- Last 7 days
-
biotium.com biotium.com
-
1.8 uL diluted ROX per 20 uL
Note that 20 ul reaction is equivalent to 10 ul of the master mix..
-
- Sep 2024
-
www.nature.com www.nature.com
-
We found a distinctive wheel-shaped arrangement of the cells
Is this arrangement dependent on the 100 kb collapse or the UMAP dimensionality reduction algorithm used?
-
Studying gene–gene correlations on a local scale, we observed the expected high correlations between the expression profiles of genes residing in the same operon
How did you chose these few operons/ this chromosomal region for this analysis?
-
Principal component analysis (PCA) at the gene level
read up: why PCA pattern differs from UMAP?
-
Two-dimensional projection by uniform manifold approximation and projection (UMAP) of LB-grown E. coli
why UMAP vs other dimensionality reduction methods? - read methods?
-
-
bmcmicrobiol.biomedcentral.com bmcmicrobiol.biomedcentral.com
-
Degenerate consensual pairs of rpoB primers called Univ_rpoB_F_deg (forward primer) and Univ_rpoB_R_deg (reverse primer) were manually designed from clustalW alignments
How small was this alignment that you manually design primers?
-
we constructed a reference database including ~ 45000 sequences; this database is available from the FROGS website (http://frogs.toulouse.inra.fr/).
Does database have full rpoB or only 434 bp region?
-
-
royalsocietypublishing-org.ezproxy.rice.edu royalsocietypublishing-org.ezproxy.rice.edu
-
In many cases, such variations reflect differences in the essentiality of genes. Genes with higher connectivity are often more essential for the reproductive success of a cell or organism
This assumption will not hold true for auxiallary genes or genes not in the core genome but still contribute to essential functions conditional to certain circumstances? for example: antibiotic resistance genes?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
poses challenges for many classical methods, such as parametric statistical tests (for example, Student’s t-test and ANOVA) and measures of correlation, including Spearman’s rank correlation, often leading to completely unacceptable false discovery rates above 90%
-
We recommend that these methods replace OTU-based approaches for all applications, except when it is necessary to combine sequence data that were generated using different technologies (that is, Illumina sequencing and 454 pyrosequencing) or with different primer sets, when mapping to a common reference database of full-length sequences is often still needed
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
The number of k-mers in each hash bin is tabulated
across all input sequences I assume?
-
-
-
If rearrangement events and horizontal transfers are rare for the 16S rRNA gene, as is widely believed to be the case, then its true gene tree is likely to be a good approximation to the true phylogenetic tree based on vertically inherited traits, assuming that the latter tree can be meaningfully defined
Is this really true? If so, it must be true for every gene right?
-
If an environmental sequence is annotated as belonging to a taxon which is defined by traits, then this is a prediction which can always be checked in principle
taxonomy by phenotype~?
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
highly multiplexed ribosomal (r)RNA-FISH
Why chose rRNA vs other phylogenetic marker genes?
-
-
link.springer.com link.springer.com
-
The diversity of bacteria can also be accessed by using COI, rpoB, cpn60 (encodes for chaperonin protein), tuf (elongation factor), RIF (Replication initiation factor), and gnd (Gluconate-6-phosphate dehydrogenase) gene as barcode
-
-
www.sciencedirect.com www.sciencedirect.com
-
The origin of the rain is not clear. Rain often is attributed to delayed PCR onset [3] or partial PCR inhibition in individual droplets [4]. However, it could also be a consequence of damaged positive droplets with corresponding reduced fluorescence, or damaged negative droplets with increased background fluorescence, or a mixture of both [5].
Tags
Annotators
URL
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
we found that the clouds can become more compact and produce substantially less rain upon: (i) reducing the ramp rate to 1 °C/sec in every PCR step (Fig. 10a), (ii) increasing the annealing/extension time to 2 minutes (up from 1 minute; Fig. 10b), and (iii) increasing the number of cycles to 50 (Fig. 10c)28
-
-
rnajournal.cshlp.org rnajournal.cshlp.org
-
Trans-splicing ribozymes can, in principle, target every uridine residue of a substrate RNA, but the target sites need to be accessible.
Can RNA folding prediction tools be used to predict accessibility?
