10,000 Matching Annotations
  1. Mar 2025
    1. Reviewer #2 (Public review):

      Summary:

      Carabalona and colleagues investigated the role of the membrane-deforming cytoskeletal regulator protein Abba (MTSS1L/MTSS2) in cortical development to better understand the mechanisms of abnormal neural stem cell mitosis. The authors used short hairpin RNA targeting Abba20 with a fluorescent reporter coupled with in utero electroporation of E14 mice to show changes to neural progenitors. They performed flow cytometry for in-depth cell cycle analysis of Abba-shRNA impact to neural progenitors and determined an accumulation in S phase. Using culture rat glioma cells and live imaging from cortical organotypic slides from mice in utero electroporated with Abba-shRNA, the authors found Abba played a prominent role in cytokinesis. They then used a yeast-two-hybrid screen to identify three high confidence interactors: Beta-Trcp2, Nedd9, and Otx2. They used immunoprecipitation experiments from E18 cortical tissue coupled with C6 cells to show Abba requirement for Nedd9 localization to the cleavage furrow/cytokinetic bridge. The authors performed an shRNA knockdown of Nedd9 by in utero electroporation of E14 mice and observed similar results as with the Abba-shRNA. They tested a human variant of Abba using in utero electroporation of cDNA and found disorganized radial glial fibers and misplaced, multipolar neurons, but lacked the impact of cell division seen in the shRNA-Abba model.

      Strengths:

      Fundamental question in biology about the mechanics of neural stem cell division.<br /> Directly connecting effects in Abba protein to downstream regulation of RhoA via Nedd9.<br /> Incorporation of human mutation in ABBA gene.<br /> Use of novel technologies in neurodevelopment and imaging.

      Weaknesses:

      Unexplored components of the pathway (such as what neurogenic populations are impacted by Abba mutation) and unleveraged aspects of their data (such as the live imaging) limit the scope of their findings and left significant questions about the effect of ABBA on radial glia development.

      (1) Claim of disorganized radial glial fibers lacks quantifications.<br /> -On page 11, the authors claim that knockdown of Abba lead to changes in radial glial morphology observed with vimentin staining. Here they claim misoriented apical processes, detached end feet, and decreased number of RGP cells in the VZ. However, they no not provide quantification of process orientation to better support their first claim. Measurements of radial glia fiber morphology (directionality, length) and of angle of division would be metrics that can be applied to data. Some of these analysis could be done in their time-lapse microscopy images, such as to quantify the number of cell division during their period of analysis (though that is short-15 hours).

      (2) Unclear where effect is:<br /> -in RG or neuroblasts? Is it in cell cleavage that results in accumulation of cells at VZ (as sometimes indicated by their data like in Fig 2A or 4D)? Interrogation of cell death (such as by cleaved caspase 3) would also help. Given their time lapse, can they identify what is happening to the RG fiber? The authors describe a change in "migration" but do not show evidence for this for either progenitor or neuroblast populations. Given they have nice time-lapse imaging data, could they visualize progenitor versus young neuron migration? Analysis of neuroblasts (such as with doublecortin expression in the tissue) would also help understand any issues in migration (of neurons v stem cells).<br /> -at cleaveage furrow? In abscission? There is high resolution data that highlights the cleavage furrow as the location of interest (fig 3A), however there is also data (fig 3B) to suggest Abba is expressed elsewhere as well and there is an overall soma decrease. More detail of the localization of Abba during the division process would be helpful-for example, could cleavage furrow proteins, such as Aurora B, co-localization (and potentially co-IP) help delineate subpopulations of Abba protein? Furthermore, the FRET imaging is unique way to connect their mutation with function-could they measure/quantify differences at furrow compared to rest of soma to further corroborate that Abba-associated RhoA effect was furrow-enriched?<br /> -The data highlights nicely that a furrow doesn't clearly form when ABBA expression and subsequent RhoA activity are decreased (in Fig 3 or 5A). Does this lead to cells that can't divide because of poor abscission, especially since "rounding" still occurs? Or abnormal progenitors (with loss of fiber or inability to support neuroblast migration)? Or abnormal progression of progenitors to neuroblasts?

      (3) Limited to a singular time point of mouse cortical development<br /> On page 13, the authors outline the results of their Y2H screen with the identification of three high confidence interactors. Notably, they used a E10.5-E12.5 mouse brain embryo library rather than one that includes E14, the age of their in utero electroporation mice. Many of the authors' claims focus on in utero electroporation of shRNA-Abba of E14 mice that are then evaluated at E16-18. Justification for the focus on this age range should be included to support that their findings can then be applied to all of mouse corticogenesis.

      (4) Detail of the effect of the human variant of the ABBA mutation in mouse is lacking.<br /> Their identification of the R671W mutation is interesting and the IUE model warrants more characterization, as they did with their original KD experiments.<br /> -Could they show that Abba protein levels are decreased (in either cell lines or electroporated tissue)?<br /> -While time-lapse morphology might not have been performed, more analysis on cell division phenotype (such as plane of division and radial glia morphology) would be helpful.

      The resubmission has addressed many of the questions raised.

      I have a few comments that should be addressed:

      (1) The authors maintain a deficit in "migration of immature neurons" which remains unsubstantiated. In their resonse, they state: "we believe that the data showing the accumulation of migrating electroporated cells in the ventricular (V) and subventricular (SV) zones provide compelling evidence of abnormal migration in ABBA-shRNA electroporated cells. "<br /> -Firstly, they do not demonstrate that it's immature neurons, not RGs, that are affected. Secondly, accumulation of cells at the V-SVZ could be due to soley the inability for the RGC to undergo mitosis, therefore remaining stuck"<br /> The commentary of migration, especially of neurons, should be modified.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript Xu et al. explores the regulation of the microtubule minus end protein CAMSAP2 localization to the Golgi by the Serine/threonine-protein kinase MARK2 (PAR1, PAR1B). The authors show that depletion of MARK2 alters Golgi morphology and diminishes CAMSAP2 localization to the Golgi apparatus. The authors combine mass spectroscopy and immunoprecipitation to show that CAMSAP2 is phosphorylated at S835 by MARK2, and that this phosphorylation regulates localization of CAMSAP2 at Golgi membranes. Further, the authors identify USO1 (p115) as the Golgi resident protein mediating CAMSAP2 recruitment to the Golgi apparatus following S835 phosphorylation.

      Impact:

      The Golgi apparatus is a key organelle in cell migration- post translationally modifying and sorting cargo for directed trafficking, acting as a signalling hub, whilst functioning as a nucleation site for microtubules. These functions are essential to establish cell polarity during migration, highlighting the importance of understanding how cells reorient their Golgi in response to different environmental cues.

      The study will be of interest to fundamental biologists investigating Golgi function, and positioning, particularly in the context of different cell migration settings. It may also interest scientists investigating the loss of polarity in cancer or the maintenance of epithelial tissue architecture. I am a cell biologist with expertise in cell trafficking, cytoskeleton, and cell migration- during processes spanning development, homeostasis and cancer.

      Comments on latest version:

      Labelling of graphs - many of the graphs are comparing HT1080 cells with two conditions: parental and KO i.e. Figure 2F, H, I. The labels the authors use are "HT1080 and CAMSAP2 KO". This is confusing and should be changed to "parental and CAMSAP2 KO", the cell type HT1080 could be listed in the figure legend or on the graph below the conditions. (Similar to the labelling in Figure 3 H, I where they use "control and siRNA").

      The method section needs improvement - particularly around analysis methods, and statistical details for experiments. I recommend a supplementary table outlining exactly where the data is from (pooled, biological/technical repeats, n definitions, tests of normality etc).

    1. Reviewer #2 (Public review):

      Summary:

      This work provides a comprehensive understanding of cellular immunity in bivalves. To precisely describe the hemocytes of the oyster C. gigas, the authors morphologically characterized seven distinct cell groups, which they then correlated with single-cell RNA sequencing analysis, also resulting in seven transcriptional profiles. They employed multiple strategies to establish relationships between each morphotype and the scRNAseq profile. The authors correlated the presence of marker genes from each cluster identified in scRNAseq with hemolymph fractions enriched for different hemocyte morphotypes. This approach allowed them to correlate three of the seven cell types, namely hyalinocytes (H), small granule cells (SGC), and vesicular cells (VC). A macrophage-like (ML) cell type was correlated through the expression of macrophage-specific genes and its capacity to produce reactive oxygen species. Three other cell types correspond to blast-like cells, including an immature blast cell type from which distinct hematopoietic lineages originate to give rise to H, SGC, VC, and ML cells. Additionally, ML cells and SGCs demonstrated phagocytic properties, with SGCs also involved in metal homeostasis. On the other hand, H cells, non-granular cells, and blast cells expressed antimicrobial peptides. This study thus provides a complete landscape of oyster hemocytes with functional validation linked to immune activities. This resource will be valuable for studying the impact of bacterial or viral infections in oysters.

      The main strength of this study lies in its comprehensive and integrative approach, combining single-cell RNA sequencing, cytological analysis, cell fractionation and functional assays to provide a robust characterization of hemocyte populations in Crassostrea gigas.

      (1) The innovative use of marker genes, quantifying their expression within specific cell fractions, allows for precise annotation of different cellular clusters, bridging the gap between morphological observations and transcriptional profiles.

      (2)The study provides detailed insights into the immune functions of different hemocyte types, including the identification of professional phagocytes, ROS-producing cells, and cells expressing antimicrobial peptides.

      (3) The identification and analysis of transcription factors specific to different hemocyte types and lineages offer crucial insights into cell fate determination and differentiation processes in oyster immune cells.

      (4) The authors significantly advance the understanding of oyster immune cell diversity by identifying and characterizing seven distinct hemocyte transcriptomic clusters and morphotypes.

      These strengths collectively make this study a significant contribution to the field of invertebrate immunology, providing a comprehensive framework for understanding oyster hemocyte diversity and function.

      Conclusion:

      The authors largely achieved their primary objective of providing a comprehensive characterization of oyster immune cells. They successfully integrated multiple approaches to identify and describe distinct hemocyte types. The correlation of these cell types with specific immune functions represents a significant advancement in understanding oyster immunity. The authors are aware of the limitations of their study, particularly with regards to the pseudotime analysis, which provides a conceptual framework for understanding lineage relationships but requires further experimental validation to confirm its findings.

      This study is likely to have a significant impact on the field of invertebrate immunology, particularly in bivalve research. It provides a new standard for comprehensive immune cell characterization in invertebrates. The identification of specific markers for different hemocyte types will facilitate future research on oyster immunity. The proposed model of hemocyte lineages, while requiring further validation, offers a framework for studying hematopoiesis in bivalves.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript reconsiders the "general form" of Hamilton's rule, in which "benefit" and "cost" are defined as regression coefficients. It points out that there is no reason to insist on Hamilton's rule of the form -c+br>0, and that, in fact, arbitrarily many terms (i.e. higher-order regression coefficients) can be added to Hamilton's rule to reflect nonlinear interactions. Furthermore, it argues that insisting on a rule of the form -c+br>0 can result in conditions that are true but meaningless and that statistical considerations should be employed to determine which form of Hamilton's rule is meaningful for a given dataset or model.

      Strengths:

      The point is an important one. While it is not entirely novel-the idea of adding extra terms to Hamilton's rule has arisen sporadically (Queller 1985, 2011; Fletcher & Zwick 2006; van Veelen et al. 2017)--it is very useful to have a systematic treatment of this point. I think the manuscript can make an important contribution by helping to clarify a number of debates in the literature. I particularly appreciate the heterozygote advantage example in the SI.

      Weaknesses:

      Although the mathematical analysis is rigorously done and I largely agree with the conclusions, I feel there are some issues regarding terminology, some regarding the state of the field, and the practice of statistics that need to be clarified if the manuscript is truly to resolve the outstanding issues of the field. Otherwise, I worry that it will in some ways add to the confusion.

      (1) The "generalized" Price equation: I agree that the equations labeled (PE.C) and (GPE.C) are different in a subtle yet meaningful way. But I do not see any way in which (GPE.C) is more general than (PE.C). That is, I cannot envision any circumstance in which (GPE.C) applies but (PE.C) does not. A term other than "generalized" should be used.

      (2) Regression vs covariance forms of the Price equation

      I think the author uses "generalized" in reference to what Price called the "regression form" of his equation. But to almost everyone in the field, the "Price Equation" refers to the covariance form. For this reason, it is very confusing when the manuscript refers to the regression form as simply "the Price Equation".

      As an example, in the box on p. 15, the manuscript states "The Price equation can be generalized, in the sense that one can write a variety of Price-like equations for a variety of possible true models, that may have generated the data." But it is not the Price equation (covariance form) that is being generalized here. It is only the regression that Price used that is being generalized.

      To be consistent with the field, I suggest the term "Price Equation" be used only to refer to the covariance form unless it is otherwise specified as in "regression form of the Price equation".

      (3) Sample covariance: The author refers to the covariance in the Price equation as "sample covariance". This is not correct, since sample covariance has a denominator of N-1 rather than N (Bessel's correction). The correct term, when summing over an entire population, is "population covariance". Price (1972) was clear about this: "In this paper we will be concerned with population functions and make no use of sample functions". This point is elaborated on by Frank (2012), in the subsection "Interpretation of Covariance".

      Of course, the difference is negligible when the population is large. However, the author applies the covariance formula to populations as small as N=2, for which the correction factor is significant.

      The author objects to using the term "population covariance" (SI, pp. 8-9) on the grounds that it might be misleading if the covariance, regression coefficients, etc. are used for inference because in this case, what is being inferred is not a population statistic but an underlying relationship. However, I am not convinced that statistical inference is or should be the primary use of the Price equation (see next point). At any rate, avoiding potential confusion is not a sufficient reason to use incorrect terminology.

      Relatedly, I suggest avoiding using E for the second term in the Price equation, since (as the ms points out), it is not the expectation of any random variable. It is a population mean. There is no reason not to use something like Avg or bar notation to indicate population mean. Price (1972) uses "ave" for average.

      I should add, however, that the distinction between population statistics vs sample statistics goes away for regression coefficients (e.g. b, c, and r in Hamilton's rule) since in this case, Bessel's correction cancels out.

      (4) Descriptive vs. inferential statistics

      When discussing the statistical quantities in the Price Equation, the author appears to treat them all as inferential statistics. That is, he takes the position that the population data are all generated by some probabilistic model and that the goal of computing the statistical quantities in the Price Equation is to correctly infer this model.

      It is worth pointing out that those who argue in favor of the Price Equation do not see it this way: "it is a mistake to assume that it must be the evolutionary theorist, writing out covariances, who is performing the equivalent of a statistical analysis." (Gardner, West, and Wild, 2011); "Neither data nor inferences are considered here" (Rousset 2015). From what I can tell, to the supporters of the Price equation and the regression form of Hamilton's rule, the statistical quantities involved are either population-level *descriptive* statistics (in an empirical context), or else are statistics of random variables (in a stochastic modeling context).

      In short, the manuscript seems to argue that Price equation users are performing statistical inference incorrectly, whereas the users insist that they are not doing statistical inference at all.

      The problem (and here I think the author would agree with me) arises when users of the Price equation go on to make predictive or causal claims that would require the kind of statistical analysis they claim not to be doing. Claims of the form "Hamilton's rule predicts.." or use of terms like "benefit" and "cost" suggest that one has inferred a predictive or causal relationship in the given data, while somehow bypassing the entire theory of statistical inference.

      There is also a third way to use the Price equation which is entirely unobjectionable: as a way to express the relationship between individual-level fitness and population-level gene frequency change in a form that is convenient for further algebraic manipulation. I suspect that this is actually the most common use of the Price equation in practice.

      For a paper that aims to clarify these thorny concepts in the literature, I think it is worth pointing out these different interpretations of statistical quantities in the Price equation (descriptive statistics vs inferential statistics vs algebraic manipulation). One can then critique the conclusions that are inappropriately drawn from the Price equation, which would require rigorous statistical inference to draw. Without these clarifications, supporters of the Price equation will again argue that this manuscript has misunderstood the purpose of the equation and that they never claimed to do inference in the first place.

      (5) "True" models

      Even if one accepts that the statistical quantities in the Price equation are inferential in nature, the author appears to go a step further by asserting that, even in empirical populations, there is a specific "true" model which it is our goal to infer. This assumption manifests at many points in the SI when the author refers to the "true model" or "true, underlying population structure" in the context of an empirical population.

      I do not think it is necessary or appropriate, in empirical contexts, to posit the existence of a Platonic "true" model that is generating the data. Real populations are not governed by mathematical models. Moreover, the goal of statistical inference is not to determine the "true model" for given data but to say whether a given statistical model is justified based on this data. Fitting a linear model, for example, does not rule out the possibility there may be higher-order interactions - it just means we do not have a statistical basis to infer these higher-order interactions from the data (say, because their p-scores are insignificant), and so we leave them out.

      What we can say is that if we apply the statistical model to data generated by a probabilistic model, and if these models match, then as the number of observations grows to infinity, the estimators in the statistical model converge to the parameters of the data-generating one. But this is a mathematical statement, not a statement about real-world populations.

      A resolution I suggest to points 3, 4, and 5 above is:<br /> *A priori, the statistical quantities in the Price Equation are descriptive statistics, pertaining only to the specific population data given.<br /> *If one wishes to impute any predictive power, generalizability, or causal meaning to these statistics, all the standard considerations of inferential statistics apply. In particular, one must choose a statistical model that is justified based on the given data. In this case, one is not guaranteed to obtain the standard (linear) Hamilton's rule and may obtain any of an infinite family of rules.<br /> *If one uses a model that is not justified based on the given data, the results will still be correct for the given population data but will lack any meaning or generalizability beyond that.<br /> *In particular, if one considers data generated by a probabilistic model, and applies a statistical model that does not match the data-generating one, the results will be misleading, and will not generalize beyond the randomly generated realization one uses.

      Of course, the author may propose a different resolution to points 3-5, but they should be resolved somehow. Otherwise, the terminology in the manuscript will be incorrect and the ms will not resolve confusion in the field.

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors use AlphaFold2 to identify potential binding partners of nuage localizing proteins.

      Strengths:

      The main strength of the paper is that the authors experimentally verify a subset of the predicted interactions.

      Many studies have been performed to predict protein-protein interactions in various subsets of proteins. The interesting story here is that the authors (i) focus on an organelle that contains quite some intrinsically disordered proteins and (ii) experimentally verify some (but not all) predictions.

      Weaknesses:

      Identification of pairwise interactions is only a first step towards understanding complex interactions. It is pretty clear from the predictions that some (but certainly not all) of the pairs could be used to build larger complexes. This is Done only for some cases and could be extended to the entire network.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, the authors investigate the molecular mechanism behind kinesin-1's coordinated movement along microtubules, with a focus on how ATP binding, hydrolysis, and microtubule attachment/detachment are regulated in the leading and trailing heads. Using pre-steady state kinetics and single-molecule assays, they show that the neck linker's conformation modulates nucleotide affinity and detachment rates in each head differently, establishing an asynchronous chemo-mechanical cycle that prevents simultaneous detachment. Supported by cryo-EM structural data, their findings suggest that strain-induced conformational changes in the nucleotide-binding pockets are crucial for kinesin's hand-over-hand movement, presenting a detailed kinetic model of its stepping mechanism. The manuscript is well-crafted, technically rigorous, and should be of significant interest to cell biology and cytoskeletal motor researchers.

