5,456 Matching Annotations
  1. Feb 2026
    1. To assess this possibility, we first estimated, using the NetMHCpan-4.0 algorithm, how frequently in the general population neopeptides derived from the out-of-frame sequence following pathogenic mutations were predicted

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses common founder mutations such as BRCA2:c.5946delT and BRCA1:c.68_69delAG, indicating their association with neopeptides that are likely presented in the population, which relates to defining or classifying a disease. Oncogenic: The mention of pathogenic mutations and their associated neoantigens suggests that these variants contribute to tumor development or progression, as they are described as potential tumor antigens.

      Gene→Variant (gene-first): 672:c.5266dupC 675:c.5946delT 672:c.68_69delAG

      Genes: 672 675

      Variants: c.5266dupC c.5946delT c.68_69delAG

    2. Interestingly, we noted very few missense pathogenic mutations in the set of reported reversions. For example, in the Incidence tumour sequencing datasets used previously, we found that (40/849, 4.7%) of these pathogenic

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of pathogenic missense mutations, specifically mentioning the BRCA1:p.C61S and p.M1I mutations, in the context of their association with disease, indicating their role in defining or confirming a disease subtype. Oncogenic: The passage refers to the BRCA1:p.C61S and p.M1I mutations as pathogenic, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.

      Gene→Variant (gene-first): 672:p.C61S 672:p.M1I

      Genes: 672

      Variants: p.C61S p.M1I

    3. For each of these common founder mutations, we noted that the reversions that emerged in these patients were generally localised to the 3' flanking sequence of the original pathogenic mutation (transcriptionally downstre

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 8

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 675:c.7355delA

      Genes: 675

      Variants: c.7355delA

    4. Amongst the 91 patients we collated data from, most (68/91, 75%) had unique pathogenic mutations (Figure 1E, annotated as "single-patient mutations" and Supplementary Figure 1). There were eight pathogenic mutations repr

      [Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.

      Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

      Genes: 672 675

      Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

    1. Median OS was 48 weeks (range=4-140). None of the following factors had a significant impact on OS: PS (P=0.403), histology (P=0.198), smoking (P=0.242), sex (P=0.475), skin rash (P=0.182) and EFGR IHC expression (P=0.63

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    2. The median follow-up period was 109 weeks and the median time to tumour progression (TTP) 20 weeks (range=4-140). A total of 23 (36%) patients had a TTP>24 weeks and 7 (10.9%) >52 weeks (Table 5). There was no difference

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    3. The DCR was significantly higher in patients of the 'classical' mutations than in patients of the 'wild-type' (90.9 and 43.3%, respectively; P=0.006) group; conversely, there was no significant difference between the DCR

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    4. A total of 1 (1.1%) patient (no. 13) had two 'other' mutations, while 3 (3.4%) patients (nos. 9, 11 and 18), who were included in the 'classical mutations' group, had both the exon 21 L858R mutation and an 'other' mutati

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. According to the mutational status, three groups of patients were identified as follows: (i) the 'wild-type' group (n=61 patients; 71%) with no detectable mutations; (ii) 'classical' mutations group (n=11 patients, 13%;

      [Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

      Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

      Genes: 1956

      Variants: E746V G719D L858R

    6. 'Classical' mutations in the EGFR tyrosine kinase domain (exons 18, 19 and 21) have been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. The aim of the current study was to evalua

      [Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.

      Gene→Variant (gene-first): 1956:G719X 1956:L858R

      Genes: 1956

      Variants: G719X L858R

    1. The finding that gilteritinib inhibited FLT3-D835Y and FLT3-ITD-D835Y, both of which harbor mutations in the activation loop essential for binding type 2 inhibitors, suggests that gilteritinib is a type 1 FLT3 inhibitor.

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.

      Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

      Genes: 2322

      Variants: D835 D835Y F691

    2. Since mutations within the TKD of FLT3 (eg, FLT3-D835Y or FLT3-F691) often confer resistance to FLT3 inhibitors that were previously effective against FLT3-ITD, the effect of gilteritinib on these resistance mutations wa

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

      Genes: 2322

      Variants: D835Y F691 F691 L F691I

    3. Inhibitory activity of gilteritinib against FLT3 containing ITD +- D835Y or F691 L/I mutations

      [Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

      Genes: 2322

      Variants: D835Y F691 L/I

    1. Four human NSCLC cell lines expressing different forms of the EGFR were investigated. Sensitivity of each cell line to the anti-proliferative effect of erlotinib was evaluated by methylene blue assay and is presented in

      [Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.

      Gene→Variant (gene-first): 1956:L858R 1956:T790M

      Genes: 1956

      Variants: L858R T790M

    1. In addition to the main driver mutations discussed above, several patients carry recurrent mutations that are clearly subclonal (present in some but not all tumour areas in a patient) and occur at later stages of tumour

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.

      Gene→Variant (gene-first): 5290:H1047R

      Genes: 5290

      Variants: H1047R

    2. We analysed 134 punch cores from nine DIPG whole brain specimens obtained at autopsy as previously described. Selected punch cores represented multiple spatial regions of the primary tumour and adjacent areas within the

      [Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 8358:K27M

      Genes: 8358

      Variants: K27M

    3. Diffuse Intrinsic Pontine Gliomas (DIPGs) are deadly paediatric brain tumours where needle biopsies help guide diagnosis and targeted therapies. To address spatial heterogeneity, here we analyse 134 specimens from variou

      [Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage discusses how the K27M mutation contributes to tumorigenesis in DIPGs, indicating its role in tumor development and progression. Diagnostic: The K27M mutation is associated with the diagnosis of DIPGs, as it helps guide diagnosis and targeted therapies in these tumors.

      Gene→Variant (gene-first): 8358:K27M

      Genes: 8358

      Variants: K27M

    1. Somatic mutations found within the tyrosine kinase domain (TKD) of the human epidermal growth factor (HER) family of receptors have been implicated in the development and progression of non-small cell lung cancer (NSCLC)

      [Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Predictive, Functional

      Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    2. Taken together, these data suggest that the V855A mutation alters the activity of HER3, which may correlate with a malignant phenotype.

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    3. To elucidate and predict the impact of mutant V855A on the conformation of the wild-type HER3, protein modeling was performed via the automated I-TASSER server. Server predicted models were further refined by submitting

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    4. Impact of V855A on HER3 protein structure

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    5. We further examined the effects of the inhibitors on HER-related signaling activity and survival using the Ba/F3 model system. Afatinib (100nmol/L) potently inhibited NRG1beta-induced phosphorylation of HER3, wild type H

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive

      Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    6. To assess the effect of the inhibitors on colony formation, Ba/F3 co-transfectants were seeded onto methyl-cellulose and treated with HER inhibitors in the presence of NRG1beta. As shown in Fig 6b, afatinib (100 nmol/L)

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    7. To investigate whether HER3-V855A can be therapeutically targeted; we examined the growth inhibitory effects of inhibitors targeting the extracellular and kinase domain of the HER receptors. These inhibitors include: erl

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    8. To further confirm that the V855A mutation provides increased activity to HER3 through enhanced physical interaction with HER2, we performed co-immunoprecipitaton experiments on Ba/F3 co-transfectants stimulated with or

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    9. Tyrosine trans-phosphorylation is a major event in HER signaling. To examine if HER3-V855A enhances trans-phosphorylation of HER2, we performed immunoblot analysis on Ba/F3 and HEK 293Tlysates after 16hr incubation in se

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    10. We next examined the effect of chronic treatment with NRG1beta on HER3/HER2 phosphorylation and their downstream targets AKT and ERK 1/2 in the Ba/F3 co-transfectants. As shown in Figure 3e, a five-day chronic treatment

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    11. We also investigated the functional relevance of stable Ba/F3 transfectants co-expressing HER3-V855A and EGFR (Supplemental Fig. 1a). While Ba/F3 cells co-expressing HER3-V855A and EGFR exerted a robust growth response t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    12. To assess the ability of HER3-V855A to form colonies we performed a methyl cellulose-based colony formation assay. As shown in Fig 3c & 3d, while NRG1beta treatment did not induce an increase in colony number between the

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    13. To determine the transforming potential of HER3-V855A in the context of IL-3 -independent growth, Ba/F3 transfectants were grown in the absence or presence of IL-3, or HER cognate ligands (neuregulin1beta (NRG1beta) or t

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    14. HER3 has been described as a contributor to oncogenic transformation and tumorigenesis, particularly when combined with its HER2 dimerization partner. Therefore, we hypothesized that the HER3 kinase mutation may cause a

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.

      Gene→Variant (gene-first): 324:V855A

      Genes: 324

      Variants: V855A

    15. To analyze the location and significance of the novel HER3-V855A mutation, we performed protein sequence alignment of exon 21 of the EGFR and HER3. Although, the amino acid at position 855 in HER3 is not conserved relati

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.

      Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

      Genes: 673 1956 324

      Variants: L597V L858 L858R V855 V855A

    16. EGFR pathogenic mutations sensitize in varying degrees to inhibition by small molecule TKIs. These mutations include both class I short in-frame deletions and class II missense mutations. One of these mutations, the L858

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    17. A single arm multicenter phase II clinical study initiated in 2006 (FIELT1 study; NCT00339586) was coordinated by our department to evaluate the safety and efficacy of first-line erlotinib in patients with advanced NSCLC

      [Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.

      Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

      Genes: 2065 324

      Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

    1. A single case with p.N822K (c.2466T>A) [Figure 4b] was identified. The tumor originated in jejunum in an elderly man with spindle morphology.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

      Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

      Genes: 3815

      Variants: c.2466T>A p.N822K

    2. Three cases involving p.K642E mutation (c.1924A>G) [Figure 4a], 2/3 were in elderly men, at gastric, an anorectal site with mixed morphology. One was a double mutation in association with exon 11 [Table 2].

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

      Genes: 3815

      Variants: c.1924A>G p.K642E

    3. Mutations were identified in 10 cases located in the small intestine with significant association (P = 0.004). One was located in the retroperitoneum. Ninety percent (9/10) tumors revealed internal tandem duplications (I

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

      Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

      Genes: 3815

      Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

    4. Insertion of 3 nucleotides, p.K558delinsBP (c.1673_1674insTCC), and duplication p.Y577_K580dup (c.1731_1742dupTTATGATCACAA) was seen 1 case (1.8%) each, respectively.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

      Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

      Genes: 3815

      Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

    5. The substitution mutations were p.V559D (3/57; 5%), p.V560D (3/57; 5%), p.V559A (2/57; 3.5%), and 1 (1.8%) cases each with p.V560G, p.T574I, and p.L576P among this 9 were homozygous and 2 heterozygous.

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

      Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

      Genes: 3815

      Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

    6. One case with simultaneous mutations in exons 11 and 13 harbored in-frame deletion in exon 11; p.M552_K558del (c.1654_1674delATGTATGAAGTACAGTGGAAG) and a novel substitution mutation; p.K642R (c.1925A>G) [Figure 1d] in ex

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

      Genes: 3815 5156 728378

      Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

    7. Exon 11 mutations were heterogeneous with in-frame deletion of 3-51 nucleotides (codons 550-576) in classic hot-spot region at the 5' end of the exon (codons 550-560). Double mutations were identified in 9 cases (16%), 8

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

      Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

      Genes: 728378 3815

      Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

    8. Exon 11 mutations were in 57% of cases [Table 2]. In-frame deletions in 35 (61.4%), 11 substitutions (19.3%), 9 double mutations (15.7%), 1 insertion and duplication (1.8%), respectively. Common mutation was p.W557_K558

      [Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

      Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

      Genes: 3815

      Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

    1. Results: We found that rs3786362 G allele of thymidylate synthase (TYMS) gene was significantly associated with PFS (P = 1.10 x 10-2), OS (P = 2.50 x 10-2) and DCR (P = 5.00 x 10-3). The expression of TYMS was overexpres

      [Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).