-
In this assay, the mRNA is incubated with trans-splicing ribozymes that carry a randomized internal guide sequence (IGS). This enables the ribozyme population to splice on every accessible site on the mRNA. The sites at which trans-splicing occurred were identified by RT-PCR, cloning, and sequencing
This might be a way to test for accessibility of the site for splicing from a secondary structure point of view?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
we performed RT-qPCR on the high-performing RENDR design, split site 15. We observed a 93-fold increase in the abundance of spliced mRNA in cells expressing both RENDR and RNA input compared to control cells lacking the RNA input
This split site 15 from Fig 2 was used in the RAM paper as well (RAM = Ribozyme addressable memory)
- 15 corresponds to: (IGS / 6 bp + P1_loop_01 / 9 bp)
-
RENDR variants sensing different RNA inputs from RFP
These are all based on splice site 15 from fig 2. This should have been explicitly mentioned :😞
-
best design delivers a 93-fold dynamic range of splicing with RENDR controlling fluorescent protein production in response to an RNA input
wasn't the dynamic range much higher (10^4 fold?!) when we checked with qPCR?
-
-
Local file Local file
-
P1_loop_03 TAGTTACCTTT
Why was this
T>G
mutation used here?
-
-
-
P1_loop_03 TAGTTACCTTT
Look for the reasoning for this T>G substitution
-
AAATAGCAATATTTACCTTTGGGTCA
WT P1 loop and IGS annotated here
-
-
www.sciencedirect.com www.sciencedirect.com
-
adjustments must be made in the IGS to allow the formation of a stable P10 helix
How can you adjust the IGS when there are two constrains on it from both P1 and P10?
-
- Aug 2024
-
oiss.rice.edu oiss.rice.edu
-
Here is the information you may need in order to complete page 2 of the Form I-983:
If your employer is Rice University, here's the E-verify info -
Employer's Name as Listed in E-Verify: Rice University Rice's E-Verify ID: 698729
-
-
www.biorxiv.org www.biorxiv.org
-
Quantification of native and barcoded 16S rRNA in E. coli expressing each cat-RNA using RT-qPCR.
explain what
normalized RNA copies
means
-
-
www.biorxiv.org www.biorxiv.org
-
We demonstrate here that bulk protein content partitions to wastewater solids. Using a combination of western blotting, ELISA, and mass spectrometry, we identify a robust repertoire of intact human antibodies, predominantly secreted IgA
Wastewater has a lot of junk that could bind to the sandwich ELISA non-specifically.
To validate this, I was wondering if there would be a good negative control antigen binder that you could look for - for example, some Ebola antibodies that you won't expect to be in this wastewater?
-
-
www.researchsquare.com www.researchsquare.com
-
used model strains Escherichia coli (E. coli) K12 MG1655 as donors and recipients along with the IncPα model conjugative plasmid RP4
Does this effect still matter if using an auxotrophic donor such as MFD-pir?
-
-
journals-asm-org.ezproxy.rice.edu journals-asm-org.ezproxy.rice.edu
-
However, it is unknown whether PFASs affect the HGT of bacterial antibiotic resistance.
This is a very poor rationale for why it should be studied. There are many things that are unknown, that does not mean they are worth knowing
-
-
rupdadmin.rice.edu rupdadmin.rice.edu
-
At all stop signs, cyclists must stop and yield the right-of-way to other vehicles and pedestrians already at the intersection. RUPD will ticket cyclists for right-of-way violations at intersections.
So if there is no other entities, the bikes don't need to stop? Could this be regarded as a
Yield
sign instead? -
Registration helps RUPD to identify owners of lost, stolen or impounded bicycles and to disseminate safety information
Have there been any examples or recovering stolen bicycles by RUPD yet?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Bacteria isolated from humans and livestock are much more likely to have duplicated antibiotic resistance genes
Is this controlled for other factors? Such as more bacteria being isolated from these environments than others?
-
-
academic.oup.com academic.oup.com
-
Recipient community cells were sorted from the same samples using the same conditions, including both colorless recipient and green fluorescent transconjugal cells
Would classifying the non-uptaking community as "recipients" rather than the initial starting community cause confusion?
-
Plasmid transfer was detected both in abundant and rare taxa of the initial recipient community
were there any OTUs that did not appear in the initial recipient community at detectable levels??
-
-
microbiomejournal.biomedcentral.com microbiomejournal.biomedcentral.com
-
Venn diagram of the number of genera identified in recipient and the corresponding transconjugant pool in the non-pharmaceutical control
The transconjugant pool has genera that don't overlap with the recipient pool. How do you explain this?
-
Conjugation events were visualized by a confocal laser scanning microscope
Why didn't you quantify from the flow cytometry runs?
-
-
www-pnas-org.ezproxy.rice.edu www-pnas-org.ezproxy.rice.edu
-
applied saliva from P- and NP-caterpillars to plant wounds and then assayed for a subset of the plant-defense genes including PIN2, TD2, and AspPI and the defense protein PPO
How did you chose this subset?
