13 Matching Annotations
- Last 7 days
-
archive.org archive.org
- Jan 2024
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
968f968–984AACGCGAAGAACCTTACNübel et al., 1996
968F
-
- Mar 2021
- Feb 2021
-
mmhaskell.com mmhaskell.com
Tags
Annotators
URL
-
- Dec 2020
-
www.bio-rad.com www.bio-rad.com
-
We recommend the following changes to the default settings when designing ddPCR assays:
Primer3 : designing primers and probes for ddPCR
In the General Settings window, change “Concentration of divalent cations” to 3.8, “Concentration of dNTPs” to 0.8, and “Mispriming/Repeat Library” to the correct organism ■In the Advanced Settings window, change both the “Table of thermodynamic parameters” and “Salt correction formula” to SantaLucia 1998 ■In the Internal Oligo window, we recommend setting 15 for the minimum number of bases for the oligo. We recommend 64°C as the minimum Tm for the probe, 65°C as the optimal Tm for the probe, and 70°C as the maximum Tm for the probe. These parameters can be relaxed to allow for smaller/larger oligos, which may be necessary for high GC or low GC targets. Oligo size should be no smaller than 13 and no larger than 30 nucleotides
Note: After you have made the desired changes in Primer3Plus, select Save Settings under General Settings and save these parameters in a file. To apply these settings in the future, upload them by selecting Browse in the General Settings tab, find this file, and click Activate Settings.
-
Strive for a Tm between 50 and 65°C. One way to calculate Tm values is by using the nearest-neighbor method. Use the Tm calculator at http://www.basic.northwestern.edu/biotools/oligocalc.html, with values of 50 mM for salt concentration and 300 nM for oligonucleotide concentration
-
-
news.rice.edu news.rice.edu
-
has developed novel bioinformatics software called OliVar, which allows researchers and assay developers to automate and design assays that target regions of the virus genome that have the lowest frequency of mutation
-
- Sep 2020
-
twitter.com twitter.comTwitter1
-
Natalie E. Dean en Twitter: “VACCINE EFFICACY 101: A biostatistician's primer. Ten tweets to cover:- How is vaccine efficacy calculated?- Distinguishing between infection, disease, & severe disease.- Measuring reduced infectiousness.- Vaccine efficacy vs. effectiveness!n” / Twitter. (n.d.). Twitter. Retrieved September 30, 2020, from https://twitter.com/nataliexdean/status/1310613702476017666
-
-
journals.plos.org journals.plos.org
-
Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
Tags
Annotators
URL
-
- Aug 2020
-
www.biorxiv.org www.biorxiv.org
-
Guo, L., Boocock, J., Tome, J. M., Chandrasekaran, S., Hilt, E. E., Zhang, Y., Sathe, L., Li, X., Luo, C., Kosuri, S., Shendure, J. A., Arboleda, V. A., Flint, J., Eskin, E., Garner, O. B., Yang, S., Bloom, J. S., Kruglyak, L., & Yin, Y. (2020). Rapid cost-effective viral genome sequencing by V-seq. BioRxiv, 2020.08.15.252510. https://doi.org/10.1101/2020.08.15.252510
-
-
www.bio-rad.com www.bio-rad.com
-
Designing Probes for a ddPCR Assay
-
- Nov 2018
-
www.zachwhalen.net www.zachwhalen.net
-
One instructor's use of Slack, comparing and contrasting other LMS (but he used Canvas); good basic breakdown of the conversational tools and samples of how hey can be used; This is a great primer of Slack's use in the classroom (5/5)
-