1,114 Matching Annotations
  1. Dec 2022
    1. a flavour with the same Ubuntu engine under the hood, but with a lightweight desktop environment, and with lighter application programs. the ultra-light Lubuntu or the medium light Ubuntu MATE or Xubuntu.
  2. Nov 2022
    1. Primers to target the DXS gene24 (one copy per genome) and the ampicillin resistance gene on the plasmid were created using the Primer3Plus design tool
    1. With this simple realization, a number of groups have realized that HTS datasets are actually count-compositions

      have dramatically different statistical properties than do counts

    1. Identification of type IV conjugative systems that are systematically excluded from metagenomic bins
    1. the box plot of ANCOM-BC had the shortest width, suggesting that it not only successfully estimates the true sampling fractions and eliminates bias due to its variability, but it also has the smallest variance which is not the case with other methods.

      The microbial absolute abundances in the ecosystem are generated from the log-normal distribution

      Is the log-normal model used to simulate the data particularly favorable to the linear regression method of ANCOM-BC?

    1. According to an extensive simulation study1, among the available methods for DA analysis, only ANCOM performs well in controlling FDR while maintaining high power, as long as the sample size is not too small

      How small is too small?

    1. green fluorescent protein containing a degradation tag (GFPmut3_LAA)

      BLAST matches the GFPmut3 sequence in rGFP and fGFP to this - so the Voigt lab authors cloned this with the partial degron tag without the LAA amino acids for this paper :

      Yang, Lei, et al. "Permanent genetic memory with> 1-byte capacity." Nature methods 11.12 (2014): 1261-1266.

    1. Consequently, amplicons produced with these primers were removed leaving amplicons corresponding to eight variable regions (V1, V2, V3, V4, V5, V6, V7, and V8) for the MVRSION method.

      7 out of 14 primer pairs were discarded but they are still able to cover V1-V8 variable regions

    1. DMSO has been successfully used to improve the performance of RT-PCR [10] and SangerSequencing [11].

      reference 10 only talks about PCR and not RT-PCR. I'm interested in the effect of DMSO on RT.

      This paper shows that 6% DMSO is optimal for RT-PCR with recombinant Thermus thermophilus DNA pol (rTth): Sidhu, Maninder K., Mei-June Liao, and Abbas Rashidbaigi. "Dimethyl sulfoxide improves RNA amplification." Biotechniques 21.1 (1996): 44-47.

      Biotechniques, 1996

  3. www.plasmidsaurus.com www.plasmidsaurus.com
    1. This consensus .fastq file will be delivered with your standard sequencing results, whereas the .fastq file for the raw read data must be requested during order submission (as above) and will be delivered via a separate raw data link.

      Note: consensus .fastq file has only 1 read (which is the consensus read)

    1. As such we believe that it was important to test these methods on a wide range of different real-world datasets in order to gain an understanding of how they differed from one another

      But I see it very hard to generalize your conclusions from the real world dataset based analysis in this paper. So there are tradeoffs with either method of validation

    1. If every number between 0 and 1 had equal probability of being chosen, method 2 would be a valid hypothesis test—but not a good one.

      Interesting. How would it be a valid hypothesis test? I guess I'll have to see what's a hypothesis test?

    1. Detailed descriptions, assumptions, limitations and test cases of many popular statistical methods for ecological research can be found in the GUSTAME server (Buttigieg and Ramette, 2014), and in the review by Paliy and Shankar (2016).
    2. condensing the information into two- or three-dimensional spaces. A very good overview of techniques to achieve this was written by Paliy and Shankar (2016).
    3. The advantages of using SSU rRNA for community fingerprinting are many: (i) This gene is found in all cellular life forms. (ii) It is a highly conserved gene, serving to a large degree as a reliable molecular chronometer. (iii) It is seldom transferred horizontally. (iv) It possesses both conserved and variable regions, so that the conserved regions can be targeted by polymerase chain reaction (PCR) primers and the variable ones be used as identifying markers. A handful of other genes, such as the large subunit (LSU) rRNA share these properties, but the length of ~1,500 bp of the bacterial SSU rRNA made it amenable to early molecular techniques, and the impressive body of knowledge that has since accumulated on the basis of this gene makes a switch to other markers very impractical, except in certain sub-fields such as mycology, where ITS and LSU are widely used.

      very crisp summary

    1. QuantStudio™ 7 Flex Real-Time PCR System features a decoupled six-by-six-color filter set thatsupports the dyes shown in the following table.