-
-
assets.thermofisher.com assets.thermofisher.com
-
Reverse primer (10 µM)
primers: 0.5 uM final (same as NEB lunascript)
-
-
www.thermofisher.com www.thermofisher.com
-
Useful discussion on the pros and cons!
-
-
www.sciencedirect.com www.sciencedirect.com
-
development of a flow cytometry optimized GFP variant, gfpmut3 (Cormack et al., 1996), which is still extensively used for monitoring the fate of plasmids in natural environments.
what about the variant causes it to be optimized for flow cyt?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
This corresponds to more sequences than sorted transconjugants for most samples (Supplementary Table 1), providing an adequate picture of the observed plasmid transfer range.
# of final reads / # of Tc sorted > 1
is that they mean -
gate for only particles of bacterial size
How do you determine where the "bacterial" sized particles should appear?
Set a gate for bacterial size on a bivariate SSC-A vs FSC-A plot for events of bacterial size by including the donor strain and excluding all events caused by a sterile pyrophosphate buffer control. Source: Klumper, 2018 Spring protocol handbook
-
- Jul 2024
-
scales.r-lib.org scales.r-lib.org
-
ll label_() functions return a "labelling" function, i.e. a function that takes a vector x and returns a character vector of length(x) giving a label for each input value.
This function when called seems to return an expression rather than a character vector.
Test using this and compare to
label_scientific
which works as intended ``` r scales::label_log(digits = 1)(c(1, 10, 100))> expression(10^0, 10^1, 10^2)
scales::label_scientific(digits = 1)(c(1, 10, 100))
> [1] "1e+00" "1e+01" "1e+02"
```
<sup>Created on 2024-07-31 with reprex v2.1.0</sup>
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
human cells could serve as an orthogonal system for studying PopZ condensation outside of the context of its Caulobacter binding clients
Wouldn't using a gamma-proteobacteria like E. coli be easier?
-
-
www.frontiersin.org www.frontiersin.org
-
to improve the accuracy of taxonomic assignment at the species level for full-length 16S rRNA sequences, we manually curated the three databases and removed the sequences that did not have a species name
So these sequences won't be classified anymore?
-
-
www.biorxiv.org www.biorxiv.org
-
for example, Vandeputte et al. (2017) measured total-community abundance using flow cytometry
how did you measure abundance properly without noise from particulates?
Tags
Annotators
URL
-
-
www.frontiersin.org www.frontiersin.org
-
However, the abundance of one species may not influence the abundance of another; the area may contain both tigers and ladybugs, and the migration of several ladybugs into the area would not be expected to affect the number of tigers. The assumption of true independence can not hold in high-throughput sequencing (HTS) experiments because the sequencing instruments can deliver reads only up to the capacity of the instrument.
good example, compositional data
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
Its -best_hit_overhang parameter, H, controls when an HSP is considered short enough to be filtered due to presence of another HSP
Does this parameter help return a single/best match when blasting against a custom database?
-
-
www.reneshbedre.com www.reneshbedre.com
-
echo "AATGTACTAT" | tr 'ATCGatcg' 'TAGCtagc' | rev
More thorough version is to account for all the IUPAC degenerate DNA codes like this
bash echo sequence | tr '[ATUGCYRSWKMBDHVNatugcyrswkmbdhvn]' '[TAACGRYSWMKVHDBNtaacgryswmkvhdbn]' |rev
-
-
cutadapt.readthedocs.io cutadapt.readthedocs.io
-
Assume your fragment of interest is mysequence and the adapter is ADAPTER. The reads may look like this:
5' adapter example
-g
-
-
www.uscis.gov www.uscis.gov
-
up to 90 days before your current OPT employment authorization expires, and within 60 days of the date your designated school official (DSO) enters the recommendation for OPT into your Student and Exchange Visitor Information System (SEVIS) record.
I guess it means dso enters the recommendation for
STEM OPT
into the SEVIS record?
-
-
www.windowscentral.com www.windowscentral.com
-
5GHz band
The latter adds speed but lacks range.
-
-
academic.oup.com academic.oup.com
-
dadasnake wrapper eases DADA2 use and deployment on computing clusters without the overhead of larger pipelines with DADA2 such as QIIME 2
[dadasnake vs Qiime2] on clusters
Where does this overhead come from?
-
-
linuxhandbook.com linuxhandbook.com
-
Despite its utility, man is not always the answer. Sometimes grepping the help prompt for a term is all one needs.
Good idea!
-
- Jun 2024
-
rclone.org rclone.org
-
"IAM & admin" -> "Service Accounts".