      Significance:

      All conclusions are well-supported by the provided data. The findings address a critical gap in our understanding of how kinesin's two motor domains coordinate their movements, offering insights into the molecular basis of its stepping mechanism. This work should be of significant interest to the cytoskeletal research community.

      Comments on latest version:

      The authors have satisfactorily addressed my comments, although I recommend the addition of the following reference:

      Lu Rao, Jan O. Wirth, Jessica Matthias, and Arne Gennerich. 2025. A Two-Heads-Bound State Drives KIF1A Superprocessivity. bioRxiv 2025.01.14.632505

      This paper provides conclusive evidence that kinesin-1 predominantly adopts a one-head-bound state at limiting ATP concentrations and remains in this state for a significant portion of its enzymatic cycle even at saturating ATP. This limits its processivity compared to KIF1A, which predominantly adopts a two-heads-bound state under saturating ATP conditions. These findings directly support the authors' conclusion that trailing head dissociation is favored over leading head detachment.

    1. Reviewer #2 (Public review):

      This is an interesting study exploring methods for reconstructing visual stimuli from neural activity in the mouse visual cortex. Specifically, it uses a competition dataset (published in the Dynamic Sensorium benchmark study) and a recent winning model architecture (DNEM, dynamic neural encoding model) to recover visual information stored in ensembles of the mouse visual cortex.

      This is a great project - the physiological data were measured at a single-cell resolution, the movies were reasonably naturalistic and representative of the real world, the study did not ignore important correlates such as eye position and pupil diameter, and of course, the reconstruction quality exceeded anything achieved by previous studies. Overall, it is great that teams are working towards exploring image reconstruction. Arguably, reconstruction may serve as an endgame method for examining the information content within neuronal ensembles - an alternative to training interminable numbers of supervised classifiers, as has been done in other studies. Put differently, if a reconstruction recovers a lot of visual features (maybe most of them), then it tells us a lot about what the visual brain is trying to do: to keep as much information as possible about the natural world in which its internal motor circuits may act consequently.

      While we enjoyed reading the manuscript, we admit that the overall advance was in the range of those that one finds in a great machine learning conference proceedings paper. More specifically, we found no major technical flaws in the study, only a few potential major confounds (which should be addressable with new analyses), and the manuscript did not make claims that were not supported by its findings, yet the specific conceptual advance and significance seemed modest. Below, we will go through some of the claims, and ask about their potential significance.

      (1) The study showed that it could achieve high-quality video reconstructions from mouse visual cortex activity using a neural encoding model (DNEM), recovering 10-second video sequences and approaching a two-fold improvement in pixel-by-pixel correlation over attempts. As a reader, I am left with the question: okay, does this mean that we should all switch to DNEM for our investigations of the mouse visual cortex? What makes this encoding model special? It is introduced as "a winning model of the Sensorium 2023 competition which achieved a score of 0.301... single-trial correlation between predicted and ground truth neuronal activity," but as someone who does not follow this competition (most eLife readers are not likely to do so, either), I do not know how to gauge my response. Is this impressive? What is the best achievable score, in theory, given data noise? Is the model inspired by the mouse brain in terms of mechanisms or architecture, or was it optimized to win the competition by overfitting it to the nuances of the data set? Of course, I know that as a reader, I am invited to read the references, but the study would stand better on its own if clarified how its findings depended on this model.

      (2) Along those lines, two major conclusions were that "critical for high-quality reconstructions are the number of neurons in the dataset and the use of model ensembling." If true, then these principles should be applicable to networks with different architectures. How well can they do with other network types?

      (3) One major claim was that the quality of the reconstructions depended on the number of neurons in the dataset. There were approximately 8000 neurons recorded per mouse. The correlation difference between the reconstruction achieved by 1 neuron and 8000 neurons was ~0.2. Is that a lot or a little? One might hypothesize that ~7,999 additional neurons could contribute more information, but perhaps, those neurons were redundant if their receptive fields were too close together or if they had the same orientation or spatiotemporal tuning. How correlated were these neurons in response to a given movie? Why did so many neurons offer such a limited increase in correlation?

      (4) On a related note, the authors address the confound of RF location and extent. The study resorted to the use of a mask on the image during reconstruction, applied during training and evaluation (Line 87). The mask depends on pixels that contribute to the accurate prediction of neuronal activity. The problem for me is that it reads as if the RF/mask estimate was obtained during the very same process of reconstruction optimization, which could be considered a form of double-dipping (see the "Dead salmon" article, https://doi.org/10.1016/S1053-8119(09)71202-9). This could inflate the reconstruction estimate. My concern would be ameliorated if the mask was obtained using a held-out set of movies or image presentations; further, the mask should shift with eye position, if it indeed corresponded to the "collective receptive field of the neural population." Ideally, the team would also provide the characteristics of these putative RFs, such as their weight and spatial distribution, and whether they matched the biological receptive fields of the neurons (if measured independently).

      (5) We appreciated the experiments testing the capacity of the reconstruction process, by using synthetic stimuli created under a Gaussian process in a noise-free way. But this further raised questions: what is the theoretical capability for the reconstruction of this processing pipeline, as a whole? Is 0.563 the best that one could achieve given the noisiness and/or neuron count of the Sensorium project? What if the team applied the pipeline to reconstruct the activity of a given artificial neural network's layer (e.g., some ResNet convolutional layer), using hidden units as proxies for neuronal calcium activity?

      (6) As the authors mentioned, this reconstruction method provided a more accurate way to investigate how neurons process visual information. However, this method consisted of two parts: one was the state-of-the-art (SOTA) dynamic neural encoding model (DNEM), which predicts neuronal activity from the input video, and the other part reconstructed the video to produce a response similar to the predicted neuronal activity. Therefore, the reconstructed video was related to neuronal activity through an intermediate model (i.e., SOTA DNEM). If one observes a failure in reconstructing certain visual features of the video (for example, high-spatial frequency details), the reader does not know whether this failure was due to a lack of information in the neural code itself or a failure of the neuronal model to capture this information from the neural code (assuming a perfect reconstruction process). Could the authors address this by outlining the limitations of the SOTA DNEM encoding model and disentangling failures in the reconstruction from failures in the encoding model?

      (7) The authors mentioned that a key factor in achieving high-quality reconstructions was model assembling. However, this averaging acts as a form of smoothing, which reduces the reconstruction's acuity and may limit the high-frequency content of the videos (as mentioned in the manuscript). This averaging constrains the tool's capacity to assess how visual neurons process the low-frequency content of visual input. Perhaps the authors could elaborate on potential approaches to address this limitation, given the critical importance of high-frequency visual features for our visual perception.

    1. Reviewer #2 (Public review):

      Earhart et al. investigated the role of the complement system in trained innate immunity (TII) in alveolar macrophages (AM). They used a WT and C3 knockout murine model primed with locally administered heat-killed P. aeruginosa (HKPA). Additionally, they employed ex vivo AM training models using C3 knockout mice, where reconstitution of C3 and blockade of C3R were performed. The study concluded that the C3-C3R axis is essential for inducing TII in macrophages in the ex vivo model. The manuscript is well-written and easy to follow. However, I have the following major concerns.

      (1) The secondary challenge to assess the reprogramming of innate cells in the BAL was conducted 14 days after the initial exposure to HKPA. However, no evidence is provided to confirm that homeostasis was re-established following the primary exposure. Demonstrating the resolution of acute inflammation is essential to ensure that the observed responses to the secondary challenge are not confounded by persistent inflammation from the initial exposure.

      (2) In Figure 1D, cytokine production by BAL cells from WT and C3KO mice after HKPA exposure and LPS challenge is shown. However, it is unclear whether the reduced response in trained C3KO mice is due to a defect in trained immunity or an intrinsic inability of C3KO cells to respond to LPS. To clarify this, the response of trained C3KO cells should also be compared to untrained C3KO controls after the LPS challenge. This comparison is necessary to determine if the reduction is specifically related to innate immune memory or a broader impairment in LPS responsiveness. Such control should be included in all ex vivo training and LPS stimulation experiments as well.

      (3) The data presented provide evidence of alterations in the functional and metabolic activities of innate cells in the lung, indicating the induction of innate immune memory in a C3-C3R axis-dependent pathway. However, it remains to be established whether such changes can lead to altered disease outcomes. Therefore, the impact of these changes should be demonstrated, for instance, through an infection model to support the claim made in the study that C3 modulates trained immunity in AMs through C3aR signalling.

      (4) Figure 3, panels B and C - stats should be shown for comparing WT-HKPA-trained and C3KO HKPA-trained.

      (5) In Figure 4, where the proper untrained C3KO is included, the data presented in Figure 4C show an increase in basal and maximum glycolysis in trained C3KO compared to their untrained control counterparts. Statistical analysis should be provided for this comparison. Based on these data, it appears that metabolic reprogramming occurs even in the absence of C3. Furthermore, C3KO cells intrinsically exhibit reduced glycolytic capacity compared to WT. These observations challenge the conclusions made in the manuscript. Therefore, without the proper control (untrained C3KO) included in all experimental approaches, it is impossible to draw an evidence-based conclusion that the C3-C3R axis plays a role in the induction of innate immune memory.

      (6) The Results and Discussion sections should be separated, and the results should be thoroughly analyzed in the context of published literature. Separating these sections will allow for a clearer presentation of findings and ensure that the discussion provides a comprehensive interpretation of the data.

    1. Reviewer #2 (Public review):

      Summary

      This manuscript focuses on the role of social responsibility and guilt in social decision-making by integrating neuroimaging and computational modeling methods. Across two studies, participants completed a lottery task in which they made decisions for themselves or for a social partner. By measuring momentary happiness throughout the task, the authors show that being responsible for a partner's bad lottery outcome leads to decreased happiness compared to trials in which the participant was not responsible for their partner's bad outcome. At the neural level, this guilt effect was reflected in increased neural activity in the anterior insula, and altered functional connectivity between the insula and the inferior frontal gyrus. Using computational modeling, the authors show that trial-by-trial fluctuations in happiness were successfully captured by a model including participant and partner rewards and prediction errors (a 'responsibility' model), and model-based neuroimaging analyses suggested that prediction errors for the partner were tracked by the superior temporal sulcus. Taken together, these findings suggest that responsibility and interpersonal guilt influence social decision-making.

      Strengths

      This manuscript investigates the concept of guilt in social decision-making through both statistical and computational modeling. It integrates behavioral and neural data, providing a more comprehensive understanding of the psychological mechanisms. For the behavioral results, data from two different studies is included, and although minor differences are found between the two studies, the main findings remain consistent. The authors share all their code and materials, leading to transparency and reproducibility of their methods.

      The manuscript is well-grounded in prior work. The task design is inspired by a large body of previous work on social decision-making and includes the necessary conditions to support their claims (i.e., Solo, Social, and Partner conditions). The computational models used in this study are inspired by previous work and build on well-established economic theories of decision-making. The research question and hypotheses clearly extend previous findings, and the more traditional univariate results align with prior work.

      The authors conducted extensive analyses, as supported by the inclusion of different linear models and computational models described in the supplemental materials. Psychological concepts like risk preferences are defined and tested in different ways, and different types of analyses (e.g., univariate and multivariate neuroimaging analyses) are used to try to answer the research questions. The inclusion and comparison of different computational models provide compelling support for the claim that partner prediction errors indeed influence task behavior, as illustrated by the multiple model comparison metrics and the good model recovery.

      Weaknesses

      As the authors already note, they did not directly ask participants to report their feelings of guilt. The decrease in happiness reported after a bad choice for a partner might thus be something else than guilt, for example, empathy or feelings of failure (not necessarily related to guilt towards the other person). Although the patterns of neural activity evoked during the task match with previously found patterns of guilt, there is no direct measure of guilt included in the task. This warrants caution in the interpretation of these findings as guilt per se.

      As most comparisons contrast the social condition (making the decision for your partner) against either the partner condition (watching your partner make their decision) or the solo condition (making your own decision), an open question remains of how agency influences momentary happiness, independent of potential guilt. Other open questions relate to individual differences in interpersonal guilt, and how those might influence behavior.

      This manuscript is an impressive combination of multiple approaches, but how these different approaches relate to each other and how they can aid in answering slightly different questions is not very clearly described. The authors could improve this by more clearly describing the different methods and their added value in the introduction, and/or by including a paragraph on implications, open questions, and future work in the discussion.

      However, taken together, this study provides useful insights into the neural and behavioral mechanisms of responsibility and guilt in social decision-making, and how they influence behavior.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of a fed vs hungry state on food decision-making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings:

      Participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings redone at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by the current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes various conformational states and structural dynamics of the Insulin degrading enzyme (IDE), a zinc metalloprotease by nature. Both open and closed-state structures of IDE have been previously solved using crystallography and cryo-EM which reveal a dimeric organization of IDE where each monomer is organized into N and C domains. C-domains form the interacting interface in the dimeric protein while the two N-domains are positioned on the outer sides of the core formed by C-domains. It remains elusive how the open state is converted into the closed state but it is generally accepted that it involves large-scale movement of N-domains relative to the C-domains. The authors here have used various complementary experimental techniques such as cryo-EM, SAXS, size-exclusion chromatography, and enzymatic assays to characterize the structure and dynamics of IDE protein in the presence of substrate protein insulin whose density is captured in all the structures solved. The experimental structural data from cryo-EM suffered from a high degree of intrinsic motion among the different domains and consequently, the resultant structures were moderately resolved at 3-4.1 Å resolution. A total of five structures were generated by cryo-EM. The authors have extensively used Molecular dynamics simulation to fish out important inter-subunit contacts which involve R668, E381, D309, etc residues. In summary, authors have explored the conformational dynamics of IDE protein using experimental approaches which are complemented and analyzed in atomic details by using MD simulation studies. The studies are meticulously conducted and lay the ground for future exploration of the protease structure-function relationship.

    1. Reviewer #2 (Public review):

      Summary:<br /> In this manuscript, the authors investigate the potential for overexpressing BDNF in dental pulp stem cells to enhance dentin regeneration. They suggest that in the inflammatory environment of injured teeth, there is increased signaling of TrkB in response to elevated levels of inflammatory molecules.

      Strengths:<br /> The potential application to dentin regeneration is interesting.

      Weaknesses:<br /> There are a number of concerns with this manuscript to be addressed.

      (1) Insufficient citation of the literature. There is a vast literature on BDNF-TrkB regulating survival, development, and function of neurons, yet there is only one citation (Zhang et al 2012) which is on Alzheimer's disease.

      (2) There are several incorrect statements. For example, in the introduction (line 80) TrkA is not a BDNF receptor.

      (3) Most important - Specific antibodies must be identified by their RRID numbers. To state that "Various antibodies were procured:... from BioLegend" is unacceptable, and calls into question the entire analysis. Specifically, their Western blot in Figure 4B indicates a band at 28 kDa that they say is BDNF, however the size of BDNF is 14 kDa, and the size of proBDNF is 32 and 37 kDa, therefore it is not clear what they are indicating at 28 kDa. The validation is critical to their analysis of BDNF-expressing cells.

      (4) Figure 2 indicates increased expression of TrkB and TrkA, as well as their phosphorylated forms in response to inflammatory stimuli. Do these treatments elicit increased secretion of the ligands for these receptors, BDNF and NGF, respectively, to activate their phosphorylation? Or are they suggesting that the inflammatory molecules directly activate the Trk receptors? If so, further validation is necessary to demonstrate that.

      (5) Figure 7 - RNA-Seq data, what is the rationale for treatment with TNF+ CTX-B? How does this identify any role for TrkB signaling? They never define their abbreviations, but if CTX-B refers to cholera toxin subunit B, which is what it usually refers to, then it is certainly not a TrkB antagonist.

    1. Reviewer #2 (Public review):

      Summary:

      For decades, the macromolecular organization of photosynthetic complexes within the thylakoids of higher plant chloroplasts has been a topic of significant debate. Using focused ion beam milling, cryo-electron tomography, and advanced AI-based image analysis, the authors compellingly demonstrate that the macromolecular organization in spinach thylakoids closely mirrors the patterns observed in their earlier research on Chlamydomonas reinhardtii. Their findings provide strong evidence challenging long-standing assumptions about the existence of a 'grana margin'-a region at the interface between grana and stroma lamellae domains that was thought to contain intermixed particles from both areas. Instead, the study establishes that this mixed zone is absent and reveals a distinct, well-defined boundary between the grana and stroma lamellae.

      Strengths:

      By situating high-resolution structural data within the broader cellular context, this work contributes valuable insights into the molecular mechanisms governing the spatial organization of photosynthetic complexes within thylakoid membranes.

    1. Reviewer #2 (Public review):

      Summary:

      Bricknell and Latham investigate the computational benefits of a dual-learning algorithm that combines a rapid, millisecond-scale weight adjustment mechanism with a conventional, slower gradient descent approach. A feedback error signal drives both mechanisms at the synaptic level.

      Strengths:

      Integrating these two learning timescales is intriguing and demonstrates improved performance compared to classical strategies, particularly in terms of robustness and generalization when learning new target signals.

      Weaknesses:

      The biological plausibility and justification for the proposed rapid learning mechanism require further elaboration and supporting mechanistic examples.

    1. Reviewer #2 (Public review):

      It is my pleasure to review this manuscript from Stoffers, Lacin, and colleagues, in which they identify pairs of transcription factors unique to (almost) every ventral nerve cord hemilineage in Drosophila and use these pairs to create reagents to label and manipulate these cells. The advance is sold as largely technical-as a pipeline for identifying durably expressed transcription factor codes in postmitotic neurons from single cell RNAseq data, generating knock-in alleles in the relevant genes, using these to match transcriptional cell types to anatomic cell types, and then using the alleles as a genetic handle on the cells for downstream explication of their function. Yet I think the work is gorgeous in linking the expression of genes that are causal for neuron-type-specific characteristics to the anatomic instantiations of those neurons. It is astounding that the authors are able to use their deep collective knowledge of hemilineage anatomy and gene expression to match 33 of 34 transcriptional profiles. Together with other recent studies, this work drives a major course correction in developmental biology, away from empirically identified cell type "markers" (in Drosophila neuroscience, often genomic DNA fragments that contain enhancers found to be expressed in specific neurons at specific times), and towards methods in which the genes that generate neuronal type identity are actually used to study those neurons. Because the relationship between fate and form/function is built into the tools, I believe that this approach will be a trojan horse to integrate the fields of neural development and systems neuroscience.

    1. Reviewer #2 (Public review):

      Summary:

      Hurst et al. developed a new Tol2-based transgenesis system ImPaqT, an Immunological toolkit for PaqCl-based Golden Gate Assembly of Tol2 Transgenes, to facilitate the production of transgenic zebrafish lines. This Golden Gate assembly-based approach relies on only a short 4-base pair overhang sequence in their final construct, and the insertion construct and backbone vector can be assembled in a single-tube reaction using PaqCl and ligase. This approach can also be expandable by introducing new overhang sequences while maintaining compatibility with existing ImPaqT constructs, allowing users to add fragments as needed.

      Strengths:

      The generation of several lines of transgenic zebrafish for the immunologic study demonstrates the feasibility of the ImPaqT in vivo. The lineage tracing of macrophages by LPS injection shows this approach's functionality, validating its usage in vivo.

      Weaknesses:

      (1) There is no quantitative data analysis showing the percentage of off-target based on these 4-bp overhang sequences.

