[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation is associated with reduced sensitivity to erlotinib treatment in the NCI-H1975 cell line, indicating a correlation with resistance to this therapy. Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with reduced sensitivity to erlotinib treatment in the NCI-H1975 cell line, indicating a correlation with resistance to this therapy.

Gene→Variant (gene-first): 1956:L858R 1956:T790M

Genes: 1956

Variants: L858R T790M

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: H1047R | Summary: The PIK3CA H1047R mutation is described as an activating mutation that contributes to tumor development and progression, particularly in high-grade astrocytoma (WHO IV). Evidence Type: Functional | Mutation: H1047R | Summary: The H1047R mutation affects the catalytic domain of PIK3CA, indicating an alteration in molecular or biochemical function related to the PI3K pathway.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is identified as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development. Evidence Type: Functional | Mutation: K27M | Summary: The K27M mutation alters the molecular function of histone proteins, specifically in the context of histone 3 variants, impacting chromatin regulation and contributing to tumorigenesis.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823825 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M mutation is associated with tumorigenesis in Diffuse Intrinsic Pontine Gliomas (DIPGs) and is involved in the development and progression of these tumors.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Summary: Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3 V855A somatic mutation is implicated in the development and progression of non-small cell lung cancer (NSCLC) and enhances ligand-induced transformation in cell lines, indicating its role in tumor development. Evidence Type: Predictive | Mutation: V855A | Summary: The presence of the HER3 V855A mutation suggests potential sensitivity to HER-targeted inhibitors, indicating its relevance in predicting response to targeted therapies in NSCLC. Evidence Type: Functional | Mutation: V855A | Summary: In silico modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the activity of HER3, indicating a change in molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation may correlate with a malignant phenotype, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular structure of the wild-type HER3 protein, specifically affecting the kinase domain and the carboxyl-terminal end.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The variant V855A is associated with alterations in the molecular or biochemical function of the HER3 protein.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The HER3-V855A mutation may predict response to targeted therapy, as indicated by the differential effects of inhibitors on HER-related signaling activity and survival in the presence of this mutation.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Functional

Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The V855A mutation in HER3 is associated with differential response to HER inhibitors, indicating its predictive value for therapy effectiveness. Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the colony formation ability of HER3 co-transfectants, demonstrating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V855A | Summary: The HER3-V855A variant is investigated for its therapeutic targeting potential, showing varying sensitivity to inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant is associated with altered growth inhibition in Ba/F3 cells, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular interaction between HER3 and HER2, enhancing their physical interaction, particularly in the presence of NRG1beta. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development by increasing the activity of HER3 through enhanced interaction with HER2, suggesting a role in cancer progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to HER signaling. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development by enhancing HER2 trans-phosphorylation, which is a key event in cancer signaling pathways.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation alters the molecular function of HER3, as it affects the phosphorylation levels of HER3 and its downstream targets in response to NRG1beta treatment. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation contributes to tumor development or progression, as it is associated with transforming activity that requires a competent HER2 receptor.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the molecular function of Ba/F3 cells, affecting their growth response and colony formation in the presence of TGFalpha. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is implicated in tumor development as it demonstrates a robust growth response in a cellular model, indicating its potential role in oncogenic processes.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A variant alters the colony formation ability, resulting in significantly larger colony sizes compared to wild-type HER3, indicating a change in molecular function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A variant contributes to tumor development or progression as evidenced by its enhanced colony formation capabilities in the presence of NRG1beta treatment.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation alters the growth response of Ba/F3 cells in the presence of NRG1beta, indicating a change in molecular function related to HER3 activation. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation contributes to tumor development by promoting IL-3-independent growth in the presence of specific ligands, suggesting its role in oncogenic processes.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The HER3-V855A mutation was studied in a Ba/F3 model system to determine its functional impact, indicating that it alters molecular or biochemical function. Evidence Type: Oncogenic | Mutation: V855A | Summary: The HER3-V855A mutation is described as a contributor to oncogenic transformation and tumorigenesis, particularly in combination with HER2, suggesting its role in tumor development.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation is suggested to have a functional effect due to its position in a conserved sequence motif that may affect protein kinase activity. Evidence Type: Functional | Mutation: L858 | Summary: The L858 mutation is part of a conserved sequence motif that stabilizes the inactive position of the alphaC helix, indicating potential functional relevance. Evidence Type: Oncogenic | Mutation: L597V | Summary: The L597V mutation is classified as an intermediate kinase active variant that significantly increases BRAF activity, contributing to tumor development. Evidence Type: Functional | Mutation: L597V | Summary: The L597V mutation is associated with increased ERK activation, indicating a functional alteration in molecular activity.

Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

Genes: 673 1956 324

Variants: L597V L858 L858R V855 V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with increased sensitivity to EGFR TKIs, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R missense mutation is classified as an activating mutation that contributes to tumor development in the context of EGFR-related cancers.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: L858R | Summary: The L858R mutation is mentioned in the context of its homology with the HER3-V855A mutation, suggesting a potential alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: V855A | Summary: The V855A mutation is mentioned in the context of its homology with the EGFR-L858R mutation, indicating a potential alteration in molecular or biochemical function.

Gene→Variant (gene-first): 1956:L858R 324:V855A

Genes: 1956 324

Variants: L858R V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: T-to-C | Summary: The T-to-C mutation in the HER3 gene is identified as a somatic variant that contributes to tumor development, as it was detected in the tumor sample but not in the patient's peripheral blood DNA. Evidence Type: Oncogenic | Mutation: V855A | Summary: The V855A mutation in the HER3 gene is a somatic variant that plays a role in tumor progression, as indicated by its presence in the tumor sample. Evidence Type: Functional | Mutation: p. Val855Ala | Summary: The p. Val855Ala mutation alters the molecular function of the HER3 protein, as it involves a substitution of valine to alanine at codon 855, which is part of the activation loop.

Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

Genes: 2065 324

Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.2466T>A; p.N822K | Summary: The mutation p.N822K (c.2466T>A) is associated with tumor development in a case of jejunal cancer, indicating its potential role in oncogenesis.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.1504_1509 dup GCCTAT | Summary: The mutation c.1504_1509 dup GCCTAT is associated with tumor development in cases of small intestine tumors, indicating its role in oncogenesis. Evidence Type: Functional | Mutation: Ala-Tyr | Summary: The duplication of Ala-Tyr at codons 502-503 suggests an alteration in molecular function due to the mutation. Evidence Type: Oncogenic | Mutation: c.1509_1510insACCTAT | Summary: The insertion mutation c.1509_1510insACCTAT is noted in a case of duodenal GIST, contributing to tumor progression. Evidence Type: Functional | Mutation: p.Y503_F504insTY | Summary: The insertion of p.Y503_F504insTY indicates a change in the molecular or biochemical function associated with the mutation.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.K558delinsBP | Summary: The mutation p.K558delinsBP (c.1673_1674insTCC) indicates an alteration in molecular or biochemical function due to the insertion of nucleotides.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558del; c.1654_1674delATGTATGAAGTACAGTGGAAG | Summary: The in-frame deletion in exon 11 is associated with tumor development in a GIST, indicating its role in oncogenesis. Evidence Type: Oncogenic | Mutation: p.K642R; c.1925A>G | Summary: The novel substitution mutation in exon 13 is implicated in tumor progression in a GIST, supporting its oncogenic potential.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.1666C>G | Summary: The mutation c.1666C>G, resulting in the p.Q556E protein change, is identified as a novel mutation in a classic hot-spot region, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: c.1666_1668dupCAG | Summary: The mutation c.1666_1668dupCAG, leading to the p.Q556dup protein change, is noted as a novel mutation associated with double mutations, indicating its potential role in tumor progression. Evidence Type: Oncogenic | Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation c.1672_1677delAAGGTTinsAGT, resulting in the p.K558_V559delinsS protein change, is described as a partner mutation in double mutations, suggesting its involvement in oncogenic processes.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558 del | Summary: The K558 del mutation is part of a common in-frame deletion associated with tumor development. Evidence Type: Oncogenic | Mutation: V555del | Summary: The V555del mutation is identified as a somatic variant contributing to tumor progression. Evidence Type: Oncogenic | Mutation: c.1669_1674delTGGAAG | Summary: The c.1669_1674delTGGAAG mutation is a common in-frame deletion that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: c.1676T>A | Summary: The c.1676T>A mutation is associated with oncogenic activity as a somatic variant. Evidence Type: Oncogenic | Mutation: c.1679T>A | Summary: The c.1679T>A mutation is recognized as a somatic variant that contributes to tumor progression. Evidence Type: Oncogenic | Mutation: p.V559D | Summary: The p.V559D mutation is identified as a somatic variant that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: p.V560D | Summary: The p.V560D mutation is associated with oncogenic behavior as a somatic variant.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Functional

Summary: Evidence Type: Prognostic | Mutation: rs3786362 | Summary: The G allele of the rs3786362 variant in the TYMS gene is significantly associated with progression-free survival (PFS) and overall survival (OS), indicating its potential role as a prognostic marker in cancer outcomes. Evidence Type: Functional | Mutation: rs3786362 | Summary: The rs3786362 variant is associated with altered expression levels of the TYMS gene, suggesting a functional impact on molecular or biochemical activity in colorectal cancer (CRC) tissues compared to normal tissues.

Gene→Variant (gene-first): 7298:rs3786362

Genes: 7298

Variants: rs3786362

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation in metastatic colorectal cancer is associated with treatment response to vemurafenib and erlotinib, indicating its predictive value for therapy efficacy. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in tumor development and progression in metastatic colorectal cancer, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: V600E | Summary: The BRAF V600E mutation is associated with the development of combination therapies involving oral BRAF inhibitors and EGFR-targeting antibodies, indicating its potential role in predicting response to these therapies. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is implicated in the progression of metastatic colorectal cancer, suggesting its role as an oncogenic driver in tumor development.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.K656E | Summary: The p.K656E mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development. Evidence Type: Oncogenic | Mutation: p.V561M | Summary: The p.V561M mutation in FGFR1 is identified as an activating somatic mutation that contributes to tumor development.

Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

Genes: 2260

Variants: c.1681G>A c.1966A>G p.K656E p.V561M

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The IDH1 p.R132H mutation is associated with tumor development or progression in gliomas, although this specific tumor was noted to be IDH1 negative.

Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

Genes: 3417 673

Variants: p.R132H p.V600E

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic

Summary: Evidence Type: Prognostic | Mutation: G12C | Summary: The KRAS exon 2 G12C variant correlates with inferior overall survival (OS) compared to non-mutated tumors, indicating a negative prognostic effect. Evidence Type: Prognostic | Mutation: G13D | Summary: The KRAS exon 2 G13D variant shows a trend towards inferior overall survival (OS) compared to non-mutated tumors, suggesting a potential negative prognostic effect. Evidence Type: Prognostic | Mutation: G12V | Summary: The KRAS exon 2 G12V mutation variant had a negative prognostic effect on progression-free survival (PFS) in the multivariate analysis.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

Evidence Type(s): Prognostic

Summary: Evidence Type: Prognostic | Mutation: G13D | Summary: The G13D mutation is associated with a median progression-free survival (PFS) of 8.8 months, indicating its correlation with disease outcome. Evidence Type: Prognostic | Mutation: G12D | Summary: The G12D variant shows a median PFS of 10.5 months and a median overall survival (OS) of 25.2 months, suggesting its impact on disease outcome. Evidence Type: Prognostic | Mutation: G12C | Summary: The G12C mutation is linked to a median overall survival (OS) of 16.8 months, indicating its association with disease outcome.

Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

Genes: 3845

Variants: A146T G12C G12D G13D Q61H

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Summary: Evidence Type: Diagnostic | Mutation: V600E | Summary: The presence of the BRAF V600E mutation is used to classify and confirm the subtype of tumors in which it is found, indicating its diagnostic relevance. Evidence Type: Oncogenic | Mutation: V600E | Summary: The BRAF V600E mutation is known to contribute to tumor development and progression, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: p.L755P | Summary: The p.L755P mutation in HER2 is associated with a response to osimertinib in a patient with NSCLC, suggesting its potential as a predictive biomarker for targeted treatment. Evidence Type: Oncogenic | Mutation: p.L755P | Summary: The p.L755P mutation contributes to tumor development or progression in the context of NSCLC, indicating its oncogenic potential.

Gene→Variant (gene-first): 2064:p.L755P

Genes: 2064

Variants: p.L755P

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.2262_2264delinsTCC | Summary: The ERBB2 exon 19 mutation is associated with tumor development or progression in the context of stage IV NSCLC. Evidence Type: Predictive | Mutation: c.2262_2264delinsTCC | Summary: The mutation correlates with the patient's response to osimertinib treatment, indicating its predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: p.(L755P) | Summary: The p.(L755P) mutation in ERBB2 is implicated in contributing to tumor development or progression in NSCLC. Evidence Type: Predictive | Mutation: p.(L755P) | Summary: This mutation is associated with the patient's response to osimertinib, suggesting its predictive role in therapy sensitivity.

Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

Genes: 2064

Variants: c.2262_2264delinsTCC p.(L755P)

[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.K57N | Summary: The MAP2K1 mutation p.K57N is associated with the development of arteriovenous malformation (AVM) through its presence in endothelial cells, indicating its role in tumor progression. Evidence Type: Functional | Mutation: p.K57N | Summary: The p.K57N variant in MAP2K1 alters the molecular function related to endothelial cell behavior, contributing to the pathophysiology of AVM.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Oncogenic, Predisposing

Summary: Evidence Type: Oncogenic | Mutation: c.2514+1G>C | Summary: The somatic mutation c.2514+1G>C in PALB2 is associated with tumor development or progression, contributing to the patient's pancreatic cancer. Evidence Type: Predisposing | Mutation: c.3114-1G>A | Summary: The germline mutation c.3114-1G>A in PALB2 is associated with an inherited risk for disease, indicating a predisposition to cancer in this patient.

Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

Genes: 79728

Variants: c.2514+1G>C c.3114-1G>A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: G142V | Summary: The G142V mutation demonstrates constitutive transactivational activity, indicating that it alters molecular function related to regulatory element binding. Evidence Type: Functional | Mutation: G524D | Summary: The G524D mutation exhibits constitutive transactivational activity, suggesting it modifies molecular function in the context of regulatory element binding. Evidence Type: Functional | Mutation: M523V | Summary: The M523V mutation shows constitutive transactivational activity, indicating an alteration in molecular function associated with regulatory element binding. Evidence Type: Functional | Mutation: M537V | Summary: The M537V mutation displays constitutive transactivational activity, suggesting it affects molecular function related to regulatory element binding. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation is involved in regulatory element binding, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation has been shown to possess a constitutive gain of function, indicating an alteration in molecular function in the absence of androgen. Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation exhibits a constitutive gain of function, suggesting it alters molecular function in the context of androgen response. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows a constitutive gain of function, indicating an alteration in molecular function related to androgen response.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

Genes: 2232 367 1387 10514 10499

Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: M886I | Summary: The mutation M886I is associated with cancer progression through altered binding to co-repressors or co-regulators, indicating its role in tumor development. Evidence Type: Functional | Mutation: M886I | Summary: The mutation M886I may not change activity from wild type but is suggested to alter molecular interactions, impacting its biochemical function.

Gene→Variant (gene-first): 9611:M886I

Genes: 9611

Variants: M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation demonstrates a significant loss of function in receptor activity, indicating its alteration of molecular function in the presence of DHT. Evidence Type: Oncogenic | Mutation: M749I | Summary: The M749I mutation has been identified in relapsed tumors and may contribute to prostate cancer progression, suggesting its role in tumor development. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows a modest loss of function at low DHT levels but gains constitutive activity at higher levels, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: Q798E | Summary: The Q798E mutation's constitutive activity could have significant implications for prostate cancer development, suggesting its contribution to tumor progression. Evidence Type: Functional | Mutation: H874Y | Summary: The H874Y mutation exhibits increased constitutive activity and notable gains of function, indicating a change in molecular function that may influence receptor signaling. Evidence Type: Oncogenic | Mutation: H874Y | Summary: The H874Y mutation is associated with constitutive activity and promiscuous ligand activation, representing a potential driver of prostate cancer progression.

Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

Genes: 367 1387 10514

Variants: H874Y M749I Q798E

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation in the DBD alters the binding profile and transactivation activity, indicating a change in molecular function related to androgen receptor activity. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation affects regulatory element activation and may interfere with acetylation of the 629RKLKK633 motif, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: I672T | Summary: The I672T mutation is predicted to disrupt the conformation of a protein-protein interaction surface, indicating a potential change in molecular function.

Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

Genes: 2908 10499

Variants: I672 I672T R629 R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: L57Q | Summary: The L57Q mutation exhibited loss of function at all concentrations of DHT, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation demonstrated constitutive activity and gain of function in the presence of DHT, suggesting its role in tumor development. Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation represented a transition from loss of function to gain of function, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation showed a transition from wild-type activity to gain of function, indicating an alteration in molecular function.

Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

Genes: 2232 367

Variants: G142V L57Q P390L P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation is associated with a loss of function in the absence of DHT, indicating an alteration in molecular function related to androgen receptor activity. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation is linked to a loss of function in the absence of DHT, suggesting it alters the molecular function of the androgen receptor. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation shows a loss of function in the absence of DHT, indicating a change in the molecular function of the androgen receptor.

Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

Genes: 367 10499

Variants: P390L R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: D879G | Summary: The D879G mutation is associated with a loss to gain of function, indicating that it alters molecular or biochemical function, with a modest recovery of function at high concentrations of DHT. Evidence Type: Functional | Mutation: Q919R | Summary: The Q919R mutation is described as part of a loss to gain of function, suggesting it alters molecular or biochemical function, although specific details on its activity are not provided. Evidence Type: Functional | Mutation: H874Y | Summary: The H874Y mutation exhibits constitutive activity and displays loss of function relative to wild type (WT) at higher levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: T877A | Summary: The T877A mutation shows a significant constitutive gain of function with a 625% increase in activity compared to WT, indicating a substantial alteration in molecular or biochemical function.

Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

Genes: 10499 367

Variants: D879G H874Y Q919R T877A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

Evidence Type(s): Predisposing, Oncogenic, Functional

Summary: Evidence Type: Predisposing | Mutation: K720E | Summary: The K720E mutation is implicated in a 6-fold increased risk of prostate cancer, indicating its role as a predisposing variant. Evidence Type: Oncogenic | Mutation: R726L | Summary: The R726L mutation contributes to tumor development by impairing binding interactions critical for androgen receptor function. Evidence Type: Functional | Mutation: N756 | Summary: The N756 mutation may be involved in AR dimerization, and its mutation to aspartate resulted in complete loss of function. Evidence Type: Functional | Mutation: A765T | Summary: The A765T mutation displayed compromised transactivation activity, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Y763C | Summary: The Y763C mutation also displayed compromised transactivation activity, suggesting it alters molecular function. Evidence Type: Functional | Mutation: Q902 | Summary: The Q902 residue is part of an H-bonding network, and its mutation to arginine (Q902R) may disrupt this interaction, indicating a functional alteration.

Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

Genes: 367 9611

Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: A748V | Summary: The A748V mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: A765T | Summary: The A765T mutation is part of a group of loss-of-function mutations that exhibit essentially no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: L744F | Summary: The L744F mutation is identified as a loss-of-function mutation with no transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: M749I | Summary: The M749I mutation is classified as a loss-of-function mutation with no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: N756D | Summary: The N756D mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: S759P | Summary: The S759P mutation is part of a group of loss-of-function mutations that exhibit no transactivational activity at physiological levels of DHT, suggesting a change in molecular function. Evidence Type: Functional | Mutation: Y763C | Summary: The Y763C mutation is associated with loss of transactivational activity at physiological levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: K720E | Summary: The K720E mutation is part of a group of mutations showing a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: V757A | Summary: The V757A mutation shows a modest loss of function at all levels of DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: V757I | Summary: The V757I mutation is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Q798E | Summary: The Q798E mutation shows impaired binding to co-regulatory proteins and is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: M886V | Summary: The M886V mutation is part of a group of loss-of-function mutations that exhibit impaired binding to co-regulatory proteins, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Q902R | Summary: The Q902R mutation is associated with a distinctive greater loss of function at 1 nM DHT, indicating an alteration in molecular function.

Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

Genes: 367 9611 1387 10514

Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K910R | Summary: The K910R mutation is associated with driving prostate cancer (PCa) development, despite showing only minor divergence from wild type (WT) and distinctive losses of function. Evidence Type: Functional | Mutation: M886I | Summary: The M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability in prostate cancer.

Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

Genes: 367 9611

Variants: K910R M886 M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: I672T | Summary: The I672T mutation shows a gain of function at 10 nM DHT and a loss of function at 1 nM, indicating its influence on ligand binding and molecular function. Evidence Type: Functional | Mutation: T575A | Summary: The T575A mutation exhibits a loss of function at low DHT concentrations and a significant gain of function at 10 nM, demonstrating its impact on molecular activity. Evidence Type: Functional | Mutation: R629Q | Summary: The R629Q mutation shows a loss of function at low DHT concentrations and a substantial gain of function at 10 nM, indicating its role in altering molecular function. Evidence Type: Functional | Mutation: A586V | Summary: The A586V mutation transitions from a loss of function at low DHT concentrations to a remarkable gain of function at 10 nM, highlighting its significant effect on transactivational activity. Evidence Type: Functional | Mutation: A587S | Summary: The A587S mutation displays constitutive transactivational activity with modest gains of function across all DHT levels, indicating its influence on molecular function.

Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

Genes: 597 367 2908 10499

Variants: A586V A587S I672T R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: P533S | Summary: The P533S mutation functions like wild-type (WT) at low DHT but gains function upon DHT binding, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: G142V | Summary: The G142V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M523V | Summary: The M523V mutation exhibits constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: G524D | Summary: The G524D mutation demonstrates constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, suggesting it contributes to tumor development. Evidence Type: Oncogenic | Mutation: M537V | Summary: The M537V mutation shows constitutive activity in the absence of ligand and modest gain of function at all concentrations of DHT, indicating its role in tumor progression.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

Genes: 2232 367

Variants: G142V G524D M523V M537V P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: P269S | Summary: The P269S mutation is associated with wild-type levels of transactivation at 10 nM DHT, indicating it does not alter molecular function in this context. Evidence Type: Functional | Mutation: P390L | Summary: The P390L mutation acquired a 26% gain of function at 10 nM DHT, suggesting it alters molecular function related to AR signaling. Evidence Type: Functional | Mutation: P514S | Summary: The P514S mutation acquired a 30% gain of function at 10 nM DHT, indicating it alters molecular function in the context of AR signaling. Evidence Type: Functional | Mutation: S515G | Summary: The S515G mutation is associated with wild-type levels of transactivation at 10 nM DHT, indicating it does not alter molecular function in this context.

Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

Genes: 367 10514

Variants: P269S P390L P514S S515G

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: D221H | Summary: The D221H mutation is associated with a loss of function that may contribute to tumor development or progression, as indicated by its context in prostate cancer. Evidence Type: Oncogenic | Mutation: D528G | Summary: The D528G mutation is implicated in tumor development or progression, as suggested by its context in prostate cancer. Evidence Type: Functional | Mutation: S296R | Summary: The S296R mutation alters interaction with the co-repressor N-CoR, leading to reduced transactivational activity, indicating a change in molecular function. Evidence Type: Functional | Mutation: P340L | Summary: The P340L mutation is predicted to create a new alpha-helix and is associated with reduced binding to TFIIF, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: E198G | Summary: The E198G mutation has been shown to maintain transactivational activity similar to wild-type in the presence of ART-27, indicating a functional aspect. Evidence Type: Functional | Mutation: P269S | Summary: The P269S mutation is reported to have transactivational activity comparable to wild-type when stimulated by ART-27, suggesting it alters molecular function. Evidence Type: Functional | Mutation: S334P | Summary: The S334P mutation also maintains transactivational activity similar to wild-type in the presence of ART-27, indicating a functional change. Evidence Type: Oncogenic | Mutation: P340L | Summary: The P340L mutation exemplifies a loss of function that can drive prostate cancer progression through reduced growth suppression, indicating its oncogenic potential.

Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 207 367 2232 9611

Variants: D221H D528G E198G P269S P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: L57Q | Summary: The L57Q mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: E198G | Summary: The E198G mutation shows a significant reduction in function (50% at 1 nM), indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: D221H | Summary: The D221H mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: A234T | Summary: The A234T mutation is located at a critical site affecting function, contributing to loss of transactivational ability. Evidence Type: Functional | Mutation: S296R | Summary: The S296R mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: S334P | Summary: The S334P mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: P340L | Summary: The P340L mutation is associated with loss of function and is noted to be present in AIS, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: P504L | Summary: The P504L mutation is associated with loss of function, indicating an alteration in molecular or biochemical function. Evidence Type: Functional | Mutation: D528G | Summary: The D528G mutation is associated with loss of function, indicating an alteration in molecular or biochemical function.

Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 1387 207 367 2232 9611

Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: G166S | Summary: The mutation G166S showed the least variance from the unmutated receptor, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: M537R | Summary: The mutation M537R exhibited a 23% gain of function at 0.1 nM DHT, suggesting an alteration in molecular function, particularly in a low androgen environment.

Gene→Variant (gene-first): 367:G166S 367:M537R

Genes: 367

Variants: G166S M537R

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: T575 | Summary: The mutation T575 is mentioned in the context of a functionally distinct domain of the androgen receptor, indicating its potential role in altering molecular function. Evidence Type: Functional | Mutation: R629 | Summary: The mutation R629 is highlighted as a highly conserved amino acid, suggesting its importance in the molecular function of the androgen receptor. Evidence Type: Functional | Mutation: I672 | Summary: The mutation I672 is also noted as a highly conserved amino acid, indicating its potential role in the molecular function of the androgen receptor.

Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

Genes: 2908 10499

Variants: I672 R629 T575

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: A234 | Summary: The mutation A234 is located within a highly conserved motif, suggesting a possible role in the mechanics of AR function. Evidence Type: Functional | Mutation: D221 | Summary: The mutation D221 is implicated in prostate cancer (PCa) and is present in at least four species, indicating a potential impact on AR function. Evidence Type: Functional | Mutation: E198 | Summary: The mutation E198 is part of a group of amino acids implicated in PCa and is present in multiple species, suggesting its relevance to AR function. Evidence Type: Functional | Mutation: G142 | Summary: The mutation G142 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: G166 | Summary: The mutation G166 is part of the residues examined for their role in prostate cancer, suggesting its involvement in AR function. Evidence Type: Functional | Mutation: L57 | Summary: The mutation L57 is implicated in prostate cancer and is present in multiple species, indicating its potential role in AR function. Evidence Type: Functional | Mutation: M523 | Summary: The mutation M523 is mentioned as being present in at least four species, suggesting its relevance to the mechanics of AR function. Evidence Type: Functional | Mutation: M537 | Summary: The mutation M537 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: P269 | Summary: The mutation P269 is located within a highly conserved motif associated with prostate cancer, suggesting its relevance to AR function. Evidence Type: Functional | Mutation: P340 | Summary: The mutation P340 is part of the residues implicated in prostate cancer, indicating its potential role in AR function. Evidence Type: Functional | Mutation: P390 | Summary: The mutation P390 is located within a highly conserved motif, suggesting a possible role in the mechanics of AR function. Evidence Type: Functional | Mutation: P514 | Summary: The mutation P514 is mentioned as being present in at least four species, indicating its relevance to the mechanics of AR function. Evidence Type: Functional | Mutation: P515 | Summary: The mutation P515 is included in the analysis of amino acids implicated in PCa, indicating its potential role in AR function. Evidence Type: Functional | Mutation: G524 | Summary: The mutation G524 is part of the residues examined for their role in prostate cancer, suggesting its involvement in AR function. Evidence Type: Functional | Mutation: S296 | Summary: The mutation S296 is one of the two mutated residues found only in humans, indicating its potential significance in AR function. Evidence Type: Functional | Mutation: S334 | Summary: The mutation S334 is confined to mammals and is implicated in prostate cancer, suggesting its potential role in AR function. Evidence Type: Functional | Mutation: P533 | Summary: The mutation P533 is one of the two residues confined to mammals, indicating its potential significance in AR function.

Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

Genes: 1387 207 367 2232 10514

Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: E152 | Summary: The E152 residue's rotamer configuration is altered in the BCL-2 G101V:S55746 structure, indicating a change in molecular function related to binding affinity. Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation affects the binding affinity of S55746, demonstrating a change in molecular function due to the variant. Evidence Type: Functional | Mutation: E152A | Summary: The E152A double mutant shows altered binding affinity to S55746, indicating a functional impact on molecular interactions.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

Genes: 596

Variants: E152 E152A G101V V101

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Predictive, Oncogenic

Summary: Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation alters the binding affinity of the BCL-2 protein to the selective antagonist S55746, indicating a change in molecular function compared to the wild-type. Evidence Type: Predictive | Mutation: G101V | Summary: The G101V mutation is associated with a significantly higher LC50 concentration for the drug S55746, suggesting that it may influence the response to this therapy. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation in BCL-2 is implicated in altering the drug binding characteristics, which may contribute to tumor development or progression.

Gene→Variant (gene-first): 596:G101V

Genes: 596

Variants: G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: E152 | Summary: The E152 mutation alters the conformation and binding affinity of the BCL-2 protein, impacting its interaction with venetoclax. Evidence Type: Functional | Mutation: E152A | Summary: The E152A mutation maintains comparable binding to wild-type BCL-2 and restores high affinity for venetoclax when combined with G101V. Evidence Type: Functional | Mutation: G101A | Summary: The G101A mutation exhibits a binding affinity to venetoclax that is comparable to wild-type BCL-2, indicating a functional role in drug interaction. Evidence Type: Oncogenic | Mutation: G101V | Summary: The G101V mutation contributes to altered binding dynamics with venetoclax, suggesting a role in tumor development or progression through its impact on drug affinity.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

Genes: 596

Variants: E152 E152A G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: E152 | Summary: The variant E152 is associated with venetoclax affinity, suggesting it may correlate with response or sensitivity to this specific therapy.

Gene→Variant (gene-first): 596:E152

Genes: 596

Variants: E152

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: G101V | Summary: The G101V mutation is associated with reduced affinity for venetoclax, indicating a potential resistance to therapy. Evidence Type: Predictive | Mutation: F104L | Summary: The F104L mutation shows a significant change in venetoclax affinity, suggesting it may contribute to resistance against the drug. Evidence Type: Predictive | Mutation: F104C | Summary: The F104C mutation demonstrates altered venetoclax affinity, which implies a role in resistance to therapy.

Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

Genes: 596

Variants: F104C F104L G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: F104L | Summary: The F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function. Evidence Type: Functional | Mutation: F104 | Summary: The F104 residue plays a role in separating the P2 and P4 pockets of BCL-2, suggesting its importance in molecular function.

Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

Genes: 596

Variants: F104 F104L L104

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: G101V | Summary: The G101V mutation alters drug binding by changing the interactions within the P2 pocket, affecting the positioning of venetoclax in relation to the BCL-2 structure. Evidence Type: Functional | Mutation: G101A | Summary: The G101A mutation introduces a milder bulk at the G101 position, which affects the interactions with venetoclax but maintains the overall positioning of the drug in the P4 pocket. Evidence Type: Functional | Mutation: E152 | Summary: The E152 mutation exhibits a rotamer change that influences the positioning of venetoclax, indicating an alteration in molecular function related to drug binding.

Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

Genes: 596

Variants: E152 G101 G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 596:F104

Genes: 596

Variants: F104

[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: G719X | Summary: The G719X mutation has been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC. Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation has been associated with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC.

Gene→Variant (gene-first): 1956:G719X 1956:L858R

Genes: 1956

Variants: G719X L858R

[Paragraph-level] PMCID: PMC3219854 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Trp557Gly | Summary: The Trp557Gly mutation in KIT is identified as a missense point mutation associated with neurofibromatosis type 1-related gastrointestinal stromal tumors (GISTs), indicating its contribution to tumor development. Evidence Type: Functional | Mutation: Trp557Gly | Summary: The Trp557Gly mutation alters the molecular function of the KIT protein, which is implicated in the pathogenesis of the tumors described.

Gene→Variant (gene-first): 3815:Trp557Gly

Genes: 3815

Variants: Trp557Gly

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Predisposing

Summary: Evidence Type: Oncogenic | Mutation: V37M | Summary: The V37M variant was identified in patients with B-ALL, indicating a potential contribution to tumor development in leukemia. Evidence Type: Oncogenic | Mutation: R181H | Summary: The R181H variant was also found in patients with B-ALL, suggesting its involvement in tumor progression. Evidence Type: Predisposing | Mutation: V37M | Summary: The V37M variant is described as a rare germline variant, indicating it may confer inherited risk for leukemia. Evidence Type: Predisposing | Mutation: R181H | Summary: The R181H variant is also classified as a rare germline variant, suggesting a potential inherited risk for leukemia.

Gene→Variant (gene-first): 2120:11905459G>A 2120:12022436 G>A 2120:R181H 2120:V37M 2120:rs150089916

Genes: 2120

Variants: 11905459G>A 12022436 G>A R181H V37M rs150089916

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation is evaluated for its impact on translation and subcellular localization of the ETV6 protein, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation is assessed for its effect on translation and subcellular localization of the ETV6 protein, suggesting a change in molecular function. Evidence Type: Functional | Mutation: P214L | Summary: The P214L mutation is described as being detectable in both cytoplasmic and nuclear fractions, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: R369Q | Summary: The R369Q mutation is noted for its presence in both cytoplasmic and nuclear fractions, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: R399C | Summary: The R399C mutation is mentioned as being detectable in both cytoplasmic and nuclear fractions, indicating a potential change in molecular function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation was assessed for its impact on transcriptional repression by ETV6, showing significantly decreased repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation was evaluated for its ability to impair transcriptional repression by ETV6, exhibiting significantly decreased repression relative to wild-type ETV6. Evidence Type: Functional | Mutation: P214L | Summary: The P214L mutation, a germline variant, was compared to other ETV6 mutations and demonstrated significantly decreased transcriptional repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: R369Q | Summary: The R369Q mutation was analyzed alongside other ETV6 variants and showed significantly reduced transcriptional repression compared to wild-type ETV6. Evidence Type: Functional | Mutation: R399C | Summary: The R399C mutation was included in the analysis of ETV6 variants and exhibited significantly decreased transcriptional repression compared to wild-type ETV6.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs 2120:P214L 2120:R369Q 2120:R399C

Genes: 2120

Variants: L349P N385fs P214L R369Q R399C

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation is predicted to cause significant conformational changes in the ETV6 protein, suggesting an alteration in its molecular function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation is predicted to truncate the ETV6 protein at a region involved in DNA interaction, indicating a change in its biochemical function.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs

Genes: 2120

Variants: L349P N385fs

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predisposing, Oncogenic

Summary: Evidence Type: Predisposing | Mutation: c.1153-5_1153_1delAACAG | Summary: The heterozygous deletion in ETV6 was identified in the proband and his mother, suggesting an inherited risk for acute lymphoblastic leukemia (ALL). Evidence Type: Oncogenic | Mutation: N385fs | Summary: The frameshift mutation at codon 385 in ETV6 is predicted to contribute to tumor development in the context of acute lymphoblastic leukemia (ALL).

Gene→Variant (gene-first): 2120:N385fs 2120:c.1153-5_1153_1delAACAG

Genes: 2120

Variants: N385fs c.1153-5_1153_1delAACAG

[Paragraph-level] PMCID: PMC4477877 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Oncogenic, Functional

Summary: Evidence Type: Diagnostic | Mutation: 415 T>C | Summary: The variant 415 T>C is associated with the diagnosis of thrombocytopenia and/or ALL, as it co-segregates with affected individuals in the family. Evidence Type: Oncogenic | Mutation: 415 T>C | Summary: The 415 T>C variant is a somatic mutation that contributes to tumor development, as it is present in all affected family members tested. Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation results in a substitution that alters the molecular function of the ETV6 protein, impacting its role in cellular processes.

Gene→Variant (gene-first): 10320:415 T>C 2120:L349P 2120:c. T1046C 2120:proline for leucine at codon 349

Genes: 10320 2120

Variants: 415 T>C L349P c. T1046C proline for leucine at codon 349

[Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predisposing, Functional

Summary: Evidence Type: Predisposing | Mutation: L349P | Summary: The L349P mutation is described as a germline mutation associated with inherited susceptibility to acute leukemia, indicating a predisposing factor for the disease. Evidence Type: Predisposing | Mutation: N385fs | Summary: The N385fs mutation is also identified as a germline mutation linked to inherited risk for acute leukemia, supporting its role as a predisposing factor. Evidence Type: Functional | Mutation: L349P | Summary: The L349P mutation alters the localization of the ETV6 protein, preventing it from localizing to the nucleus and affecting its regulatory function. Evidence Type: Functional | Mutation: N385fs | Summary: The N385fs mutation results in an abnormally truncated ETV6 protein, which shows decreased ability to regulate the expression of genes typically suppressed by ETV6, indicating a functional alteration.

Gene→Variant (gene-first): 2120:L349P 2120:N385fs

Genes: 2120

Variants: L349P N385fs

[Paragraph-level] PMCID: PMC4477877 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predisposing, Oncogenic, Functional

Summary: Evidence Type: Predisposing | Mutation: p. L349P | Summary: The p. L349P mutation is identified as a germline variant in a kindred affected by thrombocytopenia and acute lymphoblastic leukemia (ALL), suggesting it confers inherited risk for the disease. Evidence Type: Oncogenic | Mutation: p. N385fs | Summary: The p. N385fs mutation was found in leukemic cells, contributing to tumor development as it is associated with acute lymphoblastic leukemia (ALL) and secondary myelodysplasia/acute myeloid leukemia. Evidence Type: Functional | Mutation: p. N385fs | Summary: The p. N385fs mutation alters the molecular function of ETV6, as it impairs nuclear localization and reduces the ability to regulate the transcription of ETV6 target genes.