To navigate here:
Credentials
(left menu) ->Service Accounts
->Manage service accounts
-
- May 2024
-
linuxize.com linuxize.com
-
In Linux, port numbers below 1024 are reserved for well-known services and can only be bound to by root. Although you can use a port within a 1-1024 range for the SSH service to avoid issues with port allocation in the future, it is recommended to choose a port above 1024.
why recommended above 1024?
-
-
journals.asm.org journals.asm.org
-
translocation occurred from an IncF plasmid into a cryptic conjugative plasmid showing how cryptic conjugative plasmids are a significant concern because they can capture and disperse ARGs from the vast gene pool in the environments
Why only cryptic? Any conjugative plasmid can do the same?
-
-
www.medrxiv.org www.medrxiv.org
-
The sensitivity of the assay is estimated to be 90% as 10% of the influenza A H5 subtype sequences in GISAID and NCBI have single nucleotide polymorphisms in the primer and probe regions.
This change might cover that additional 10%? - AGTGGKTAYGCTGCRGAC (note the Y in the middle is bolded there) instead of having a C in that position
Source: Mike Nute/Treangan lab @Rice
Btw in that boems paper they report their assay as 90% sensitive. I’m fairly sure that the C in that position is what is causing that 10% loss, so they may have chosen not to make that a Y for some very good reason because all the other ambiguous bases are based on much lower frequency variants, so I would suspect they tried a Y there somehow.
-
-
www.bio-rad.com www.bio-rad.com
-
-
Do not exceed 5,000 copies of target/μl of the final ddPCR reaction mix
1e5 targets per 20 ul reaction well. Sounds a little high no for 20,000 droplets, I would estimate a total of 2,000 copies to keep the avg 0.1 copies per droplet?
-
Do not heat inactivate at greater than 65°C
heh, why? Older enzymes have 80C inactivation temps..
-
Many assays will perform well regardless of which NEBuffer is used or the amountof 1x digest reaction loaded into ddPCR
contradicts the above point about max 2 ul template / 22 ul rxn but ok..
-
Restriction Digestion
See notes in this section for restriction digestion tips
-
-
go-gale-com.ezproxy.rice.edu go-gale-com.ezproxy.rice.edu
-
we compared the sensitivity of qPCR, HRM and dPCR in detecting the allele A from two pools of bulk beet DNA composed of 90 biennial + 10 annual plants (B1) and 99 biennial + 1 annual plant (B2), respectively
Read about probe design - One probe per allele?
-
-
web.genewiz.com web.genewiz.com
-
Samples must be received by 3 pm ET Wednesday
Which means, samples should be submitted by 3 pm Tuesday to Genewiz dropbox. - Remember that it takes 30 mins to fill the Amplicon EZ form and 15 mins to do the qubit and dilutions too
There could be some delays in shipping, so it is best to have it picked up on Monday if timeline is urgent
-
low TE (<0.1 mM EDTA)
IDTE buffer from IDT should work
IDTE (10 mM Tris, 0.1 mM EDTA). Source: IDT
-
We recommend using a dsDNA quantification assay such as Qubit or PicoGreen. Note that the NanoDrop cannot distinguish between dsDNA and ssDNA (oligos and dNTPs) and may cause you to overestimate the amount of dsDNA in your samples.
Is
nanodrop
ok to use then after size selection with mag beads?
-
-
quarto.org quarto.org
-
HTML Options
This was not intuitive but these options go under this section shown below and this Posit community page was very helpful
format: html: ..
-
-
-
You can use inline R code (see Section 3.1) anywhere in an Rmd document, including the YAML metadata section. This means some YAML metadata can be dynamically generated with inline R code, such as the document title
Does this apply to
.qmd
documents?
-
-
microbiomejournal.biomedcentral.com microbiomejournal.biomedcentral.com
-
Absolute quantitation of microbiota abundance in environmental samples
-
use of synthetic DNA spikes enables absolute quantification of microbiome members directly in environmental samples [14].