      (2) There is no statement for the upper limitation of the expandability.

      (3) There is no data about any potential side effect on their endogenous function of promoter/protein of interest with the ImPaqT method.

    1. Reviewer #2 (Public review):

      Summary:

      The authors developed an optogenetic tool (Opto-PKCε) and demonstrated spatiotemporal control of optoPKCε at different subcellular compartments such as the plasma membrane or mitochondria. Signaling outcomes of optoPKCε were characterized by phosphoproteomics and biochemical analysis of downstream signaling effectors.

      Strengths:

      (1) Conventional strategy to activate PKC often involves activation of multiple downstream signaling pathways. This work showcases an alternative strategy that could help dissect the effect of specific PKC-elicited signaling outcomes.

      (2) The differential phosphoproteomic analysis of PKC substrates between PMA stimulation and optoPKCε activation is insightful. A follow-up question is whether co-transfection of CIBN-GFP-CaaX and optoPKCε increases the pool of substrate compared to optoPKCε only, or optoPKCε activation at the plasma membrane is more effective in phosphorylating its substrates?

      (3) The finding that PKC activation at the plasma membrane is required for insulin receptor activation is interesting. Why does Thr1160 phosphorylation lead to a reduction of Thr1158/1162/1163? Does "insulin-stimulated" imply that insulin was administrated in the culture during optogenetic stimulation? Also, did the author observe any insulin receptor endocytosis upon optoPKCε activation?

      Weaknesses:

      (1) When citing the previous work on optogenetics, the reviewer believes a broader scope of papers (reviews) and recent research articles should be cited, especially those that used similar strategies, i.e., membrane translocation followed by oligomerization (of cryptochrome), as reported in this work.

      (2) In terms of molecular modeling, how would the author enable AlphaFold3 structure prediction of activated optoPKCε (or the blue-light stimulated state of cryptochrome)? Current methods only describe that "To generate models of the monomer, an amino acid sequence corresponding to Opto-PKCɛ, 2 ATPs and 1 FAD were used as input whereas for the tetramer, copies of Opto-PKCɛ, 8 ATPs and 4 FADs were used as input" (likely missing "four" between "tetramer" and "copies"). However, simply putting four monomers would not ensure that each monomer is in the "activated" state, which involves excitation of the FAD cofactor and likely conformational changes in cryptochrome.

      (3) It would be helpful if the authors could help interpret some results. For example, Figure S1: Was the puncta of mCherry-PKCε on the plasma membrane or within the cytosol? Also, why does optoPKCε only work when PKCε is fused at the C-terminus? When screening for the optoPKCε system with the largest light-to-dark contrast, the AGC domain was truncated. What is the physiological function of AGC? Does AGC removal limit PKC's access to its endogenous substrates?

    1. Reviewer #2 (Public review):

      The provided evidence in the study by MacQueen and colleagues is convincing, albeit some methodological challenges still exist. The authors rightly state that different subpopulations are likely to have evolved distinct patterns of GxE. It has been recently shown that the genetic architecture for adaptive traits differs across subpopulations (Lopez-Arboleda et al. 2021), hence this effect should be even more pronounced for GxE. How to best account for this in a statistical framework is not utterly clear. Here the authors describe their efforts to asses these interactions and to estimate the magnitude of the respective effects. Building on the statistical framework described, it could be possible to translate their findings from switchgrass to other species. A plus of the study is the effort to use an independent pseudo-F2 population to confirm the found associations.<br /> The manuscript is written coherently and all data and code used is freely available and explained in detail in the supplementary information.

      Nevertheless, I feel that there are some points in the data analysis that could be clarified some more.

      (1) Dividing GxE interactions into discrete, measurable GxWeather terms is a nice idea to gain a reliable measurement of E. I also appreciate the effort to create date-related values as a summary function of a weather variable across a specified date range. Using cumulative data the week prior to flowering seems like a good choice to associate weather patterns to this phenotype, but there are many - including non-linear ways - to accumulate these data. Additionally, weather parameters like temperature and precipitation can show interaction effects. I wonder if there is a way to consider these.

      (2) As pointed out in Section S1, a trait measured in eight common gardens could be modeled at eight genetically correlated traits. To assess the genetic correlation one would need to estimate the genetic variance within each trait and 28 genetic covariance structures. Here model convergence would be painful given the sample sizes. There are different statistical solutions for this including the mash algorithm the authors choose. I highly appreciate the effort in how the rationale is described in the supplementary information, but to me, it is still not completely clear how 'strong' and random effects have been selected from GWAS. How sensitive is the model to a selection of different effects? Could one run permutations to assess this? Why is the number of total markers different for different phenotypes and subsets and does this affect statistical power?

      (3) The mash model chooses different covariance matrices for the different analyses. Although I do understand the rationale for this, I am not sure how this will impact the respective analysis and how comparable the results are. Would one not like to have the same covariance matrices selected for all analyses?

      (4) Although the observed pattern of different GxE in different subpopulations is intriguing, it remains a little unclear what we actually learn apart from the fact that GxE in adaptive traits is complex. Figure 3 divides GxE into sign and magnitude effects. Interestingly the partition differs significantly between Greenup date and Flowering Date. Still, the respective QTLs in Figure 4 do - at least partially - overlap (e.g. on CHR05N). What is the interpretation of these? Here, I would appreciate a more detailed discussion and hearing the thoughts of the authors.

      (5) Figure 4 states that Stars indicate QTLs with significant enrichment for SNPs in the 1% mash tail. The shown Rug plots indicate this, but unfortunately, I am missing the respective stars. Is there a way to identify what is underlying these QTLs?

      To summarize, the manuscript nicely shows the complex nature of GxE in different switchgrass subpopulations. The goal now would be to identify the causative alleles for these phenomena and understand how these have evolved. Here the provided study paves the way for further analyses in this perspective.

    1. Reviewer #2 (Public review):

      Summary and strengths:

      Kamei et al. observe the Raman spectra of a population of single E.Coli cells in diverse growth conditions. Using LDA, Raman spectra for the different growth conditions are separated. Using previously available protein abundance data for these conditions, a linear mapping from Raman spectra in LDA space to protein abundance is derived. Notably, this linear map is condition-independent and is consequently shown to be predictive for held-out growth conditions. This is a significant result and in my understanding extends the earlier Raman to RNA connection that has been reported earlier.

      They further show that this linear map reveals something akin to bacterial growth laws (ala Scott/Hwa) that the certain collection of proteins shows stoichiometric conservation, i.e. the group (called SCG - stoichiometrically conserved group) maintains their stoichiometry across conditions while the overall scale depends on the conditions. Analyzing the changes in protein mass and Raman spectra under these conditions, the abundance ratios of information processing proteins (one of the large groups where many proteins belong to "information and storage" - ISP that is also identified as a cluster of orthologous proteins) remain constant. The mass of these proteins deemed, the homeostatic core, increases linearly with growth rate. Other SCGs and other proteins are condition-specific.

      Notably, beyond the ISP COG the other SCGs were identified directly using the proteome data. Taking the analysis beyond they then how the centrality of a protein - roughly measured as how many proteins it is stoichiometric with - relates to function and evolutionary conservation. Again significant results, but I am not sure if these ideas have been reported earlier, for example from the community that built protein-protein interaction maps.

      Finally, the paper built a lot of "machinery" to connect \Omega_LE, built directly from proteome, and \Omega_B, built from Raman, spaces. I am unsure how that helps and have not been able to digest the 50 or so pages devoted to this.

      Strengths:

      The rigorous analysis of the data is the real strength of the paper. Alongside this, the discovery of SCGs that are condition-independent and that are condition-dependent provides a great framework.

      Weaknesses:

      Overall, I think it is an exciting advance but some work is needed to present the work in a more accessible way.

    1. Reviewer #2 (Public review):

      Summary:

      The paper describes new insights into the role of adenosine deaminase-related growth factor (ADGF), an enzyme that catalyses the breakdown of adenosine into ammonia and inosine, in tip formation during Dictyostelium development. The ADGF null mutant has a pre-tip mound arrest phenotype, which can be rescued by the external addition of ammonia. Analysis suggests that the phenotype involves changes in cAMP signaling possibly involving a histidine kinase dhkD, but details remain to be resolved.

      Strengths:

      The generation of an ADGF mutant showed a strong mound arrest phenotype and successful rescue by external ammonia. Characterisation of significant changes in cAMP signaling components, suggesting low cAMP signaling in the mutant and identification of the histidine kinase dhkD as a possible component of the transduction pathway. Identification of a change in celltype differentiation towards prestalk fate

      Weaknesses:

      Lack of details on the developmental time course of ADGF activity and celltype type-specific differences in ADGF expression. The absence of measurements to show that ammonia addition to the null mutant can rescue the proposed defects in cAMP signaling. No direct measurements in the dhkD mutant to show that it acts upstream of sdgf in the control of changes in cAMP signaling and tip formation.

    1. Reviewer #3 (Public review):

      Summary:

      Chen et al. present a thorough statistical analysis of social interactions, more precisely, co-occupying the same chamber in the Eco-HAB measurement system. They also test the effect of manipulating the prelimbic cortex by using TIMP-1 that inhibits the MMP-9 matrix metalloproteinase. They conclude that altering neural plasticity in the prelimbic cortex does not eliminate social interactions, but it strongly impacts social information transmission.

      Strengths:

      The quantitative approach to analyzing social interactions is laudable and the study is interesting. It demonstrates that the Eco-HAB can be used for high throughput, standardized and automated tests of the effects of brain manipulations on social structure in large groups of mice.

      Weaknesses:

      A demonstration of TIMP-1 impairing neural plasticity specifically in the prelimbic cortex of the treated animals would greatly strengthen the biological conclusions. The Eco-HAB provides coarser spatial information compared to some other approaches, which may influence the conclusions.

    1. Reviewer #3 (Public review):

      Summary:

      The authors characterized previous substrate specificity of several polysaccharide lyases from family PL35 (CAzy) and discovered their unusually broad substrate specificity, being able to degrade three types of GAGs belonging to HA, CS, and HS classes.<br /> In this study they determined the 3D structures of two lyases from this family and identified several residues essential for substrate degradation. Comparison with lyases from other PL families but having the same fold allowed them to propose an Asn, Tyr and His as essential for catalysis. One of the characterized lyases can also degrade alginate and they established a specific His residue as necessary for activity toward this substrate but not sufficient by itself.<br /> Attempts to obtain crystals with substrate or products were unsuccessful, therefore the authors resorted to modeling substrate into the determined structures. The obtained models led them to propose a catalytic mechanism, that generally reflects previously proposed mechanism for lyases with this fold.

      Unfortunately, they have no definitive explanation for a broad specificity for the PL35 lyases but suggest that it is related to a shorter substrate binding cleft with a large open space on the nonreducing end of the substrate.

      Strengths:

      The determination of 3D structure of two PL35 lyases allows comparing them to other lyases with similar fold. The structures show a shorter substrate binding cleft that might be the reason for broader substrate specificity. Essential roles of several residues in catalysis and/or substrate binding were established by mutagenesis.

      Weaknesses:

      The main weakness is the lack of the structures of an enzyme-substrate/product complex. While the determined structures confirm the predicted two domain fold with a helical toroid domain and a double beta-sheet domain, the explanation for the broad specificity is lacking, except for suggestion that it has to do with a shorter substrate binding cleft. The enzymatic mechanism is hypothesized based on models rather than supported by experimentally determined structure of the complex.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have established a femur graft model that allows the study of hematopoietic regeneration following transplantation. They have extensively characterized this model, demonstrating the loss of hematopoietic cells from the donor femur following transplantation, with recovery of hematopoiesis from recipient cells. They also show evidence that BM MSCs present in the graft following transplantation are graft-derived. They have utilized this model to show that following transplantation, periosteal cells respond by first expanding, then giving rise to more periosteal SSCs, then migrating into the marrow to give rise to BM MSCs.

      Strengths:

      These studies are notable in several ways: 1) establishment of a novel femur graft model for the study of hematopoiesis; 2) Use of lineage tracing and surgery models to demonstrate that periosteal cells can give rise to BM MSCs.

      Weaknesses:

      There are a few weaknesses. First, the authors do not definitively demonstrate the requirement of periosteal SSC movement into the BM cavity for hematopoietic recovery. Hematopoiesis recovers significantly before 5 months, even before significant P-SSC movement has been shown, and hematopoiesis recovers significantly even when periosteum has been stripped. Second, it is not clear how the periosteum is changing in the grafts. Which cells are expanding is unclear, and it is not clear if these cells have already adopted a more MSC-like phenotype prior to entering the marrow space. Indeed, given the presence of host-derived endothelial cells in the BM, these studies are reminiscent of prior studies from this group and others that re-endothelialization of the marrow may be much more important for determining hematopoietic regeneration, rather the P-SSC migration. Third, the studies exploring the preferential depletion of BM MSCs vs P-SSCs are difficult to interpret. The single metabolic stress condition chosen was not well-justified, and the use of purified cell populations to study response to stress ex vivo may have introduced artifacts into the system.

      Comments on the current version: The authors have addressed my concerns adequately

    1. Reviewer #3 (Public review):

      Summary:

      The manuscript "SARS-CoV-2 nsp16 is regulated by host E3 ubiquitin ligases, UBR5 and MARCHF7" is an interesting work by Tian et al. describing the degradation/ stability of NSP16 of SARS CoV2 via K48 and K27-linked Ubiquitination and proteasomal degradation. The authors have demonstrated that UBR5 and MARCHF7, an E3 ubiquitin ligase bring about the ubiquitination of NSP16. The concept, and experimental approach to prove the hypothesis looks ok. The in vivo data looks ok with the controls. Overall, the manuscript is good.

      Strengths:

      The study identified important E3 ligases (MARCHF7 and UBR5) that can ubiquitinate NSP16, an important viral factor.

      Comments on revisions:

      I had gone through the revised form of the manuscript thoroughly. The authors have addressed all of my concerns. To me, the experimental approach looks convincing that the host E3 ubiquitin ligases (UBR5 and MARCHF7) ubiquitinate NSP16 and mark it for proteasomal degradation via K48- and K27- linkage. The authors have represented the final figure (Fig.8) in a convincing manner, opening a new window to explore the mechanism of capping the vRNA bu NSP16.

    1. Reviewer #2 (Public review):

      This paper seeks to determine whether the human visual system's sensitivity to causal interactions is tuned to specific parameters of a causal launching event, using visual adaptation methods. The three parameters the author investigates in this paper are the direction of motion in the event, the speed of the objects in the event, and surface features or identity of the objects in the event (in particular, having two objects of different color).

      The key method, visual adaptation to causal launching, has now been demonstrated by at least three separate groups and seems to be a robust phenomenon. Adaptation is a strong indicator of a visual process that is tuned to a specific feature of the environment, in this case launching interactions. Whereas other studies have focused on retinotopically-specific adaptation (i.e., whether the adaptation effect is restricted to the same test location on the retina as the adaptation stream was presented to), this one focuses on feature-specificity.

      The first experiment replicates the adaptation effect for launching events as well as the lack of adaptation event for a minimally different non-causal 'slip' event. However, it also finds that the adaptation effect does not work for launching events that do not have a direction of motion more than 30 degrees from the direction of the test event. The interpretation is that the system that is being adapted is sensitive to the direction of this event, which is an interesting and somewhat puzzling result given the methods used in previous studies, which have used random directions of motion for both adaptation and test events.

      The obvious interpretation would be that past studies have simply adapted to launching in every direction, but that in itself says something about the nature of this direction-specificity: it is not working through opposed detectors. For example, in something like the waterfall illusion adaptation effect, where extended exposure to downward motion leads to illusory upward motion on neutral-motion stimuli, the effect simply doesn't work if motion in two opposed directions are shown (i.e., you don't see illusory motion in both directions, you just see nothing). The fact that adaptation to launching in multiple directions doesn't seem to cancel out the adaptation effect in past work raises interesting questions about how directionality is being coded in the underlying process. In addition, one limitation of the current method is that it's not clear whether the motion-direction-specificity is also itself retinotopically-specific, that is, if one retinotopic location were adapted to launching in one direction and a different retinotopic location adapted to launching in the opposite direction, would each test location show the adaptation effect only for events in the direction presented at that location?

      The second experiment tests whether the adaptation effect is similarly sensitive to differences in speed. The short answer is no; adaptation events at one speed affect test events at another. Furthermore, this is not surprising given that Kominsky & Scholl (2020) showed adaptation transfer between events with differences in speeds of the individual objects in the event (whereas all events in this experiment used symmetrical speeds). This experiment is still novel and it establishes that the speed-insensitivity of these adaptation effects is fairly general, but I would certainly have been surprised if it had turned out any other way.

      The third experiment tests color (as a marker of object identity), and pits it against motion direction. The results demonstrate that adaptation to red-launching-green generates an adaptation effect for green-launching-red, provided they are moving in roughly the same direction, which provides a nice internal replication of Experiment 1 in addition to showing that the adaptation effect is not sensitive to object identity. This result forms an interesting contrast with the infant causal perception literature. Multiple papers (starting with Leslie & Keeble, 1987) have found that 6-8-month-old infants are sensitive to reversals in causal roles exactly like the ones used in this experiment. The success of adaptation transfer suggests, very clearly, that this sensitivity is not based only on perceptual processing, or at least not on the same processing that we access with this adaptation procedure. It implies that infants may be going beyond the underlying perceptual processes and inferring genuine causal content. This is also not the first time the adaptation paradigm has diverged from infant findings: Kominsky & Scholl (2020) found a divergence with the object speed differences as well, as infants categorize these events based on whether the speed ratio (agent:patient) is physically plausible (Kominsky et al., 2017), while the adaptation effect transfers from physically implausible events to physically plausible ones. This only goes to show that these adaptation effects don't exhaustively capture the mechanisms of early-emerging causal event representation.

      One overarching point about the analyses to take into consideration: The authors use a Bayesian psychometric curve-fitting approach to estimate a point of subjective equality (PSE) in different blocks for each individual participant based on a model with strong priors about the shape of the function and its asymptotic endpoints, and this PSE is the primary DV across all of the studies. As discussed in Kominsky & Scholl (2020), this approach has certain limitations, notably that it can generate nonsensical PSEs when confronted with relatively extreme response patterns. The authors mentioned that this happened once in Experiment 3, and that participant had to be replaced. An alternate approach is simply to measure the proportion of 'pass' reports overall to determine if there is an adaptation effect. The results here do not change based on which analytical strategy is used, which ultimately just goes to show that the effects are very robust.

      In general, this paper adds further evidence for something like a 'launching' detector in the visual system, but beyond that it specifies some interesting questions for future work about how exactly such a detector might function.

      Kominsky, J. F., & Scholl, B. J. (2020). Retinotopic adaptation reveals distinct categories of causal perception. Cognition, 203, 104339. https://doi.org/10.1016/j.cognition.2020.104339

      Kominsky, J. F., Strickland, B., Wertz, A. E., Elsner, C., Wynn, K., & Keil, F. C. (2017). Categories and Constraints in Causal Perception. Psychological Science, 28(11), 1649-1662. https://doi.org/10.1177/0956797617719930

      Leslie, A. M., & Keeble, S. (1987). Do six-month-old infants perceive causality? Cognition, 25(3), 265-288. https://doi.org/10.1016/S0010-0277(87)80006-9

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript investigated the effect of olfactory cues on caterpillar performance and parasitoid avoidance in Pieris brassicae. The authors knocked out Orco to produce caterpillars with significantly reduced olfactory perception. These caterpillars showed reduced performance and increased susceptibility to a parasitoid wasp.