      6-plex assay. Useful for troubleshooting droplet digital PCR assays too?

    Tags

    Annotators

    1. Actions=Editor

      causes error

      **-thinkpad:/usr/share/applications$ desktop-file-validate obsidian.desktop obsidian.desktop: error: action "Editor" is defined, but there is no matching "Desktop Action Editor" group

    2. Path/to/AppImage

      the root folder ~ is /home/*username* so you would write the path like this /home/prashant/Downloads/setup_files/Obsidian-1.0.0.AppImage

    3. chmod +x *.AppImage

      use chmod a+x *.AppImage to make executable file for all users

    1. Fundamentally, all real-time thermal cyclers are engineered to detect fluorescein (FAM) first and foremost, so dyes with longer wavelength emission may be detected less sensitively
    2. For those shorter than 25 bases, a standard (dual labeled) BHQ™ Probe may be perfectly satisfactory.

      Nova might be better to have for 1-step ddPCR applications where the BHQ quenchers are unstable due to reduction of the N=N azo bond by the DTT additive

  4. Oct 2022
    1. the majority of chimeras are believed to arise from incomplete extension. During subsequent cycles of PCR, a partially extended strand can bind to a template derived from a different but similar sequence. This then acts as a primer that is extended to form a chimeric sequence
    1. RP4 plasmid (also known as RK2, RP1, and the Birmingham plasmid) stands not only as a model of bacterial conjugation studied over the past 40 years, but also as one of the most conspicuous, broad-host range conjugative plasmids described in the literature. It mediates mating and plasmid transfer between a wide variety of Gram– donors/recipients (8) and is also capable of efficiently conjugating with Gram+, (9) yeast (10,11) and mammalian cells. (12)
    1. Rahul Gandhi’s comparison is great fodder for intellectual debate, but it is not good politics. When the country is in ‘wartime’, the adornments of peace do not sit very well. This comparison is a peacetime jewel. In a war zone, only the cannons, pistols and swords do well.

      very crisp summary

    1. To perform bacterial genome assembly, we suggest using the third-party de novo assembly tool Flye3. This analysis package represents a complete pipeline, taking raw nanopore reads as input, and producing polished contigs as output. We also recommend one round of polishing with Medaka4. These tools can be found on GitHub
    1. DNA fragmentation by restriction digestion prior to dropletgeneration enables optimal accuracy by separating tandemgene copies, reducing sample viscosity, and improving templateaccessibility for input samples >66 ng per well

      NEB says

      Digestion is recommended whenever DNA input is greater than 75 ng Source

    1. droplet digital PCR for simultaneous detection of plasmid and genomic DNA in sorted cells

      did they shear or digest their genomic DNA to improve ddPCR detection (as recommended by biorad protocol?)

    2. For each of these two subpopulations, 1000 cells were sorted

      find out how these 1,000 cells were lysed after sorting - could there be any loss during pelleting to concentrate the cells?

    1. Samples must be received by 3 pm ET Wednesday

      Which means, samples should be submitted by 3 pm Tuesday to Genewiz dropbox. - Remember that it takes 30 mins to fill the Amplicon EZ form and 15 mins to do the qubit and dilutions too

    1. pop.MFI computes and returns the median fluorescence intensity for each marker. They are typ-ically used as the arguments passed to gh_pop_get_stats method to perform the sample-wisepopulation stats calculations
    1. Additionally, make sure to use both forward and side scatter on log scale when measuring microparticles or microbiological samples like bacteria. These types of particles generate dim scatter signals that are close to the cytometer’s noise, so it’s often necessary to visualize signal on a log scale in order to separate the signal from scatter noise.
    1. By introducing rationally selected combinations of folding-enhancing mutations into GFP templates and screening for brightness and expression rate in human cells, we developed mGreenLantern, a fluorescent protein having up to sixfold greater brightness in cells than EGFP
  5. Sep 2022
    1. But Poisson statisticspredicts that there will be some empty droplets (1,642 empty droplets) and gives a preciserelationship between the average number of copies/droplet and the expected fraction ofempty droplets.