Gene→Variant (gene-first): 2120:p. L349P 2120:p. N385fs

Genes: 2120

Variants: p. L349P p. N385fs

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: T790M | Summary: The T790M mutation is associated with resistance to EGFR inhibitors, specifically indicating a mechanism of resistance to the third-generation EGFR inhibitor osimertinib. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation contributes to tumor development or progression as it is a mechanism of resistance that arises in patients treated with EGFR inhibitors. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is known to contribute to tumor development or progression in the context of EGFR mutations. Evidence Type: Oncogenic | Mutation: G719S | Summary: The G719S mutation is part of a composite mutation that is implicated in tumor development or progression. Evidence Type: Oncogenic | Mutation: L861Q | Summary: The L861Q mutation is part of a composite mutation that is implicated in tumor development or progression.

Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

Genes: 1956

Variants: G719S L858R L861Q T790M

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 17

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with overall survival (OS) outcomes, indicating that patients with this mutation have a comparable prognosis to those with uncommon actionable variants when adjusted for age, sex, and year of diagnosis. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is implicated in tumor development and progression, as it is associated with worse outcomes compared to other variants in the context of overall survival analysis.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Prognostic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation correlates with response to first-line targeted therapy, as indicated by the proportion of patients receiving this therapy. Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with median overall survival (OS) outcomes, with a median OS of 18.3 months for patients treated with first-line targeted therapy.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 13

Evidence Type(s): Prognostic

Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with a median overall survival (OS) of 16.7 months, indicating its correlation with disease outcome independent of therapy.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Diagnostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: L858R | Summary: The L858R mutation is associated with treatment and survival data, indicating a correlation with disease outcome independent of therapy. Evidence Type: Diagnostic | Mutation: L858R | Summary: The L858R mutation is used to classify and confirm the presence of a specific EGFR mutation in patients, aiding in the diagnosis of the disease. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is a somatic variant that contributes to tumor development and progression in patients with EGFR mutations.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation is identified as a classical, actionable EGFR mutation that contributes to tumor development or progression in a significant proportion of patients. Evidence Type: Oncogenic | Mutation: L861X | Summary: The L861X mutation is noted as an uncommon but actionable EGFR mutation that may also contribute to tumor development or progression, particularly in patients tested with multi-gene assays.

Gene→Variant (gene-first): 1956:L858R 1956:L861X

Genes: 1956

Variants: L858R L861X

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: Gln61 | Summary: The passage discusses the impact of insertions on the catalytic Gln61, indicating that these variants alter molecular function related to GTP hydrolysis. Evidence Type: Oncogenic | Mutation: Gln61 | Summary: The mention of insertions in tumor samples suggests that these variants contribute to tumor development or progression, classifying them as oncogenic.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The HRAS p.G12V variant alters molecular function by inducing phosphorylation of ERK and AKT, indicating its role in RAS signaling pathways. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The HRAS p.G12V variant contributes to tumor development by enhancing signaling capabilities, as evidenced by increased levels of phosphorylated ERK and AKT in transfected cells.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 22

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The variant KRAS p.G12V is described as a classical oncogenic variant, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.G12V | Summary: The p.G12V variant of KRAS shows reduced intrinsic GTP hydrolysis rates compared to wild type, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: p.G12V | Summary: The p.G12V variant is classified as a classical oncogenic variant, contributing to tumor development and progression.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 18

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.G12V | Summary: KRAS p.G12V is described as a classical oncogenic variant, indicating its role in tumor development or progression. The variant's interaction with Raf-RBD and its altered dissociation rate further support its oncogenic properties. Evidence Type: Functional | Mutation: p.G12V | Summary: The variant KRAS p.G12V alters the intrinsic dissociation rate of the nucleotide, demonstrating a change in molecular function compared to wild type KRAS.

Gene→Variant (gene-first): 3845:p.G12V

Genes: 3845

Variants: p.G12V

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.Q61L | Summary: The passage discusses the functional consequences of the p.Q61L mutation in relation to RAS signaling, indicating that it is a classic pathogenic missense mutation that may alter molecular function. Evidence Type: Oncogenic | Mutation: p.Q61L | Summary: The p.Q61L mutation is described as a classic pathogenic missense mutation, suggesting its contribution to tumor development or progression.

Gene→Variant (gene-first): 4893:p.Q61L

Genes: 4893

Variants: p.Q61L

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: Gln61 | Summary: The residue Gln61 is involved in GTP hydrolysis and is likely affected by insertions that alter molecular interactions, impacting the protein's biochemical function.

Gene→Variant (gene-first): 5921:Gln61

Genes: 5921

Variants: Gln61

[Paragraph-level] PMCID: PMC6547725 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.G12A | Summary: The p.G12A mutation is described as affecting a classical position in the P-loop of KRAS, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: p.G13H | Summary: The p.G13H mutation is also noted to affect a classical position in the P-loop of KRAS, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: p.Q22K | Summary: The p.Q22K mutation is associated with increased GTP loading, indicating an alteration in molecular or biochemical function.

Gene→Variant (gene-first): 3845:p.G12A 3845:p.G13H 3845:p.Q22K

Genes: 3845

Variants: p.G12A p.G13H p.Q22K

[Paragraph-level] PMCID: PMC3058384 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation is associated with tumor development and progression in malignant melanomas, as it is found in 50-70% of these cases. Evidence Type: Predictive | Mutation: B-RAFV600E | Summary: The B-RAFV600E mutation predicts a dependency on the MAPK signaling cascade in melanoma, which has been validated by the success of RAF and MEK inhibitors in clinical trials.

Gene→Variant (gene-first): 673:B-RAFV600E 673:serine/threonine

Genes: 673

Variants: B-RAFV600E serine/threonine

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: K131 | Summary: The K131 variant removes a positively charged residue that directly interacts with the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: R168 | Summary: The R168 variant removes a positively charged residue that directly interacts with the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: Q133E | Summary: The Q133E variant introduces a negatively charged group that destabilizes the negatively charged triphosphate group of ATP, influencing RAD51C function. Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: T132I | Summary: The T132I variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: V140E | Summary: The V140E variant introduces a charged or bulky group into a tight hydrophobic pocket, potentially destabilizing the residue 130-140 helical region and influencing RAD51C function. Evidence Type: Functional | Mutation: R312W | Summary: The R312W variant removes a positively charged residue that may weaken the interaction with the negatively charged gamma phosphate group of ATP, influencing RAD51C activity. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant disrupts a hydrophobic core and may interfere with RAD51C protomer formation, influencing RAD51C function.

Gene→Variant (gene-first): 5889:16 A 5889:C135Y 5889:E94K 5889:G130R 5889:G302V 5889:K131 5889:L138F 5889:P21S 5889:Q133E 5889:R168 5889:R168G 5889:R312 5889:R312W 5889:T132I 5889:T132R 5892:T86I 5889:V140E 5889:p.Cys135Tyr 5889:p.Thr132Ile 5889:p.Val140Glu

Genes: 5889 5892

Variants: 16 A C135Y E94K G130R G302V K131 L138F P21S Q133E R168 R168G R312 R312W T132I T132R T86I V140E p.Cys135Tyr p.Thr132Ile p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: A126T | Summary: The A126T variant is described as a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, indicating it does not alter the molecular function of the RAD51C complexes. Evidence Type: Functional | Mutation: D109Y | Summary: The D109Y variant is also a neutral variant that coimmunoprecipitates with RAD51D and XRCC2, suggesting it does not affect the molecular function of the RAD51C complexes. Evidence Type: Oncogenic | Mutation: L138F | Summary: The L138F variant is identified as a deleterious variant that fails to coimmunoprecipitate with RAD51D and XRCC2, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: L27P | Summary: The L27P variant is classified as a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: T336P | Summary: The T336P variant is a deleterious variant that binds only to XRCC3 and not to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: T86I | Summary: The T86I variant is described as an intermediate variant that binds only to XRCC3 and not to RAD51D-XRCC2, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: D159N | Summary: The D159N variant is classified as an intermediate variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, indicating a change in molecular function. Evidence Type: Functional | Mutation: G162E | Summary: The G162E variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: S163R | Summary: The S163R variant is classified as a deleterious variant that loses the ability to bind to XRCC3 but retains binding to RAD51D-XRCC2, suggesting a change in molecular function. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant is identified as a deleterious variant that loses the ability to bind to XRCC3 but can still bind to RAD51D-XRCC2, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: R258H | Summary: The R258H variant, observed as a homozygous variant in a FANCO patient, displays reduced binding for all complex members, indicating a change in molecular function.

Gene→Variant (gene-first): 5889:A126T 5889:D109Y 5889:D159N 5889:G162E 5889:G302V 5889:L138F 5889:L27P 5889:Q133E 5889:R258H 5889:S163R 5889:T336P 5892:T86I 5889:p.Gly162Glu 5889:p.Ser163Arg 5889:p.Thr336Pro 5892:p.Thr86Ile

Genes: 5889 5892

Variants: A126T D109Y D159N G162E G302V L138F L27P Q133E R258H S163R T336P T86I p.Gly162Glu p.Ser163Arg p.Thr336Pro p.Thr86Ile

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant alters molecular function by causing a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: K131I | Summary: The K131I variant alters molecular function, leading to a significant decrease in RAD51 foci, which suggests a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant affects molecular function, resulting in a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant alters molecular function, as evidenced by a decrease in RAD51 foci, suggesting a disruption in homologous recombination repair. Evidence Type: Functional | Mutation: R168G | Summary: The R168G variant impacts molecular function, leading to a significant decrease in RAD51 foci, indicating a disruption in homologous recombination repair.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Summary: Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant is characterized as deleterious and shows reduced HDR activity in U2OS cells, indicating that it alters molecular function related to homologous recombination. Evidence Type: Predictive | Mutation: L138F | Summary: The L138F variant is associated with sensitivity to cisplatin and olaparib in CL-V4B cells, suggesting it may correlate with response to specific therapies.

Gene→Variant (gene-first): 5889:L138F

Genes: 5889

Variants: L138F

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Predictive

Summary: Evidence Type: Functional | Mutation: G130R | Summary: The G130R variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: K131I | Summary: The K131I variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: T132R | Summary: The T132R variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: Q133E | Summary: The Q133E variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: L138F | Summary: The L138F variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: R168G | Summary: The R168G variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Functional | Mutation: G302V | Summary: The G302V variant was confirmed to have functional effects in a human cell line, indicating it alters molecular or biochemical function. Evidence Type: Predictive | Mutation: G130R | Summary: The G130R variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: K131I | Summary: The K131I variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: T132R | Summary: The T132R variant showed sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: Q133E | Summary: The Q133E variant had intermediate effects on sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy. Evidence Type: Predictive | Mutation: G302V | Summary: The G302V variant had intermediate effects on sensitivity to olaparib compared with WT-complemented cells, indicating a correlation with response to therapy.

Gene→Variant (gene-first): 5889:G130R 5889:G302V 5889:K131I 5889:L138F 5889:Q133E 5889:R168G 5889:T132R

Genes: 5889

Variants: G130R G302V K131I L138F Q133E R168G T132R

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: P21S | Summary: The P21S variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D109Y | Summary: The D109Y variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: C147Y | Summary: The C147Y variant induces RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D108G | Summary: The D108G variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: V140E | Summary: The V140E variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: A155E | Summary: The A155E variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: D159Y | Summary: The D159Y variant exhibits dramatically reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response. Evidence Type: Functional | Mutation: G306R | Summary: The G306R variant exhibits partially reduced RAD51 foci formation, indicating it alters molecular function related to DNA damage response.

Gene→Variant (gene-first): 5889:A155E 5889:C135Y 5889:C147Y 5888:D108G 5889:D109Y 5889:D159Y 5889:G306R 5889:P21S 5889:V140E 5889:p.Ala155Glu 5888:p.Asp108Gly 5889:p.Asp109Tyr 5889:p.Asp159Tyr 5889:p.Cys147Tyr 5889:p.Gly306Arg 5889:p.Pro21Ser 5889:p.Val140Glu

Genes: 5889 5888

Variants: A155E C135Y C147Y D108G D109Y D159Y G306R P21S V140E p.Ala155Glu p.Asp108Gly p.Asp109Tyr p.Asp159Tyr p.Cys147Tyr p.Gly306Arg p.Pro21Ser p.Val140Glu

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 5

Evidence Type(s): Predictive, Functional

Summary: Evidence Type: Predictive | Mutation: E94K | Summary: The variant p.Glu94Lys (E94K) shows a significant reduction in sensitivity to cisplatin and a notable decrease in sensitivity to olaparib, indicating its potential role in predicting treatment response. Evidence Type: Predictive | Mutation: G306R | Summary: The variant p.Gly306Arg (G306R) demonstrates a marked reduction in sensitivity to both cisplatin and olaparib, suggesting its predictive value for treatment response. Evidence Type: Functional | Mutation: E94K | Summary: The variant p.Glu94Lys (E94K) is associated with altered IC50 values for cisplatin and olaparib, indicating a change in molecular function. Evidence Type: Functional | Mutation: G306R | Summary: The variant p.Gly306Arg (G306R) exhibits altered IC50 values for cisplatin and olaparib, suggesting a functional impact on drug response.