      Strengths:

      This is an impressive piece of work and a well-written manuscript. The authors have used multiple techniques to investigate not only the effect of the loss of olfactory cues on host-parasitoid interactions, but also the mechanisms underlying this.

      Weaknesses:

      I do have one major query regarding this manuscript - I agree that the results of the caterpillar choice tests in a y-maze give weight to the idea that olfactory cues may help them avoid areas with higher numbers of parasitoids. However, the experiments with parasitoids were carried out on a single plant. Given that caterpillars in these experiments were very limited in their potential movement and source of food - how likely is it that avoidance played a role in the results seen from these experiments, as opposed to simply the slower growth of the KO caterpillars extending their period of susceptibility? While the two mechanisms may well both take place in nature - only one suggests a direct role of olfaction in enemy avoidance at this life stage, while the other is an indirect effect, hence the distinction is important.

      My other issue was determining sample sizes used from the text was sometimes a bit confusing. (This was much clearer from the figures).

      I also couldn't find the test statistics for any of the statistical methods in the main text, or in the supplementary materials.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript addresses the development of a low-cost behavioural setup and standardised open-source high-performing classifiers for aggression and courtship behaviour. It does so by using readily available laboratory equipment and previously developed software packages. By comparing the performance of the setup and the classifiers to previously developed ones, this study shows the classifier's overperformance and the reliability of the low-cost setup in recapitulating previously described effects of different manipulations on aggression and courtship.

      Strengths:

      The newly developed classifiers for lunges, wing extension, attempted copulation, copulation, following, and circling, perform better than available previously developed ones. The behavioural setup developed is low cost and reliably allows analysis of both aggression and courtship behaviour, validated through social experience manipulation (social isolation), gene knock (Dsk in Dilp2 neurons) and neuronal inactivation (dopaminergic neurons) known to affect courtship and aggression.

      Weaknesses:

      Aggression encompasses multiple defined behaviours, yet only lunges were analysed. Moreover, the CADABRA software to which DANCE was compared analyses further aggression behaviours, making their comparisons incomplete. In addition, though DANCE performs better than CADABRA and Divider in classifying lunges in the behavioural setup tested, it did not yield very high recall and F1 scores.

      DANCE is of limited use for neuronal circuit-level enquiries, since mechanisms for intensity and temporally controlled optogenetic manipulations, which are nowadays possible with open-source software and low-cost hardware, were not embedded in its development.

    1. Different regions can have unique soilcompositions due to variations in geology, climate, and vegetation.

      "Since soil composition differs by mineral, organic, and environmental components"

    1. Reviewer #2 (Public Review):

      In this study, the authors characterize the defensive responses of C. elegans to the predatory Pristionchus species. Drawing parallels to ecological models of predatory imminence and prey refuge theory, they outline various behaviors exhibited by C. elegans when faced with predator threats. They also find that these behaviors can be modulated by the peptide NLP-49 and its receptor SEB-3 in various degrees.

      The conclusions of this paper are mostly well-supported, the writing and the figures are clear and easy to interpret. However, some of the claims need to be better supported and the unique findings of this work should be clarified better in text.

      (1) Previous work by the group (Quach, 2022) showed that Pristionchus adopt a "patrolling strategy" on a lawn with adult C. elegans and this depends on bacterial lawn thickness. Consequently, it may be hypothesized that C. elegans themselves will adopt different predator avoidance strategies depending on predator tactics differing due to lawn variations. The authors have not shown why they selected a particular size and density of bacterial lawn for the experiments in this paper, and should run control experiments with thinner and denser lawns with differing edge densities to make broad arguments about predator avoidance strategies for C. elegans. In addition, C. elegans leaving behavior from bacterial lawns (without predators) are also heavily dependent on density of bacteria, especially at the edges where it affects oxygen gradients (Bendesky, 2011), and might alter the baseline leaving rates irrespective of predation threats. The authors also do not mention if all strains or conditions in each figure panel were run as day-matched controls. Given that bacterial densities and ambient conditions can affect C. elegans behavior, especially that of lawn-leaving, it is important to run day-matched controls.

      (2) Both the patch-leaving and feeding in outstretched posture behaviors described here in this study were reported in an earlier paper by the same group (Quach, 2022) as mentioned by the authors in the first section of the results. While they do characterize these further in this study, these are not novel findings of this work.

      (3) For Figures 1F-H, given that animals can reside on the lawn edges as well as the center, bins explored are not a definitive metric of exploration since the animals can decide to patrol the lawn boundary (especially since the lawns have thick edges). The authors should also quantify tracks along the edge from videographic evidence as they have done previously in Figure 5 of Quach, 2022 to get a total measure of distance explored.

      (4) Where were the animals placed in the wide-arena predator-free patch post encounter? It is mentioned that the animal was placed at the center of the arena in lines 220-221. While this makes sense for the narrow-arena, it is unclear how far from the patch animals were positioned for the wide exit arena. Is it the same distance away as the distance of the patch from the center of the narrow exit arena? Please make this clear in the text or in the methods.

      (5) Do exit decisions from the bacterial patch scale with number of bites or is one bite sufficient? Do all bites lead to bite-induced aversive response? This would be important to quantify especially if contextualizing to predatory imminence.

      (6) Why are the threats posed by aversive but non-lethal JU1051 and lethal PS312 evaluated similarly? Did the authors characterize if the number of bites are different for these strains? Can the authors speculate on why this would happen in the discussion?

      (7) The authors indicate that bites from the non-aversive TU445 led to a low number of exits and thus it was consequently excluded from further analysis. If anything, this strain would have provided a good negative control and baseline metrics for other circa-strike and post-encounter behaviors.

      8) For Figures 3 G and H, the reduction in bins explored (bins_none - bins_RS1594) due to the presence of predators should be compared between wildtype and mutants, instead of the difference between none and RS5194 for each strain.

      (9) While the authors argue that baseline speeds of seb-3 are similar to wild type (Figure S3), previous work (Jee, 2012) has shown that seb-3 not only affects speed but also roaming/dwelling states which will significantly affect the exploration metric (bins explored) which the authors use in Figs 3G-H and 4E-F. Control experiments are necessary to avoid this conundrum. Authors should either visualize and quantify tracks (as suggested in 3) or quantify roaming-dwelling in the seb-3 animals in the absence of predator threat.

      (10) While it might be beyond the scope of the study, it would be nice if the authors could speculate on potential sites of actions of NLP-49 in the discussion, especially since it is expressed in a distinct group of neurons.

    1. Reviewer #2 (Public review):

      In this work, Chang-Gonzalez and coworkers follow up on an earlier study on the force-dependence of peptide recognition by a T-cell receptor using all-atom molecular dynamics simulations. In this study, they compare the results of pulling on a TCR-pMHC complex between two different TCRs with the same peptide. A goal of the paper is to determine whether the newly studied B7 TCR has the same load-dependent behavior mechanism shown in the earlier study for A6 TCR. The primary result is that while the unloaded interaction strength is similar, A6 exhibits more force-stabilization.

      This is a detailed study, and establishing the difference between these two systems with and without applied force may establish them as a good reference setup for others who want to study mechanobiological processes if the data were made available, and could give additional molecular details for T-Cell-specialists.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

      (1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      - Thanks for the clarification provided on your revised version of the manuscript

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      - Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

      - I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      - Thanks for providing the miRNA quantification on the revised version of the manuscript.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      - Thanks for the clarification provided on your revised version of the manuscript.

      (6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      - Thanks for addressing this concern raised by R1 and R2.

      (7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

      - I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

      Comments on revised version:

      The authors have addressed most of the changes suggested by R1 and R2.

    1. Reviewer #2 (Public review):

      Summary:

      Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

      Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

      Strengths:

      (1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

      (2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

      (3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

      Weaknesses:

      (1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

      (2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the effect of fed vs hungry state on food decision making.

      70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

      Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

      A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

      Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

      Strengths:

      The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

      Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

      Weaknesses:

      My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

      Comments on revisions: No further comments - all my questions addressed.

    1. Reviewer #2 (Public Review):

      • A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

      • An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

      Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

      • An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

      • A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

    1. Reviewer #2 (Public review):

      In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

      Major points

      (1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

      (2) The rationale regarding the PR8 hybrid is not well described and should be described better.

      (3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

      (4) Figure 5A and 7A: Negative controls are missing.

      (5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

    1. Reviewer #2 (Public review):

      This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

      The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

      Strengths:

      The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

      Comments on revised version:

      In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

      In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

      Additional comments:

      The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

      Comments on revisions:

      The authors have addressed the concerns and questions raised in the original review.

    1. Reviewer #2 (Public review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

      In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

      (1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

      Strengths:

      To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

      Weaknesses:

      However, several critical points need to be addressed.

      (1) Use of Liftoff for GTF Annotation

      The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

      (2) Transcript Filtering and Potential Biases

      The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

      (3) Data Integration with Harmony

      The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

    1. Reviewer #3 (Public review):

      In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

      Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

    1. Reviewer #2 (Public review):

      Summary:

      This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

      Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

      Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

      Strengths:

      The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

      The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

      Weaknesses:

      This study is not, however, without caveats and several specific conclusions are not fully convincing.

      First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

      Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

      Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

      For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

      TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

      In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

      Strengths:

      (1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

      (2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

      Weaknesses:

      (1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

      (2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

      (3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

      (4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

      (5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

      (6) L214, ablations of individual features are missing.

      (7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

      (8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

      (9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

      (10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

      The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

      Strengths:

      The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

      This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

      Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

      Weaknesses:

      Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

      A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

      It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

      The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

      The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

    1. Reviewer #2 (Public review):

      Summary:

      The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

      Strengths:

      The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

      Weaknesses:

      The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

    1. Reviewer #2 (Public review):

      This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

      Strengths:

      The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

      That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

      The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

      The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

      I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

      Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

      The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

      Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

      Strengths:

      I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

      Weaknesses:

      The weakness of the study revolves around two aspects:

      (1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

      (2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

      Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

    1. Reviewer #2 (Public review):

      FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

      Comments on revisions:

      The authors have fully addressed the reviewers' comments and questions.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript Bohra et al. measure the effects of estrogen responsive gene expression upon induction on nearby target genes using a TAD containing the genes TFF1 and TFF3 as a model. The authors propose that there is a sort competition for transcriptional machinery between TFF1 (estrogen responsive) and TFF3 (not responsive) such that when TFF1 is activated and machinery is recruited, TFF3 is activated after a time delay. The authors attribute this time delay to transcriptional machinery that was being sequestered at TFF1 becomes available to the proximal TFF3 locus. The authors demonstrate that this activation is not dependent on contact with the TFF1 enhancer through deletion, instead they conclude that it is dependent on a phase-separated condensate which can sequester transcriptional machinery. Although the manuscript reports an interesting observation that there is a dose dependence and time delay on the expression of TFF1 relative to TFF3, there is much room for improvement in the analysis and reporting of the data. Most importantly there is no direct test of condensate formation at the locus in the context of this study: i.e. dissolution upon the enhancer deletion, decay in a temporal manner, and dependence of TFF1 expression on condensate formation. Using 1,6' hexanediol to draw conclusion on this matter is not adequate to draw conclusions on the effect of condensates on a specific genes activity given current knowledge on its non-specificity and multitude of indirect effects. Thus, in my opinion the major claim that this effect of a time delayed expression of TFF3 being dependent on condensates in not supported by the current data.

      Strengths:

      The depends of TFF1 expression on a single enhancer and the temporal delay in TFF3 is a very interesting finding.

      The non-linear dependence of TFF1 and TTF3 expression on ER concentration is very interesting with potentially broader implications.

      The combined use of smFISH, enhancer deletion, and 4C to build a coherent model is a good approach.

      Weaknesses:

      There is no direct observation of a condensate at the TFF1 and TFF3 locus and how this condensate changes over time after E2 treatment, upon enhancer deletion, whether transcriptional machinery is indeed concentrated within it, and other claims on condensate function and formation made in the manuscript. The use of 1,6' HD is not appropriate to test this idea given how broadly it acts.

      Comments on latest version:

      I don't think the response to Reviewer 2's comment on LLPS condensates on TFF1 are adequate and given this point is essential to the claims of the manuscript they must be addressed. Namely, the data from Saravavanan, 2020 actually suggest that condensate formation at the locus is not very predictive and barely enriched over random spots. The claims in the manuscript on the dependence of the condensate being responsible for sequestering transcriptional machinery are quite strong and the crux of the current model. To continue to make this claim (which I don't think is necessary since there are other possible models) the authors must test if the condensate at his locus (1) shows time dependent behavior, (2) is not present or weakened at the locus in cells that show high TFF3 expression, (3) is indeed enriched for transcriptional machinery when TFF1 peaks. The use of 1,6 hexanediol is not appropriate as pointed out by reviewer 2 and is no longer considered as an appropriate experiment by many as the whole notion of LLPS forming nuclear condensates is now under question. Such condensates can form through a variety of mechanisms as reviewed for example by Mittaj and Pappu (A conceptual framework for understanding phase separation and addressing open questions and challenges, Molecular Cell, 2022). Furthermore, given the distance between TFF1 and TFF3 it is hard to imagine that if a condensate that concentrates machinery in a non-stoichiometric manner was forming how it would not boost expression on both genes and be just specific to one. There must be another mechanism in my opinion.

      I would recommend the authors remove this aspect of their manuscript/model and simply report their interesting findings that are actually supported by data: The temporal delay of TFF3 expression, the dependence on ER concentration, and the enhancer dependence.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript presents a valuable finding on the impact of FRMD8 loss on tumor progression and the resistance to tamoxifen therapy. The author conducted systematic experiments to explore the role of FRMD8 in breast cancer and its potential regulatory mechanisms, confirming that FRMD8 could serve as a potential target to revere tamoxifen resistance.

      The research is logically coherent and persuasive. The results support their conclusions and have achieved the research objectives.

    1. Reviewer #2 (Public review):

      Summary:

      In the presented work by Wu et al, the authors investigate the role of the transcription factor Pu.1 in the survival and maintenance of microglia, the tissue-resident macrophage population in the brain. To this end, they generated a sophisticated new conditional pu.1 allele in zebrafish using CRISPR-mediated genome editing which allows visual detection of expression of the mutant allele through a switch from GFP to dsRed after Cre-mediated recombination. Using EdU pulse-chase labelling, they first estimated the daily turnover rate of microglia in the adult zebrafish brain which was found to be higher than rates previously estimated for mice and humans. After conditional deletion of pu.1 in coro1a positive cells, they do not find a difference in microglia number at 2 and 8 days or 1-month post-injection of Tamoxifen. However, at 3 months post-injection, a strong decrease in mutant microglia could be detected. While no change in microglia number was detected at 1mpi, an increase in apoptotic cells and decreased proliferation as observed. RNA-seq analysis of WT and mutant microglia revealed an upregulation of tp53, which was shown to play a role in the depletion of pu.1 mutant microglia as deletion in tp53-/- mutants did not lead to a decrease in microglia number at 3mpi. Through analysis of microglia number in pU.1 mutants, the authors further show that the depletion of microglia in the conditional mutants is dependent on the presence of WT microglia. To show that the phenomenon is conserved between species, similar experiments were also performed in mice.

      This work expands on previous in vitro studies using primary human microglia. The majority of conclusions are well supported by the data, addition of controls and experimental details would strengthen the conclusions and rigor of the paper.

      Strengths:

      Generation of an elegantly designed conditional pu.1 allele in zebrafish that allows for the visual detection of expression of the knockout allele.

      The combination of analysis of pu.1 function in two model systems, zebrafish and mouse, strengthens the conclusions of the paper.

      Confirmation of the functional significance of the observed upregulation of tp53 in mutant microglia through double mutant analysis provides some mechanistic insight.

      Weaknesses:

      (1) The presented RNA-Seq analysis of mutant microglia is underpowered and details on how the data was analyzed are missing. Only 9-15 cells were analyzed in total (3 pools of 3-5 cells each). Further, the variability in relative gene expression of ccl35b.1, which was used as a quality control and inclusion criterion to define pools consisting of microglia, is extremely high (between ~4 and ~1600, Figure S7A).

      (2) The authors conclude that the reduction of microglia observed in the adult brain after cKO of pu.1 in the spi-b mutant background is due to apoptosis (Lines 213-215). However, they only provide evidence of apoptosis in 3-5 dpf embryos, a stage at which loss of pu.1 alone does lead to a complete loss of microglia (Figure 2E). A control of pu.1 KI/d839 mutants treated with 4-OHT should be added to show that this effect is indeed dependent on the loss of spi-b. In addition, experiments should be performed to show apoptosis in the adult brain after cKO of pu.1 in spi-b mutants as there seems to be a difference in the requirement of pu.1 in embryonic and adult stages.

      (3) The number of microglia after pu.1 knockout in zebrafish did only show a significant decrease 3 months after 4-OHT injection, whereas microglia were almost completely depleted already 7 days after injection in mice. This major difference is not discussed in the paper.

      (4) Data is represented as mean +/-.SEM. Instead of SEM, standard deviation should be shown in all graphs to show the variability of the data. This is especially important for all graphs where individual data points are not shown. It should also be stated in the figure legend if SEM or SD is shown.

    1. Reviewer #2 (Public review):

      Summary:

      The goal of this proposal was to understand how two separate projection neurons from the medial prefrontal cortex, those innervating the basolateral amygdala (BLA ) and nucleus accumbens (NAc), contribute to the encoding of emotional behaviors. The authors record the activity of these different neuron classes across three different behavioral environments. They propose that, although both populations are involved in emotional behavior, the two populations have diverging activity patterns in certain contexts. A subset of projections to the NAc appears particularly important for social behavior. They then attempt to link these changes to the emotional state of the animal and changes in synaptic connectivity.

      Strengths:

      The behavioral data builds on previous studies of these projection neurons supporting distinct roles in behavior and extend upon previous work by looking at the heterogeneity within different projection neurons across contexts.

      Weaknesses:

      The diversity of neurons mediating these projections and their targeting within the BLA and NAc is not explored. These are not homogeneous structures and so one possibility is that some of the diversity within their findings may relate to targeting of different sub-structures within each region. The electrophysiological data have significant experimental confounds and more methodological information is required to support other conclusions related to these data.

    1. Reviewer #2 (Public review):

      Summary:

      Telomeres are key genomic structures linked to everything from aging to cancer. These key structures at the end of chromosomes protect them from degradation during replication and rely on a complex made up of human telomerase RNA gene (hTERC) and human telomerase reverse transcriptase (hTERT). While hTERC is expressed in all cells, the amount of hTERT is tightly controlled. The main hypothesis being tested is whether telomere length itself could regulate the hTERT enzyme. The authors conducted several experiments with different methods to alter telomere length and measured the binding of key regulatory proteins to this gene. It was generally observed that the shortening of telomere length leads to the recruitment of factors that reduce hTERT expression and lengthening of telomeres has the opposite effect. To rule out direct chromatin looping between telomeres and hTERT as driving this effect artificial constructs were designed and inserted a significant distance away and similar results were obtained.

      Overall, the claims of telomere length-dependent regulation of hTERT are supported throughout the manuscript.