      @Esther?

  6. Aug 2022
    1. Note that for creating perfect PDF files for printing, it’s better to turn to a dedicated desktop publishing software such as Scribus, which can also import SVG files.

      why?

    1. 10-20 sec

      Depends on the amplicon length. For Cheetah Hotstart Qaq it is 1 min / kb reference:

    2. 3 uL diluted ROX per 20 uL reaction

      for undiluted ROX : 1.5ul/1ml master mix -- add this once per aliquot and label in as ROX added

      2.25 ul / 1.5 ml master mix

    1. Avoid the use of spectral schemes to represent sequential data because the spectral order of visible light carries no inherent magnitude message. Readers do not automatically perceive violet as greater than red even though the two colors occupy opposite ends of the color spectrum. Rainbow color schemes are therefore not appropriate if the data to be mapped or graphed represent a distribution of values ranging from low to high
  7. Jul 2022
    1. A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase.

      The engineered WarmStart Luna Reverse Transcriptase also possesses higher thermostability than many other RTs, allowing an optimal reaction temperature of 55°C. For difficult targets/templates, higher RT step temperatures of up to 60°C can be used without compromising Luna performance. Luna one step RT-qPCR kit E3005 manual

    1. Denature for 5 minutes at 65°C. Put promptly on ice.

      If denaturation of template RNA is desired

  8. Jun 2022
    1. across() is very useful within summarise() and mutate(), but it’s hard to use it with filter() because it is not clear how the results would be combined into one logical vector. So to fill the gap, we’re introducing two new functions if_all() and if_any().
    1. If you are fine making the jump to Rainin, I would recommend that above all. They make the best pipettes in general, and probably by far the best multichannels. Their single pipettes are probably only rivaled by Eppendorf.
    1. Donor and recipients cells were mixed 1:1 (vol/vol, 0.1 to 1 ml), pelleted (2,000g for 10 min), resuspended in 10–100 µl LB + 300 µM DAP, pipetted onto a LB + 300 µM DAP plate and incubated at 37 °C for 2 h

      conjugation with DAP

  9. May 2022
    1. This class serves the same purpose as the flowFrame class from the flowCore package: to storequantitative data on cell populations from a single FCS run. The primary difference is in the un-derlying representation of the data. While flowFrame objects store the underlying data matrix inthe exprs slot as an R object, cytoframe objects store the matrix (as well as the data from theother slots) in a C data structure that is accessed through an external pointer. This allows for greateroptimization of data operations including I/O, parsing, transformation, and gating.
    1. The original or engineered proteins used in the R6, R7, R7.3, R10 and R10.3 nanopores have not been disclosed by the company to date

      trade secret

    1. One such behavioral trait is seeing all non-human animals as commodities, believing they have been “put on this planet for us to consume”

      This could be extended even to plants

    1. Autofluorescence was not subtracted from these populations.

      why? Is it mathematically sound to combine the autofluorescence histograms and subtract the mode/median etc. from the rest of the populations?

    2. average (n ≥ 3) population geometric MEFL mean

      so arithmetic mean of 3 geometric mean values?

    1. We visualized population-level cellular fluorescence using frequency distributions and violin plots.

      How are replicates handled in these plots?

      Appendix S5 says

      All violins represent data combined from experiments on three separate days except for the max and DAPG sensor violins, where only one replicate was measured.

    1. For background information on how tiling amplicon sequencing works, please prefer to the original “PrimalSeq” protocol paper as tested on Zika Quick et al. Nature Protocols and a follow-up paper Grubaugh, Gangavaparu et al. Genome Biology that focuses on in-host variation and Illumina sequencing.
    1. Indira Gandhi’s image as someone who cared for the poor was seriously dented.