Gene→Variant (gene-first): 5889:E94K 5889:G306R 5889:p.Glu94Lys 5889:p.Gly306Arg

Genes: 5889

Variants: E94K G306R p.Glu94Lys p.Gly306Arg

[Paragraph-level] PMCID: PMC10390864 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: A126T | Summary: The A126T mutation was assessed in a cell-based HDR assay, indicating its influence on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: C135Y | Summary: The C135Y mutation was categorized as deleterious in the HDR assay, demonstrating its impact on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: D159N | Summary: The D159N mutation was classified as intermediate in the HDR assay, suggesting it alters RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G125V | Summary: The G125V mutation was identified as deleterious in the HDR assay, indicating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G153D | Summary: The G153D mutation was categorized as deleterious in the HDR assay, reflecting its influence on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G264S | Summary: The G264S mutation was classified as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G264V | Summary: The G264V mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: G3R | Summary: The G3R mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: L138F | Summary: The L138F mutation was identified as deleterious in the HDR assay, demonstrating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: L219S | Summary: The L219S mutation was classified as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: Q143R | Summary: The Q143R mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R214C | Summary: The R214C mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R258H | Summary: The R258H mutation was classified as intermediate in the HDR assay, suggesting it alters RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R312W | Summary: The R312W mutation was identified as deleterious in the HDR assay, demonstrating its effect on RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: R366Q | Summary: The R366Q mutation was reported as neutral in the HDR assay, indicating it does not significantly alter RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: T287A | Summary: The T287A mutation was categorized as neutral in the HDR assay, suggesting it does not impact RAD51C HR DNA repair activity. Evidence Type: Functional | Mutation: V169A | Summary: The V169A mutation was reported as neutral in the HDR assay, indicating it does not affect RAD51C HR DNA repair activity.

Gene→Variant (gene-first): 5889:A126T 5889:C135Y 5889:D159N 5889:G125V 5889:G153D 5889:G264S 5889:G264V 5889:G3R 5889:L138F 5889:L219S 5889:Q143R 5889:R214C 5889:R258H 5889:R312W 5889:R366Q 5889:T287A 5889:V169A 5889:p.Arg214Cys 5889:p.Arg258His 5889:p.Arg312Trp 5889:p.Arg366Gln 5889:p.Asp159Asn 5889:p.Gln143Arg 5889:p.Gly125Val 5889:p.Gly153Asp 5889:p.Gly264Ser 5889:p.Gly264Val 5889:p.Gly3Arg 5889:p.Leu219Ser 5889:p.Thr287Ala 5889:p.Val169Ala

Genes: 5889

Variants: A126T C135Y D159N G125V G153D G264S G264V G3R L138F L219S Q143R R214C R258H R312W R366Q T287A V169A p.Arg214Cys p.Arg258His p.Arg312Trp p.Arg366Gln p.Asp159Asn p.Gln143Arg p.Gly125Val p.Gly153Asp p.Gly264Ser p.Gly264Val p.Gly3Arg p.Leu219Ser p.Thr287Ala p.Val169Ala

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with a response to ruxolitinib treatment, indicating its potential predictive value for therapy sensitivity. Evidence Type: Oncogenic | Mutation: S703I | Summary: The presence of the S703I mutation in JAK1 suggests its contribution to tumor development or progression, highlighting its oncogenic potential.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S703I | Summary: The JAK1S703I mutation correlates with sensitivity to the JAK1/2 inhibitor ruxolitinib, indicating its potential role in predicting treatment response. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is suggested to play a critical role in tumorigenesis in the LI-03-0191 PDX model, indicating its contribution to tumor development.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation in JAK1 is associated with tumor development or progression, as indicated by its presence in a patient-derived xenograft (PDX) model. Evidence Type: Predictive | Mutation: S703I | Summary: The S703I mutation correlates with the response to the therapy ruxolitinib, suggesting its predictive value in treatment outcomes.

Gene→Variant (gene-first): 3716:S703I

Genes: 3716

Variants: S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study evaluating the transformation ability of JAK1 mutations, indicating a potential alteration in molecular function. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is capable of continual proliferation in the absence of IL-3, suggesting it contributes to tumor development or progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation serves as a positive control in the study, indicating its role in enabling continual proliferation and suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E483D | Summary: The JAK1E483D mutation is part of a study exploring biological functions in the JAK-STAT signaling pathway, indicating its potential role in tumor development. Evidence Type: Oncogenic | Mutation: S703I | Summary: The JAK1S703I mutation is associated with elevated expression levels of phosphorylated JAK1 and STAT proteins, suggesting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: S729C | Summary: The JAK1S729C mutation is described as a known and recurrent activating mutation, indicating its role in tumor development.

Gene→Variant (gene-first): 3716:E483D 3716:S703I 3716:S729C

Genes: 3716

Variants: E483D S703I S729C

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: S703I | Summary: The S703I mutation is identified as an activating mutation of the JAK1 gene, contributing to tumor development in HCC patients. Evidence Type: Oncogenic | Mutation: A1086S | Summary: The A1086S mutation is located in the catalytic kinase domain of JAK1, suggesting its role in tumor development. Evidence Type: Oncogenic | Mutation: N451S | Summary: The N451S mutation is found in the SH2 domain of JAK1, indicating its potential contribution to tumor progression. Evidence Type: Oncogenic | Mutation: E483D | Summary: The E483D mutation, located in the SH2 domain of JAK1, may also play a role in tumor development.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC4868698 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3716:A1086S 3716:E483D 728378:N451S 3716:S703I

Genes: 3716 728378

Variants: A1086S E483D N451S S703I

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 23

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 8850:S7C

Genes: 8850

Variants: S7C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 21

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3084:S6 8850:S7

Genes: 3084 8850

Variants: S6 S7

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 19

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 1956:S2 3084:S6C

Genes: 1956 3084

Variants: S2 S6C

[Paragraph-level] PMCID: PMC7472556 Section: RESULTS PassageIndex: 12

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 5979:Q8

Genes: 5979

Variants: Q8

[Paragraph-level] PMCID: PMC4899144 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: Y641F | Summary: The Y641F mutation in EZH2 contributes to tumor development in mouse B-cells, leading to high-penetrance lymphoma. Evidence Type: Oncogenic | Mutation: Y646F | Summary: The Y646F mutation in EZH2 is associated with tumor progression in melanoma, as demonstrated in a mouse model.

Gene→Variant (gene-first): 2146:Y641F 2146:Y646F

Genes: 2146

Variants: Y641F Y646F

[Paragraph-level] PMCID: PMC5029699 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: N540K | Summary: The N540K mutation is reinforced as an important alteration that contributes to tumor development and progression, as it is associated with activating mutations in FGFR3. Evidence Type: Oncogenic | Mutation: K650E | Summary: The K650E mutation is established as a significant alteration that contributes to tumor development and progression, being linked to the activation of FGFR3. Evidence Type: Functional | Mutation: R669G | Summary: The R669G mutation is noted for its role in altering the activation state of FGFR3, although it does not occur at high frequency and may not be linked to activation.

Gene→Variant (gene-first): 2261:K650E 2261:N540K 2261:R669G

Genes: 2261

Variants: K650E N540K R669G

[Paragraph-level] PMCID: PMC4378307 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic

Summary: Evidence Type: Prognostic | Mutation: G12D | Summary: The G12D mutation in KRAS is associated with a poor prognosis in progression-free survival (PFS), indicating it serves as an independent negative prognostic factor.

Gene→Variant (gene-first): 3845:G12D

Genes: 3845

Variants: G12D

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 20

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: c.199G>A | Summary: The c.199G>A variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Prognostic | Mutation: c.169A>G | Summary: The c.169A>G variant in the MAP2K1 gene is correlated with worse disease/progression-free survival in CRC patients. Evidence Type: Oncogenic | Mutation: c.199G>A | Summary: The c.199G>A variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs. Evidence Type: Oncogenic | Mutation: c.169A>G | Summary: The c.169A>G variant contributes to tumor development or progression as it is associated with acquired resistance to anti-EGFR MoAbs.

Gene→Variant (gene-first): 5604:c.169A>G 5604:c.199G>A 5604:p.Asp67Asn 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G c.199G>A p.Asp67Asn p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: c.1268G>T; p.Gly423Val | Summary: The variant c.1268G>T; p.Gly423Val is associated with a complete response to first-line therapy, indicating its potential predictive value for treatment response. Evidence Type: Oncogenic | Mutation: c.1268G>T; p.Gly423Val | Summary: The presence of the FBXW7 variant c.1268G>T; p.Gly423Val suggests a role in tumor development or progression, supporting its classification as oncogenic.

Gene→Variant (gene-first): 55294:c.1268G>T 55294:p.Gly423Val

Genes: 55294

Variants: c.1268G>T p.Gly423Val

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: c.1798G>A (p.Asp600Asn) | Summary: The c.1798G>A variant is associated with a shorter progression-free survival (PFS) in patients, indicating a potential prognostic role. Evidence Type: Oncogenic | Mutation: c.1513C>T (p.Arg505Cys) | Summary: The c.1513C>T variant has been reported in several cancer types and is associated with loss of function of the protein, suggesting both oncogenic potential and functional impact.

Gene→Variant (gene-first): 55294:c.1513C>T 1956:c.1798G>A 55294:p.Arg505Cys 673:p.Asp600Asn

Genes: 55294 1956 673

Variants: c.1513C>T c.1798G>A p.Arg505Cys p.Asp600Asn

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 13

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.638_639insA | Summary: The insertion mutation in NF1 leads to a premature stop codon, contributing to tumor development through loss of function and increased activation of the RAS signaling pathway. Evidence Type: Oncogenic | Mutation: c.5101A>T | Summary: The SNV in NF1 results in a premature stop codon, which is associated with tumor progression due to loss of function and enhanced RAS signaling. Evidence Type: Functional | Mutation: c.638_639insA | Summary: This insertion mutation alters the molecular function of NF1 by creating a premature stop codon, leading to loss of function. Evidence Type: Functional | Mutation: c.5101A>T | Summary: The SNV creates a premature stop codon in NF1, affecting its molecular function and resulting in loss of regulatory control over the RAS pathway.

Gene→Variant (gene-first): 4763:c.5101A>T 4763:c.638_639insA 4763:p.Asn214Lys fs*2 4763:p.Lys1701Ter

Genes: 4763

Variants: c.5101A>T c.638_639insA p.Asn214Lys fs*2 p.Lys1701Ter

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G in the MAP2K1 gene results in a substitution that alters the molecular function of the MEK1 protein, leading to a gain of function. Evidence Type: Oncogenic | Mutation: c.169A>G; p.Lys57Glu | Summary: The variant c.169A>G is associated with a gain of function in the MEK1 protein, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 5604:c.169A>G 5604:p.Lys57Glu

Genes: 5604

Variants: c.169A>G p.Lys57Glu

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.183A>T; p.Gln61His | Summary: The KRAS variant (c.183A>T; p.Gln61His) was identified in tumor tissue, indicating its potential role in tumor development or progression. Evidence Type: Functional | Mutation: c.183A>T; p.Gln61His | Summary: The variant is associated with molecular alterations, as it was confirmed through ddPCR analysis, suggesting it affects the biochemical function of the KRAS gene.

Gene→Variant (gene-first): 3845:c.183A>T 3845:p.Gln61His

Genes: 3845

Variants: c.183A>T p.Gln61His

[Paragraph-level] PMCID: PMC6627713 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.275_276insGGCC | Summary: The variant c.275_276insGGCC in TP53 is associated with tumor development or progression, contributing to oncogenic behavior. Evidence Type: Oncogenic | Mutation: c.837_838InsG | Summary: The variant c.837_838InsG in TP53 is implicated in tumor development or progression, indicating its oncogenic potential. Evidence Type: Oncogenic | Mutation: c.4467_4468insCATTTTG | Summary: The variant c.4467_4468insCATTTTG in APC is associated with tumor development or progression, suggesting it has oncogenic properties. Evidence Type: Oncogenic | Mutation: c.4098_4099delTCinsAT | Summary: The variant c.4098_4099delTCinsAT in APC contributes to tumor development or progression, indicating its role as an oncogenic variant. Evidence Type: Oncogenic | Mutation: c.589_590insGAGTT | Summary: The variant c.589_590insGAGTT in APC is linked to tumor development or progression, supporting its classification as an oncogenic variant.