-
-
www.bio-rad.com www.bio-rad.com
-
buffers with high salt
- Cutsmart has 50 mM KoAc, 10 mM MgoAc
- Buffer 2.1 has 50 mM NaCl, 10 mM MgCl2
- Buffer 3.1 has 100 mM NaCl, 10 mM MgCl2
-
Dilute the restriction enzyme using the recommendeddiluent buffer
-
DNA fragmentation by restriction digestion prior to dropletgeneration enables optimal accuracy by separating tandemgene copies, reducing sample viscosity, and improving templateaccessibility for input samples >66 ng per well
NEB says
Digestion is recommended whenever DNA input is greater than 75 ng Source
NEB says that biorad recommends these enzymes: AluI, CviQI, HaeIII, HindIII-HF, MseI
More guidelines
- Assemble ddPCR reactions at room temperature, this allows the restriction enzyme to digest the gDNA during the reaction set-up period
- Prepare reaction mixes as you would for a standard ddPCR reaction. Add 0.5–1 μL of each restriction enzyme (5–20 units, depending on enzyme concentration) to the reaction mixture
- After set-up, simply continue droplet generation as normal
- Restriction enzyme will be inactivated during first PCR denaturation step
-
-
-
Diluent Buffers (A, B or C) are recommended for making dilutions of restriction endonucleases. When necessary, we recommend diluting enzymes just prior to use and suggest that the final concentration of diluted enzymes be at least 1,000 units/ml
How is the diluent better than the reaction buffer?
-
-
-
Digestion is recommended whenever DNA input is greater than 75 ng
Might be good to do on a cell lysate since there is unknown amount of DNA before direct ddPCR
-
Refer to this protocol mentioned in the BioRad page, annotation
-
-
Local file Local file
-
The gun has been called the great equalizer, meaning that a small person witha gun is equal to a large person, but it is a great equalizer in another way,too. It insures that the people are the equal of their government wheneverthat government forgets that it is servant and not master of the governed
Is this questioning the monopoly of violence of the govt?
-
-
biosearchtech.a.bigcontent.io biosearchtech.a.bigcontent.io
-
The sample can be periodically mixed by pipetting/vortexing/shaking to ensure thesbeadex particles remain in suspension. This mixing may increase the efficiency ofthe binding/washing
I noticed that the suspension is still brown enough without mixing for 5 mins
-
-
www.qiagen.com www.qiagen.com
-
The composition of Buffer EB is: 10 mM Tris-Cl, pH 8.5
-
-
www.beckman.com www.beckman.com
-
Size optimized Low settling rates for automation applications
avoids the need for agitation during binding/elution steps
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
cell pellet suspended in 20 μl of Lyse and Go PCR Reagent (Thermo Scientific)
Does this kind of lysis bias the community to easy lysers? - I'm currently just heating 95C, 10 m for lysis and worry about the same. Will switch to not pelleting cells, adding a lysis buffer and proceeding into a mag bead based DNARNA extraction kit (Maxwell)
The more recent method used by Klumper paper, 2022 uses a proper extraction kit but also acquires more cells -
A minimum of 50,000 cells were acquired in all sorting runs.The sorted transconjugant and recipient cells were lysed and DNA extractions were performed using the DNeasy Powersoil Pro Kit. Source: Wang, Yue, et al. "Non-antibiotic pharmaceuticals promote conjugative plasmid transfer at a community-wide level." Microbiome 10.1 (2022): 124.
Thermo discontinued lyse n go. alternatives? - check Microlysis from gelcompany
-
centrifuged at 10 000 g for 30 min to collect the cell pellets
That's quite long..
-
-
Local file Local file
-
Keep sorted transconjugants in 30% glycerol at 4C
Why glycerol?
-
3 mL pyrophosphate buffer
Pyrophosphate buffer: 50 mM Na 4O 7 P2 , 0.05% Tween 80; adjust pH to 8.0. Sterilize by autoclaving.
-
- Apr 2024
-
royalsocietypublishing-org.ezproxy.rice.edu royalsocietypublishing-org.ezproxy.rice.edu
-
making our analyses available through a Shiny app and R package
Could be a good activity to cover in a statistics class!
-
-
biosearchtech.a.bigcontent.io biosearchtech.a.bigcontent.io
-
Mix thoroughly and incubate for 5 minutes with periodic shaking
How essential is this periodic shaking? OmegaBiotek's similar protocol doesn't have this
- Pipet up and down 5-10 times or vortex for 30 seconds.
- Let sit at room temperature for 5 minutes. source: Manual for Mag-Bind® TotalPure NGS
-
-
www.cnet.com www.cnet.com
-
Google Photos ended its unlimited free storage policy for photos and videos as of June 1
June 1, 2021
-
-
www.southwest.com www.southwest.com
-
Any Wanna Get Away or Wanna Get Away Plus funds will be forfeited
only
If you don’t cancel your reservation at least 10 minutes before the flight’s original scheduled departure time
-
No change fees. We never charge a fee to change your flight
for all southwest fares, including the cheapest
Wanna get away
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
replaced the Taq polymerase used for primary amplification of the unique molecular identifier (UMI) tagged templates with a proofreading polymerase (Supplementary Fig. 16). This increased the percentage of error-free reads nearly four-fold, which greatly improves our ability to resolve full-length 16S rRNA ASVs (FL-ASVs) from low abundant taxa because at least two identical sequences are required to resolve an FL-ASV
Phusion polymerase. Tested on
ZymoBIOMICS Microbial Community DNA Standard
-
1391r primer48 as it has better coverage of the known bacterial diversity
Figure out how much this is better by
-
Dueholm, M. S. et al. Generation of comprehensive ecosystem-specific reference databases with species-level resolution by high-throughput full-length 16S rRNA gene sequencing and automated taxonomy assignment (AutoTax). mBio 11, e01557–20 (2020).
why ecosystem specific databases vs general ones?