      Strengths:

      The paper has several important strengths. Firstly, it uses several methods and cell lines that consistently demonstrate the same directionality of the findings. Secondly, it builds on established findings in the field but still demonstrates how this mechanism is separate from that which has been observed. Specifically, designing and implementing luciferase assays in the CCR5 locus supports that direct chromatin looping isn't necessary to drive this effect with TRF2 binding. Another strength of this paper is that it has been built on a variety of other studies that have established principles such as G4-DNA in the hTERT locus and TRF2 binding to these G4 sites.

      Weaknesses:

      The largest technical weakness of the paper is that minimal replicates are used for each experiment. I understand that these kinds of experiments are quite costly, and many of the effects are quite large, however, experiments such as the flow cytometry or the IPSC telomere length and activity assays appear to be based on a single sample, and several are based upon two maximum three biological replicates. If samples were added the main effects would likely hold, and many of the assays using GAPDH as a control would result in significant differences between the groups. This unnecessarily weakens the strength of the claims.

      Another detail that weakens the confidence in the claims is that throughout the manuscript there are several examples of the control group with zero variance between any of the samples: e.g. Figure 2K, Figure 3N, and Figure 6G. It is my understanding that a delta delta method has been used for calculation (though no exact formula is reported and would assist in understanding). If this is the case, then an average of the control group would be used to calculate that fold change and variance would exist in the group. The only way I could understand those control group samples always set to 1 is if a tube of cells was divided into conditions and therefore normalized to the control group in each case. A clearer description in the figure legend and methods would be required if this is what was done and repeated measures ANOVA and other statistics should accompany this.

      A final technical weakness of the paper is the data in Figure 5 where the modified hTERT promoter was inserted upstream of the luciferase gene. Specifically, it is unclear why data was not directly compared between the constructs that could and could not form G4s to make this point. For this reason, the large variance in several samples, and minimal biological replicates, this data was the least convincing in the manuscript (though other papers from this laboratory and others support the claim, it is not convincing standalone data).

      The second largest weakness of the paper is formatting.

      When I initially read the paper without a careful reading of the methods, I thought that the authors did not have appropriate controls meaning that if a method is applied to lengthen, there should be one that is not lengthened, and when a method is applied to shorten, one which is not shortened should be analysed as well. In fact, this is what the authors have done with isogenic controls. However, by describing all samples as either telomere short or telomere long, while this simplifies the writing and the colour scheme, it makes it less clear that each experiment is performed relative to an unmodified. I would suggest putting the isogenic control in one colour, the artificially shortened in another, and the artificially lengthened in another.

      Similarly, the graphs, in general, should be consistent with labelling. Figure 2 was the most confusing. I would suggest one dotted line with cell lines above it, and then the method of either elongation or shortening below it. I.e. HT1080 above, hTERC overexpression below, MDAMB-231 above guanine terminal repeats below, like was done on the right. Figure 2 readability would also be improved by putting hTERT promoter GAPDH (-ve control) under each graph that uses this (Panel B and Panel C not just Panel C). All information is contained in the manuscript but one must currently flip between figure legends, methods, and figures to understand what was done and this reduces clarity for the reader.

    1. for - Christine Wamsler - Lund University - homepage - from - youtube - Mindfulness World Community - Awareness, Care and Sustainability for Our Earth - https://hyp.is/GCUJ1APHEfCcr_vvv3lAFw/www.youtube.com/watch?v=CTUc_0GroGM

      research areas - sustainable cities - collaborative governance - city-citizen collaboration - citizen participation - sustainability and wellbeing - sustainability transformation - inner development goals - inner transformation - inner transition - existential sustainability

    1. Reviewer #2 (Public review):

      This work offers an insightful contribution for researchers in computational biology, immunology, and machine learning. By employing a 3-mer embedding and CNN architecture, the authors demonstrate that it is possible to extend sequence context without exponentially increasing the model's complexity.

      Key findings include:

      (1) Efficiency and Performance: Thrifty CNNs outperform traditional 5-mer models and match the performance of significantly larger models like DeepSHM.

      (2) Neutral Mutation Data: A distinction is made between using synonymous mutations and out-of-frame sequences for model training, with evidence suggesting these methods capture different aspects of SHM, or different biases in the type of data.

      (3) Open Source Contributions: The release of a Python package and pre-trained models adds practical value for the community.

      However, readers should be aware of the limitations. The improvements over existing models are modest, and the work is constrained by the availability of high-quality out-of-frame sequence data. The study also highlights that more complex modeling techniques, like transformers, did not enhance predictive performance, which underscores the role of data availability in such studies.

    1. Reviewer #2 (Public review):

      Summary:

      This study used an unbiased approach to evaluate epigenetic dynamics during the differentiation of granule neuron precursors, the cell of origin for Shh-MB. These profiling findings led to the focus on H3K27me3 dynamics, which correlate with the remodeling of epigenetic landscape associated with neuronal differentiation gene activation.

      Strengths:

      Depletion of EZH2, an enzymatic subunit of PRC2, resulted in premature neuronal differentiation in the developing cerebellum.

      Weaknesses:

      Little information is shown about the specific genetic programs disrupted by EZH2 depletion. This is a crucial weakness as existing PRC2 inhibitors do not effectively cross the blood-brain barrier. Further studies are necessary to identify downstream targets of PRC2 that could be targeted to induce neuronal differentiation in MB cells.

    1. Reviewer #3 (Public review):

      Summary:

      This study attempts to reconstruct the history of the COVID-19 epidemic, with its successive waves of viral variants from SARS-CoV-2 seroprevalence during 2021 and 2022 among blood donors in different regions of Bolivia. By using serological tests "specific" for the various variants the authors try to achieve a "colour" vision that is not provided by standard "black-and-white" serology.

      Strengths and Weaknesses:<br /> I am not an expert on the performance of SARS-CoV-2 serological tests, so may overlook certain weaknesses. Instead I tried to assess whether the authors, in this manuscript, have managed to substantiate their claims that "seroprevalence studies are a valuable adjunct to active surveillance because they allow analysis of the level of immunity of a population to a specific pathogen without the need for prospective testing" , and that "genomic surveillance and serology offer distinct yet complementary insights thus far." I think they succeeded, as they paint a credible and interesting history of the epidemic in Bolivia using (to me) novel methodology that certainly will stimulate extensive discussion, controversies, and follow-up studies (for which the authors might make some suggestions).

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

      Strengths:

      Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

      Weaknesses:

      (a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

      Comments on revised verson:

      Several of the points were addressed in the revised manuscript, but the following issues remain:

      Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

      Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

      Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

      Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

      Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

    1. Reviewer #3 (Public review):

      Summary:

      The authors aim to establish that cipargamin can be used for the treatment of infection caused by Babesia organisms.

      Strengths:

      The study provides strong evidence that cipargamin is effective against various Babesia species. In vitro growth assays were used to establish that cipargamin is effective against Babesia bovis and Babesia gibsoni. Infection of mice with Babesia microti demonstrated that cipargamin is as effective as the combination of atovaquone plus azithromycin. Cipargamin protected mice from lethal infection with Babesia rodhaini. Mutations that confer resistance to cipargamin were identified in the gene encoding ATP4, a P-type Na ATPase that is found in other apicomplexan parasites, thereby validating ATP4 as the target of cipargamin. A 7-day treatment of cipagarmin, when combined with a single dose of tafenoquine, was sufficient to eradicate Babesia microti in a mouse model of severe babesiosis caused by lack of adaptive immunity.

      Weaknesses:

      Cipargamin was tested in vivo at a single dose administered daily for 7 days. Despite the prospect of using cipargamin for the treatment of human babesiosis, there was no attempt to identify the lowest dose of cipagarmin that protects mice from Babesia microti infection. In the SCID mouse model, cipargamin was tested in combination with tafenoquine but not with atovaquone and/or azithromycin, although the latter combination is often used as first-line therapy for human babesiosis caused by Babesia microti.

    1. Reviewer #2 (Public review):

      Summary:

      Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to use humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

      In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

      Strengths:

      (1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debateble, these description is valuable knowledge for this field of research.

      (2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

      Weaknesses:

      (1) In this manuscript, such as Fig. 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

      The authors added the data about FOXP3 expression among Tfh/Tph cells in the revised manuscript. This improved our data interpretation.

      (2) The definition of "Disease" discussed after Fig. 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

      The authors appropriately modified the manuscript and provided sufficient information about the definition of diseases.

      (3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Fig. 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

      The authors correctly cited their previous findings about the TCR repertoire variation. This strengthened the discussion of this study.

    1. Reviewer #2 (Public review):

      Summary:

      The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

      Strengths:

      Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

      Provides relevant information on the multivariate organization of serotoninergic system in the brain.

      Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

      Comments on revisions:

      I thank the authors for carefully addressing my comments and in particular for the interesting insights added to the discussion.

      I have just one last remark pertaining to the point of the sample size: rats undergoing the MDMA acute challenge constitute a relatively small sample (N=11); I feel there is a certain risk the results presented might not be particularly replicable. Could the authors prove the stability of their (main) results by randomly iterating the individuals included in their sample (e.g. via permutation tests)? Alternatively, including at least a justification of the sample size in the context of the available evidence would be valuable.

    1. Reviewer #2 (Public review):

      In this manuscript, the authors seek to demonstrate that it is possible to sequence antibody variable domains from cryoEM reconstructions in combination with bottom-up LC-MSMS. In particular, they extract de novo sequences from single particle-cryo-EM-derived maps of antibodies using the "deep-learning tool ModelAngelo", which are run through the program Stitch to try to select the top scoring V-gene and construct a placeholder sequence for the CDR3 of both the heavy and light chain of the antibody under investigation. These reconstructed variable domains are then used as templates to guide the assembly of de novo peptides from LC-MS/MS data to improve the accuracy of the candidate sequence.

      Using this approach the authors claim to have demonstrated that "cryoEM reconstructions of monoclonal antigen-antibody complexes may contain sufficient information to accurately narrow down candidate V-genes and that this can be integrated with proteomics data to improve the accuracy of candidate sequences".

    1. Reviewer #3 (Public review):

      Summary:

      This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

      Strengths:

      The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

      Weakness:

      The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

    1. Reviewer #2 (Public review):

      Summary:

      An initial screening of pretreatment with different stress treatments of K. pneumoniae allowed the identification of heat stress as a protection factor against the infection of the lytic phage Kp11. Then experiments prove that this is mediated not by an increase of phage-resistant bacteria but due to an increase in phage transient tolerant population, which the authors identified as bacteriophage persistence in analogy to antibiotic persistence. Then they proved that phage persistence mediated by heat shock enhanced the evolution of bacterial resistance against the phage. The same trait was observed using other lytic phages, their combinations, and two clinical strains, as well as E. coli and two T phages, hence the phenomenon may be widespread in enterobacteria.

      Next, the elucidation of heat-induced phage persistence was done, determining that phage adsorption was not affected but phage DNA internalization was impaired by the heat pretreatment, likely due to alterations in the bacterial envelope, including the downregulation of envelope proteins and of LPS; furthermore, heat treated bacteria were less sensitive to polymyxins due to the decrease in LPS.

      Finally, cyclic exposure to heat stress allowed the isolation of a mutant that was both resistant to heat treatment, polymyxins, and lytic phage, that mutant had alterations in PspA protein that allowed a gain of function and that promoted the reduction of capsule production and loss of its structure; nevertheless this mutant was severely impaired in immune evasion as it was easily cleared from mice blood, evidencing the tradeoffs between phage/heat and antibiotic resistance and the ability to counteract the immune response.

      Strengths:

      The experimental design and the sequence in which they are presented are ideal for the understanding of their study and the conclusions are supported by the findings, also the discussion points out the relevance of their work particularly in the effectiveness of phage therapy, and allows the design of strategies to improve their effectiveness.

      Weaknesses:

      In its present form, it lacks the incorporation of some relevant previous work that explored the role of heat stress in phage susceptibility, antibiotic susceptibility, tradeoffs between phage resistance and resistance against other kinds of stress, virulence, etc., and the fact that exposure to lytic phages induces antibiotic persistence.

    1. Reviewer #2 (Public review):

      Summary:

      The authors study a panel of sparsely labeled neuronal lines in Drosophila that each form multiple synapses. Critically, each axonal branch can be injured without affecting the others, allowing the authors to differentiate between injuries that affect all axonal branches versus those that do not, creating spared branches. This is a highly powerful model. Axonal injuries are known to cause Wnd (mammalian DLK)-dependent retrograde signals to the cell body, culminating in a transcriptional response. This work identifies a fascinating new phenomenon that this injury response is not all-or-none. If even a single branch remains uninjured, the injury signal is not activated in the cell body. The authors rule out that this could be due to changes in the abundance of Wnd (perhaps if incrementally activated at each injured branch) by Wnd, Hiw's known negative regulator. Thus there is both a yet-undiscovered mechanism to regulate Wnd signaling, and more broadly a mechanism by which the neuron can integrate the degree of injury it has sustained. It will now be important to tease apart the mechanism(s) of this fascinating phenomenon. But even absent a clear mechanism, this is a new biology that will inform the interpretation of injury signaling studies across species.

      Strengths:

      - A conceptually beautiful series of experiments that reveal a fascinating new phenomenon is described, with clear implications (as the authors discuss in their Discussion) for injury signaling in mammals.<br /> - Suggests a new mode of Wnd regulation, independent of Hiw.

      Weaknesses:

      -The use of a somatic transcriptional reporter for Wnd activity is powerful, however, the reporter indicates whether the transcriptional response was activated, not whether the injury signal was received. It remains possible that Wnd is still activated in the case of a spared branch, but that this activation is either local within the axons (impossible determine in the absence of a local reporter) or that the retrograde signal was indeed generated but it was somehow insufficient to activate transcription when it entered the cell body. This is more of a mechanistic detail (and likely an extreme technical challenge to assess) and should not detract from the overall importance of the study

      -That the protective effect of a spared branch is independent of Hiw, the known negative regulator of Wnd, is fascinating. But this leaves open a key question: what is the signal?

      Comments on revisions:

      I appreciate your discussion about the potential bi-modal regulation of the puckered transcriptional reporter and think that readers would benefit from a short discussion of this.

    1. Reviewer #2 (Public review):

      Summary:

      The group around Prof. Scheiffele has made seminal discoveries reg. alternative splicing that is reflected by a current ERC advanced grant and landmark papers in eLife (2015), Science (2016), and Nature Neuroscience (2019). Recently, the group investigated proteins that contain an RRM motif in the mouse cortex. One of them, termed RBM20, was originally thought be muscle-specific and involved in alternative splicing in cardiomyocytes. However, upon close inspection, RBP20 is expressed in a particular set of interneurons (PV positive cells of the somatosensory cortex) in the cortex as well as in mitral cells of the olfactory bulb (OB). Importantly, they used CLIP to identify targets in the OB and heart. Next and quite importantly, they generated a knock-in mouse line with a His-biotin acceptor peptide and a HA epitope to perform specific biochemistry. Not surprisingly, this allowed them to specifically identify transcripts with long introns, however, most of the intronic binding sites were very distant to the splice sites. Closer GO term inspection revealed that RBM20 specifically regulates synapse-related transcripts. In order to get in vivo insight into its function in the brain, the authors generated both global as well as conditional KO mice. Surprisingly, there were no significant differences in in RBM20 PV interneurons, however, 409 transcripts were deregulated in in OB glutamatergic neurons. Here, CLIP sites were mostly found to be very distant from differentially expressed exons. Furthermore, loss-of-function RBM20 primarily yields loss of transcripts, whereas upregulation appears to be indirect. Together, these results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Strengths:

      The quality of the data and the figures is high, impressive and convincing. The reported results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

      Weaknesses:

      In their revised manuscript, the authors significantly improved the intro and results section, which is now much better suited for the general public and allows better to follow the logic of the experiments. Also, the discussion has now been expanded doing better justice to the importance of the findings presented.

      In my opinion, the revised manuscript clearly improved and represents a timely and important study, which provides major new insight into the expression and possible function of RBM20 in tissues outside of muscle.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a combined experimental and theoretical workflow to study partitioning noise arising during cell division. Such quantifications usually require time-lapse experiments, which are limited in throughput. To bypass these limitations, the authors propose to use flow-cytometry measurements instead and analyse them using a theoretical model of partitioning noise. The problem considered by the authors is relevant and the idea to use statistical models in combination with flow cytometry to boost statistical power is elegant. The authors demonstrate their approach using experimental flow cytometry measurements and validate their results using time-lapse microscopy. However, while I appreciate the overall goal and motivation of this work, I was not entirely convinced by the strength of this contribution. The approach focuses on a quite specific case, where the dynamics of the labelled component depend purely on partitioning. As such it seems incompatible with studying the partitioning noise of endogenous components that exhibit production/turnover. The description of the methods was partly hard to follow and should be improved. In addition, I have several technical comments, which I hope will be helpful to the authors.

      Comments:

      (1) In the theoretical model, copy numbers are considered to be conserved across generations. As a consequence, concentrations will decrease over generations due to dilution. While this consideration seems plausible for the considered experimental system, it seems incompatible with components that exhibit production and turnover dynamics. I am therefore wondering about the applicability/scope of the presented approach and to what extent it can be used to study partitioning noise for endogenous components. As presented, the approach seems to be limited to a fairly small class of experiments/situations.

      (2) Similar to the previous comment, I am wondering what would happen in situations where the generations could not be as clearly identified as in the presented experimental system (e.g., due to variability in cell-cycle length/stage). In this case, it seems to be challenging to identify generations using a Gaussian Mixture Model. Can the authors comment on how to deal with such situations? In the abstract, the authors motivate their work by arguing that detecting cell divisions from microscopy is difficult, but doesn't their flow cytometry-based approach have a similar problem?

      (3) I could not find any formal definition of division asymmetry. Since this is the most important quantity of this paper, it should be defined clearly.

      (4) The description of the model is unclear/imprecise in several parts. For instance, it seems to me that the index "i" does not really refer to a cell in the population, but rather a subpopulation of cells that has undergone a certain number of divisions. Furthermore, why is the argument of Equation 11 suddenly the fraction f as opposed to the component number? I strongly recommend carefully rewriting and streamlining the model description and clearly defining all quantities and how they relate to each other.

      (5) Similarly, I was not able to follow the logic of Section D. I recommend carefully rewriting this section to make the rationale, logic, and conclusions clear to the reader.

      (6) Much theoretical work has been done recently to couple cell-cycle variability to intracellular dynamics. While the authors neglect the latter for simplicity, it would be important to further discuss these approaches and why their simplified model is suitable for their particular experiments.

      (7) In the discussion the authors note that the microscopy-based estimates may lead to an overestimation of the fluctuations due to limited statistics. I could not follow that reasoning. Due to the gating in the flow cytometry measurements, I could imagine that the resulting populations are more stringently selected as compared to microscopy. Could that also be an explanation? More generally, it would be interesting to see how robust the results are in terms of different gating diameters.

      (8) It would be helpful to show flow cytometry plots including the identified subpopulations for all cell lines, currently, they are shown only for HCT116 cells. More generally, very little raw data is shown.

      (9) The title of the manuscript could be tailored more to the considered problem. At the moment it is very generic.

    1. Reviewer #2 (Public review):

      Summary:

      This paper investigates the idea that the protracted maturation of the prefrontal cortex - often viewed as a developmental limitation - may actually confer advantages for conceptual learning in children. The authors focus on semantic control processes, which govern the context-sensitive application of conceptual knowledge, and are closely associated with late-developing regions of the prefrontal cortex.