      Gene→Variant (gene-first): 7298:rs3786362

      Genes: 7298

      Variants: rs3786362

    1. Thirty-two patients with BRAF V600E positive metastatic colorectal cancer (mCRC) and 7 patients with other cancers were enrolled. No dose-limiting toxicities were observed in escalation, with vemurafenib 960 mg twice dai

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    2. BRAF V600E mutant metastatic colorectal cancer represents a significant clinical problem, with combination approaches being developed clinically with oral BRAF inhibitors combined with EGFR-targeting antibodies. While co

      [Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. Whole exome sequencing identified a total of 15 somatic mutations, including nine missense mutations. Interestingly, we identified two activating mutations affecting FGFR1, including FGFR1 p.K656E (NM_023110.3:c.1966A>G)

      [Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.

      Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

      Genes: 2260

      Variants: c.1681G>A c.1966A>G p.K656E p.V561M

    2. Patient is an 18-month-old otherwise healthy boy who presented with acute onset nausea, vomiting, and gait instability, resulting in a fall on the day of presentation. On arrival to the ED, vital signs were notable for h

      [Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.

      Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

      Genes: 3417 673

      Variants: p.R132H p.V600E

    1. Comparisons of PFS and OS (univariate and multivariate) of patients with mutation variants to patients with non-mutated tumors revealed the KRAS exon 2 G12C-variant (n = 28) to correlate with inferior OS compared with no

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Prognostic, Oncogenic

      Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.

      Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

      Genes: 3845

      Variants: G12C G12D G12V G13D

    2. The median PFS of patients with KRAS exon 2 mutant tumor subtypes ranged from 8.8 [95% confidence interval (CI) 7.6-10.0] months (G13D mutation) to 10.5 (95% CI 9.0-11.9) months in (G12D variants). The median OS widely r

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.

      Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

      Genes: 3845

      Variants: A146T G12C G12D G13D Q61H

    3. Of 1239 analyzed tumors, in 664 tumors (53.6%), no mutation was detected, whereas 462 tumors harboring KRAS (37.3%) mutations and 39 NRAS (3.1%) mutations were found. Additionally, a total of 74 tumors (6.0%) were carryi

      [Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.

      Gene→Variant (gene-first): 673:V600E

      Genes: 673

      Variants: V600E

    1. This is the first report to our knowledge to demonstrate activity of osimertinib in a patient with NSCLC harboring HER2 exon 19, p.L755P mutation resulting in intra- and extracranial response. In the future, osimertinib

      [Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.

      Gene→Variant (gene-first): 2064:p.L755P

      Genes: 2064

      Variants: p.L755P

    2. A 68-year-old female with a past medical history of type 2 diabetes and minimal smoking was diagnosed with stage IV NSCLC. Next generation sequencing on tumor tissue demonstrated an ERBB2 exon 19 c.2262_2264delinsTCC, p.

      [Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

      Genes: 2064

      Variants: c.2262_2264delinsTCC p.(L755P)

    1. Extracranial arteriovenous malformation (AVM) is most commonly caused by MAP2K1 mutations in the endothelial cell. The purpose of this study was to determine if local tissue overgrowth associated with AVM is caused by di

      [Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.

      Gene→Variant (gene-first): 5604:p.K57N

      Genes: 5604

      Variants: p.K57N

    1. We describe a 57-year-old woman with resected stage IIIB pancreatic cancer who underwent several lines of conventional chemotherapy after multiple lymph node metastases. When the disease progressed again, the patient rec

      [Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.

      Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

      Genes: 79728

      Variants: c.2514+1G>C c.3114-1G>A

    1. This analysis examined 45 single missense mutations detected in PCa with metastasis or high Gleason scores, and which extend along the entire length of the protein. Our sensitive assay system uncovered a previously unide

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.

      Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

      Genes: 2232 367 1387 10514 10499

      Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

    2. Mutations with no apparent change of activity from WT may be able to drive cancer progression though several diverse routes. These include altered binding to co-repressors or co-regulators e.g. M886I, regulatory element-

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.

      Gene→Variant (gene-first): 9611:M886I

      Genes: 9611

      Variants: M886I

    3. The LBD mutations had a greater dependence on the regulatory elements, emphasizing the importance of interdomain communication for receptor function. While the major losses of function seen with M749I at 10 nM DHT were c

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.

      Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

      Genes: 367 1387 10514

      Variants: H874Y M749I Q798E

    4. Mutations within the DBD and hinge domains of the AR would be expected to have the greatest influence on regulating ARE binding and indeed, the profile for T575A in the first zinc finger of the DBD was markedly different

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

      Genes: 2908 10499

      Variants: I672 I672T R629 R629Q T575A

    5. The results for the AR NTD mutations investigated with PSA61Luc closely matched those for GRE2-TATA-Luc. AR mutation L57Q had loss of function at all concentrations of DHT with both reporters although they were less pron

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.

      Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

      Genes: 2232 367

      Variants: G142V L57Q P390L P533S

    6. In general, the profiles of PSA61Luc stimulation for the different AR mutations were very similar to those for GRE2-TATA-Luc; indicating that the findings in the broad GRE2-TATA-Luc study accurately reveal the effects of

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.

      Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

      Genes: 367 10499

      Variants: P390L R629Q T575A

    7. The LBD contained two mutations, D879G and Q919R, which fall within the grouping of loss to gain of function, although recovery to a modest 19% gain of function and WT levels respectively took place at only the highest c

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.

      Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

      Genes: 10499 367

      Variants: D879G H874Y Q919R T877A

    8. Mutations K720E and R726L, which is implicated in a 6-fold increased risk of prostate cancer, reside in a positive cluster in helix 3 with lysine 720 creating a charged clamp with glutamate 897, and both residues partici

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

      Evidence Type(s): Predisposing, Functional

      Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.

      Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

      Genes: 367 9611

      Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

    9. Within the LBD, all but two loss of function mutations were clustered between residues 720 and 798. Of these, half had essentially no transactivational activity at physiological levels of DHT and comprise of L744F, A748V

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.

      Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

      Genes: 367 9611 1387 10514

      Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

    10. Mutations in the LBD have historically been considered as the most likely candidates for driving PCa, therefore, the finding that the majority of mutations under investigation had no change from WT or loss of function wa

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.

      Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

      Genes: 367 9611

      Variants: K910R M886 M886I

    11. Within the hinge region, mutation I672T has been included in the arbitrary classification of no change from WT due to deviation of less than 10% at 0 and 0.1 nM DHT changing to a 14% gain of function at 10 nM. Interestin

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.

      Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

      Genes: 597 367 2908 10499

      Variants: A586V A587S I672T R629Q T575A

    12. The only mutation to function like WT at low DHT and then gain function compared to WT upon DHT binding was P533S in the NTD. As with other groupings, mutations leading to constitutive transactivation activity were prese

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.

      Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

      Genes: 2232 367

      Variants: G142V G524D M523V M537V P533S

    13. The novel class of mutation, namely loss of function at low levels or in the absence of DHT recovering to WT values or a gain of function upon binding of DHT was present in the NTD. Mutations P269S and S515G had WT level

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.

      Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

      Genes: 367 10514

      Variants: P269S P390L P514S S515G

    14. Interestingly, there was exiguous rescue at the highest concentration of DHT with D221H, P504L and D528G, while P340L manifested a striking dose-dependent recovery. The S296R mutation has been shown to have altered inter

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.

      Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

      Genes: 207 367 2232 9611

      Variants: D221H D528G E198G P269S P340L P504L S296R S334P

    15. The predominant type of mutation i.e. loss of function, was well represented in the NTD. Mutations L57Q, E198G, D221H, A234T, S296R; S334P, P340L, P504L and D528G all displayed loss of function with E198G showing the gre

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).

      Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

      Genes: 1387 207 367 2232 9611

      Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

    16. All five classes of mutation were represented within the NTD. Of the five mutations in AR classified as having no change from WT, G166S showed the least variance from the unmutated receptor. The mutation M537R also had m

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.

      Gene→Variant (gene-first): 367:G166S 367:M537R

      Genes: 367

      Variants: G166S M537R

    17. Unsurprisingly, the DBD is virtually unaltered across a wide range of species with 100% homology between the examples shown here; except for two conservative substitutions in Xenopus, one of which T575, has been included

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.

      Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

      Genes: 2908 10499

      Variants: I672 R629 T575

    18. The NTD is by far the least conserved domain with mouse, chicken and Xenopus having only 75, 32 and 34% similarity to human respectively. Alignment of the investigated human AR mutations to the primary sequence of AR in

      [Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Functional

      Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.

      Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

      Genes: 1387 207 367 2232 10514

      Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

    1. To further investigate this we solved the structure of BCL-2 G101V bound to S55746 (Table 1). We obtained diffraction to 2.0 A in a P 21 spacegroup with two molecules in the asymmetric unit. The BCL-2 G101V:S55746 struct

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.

      Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

      Genes: 596

      Variants: E152 E152A G101V V101

    2. S55746 is another BCL-2 selective antagonist that has progressed to the clinic. The recently disclosed crystal structure of BCL-2 WT bound to S55746 revealed binding to the P1, P2 and P3 pockets, in contrast to venetocla

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.

      Gene→Variant (gene-first): 596:G101V

      Genes: 596

      Variants: G101V

    3. E152 moved into the base of the P2 pocket in the BCL-2 G101V:venetoclax structure (Fig. 2b, c). To test the role of E152 in reducing affinity we generated a BCL-2 G101V/E152A double mutant. Alanine does not have a Cgamma

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.

      Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

      Genes: 596

      Variants: E152 E152A G101A G101V

    4. SPR experiments were performed using a BIMBH3 or BAXBH3 immobilised sensor surface with BCL-2 mutants as the analyte and determining venetoclax affinity by competition experiments, (Fig. 3, Table 2 and Supplementary Fig.

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.

      Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

      Genes: 596

      Variants: F104C F104L G101V

    5. The crystals of venetoclax complexed with BCL-2 F104L and BCL-2 WT are isomorphous (Table 1). Well-defined electron density for the drug in the mutant complex structure (Supplementary Fig. 1) suggests two conformations f

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.

      Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

      Genes: 596

      Variants: F104 F104L L104

    6. To understand how these BCL-2 mutations compromise drug binding we solved crystal structures of both complexes (Table 1 and Fig. 2). The G101V mutation resides on the BCL-2 alpha2 helix packing against the alpha5 helix a

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.

      Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

      Genes: 596

      Variants: E152 G101 G101A G101V

    7. Crystal structures of BCL-2 with ABT-263 and various analogues of venetoclax have been deposited in the PDB and described in the literature (Fig. 1a, b). One of those analogues is 4-[4-((4'-chloro-3-[2-(dimethylamino)eth

      [Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 596:F104

      Genes: 596

      Variants: F104

    1. Multiple jejunalgastrointestinal stromal tumors (GISTs) were found in a 52-year-old woman with a history of neurofibromatosis type 1. These tumors were composed of interlacing fascicles of uniform spindle cells with eosi

      [Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Diagnostic

      Justification: Oncogenic: The passage describes a missense point mutation (Trp557Gly) identified in the KIT gene associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Diagnostic: The variant Trp557Gly is mentioned in the context of identifying and characterizing the tumors associated with neurofibromatosis type 1, suggesting its role in defining the disease subtype.

      Gene→Variant (gene-first): 3815:Trp557Gly

      Genes: 3815

      Variants: Trp557Gly

    1. Fusions involving ETV6 in leukemia have long been recognized. Other mutation types, including single nucleotide variations, insertions, deletions, frame-shifts and non-sense alterations are also becoming increasingly evi

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Diagnostic, Functional

      Justification: Diagnostic: The passage discusses the identification of rare germline variants (V37M, R181H) in patients with B-ALL, indicating their association with the disease. Functional: Luciferase assays performed on the variants showed no significant changes in transcriptional repression activity compared to WT ETV6, indicating an assessment of their molecular function.

      Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

      Genes: 2120

      Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

    2. To examine whether the L349P and N385fs mutations negatively impact translation or alter subcellular localization of the ETV6 protein, we performed cell fractionation assays and western blotting of HeLa cells transiently

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Justification: Functional: The detection of different localization patterns for the mutants P214L, R369Q, and R399C also suggests alterations in their molecular or biochemical function.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

      Genes: 2120

      Variants: L349P N385fs P214L R369Q R399C

    3. To evaluate the functional consequences of these mutations, we first assessed whether L349P and N385fs might impair transcriptional repression by ETV6. HeLa cells were transiently co-transfected with constructs encoding

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the mutations L349P, N385fs, P214L, R369Q, and R399C impair the transcriptional repression function of ETV6, indicating that these variants alter molecular function.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

      Genes: 2120

      Variants: L349P N385fs P214L R369Q R399C

    4. Both ETV6 variants were absent in the National Heart Lung Blood Institute (NHLBI) Exome Sequencing Project (ESP) (http://evs.gs.washington.edu/EVS/), Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/),

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the L349P and N385fs mutations are predicted to alter the molecular function of the ETV6 protein, including conformational changes and truncation that affect DNA interaction.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs

      Genes: 2120

      Variants: L349P N385fs

    5. Fibroblast and lymphocyte DNA from the proband with ALL and parents in Kindred 2 were analyzed by clinical whole exome sequencing (Ambry Genetics, Aliso Viejo, CA, USA). The proband and his mother harbored a heterozygous

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the identification of a heterozygous deletion in ETV6 that is associated with the diagnosis of acute lymphoblastic leukemia (ALL) in the proband, indicating its role in defining the disease. Oncogenic: The variant N385fs is described as leading to a truncation of the ETV6 protein, which is implicated in tumor development, specifically in the context of acute lymphoblastic leukemia (ALL).

      Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

      Genes: 2120

      Variants: N385fs c.1153-5_1153_1delAACAG

    6. DNA from 16 individuals in Kindred 1 (9 individuals with thrombocytopenia and/or ALL and 7 unaffected individuals) was subjected to Sanger sequencing for all exons of a targeted panel of leukemia-associated genes (Method

      [Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Predisposing, Oncogenic

      Justification: Diagnostic: The variant 415 T>C is associated with thrombocytopenia and leukemia, as it was identified in all affected family members and absent in unaffected individuals, indicating its role in defining the disease. Predisposing: The passage describes the variant as being present in affected individuals and absent in unaffected individuals, suggesting it confers inherited risk for developing the disease, although it does not explicitly state that it is germline. Oncogenic: The variant is described in the context of leukemia, indicating its potential role in tumor development or progression, particularly as it is a missense mutation in a gene associated with leukemia.

      Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

      Genes: 10320 2120

      Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

    7. Inherited mutations of transcription factors have recently been associated with susceptibility to acute leukemia. Here we report two unrelated kindreds with inherited mutations in ETV6, the gene encoding the transcriptio

      [Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Predisposing, Functional

      Justification: Predisposing: The passage discusses inherited mutations in ETV6 that confer susceptibility to acute leukemia, indicating a germline origin and inherited risk for developing the disease. Functional: The passage describes how the ETV6 mutations (L349P and N385fs) alter the protein's localization and its ability to regulate gene expression, demonstrating a change in molecular function.

      Gene→Variant (gene-first): 2120:L349P 2120:N385fs

      Genes: 2120

      Variants: L349P N385fs

    8. Somatic mutations affecting ETV6 often occur in acute lymphoblastic leukemia (ALL), the most common childhood malignancy. The genetic factors that predispose to ALL remain poorly understood. Here we identify a novel germ

      [Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predisposing, Oncogenic, Functional

      Justification: Predisposing: The passage describes a germline ETV6 p. L349P mutation identified in a kindred affected by thrombocytopenia and ALL, indicating an inherited risk for developing the disease. Oncogenic: The ETV6 p. N385fs mutation was found in leukemic cells and is associated with the deletion of wild type ETV6, suggesting its contribution to tumor development in the context of leukemia. Functional: The enforced expression of the ETV6 mutants showed impaired nuclear localization and a significantly reduced ability to regulate the transcription of ETV6 target genes, indicating an alteration in molecular function.

      Gene→Variant (gene-first): 2120:p. L349P 2120:p. N385fs

      Genes: 2120

      Variants: p. L349P p. N385fs

    1. In 2017, the third-generation EGFR inhibitor osimertinib was approved for use in patients who developed the EGFR T790M mutation as a mechanism of resistance. In this year, of the 254 patients who received an EGFR inhibit

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the T790M mutation as a mechanism of resistance to the EGFR inhibitor osimertinib, indicating its correlation with treatment response. Oncogenic: The T790M mutation is described as contributing to resistance in patients treated with EGFR inhibitors, suggesting its role in tumor progression.

      Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

      Genes: 1956

      Variants: G719S L858R L861Q T790M

    2. Uni- and multivariable Cox regression analyses were performed to evaluate whether the type of EGFR mutation is associated with OS (Table 3). Because OS for patients with EGFR exon 20 insertions and patients with not acti

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses overall survival (OS) outcomes associated with the L858R variant, indicating that it correlates with disease outcome independent of therapy. Diagnostic: The mention of the type of EGFR mutation, including L858R, being associated with overall survival suggests its role in classifying or defining disease outcomes.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    3. The proportion of patients receiving first-line targeted therapy was highest for those with an exon 19 deletion (321/390; 82%) or L858R mutation (227/287; 79%), lower for those with uncommon, actionable variants (69/103;

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Prognostic

      Justification: Predictive: The passage discusses the proportion of patients receiving first-line targeted therapy based on the presence of the L858R mutation, indicating a correlation with treatment response. Prognostic: The median overall survival (OS) for patients with the L858R mutation is reported, demonstrating its correlation with disease outcome independent of therapy.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    4. OS in patients with any EGFR mutation was higher for those diagnosed in 2017 (median 18.1 months; 95% CI, 15.7-20.5) compared to 2013 (median 14.3 months; 95% CI, 12.5-16.1; p = 0.035), but similar to 2015 (median 17.6 m

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage discusses overall survival (OS) in patients with the L858R variant, indicating a correlation between this variant and disease outcome, independent of therapy. Diagnostic: The mention of distinct survival patterns observed in different EGFR mutation subclasses, including L858R, suggests that this variant is used to classify or define a subtype of disease.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    5. Treatment and survival data were available for 10,237 out of 10,254 patients (99.8%). This included 390 patients with an exon 19 deletion, 287 patients with L858R, 103 patients with an uncommon, actionable variant, 69 pa

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    6. Of the 7908 patients tested for EGFR mutations at initial diagnosis, one or more mutations were reported in 11.7% of all cases (95% CI, 11.0-12.4%; n = 925) (Table 2). Female patients were more likely to harbor EGFR muta

      [Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the prevalence of EGFR mutations, including L858R and L861X, in patients at initial diagnosis, indicating their association with the disease and their use in defining the mutation status of patients. Oncogenic: The variants L858R and L861X are described as actionable mutations within the context of EGFR, suggesting their role in tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R 1956:L861X

      Genes: 1956

      Variants: L858R L861X

    1. An in-house database search for insertions comparable to the VMOS RAS variants revealed one in-frame insertion in KRAS in a case suspected for Noonan syndrome (Fig. 7A). Furthermore, a screen of the current literature an

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the impact of the insertions on the catalytic Gln61 might be stronger, indicating an alteration in molecular function related to GTP hydrolysis.

      Gene→Variant (gene-first): 5921:Gln61

      Genes: 5921

      Variants: Gln61

    2. The biophysical characterisation of the VMOS RAS variants showed two opposing effects. VMOS RAS variants appeared insensitive to the action of GEFs with a consequently decrease of signalling capability. On the other hand

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the HRAS p.G12V variant alters the signaling capability by affecting GTP hydrolysis and inducing phosphorylation of ERK and AKT, indicating a change in molecular function. Oncogenic: The HRAS p.G12V variant is implicated in inducing signaling pathways that are associated with tumor development, as evidenced by the increased levels of phosphorylated ERK and AKT in the transfected cells.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    3. To analyse the effect of the VMOS RAS variants on GAP catalysed GTP hydrolysis, G-proteins were incubated in the presence of various concentration of RAS-GAP. GTP and GDP content was analysed after termination of the rea

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the classical oncogenic variant KRAS p.G12V in the context of its effect on GTP hydrolysis, indicating its role in tumor development or progression. Functional: The passage describes how the variant KRAS p.G12V affects the biochemical function of GTP hydrolysis, demonstrating its impact on molecular activity in the presence of RAS-GAP.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    4. GTP hydrolysis was followed over time by terminating the reactions at different points in time, and GDP and GTP contents analysis by HPLC. The intrinsic GTP hydrolysis rates of VMOS RAS variants were reduced by a factor

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the p.G12V variant alters the intrinsic GTP hydrolysis rates, indicating a change in molecular function related to protein activity. Oncogenic: The p.G12V variant is described as a classical oncogenic variant, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    5. The interaction of G-protein and the nucleotide is stabilised in the ternary complex with the effector and in consequence the rate of nucleotide dissociation is reduced. This effect was used to analyse the interaction of

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression. Functional: The passage discusses how KRAS p.G12V alters the intrinsic dissociation rate of mGppNHp compared to wild type, indicating a change in molecular function.

      Gene→Variant (gene-first): 3845:p.G12V

      Genes: 3845

      Variants: p.G12V

    6. The clinical context indicated that VMOS RAS variants cause enhanced RAS signalling, but the outcome of the in silico analysis is not unambiguously supporting this expectation. In fact, it strongly suggested deficiencies

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the impact of the p.Q61L variant on nucleotide exchange, effector binding, and GTP hydrolysis, indicating that it alters molecular or biochemical function. Oncogenic: The p.Q61L variant is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

      Gene→Variant (gene-first): 4893:p.Q61L

      Genes: 4893

      Variants: p.Q61L

    7. On amino acid level the DNA duplications and insertions found in the VMOS RAS variants resulted in an insertion of mainly duplicated sequence around position 65 (Fig. 2A). It is difficult to predict to what extent the in

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the insertions around Gln61 likely alter the molecular interactions and functions of the protein, particularly affecting GTP hydrolysis and interactions with GEFs and GAPs.

      Gene→Variant (gene-first): 5921:Gln61

      Genes: 5921

      Variants: Gln61

    8. Sensitive NGS based screening of frequently mutated positions in a panel of multiple genes were applied in 299 cases. In 108 cases, putative causative variants were identified, of which in 15 cases RAS genes were affecte

      [Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses mutations in RAS genes, including p.G12A, p.G13H, and p.Q22K, which are described as classical oncogenic mutations that affect tumor development and progression. Functional: The passage indicates that the p.Q22K mutation is associated with increased GTP loading, suggesting that it alters molecular function related to protein activity.

      Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

      Genes: 3845

      Variants: p.G12A p.G13H p.Q22K

    1. Oncogenic mutations in the serine/threonine kinase B-RAF are found in 50-70% of malignant melanomas. Pre-clinical studies have demonstrated that the B-RAFV600E mutation predicts a dependency on the mitogen activated prot

      [Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, and this is validated by the success of RAF and MEK inhibitors in clinical trials, indicating a correlation with treatment response. Oncogenic: The passage discusses oncogenic mutations in B-RAF, specifically the B-RAFV600E mutation, which is implicated in tumor development and progression in malignant melanomas.

      Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

      Genes: 673

      Variants: B-RAFV600E serine/threonine

    1. Structural details can provide mechanistic insight into variant effects on protein function. However, the structure of the RAD51C protein had not been experimentally determined at the time of this study. Initially, a hom

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how several variants, including K131, R168G, G130R, and others, alter the molecular function of RAD51C by disrupting the ATP-binding site and influencing RAD51C activity, as demonstrated in HDR assays. Oncogenic: The passage indicates that the variants are deleterious and influence RAD51C function, which is relevant to tumor development or progression, particularly in the context of HDR assays.

      Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu

      Genes: 5889 5892

      Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu

    2. RAD51C forms the BCDX2 and CX3 complexes that are involved in RAD51 recruitment to sites of DNA damage. To evaluate the influence of RAD51C variants on the integrity of these intrinsic complexes, coimmunoprecipitation of

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how various RAD51C variants affect the ability to form protein complexes involved in DNA damage repair, indicating that these variants alter molecular function. Oncogenic: The mention of deleterious variants that lose the ability to form complexes suggests a role in tumor development or progression, as these variants are associated with impaired DNA repair mechanisms.

      Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

      Genes: 5889 5892

      Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

    3. Because RAD51C participates in DNA damage signaling by regulating cell cycle progression, colony formation assays were performed to evaluate the influence of RAD51C variants on cell proliferation. U2OS RAD51C-/- landing

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how RAD51C variants alter cell proliferation and the formation of RAD51 foci in response to ionizing radiation, indicating changes in molecular function related to DNA damage signaling and repair. Oncogenic: The variants are implicated in a proliferation defect and disruption of homologous recombination (HR) repair, suggesting their role in tumor development or progression.

      Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

      Genes: 5889

      Variants: G130R G302V K131I L138F Q133E R168G T132R

    4. In parallel, a recent study evaluated the influence of 36 RAD51C missense variants on HR activity of U2OS and 21 on HR activity of MCF10A cells. Importantly, 18 of 36 evaluated in U2OS and 13 of 21 evaluated in MCF10A ce

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses how the L138F variant alters HDR activity in different cell lines, indicating a change in molecular function. Predictive: The passage mentions the sensitivity of variants, including L138F, to cisplatin and olaparib, suggesting a correlation with response to these therapies.

      Gene→Variant (gene-first): 5889:L138F

      Genes: 5889

      Variants: L138F

    5. To confirm the functional effects of RAD51C variants in a human cell line, RAD51C WT and 7 deleterious or intermediate missense variants in the HDR assay (G130R, K131I, T132R, Q133E, L138F, R168G and G302V) were introduc

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the sensitivity of specific RAD51C variants (G130R, K131I, T132R, Q133E, and G302V) to olaparib, indicating a correlation with response to therapy. Functional: The passage describes the introduction of RAD51C variants into a cell line and assesses their effects on homologous recombination repair (HDR), indicating that these variants alter molecular function.

      Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

      Genes: 5889

      Variants: G130R G302V K131I L138F Q133E R168G T132R

    6. An inability to form RAD51 foci at the sites of DNA DSBs is a key component of an HR deficient phenotype. Because disruption of RAD51C substantially decreases RAD51 foci formation the influence of RAD51C missense variant

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional, Predictive

      Justification: Functional: The passage discusses how RAD51C missense variants alter RAD51 foci formation in response to DNA damage, indicating a change in molecular function related to DNA repair mechanisms. Predictive: The mention of "drug response findings" suggests that the variants may correlate with sensitivity or resistance to a specific therapy, indicating predictive evidence.

      Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu

      Genes: 5889 5888

      Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu

    7. RAD51C loss promotes HR deficiency and sensitizes cells to cisplatin and olaparib PARP inhibitor. Thus, the influence of 60 RAD51C missense variants from the HDR assay (30 deleterious, 23 neutral, and 7 intermediate) on

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the influence of RAD51C missense variants on the response to cisplatin and olaparib, indicating a correlation between the variants and treatment sensitivity. Functional: The passage describes how the variants affect IC50 values in the HDR assay, suggesting that they alter molecular function related to drug response.

      Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg

      Genes: 5889

      Variants: E94K G306R p.Glu94Lys p.Gly306Arg

    8. A cell-based DR-GFP HDR colorimetric reporter assay was used to assess the influence of 173 missense mutations on RAD51C HR DNA repair activity (Supplementary Table S1). RAD51C deficient CL-V4B cells were reconstituted w

      [Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the influence of missense mutations on RAD51C HR DNA repair activity, indicating that the variants alter molecular function as assessed by HDR activity in a cell-based assay. Oncogenic: The mention of deleterious variants categorized based on their impact on HDR activity suggests that these somatic variants contribute to tumor development or progression through their effects on DNA repair mechanisms.

      Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala

      Genes: 5889

      Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala

    1. Firstly, the level of total STAT3 in two HCC patient samples appeared to be higher than that in corresponding adjacent normal tissues. Interestingly, treatment of ruxolitinib led to a significant reduction (50%) of the p

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the treatment of ruxolitinib and its effects on the phosphorylation level of STAT3 in tumors with the JAK1 S703I mutation, indicating a correlation with treatment response. Oncogenic: The mention of the JAK1 S703I mutation in the context of tumor models suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    2. In vivo efficacy studies of JAK1/2 inhibitor, ruxolitinib, were conducted in these four JAK1-mutant models and a JAK1-WT PDX model as a control (Figure 3A). The results showed that, only in LI-03-0191 model bearing JAK1S

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of the JAK1S703I mutation to the JAK1/2 inhibitor ruxolitinib, indicating a correlation with treatment response. Oncogenic: The passage suggests that the JAK1S703I mutation may play a critical role in tumorigenesis, indicating its contribution to tumor development.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    3. Anti-tumor activity of ruxolitinib in JAK1S703I-mutant PDX model

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the anti-tumor activity of ruxolitinib in a model with the JAK1 S703I mutation, indicating a correlation with response to therapy. Oncogenic: The mention of the JAK1 S703I mutation in the context of a PDX model suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 3716:S703I

      Genes: 3716

      Variants: S703I

    4. To further evaluate the transformation ability of these JAK1 mutations, Ba/F3 cells were stably infected with lentivirus expressing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703I, JAK1A1086S, and JAK1S729C, respec

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the transformation ability of JAK1 mutations, specifically noting that JAK1S703I and JAK1S729C are capable of continual proliferation in the absence of IL-3, indicating their contribution to tumor development or progression. Functional: The passage mentions that JAK1S703I activates the JAK-STAT signaling pathway, which indicates an alteration in molecular function related to the variant.

      Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

      Genes: 3716

      Variants: E483D S703I S729C

    5. To explore the biological functions of JAK1 mutations in JAK-STAT signaling pathway, we introduced these mutations into pLVX-IRES-Neo-JAK1 plasmid. Plasmids containing EGFP, wild-type JAK1, JAK1N451S, JAK1E483D, JAK1S703

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the introduction of JAK1 mutations, including E483D, S703I, and S729C, alters the expression levels of phosphorylated JAK1 and STAT proteins, indicating a change in molecular function. Oncogenic: The passage mentions that JAK1S729C is a known and recurrent activating mutation, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

      Genes: 3716

      Variants: E483D S703I S729C

    6. Specifically, S703I mutation was found in the pseudo-kinase domain of JAK1 protein, and could potentially cause the disruption of auto-inhibition of JAK1 kinase. Notably, S703I was previously identified in tumors of two

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage indicates that the S703I mutation is an activating mutation of the JAK1 gene and was found in tumors, suggesting it contributes to tumor development or progression. Functional: The S703I mutation is described as potentially causing disruption of auto-inhibition of the JAK1 kinase, indicating an alteration in molecular or biochemical function.

      Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

      Genes: 3716 728378

      Variants: A1086S E483D N451S S703I

    7. More than 160 HCC PDX models were established at WuXi AppTec in the past three years, of which over 60 models were characterized by WES. Among them, four models (LI-03-0012, LI-03-0155, LI-03-0191, and LI-03-0257) were i

      [Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

      Genes: 3716 728378

      Variants: A1086S E483D N451S S703I

    1. To examine if upregulation of NRG1 is induced by hormone therapy, we treated freshly isolated primary CAFs from CWR22Pc tumors or pCAFs with CSS or Enz. CSS and Enz both induced NRG1 mRNA and protein expression after 7 d

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses how NRG1 levels increase after androgen deprivation therapy (ADT) and suggests that these elevated levels are sufficient to promote resistance to ADT, indicating a correlation with treatment response. Oncogenic: The mention of NRG1 promoting resistance to ADT implies a role in tumor development or progression, which aligns with the definition of an oncogenic variant.

      Gene→Variant (gene-first): 8850:S7C

      Genes: 8850

      Variants: S7C

    2. To gain insight into the potential clinical relevance of these findings, we examined NRG1 expression in a cohort of 43 patients with localized prostate cancer who underwent radical prostatectomy surgery, 23 of whom recei

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Diagnostic, Predictive

      Justification: Diagnostic: The passage discusses the detection of NRG1 expression in patients with localized prostate cancer, indicating its potential role in classifying or defining the disease based on the presence or absence of NRG1 staining. Predictive: The analysis includes a comparison of NRG1 expression in patients who received neoadjuvant ADT versus those who were hormonally intact, suggesting a correlation with treatment response.

      Gene→Variant (gene-first): 3084:S6 8850:S7

      Genes: 3084 8850

      Variants: S6 S7

    3. Our earlier analysis of five canonical AR target genes suggested that NRG1 preserves tumor cell viability without restoring AR target gene expression (Figures 2G and 2H). To address this question more comprehensively, we

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 1956:S2 3084:S6C

      Genes: 1956 3084

      Variants: S2 S6C

    4. To carry out the purification, serum-free 22Pc-CAFCM was collected, concentrated, and applied to a Q-Superose anion exchange column, from which we eluted two protein peaks by using 30% and 100% high-salt buffer B (termed

      [Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses resistance-promoting activity and its correlation with HER3 phosphorylation, indicating a relationship with response or resistance to therapy. Functional: The passage describes how the variant affects HER3 phosphorylation activity, suggesting an alteration in molecular function related to resistance-promoting activity.

      Gene→Variant (gene-first): 5979:Q8

      Genes: 5979

      Variants: Q8

    1. B-cell lymphoma and melanoma harbor recurrent mutations in the gene encoding the EZH2 histone methyltransferase, but the carcinogenic role of these mutations is unclear. Here we describe a mouse model in which the most c

      [Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes how the somatic mutations Y641F and Y646F in the EZH2 gene contribute to tumor development, specifically leading to high-penetrance lymphoma and melanoma in a mouse model. Functional: The variant Ezh2Y641F is shown to alter molecular function by increasing global H3K27 trimethylation and causing a redistribution of this mark, which affects transcription at various loci.

      Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

      Genes: 2146

      Variants: Y641F Y646F

    1. Frequent genetic alterations discovered in FGFRs and evidence implicating some as drivers in diverse tumors has been accompanied by rapid progress in targeting FGFRs for anticancer treatments. Wider assessment of the imp

      [Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the impact of FGFR3 kinase domain variants on drug responses and highlights the distinct changes in efficacy of inhibitors based on specific activating mutations, indicating a correlation with treatment response. Oncogenic: The mention of FGFR3 variants as drivers in diverse tumors suggests that these somatic mutations contribute to tumor development or progression.

      Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G

      Genes: 2261

      Variants: K650E N540K R669G

    1. Results: Among a total of 148 patients, 48 (32%) had mutated KRAS, 77% at codon 12 and 23% at codon 13. The PFS was significantly worse in the mutant KRAS patients in comparison to wild type KRAS patients (p < 0.05). The

      [Paragraph-level] PMCID: PMC4378307 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Prognostic, Diagnostic

      Justification: Prognostic: The passage indicates that KRAS mutation, specifically G12D, is associated with a poor prognosis in progression-free survival (PFS), demonstrating its role as an independent negative prognostic factor. Diagnostic: The mention of KRAS mutations, including G12D, being associated with specific outcomes in patients suggests that these mutations can be used to classify or define disease subtypes.