      How then did she manage to win again in 1980? This question always seems to puzzle me about our electorate during that time

    1. A "negative lookahead assertion" can be used to remove from consideration any apostrophes, before they are even tested for being punctuation characters. gsub("(?!')[[:punct:]]", "", str2, perl=TRUE)

      How does this work? From my knowledge, negative lookahead assertion is used in this format lookfor(?!x) Source: Regex cheat sheet

    1. Substitution of SuperScript IV for LunaScript RT SuperMix and reaction volume reduced to 10 uL.

      Why was this substituted? - Could be lower cost : Superscript (350$/25 rxn) vs Lunascript (250$/50 rxn)

    1. As you can see, the theme author has included a .Site.Params variable called commentsrepo

      figure out how to do this for themes that don't have it

    1. a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.

      Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?

    1. However, they were so fond of its diverse uses that they minimized the hazards it posed

      by 'minimized' you mean downplayed

    1. can be a file path to the package or a package object.

      This installs the branch that is currently checked out -- since that is what is in the directory that devtools::install() looks at.

      Stackoverflow comment

  10. Apr 2022
    1. putative ∼97 kbp crAssphage genome (accession code: JQ995537)

      This record was removed because the sequence was not directly determined by the submitter. GenBank: JQ995537.1

      Instead check this : MAG Genbank : BK010471

    1. Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).

      The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way

    1. GenExpDB is the world’s largest repository for E. coli gene expression data. This site is a widely used public resource for gene expression analysis.
    1. while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources

      ROX increases precision of technical replicates (which we don't do much of in our lab)

    2. ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges

      ROX helps normalize these variations

    1. ROX is normalising for the attributes of the qPCR mixture, such as volume differences, presence of bubble etc.

      passive reference ROX helps with these

    2. differences in reaction volumes due to pipetting errors can bias the results. Also, issues associated with the qPCR instrument, such as the optics, can also influence the fluorescent signal generated.

      passive reference ROX helps with these

    1. Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).

      This is an interesting argument as to what individual users can do to keep Firefox alive. But the biggest dent on anti-competitive behavior should come from well enforced proper anti-trust regulations the way Europe is doing it. How can browser users contribute to this?

  11. Mar 2022
    1. If I am applying for a J visa, my current DS-2019 is issued by the same institution as the institution listed on my previous visa.

      Same for F visa, mentioned in this page - https://www.ustraveldocs.com/cn/cn-niv-visarenew.asp

      Is this requirement specific to Chinese applicants?

    1. The MRV fee is valid and may be used to schedule an interview appointment in the country where it was purchased within one year of the date of payment
    1. For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.
    1. no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.

      Sounds like most probe qPCR reactions right? I assume this is in the raw data before baseline subtraction

    2. Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)

      Why sample id? Isn't target and sample type not enough?

    1. a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (

      KanR here is a aminoglycoside nucleotidyltransferase (aadD1), uniprot = P05057 from Staph aureus. This is different from the usual phosphotransferase aphA1/3 used in e.coli

  12. Feb 2022
    1. When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases

      Does this mean that probe-based data without plateau phase cannot be analyzed effectively?

    2. For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample

      For clinical samples where each sample is expected to have a different inhibitor load hence different efficiency

    1. One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package

      The $AsXML exported .rdml file is not valid in RDML-ninja.

      Error message : No rdml_data.xml in compressed RDML file found.

      How to fix this?

  13. Jan 2022
    1. The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.

      using qpcR package for analysis

    1. Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.

      Using qpcR package for qPCR data analysis..

    1. Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1

      I wonder why this fit information was not used for quantification as well?

    1. The ability of a community to receive genes located on mobilizable non-self-transmissible plasmids, on the other hand, would rely on the community’s own content of conjugal plasmids

      Are we assuming here that the secondary conjugation events within the community are more significant than the primary donor with the conjugation helper plasmid?

    1. the sigmoidal response curve is symmetric on the logarithm of x

      will not fit when 0 is included in the data, right?