-
-
journals-asm-org.ezproxy.rice.edu journals-asm-org.ezproxy.rice.edu
-
ASVs are not ideal as references for linking microbial identity with the physiology and ecology of key community members
As opposed to a taxonomic assignment
-
-
www.canada.ca www.canada.ca
-
India
Indian citizens are required to have a visa to enter Canada.
-
-
www.graphpad.com www.graphpad.com
-
if your treatments are ordered, don't compare each mean with each other mean (multiple comparisons), instead do one test for trend to ask if the outcome is linearly related with treatment number
How do you do hypothesis testing for trends for an ordered categorical variable?
Could you convert
x
to numbers (1,2,3) and run a linear regression y ~ x? or even categorical ordered variables can be linearly regressed?
-
-
www.stat.columbia.edu www.stat.columbia.edu
-
e are typically not terribly concerned with Type 1 error because werarely believe that it is possible for the null hypothesis to be strictly true.
What is this assumption based on?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
NNK
Why
NNK
as opposed toNNN
?
-
-
support.lenovo.com support.lenovo.com
-
Supports up to 8GB maximum memory
only a single slot?
-
-
www.gopests.com www.gopests.com
-
flea tips
-
-
www.frontiersin.org www.frontiersin.org
-
new avenues for studying ARG transfer (Karimi et al., 2015; Li et al., 2018) (Figure 2C). Microfluidic chips equipped with delayed imaging, coupled with fluorescence technology, enable real-time observation of community changes and tracking of the transfer dynamics of ARGs
-
-
bpb-us-e1.wpmucdn.com bpb-us-e1.wpmucdn.com
-
Scott Banta “Engineering of Acidithiobacillus ferrooxidans forBioelectrocatalysis Applications”
Great talk! held my interest for quite long Isobutyric acid made instead of intended isobutanol,..
-
Akihiro Okamoto “Decoding Extracellular Electron Transfer: A NewGlimpse into In-VivoEnzyme Dynamics
Very interesting idea : sl 13 - Liposome enters cells and grabs some outer membrane stuff including cytochromes that can do EET - Electron source: by X-ray striking an internal TiO2 nanoparticle! -> EET -> generate ROS -> cure a tumour!?
-
Biki Kundu
part notes on the web version - https://naismet2024.rice.edu/program/
-
-
naismet2024.rice.edu naismet2024.rice.edu
-
10:20AM Biki Kundu
Excellent story. Worth emulating, Ask for a video recording!
-
-
cran.r-project.org cran.r-project.org
-
lmer(heartrate ~ depth + duration + (1|bird), data = penguins)
Use this stats.stackexchange thread to understand the notation of the hierarchial / mixed effect mode
-
- Mar 2024
-
linuxize.com linuxize.com
-
Use the lsb_release -a command to display the Ubuntu version.
-
-
quarto.org quarto.org
-
quarto publish gh-pages document.qmd
Explore
tokens
to minimize the number of ssh passphrase asked by this command!
Tags
Annotators
URL
-
-
quarto.org quarto.org
-
A bracketed sequence of inlines, as one would use to begin a link, will be treated as a Span with attributes if it is followed immediately by attributes: [This is *some text*]{.class key="val"}
Tags
Annotators
URL
-
-
moderndive.com moderndive.com
-
8.4.2 infer package workflow
Tags
Annotators
URL
-
-
statsandr.com statsandr.com
-
A nice and easy way to report results of an ANOVA in R is with the report() function from the {report} package:
Tags
Annotators
URL
-
-
quarto.org quarto.org
-
out-width Width of the plot in the output document, which can be different from its physical fig-width, i.e., plots can be scaled in the output document.
fig-width reference
Tags
Annotators
URL
-
-
quarto.org quarto.org
-
There are a number of ways to include dynamic variables within documents rendered by Quarto
Can this work within the
yaml
header as well? - Would be relevant to the question raised by this thread
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
I
I is ionosine? that matches to all nucleotides?