      Gene→Variant (gene-first): 3845:G12D

      Genes: 3845

      Variants: G12D

    1. In the cBioPortal database, variants of the MAP2K1 gene are reported at frequencies of 1.7% in CRC patients (Table 1) and correlated with worse disease/progression-free survival (Logrank Test P-Value: 1.815e-3), but not

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Diagnostic, Prognostic, Predictive, Oncogenic

      Justification: Diagnostic: The passage discusses the frequencies of MAP2K1 variants in CRC patients and their association with specific tumor characteristics, indicating their role in defining or classifying the disease. Prognostic: The variants are correlated with worse disease/progression-free survival, suggesting they have prognostic implications independent of therapy. Predictive: The passage mentions that MAP2K1 mutations are associated with de novo and acquired resistance to anti-EGFR MoAbs, indicating a predictive relationship with therapy response. Oncogenic: The variants are described as contributing to a gain of function of the MEK1 protein, which is indicative of their role in tumor development or progression.

      Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu

      Genes: 5604

      Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu

    2. The CNVs were much more frequent among patients with longer PFS. Within this cohort, patient P16 had a significant copy number gain of ERBB2 (78.99) that was confirmed by FISH analysis (data not shown). Patient P16 had a

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the response of patients to cetuximab-based first-line therapy, specifically noting that patient P4, who carries the FBXW7 variant c.1268G>T; p.Gly423Val, had a complete response to this therapy. Diagnostic: The mention of the FBXW7 variant in the context of patient P4's treatment response suggests that it may be used to classify or define the patient's disease or treatment outcome.

      Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val

      Genes: 55294

      Variants: c.1268G>T p.Gly423Val

    3. Of the three missense mutations detected in FBXW7, two were found in patients with a PFS shorter than median PFS. Patient P14 (PFS 8.07 months) carried the c.1798G>A variant (p.Asp600Asn) and patient P18 (PFS 1.73 months

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Prognostic, Oncogenic

      Justification: Prognostic: The passage indicates that two missense mutations are associated with patients having a shorter progression-free survival (PFS), suggesting a correlation with disease outcome. Oncogenic: The FBXW7 p.Arg505Cys mutation is reported to lead to loss of function of the protein and has been associated with several cancer types, indicating its contribution to tumor development or progression.

      Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn

      Genes: 55294 1956 673

      Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn

    4. Two patients (P20 and P21) had variants in NF1, a negative regulator of RAS, inactivated by mutation in various cancers. Specifically, we found an insertion (c.638_639insA; p.Asn214Lys fs*2) in the tumor from patient P20

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Oncogenic, Prognostic

      Justification: Oncogenic: The variants in NF1 are described as contributing to tumor development by leading to a loss of function and increased activation of the RAS signaling pathway, indicating their role in oncogenesis. Prognostic: The passage provides progression-free survival (PFS) times for the patients with the variants, suggesting a correlation between the variants and disease outcome.

      Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter

      Genes: 4763

      Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter

    5. Patient P3 (PFS 6.63 months) carried the variant c.169A>G in the MAP2K1 gene coding for the MEK1 protein. This variant has been already reported in the cBioPortal database. It results in the substitution of an amino acid

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The variant c.169A>G results in an amino acid substitution (p.Lys57Glu) that is associated with a gain of function of the MEK1 protein, indicating an alteration in molecular function. Oncogenic: The variant is discussed in the context of its role in the MAP2K1 gene, which is known to contribute to tumor development or progression, suggesting its oncogenic potential.

      Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu

      Genes: 5604

      Variants: c.169A>G p.Lys57Glu

    6. All variants were at an allelic frequency >5% with the exception of a KRAS variant (c.183A>T; p.Gln61His) that was identified in the tumor tissue from patient P7 (PFS 3.93 months) at an allelic frequency of 0.4%. This va

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the KRAS variant (c.183A>T; p.Gln61His) identified in tumor tissue, indicating its role in tumor development or progression as it is associated with a specific patient's tumor.

      Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His

      Genes: 3845

      Variants: c.183A>T p.Gln61His

    7. Of the 54 SNVs and insertions/deletions (Indels) identified, 35% and 41% were APC and TP53 variants, respectively (Figure 1). Nineteen patients (90.47%) had at least one TP53 SNV or Indel, whereas 15/21 (71.43%) patients

      [Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the presence of specific variants in patients and their association with APC and TP53 mutations, indicating their role in defining or classifying the disease context. Oncogenic: The variants mentioned are associated with tumors, suggesting that they contribute to tumor development or progression, which aligns with the definition of oncogenic variants.

      Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG

      Genes: 7157 324

      Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG

    1. Finally, we investigated genetic mutation status in biopsies of two patients who progressed on repotrectinib in clinical trial using targeted sequencing. Patient A, a 46-year-old male with a 20 pack-year smoking history,

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses mutations identified in patients who progressed on repotrectinib treatment, suggesting a potential role of these variants in acquired resistance to the therapy. Functional: The passage indicates that further studies are necessary to investigate the functional role of the mutations, implying that these variants may alter molecular or biochemical functions related to resistance mechanisms.

      Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q

      Genes: 1050 7157 896 2064 5925

      Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q

    2. The clinical activity of repotrectinib against ROS1 SFM was seen in a 49-year-old female ROS1-rearranged patient who progressed after 44 months of crizotinib treatment with an identified CD74-ROS1 G2032R mutation. The pa

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Diagnostic

      Justification: Predictive: The passage discusses the clinical activity of repotrectinib in a patient with the G2032R mutation, indicating a response to therapy, which aligns with predictive evidence. Diagnostic: The G2032R mutation is identified in the context of a ROS1-rearranged patient, suggesting its role in defining the patient's disease subtype.

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    3. We identified the ROS1-G2032R mutation in YU1079, which was serially established in the same patient as YU1078 but after progressing on crizotinib treatment. Based on recent studies examining lorlatinib and cabozantinib

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the response of the ROS1-G2032R mutation to various therapies, specifically mentioning the effectiveness of cabozantinib and repotrectinib in inhibiting growth, which correlates with treatment response. Oncogenic: The ROS1-G2032R mutation is implicated in tumor growth, as indicated by the investigation of its effects in Ba/F3 cells and the context of progression on crizotinib treatment, suggesting its role in tumor development.

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    4. Repotrectinib overcomes crizotinib-resistant ROS1 G2032R

      [Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Predictive

      Justification: Predictive: The passage indicates that repotrectinib is effective against crizotinib-resistant ROS1 G2032R, suggesting a correlation between the variant and response to therapy.

      Gene→Variant (gene-first): 6098:G2032R

      Genes: 6098

      Variants: G2032R

    1. DNMT3A exon 23 screening was performed on available samples coming from 288 AML patients aged from 18 to 65-year old and treated in Toulouse between 2000 and 2009. DNMT3A exon 23 mutations were detected in 39 patients (1

      [Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the detection of DNMT3A exon 23 mutations in AML patients, indicating that these mutations are associated with the disease, which supports their use in defining or confirming the disease. Oncogenic: The mention of DNMT3A mutations in AML patients suggests that these somatic variants contribute to tumor development or progression, as they are identified in a cancer context.

      Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S

      Genes: 1788

      Variants: R882 R882C R882H R882P W893 W893S

    1. A total of 3 out of 42 GC patients were METex14del positive (Table 3). All GC cases were MET IHC 3+ and the only case in the series with MET amplification. For example, one case was a 27-year old male patient who present

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 1956:T790M 673:V600E

      Genes: 1956 673

      Variants: T790M V600E

    2. All 13 METex14del cases were further confirmed by qualitative RT-PCR using probes overlapping an exon 13-15 junction, a fusion transcript caused by exon 14 skipping. In all cases, although the absolute Ct (cycles to thre

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage indicates that the variant c.3082+811A TTTTAACA > GGTTTGAT is found in all GI cancer samples, suggesting its association with the disease. Oncogenic: The presence of the variant in GI cancer samples implies a potential role in tumor development or progression, as it is discussed in the context of mutations in cancer.

      Gene→Variant (gene-first): 7157:c.3082+811A TTTTAACA > GGTTTGAT

      Genes: 7157

      Variants: c.3082+811A TTTTAACA > GGTTTGAT

    3. The patient cohort from the NEXT-1 trial (NCT02141152), which is an actively enrolling clinical trial for genomic profiling in cancer patients, was used (Figure 1). Of 428 patients enrolled and screened, sufficient RNAs

      [Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2

      Evidence Type(s): None

      Justification: Not enough information in this passage.

      Gene→Variant (gene-first): 4916:p.982_1028del47

      Genes: 4916

      Variants: p.982_1028del47

    1. Based on our search criteria, a total of 41 studies, which enrolled 13,103 KRAS assessable patients with 18 percent (2,374) KRAS mutant positive cases, were eligible for inclusion in the present analyses. The process of

      [Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency of KRAS mutations, specifically mentioning that the majority occur in codon 12 with G12C being the most common, indicating its association with lung cancer subtypes. Oncogenic: The mention of KRAS mutations, including G12C, in the context of lung adenocarcinoma suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 3845:G12C

      Genes: 3845

      Variants: G12C

    1. We report two inflammatory myofibroblastic tumor (IMT) patients with ALK fusions (RRBP-ALK and TNS1-ALK, respectively). They both received tumor resection surgery and treatment with ALK inhibitors crizotinib followed by

      [Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The variant L1196Q is associated with the development of resistance to ALK inhibitors, and its identification guided the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Oncogenic: The passage indicates that the L1196Q mutation is a secondary mutation that developed in the context of drug resistance, suggesting it contributes to tumor progression and the development of resistance to therapy.

      Gene→Variant (gene-first): 238:L1196Q

      Genes: 238

      Variants: L1196Q

    1. Pediatric glioblastomas (GBM) including diffuse intrinsic pontine gliomas (DIPG) are devastating brain tumors with no effective therapy. Here, we investigated clinical and biological impacts of histone H3.3 mutations. Fo

      [Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Diagnostic, Prognostic, Oncogenic

      Justification: Diagnostic: K27M-H3.3 mutation defines clinically and biologically distinct subgroups in DIPG, indicating its use in classifying the disease. Prognostic: K27M-H3.3 is universally associated with short survival in DIPG, while patients wild-type for H3.3 show improved survival, indicating its correlation with disease outcome. Oncogenic: The K27M-H3.3 mutation contributes to tumor development or progression in pediatric glioblastomas, as indicated by its prevalence in DIPG and association with specific copy number changes.

      Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M

      Genes: 3021

      Variants: G34V G34V/R K27M

    1. Isocitrate dehydrogenases (IDHs) catalyse oxidative decarboxylation of isocitrate to alpha-ketoglutarate (alpha-KG). IDH1 functions in the cytosol and peroxisomes, whereas IDH2 and IDH3 are both localized in the mitochon

      [Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses heterozygous somatic mutations in IDH1, specifically the R132H variant, and its association with tumorigenesis in gliomas, indicating that this variant contributes to tumor development or progression. Functional: The passage mentions that mutations in IDH1, including R132H, cause loss of normal enzyme function and gain-of-function, leading to the accumulation of D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    2. We studied 47 glioblastomas (WHO grade IV). Heterozygous mutations of IDH1 were found in 6/47 tumours (12%). All 6 mutations were single base substitutions c.395G>A occurring at residue R132, resulting in an arginine to

      [Paragraph-level] PMCID: PMC3100313 Section: RESULTS PassageIndex: 2

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency of heterozygous mutations of IDH1, specifically the c.395G>A variant, in glioblastomas, indicating its association with this disease subtype. Oncogenic: The presence of the IDH1 mutation (p.R132H) in glioblastomas suggests that this somatic variant contributes to tumor development or progression.