Gene→Variant (gene-first): 7157:c.275_276insGGCC 324:c.4098_4099delTCinsAT 324:c.4467_4468insCATTTTG 324:c.589_590insGAGTT 324:c.837_838InsG

Genes: 7157 324

Variants: c.275_276insGGCC c.4098_4099delTCinsAT c.4467_4468insCATTTTG c.589_590insGAGTT c.837_838InsG

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 196_197insHP | Summary: The mutation in CEBPA (196_197insHP) was identified in a post-repotrectinib tumor biopsy, suggesting its potential role in tumor development or progression. Evidence Type: Oncogenic | Mutation: E171G | Summary: The TP53 mutation (E171G) was detected in the post-repotrectinib tumor biopsy, indicating its possible contribution to tumor progression. Evidence Type: Oncogenic | Mutation: H178Q | Summary: The TP53 mutation (H178Q) found in the post-repotrectinib tumor biopsy may play a role in tumor development or progression. Evidence Type: Oncogenic | Mutation: H179Y | Summary: The TP53 mutation (H179Y) identified in the post-repotrectinib tumor biopsy suggests its involvement in tumor progression. Evidence Type: Oncogenic | Mutation: H555R | Summary: The RB1 mutation (H555R) detected in the post-repotrectinib tumor biopsy indicates its potential role in tumor development. Evidence Type: Oncogenic | Mutation: R143Q | Summary: The ERBB2 mutation (R143Q) found in the post-repotrectinib tumor biopsy suggests its contribution to tumor progression.

Gene→Variant (gene-first): 1050:196_197insHP 7157:E171G 896:E253Q 2064:H178Q 7157:H179Y 5925:H555R 2064:R143Q

Genes: 1050 7157 896 2064 5925

Variants: 196_197insHP E171G E253Q H178Q H179Y H555R R143Q

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with a positive response to repotrectinib treatment in a patient with ROS1-rearranged NSCLC, indicating its predictive value for therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation is part of the CD74-ROS1 rearrangement, which contributes to tumor development in the context of ROS1-rearranged non-small cell lung cancer (NSCLC).

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The ROS1-G2032R mutation is associated with varying responses to different tyrosine kinase inhibitors (TKIs), indicating its predictive value for treatment outcomes with cabozantinib and lorlatinib. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The ROS1-G2032R mutation contributes to tumor growth in the YU1079 model, demonstrating its role in oncogenic processes.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC10283448 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: G2032R | Summary: The G2032R mutation is associated with resistance to crizotinib, and the passage indicates that repotrectinib can overcome this resistance, suggesting a predictive relationship with therapy response. Evidence Type: Oncogenic | Mutation: G2032R | Summary: The G2032R mutation in ROS1 is implicated in crizotinib resistance, indicating its role in tumor development or progression, thus supporting its classification as oncogenic.

Gene→Variant (gene-first): 6098:G2032R

Genes: 6098

Variants: G2032R

[Paragraph-level] PMCID: PMC3260002 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: R882H | Summary: The R882H mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882C | Summary: The R882C mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: R882P | Summary: The R882P mutation in DNMT3A is associated with tumor development or progression in AML patients. Evidence Type: Oncogenic | Mutation: W893S | Summary: The W893S mutation in DNMT3A is associated with tumor development or progression in AML patients.

Gene→Variant (gene-first): 1788:R882 1788:R882C 1788:R882H 1788:R882P 1788:W893 1788:W893S

Genes: 1788

Variants: R882 R882C R882H R882P W893 W893S

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is associated with tumor development in the context of non-small cell lung cancer (NSCLC) patients, indicating its role as a somatic variant contributing to cancer progression. Evidence Type: Oncogenic | Mutation: V600E | Summary: The V600E mutation in BRAF is implicated in tumor development, as it was detected in colon cancer cases, suggesting its role as a somatic variant contributing to cancer progression.

Gene→Variant (gene-first): 1956:T790M 673:V600E

Genes: 1956 673

Variants: T790M V600E

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 4

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 7157:c.3082+811A TTTTAACA > GGTTTGAT

Genes: 7157

Variants: c.3082+811A TTTTAACA > GGTTTGAT

[Paragraph-level] PMCID: PMC4695055 Section: RESULTS PassageIndex: 2

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.982_1028del47 | Summary: The mutation p.982_1028del47 is associated with the detection of a METex14del transcript, indicating a potential alteration in molecular function related to the MET gene. Evidence Type: Oncogenic | Mutation: p.982_1028del47 | Summary: The presence of the METex14del mutation (p.982_1028del47) suggests a contribution to tumor development or progression, as it is being screened in a cohort of cancer patients.

Gene→Variant (gene-first): 4916:p.982_1028del47

Genes: 4916

Variants: p.982_1028del47

[Paragraph-level] PMCID: PMC4884999 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: G12C | Summary: The G12C mutation in KRAS is identified as a common mutation occurring in codon 12, which contributes to tumor development or progression in lung cancer.

Gene→Variant (gene-first): 3845:G12C

Genes: 3845

Variants: G12C

[Paragraph-level] PMCID: PMC7568619 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L1196Q | Summary: The L1196Q mutation in ALK was identified after alectinib resistance developed, leading to the prescription of a newer ALK inhibitor, ceritinib, which resulted in a partial response in the patient. Evidence Type: Oncogenic | Mutation: L1196Q | Summary: The L1196Q mutation is associated with the development of resistance to ALK inhibitors, indicating its role in tumor progression in the context of inflammatory myofibroblastic tumors.

Gene→Variant (gene-first): 238:L1196Q

Genes: 238

Variants: L1196Q

[Paragraph-level] PMCID: PMC3422615 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Prognostic, Diagnostic

Summary: Evidence Type: Oncogenic | Mutation: K27M | Summary: The K27M-H3.3 mutation is prevalent in pediatric glioblastomas and contributes to tumor development, defining clinically and biologically distinct subgroups. Evidence Type: Prognostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is universally associated with short survival in DIPG, indicating its prognostic significance in disease outcome. Evidence Type: Diagnostic | Mutation: K27M | Summary: The K27M-H3.3 mutation is used to define clinically and biologically distinct subgroups in pediatric glioblastomas, supporting its role in diagnostic testing.

Gene→Variant (gene-first): 3021:G34V 3021:G34V/R 3021:K27M

Genes: 3021

Variants: G34V G34V/R K27M

[Paragraph-level] PMCID: PMC3100313 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1 R132H mutation is identified as a somatic mutation that occurs frequently in gliomas and is implicated in tumorigenesis through its effects on enzyme function and the accumulation of D-2-hydroxyglutarate. Evidence Type: Functional | Mutation: R132H | Summary: The R132H mutation in IDH1 causes a loss of normal enzyme function and a gain-of-function, leading to the reduction of alpha-ketoglutarate to D-2-hydroxyglutarate, which alters the biochemical function of the enzyme.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC3100313 Section: RESULTS PassageIndex: 2

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: p.R132H | Summary: The heterozygous mutation p.R132H in IDH1 is associated with glioblastoma, indicating its contribution to tumor development or progression. Evidence Type: Functional | Mutation: p.R132H | Summary: The mutation p.R132H alters the molecular function of the IDH1 enzyme, which is relevant in the context of glioblastoma.

Gene→Variant (gene-first): 728294:R132 79944:arginine to histidine 728294:c.395G>A 3417:p.R132H

Genes: 728294 79944 3417

Variants: R132 arginine to histidine c.395G>A p.R132H

[Paragraph-level] PMCID: PMC2570525 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: AKT1 (E17K) | Summary: The AKT1 E17K mutation is reported as an activating mutation contributing to tumor development in breast, ovarian, and colorectal cancers, as well as melanoma. Evidence Type: Functional | Mutation: AKT3 (E17K) | Summary: The AKT3 E17K mutation results in the activation of AKT when expressed in human melanoma cells, indicating a change in molecular function.

Gene→Variant (gene-first): 207:AKT1 (E17K 207:E17K

Genes: 207

Variants: AKT1 (E17K E17K

[Paragraph-level] PMCID: PMC10161095 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: lysine-to-methionine | Summary: The lysine-to-methionine mutation at histone H3 lysine 27 (H3K27M) is associated with the development and progression of diffuse midline gliomas, contributing to the tumor's lethal characteristics. Evidence Type: Functional | Mutation: lysine-to-methionine | Summary: The H3K27M mutation alters histone modifications, impacting the function of the SWI/SNF complex and leading to changes in chromatin accessibility and gene expression.

Gene→Variant (gene-first): 3021:lysine 27 55193:lysine-to-methionine

Genes: 3021 55193

Variants: lysine 27 lysine-to-methionine

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: D1288N | Summary: The D1288N mutation is associated with MET TKI resistance, indicating its role in tumor development or progression. Evidence Type: Oncogenic | Mutation: L1195I | Summary: The L1195I mutation is known as a secondary mutation associated with MET TKI resistance, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: L1195V | Summary: The L1195V mutation is recognized as a secondary mutation linked to MET TKI resistance, playing a role in tumor development. Evidence Type: Oncogenic | Mutation: Y1230H | Summary: The Y1230H mutation is identified as a secondary mutation associated with MET TKI resistance, indicating its contribution to tumor progression.

Gene→Variant (gene-first): 79811:D1288N L1195I 79811:L1195V 79811:Y1230H 2064:c.1899-936_1946+520del

Genes: 79811 2064

Variants: D1288N L1195I L1195V Y1230H c.1899-936_1946+520del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: L858R | Summary: The L858R mutation in EGFR is associated with advanced LUAD and is relevant for predicting response to osimertinib therapy. Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation contributes to tumor development in advanced LUAD. Evidence Type: Oncogenic | Mutation: L755S | Summary: The L755S mutation is suggested as a potential resistance mechanism in the context of osimertinib treatment. Evidence Type: Oncogenic | Mutation: D769Y | Summary: The D769Y mutation is indicated as a possible resistance mechanism following treatment with osimertinib. Evidence Type: Oncogenic | Mutation: c.1899-32_1909del | Summary: The c.1899-32_1909del alteration is detected as a concurrent alteration in the context of resistance mechanisms after osimertinib progression.

Gene→Variant (gene-first): 2064:D769Y 2064:L755S 1956:L858R 2064:c.1899-32_1909del

Genes: 2064 1956

Variants: D769Y L755S L858R c.1899-32_1909del

[Paragraph-level] PMCID: PMC9859631 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: c.1899-880_1946+761del | Summary: The variant c.1899-880_1946+761del was detected in two patients, indicating its potential role in tumor development or progression. Evidence Type: Predictive | Mutation: c.1899-2A>G | Summary: The variant c.1899-2A>G was identified in a patient after treatment, suggesting a correlation with treatment response or resistance.

Gene→Variant (gene-first): 2064:c.1899-2A>G 2064:c.1899-880_1946+761del

Genes: 2064

Variants: c.1899-2A>G c.1899-880_1946+761del

[Paragraph-level] PMCID: PMC5111006 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The CHEK2 mutation p.R474C alters the tertiary structure of CHK2 by disrupting the salt bridge between p.R474 and p.E394, indicating its functional importance. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The homozygous CHEK2 variant p.R474C is suggested to be contributory to familial cancer, as inactivation of CHEK2 in mice led to cancers in multiple organs.

Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

Genes: 11200

Variants: p.R474 p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 18

Evidence Type(s): Diagnostic

Summary: Evidence Type: Diagnostic | Mutation: rs757110 | Summary: The variant rs757110 in ABCC8 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs5215 | Summary: The variant rs5215 in KCNJ11 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs5219 | Summary: The variant rs5219 in KCNJ11 is associated with diabetes or insulin secretion, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs2468844 | Summary: The variant rs2468844 in SAA2 is associated with carotid intima media thickness, indicating its role in defining or classifying a disease. Evidence Type: Diagnostic | Mutation: rs11703684 | Summary: The variant rs11703684 in PIWIL3 is associated with oligospermia, indicating its role in defining or classifying a disease.

Gene→Variant (gene-first): 440822:rs11703684 6289:rs2468844 3767:rs5215 3767:rs5219 6833:rs757110

Genes: 440822 6289 3767 6833

Variants: rs11703684 rs2468844 rs5215 rs5219 rs757110

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 17

Evidence Type(s): Predisposing

Summary: Evidence Type: Predisposing | Mutation: rs1042522 | Summary: The variant rs1042522 (TP53, p.P72R) is associated with Li-Fraumeni syndrome, indicating a potential inherited risk for disease. Evidence Type: Predisposing | Mutation: rs169547 | Summary: The variant rs169547 (BRCA2, p.V2466A) is linked to hereditary breast/ovarian cancer, suggesting it may confer inherited risk for disease.

Gene→Variant (gene-first): 7157:p.P72R 675:p.V2466A 7157:rs1042522 2956:rs1042821 4072:rs1126497 675:rs169547 5395:rs1805323 5395:rs2228006 4436:rs2303424

Genes: 7157 675 2956 4072 5395 4436

Variants: p.P72R p.V2466A rs1042522 rs1042821 rs1126497 rs169547 rs1805323 rs2228006 rs2303424

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The variant p.R474C alters the molecular function of CHK2, resulting in instability and poor activation by DNA damage compared to wild-type CHK2. Evidence Type: Oncogenic | Mutation: p.R474C | Summary: The variant p.R474C contributes to tumor development or progression by affecting the function of CHK2, a gene implicated in cell cycle regulation and DNA damage response.