-
-
-
This preparation includes fragments from the RNA-dependent RNA polymerase and VP1 (ORF1-ORF2 junction) regions.
of which strain of Norovirus?
-
-
journals.asm.org journals.asm.org
-
(Cog1F and Cog1R for GI viruses; Cog2F and Cog2R for GII viruses) (27), and 200 nM each probe (Ring 1E, FAM-TGG ACA GGR GAY CGC-MGBNFQ, where FAM is 6-carboxyfluorescein and MGBNFQ is minor groove binder and nonfluorescent quencher
Ring 1E requires MGB for best performance since it has a low Tm otherwise
-
-
stackoverflow.com stackoverflow.com
-
git log -SFoo -- path_containing_change
Excellent command to search in git history of a specific file!
-
-
quarto.org quarto.org
-
Callouts are an excellent way to draw extra attention to certain concepts, or to more clearly indicate that certain content is supplemental or applicable to only some scenarios.
Tags
Annotators
URL
-
-
www.zotero.org www.zotero.org
-
This item type can also be adapted to fit many types of unusual items.
report
-
-
www.nature.com www.nature.com
-
When a desired DNA is present at low concentrations relative to nearly identical undesired DNAs, LNAs can block amplification of unwanted DNAs
I don’t understand what they mean by blocker? Doesn’t the stuff also get extended like primers or cleaved like probes?
-
-
journals.plos.org journals.plos.org
-
Ensuring that each amplicon is only copied by its “correct” SuperSelective primer
-
shorter foot lengths, though lowering the equilibrium abundance of foot hybrids, resulting in longer delays before the threshold cycle is achieved, lead to enhanced selectivity
Why don't you show selectivity directly with the difference in Cq for same concentration of target and non-target sequence?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Although single-color ddPCR assays have been already utilized to assess SNVs at low VAFs24, it is required to design two different allele-specific primers to detect one SNV (wild-type and mutation-specific assays)
The two different allele-specific primers are required to compete with each other?
-
SuperSelective primers, which enable the amplification of SNVs in the presence of an excess of the corresponding wild-type target
See Fig 1A in ref 13
Vargas, D. Y., Kramer, F. R., Tyagi, S. & Marras, S. A. E. Multiplex real-time PCR assays that measure the abundance of extremely rare mutations associated with cancer. PLoS ONE 11, e0156546 (2016).
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
Underlined letters represent LNA bases.
I don't see any underlined bases here 😠
-
-
www.mdpi.com www.mdpi.com
-
All reference sequences (ABCC9 and SNV wt assays) were located in copy-number-neutral regions. Sequence details are available upon request.
Why won't you just put them here?
-
-
www.bio-rad.com www.bio-rad.com
-
SNP PI3Kca_E545K
How many nucleotides is this?
-
An RMD assay comprises a single set of primers plus two competitive probes (each probe with a different fluorophore), one detecting the wild-type allele, and one detecting the variant allele.
RMD = Rare mutant detection
-
Drop Off (DOF) Determines absolute quantification of targets for assays designed to detect non-wild type sequences, such as indels and genome edits. The experiment type isdesigned to support an assay strategy where one probe counts all alleles andone “drop-off” probe sits on top of a predicted cut site.
Is this better/more robust than detecting each allele with a different probe? - ie) using direct quantification of individual variants?
-
Tm enhancers for probes are recommended for single nucleotide polymorphism (SNP) and rare mutation detection assays in order to keep the background fluorescence to a minimum. Shorter probes discriminate better between single base differences in the target amplicon(s)
Does higher T annealing mean lower background? Or is there something else that relate Tm enhancers to background fluor - Could be to improve discrimination between the WT and the SNP variant?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Relative expression level measured by RNA QASeq in four clinical FFPE tumor tissue samples and three normal placenta FFPE samples
LS : how are they able to detect 3 orders of magnitude difference? Won't the high abundance one hog most of the reads? - I guess the read depth should be 10 to 100x higher than the range you want to span?
-
10 ng Human PBMC gDNA from the same healthy donor was used per experiment, corresponding to 2,790 haploid copies
How was this determined?
-
-
www.lifewire.com www.lifewire.com
-
Windows 10 has a built-in calibration tool that you can use to fix various display issues associated with your monitor.
the one called "
calibrate display colour
" doesn't do this? -
experiment with different screen resolutions within Windows 10 Settings until you get to one that looks the way you want.
This is hard.. most other of the resolutions in the drop down list give you blank screen space at the sides or too large content. - There needs to be a customization of the resolution to arbitrary values while maintaining the aspect ratio. I assume something like this would be possible in a linux system through the commandline?