      Gene→Variant (gene-first): 728294:R132 79944:arginine to histidine 728294:c.395G>A 3417:p.R132H

      Genes: 728294 79944 3417

      Variants: R132 arginine to histidine c.395G>A p.R132H

    1. Recently, a rare activating mutation of AKT1 (E17K) has been reported in breast, ovarian, and colorectal cancers. However, analogous activating mutations in AKT2 or AKT3 have not been identified in any cancer lineage. To

      [Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Diagnostic, Oncogenic, Functional

      Justification: Diagnostic: The passage discusses the identification of the AKT1 (E17K) mutation in various cancer types, indicating its association with melanoma and suggesting its role in defining the presence of this mutation in cancer specimens. Oncogenic: The passage states that the AKT1 E17K mutation is an activating mutation that contributes to tumor development, as evidenced by its identification in melanoma specimens and cell lines, indicating its role in cancer progression. Functional: The passage mentions that the AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, demonstrating a change in molecular function related to the variant.

      Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K

      Genes: 207

      Variants: AKT1 (E17K E17K

    1. Diffuse midline gliomas (DMGs) including diffuse intrinsic pontine gliomas (DIPGs) bearing lysine-to-methionine mutations in histone H3 at lysine 27 (H3K27M) are lethal childhood brain cancers. These tumors harbor a glob

      [Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses how the lysine-to-methionine mutation at lysine 27 (H3K27M) contributes to tumor development and progression in diffuse midline gliomas, indicating its role as a somatic variant in cancer. Functional: The variant alters molecular function by affecting the levels of proteins in the SWI/SNF complex and influencing chromatin modifications, demonstrating its impact on biochemical processes within the tumor cells.

      Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine

      Genes: 3021 55193

      Variants: lysine 27 lysine-to-methionine

    1. P05 was a female patient with EGFR exon 19 deletion-mutant stage IV LUAD with bone metastasis, and ERBB2DeltaEx16 was identified from her plasma sample after progression on osimertinib plus crizotinib ( Table 2 ; Figure

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses various mutations, including Y1230H, D1288N L1195I, and L1195V, which are described as secondary mutations associated with MET TKI resistance, indicating a correlation with treatment response. Oncogenic: The mention of mutations contributing to resistance against targeted therapies suggests that these variants may play a role in tumor development or progression, particularly in the context of lung cancer.

      Gene→Variant (gene-first): 79811:D1288N L1195I 79811:L1195V 79811:Y1230H 2064:c.1899-936_1946+520del

      Genes: 79811 2064

      Variants: D1288N L1195I L1195V Y1230H c.1899-936_1946+520del

    2. P03 was a female patient with EGFR L858R-mutant advanced LUAD with bone metastasis. ERBB2DeltaEx16 was detected after disease progression with osimertinib using her plasma samples but not in the paired tissue rebiopsy (

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the presence of the EGFR L858R variant in a patient with advanced LUAD and its association with resistance to osimertinib, indicating a correlation with treatment response. Oncogenic: The mention of the EGFR L858R variant and its role in the context of advanced LUAD suggests that it contributes to tumor development or progression, particularly as it is associated with resistance mechanisms.

      Gene→Variant (gene-first): 2064:D769Y 2064:L755S 1956:L858R 2064:c.1899-32_1909del

      Genes: 2064 1956

      Variants: D769Y L755S L858R c.1899-32_1909del

    3. Of the 21 unique ERBB2DeltaEx16 variants detected from Chinese patients, 9 involved complete deletion of exon 16, 3 were deletions or point mutations involving splice donors, and 9 deletions or point mutations affecting

      [Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Diagnostic, Predictive

      Justification: Diagnostic: The passage discusses the detection of ERBB2 variants in patients, indicating their association with specific cases, which supports their use in defining or classifying a disease subtype. Predictive: The mention of the novel variant ERBB2 c.1899-2A>G being detected after treatment suggests a potential correlation with treatment response, indicating its relevance in predicting therapy outcomes.

      Gene→Variant (gene-first): 2064:c.1899-2A>G 2064:c.1899-880_1946+761del

      Genes: 2064

      Variants: c.1899-2A>G c.1899-880_1946+761del

    1. In clinical practice, there are a number of cancer patients with clear family histories, but the patients lack mutations in known familial cancer syndrome genes. Recent advances in genomic technologies have enhanced the

      [Paragraph-level] PMCID: PMC5111006 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage indicates that the homozygous CHEK2 variant p.R474C was contributory to familial cancer, and the inactivation of CHEK2 in mice led to cancers in multiple organs, suggesting a role in tumor development. Functional: The variant p.R474C alters the tertiary structure of the CHK2 protein by disrupting a salt bridge, and subsequent analysis showed that it was unstable and scarcely activated, indicating a change in molecular function.

      Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

      Genes: 11200

      Variants: p.R474 p.R474C

    2. Among the variants detected in the runs of homozygosity common to both siblings, five were recorded as disease-associated variants in the HGMD public entries. However, they are related to diabetes or insulin secretion (r

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 18

      Evidence Type(s): Diagnostic, Predisposing

      Justification: Diagnostic: The passage states that the variants are recorded as disease-associated variants, indicating their use in defining or classifying diseases such as diabetes, carotid intima media thickness, and oligospermia. Predisposing: The variants mentioned are associated with inherited conditions, suggesting they confer an inherited risk for developing diseases, although the germline nature is implied rather than explicitly stated.

      Gene→Variant (gene-first): 440822:rs11703684 6289:rs2468844 3767:rs5215 3767:rs5219 6833:rs757110

      Genes: 440822 6289 3767 6833

      Variants: rs11703684 rs2468844 rs5215 rs5219 rs757110

    3. We surveyed variants in potential hereditary loci including those in TP53 (causative gene for Li-Fraumeni syndrome), BRCA2 (causative gene for hereditary breast/ovarian cancer), and mismatch repair genes (MSH2, MSH6, PMS

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 17

      Evidence Type(s): Predisposing, Diagnostic

      Justification: Predisposing: The passage discusses variants in hereditary loci, specifically mentioning TP53 and BRCA2, which are associated with inherited cancer syndromes, indicating a potential inherited risk for developing disease. Diagnostic: The passage mentions the classification of variants as "Benign" or of "Uncertain significance," which relates to their use in defining or classifying disease risk or status.

      Gene→Variant (gene-first): 7157:p.P72R 675:p.V2466A 7157:rs1042522 2956:rs1042821 4072:rs1126497 675:rs169547 5395:rs1805323 5395:rs2228006 4436:rs2303424

      Genes: 7157 675 2956 4072 5395 4436

      Variants: p.P72R p.V2466A rs1042522 rs1042821 rs1126497 rs169547 rs1805323 rs2228006 rs2303424

    4. CHK2 is a cell cycle checkpoint regulator activated by DNA damage. The above analysis and the function of CHK2 suggest that CHEK2 is a contributory gene for this familial case. We therefore examined the function of CHK2

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the p.R474C variant alters the molecular function of the CHK2 protein, demonstrating that it is poorly expressed and activated by DNA damage compared to the wild-type protein. Oncogenic: The context implies that the p.R474C variant contributes to tumor development or progression by affecting the function of a cell cycle checkpoint regulator, which is critical in the context of cancer biology.

      Gene→Variant (gene-first): 11200:p.R474C

      Genes: 11200

      Variants: p.R474C

    5. CHK2 p.R474C Protein Is Poorly Activated in the Cell upon DNA Damage

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Functional

      Justification: Functional: The passage indicates that the p.R474C variant affects the activation of the CHK2 protein in response to DNA damage, suggesting an alteration in its molecular function.

      Gene→Variant (gene-first): 11200:p.R474C

      Genes: 11200

      Variants: p.R474C

    6. The tertiary structure of FCGRT-immunoglobulin Fc fragment complex was determined. p.R210 contacts the carboxyl terminus of the immunoglobulin Fc fragment. Although there is a salt bridge between p.R210 and the Fc fragme

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variant p.R210 and its substitution p.R210Q relate to the structure and potential function of the protein, indicating that p.R210Q is not likely to affect the function and structure of the protein.

      Gene→Variant (gene-first): 2217:p.R210 2217:p.R210Q

      Genes: 2217

      Variants: p.R210 p.R210Q

    7. Second, we examined how the amino acid substitutions affect the tertiary structure of the proteins. The tertiary structure of the inactive CHK2 homodimer (PDB code: 3i6w) is shown in Figure 4B. p.R474 is located away fro

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variant p.R474C alters the salt bridge formation and is likely to make the protein unstable, indicating an alteration in molecular function. Oncogenic: The variant p.R474C is described as "disease causing" and likely interferes with protein function, suggesting a role in tumor development or progression.

      Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

      Genes: 11200

      Variants: p.R474 p.R474C

    8. First, the effects of these missense variants were predicted using the Variant Effect Predictor at Ensembl, for which SIFT (Sorting Intolerant from Tolerant) and PolyPhen (Polymorphism Phenotyping) are used. Three varian

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Functional

      Justification: Functional: The passage discusses how the variant p.R474 in CHEK2 was analyzed for its effect on protein function based on evolutionary conservation, indicating that it alters molecular or biochemical function.

      Gene→Variant (gene-first): 11200:p.R474

      Genes: 11200

      Variants: p.R474

    9. The female patient, FL2, was 6 years older than the male patient. At the age of 38, she was diagnosed with uterine myoma and developed multiple primary lung cancer at the age of 60 with no history of smoking. Three prima

      [Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the presence of the L858R mutation in the context of lung cancer, indicating its potential role in tumor development or progression.

      Gene→Variant (gene-first): 1956:L858R

      Genes: 1956

      Variants: L858R

    1. Ninety-two of the 93 tumors were amenable to data analysis. TP53 was the most common mutation, occurring in 47 (51%) patients, followed by CDKN2A (n=23, 25%), CCND1 (n=22, 24%), and PIK3CA (n=19, 21%). The total mutation

      [Paragraph-level] PMCID: PMC6333965 Section: ABSTRACT PassageIndex: 6

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage mentions that PIK3CA E545K and CDKN2A R58X are potentially targetable alterations, indicating their association with specific tumor characteristics or responses, which aligns with diagnostic evidence. Oncogenic: The variants PIK3CA E545K and CDKN2A R58X are described as potentially targetable alterations, suggesting their role in tumor development or progression, which supports oncogenic evidence.

      Gene→Variant (gene-first): 5290:E545K 1029:R58X

      Genes: 5290 1029

      Variants: E545K R58X

    1. Single nucleotide variants (SNVs) and insertions and deletions (InDels) were identified in mouse ccRCCs versus matched liver. The most frequent SNVs were C>A/G>T transversions, C>T/G>A transitions and A>G/T>C transitions

      [Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage discusses the frequency and types of mutations observed in human ccRCC, indicating that these mutations are associated with the disease, thus providing evidence for their role in defining or classifying the disease. Oncogenic: The passage describes mutations in primary cilium-related genes that contribute to the formation of ccRCC precursor lesions in mice, indicating that these somatic variants play a role in tumor development.

      Gene→Variant (gene-first): 7428:A>G 7428:C>A 7428:C>T 7428:G>A 7428:G>T 7428:T>C

      Genes: 7428

      Variants: A>G C>A C>T G>A G>T T>C

    2. To functionally test this idea in mice, we genetically deleted Vhl together with two tumour suppressor genes that encode proteins that function as the key controllers of cell cycle entry in the p53/G1-S network, namely T

      [Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the deletion of Trp53 in mice and its contribution to tumor development, as evidenced by the increased incidence and earlier onset of tumors in VhlDelta/DeltaTrp53Delta/DeltaRb1Delta/Delta mice compared to other genotypes. Functional: The deletion of Trp53 is described in the context of its role in the p53/G1-S network, indicating that it alters the molecular function related to cell cycle control and tumorigenesis.