      Drawing on a computational model, the paper formally tests whether delayed maturation of semantic control promotes the acquisition of conceptual knowledge. The simulations demonstrate that when semantic control and anatomical connectivity mature later, conceptual learning is accelerated without compromising the integrity of the learned representations. Notably, the benefit is most apparent when control connections target intermediate layers in the computational model, suggesting a nuanced interplay between control processes and the underlying conceptual network.

      To validate these computational insights in a human developmental context, the authors conduct a meta-analysis of the classic triadic matching task - a paradigm where participants decide which of two choices best matches a reference concept based on either taxonomic or thematic relations. Critically, when these relations conflict, semantic control is required to select the context-appropriate match. Results indicate that context-sensitive semantic control develops more slowly than basic conceptual knowledge, showing marked improvements between 3 and 6 years of age.

      Overall, the paper argues that the delayed development of prefrontal cortex-based control processes allows for a period of less constrained learning, ultimately enhancing conceptual acquisition. The findings challenge the traditional view of late PFC maturation as solely disadvantageous and instead position it as an adaptive feature for building robust conceptual frameworks in early childhood.

      Strengths:

      (1) Novel Theoretical Contribution<br /> The paper offers a compelling, counterintuitive argument that a developmental lag in the maturation of control processes might be beneficial for semantic learning. This stands in contrast to the conventional framing of late prefrontal cortex (PFC) development as purely disadvantageous (e.g., a "necessary but unfortunate" constraint).

      (2) Well-Grounded Computational Approach<br /> The authors propose a neural network model that is both theoretically driven (hub-and-spoke framework) and systematically tested under various conditions (different timelines for control onset, and different connectivity patterns). Their simulations replicate and extend previous findings about how insulating the multimodal hub from direct control inputs helps preserve abstract conceptual representations.

      (3) Neuro-anatomical basis<br /> The paper connects its computational claims to empirical neuroanatomy, particularly the lack of direct structural connectivity between ventral ATL (the "hub") and the PFC in humans. This lends biological plausibility to the argument that control signals likely reach the ATL via intermediate regions (e.g., posterior temporal cortex).

      (4) Meta-Analysis of Triadic Match-to-Sample<br /> The authors leverage decades of developmental data on conceptual matching tasks, reframing them in terms of semantic control vs. semantic representation. Their analysis nicely illustrates that children can identify semantic relationships (taxonomic or thematic) at age 2 if the task does not require them to select between conflicting semantic relations. In contrast, the ability to choose a task-relevant relation only emerges more robustly in 3-6 years. This developmental pattern aligns with the computational model's predictions.

      Weaknesses:

      The contribution of the paper might be considered rather specialist, and might not appeal to a broad public, which should be typical of a generalist journal. Moreover, the scope of the model is fairly narrow - its relatively small, controlled training environment raises questions about scalability to more naturalistic, high-dimensional data. Finally, the meta-analysis does not test directly the model predictions in terms of specific outcomes of the task, error patterns, or model fit, but only the developmental pattern which was an already observed phenomenon that in part motivated the hypothesis and the model itself.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present data from a single-center cohort of African-American and Hispanic/Latinx individuals with atrial fibrillation (AF). This study provides insight into the incidences and clinical impact of missense variants in the Titin (TTN) gene in this population. In addition, the authors identified a single amino acid TTN missense variant (TTN-T32756I) that was further studied using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). These studies demonstrated that the Four-and-a-Half Lim domains 2 (FHL2), has increased binding with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I-iPSC-aCMs, enhancing the slow delayed rectifier potassium current (Iks) and is a potential mechanism for atrial fibrillation. Finally, the authors demonstrate that suppression of FHL2 could normalize the Iks current.

      Strengths:

      The strengths of this manuscript/study are listed below:

      (1) This study includes a previously underrepresented population in the study of the genetic and mechanistic basis of AF.<br /> (2) The authors utilize current state-of-the-art methods to investigate the pathogenicity of a specific TTN missense variant identified in this underrepresented patient population.<br /> (3) The findings of this study identify a potential therapeutic for treating atrial fibrillation.

      Weaknesses:

      (1) The authors do not include a non-AF group when evaluating the incidence and clinical significance of TTN missense variants in AF patients.

      (2) The authors do not provide evidence that TTN-T32756I-iPSC-aCMs are arrhythmogenic only that there is an increase in the Iks current and associated action potential changes. More specifically, the authors report "compared to the WT, TTN-T32756I-iPSC-aCMs exhibited increased arrhythmic frequency" yet is it is unclear what they are referring to by "arrhythmic frequency".

      (3) There seem to be discrepancies regarding the impact of the TTN-T32756I variant on mechanical function. Specifically, the authors report "both reduced contraction and abnormal relaxation in TTN-T32756I-iPSC-aCMs" yet, separately report "the contraction amplitude of the mutant was also increased . . . suggesting an increased contractile force by the TTN-T32756I-iPSC-aCMs and TTN-T32756I-iPSC-CMs exhibited similar calcium transient amplitudes as the WT."

    1. Reviewer #2 (Public review):

      Summary:

      The authors of this paper note that although polyphosphate (polyP) is found throughout biology, the biological roles of polyP have been under-explored, especially in multicellular organisms. The authors created transgenic Drosophila that expressed a yeast enzyme that degrades polyP, targeting the enzyme to different subcellular compartments (cytosol, mitochondria, ER, and nucleus, terming these altered flies Cyto-FLYX, Mito-FLYX, etc.). The authors show the localization of polyP in various wild-type fruit fly cell types and demonstrate that the targeting vectors did indeed result in the expression of the polyP degrading enzyme in the cells of the flies. They then go on to examine the effects of polyP depletion using just one of these targeting systems (the Cyto-FLYX). The primary findings from the depletion of cytosolic polyP levels in these flies are that it accelerates eclosion and also appears to participate in hemolymph clotting. Perhaps surprisingly, the flies seemed otherwise healthy and appeared to have little other noticeable defects. The authors use transcriptomics to try to identify pathways altered by the cyto-FLYX construct degrading cytosolic polyP, and it seems likely that their findings in this regard will provide avenues for future investigation. And finally, although the authors found that eclosion is accelerated in pupae of Drosophila expressing the Cyto-FLYX construct, the reason why this happens remains unexplained.

      Strengths:

      The authors capitalize on the work of other investigators who had previously shown that expression of recombinant yeast exopolyphosphatase could be targeted to specific subcellular compartments to locally deplete polyP, and they also use a recombinant polyP binding protein (PPBD) developed by others to localize polyP. They combine this with the considerable power of Drosophila genetics to explore the roles of polyP by depleting it in specific compartments and cell types to tease out novel biological roles for polyP in a whole organism. This is a substantial advance.

      Weaknesses:

      Page 4 of the Results (paragraph 1): I'm a bit concerned about the specificity of PPBD as a probe for polyP. The authors show that the fusion partner (GST) isn't responsible for the signal, but I don't think they directly demonstrate that PPBD is binding only to polyP. Could it also bind to other anionic substances? A useful control might be to digest the permeabilized cells and tissues with polyphosphatase prior to PPBD staining and show that the staining is lost.

      In the hemolymph clotting experiments, the authors collected 2 ul of hemolymph and then added 1 ul of their test substance (water or a polyP solution). They state that they added either 0.8 or 1.6 nmol polyP in these experiments (the description in the Results differs from that of the Methods). I calculate this will give a polyP concentration of 0.3 or 0.6 mM. This is an extraordinarily high polyP concentration and is much in excess of the polyP concentrations used in most of the experiments testing the effects of polyP on clotting of mammalian plasma. Why did the authors choose this high polyP concentration? Did they try lower concentrations? It seems possible that too high a polyP concentration would actually have less clotting activity than the optimal polyP concentration.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Chaguza et al. presents a novel perspective on pneumococcal growth kinetics, suggesting that the overall genetic background of Streptococcus pneumoniae, rather than specific loci, plays a more dominant role in determining growth dynamics. Through a genome-wide association study (GWAS) approach, the authors propose a shift in how we understand growth regulation, differing from earlier findings that pinpointed individual genes, such as wchA or cpsE, as key regulators of growth kinetics. This study highlights the importance of considering the cumulative impact of the entire genetic background rather than focusing solely on individual genetic loci.

      The study emphasizes the cumulative effects of genetic variants, each contributing small individual impacts, as the key drivers of pneumococcal growth. This polygenic model moves away from the traditional focus on single-gene influences. Through rigorous statistical analyses, the authors persuasively advocate for a more holistic approach to understanding bacterial growth regulation, highlighting the complex interplay of genetic factors across the entire genome. Their findings open new avenues for investigating the intricate mechanisms underlying bacterial growth and adaptation, providing fresh insights into bacterial pathogenesis.

      Strengths:

      This study exemplifies a holistic approach to unraveling key factors in bacterial pathogenesis. By analyzing a large dataset of whole-genome sequences and employing robust statistical methodologies, the authors provide strong evidence to support their main findings. Which is a leap forward from previous studies focused on a relatively smaller number of strains. Their integration of genome-wide association studies (GWAS) highlights the cumulative, polygenic influences on pneumococcal growth kinetics, challenging the traditional focus on individual loci. This comprehensive strategy not only advances our understanding of bacterial growth regulation but also establishes a foundation for future research into the genetic underpinnings of bacterial pathogenesis and adaptation. The amount of data generated and corresponding approaches to analyze the data are impressive as well as convincing. The figures are convincing and comprehensible too.

      Weaknesses:

      Despite the strong outcomes of the GWAS approach, this study leaves room for differing interpretations. A key point of contention lies in the title, which initially gives the impression that the research addresses growth kinetics under both in vitro and in vivo conditions. However, the study is limited to in vitro growth kinetics, with the assumption that these findings are equally applicable to in vivo scenarios-a premise that is not universally valid. To more accurately reflect the study's scope and avoid potential misrepresentation, the title should explicitly specify "in vitro" growth kinetics. This clarification would better align the title with the study's actual focus and findings.

      This study suggests that the entire genetic background significantly influences bacterial growth kinetics. However, to transform these predictions into established facts, extensive experimental validation is necessary. This would involve "bench experiments" focusing on generating and studying mutant variants of serotypes or strains with diverse genomic variations, such as targeted deletions. The growth phenotypes of these mutants should be analyzed, complemented by complementation assays to confirm the specific roles of the deleted regions. These efforts would provide critical empirical evidence to support the findings from the GWAS approach and enhance understanding of the genetic basis of bacterial growth kinetics.

      In the discussion section, the authors state that "the influence of serotype appeared to be higher than the genetic background for the average growth rate" (lines 296-298). Alongside references 13-15, this emphasizes the important role of capsular variability, which is a key determinant of serotypes, in influencing growth kinetics. However, this raises the question: why isn't a specific locus like cps, which is central to capsule biogenesis, considered a strong influencer of growth kinetics in this study?

      One plausible explanation could be the absence of "elevated signals" for cps in the GWAS analysis. GWAS relies on identifying loci with statistically significant associations to phenotypes. The lack of such signals for cps may indicate that its contribution, while biologically important, does not stand out genome-wide. This might be due to the polygenic nature of growth kinetics, where the overall genetic background exerts a cumulative effect, potentially diluting the apparent influence of individual loci like cps in statistical analyses.

    1. Reviewer #2 (Public review):

      Summary:

      This paper by Wang et al. uses rich brain, behaviour, and genetics data from the ABCD cohort to ask how well cognitive abilities can be predicted from mental-health-related measures, and how brain and genetics influence that prediction. They obtain an out-of-sample correlation of 0.4, with neuroimaging (in particular task fMRI) proving the key mediator. Polygenic scores contributed less.

      Strengths:

      This paper is characterized by the intelligent use of a superb sample (ABCD) alongside strong statistical learning methods and a clear set of questions. The outcome - the moderate level of prediction between the brain, cognition, genetics, and mental health - is interesting. Particularly important is the dissection of which features best mediate that prediction and how developmental and lifestyle factors play a role.

      Weaknesses:

      There are relatively few weaknesses to this paper. It has already undergone review at a different journal, and the authors clearly took the original set of comments into account in revising their paper. Overall, while the ABCD sample is superb for the questions asked, it would have been highly informative to extend the analyses to datasets containing more participants with neurological/psychiatric diagnoses (e.g. HBN, POND) or extend it into adolescent/early adult onset psychopathology cohorts. But it is fair enough that the authors want to leave that for future work.

      In terms of more practical concerns, much of the paper relies on comparing r or R2 measures between different tests. These are always presented as point estimates without uncertainty. There would be some value, I think, in incorporating uncertainty from repeated sampling to better understand the improvements/differences between the reported correlations.

      The focus on mental health in a largely normative sample leads to the predictions being largely based on the normal range. It would be interesting to subsample the data and ask how well the extremes are predicted.

      A minor query - why are only cortical features shown in Figure 3?

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes novel technique development and experiments to track the social gaze of marmosets. The authors used video tracking of multiple cameras in pairs of marmosets to infer head orientation and gaze and then studied gaze direction as a function of distance between animals, relationships, and social conditions/stimuli.

      Strengths:

      Overall the work is interesting and well done. It addresses an area of growing interest in animal social behavior, an area that has largely been dominated by research in rodents and other non-primate species. In particular, this work addresses something that is uniquely primate (perhaps not unique, but not studied much in other laboratory model organisms), which is that primates, like humans, look at each other, and this gaze is an important social cue of their interactions. As such, the presented work is an important advance and addition to the literature that will allow more sophisticated quantification of animal behaviors. I am particularly enthusiastic with how the authors approach the cone of uncertainty in gaze, which can be both due to some error in head orientation measurements as well as variable eye position.

      Weaknesses:

      There are a few technical points in need of clarification, both in terms of the robustness of the gaze estimate, and possible confounds by gaze to non-face targets which may have relevance but are not discussed. These are relatively minor, and more suggestions than anything else.

    1. Reviewer #2 (Public review):

      The authors introduce MorphCellSorter, an open-source tool available on GitHub, designed for automated morphometric analysis of microglia. Current understanding suggests that microglia represent a heterogeneous population, especially in non-steady adult states, better characterized as a continuum rather than distinct cell groups.

      This tool was developed to classify microglia along this continuum. Using stained brain sections and microscope imaging, individual microglia are binarized and processed with MorphCellSorter, which categorizes them based on 20 morphological parameters. Notably, the tool is versatile, as it can be applied to both fluorescent and brightfield brain sections, as demonstrated by the authors. Additionally, it has been tested across various setups (both fixed and live tissues) and biological contexts (including embryonic stages, Alzheimer's disease models, stroke, and primary cell cultures), showcasing its versatility and adaptability. Overall, the study is well-conceived and could have some value in the field.

      Numerous similar tools already exist, and the number is likely to grow, especially with advancements in AI. These tools have limited scientific utility as they provide descriptive rather than informative outputs. Microglial morphology varies due to external influences (such as developmental stages and injuries), but the significance of these variations remains largely hypothetical.

    1. Reviewer #2 (Public review):

      Summary:

      In this article, Ruyle and colleagues assessed the contribution of central and peripheral mu opioid receptors in mediating fentanyl-induced respiratory depression using both nalaxone and nalaxone methiodide, which does not cross the blood brain barrier. Both compounds prevented and reversed fentanyl-induced respiratory depression to a comparable degree. The advantage of peripheral treatments is that they circumvent the withdrawal-like effects of nalaxone. Moreover, neurons located in the nucleus of the solitary tract are no longer activated by fentanyl when nalaxone methiodide is administered, suggesting that these responses are mediated by peripheral mu opioid receptors. The results delineate a role for peripheral mu opioid receptors in fentanyl-derived respiratory depression and identify a potentially advantageous approach to treating overdoses without inflicting withdrawal on the patients.

      Strengths:

      The strengths of the article include the intravenous delivery of all compounds, which increases the translational value of the article. The authors address both prevention and reversal of fentanyl-derived respiratory depression. The experimental design and data interpretation are rigorous and appropriate controls were used in the study. Multiple doses were screened in the study and the approaches were multipronged. The authors demonstrated activation of NTS cells using multiple techniques and the study links peripheral activation of mu opioid receptors to central activation of NTS cells. Both males and females were used in the experiments. The authors demonstrate the peripheral restriction of nalaxone methiodide.

      Weaknesses:

      Nalaxone is already broadly used to prevent overdoses from opioids so in some respects, the effects reported here are somewhat incremental.

      Comments on the latest version:

      I think the authors have adequately addressed previous critiques and I don't have any additional comments.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Barzo and colleagues aim to establish an appraisal for the development of basal electrophysiology of human layer 2/3 pyramidal cells across life and compare their morphological features at the same ages.

      Strengths:

      The authors have generates recordings from an impressive array of patient samples, allowing them to directly compare the same electrophysiological features as a function of age and other biological features. These data are extremely robust and well organised.

      The authors group patient ages into developmentally organised bins, which are elaborated on in supplementary analysis - exemplifying the importance of determining early postnatal development on human neuron function

      Weaknesses:

      The author's use of (perhaps) arbitrary categorisation of spine morphology could limit the full usefulness of these data.

      Overall, the authors achieve their aims by assessing the physiological and morphological properties of human L2/3 pyramidal neurons across life. Their findings have extremely important ramifications for our understanding of human brain development and implications for how different neuronal properties may influence life and disease associated with neurological conditions.

      Comments on revisions:

      Overall, the authors have satisfied my concerns. I fully appreciate their candour with their data and the potential limitations. I especially appreciate their supplementary data inclusions which I believe truly strengthen their conclusions and are a valuable resource for the field,

      I agree whole-heartedly with the authors assertion that it is perhaps better to use the most sophisticated equipment, not always being most appropriate. However, statistical rigour should still be standard. As such, my one remaining concern relates to inappropriate replicate choice of spine morphology data in figure 6. I commend the authors inclusion of additional reconstructions and morphology data from further cells in this data set. However, to me, these still represent data from 3 cells and 1 patient/age - as to the best of my interpretation. I feel it would be more helpful to plot cell averages +/- SD for each cell - even if side-by-side with data from all spines. Likewise, it is unclear what statistical test was performed on these data and did it take into account the fact that these values are a) from 3 technical replicates per group, or b) that many of the data sets consist of many zero-values (would a categorical test be more appropriate?).

    1. Reviewer #2 (Public Review):

      Summary:

      This work presents new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      Strengths:

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells, and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      Weaknesses:

      The scenario where the lines would demonstrate their full potential compared to existing models has not been tested. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. Therefore, a demonstration of the efficient deletion of multiple floxed alleles in a mosaic fashion would be a valuable addition.

      In addition, a drawback of this line is the constitutive expression of Cre. When combined with the confetti line, the reporter cassette will continue flipping, potentially leading to misleading lineage tracing results. Constitutive expression of Cre is also associated with toxicity, as discussed by the authors in the introduction. These drawbacks should be acknowledged.

    1. Reviewer #2 (Public review):

      The authors provide valuable findings characterizing a Prosapip1 conditional knockout mouse and the effects of knockout on hippocampal excitatory transmission, NMDAR transmission, and several learning behaviors. Furthermore, the authors selectively and conditionally knockout Prosapip1 in the dorsal hippocampus and show that it is required for the same spatial learning and memory assessed in the conditional knockout mice. The study uncovers how Prosapip1 is involved PSD organization and is a functional and critical player in dorsal Hippocampal LTP via its interaction with GluN2B subunits. The study is well controlled, detailed, and data in the paper match the conclusions.