-
-
www.avforums.com www.avforums.com
-
You need to turn off overscan, either on the TV or in the graphics card settings.
Look for
overscan
in settings QuestionSharp Aquos 26D44 connected to my new computer via a VGA cable and it displays fine. However, now that I've tried it with a DVI to HDMI cable it cuts off the edges of the desktop
-
-
www.pcworld.com www.pcworld.com
-
With the file(s) selected, press Shift-Z
Linking to a file within multiple folders.
Sharing permissions are probably not carried over? check this
-
-
git-scm.com git-scm.com
-
or changes between two files on disk
I assume they have to be in the same repo?
-
- Feb 2024
-
modernstatisticswithr.com modernstatisticswithr.com
-
This approach exploits the equivalence between confidence intervals and hypothesis tests, detailed in Section 12.2.
-
we must add aes(y = ..density..)) to the call to geom_histogram, which rescales the histogram to have area 1 (just like a density function has). We can then add the density function using geom_function
See note for current version from stackoverflow
The dot-dot notation (..density..) was deprecated in ggplot2 3.4.0. Please use after_stat(density) instead for the
aes(y = )
Tags
Annotators
URL
-
-
-
The data on the 463 courses at UT Austin can be found in the evals data frame included in the moderndive package
-
-
www.sciencedirect.com www.sciencedirect.com
-
a digestion with Plasmid-Safe DNase (Lucigen, Madison, WI, USA) was performed to purify the extracted plasmid DNA
Digest unwanted contaminating linear double-stranded DNA, without harming circular double-stranded DNA such as plasmids and fosmids. LGC Biosearchtech
-
-
rstudio-conf-2022.github.io rstudio-conf-2022.github.io
-
Incremental reveal Not limited to just bullet points... Use `. . .` syntax to indicate a break at an arbitrary location . . . ```{r} head(mtcars) ```
quarto incremental reveal
-
-
www.thewindowsclub.com www.thewindowsclub.com
-
To start and end a video, you need to use ?start=<seconds> and ?end=<seconds> to define the starting and ending times. Something like this:https://www.youtube.com/embed/xxx6x67ws7?start=45&end=200
Youtube, url with start and end
-
-
www.neb.com www.neb.com
-
10,000 units
100,00 U/ 200 U/ul = 50 ul => 50 reactions using 200 units = 1 ul/20 ul rxn.
-
-
www.neb.com www.neb.com
-
Benefit from increased resistance to inhibitors and chemicals with our optimized buffer system
-
-
-
Any other educational assistance that is excludable from gross income (tax free),
Can this be considered a definition of tax free?
-
Your filing status is married filing separately.
Cannot claim credit
-
credits are based on the amount of adjusted qualified education expenses paid for the student in 2023 for academic periods beginning in 2023 or beginning in the first 3 months of 2024.
paid FOR the student?
Paid by whom if not the student themself?
-
Qualified education expenses paid on behalf of the student by someone other than the student (such as a relative) are treated as paid by the student.
Does Tuition paid for graduate students by the professor (from research grants) count as a third party?
-
-
www.taxesforexpats.com www.taxesforexpats.com
-
Scholarship - partially taxable. Amount spent on tuition and qualified education expenses (provide link) not taxable, the remainder is taxable ordinary income. Reported on 1098-T if from USA stipend is treated as a Scholarships
-
-
www.irs.gov www.irs.gov
-
You cannot claim a credit for education expenses paid with tax-free funds. You must reduce the amount of expenses paid with tax-free grants, scholarships and fellowships and other tax-free education help.
What are
tax-free funds
? Are fellowship / tuition for grad students paid by faculty grants counted as tax free?
-
-
-
a formal billing arrangement is an arrangement in which the institution: (1) bills only an employer or a governmental entity for education that the institution furnishes to a student
Applicable for graduate students
-
-
bios-538.github.io bios-538.github.io
-
Asking questions
add caveat on timing if you need urgent answer:
Please note that when posting a question on the discussion board, the TA's will not jump in until 24 hours after posting to give others a chance to answer and earn credit. If you need an immediate answer, put an
Urgent
tag on your question and one of us will email you the response in a few hours.
-
-
bios-538.github.io bios-538.github.io
-
Midterm
change to take home
-
-
-
git log --oneline --graph --decorate --all
show commits of git as a tree
To show the last 2 commits use this!
git log --oneline --graph --decorate --all HEAD~2..HEAD
-
git config --global alias.tree 'log --oneline --graph --decorate --all'
configuration to make a shortcut to show commits of git as a tree
-