    1. Try with an actual exponential. You’ll probably want a self-starting function to avoid the “singular gradient” error — read more in my post on the subject.
    1. To ensure unambiguous selection of data points within the window-of-linearity, an iterative algorithm is formulated to search for lines consisting of at least 4 and no more than six data points with the highest R2 value and a slope close to the maximum slope

      Isn't this too small a subset of data? Or is the exponential phase usually <= 6 points?

    1. To cancel out the random variation in individual PCR efficiencies, web-based LinRegPCR, determines for each reaction the centre of the exponential phase from the baseline-corrected fluorescence values and, using the mean PCR efficiency of the assay, constructs an ideal amplification curve which is then used to call the Cq value for the reaction

      Wouldn't this lead to too much dependency on just one data point of the assay - the midpoint of the log-phase?

    1. RT-qPCR targeting SARS-CoV-2 is sensitive to inhibitors that are present in wastewater, leading to false-negative results

      How sensitive is LAMP to contaminants considering the a lot more intricate primer binding reactions are involved. Could there be mispriming and false positives due to contaminants?

  14. Dec 2021
    1. the rapid approach uses a transposase enzyme to simultaneously cleave DNA and attach barcode/adapter sequences

      How efficient is the transposase with supercoiled plasmid DNA compared to long linear genomic DNA fragments it was originally designed for?

    1. The basic idea is that abundant sequences are more likely to generate erroneous sequences than rare sequences

      hmm?

    1. an accumulation of single base pair errors will clearly lead to removal of more reads prior to downstream analyses when using an ESV-based approach versus an OTU-based approach.

      I would say the removal of reads caused by errors is better than somehow squeezing them into OTU clusters and risking spurious OTUs (singletons or otherwise). Thoughts?

    2. If your data is high quality, you want improved taxonomic resolution, and you are not concerned about the intra-genomic heterogeneity in the targeted marker genes, an ESV-based approach could be advantageous. Otherwise, a more standard OTU-based approach might be your best bet.
    1. Tm enhancers for probes are recommended for single nucleotide polymorphism (SNP) and rare mutation detection assays in order to keep the background fluorescence to a minimum. Shorter probes discriminate better between single base differences in the target amplicon(s)

      Does higher T annealing mean lower background? Or is there something else that relate Tm enhancers to background fluor

    1. runcate reads after truncLen bases.Reads shorter than this are discarded.

      Is this from 5' end or 3' end?

      How to prevent shorter reads from being discarded?

  15. Nov 2021
    1. You can also overwrite records in a while loop to avoid excessive memory allocation.

      Does for record in reader not overwrite record the same as the while loop?

    1. , independent inference by sample is trivially parallelizable and enables total computation time to scale linearly and memory requirements to remain flat with increasing sample number, allowing ASVs to be inferred from arbitrarily large data sets.

      It is observed that parallel processing of individual samples (unpooled) underestimates rare taxa (discarding them among sequencing noise) Reference: Fierer lab

    1. Side scatter measurement provides information about the internal complexity (i.e. granularity) of a cell. The interface between the laser and intracellular structures causes the light to refract or reflect. Cellular components that increase side scatter include granules and the nucleus (1). 
    2. FSC intensity is proportional to the diameter of the cell, and is primarily due to light diffraction around the cell.
    1. Chimeric reads occur when one sequencing read aligns to two distinct portions of the genome with little or no overlap. Chimeric reads are indicative of structural variation. Chimeric reads are also called split reads.
    1. The mergePairs(..., justConcatenate=TRUE) option allows the paired reads to be joined without any overlap, but with 10Ns inserted in between the forward and reverse reads. The chimera removal and assignTaxonomy functions will handle such merged reads

      In case of non-overlapping paired ends

    1. or replicates, no statistics should be shown, because they give only an indication of the fidelity with which the replicates were created: they might indicate how good the pipetting was, but they have no bearing on the hypothesis being tested6.

      technical replicates

    1. For a fully functional device you additionally require four magnets with a diameter of 3 mm and a height of 2 mm.

      magnets here -https://www.apexmagnets.com/magnets/3mm-x-2mm-disc-neodymium-magnet

      Where are the magnets going in?