      Gene→Variant (gene-first): 7428:Trp53 deletion

      Genes: 7428

      Variants: Trp53 deletion

    1. The observation that K-RasG12D and switch 2 insertion mutant proteins are defective for PI3K binding and Akt activation suggested that this might alter effector pathway dependencies. To address this question, we exposed

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 15

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity of cells expressing K-RasG12D to specific therapies, indicating a correlation between the variant and response to treatment with MEK and PI3K inhibitors. Oncogenic: The mention of K-RasG12D in the context of transformed Ba/F3 cells suggests that this somatic variant contributes to tumor development or progression, as it is involved in cytokine-independent growth.

      Gene→Variant (gene-first): 3845:K-RasG12D

      Genes: 3845

      Variants: K-RasG12D

    2. Together with prior structural modelling predictions, these biochemical data prompted us to directly assess the ability of WT and mutant K-Ras proteins to bind to effectors in vitro. As expected, His-K-Ras WT bound GST-R

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the ability of mutant K-Ras proteins to bind to effectors in vitro, indicating that the variants alter molecular interactions, specifically the binding to FLAG-p110alpha. Oncogenic: The mention of K-RasG12D and the other mutant variants in the context of their binding interactions suggests that these somatic variants contribute to tumor development or progression through their altered functional properties.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D 5290:Y64G

      Genes: 5295 3845 5290

      Variants: A66dup K-RasG12D Y64G

    3. To assess how acute activation of K-Ras duplication mutants modulates effector pathway activation, we engineered tetracycline inducible GFP-K-Ras constructs and introduced them into Ba/F3 cells (Supplementary Fig. 4). In

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the K-RasG12D variant alters the levels of pERK and pAkt, indicating a change in molecular function related to signaling pathways. Oncogenic: The K-RasG12D variant is implicated in modulating effector pathway activation, which suggests its role in tumor development or progression.

      Gene→Variant (gene-first): 3845:K-RasG12D

      Genes: 3845

      Variants: K-RasG12D

    4. Expression of K-RasG12D and each tandem duplication mutant, but not WT K-Ras, transformed interleukin 3 (IL-3)-dependent Ba/F3 cells to cytokine-independent growth (Supplementary Fig. 3a). Ba/F3 cells expressing K-RasG12

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes how the K-RasG12D variant and tandem duplication mutants transform Ba/F3 cells to cytokine-independent growth, indicating their role in tumor development or progression. Functional: The passage mentions that Ba/F3 cells expressing K-RasG12D and the tandem duplication mutants had elevated levels of Ras-GTP, suggesting that these variants alter molecular function related to Ras signaling.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    5. To directly test these predictions, we produced N-terminal histidine fusions encoding amino acids 1-166 of K-RasG60_A66dup or K-RasE62_A66dup, and compared their biochemical properties with WT K-Ras and K-RasG12D (Supple

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variants K-RasG60_A66dup and K-RasE62_A66dup alter the biochemical properties of K-Ras, specifically their GTPase activity and response to GAP stimulation, indicating a change in molecular function. Oncogenic: The variants are described in the context of their role in accumulating in the active GTP conformation and exhibiting impaired GTPase activity, which suggests their contribution to tumor development or progression.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    6. We next examined published crystal structures to model potential effects of switch 2 insertions on the following: (1) the positions of critical residues involved in intrinsic catalysis such as Glutamine 61 (Q61); (2) the

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the variant Glutamine 61 (Q61) may alter protein-protein interactions and the structural dynamics of Ras, indicating a change in molecular function due to the predicted effects of switch 2 insertions. Oncogenic: The analysis suggests that the alterations in the Ras protein structure, particularly involving Q61, may contribute to the GTP conformation of Ras, which is associated with tumor development and progression.

      Gene→Variant (gene-first): 3845:Glutamine 61 3845:Q61

      Genes: 3845

      Variants: Glutamine 61 Q61

    7. A hypersensitive pattern of colony-forming unit granulocyte macrophage (CFU-GM) progenitor formation in response to colony-stimulating factor (GM-CSF) is a cellular hallmark of JMML. To ask whether K-Ras insertion mutant

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 5

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses how the K-RasG12D variant induces cytokine-independent colony formation and contributes to abnormal growth patterns in hematopoietic progenitor cells, indicating its role in tumor development. Functional: The variant K-RasG12D alters the growth response of progenitor cells to GM-CSF, demonstrating a change in molecular function related to colony formation.

      Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

      Genes: 5295 3845

      Variants: A66dup K-RasG12D

    8. Juvenile myelomonocytic leukaemia (JMML) is an aggressive myeloproliferative neoplasm (MPN) characterized by driver Ras pathway mutations in 85% of cases, including known oncogenic KRAS and NRAS substitutions. We discove

      [Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage describes a partial duplication of the K-Ras gene that is associated with juvenile myelomonocytic leukaemia (JMML), indicating that the variant contributes to tumor development or progression. Functional: The immunoblot analysis shows that the variant alters the molecular function of K-Ras, as evidenced by the detection of a band with reduced electrophoretic mobility compared to normal Ras protein, indicating a change in protein behavior.

      Gene→Variant (gene-first): 3845:c.178_198dup 3845:c.184_198dup

      Genes: 3845

      Variants: c.178_198dup c.184_198dup

    1. Finally, we tested the effects of the combination therapies on cell proliferation in osimertinib-resistant cell lines. Similar to RPC-9/NaqR cells, the osimertinib-resistant cell lines were derived from RPC-9 cells, desi

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effects of combination therapies on cell proliferation in osimertinib-resistant cell lines, indicating a relationship between the presence of the T790M mutation and the response to therapy, specifically mentioning osimertinib and naquotinib. Oncogenic: The T790M mutation is maintained in the osimertinib-resistant RPC-9/OsiR cells, suggesting its role in tumor development or progression, particularly in the context of resistance to therapy.

      Gene→Variant (gene-first): 1956:C797S 1956:T790M

      Genes: 1956

      Variants: C797S T790M

    2. Next we investigated RPC-9/NaqR cells, which were derived from gefitinib-resistant lung adenocarcinoma cell lines (RPC-9 cells harboring the EGFR exon 19del and T790M mutations). Exposure to naquotinib inhibited the phos

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses gefitinib-resistant lung adenocarcinoma cell lines harboring the EGFR exon 19del and T790M mutations, indicating a correlation with resistance to therapy, specifically gefitinib. Oncogenic: The mention of the EGFR exon 19del and T790M mutations in the context of gefitinib resistance suggests that these somatic variants contribute to tumor development or progression in lung adenocarcinoma.

      Gene→Variant (gene-first): 1956:19del 1956:T790M

      Genes: 1956

      Variants: 19del T790M

    3. To further examine the role of MET in EGFR-TKI-naive cancer cells, we developed another resistant cell line from EGFR-TKI-naive lung cancer cells, HCC827, which harbor the EGFR exon 19del. The resistant cell line, design

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 8

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The passage discusses the role of the EGFR exon 19del variant in the development of a resistant cell line, indicating that this somatic variant contributes to tumor progression and resistance mechanisms in lung cancer cells. Predictive: The passage mentions that the combination of EGFR-TKIs and MET inhibitors showed an excellent inhibitory effect on cell proliferation in the resistant cell line, suggesting a correlation between the variant and response to therapy.

      Gene→Variant (gene-first): 1956:19del

      Genes: 1956

      Variants: 19del

    4. Next, we assessed the effects of several generations of EGFR-TKIs in these naquotinib-resistant cell lines. The resistant cell lines exhibited 52- to 157-fold resistance to naquotinib compared with each parental cell lin

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 4

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the acquired EGFR C797S mutation in the context of resistance to osimertinib, indicating that this variant correlates with resistance to a specific therapy. Oncogenic: The C797S mutation is described as contributing to resistance in cell lines, suggesting its role in tumor progression or development in the context of EGFR-TKI treatment.

      Gene→Variant (gene-first): 1956:C797S

      Genes: 1956

      Variants: C797S

    5. First, to explore the mechanism of resistance to naquotinib, we established naquotinib-resistant lung cancer cells using a cell line-based model. The following cell lines were examined: 1. EGFR-TKI-naive PC-9 cells harbo

      [Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the establishment of naquotinib-resistant lung cancer cells and mentions the effectiveness of naquotinib in inhibiting cell proliferation, indicating a correlation between the variants (19del and T790M) and resistance to therapy. Oncogenic: The presence of the T790M mutation in acquired gefitinib-resistant cells suggests that it contributes to tumor development or progression, as it is associated with resistance mechanisms in lung cancer.

      Gene→Variant (gene-first): 1956:19del 1956:T790M

      Genes: 1956

      Variants: 19del T790M

    1. We also investigated whether drug efficacy is dependent on the FGFR variants in patients. For this purpose, we retrospectively collected variant information and drug efficacy data related to FGFR inhibitors in 399 cases

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the correlation between the FGFR3 S249C variant and the response to treatment with FGFR TKIs, indicating that patients with this mutation exhibited partial or complete responses, which aligns with predictive evidence. Oncogenic: The FGFR3 S249C variant is described as the most frequent mutation of FGFR3, suggesting its role in tumor development or progression, which supports its classification as oncogenic.

      Gene→Variant (gene-first): 2261:S249C

      Genes: 2261

      Variants: S249C

    2. Furthermore, the existence of concurrent mutations between FGFRs and the genes involved in different pathways, such as PIK3CA, PTEN, AKT1/2/3, and MAP2K1 was investigated. Indeed, concurrent mutations with PIK3CA were fr

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 21

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage indicates that the mutations E545K, E542K, and H1047R are described as "oncogenic mutations," suggesting they contribute to tumor development or progression.

      Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

      Genes: 5290

      Variants: E542K E545K H1047R

    3. More than 400 types of FGFR compound mutations were observed in the COSMIC database, and 34 types of those were reported in more than two samples (Fig. 7a). The most frequent compound mutation is the combination of S249C

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Oncogenic, Predictive

      Justification: Oncogenic: The passage discusses the transforming activities of FGFR3 S249C compound mutations, indicating that these mutations contribute to tumor development or progression as demonstrated by their evaluation in 3T3 and Ba/F3 cells. Predictive: The passage mentions the sensitivity to E7090 and erdafitinib in relation to the mutations, indicating a correlation with treatment response, which aligns with predictive evidence.

      Gene→Variant (gene-first): 2261:K650E 2261:K650M 2261:S249C 2261:Y373C

      Genes: 2261

      Variants: K650E K650M S249C Y373C

    4. Next, we measured the effectiveness of E7090 and erdafitinib in vivo. Mouse 3T3 fibroblasts expressing FGFR1 N546K, FGFR2 N549K, FGFR3 R248C, FGFR3 K650M, or FGFR3 K650N were injected into nude mice that were subsequentl

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the effectiveness of E7090 and erdafitinib in treating tumors with specific variants, indicating a correlation between the variants and the response to these therapies. Oncogenic: The variants are described in the context of tumor growth and response to treatment, suggesting that they contribute to tumor development or progression.

      Gene→Variant (gene-first): 2261:K650M 2261:K650N 2260:N546K 2263:N549K 2261:R248C

      Genes: 2261 2260 2263

      Variants: K650M K650N N546K N549K R248C

    5. Inhibition of FGFRs and downstream signaling pathways by FGFR TKIs was evaluated through immunoblot analyses (Fig. 3c). While phosphorylation of FGFR3 K650M was suppressed by E7090 at 100 nM, that of FGFR3 K650N was decr

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 14

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the response of FGFR3 variants K650M and K650N to FGFR TKIs, indicating their sensitivity to specific therapies, which aligns with predictive evidence. Functional: The passage describes the alteration of phosphorylation status of the FGFR3 variants K650M and K650N in response to treatment, indicating a change in molecular function due to the variants.