      Comments on revisions:

      The authors have addressed all concerns.

    1. Reviewer #2 (Public review):

      Summary:

      The current paper consists of two parts. The first part is the rigorous feature optimization of the MEG signal to decode individual finger identity performed in a sequence (4-1-3-2-4; 1~4 corresponds to little~index fingers of the left hand). By optimizing various parameters for the MEG signal, in terms of (i) reconstructed source activity in voxel- and parcel-level resolution and their combination, (ii) frequency bands, and (iii) time window relative to press onset for each finger movement, as well as the choice of decoders, the resultant "hybrid decoder" achieved extremely high decoding accuracy (~95%). This part seems driven almost by pure engineering interest in gaining as high decoding accuracy as possible.<br /> In the second part of the paper, armed with the successful 'hybrid decoder,' the authors asked more scientific questions about how neural representation of individual finger movement that is embedded in a sequence, changes during a very early period of skill learning and whether and how such representational change can predict skill learning. They assessed the difference in MEG feature patterns between the first and the last press 4 in sequence 41324 at each training trial and found that the pattern differentiation progressively increased over the course of early learning trials. Additionally, they found that this pattern differentiation specifically occurred during the rest period rather than during the practice trial. With a significant correlation between the trial-by-trial profile of this pattern differentiation and that for accumulation of offline learning, the authors argue that such "contextualization" of finger movement in a sequence (e.g., what-where association) underlies the early improvement of sequential skill. This is an important and timely topic for the field of motor learning and beyond.

      Strengths:

      Each part has its own strength. For the first part, the use of temporally rich neural information (MEG signal) has a significant advantage over previous studies testing sequential representations using fMRI. This allowed the authors to examine the earliest period (= the first few minutes of training) of skill learning with finer temporal resolution. Through the optimization of MEG feature extraction, the current study achieved extremely high decoding accuracy (approx. 94%) compared to previous works. For the second part, the finding of the early "contextualization" of the finger movement in a sequence and its correlation to early (offline) skill improvement is interesting and important. The comparison between "online" and "offline" pattern distance is a neat idea.

      Weaknesses:

      Despite the strengths raised, the specific goal for each part of the current paper, i.e., achieving high decoding accuracy and answering the scientific question of early skill learning, seems not to harmonize with each other very well. In short, the current approach, which is solely optimized for achieving high decoding accuracy, does not provide enough support and interpretability for the paper's interesting scientific claim. This reminds me of the accuracy-explainability tradeoff in machine learning studies (e.g., Linardatos et al., 2020). More details follow.

      There are a number of different neural processes occurring before and after a key press, such as planning of upcoming movement and ahead around premotor/parietal cortices, motor command generation in primary motor cortex, sensory feedback related processes in sensory cortices, and performance monitoring/evaluation around the prefrontal area. Some of these may show learning-dependent change and others may not.

      Given the use of whole-brain MEG features with a wide time window (up to ~200 ms after each key press) under the situation of 3~4 Hz (i.e., 250~330 ms press interval) typing speed, these different processes in different brain regions could have contributed to the expression of the "contextualization," making it difficult to interpret what really contributed to the "contextualization" and whether it is learning related. Critically, the majority of data used for decoder training has the chance of such potential overlap of signal, as the typing speed almost reached a plateau already at the end of the 11th trial and stayed until the 36th trial. Thus, the decoder could have relied on such overlapping features related to the future presses. If that is the case, a gradual increase in "contextualization" (pattern separation) during earlier trials makes sense, simply because the temporal overlap of the MEG feature was insufficient for the earlier trials due to slower typing speed.

      Several direct ways to address the above concern, at the cost of decoding accuracy to some degree, would be either using the shorter temporal window for the MEG feature or training the model with the early learning period data only (trials 1 through 11) to see if the main results are unaffected would be some example.

    1. Reviewer #2 (Public review):

      Summary:

      In this study, Catani et al. have immunized mice with 17 recombinant N1 neuraminidases (NAs) from human isolates circulating between 2009-2020 to investigate antigenic diversity. NA inhibition (NAI) titers revealed two groups that were antigenically and phylogenetically distinct. Machine learning was used to estimate the antigenic distances between the N1 NAs and mutations at residues K432E and I321V were identified as key determinants of N1 NA antigenicity.

      Strengths:

      Observation of mutations associated with N1 antigenic drift.

      Weaknesses:

      Validation that K432E and I321V are responsible for antigenic drift was not determined in a background strain with native K432 and I321 or the restitution of antibody binding by reversion to K432 and I321 in strains that evaded sera.

    1. Reviewer #2 (Public review):

      This work present new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

      The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

      The study and the new models have also some limitations. The demonstration of efficient deletion of multiple floxed alleles in a mosaic fashion, a scenario where the lines would demonstrate their full potential compared to existing models, has not been tested in the current study. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. In addition, as discussed by the authors, a limitation of this line is the constitutive expression of Cre, which is associated with toxicity in some cases.

    1. Reviewer #2 (Public review):

      Summary:

      In this manuscript, the authors examined the representational geometry of orientation representations during visual perception and working memory along the visual hierarchy. Using representational similarity analysis, they found that similarity was relatively evenly distributed among all orientations during perception, while higher around oblique orientations during WM. There were some noticeable differences along the visual hierarchy. IPS showed the most pronounced oblique orientation preferences during WM but no clear patterns during perception, likely due to the different task demands for the WM orientation task and the perception contrast discrimination task. The authors proposed two models to capture the differences. The veridical model estimated the representational geometry in perception by assuming an efficient coding framework, while the categorical model estimated the pattern in WM using psychological distances to measure the differences among orientations (including estimates from a separate psychophysical study performed outside the scanner). Therefore, I think this work is valuable and advances our understanding of the transition from perception to memory.

      Strengths:

      The use of RSA to identify representational biases goes beyond simply relying on response patterns and helps identify how representational formats change from perception to WM. The study nicely leverages ideas about efficient coding to explain perceptual representations that are more veridical, while leaning on ideas about abstractions of percepts that are more categorical-psychological in nature (but see (1) below). Moreover, the match between memory biases of orientation and the patterns estimated with RSA were compelling (but see (2) below). I found the analyses showing how RSA and decoding (eg, cross-generalization) are associated and how/why they may differ to be particularly interesting.

      Weaknesses:

      (1) The idea that later visual maps (ie, IPS0) encode perceptions of orientation in a veridical form and then in a categorical form during WM is an attractive idea. However, the support is somewhat weakened by a few issues. The RSA plots in Figure 1C for IPS0 appear to show a similar pattern, but just of lower amplitude during perception. But in the model fits either for orientation statistics or estimated from the psychophysics task, the Veridical model fits best for perception and the Categorical model fits best for memory in IPS0. By my eye, the modeled RSMs in Figures 2 & 3 do not look like the observed ones in Figure 1C. Those modeled RSMs look way more categorical than the observed IPS0. They look like something in between.

      (2) My biggest concern is the omission of the in-scanner behavioral data. Yes, on the one hand, they used the N=17 outside the scanner psychophysics dataset for the analyses in Figure 3. On the other hand, they do not even mention the behavioral data collected in the scanner along with the BOLD data. Those data had clear oblique effects if I recall correctly. Why use the data from the psychophysics experiment? Also, perhaps a missed opportunity; I wonder if the Veridical/Categorical models fit a single subject's RSA data matches that subject's behavioral biases. That would really be compelling if found.

      The data were collected (reanalysis of published study) without consideration for the aims of the current study, and are therefore not optimized to test their goals. The biggest issue is that "The distractors are really distracting me." I'm somewhat concerned about how the distractors may have impacted the results. I honestly did not notice that the authors were using delay periods that had 11s of distractor stimuli until way into the paper. On the one hand, the "patterns" of the model fits across the ROIs appear to be qualitatively similar. That's good if you want to pool data like the authors did. But, while the authors state on line 350 "..we also confirmed that the presence of distractors during the delay did not impact the pattern of results in the memory task (Supplementary Figure 5)." When looking at Supplementary Figure 5, I noticed that there are a couple of exceptions to this. In the Gratings distractor data, V1 shows a better fit to the Veridical model, while V4 and IPS0 shows no better fit to either model. And in the Noise distractor data, neither model fits better for any ROI. At first glance, I was concerned, but then looking at the No distractor data, the pattern is identical to that of the combined data. Thus, this can be seen as a glass half full/empty issue as almost all of the ROIs show a similar pattern, but still it would concern me if I were leading this study. This gets me to my key question, why even use the distractor trials at all, where the interpretation can get dicey? For instance, the authors have shown in this exact data that the impact of distraction affects the fidelity of representations differently along the visual hierarchy (Rademaker, 2019), consistent with several other studies (eg., Bettencourt & Xu, 2016; Lorenc, 2018; Hallenbeck et al., 2022) and with one of the author's preprints (Rademaker & Serences, 2024). My guess is that without the full dataset, some of the RSA analyses are underpowered. If that is the case, I'm fine with it, but it might be nice to state that.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript describes synaptic connectivity in the Songbird cortex's four main classes of sensory neuron afferents onto three known classes of projection neurons of the pre-motor cortical region HVC. HVC is a region associated with the generation of learned bird songs. Investigators here use all male zebra finches to examine the functional anatomy of this region using patch clamp methods combined with optogenetic activation of select neuronal groups.

      Strengths:

      The quality of the recordings is extremely high and the quantity of data is on a very significant scale, this will certainly aid the field.

      Weaknesses:

      The authors could make the figures a little easier to navigate. Most of the figures use actual anatomical images but it would be nice to have this linked with a zebra finch atlas in more of a cartoon format that accompanied each fluro image. Additionally, for the most part, figures showing the labeling lack scale bar values (in um). These should be added not just shown in the legends.

      The authors could make it clear in the abstract that this is all male zebra finches - perhaps this is obvious given the bird song focus, but it should be stated. The number of recordings from each neuron class and the overall number of birds employed should be clearly stated in the methods (this is in the figures, but it should say n=birds or cells as appropriate).

      The authors should consider sharing the actual electrophysiology records as data.

    1. Reviewer #2 (Public review):

      Summary:

      The author provide evidence that helps resolve long-standing questions about the differential involvement of frontal and posterior cortex in working memory. They show that whereas early visual cortex shows stronger decoding of memory content in a memorization task vs a more complex categorization task, frontal cortex shows stronger decoding during categorization tasks than memorization tasks. They find that task-optimized RNNs trained to reproduce the memorized orientations show some similarities in neural decoding to people. Together, this paper presents interesting evidence for differential responsibilities of brain areas in working memory.

      Strengths:

      This paper was overall strong. It had a well-designed task, best-practice decoding methods, and careful control analyses. The neural network modeling adds additional insight into the potential computational roles of different regions.

      Weaknesses:

      Few. The RNN-fMRI correspondence could be a little more comprehensive, but the paper contributes a compelling set of empirical findings and interpretations that can inform future research.

    1. Reviewer #2 (Public review):

      Dierks et al. investigate the impact of m6A RNA modifications on the mRNA life cycle, exploring the links between transcription, cytoplasmic RNA degradation and subcellular RNA localization. Using transcriptome-wide data and mechanistic modelling of RNA metabolism, the authors demonstrate that a simplified model of m6A primarily affecting cytoplasmic RNA stability is sufficient to explain the nuclear-cytoplasmic distribution of methylated RNAs and the dynamic changes in m6A levels upon perturbation. Based on multiple lines of evidence, they propose that passive mechanisms based on the restricted decay of methylated transcripts in the cytoplasm play a primary role in shaping condition-specific m6A patterns and m6A dynamics. The authors support their hypothesis with multiple large-scale datasets and targeted perturbation experiments. Overall, the authors present compelling evidence for their model which has the potential to explain and consolidate previous observations on different m6A functions, including m6A-mediated RNA export.

    1. Reviewer #2 (Public review):

      In this manuscript, the authors present an approach to correct GRIN lens aberrations, which primarily cause a decrease in signal-to-noise ratio (SNR), particularly in the lateral regions of the field-of-view (FOV), thereby limiting the usable FOV. The authors propose to mitigate these aberrations by designing and fabricating aspherical corrective lenses using ray trace simulations and two-photon lithography, respectively; the corrective lenses are then mounted on the back aperture of the GRIN lens.

      This approach was previously demonstrated by the same lab for GRIN lenses shorter than 4.1 mm (Antonini et al., eLife, 2020). In the current work, the authors extend their method to a new class of GRIN lenses with lengths exceeding 6 mm, enabling access to deeper brain regions as most ventral region of the mouse brain. Specifically, they designed and characterized corrective lenses for GRIN lenses measuring 6.4 mm and 8.8 mm in length. Finally, they applied these corrected long micro-endoscopes to perform high-precision calcium signal recordings in the olfactory cortex.

      Compared with alternative approaches using adaptive optics, the main strength of this method is that it does not require hardware or software modifications, nor does it limit the system's temporal resolution. The manuscript is well-written, the data are clearly presented, and the experiments convincingly demonstrate the advantages of the corrective lenses.

      The implementation of these long corrected micro-endoscopes, demonstrated here for deep imaging in the mouse olfactory bulb, will also enable deep imaging in larger mammals such as rats or marmosets.

      Comments on revisions:

      The authors have clearly addressed all my comments.

    1. Reviewer #2 (Public review):

      Summary:

      The authors sought to evaluate whether analyses of large-scale electrophysiology data obtained from 10 different individual laboratories are reproducible when they use standardized procedures and quality control measures. They were able to reproduce most of their experimental findings across all labs. Despite attempting to target the same brain areas in each recording, variability in electrode targeting was a source of some differences between datasets.

      Strengths:

      This paper gathered a standardized dataset across 10 labs and performed a host of state-of-the-art analyses on it. Their ability to assess the reproducibility of each analysis across this kind of data is an important contribution to the field.

      Comments on revisions:

      The authors have addressed almost all of the concerns that I raised in this revised version. The new RIGOR notebook is helpful, as are the new analyses.

      This paper attributes much error in probe insertion trajectory planning to the fact that the Allen CCF and standard stereotaxic coordinate systems are not aligned. Consequently, it would be very helpful for the community if this paper could recommend software tools, procedures, or code to do trajectory planning that accounts for this.

      I think it would still be helpful for the paper to have some discussion comparing/contrasting the use of the RIGOR framework with existing spike sorting statistics. They mention in their response to reviewers that this is indeed a large space of existing approaches. Most labs performing Neuropixels recordings already do some type of quality control, but these approaches are not standardized. This work is well-positioned to discuss the advantages and disadvantages of these alternative approaches (even briefly) but does not currently do so-it does not need to run any of these competing approaches to helpfully mention ideas for what a reader of the paper should do for quality control with their own data.

    1. Reviewer #2 (Public review):

      This is a comprehensive analysis of Salmonella Dublin genomes that offers insights into the global spread of this pathogen and region-specific traits that are important to understand its evolution. The phenotyping of isolates of ST10 and ST74 also offer insights into the variability that can be seen in S. Dublin, which is also seen in other Salmonella serovars, and reminds the field that it is important to look beyond lab-adapted strains to truly understand these pathogens. This is a valuable contribution to the field. The only limitation, which the authors also acknowledge, is the bias towards S. Dublin genomes from high income settings. However, there is no selection bias; this is simply a consequence of publicly available sequences.

    1. Reviewer #2 (Public review):

      Summary:

      The study highlights the role of CRISP1 and CRISP3, two epididymal proteins, in early embryo development through DNA integrity. The authors demonstrate that C1/C3 DKO sperm exhibit defects in the DNA integrity, probably due to Ca2+ dysregulation in the epididymis. However, direct evidence for this mechanism requires further experiments. The finding of the involvement of the epididymal environment in embryogenesis is significant, but some results on sperm fertilizing ability of C1/C3 DKO mice were similar to the previous report. Thus, this point raises concern about the perspective of novelty.

      Strengths:

      The authors demonstrate that CRISP1 and CRISP3 regulate Ca2+ in the epididymal fluid, and loss of CRISP1 and CRISP3 disrupts Ca2+ regulation in the epididymal fluid, leading to sperm DNA fragmentation and impaired embryonic development after fertilization. This proposed mechanism is both novel and intriguing, offering valuable insights into the epididymal control of sperm quality.

      Weaknesses:

      The evidence supporting the mechanism of CRISP1 and CRISP3 in calcium regulation within epididymis and its contribution to the sperm DNA damage remains limited.

      Major comments:

      The data provided in this manuscript (Figure 2A and B) appear to overlap with data in previously published paper (PMID:33037689), despite differences in the duration of in vivo fertilization after mating. The results in both studies show similar findings, raising concerns about potential data redundancy.

      As shown in Figure 6A, while wild-type sperm were exposed to the epididymal fluid of C1/C3 DKO mice, the wild-type sperm exhibited DNA fragmentation. Additionally, when wild-type sperm were exposed to the epididymal fluid of wild-type mice with 10 mM Ca2+, DNA fragmentation is still observed. Therefore, the authors conclude that the DNA fragmentation in C1/C3 DKO sperm is due to the increased level of the Ca2+. However, the connection between the DNA damage in wild-type sperm exposed to the epididymal fluid of C1/C3 DKO mice and the increased levels of Ca2+ remains unclear. To clarify this, it is suggested that intracellular calcium levels in the wild type sperm should be analyzed before and after exposure to the epididymal fluid of C1/C3 DKO mice (or before and after adding 10 mM Ca2+ into wild-type fluid). Furthermore, the author should explain detailed information on epididymal fluid collection, because Ca2+ levels vary between different sections of the epididymis.

      In lines 321-323, the authors mention the selection system of the female reproductive tract that only allows high-quality sperm to reach the eggs (Cummins and Yanagimachi 1982), but this paper is not listed in the bibliography. It is important to ensure proper referencing.

      The discussion section is too long and difficult to follow well because there is redundancy of the results in many parts. It is recommended to shorten it by focusing only on relevant and important information.

    1. Reviewer #2 (Public review):

      In their manuscript entitled "BEND2 is a crucial player in oogenesis and reproductive aging", the authors present their findings that full-length BEND2 is important for repair of meiotic double strand break repair in spermatocytes, regulation of LINE-1 elements in spermatocytes, and proper oocyte meiosis and folliculogenesis in females. The manuscript utilizes an elegant system to specifically ablate the full-length form of BEND2 which has been historically difficult to study due to its location on the X chromosome and male sterility of global knockout animals.

      The authors have been extremely responsive to reviewer critiques and have presented strong data and appropriate conclusions, making it an excellent addition to the field.

    1. Reviewer #2 (Public review):

      Summary:

      The authors investigated DG neuronal activity at the population and single cell level across sleep/wake periods. They found an infraslow oscillation (0.01-0.03 Hz) in both granule cells (GC) and mossy cells (MC) during NREM sleep. The important findings are:

      (1) The antiparallel temporal dynamics of DG neuron activities and serotonin neuron activities/extracellular serotonin levels during NREM sleep<br /> (2) The GC Htr1a-mediated GC infraslow oscillation.

      Strengths:

      (1) The combination of polysomnography, Ca-fiber photometry, two-photon microscopy and gene depletion is technically sound. The coincidence of microarousals and dips in DG population activity is convincing. The dip in activity in upregulated cells is responsible for the dip at the population level.

      (2) DG GCs express excitatory Htr4 and Htr7 in addition to inhibitory Htr1a, but deletion of Htr1a is sufficient to disrupt DG GC infraslow oscillation, supporting the importance of Htr1a in DG activity during NREM sleep.