Gene→Variant (gene-first): 11200:p.R474C

Genes: 11200

Variants: p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.R474C | Summary: The mutation p.R474C in CHK2 is associated with altered molecular function, specifically indicating that the protein is poorly activated in response to DNA damage.

Gene→Variant (gene-first): 11200:p.R474C

Genes: 11200

Variants: p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.R210 | Summary: The mutation p.R210 is described in the context of its interaction with the immunoglobulin Fc fragment, but it is noted that it is not well conserved and does not significantly affect the function or structure of the protein. Evidence Type: Functional | Mutation: p.R210Q | Summary: The mutation p.R210Q is mentioned as not likely to affect the function and structure of the protein, indicating a focus on its molecular function.

Gene→Variant (gene-first): 2217:p.R210 2217:p.R210Q

Genes: 2217

Variants: p.R210 p.R210Q

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 11

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.R474 | Summary: The mutation p.R474 is involved in forming a salt bridge that is crucial for protein stability, indicating its role in altering molecular function. Evidence Type: Functional | Mutation: p.R474C | Summary: The mutation p.R474C disrupts the salt bridge with p.E394, likely leading to protein instability and altering its molecular function.

Gene→Variant (gene-first): 11200:p.R474 11200:p.R474C

Genes: 11200

Variants: p.R474 p.R474C

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.R474 | Summary: The variant p.R474 of CHEK2 was analyzed for its impact on protein function, showing high conservation in homologs, which suggests a potential functional significance. Evidence Type: Functional | Mutation: p.R218 | Summary: The variant p.R218 of FCGRT was assessed for its effect on protein function, with lower conservation in homologs indicating a possible alteration in molecular function.

Gene→Variant (gene-first): 11200:p.R474

Genes: 11200

Variants: p.R474

[Paragraph-level] PMCID: PMC5111006 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: L858R | Summary: The L858R mutation in the EGFR gene is associated with tumor development in lung cancer, indicating its role as a somatic variant contributing to oncogenesis.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC6333965 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E545K | Summary: The PIK3CA E545K mutation is noted as a potentially targetable alteration, indicating its contribution to tumor development or progression. Evidence Type: Oncogenic | Mutation: R58X | Summary: The CDKN2A R58X mutation is also mentioned as a potentially targetable alteration, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 5290:E545K 1029:R58X

Genes: 5290 1029

Variants: E545K R58X

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: A>G | Summary: The A>G mutation is associated with the development of ccRCC precursor lesions in mice, indicating its role in tumor progression. Evidence Type: Oncogenic | Mutation: C>A | Summary: The C>A mutation is part of the frequent SNVs observed in human ccRCC, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: C>T | Summary: The C>T mutation is one of the most frequently occurring mutations in human ccRCC, indicating its potential role in oncogenesis. Evidence Type: Oncogenic | Mutation: G>A | Summary: The G>A mutation is included in the common classes of mutations found in human ccRCC, supporting its involvement in tumorigenesis. Evidence Type: Oncogenic | Mutation: G>T | Summary: The G>T mutation is part of the frequent SNVs in human ccRCC, suggesting its contribution to cancer development. Evidence Type: Oncogenic | Mutation: T>C | Summary: The T>C mutation is among the most frequently occurring mutations in human ccRCC, indicating its potential role in tumor progression.

Gene→Variant (gene-first): 7428:A>G 7428:C>A 7428:C>T 7428:G>A 7428:G>T 7428:T>C

Genes: 7428

Variants: A>G C>A C>T G>A G>T T>C

[Paragraph-level] PMCID: PMC5509015 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: Trp53 deletion | Summary: The deletion of Trp53 in mice contributes to tumor development, as evidenced by the increased incidence and earlier onset of tumors in VhlDelta/DeltaTrp53Delta/DeltaRb1Delta/Delta mice compared to other genotypes. Evidence Type: Functional | Mutation: Trp53 deletion | Summary: The functional deletion of Trp53 alters the molecular behavior of renal epithelial cells, leading to the development of cysts and dysplasia, indicating a change in cellular function associated with tumorigenesis.

Gene→Variant (gene-first): 7428:Trp53 deletion

Genes: 7428

Variants: Trp53 deletion

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional, Predictive, Oncogenic

Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with defective PI3K binding and Akt activation, indicating an alteration in molecular function related to signaling pathways. Evidence Type: Predictive | Mutation: K-RasG12D | Summary: The sensitivity of Ba/F3 cells expressing K-RasG12D to MEK inhibition suggests that this mutation correlates with response to specific therapies, indicating predictive value. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to the transformed, cytokine-independent growth of Ba/F3 cells, indicating its role in tumor development.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras shows a markedly reduced interaction with FLAG-p110alpha, indicating an alteration in molecular function. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation is associated with a profound reduction in binding to FLAG-p110alpha, suggesting its role in tumor development or progression. Evidence Type: Functional | Mutation: Y64G | Summary: The Y64G mutation in K-Ras, when combined with K-RasG12D, results in a significantly reduced binding to FLAG-p110alpha, indicating an alteration in molecular function.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D 5290:Y64G

Genes: 5295 3845 5290

Variants: A66dup K-RasG12D Y64G

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters molecular function, as indicated by the increased levels of pERK and pAkt in response to its expression in Ba/F3 cells. Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation contributes to tumor development or progression, as it is associated with elevated signaling pathways indicative of oncogenic activity.

Gene→Variant (gene-first): 3845:K-RasG12D

Genes: 3845

Variants: K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation. Evidence Type: Oncogenic | Mutation: A66dup | Summary: The A66dup variant contributes to tumor development by transforming IL-3-dependent Ba/F3 cells to cytokine-independent growth. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup variant alters molecular function by increasing levels of Ras-GTP in Ba/F3 cells under serum deprivation.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation alters the biochemical properties of K-Ras, leading to impaired intrinsic GTPase activity and increased accumulation in the active GTP conformation. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation exhibits resistance to GAP stimulation and altered GTPase activity, indicating a change in molecular function.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: Glutamine 61; Q61 | Summary: The passage discusses potential effects on the molecular function of Glutamine 61 (Q61) due to structural changes from switch 2 insertions, indicating alterations in protein-protein interactions and the GTP conformation of Ras. Evidence Type: Oncogenic | Mutation: Glutamine 61; Q61 | Summary: The analysis suggests that alterations involving Q61 may contribute to tumor development or progression by favoring the GTP conformation of Ras, which is associated with oncogenic activity.

Gene→Variant (gene-first): 3845:Glutamine 61 3845:Q61

Genes: 3845

Variants: Glutamine 61 Q61

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: K-RasG12D | Summary: The K-RasG12D mutation induces cytokine-independent colony formation and contributes to tumor development by promoting hypersensitive growth patterns in hematopoietic progenitor cells. Evidence Type: Functional | Mutation: K-RasG12D | Summary: The K-RasG12D mutation alters the growth response of myeloid progenitors to GM-CSF, indicating a change in molecular function related to colony formation. Evidence Type: Functional | Mutation: A66dup | Summary: The A66dup mutation in K-Ras insertion variants sensitizes myeloid progenitors to GM-CSF, suggesting an alteration in biochemical function related to growth response.

Gene→Variant (gene-first): 5295:A66dup 3845:K-RasG12D

Genes: 5295 3845

Variants: A66dup K-RasG12D

[Paragraph-level] PMCID: PMC4748120 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.178_198dup | Summary: The c.178_198dup variant is a partial duplication of the switch 2 domain of K-Ras, which is associated with juvenile myelomonocytic leukaemia (JMML) and contributes to tumor development. Evidence Type: Oncogenic | Mutation: c.184_198dup | Summary: The c.184_198dup variant is a tandem duplication found in lung adenocarcinomas and colorectal cancer, indicating its role in tumor progression.

Gene→Variant (gene-first): 3845:c.178_198dup 3845:c.184_198dup

Genes: 3845

Variants: c.178_198dup c.184_198dup

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 14

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: T790M | Summary: The EGFR T790M mutation is maintained in osimertinib-resistant RPC-9/OsiR cells, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 1956:C797S 1956:T790M

Genes: 1956

Variants: C797S T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with gefitinib resistance in lung adenocarcinoma, indicating its role in tumor development and progression. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation in EGFR is implicated in gefitinib resistance in lung adenocarcinoma, contributing to tumor development and progression.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 8

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19del mutation is associated with the development of resistance in lung cancer cells, indicating its role in tumor progression.

Gene→Variant (gene-first): 1956:19del

Genes: 1956

Variants: 19del

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: C797S | Summary: The C797S mutation is associated with resistance to osimertinib, indicating its role in therapy response. Evidence Type: Oncogenic | Mutation: C797S | Summary: The C797S mutation contributes to tumor progression by conferring resistance to EGFR-TKIs, which is a characteristic of oncogenic behavior.

Gene→Variant (gene-first): 1956:C797S

Genes: 1956

Variants: C797S

[Paragraph-level] PMCID: PMC5792548 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: 19del | Summary: The EGFR exon 19 deletion (19del) is associated with tumor development and progression in lung cancer, as indicated by its presence in both naive and acquired gefitinib-resistant cell lines. Evidence Type: Oncogenic | Mutation: T790M | Summary: The T790M mutation is implicated in tumor development and progression, as it is found in acquired gefitinib-resistant lung cancer cells, indicating its role in resistance mechanisms.

Gene→Variant (gene-first): 1956:19del 1956:T790M

Genes: 1956

Variants: 19del T790M

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with a partial or complete response to treatment with FGFR TKIs, indicating its correlation with drug efficacy. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation is identified as the most frequent mutation of FGFR3, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2261:S249C

Genes: 2261

Variants: S249C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 21

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: E542K | Summary: The mutation E542K is described as an oncogenic mutation that contributes to tumor development or progression when co-mutated with PIK3CA. Evidence Type: Oncogenic | Mutation: E545K | Summary: The mutation E545K is identified as an oncogenic mutation that plays a role in tumor development or progression in conjunction with PIK3CA. Evidence Type: Oncogenic | Mutation: H1047R | Summary: The mutation H1047R is classified as an oncogenic mutation, indicating its contribution to tumor development or progression when occurring alongside PIK3CA.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047R

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic, Predictive

Summary: Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with transforming activities in cancer cells, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: K650E | Summary: The K650E mutation, when combined with S249C, shows stronger transforming activities than each single mutation, suggesting its contribution to tumor progression. Evidence Type: Oncogenic | Mutation: K650M | Summary: The K650M mutation, in combination with S249C, exhibits enhanced transforming activities, supporting its role in oncogenesis. Evidence Type: Predictive | Mutation: Y373C | Summary: The Y373C mutation, when combined with S249C, does not significantly affect sensitivity to E7090 and erdafitinib, indicating its potential role in treatment response dynamics.

Gene→Variant (gene-first): 2261:K650E 2261:K650M 2261:S249C 2261:Y373C

Genes: 2261

Variants: K650E K650M S249C Y373C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 16

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: N546K | Summary: The variant FGFR1 N546K was associated with a lack of effectiveness of E7090 and erdafitinib in suppressing tumor growth, indicating a potential resistance to these therapies. Evidence Type: Predictive | Mutation: N549K | Summary: Tumors with the FGFR2 N549K variant exhibited a better response to treatment with E7090 compared to erdafitinib, suggesting a correlation with therapy effectiveness. Evidence Type: Predictive | Mutation: R248C | Summary: The FGFR3 R248C variant showed significant antitumor activity against tumors treated with E7090, indicating a potential sensitivity to this therapy. Evidence Type: Predictive | Mutation: K650N | Summary: The FGFR3 K650N variant was associated with significantly decreased tumor volumes in response to both E7090 and erdafitinib, indicating a favorable response to these therapies. Evidence Type: Predictive | Mutation: K650M | Summary: The drug responses of tumors with the FGFR3 K650M variant were similar to those recorded in vitro, suggesting a correlation with therapy effectiveness.

Gene→Variant (gene-first): 2261:K650M 2261:K650N 2260:N546K 2263:N549K 2261:R248C

Genes: 2261 2260 2263

Variants: K650M K650N N546K N549K R248C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: K650M | Summary: The K650M mutation in FGFR3 shows a correlation with response to the FGFR TKI E7090, indicating its predictive value for therapy response. Evidence Type: Predictive | Mutation: K650N | Summary: The K650N mutation in FGFR3 demonstrates decreased phosphorylation at lower concentrations of the FGFR TKI E7090, suggesting its predictive relevance for therapy response.