    1. we designed the medium to contain a minimal amount of undefined ingredients that are typically used to cover unknown nutrient requirements

      yeast extract

    1. A self-transmissible RK2 helper plasmid facilitated the spread of mobilizable CRISPR/Cas

      Why have two plasmids instead of having just one self transmissible one?

    1. direct labelling”, in which the plot region itself contains the labels for groups of points instead of using a legend. This usually makes the plot easier to read because it puts the labels closer to the data.
  16. Oct 2021
    1. SNAP-Capture Magnetic Beads are used to selectively immobilize and magnetically separate a SNAP-tag fusion protein from solution using magnetic agarose beads
    1. transmembrane β-strands are highly conserved and that the surface-exposed regions display the highest variability, not only in sequence but also in length.

      Promise for Broad host membrane surface display?

    1. we establish Saturated Programmable Insertion Engineering (SPINE), an unbiased, comprehensive, and targeted domain insertion library generation technique using oligo library synthesis and multi-step Golden Gate cloning
    1. So, here is how I manage it, if the line height cannot be reduced sufficiently by the numeric entry/spinbox: Try clicking the question-mark (un-set variable inline height).If that does not resolve the issue, activate the Tt button ("outer" text style) and set the font height to something small and linespacing to something small and click the questionmark.Then de-activate Tt (outer) and edit the text normally.i.e. The outer style overrides the inner style.
    1. high-throughput 16S rRNA analysis were used to track changes in the bacterial community with Rpf addition, which could reveal the key functional populations contributing to the enhanced phenol degradation under high salinity conditions

      Why would the 16s DNA content change with the resuscitation?

      Do viable, non culturable organisms have lower 16s gene abundance or are harder to lyse and extract from?

    1. Kraken (https://ccb.jhu.edu/software/kraken2/) is one of the most frequently used tools to classify microbial community taxonomic information

      Really? I thought it is relatively new to the taxonomic field

    1. openCyto package is designed to facilitate the application of automated gating methods in a sequential way to mimic the construction of a manual gating scheme.
    1. We sought to reduce the time needed for allele enrichment by putting a selective pressure against the WT allele at the nucleotide level using CRISPR-Cas9 nuclease.

      Using this will make HiSCRIBE the same as SCRIBE?

    1. There are several widely used tool collections, e.g., QIIME 2 [13], mothur [14], usearch [15], and vsearch [16], and 1-stop pipelines, e.g., LotuS [17], with new approaches continually being developed, e.g., OCToPUS [18] and PEMA [19]
    1. Exercising caution when interpreting oligotyping results is warranted, because the 16S rRNA gene, even at full length, can miss important genetic variation underlying ecological and evolutionary differentiation between species

      On the other hand, an individual bacterial cell can house multiple copies of 16s gene that differ slightly to each other.

  17. Sep 2021
    1. print_median(@benchmark linear_access(data, 4096))

      The linear access is taking 435 times longer than random access?

      This is in contradiction from the explanation above. Is this a mistake in the order the results are presented?

  18. Aug 2021
    1. scale_x_discrete(guide = guide_axis(n.dodge = 2))

      With guide_axis(), we can add dodge to our axis label texts to avoid overlapping texts. In the code below, we have used guide_axis() function with n.dodge=2 inside scale_x_discrete() to dodge overlapping text on x-axis.

    1. Considering that DNA molecules consist of double strands of phosphate-deoxyribose backbone and bases that contain a large number of phosphate groups, we next tested if the DNA in the used columns could be effectively removed using a phosphoric acid solution

      phosphate will compete with DNA for binding the column?

    1. High pH favors the breakage of the hydrogen bonds

      probably by de-protonating the OH groups involved in the hydrogen bonding?

    1. The ability of RSF1010 to transfer at high frequencies is remarkable considering its dependency on the availability of compatible conjugation machinery in trans. These data indicate a high prevalence of naturally occurring conjugative elements in sand filter communities

      Or more likely is the possibility that the first transfer is much more abundant than subsequent secondary transfers in the 24 hour duration of this experiment

    2. extracted

      enriched?