      Gene→Variant (gene-first): 2261:K650M 2261:K650N

      Genes: 2261

      Variants: K650M K650N

    6. Hierarchical clustering analysis was conducted to evaluate the similarity of FGFR inhibitors and FGFR variants using drug sensitivity data of Fig. 4 (Supplementary Fig. 11). FGFR variants were classified into four cluste

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 13

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the sensitivity and resistance of FGFR variants, including N546K and N549D/K, to FGFR inhibitors, indicating a correlation with response to therapy. Oncogenic: The passage mentions that KRAS G12V is part of a cluster composed mainly of oncogenic variants, suggesting its role in tumor development or progression.

      Gene→Variant (gene-first): 3845:G12V 2260:N546K 2263:N549D/K

      Genes: 3845 2260 2263

      Variants: G12V N546K N549D/K

    7. To validate the results of the pooled assay, the respective variants to which drug sensitivity was different among TKIs were further analyzed. Interestingly, in the evaluation with the MANO method, different missense var

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Predictive

      Justification: Predictive: The passage discusses how different missense variants at specific amino acid positions in FGFR2 and FGFR3 correlate with varying drug sensitivities to FGFR inhibitors, indicating a relationship between the variants and treatment response.

      Gene→Variant (gene-first): 2263:K656 2263:K656E/M 2263:N549 2263:N549D/H

      Genes: 2263

      Variants: K656 K656E/M N549 N549D/H

    8. The drug sensitivity of transformed FGFR variants was also assessed through the MANO method. The mixture of 3T3 cells expressing different types of FGFR variants were treated with eight different targeted drugs, and drug

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 11

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the drug sensitivity of FGFR variants in response to various targeted therapies, indicating that certain variants are sensitive or resistant to specific inhibitors, which aligns with predictive evidence. Oncogenic: The context of transformed FGFR variants suggests that these somatic mutations contribute to tumor development or progression, particularly as they are assessed for their response to targeted therapies.

      Gene→Variant (gene-first): 2264:N535K 2260:N546K 2263:N549D/K 2263:V550L

      Genes: 2264 2260 2263

      Variants: N535K N546K N549D/K V550L

    9. The mRNA expression levels were similar among variants in previous studies using the MANO method. We evaluated the mRNA and protein expression of several FGFR3 variants using real-time PCR and western blotting. While a s

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 9

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the evaluation of mRNA and protein expression levels of the R248H variant, indicating that it alters protein expression compared to oncogenic variants, which relates to its molecular function. Oncogenic: The passage implies that the R248H variant is classified as a non-oncogenic variant, contrasting it with oncogenic variants, suggesting its role in tumor development or progression is not supported.

      Gene→Variant (gene-first): 1956:R248H

      Genes: 1956

      Variants: R248H

    10. Thus, we utilized the MANO method to compare the number of 3T3 cells expressing each FGFR variant between Day 3 and Day 18 in the assessment of the transforming potential (Fig. 2 and Supplementary Fig. 3). In parallel wi

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 7

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The passage discusses the transforming potential of various FGFR variants, indicating that certain mutations contribute to tumor development or progression, as evidenced by their significant transforming activities in assays.

      Gene→Variant (gene-first): 2261:G370C 2261:G380E/R 2261:K650E/M 2263:K659E 2263:N549H 2261:R248C 2261:S249C 6867:S342F 2261:S371C 2263:W290C 2261:Y373C

      Genes: 2261 2263 6867

      Variants: G370C G380E/R K650E/M K659E N549H R248C S249C S342F S371C W290C Y373C

    11. FGFRs are highly conserved transmembrane receptor tyrosine kinases, comprised of an extracellular domain with three Ig-like domains, followed by a transmembrane domain and a tyrosine kinase domain (Fig. 1a). Firstly, the

      [Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 3

      Evidence Type(s): Oncogenic

      Justification: Oncogenic: The V550L mutation in FGFR4 is mentioned in the context of rhabdomyosarcoma, suggesting its contribution to tumor development.

      Gene→Variant (gene-first): 2260:K656E 2260:N546K 2261:S249C 2263:S252W 2263:V550L

      Genes: 2260 2261 2263

      Variants: K656E N546K S249C S252W V550L

    1. IDH1 R132H and ATRX KO have similar levels of PARP inhibitor sensitivity.

      [Paragraph-level] PMCID: PMC8203843 Section: ABSTRACT PassageIndex: 4

      Evidence Type(s): Predictive

      Justification: Predictive: The passage indicates that IDH1 R132H is associated with sensitivity to PARP inhibitors, which correlates the variant with a specific therapy response.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    1. FLT3 mutations are the most frequently identified genetic alterations in acute myeloid leukemia (AML) and are associated with poor prognosis. Multiple FLT3 inhibitors are in various stages of clinical evaluation. However

      [Paragraph-level] PMCID: PMC8255005 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the resistance of FLT3 mutations, specifically F691L, to FLT3 inhibitors and highlights the efficacy of KX2-391 in overcoming this resistance, indicating a correlation with treatment response. Oncogenic: The FLT3 mutations, including D835 and F691, are described as contributing to tumor development and progression in acute myeloid leukemia (AML), which supports their classification as oncogenic variants.

      Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691 2322:F691L

      Genes: 2322

      Variants: D835 D835Y F691 F691L

    1. To get a deeper insight into the molecular characteristics of this group, we analyzed next-generation sequencing results from 17 cases. Seven cases were analyzed using the Heidelberg 130 gene panel, six cases were sequen

      [Paragraph-level] PMCID: PMC7785563 Section: RESULTS PassageIndex: 12

      Evidence Type(s): Diagnostic, Oncogenic

      Justification: Diagnostic: The passage indicates that 90% of the cases harbored IDH1-R132H mutations, which are associated with conventional supratentorial IDH-mutant astrocytomas, suggesting a role in defining or classifying the disease. Oncogenic: The presence of IDH1-R132H mutations in the tumors suggests that this somatic variant contributes to tumor development or progression, as it is commonly found in a specific type of cancer.

      Gene→Variant (gene-first): 3417:R132H

      Genes: 3417

      Variants: R132H

    1. In metastatic breast cancer, HER2 activating mutations frequently co-occur with mutations in the PIK3CA, TP53, or E-cadherin genes. Of these co-occurring mutations, HER2 and PIK3CA mutations are the most prevalent gene p

      [Paragraph-level] PMCID: PMC10527017 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses the resistance of HP breast cancers to the pan-HER tyrosine kinase inhibitor, neratinib, and the effectiveness of combining neratinib with trastuzumab deruxtecan and CDK4/6 inhibitors, indicating a correlation with treatment response. Oncogenic: The study involves genetically engineered mice with the HER2V777L mutation, showing accelerated tumor formation and increased invasion, which supports the notion that this somatic variant contributes to tumor development and progression.

      Gene→Variant (gene-first): 2064:V777L

      Genes: 2064

      Variants: V777L

    1. ALK-break positive non-small cell lung cancer (NSCLC) patients initially respond to crizotinib, but resistance occurs inevitably. In this study we aimed to identify fusion genes in crizotinib resistant tumor samples. Re-

      [Paragraph-level] PMCID: PMC4821611 Section: ABSTRACT PassageIndex: 1

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses ALK mutations (p.C1156Y and p.G1269A) in the context of crizotinib resistance, indicating a correlation between these variants and resistance to the therapy. Oncogenic: The ALK mutations are described as being detected in post-treatment tumor samples, suggesting their contribution to tumor development or progression in the context of crizotinib resistance.

      Gene→Variant (gene-first): 238:p.C1156Y 238:p.G1269A

      Genes: 238

      Variants: p.C1156Y p.G1269A

    2. Mutations in ALK, EGFR and KRAS have been reported to confer resistance against crizotinib. To determine presence of mutations in these genes in the three post-treatment samples, we inspected the RNA-seq bam files in IGV

      [Paragraph-level] PMCID: PMC4821611 Section: RESULTS PassageIndex: 10

      Evidence Type(s): Predictive, Oncogenic

      Justification: Predictive: The passage discusses mutations in the ALK gene, specifically p.C1156Y and p.G1269A, which have been reported to confer resistance against crizotinib, indicating a correlation with treatment response. Oncogenic: The presence of mutations in the ALK gene, such as p.C1156Y and p.G1269A, suggests that these somatic variants contribute to tumor development or progression, as they were identified in post-treatment tumor samples.

      Gene→Variant (gene-first): 238:c.3467G>A 238:c.3806G>C 238:p.C1156Y 238:p.G1269A

      Genes: 238

      Variants: c.3467G>A c.3806G>C p.C1156Y p.G1269A

    1. In TERT-NHUC, abolishing PLCgamma1 phosphorylation significantly reduced the increase in saturation density associated with S249C FGFR3 (13% vs. 24%, p=0.05) (Figure 6a), suggesting that PLCgamma1 signaling contributes t

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 23

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the S249C and K652E mutations affect cell viability and signaling pathways, indicating that these variants alter molecular or biochemical functions related to cell growth and density. Oncogenic: The evidence suggests that the S249C and K652E mutations contribute to tumor development or progression by affecting cell cycle phases and viability, which are indicative of cancer-driving behavior.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

      Genes: 2261

      Variants: K652E S249C Y762F

    2. To clarify whether the lack of constitutive PLCgamma1 phosphorylation may explain the different phenotypic behavior associated with the K652E mutation, we used a construct encoding a S249C FGFR3 protein with a mutated PL

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 22

      Evidence Type(s): Oncogenic, Functional

      Justification: Oncogenic: The passage discusses the S249C+Y762F FGFR3 mutant protein's ability to induce morphological transformation and increased proliferation in NIH-3T3 cells, indicating its role in tumor development or progression. Functional: The passage describes how the S249C+Y762F mutation affects the phosphorylation of PLCgamma1 and alters the activation of downstream signaling pathways, demonstrating a change in molecular function.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

      Genes: 2261

      Variants: K652E S249C Y762F

    3. As expected, FGF1 induced phosphorylation of FRS2alpha, ERK1/2 and PLCgamma1 in normal urothelial cells over-expressing wildtype FGFR3 (Figure 4b). Consistent with their complete ligand-independence, FGF1 treatment faile

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 20

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses how the K652E, S249C, and Y375C mutations alter the signaling response to FGF1 treatment, indicating that these variants affect molecular function related to phosphorylation and activation of signaling pathways. Oncogenic: The context of the mutations being discussed in relation to their effects on signaling pathways suggests that they may contribute to tumor development or progression, particularly given the focus on their responses in cancer-related cellular contexts.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C

    4. We next examined whether cells expressing wildtype and mutant FGFR3 were responsive to FGF1 stimulation in terms of receptor activation (Figure 4a, Supplementary Figure 5) and signaling (Figure 4b, Supplementary Figure 5

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 19

      Evidence Type(s): Predictive, Functional

      Justification: Predictive: The passage discusses the response of cells expressing mutant FGFR3 variants (S249C, Y375C, K652E) to FGF1 stimulation, indicating a correlation with receptor activation and signaling, which relates to treatment response. Functional: The passage describes how the variants S249C, Y375C, and K652E affect the phosphorylation of FGFR3, indicating that these mutations alter the molecular function of the receptor in response to ligand stimulation.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C

    5. Signaling was examined in cells at various degrees of confluence, in full and depleted medium (Figure 3c, Supplementary Figure 4b). In all conditions tested, no differences were observed between mutant and control cells

      [Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 16

      Evidence Type(s): Functional, Oncogenic

      Justification: Functional: The passage discusses the increased phosphorylation of PLCgamma1 specifically in cells expressing the S249C and Y375C FGFR3 variants, indicating that these variants alter molecular function. Oncogenic: The mention of increased phosphorylation of signaling proteins in cells expressing the FGFR3 mutants suggests that these variants contribute to tumor development or progression.

      Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

      Genes: 2261

      Variants: K652E S249C Y375C