Gene→Variant (gene-first): 2261:K650M 2261:K650N

Genes: 2261

Variants: K650M K650N

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 13

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: G12V | Summary: The KRAS G12V variant is associated with resistance to all FGFR inhibitors, indicating its predictive role in therapy response. Evidence Type: Predictive | Mutation: N546K | Summary: The FGFR1 N546K variant is included in a cluster that is relatively resistant to all FGFR inhibitors, suggesting its predictive significance in treatment response. Evidence Type: Predictive | Mutation: N549D/K | Summary: The FGFR N549D/K variants are part of a cluster that shows resistance to all FGFR inhibitors, highlighting their predictive value in therapy response.

Gene→Variant (gene-first): 3845:G12V 2260:N546K 2263:N549D/K

Genes: 3845 2260 2263

Variants: G12V N546K N549D/K

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: N549D | Summary: The N549D variant in FGFR2 is associated with different drug sensitivities to FGFR inhibitors, indicating a correlation with treatment response. Evidence Type: Predictive | Mutation: N549H | Summary: The N549H variant in FGFR2 shows varying drug sensitivities to FGFR inhibitors, suggesting its role in influencing treatment response. Evidence Type: Predictive | Mutation: K656E | Summary: The K656E variant in FGFR3 is linked to different sensitivities to FGFR inhibitors, indicating its potential impact on treatment response. Evidence Type: Predictive | Mutation: K656M | Summary: The K656M variant in FGFR3 demonstrates varying drug sensitivities to FGFR inhibitors, suggesting its relevance in treatment response. Evidence Type: Predictive | Mutation: K656N | Summary: The K656N variant in FGFR3 is associated with different drug sensitivities to FGFR inhibitors, indicating its role in influencing treatment response.

Gene→Variant (gene-first): 2263:K656 2263:K656E/M 2263:N549 2263:N549D/H

Genes: 2263

Variants: K656 K656E/M N549 N549D/H

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 11

Evidence Type(s): Predictive

Summary: Evidence Type: Predictive | Mutation: N546K | Summary: The N546K variant is associated with resistance to FGFR TKIs, indicating its role in predicting drug sensitivity. Evidence Type: Predictive | Mutation: N549D/K | Summary: The N549D/K variant shows relative resistance to FGFR TKIs, suggesting its predictive value for treatment response. Evidence Type: Predictive | Mutation: N535K | Summary: The N535K variant is sensitive to the FGFR4 inhibitor H3B-6527, indicating its predictive role in therapy response.

Gene→Variant (gene-first): 2264:N535K 2260:N546K 2263:N549D/K 2263:V550L

Genes: 2264 2260 2263

Variants: N535K N546K N549D/K V550L

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: R248H | Summary: The R248H variant is described as a non-oncogenic variant, indicating that it does not contribute to tumor development or progression compared to oncogenic variants.

Gene→Variant (gene-first): 1956:R248H

Genes: 1956

Variants: R248H

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 7

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: N549H | Summary: The N549H variant in FGFR2 exhibits significant transforming activity, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: K659E | Summary: The K659E variant in FGFR2 shows significant transforming activity, contributing to tumor progression. Evidence Type: Oncogenic | Mutation: W290C | Summary: The W290C variant in FGFR2 demonstrates significant oncogenic potential compared to wild-type FGFR2. Evidence Type: Oncogenic | Mutation: S342F | Summary: The S342F variant in FGFR4 exhibits significant oncogenicity, indicating its contribution to tumor development. Evidence Type: Oncogenic | Mutation: R248C | Summary: The R248C variant in FGFR3 is located in the ligand binding site and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C variant in FGFR3 is located in the ligand binding site and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: G370C | Summary: The G370C variant in FGFR3 is located in the transmembrane domain and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: S371C | Summary: The S371C variant in FGFR3 is located in the transmembrane domain and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: Y373C | Summary: The Y373C variant in FGFR3 is located in the transmembrane domain and is associated with oncogenic mutations. Evidence Type: Oncogenic | Mutation: G380E/R | Summary: The G380E/R variant in FGFR3 is located in the transmembrane domain and contributes to oncogenic behavior. Evidence Type: Oncogenic | Mutation: K650E/M | Summary: The K650E/M variant in FGFR3 is located in the kinase domain and is associated with oncogenic mutations.

Gene→Variant (gene-first): 2261:G370C 2261:G380E/R 2261:K650E/M 2263:K659E 2263:N549H 2261:R248C 2261:S249C 6867:S342F 2261:S371C 2263:W290C 2261:Y373C

Genes: 2261 2263 6867

Variants: G370C G380E/R K650E/M K659E N549H R248C S249C S342F S371C W290C Y373C

[Paragraph-level] PMCID: PMC8285406 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K656E | Summary: The K656E mutation in the FGFR1 tyrosine kinase domain is reported as an oncogenic mutation frequently discovered in glioma. Evidence Type: Oncogenic | Mutation: N546K | Summary: The N546K mutation in the FGFR1 tyrosine kinase domain is identified as an oncogenic mutation commonly found in glioma. Evidence Type: Oncogenic | Mutation: S252W | Summary: The S252W mutation in FGFR2, located in the ligand-binding region, is recognized as an oncogenic hotspot mutation in endometrial cancers. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is noted as an oncogenic hotspot mutation in bladder cancer. Evidence Type: Oncogenic | Mutation: V550L | Summary: The V550L mutation in FGFR4, located in the tyrosine kinase domain, is reported as an oncogenic mutation in rhabdomyosarcoma.

Gene→Variant (gene-first): 2260:K656E 2260:N546K 2261:S249C 2263:S252W 2263:V550L

Genes: 2260 2261 2263

Variants: K656E N546K S249C S252W V550L

[Paragraph-level] PMCID: PMC8203843 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: R132H | Summary: The R132H variant is associated with sensitivity to PARP inhibitors, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: R132H | Summary: The R132H variant contributes to tumor development or progression, as it is implicated in cancer-related pathways.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC8255005 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Prognostic, Predictive, Oncogenic

Summary: Evidence Type: Prognostic | Mutation: D835 | Summary: The D835 mutation is associated with poor prognosis in acute myeloid leukemia (AML). Evidence Type: Predictive | Mutation: F691L | Summary: The F691L mutation is described as a "gatekeeper" mutation that is resistant to most available FLT3 inhibitors, indicating its role in treatment resistance. Evidence Type: Oncogenic | Mutation: D835Y | Summary: The D835Y mutation is part of the FLT3-TKD mutations that contribute to tumor development and progression in AML. Evidence Type: Oncogenic | Mutation: F691 | Summary: The F691 mutation is implicated in the resistance to FLT3 inhibitors and contributes to tumor progression in AML.

Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691 2322:F691L

Genes: 2322

Variants: D835 D835Y F691 F691L

[Paragraph-level] PMCID: PMC7785563 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Predisposing, Functional

Summary: Evidence Type: Oncogenic | Mutation: R132H | Summary: The IDH1-R132H mutation is associated with conventional supratentorial IDH-mutant astrocytomas, indicating its role in tumor development or progression. Evidence Type: Predisposing | Mutation: MSH2 (germline) | Summary: The presence of a known deleterious germline MSH2 mutation in cases diagnosed with Lynch syndrome suggests an inherited risk for colorectal cancer. Evidence Type: Predisposing | Mutation: MSH6 (germline) | Summary: The identification of germline mutations in MSH6 in several tumors indicates a hereditary predisposition to MMR-deficiency syndromes, including Lynch syndrome. Evidence Type: Functional | Mutation: MSH6 | Summary: The tumor cell-specific loss of MSH6 expression in one case suggests that the mutation alters the molecular function of the MMR pathway, contributing to tumorigenesis.

Gene→Variant (gene-first): 3417:R132H

Genes: 3417

Variants: R132H

[Paragraph-level] PMCID: PMC10527017 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Summary: Evidence Type: Oncogenic | Mutation: V777L | Summary: The HER2V777L mutation contributes to tumor development and progression in breast cancer, as evidenced by accelerated tumor formation and increased invasion in genetically engineered mice. Evidence Type: Predictive | Mutation: V777L | Summary: The HER2V777L mutation is associated with resistance to the pan-HER tyrosine kinase inhibitor neratinib, indicating its predictive value for therapy response. Evidence Type: Functional | Mutation: V777L | Summary: The HER2V777L mutation alters molecular function, as indicated by changes in gene expression and cell cycle markers in breast cancer organoids.

Gene→Variant (gene-first): 2064:V777L

Genes: 2064

Variants: V777L

[Paragraph-level] PMCID: PMC4821611 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: p.C1156Y | Summary: The ALK mutation p.C1156Y was detected in post-treatment tumor samples, indicating its contribution to tumor development or progression, particularly in the context of crizotinib resistance. Evidence Type: Oncogenic | Mutation: p.G1269A | Summary: The ALK mutation p.G1269A was also found in post-treatment tumor samples, suggesting its role in tumor development or progression related to crizotinib resistance.

Gene→Variant (gene-first): 238:p.C1156Y 238:p.G1269A

Genes: 238

Variants: p.C1156Y p.G1269A

[Paragraph-level] PMCID: PMC4821611 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Summary: Evidence Type: Predictive | Mutation: p.C1156Y | Summary: The mutation p.C1156Y in the ALK gene has been reported to confer resistance against crizotinib, indicating a correlation with treatment response. Evidence Type: Oncogenic | Mutation: p.C1156Y | Summary: The mutation p.C1156Y contributes to tumor development or progression as it is found in a significant percentage of RNA-seq reads in patient #1. Evidence Type: Oncogenic | Mutation: p.G1269A | Summary: The mutation p.G1269A is present in 100% of the RNA-seq reads in patient #3, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 238:c.3467G>A 238:c.3806G>C 238:p.C1156Y 238:p.G1269A

Genes: 238

Variants: c.3467G>A c.3806G>C p.C1156Y p.G1269A

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with altered cell cycle distribution and viability, indicating a change in molecular function related to PLCgamma1 signaling. Evidence Type: Functional | Mutation: Y762F | Summary: The Y762F mutation, when combined with S249C, shows an increase in cell numbers at confluence, suggesting it also alters molecular function in the context of FGFR3 signaling. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation is linked to reduced viability and saturation density in TERT-NHUC cells, indicating a functional impact on cell behavior.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

Genes: 2261

Variants: K652E S249C Y762F

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation is associated with a lack of constitutive PLCgamma1 phosphorylation, suggesting it alters molecular function related to PLCgamma1 signaling. Evidence Type: Oncogenic | Mutation: S249C | Summary: The S249C mutation in FGFR3 is linked to morphological transformation, increased proliferation, and colony formation in soft agar, indicating its role in tumor development. Evidence Type: Oncogenic | Mutation: Y762F | Summary: The Y762F mutation, when combined with S249C, contributes to morphological transformation and increased proliferation in NIH-3T3 cells, supporting its oncogenic potential.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y762F

Genes: 2261

Variants: K652E S249C Y762F

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation exhibits complete ligand-independence, failing to stimulate signaling in response to FGF1 treatment. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation shows a small increase in ERK1/2 activation in response to FGF1 treatment, indicating altered molecular function. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation displays increased phosphorylation of PLCgamma1, ERK1/2, and FRS2alpha in response to FGF1 treatment, suggesting a significant alteration in molecular function.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 exhibits strong constitutive phosphorylation, indicating a change in molecular function that leads to ligand-independence. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 shows increased levels of phosphorylation in response to ligand stimulation, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 also demonstrates increased phosphorylation levels in response to ligand stimulation, indicating a change in molecular function.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 was associated with increased phosphorylation of PLCgamma1, indicating an alteration in molecular function. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 was linked to increased phosphorylation of PLCgamma1, suggesting a change in biochemical function.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 15

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 alters the phosphorylation levels and activation state of the receptor, indicating a change in molecular function. Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 leads to ligand-independent dimerization, suggesting an alteration in molecular function. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 also results in ligand-independent dimerization, indicating a change in molecular function.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Summary: Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 is associated with altered molecular function, as indicated by the differential expression of regulators of cell survival affecting cell viability. Evidence Type: Oncogenic | Mutation: K652E | Summary: The K652E mutation in FGFR3 contributes to tumor development or progression, as suggested by its impact on cell viability in the context of mutant FGFR3 expression.

Gene→Variant (gene-first): 2261:K652E

Genes: 2261

Variants: K652E

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 alters the expression and phosphorylation of the retinoblastoma protein (RB) and increases CDK1 levels, indicating a change in molecular function related to cell cycle regulation. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 is associated with altered expression and phosphorylation of the retinoblastoma protein (RB) and increased CDK1 levels, suggesting a functional impact on cell cycle-related proteins. Evidence Type: Functional | Mutation: K652E | Summary: The K652E mutation in FGFR3 results in a distinct protein profile with low RB and intermediate CDK1 levels, indicating a change in molecular function compared to other mutants.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC2789045 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: S249C | Summary: The S249C mutation in FGFR3 is associated with increased cell viability at confluence compared to controls, indicating a potential alteration in molecular function. Evidence Type: Functional | Mutation: Y375C | Summary: The Y375C mutation in FGFR3 also shows increased cell viability at confluence, suggesting it alters molecular or biochemical function.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C