expression in nearly 36% of expressed genes, with nearly half being upregulated while an equal fraction was downregulated. Pathways affected included mostly neureopeptide neurotransmitter pathways. Surprisingly, there was no correlation between the direction in change in expression and TF binding since nearly all the sites were bound by ZFHX3 and the active histone PTMs. The ChIP-seq experiment for ZFHX3 in the UBC-Cre+Tam mice again could help resolve the real targets of ZFHX3 and the transcriptional state in knockout animals.

      To determine the fraction of rhythmic transcripts, Using dryR, the authors categorise the rhythmic transcriptome (about 7% in all) into modules that include genes that lose rhythmicity in the KO, gain rhythmicity in the KO or remain unaffected or partially affected. The analysis indicates that a large fraction of the rhythmic transcriptome is affected in the KO model. However, among core-clock genes only Bmal1 expression is affected showing a complete loss of rhythm. The authors state a decrease in Clock mRNA expression (line 294) but the panel figure 4A does not show this data. Instead it depicts the loss in Avp expression - {{ misstated in line 321 ( we noted severe loss in 24-h rhythm for crucial SCN neuropeptides such as Avp (Fig. 3a).}}

      However, core-clock genes such as Pers and Crys show minor or no change in expression patterns while Per2 and Per3 show a ~2hr phase advance. While these could only weakly account for the behavioral phase advance, the authors used TimeTeller to assess circadian phase in wildtype and ZFHX3 deficient mice. This approach clearly indicated that while the clock is not disrupted in the knockout animals, the phase advance can be correctly predicted from a network of gene expression patterns.

      Strengths

      The authors use a multiomic strategy in order to reveal the role of the ZFHX3 transcription factor with a combination of TF and histone PTM ChIPseq, time-resolved RNAseq from wildtype and knockout mice and modeling the transcriptomic data using TimeTeller. The RNAseq experiments are nicely controlled and the analysis of the data indicates a clear impact on gene-expression levels in the knockout mice and the presence of a regulatory network that could underlie the advanced activity onset behavior.

      Weaknesses

      It is not clear whether ZFHX3 has a direct role in any of the processes and seems to be a general factor that marks H3K4me3 and K27ac marked chromatin. Why it would specifically impact the core-clock TTFL clock gene expression or indeed daily gene expression rhythms is not clear either. Details for treatment of different ChIP samples (ZFHX3 and histone PTM ChIPs) on data normalization for analysis are needed. The loss of complete rhythmicity of Avp and other neuropeptides or indeed other TFs could instead account for the transcriptional deregulation noted in the knockout mice.

      Comments on revisions:

      The authors addressed the majority of my criticisms. They also explained that some requested experiments are beyond the scope of the current manuscript, while others are technically not feasible. I do not have any further concerns.