      Weaknesses from the original round of review:

      (1) The current data set and analysis are insufficient to interpret the observation correctly [...].

      (2) It is acceptable that DG Htr1a KO induces the reduced freezing in the CFC test (Fig. 6E, F), but it is too much of a stretch that the disruption of DG ISO causes impaired fear memory. There should be a correlation.

      (3) It is necessary to describe the extent of AAV-Cre infection. The authors injected AAV into the dorsal DG (AP -1.9 mm), but the histology shows the ventral DG (Supplementary Fig. 4), which reduces the reliability of this study.

      Comments on revisions:

      Thank you for the clarification of the detection criteria and the quantification of the specific events. This reviewer can now follow the authors' interpretation.

    1. Reviewer #2 (Public review):

      Summary:

      In this well-conceived and timely study, the authors assess the controllability of emotions in a quantitative way using the framework of control theory. They use a controlled distancing intervention halfway through an emotion rating task where emotion-inducing short videos from a validated database are shown and find that the intervention enables a better controllability of externally induced emotions in the experimental group.

      Strengths:

      It is a highly original idea to address the external controllability of emotions using the formal framework of control theory. It is also a very propitious approach to take what could be called a 'micro-therapeutic' perspective which looks at the immediate effect of an intervention instead of the 'macro-therapeutic' mid- or long-term effect of a whole course of therapy.

      Weaknesses:

      Acquiring data online inevitably gives rise to selection and self-selection effects. This needs to be acknowledged clearly. Exacerbating this, participant remuneration seems low at an amount below the minimum or living wage in Western countries (do the authors know where their participants came from?).

      Another concern is that the intervention does not simply take place before the second block begins but is ongoing during the whole of the second block in that it is integrated into the phrasing of the task on each trial. It is therefore somewhat misleading to speak of a period 'after the intervention', and it would have been interesting to assess the effect of this by including a third group where the phrasing does not change, but the floating leaves intervention takes place.

      As mentioned in the Limitations section, observation noise was assumed and not estimated. While this is understandable in this case, the effect of this assumption could have been assessed by simulation with varying levels of observation (and process) noise.

      Relatedly, the reliance on formal model comparison is unfortunate since the outcome of such comparisons is easily influenced by slight changes to assumptions such as noise levels. An alternative approach would have been to develop a favoured model based on its suitability to address the research question and its ability, established by simulation, to distill relevant changes of behaviour into reliable parameter estimates.

      The statistical analyses clearly show the limitations of classical statistical testing with highly complex models of the kind the authors (commendably) use. Hunting for statistically significant interactions in a multivariate repeated-measures design relying on inputs from time series-derived point estimates is a difficult proposition. While the authors make the best of the bad situation they create by using null-hypothesis significance testing, a more promising approach would have been to estimate parameters using a sampler like Stan or PyMC and then draw conclusions based on posterior predictive simulations.

    1. Reviewer #2 (Public review):

      Summary:

      The report by Kohwi-Shigematsu et al. describes the key observation that SATB1 binds directly to so-called BUR elements. This is in contrast to several other reports describing SATB1 binding to promoters and enhancers. This discrepancy is explained by the authors to depend on the features of the ChIP technique being used. Urea-ChIP, innovated by the authors, strips off protein-protein interactions that are maintained in conventional ChIP. The authors convincingly make the case that SATB1 and the key genome organiser CTCF co-localize by conventional ChIP but not urea ChIP, as particularly evident in Figure 2A. SATB1 controls long-range interactions in thymocytes and the expression of gene clusters. This feature is independent of TADs, as the knockdown of SATB1 expression does not affect the TAD patterns.

      Strengths:

      A new and innovative adaptation of the urea ChIP-seq technique has enabled the authors to reveal a new aspect of SATB1 binding to the genome. The authors provide a wealth of data to reinforce their claims. This report thus sheds new light on SATB1 function, which is particularly important given its role in metastasising cancer cells.

      Weaknesses:

      No weaknesses were identified by this reviewer.

    1. Reviewer #2 (Public review):

      Summary:

      This study identifies a key role for bodywide canonical Wnt gradients in controlling the outcome of regeneration within planarians, likely acting in parallel to injury-induced cues that also use tissue asymmetry to control this process. In S. Mediterranea a central part of this decision process is the asymmetric expression of the Wnt inhibitor notum specifically at injury sites facing in the anterior direction to promote head formation and inhibit tail formation through regulation of canonical Wnt signaling pathways. Leveraging classic studies by T.H. Morgan over a century ago, which found that amputated thin transverse fragments occasionally incorrectly regenerate 2 heads rather than a head and a tail in a species of Girardia planarians, this study identifies a closely related species G. Sinensis which undergoes errors to regeneration specificity under similar challenges. Morgan had proposed that his results might arise from the use of a "gradient of materials" providing axis information across the body axis such that small tissue fragments are too narrow to interpret gradient differences, leading to head/tail polarity defects in regeneration. The authors show very convincingly that this species of planaria undergoes notum expression after injury, but unlike in S. Mediterranea, this occurs symmetrically at the onset of regeneration. Using RNAi, they show notum participates in the regeneration of mispolarized heads (though interestingly apparently not in normal head regeneration unlike in Smeds, at least under these conditions). G. Sinensis planarians, like many organisms, have abundant expression of Wnt genes posteriorly. To test whether this gradient of Wnts may participate in the regeneration distinct from any Wnt signals activated after injury, the authors use chemical inhibition to reduce Wnt signaling prior to injury and then alleviate inhibition following injury by removal of the drug and confirming successful washout of the drug using mass spec. They also raise a new antibody that can detect beta-catenin-1 in this species in order to monitor the body-wide cWnt gradient after these treatments, and correlate this with outcomes on the head/tail regeneration decision. Using this approach, they find that homeostatic inhibition of porcupine (required for Wnt secretion) could dampen the cWnt/beta-catenin gradient and increase the incidence of inappropriate head regeneration at posterior-facing wounds. In addition, they find that the cWnt gradient is less steep in larger animals that also concurrently have a higher incidence of mistakes in regeneration specificity. Together, the paper presents compelling experiments and analysis to support the conclusion that cWnt gradients are an important determinant of head/tail identity determination decisions in G. Sinensis, and thereby proposes a plausible model that the notum asymmetry present in S. Mediterranea could act in parallel to support the higher regeneration robustness observed in that species.

      Strengths:

      This is a great paper, an instant classic. It addresses an enduring problem that Morgan and others initiated more than a century ago and brings a new synthesis of ideas to clarify an important mechanism. I also like the term "regeneration specificity" which can provide a nice unification and generalization of ideas that other authors have variously described as regeneration patterning or regeneration polarity. The work is a tour de force that creatively builds new tools and observations to leverage a new model of planarian species for unraveling general mechanisms of regeneration decision-making. The experiments are rigorously conducted and I find the overall data to be quite compelling. I have some comments for the authors to consider below for drawing out the interpretation and also clarifying the underlying mechanism.

      Comments:

      (1) The G. Sinesis species showed accurate head/tail specificity in 2mm thick fragments but was strongly impaired at 1 mm thick. I am assuming that outcomes of pieces greater than 2mm would make similarly robust head/tail choices, implying a rather sharp transition occurring between 1 and 2 mm. In that case, in the gradient model, are there theoretical reasons to predict that polarity outcomes would decline sharply rather than gradually as size thickness decreases? I think the muscle fibers themselves are thought to have lengths on the order of 200 microns, so I wonder what could account for the characteristic length of less than 1mm here? From the lab's prior analysis of beta-cat gradient, is this perhaps the minimal length where a difference in bcat protein levels can be detected? This is not essential to resolve in this draft (in my view), just a very interesting question arising from the present study. Relatedly, it seems that the slope of cWnt at the wound site itself might not be enough information for polarity because at a highly granular level, this should be identical at posterior-facing wounds from trunk fragments versus thin transverse fragments obtained at the same AP position, yet trunk fragments succeed at regeneration specificity whereas thin transverse fragments fail.

      (2) The paper nicely shows strong evidence that notum expression is definitely symmetric at the first occurrence of its expression by 6 hours in D. Sinensis, and this is a really important result of the paper. At 12 hours, it does look to me in the FISH experiments that there is more persistence of expression at the anterior-facing wound versus the posterior-facing wounds (Fig 2D), although the methods for quantification in Fig2E/F do not show a difference in expression at the two wound sites at this time point. Could this difference arise from differences in the perdurance or timing of early wound-induced signaling at the two wound sites that was perhaps too subtle to detect in the quantification methods used? Or perhaps these images do not represent the population? On a related note, the quantification method seems to fail to show that in 6h Smeds, notum expression is indeed asymmetric. Probably the issue here is not the data in the FISH images themselves which strongly support the author's interpretations, but rather a deficiency or limitation of the quantification method used, which should be resolved so that the conclusions from the single FISH images can be interpreted robustly. For example, some authors have used a method of counting notum+ cells and I wonder if this could provide better quantitative information here.

      (3) Given that the double-headed phenotype is observed from thin transverse fragments, ideally, the symmetry of notum could be established to occur in those types of fragments as well. This experiment would clarify that notum is expressed at posterior-facing wounds in the very same types of fragments that undergo the highest levels of mistakes in regeneration specificity.

      (4) Is wnt1 expressed symmetrically at wound sites in this species? It seems there are cases like acoels where wound-induced Wnt activation can occur asymmetrically but through preferential expression of Wnts at posterior-facing wounds, rather than notum. It would be interesting to know although I also think the work the authors already have done in this study itself already constitutes a very comprehensive advance and could be the subject of future work.

      (5) I agree that notum is relatively much more strongly expressed at the far posterior region in D. Senesis than in Smeds, but it does seem from the RNAseq data it also has some locally enriched expression at the anterior pole. Because the RNAseq analysis involves scaling expression across the regions for each gene, it is difficult to know if the anterior expression is relatively lower or perhaps even about the same level of expression as the anterior pole expression of this gene in Smeds. Though not essential to make the desired arguments, in situs on notum in the intact animals would be helpful to clarify this. Relatedly it would be fascinating to know whether D. Senesis notum undergoes anterior-pole expression around the 72 hour or similar timepoint as in Smeds.

      (6) The assessment of beta-catenin gradients was done through protein extractions from whole tissue fragments. However, it has been shown in other planarian species that beta-catenin can have strong tissue-specific expression in, for example, the pharynx, brain, and reproductive systems. Some supporting evidence or argument should be presented to clarify the interpretation that the graded expression observed by western blotting cannot be fully explained by this kind of tissue-specific expression of beta-catenin rather than representing a true signaling gradient as interpreted by the authors. For example, if this antibody could be used in immunostaining, this could support the beta-catenin signaling gradient. Alternatively, information about the location of the pharynx or any other posterior reproductive tissues in D. Sinensis could be calibrated with respect to the fragment bins used for the gradient--perhaps a portion of the C59-dependent body-wide gradient measured here occurs fully within tail tissue that lacks other regionalized tissue that could be a potential additional source of beta-catenin. Further discussion and interpretation, or additional experiments, should be included to rule out alternative confounding sources of beta-catenin in order to clarify the interpretation of the western blot as representing a beta-catenin signaling gradient.

      (7) I find the analysis in Figure 5 to be quite compelling for showing the importance of cWnt/Bcat gradients in contributing to head/tail determination, and I also think that the author's discussion of the limitations of the approach are well articulated and considered. Based on prior literature, it also seems very likely that there is a third redundantly acting component to regeneration specificity, which is the amplification of small differences in cWnt in a directional-dependent manner early in the regeneration process (24-72 hours in Smeds). This would explain why post-amputation with porcupine inhibitor in D. Sinensis caused 100% penetrant defects in regeneration specificity while the pre-treatment paradigm caused a weaker effect (25-40% for larger animals). In Smeds, it is known already that delivery of dsRNAs against beta-catenin-1, wnt1, and notum only after injury caused polarity defects, and thus all three genes certainly have a function relevant for head/tail after injury (Petersen and Reddien 2008, 2009, 2011- please note these experiments were reported in the text of these studies and not in individual figures). This evidence, combined with extensive FISH and complementary RNAi studies in the field, strongly suggests that some combination of the 6-18h injury-induced phase but also very likely the subsequent "pole-specific phase" of wnt1 expression is likely to be important for driving or enacting the tail fate program and is therefore a component of the regeneration specificity mechanism described here.

      (8) Prior work has also demonstrated roles for Wnt genes expressed in gradients to participate in regeneration specificity. In particular, inhibition of the wntP-2/wnt11-5 gene, which is expressed in an animal-wide gradient, strongly enhanced the effects of inhibition of wnt1, which is the earliest wound-activated Wnt gene, to cause 100% penetrant posterior head regeneration phenotypes in S. mediterranea (Petersen and Reddien 2009). These observations are complementary to the present study by implicating Wnts expressed in bodywide gradients in the process of regeneration decision-making. Given that this study also showed that wnt1 is necessary for new wntP-2 expression during the wound-induced early phase and that wnt1 activation does not require beta-catenin for its expression, collectively suggest a more complex process involved in gradient detection and the involvement of wound signals likely beyond only autoregulation of the cWnt gradient or notum asymmetry mechanisms. Although this paper is cited already, framing the present study more fully in context with this and other relevant prior work would be helpful to contextualize the advance for the field.

    1. Reviewer #2 (Public review):

      Summary:

      This study introduces a set of genetically encoded tools for the selective and reversible ablation of excitatory and inhibitory synapses. Previously, the authors developed GFE3, a tool that efficiently ablates inhibitory synapses by targeting an E3 ligase to the inhibitory scaffolding protein Gephyrin via GPHN.FingR, a recombinant, antibody-like protein (Gross et al., 2016). Building on this work, they now present three new ablation tools: PFE3, which targets excitatory synapses, and two new versions of GFE3-paGFE3 and chGFE3-that are photoactivatable and chemically inducible, respectively. These tools enable selective and efficient synapse ablation in specific cell types, providing valuable methods for disrupting neural circuits. This approach holds broad potential for investigating the roles of specific synaptic input onto genetically determined cells.

      Strengths:

      The primary strength of this study lies in the rational design and robust validation of each tool's effectiveness, building on previous work by the authors' group (Gross et al., 2016). Each tool serves distinct research needs: PFE3 enables efficient degradation of PSD-95 at excitatory synapses, while paGFE3 and chGFE3 allow for targeted degradation of Gephyrin, offering spatiotemporal control over inhibitory synapses via light or chemical activation. These tools are efficiently validated through robust experiments demonstrating reductions in synaptic markers (PSD-95 and Gephyrin) and confirming reversibility, which is crucial for transient ablation. By providing tools with both optogenetic and chemical control options, this study broadens the applicability of synapse manipulation across varied experimental conditions, enhancing the utility of E3 ligase-based approaches for synapse ablation.

      Weaknesses:

      While this study provides valuable tools and addresses many critical points for varidation, examining potential issues with specificity and background ubiquitination in further detail could strengthen the paper. For PFE3, the study demonstrates reductions in both PSD-95 and GluA1. In their previous work, GFE3 selectively reduced Gephyrin without affecting major Gephyrin interactors or other PSD proteins. Clarifying whether PFE3 affects additional PSD proteins beyond GluA1 would be important for accurately interpreting results in experiments using PFE3. Additionally, further insight into PFE3's impact on inhibitory synapses would be valuable to assess the excitatory specificity and potential for circuit-level applications. For paGFE3 and chGFE3, the E3 ligase (RING domain of Mdm2) is overexpressed and thus freely diffusible within the cell as a separate construct. Although the authors show that Gephyrin is not significantly reduced without light or chemical activation, it remains possible that other proteins, particularly non-synaptic proteins, could be ubiquitinated due to the presence of freely diffusing E3 ligase in cytosol. Addressing these points would clarify the strengths and limitations of tools, providing users with valuable information.

    1. Reviewer #2 (Public review):

      Summary:

      By measuring intracellular changes in membrane voltage from a single neuron of the medulla the authors describe a method for determining the balance of excitatory and inhibitory synaptic drive onto a single neuron within this important brain region.

      Strengths:

      This data-driven approach to exploring neural circuits is well described and could be valuable in identifying microcircuits that generate rhythms. Importantly, perhaps, this inference method could enable microcircuits to be studied without the need for time consuming anatomical tracing or other more involved electrophysiological techniques. Therefore, I definitely can see the value in developing an approach of this type.

      Weaknesses:

      There are many assumptions that need to be accepted in order to successfully apply this technique and I was pleased to see that several of these assumption have been explored by the authors in this study.

      For example, this approach involves assuming the reversal potential that is associated with the different permeant ions that underlie the excitation and inhibition as well as the application of Ohms law to estimate the contribution of excitation and inhibitory conductance. My first concern was that this approach relies on a linear I-V relationship between the measured voltage and the estimated reversal potential. However, open rectification is a feature of any I-V relationship generated by asymmetric distributions of ions (see the GHK current equation) and will therefore be a particular issue for the inhibition resulting from asymmetrical Cl- ion gradients across GABA-A receptors. The mixed cation conductance that underlies most synaptic excitation will also generate a non-linear I-V relationship due to the inward rectification associated with polyamine block of AMPA receptors. The authors present evidence that over most of the voltage range examined the I-V relationship is linear and this is a helpful addition.

      This approach has similarities to earlier studies undertaken in the visual cortex that estimated the excitatory and inhibitory synaptic conductance changes that contributed to membrane voltage changes during receptive field stimulation. However, these approaches also involved the recording of transmembrane current changes during visual stimulation that were undertaken in voltage-clamp at various command voltages to estimate the underlying conductance changes. Molkov et al have attempted to essentially deconvolve the underlying conductance changes without this information and I am concerned that this simply may not be possible.

      The current balance equation (1) cited in this study is based upon the parallel conductance model developed by Hodgkin & Huxley. One key element of the HH equations is the inclusion of an estimate of the capacitive current generated due to the change in voltage across the membrane capacitance. While the present study takes into account the impact of membrane capacitance, a deeper discussion on how variations in capacitance across different neuron types might affect inference accuracy would be useful. Differences in capacitance could introduce variability in inferred conductances, potentially influencing model predictions.

      Studies using acute slicing preparations to examine circuit effects have often been limited to the study of small microcircuits - especially feedforward and feedback interneuron circuits. It is widely accepted that any information gained from this approach will always be compromised by the absence of patterned afferent input from outside the brain region being studied. In this study, descending control from the Pons and the neocortex will not be contributing much to the synaptic drive and ascending information from respiratory muscles will also be absent completely. This may not have been such a major concern if this study was limited to demonstrating the feasibility of a methodological approach. However, this limitation does need to be considered when using an approach of this type to speculate on the prevalence of specific circuit motifs within the medulla (Figure 4). Therefore, I would argue that some discussion of this limitation should be included in this manuscript.

    1. Reviewer #2 (Public review):

      Summary:

      The study examined 10 congenitally blind patients who recovered vision through the surgical removal of bilateral dense cataracts, measuring neural activity and neuro chemical profiles from the visual cortex. The declared aim is to test whether restoring visual function after years of complete blindness impacts excitation/inhibition balance in the visual cortex. The manuscript reports precious behavioural, electrophysiological and magnetic resonance data from a rare population. Although the findings are useful for stimulating further research in the field, they only provide incomplete support to the authors' claims.

      The main claim is that sight recovery impacts the excitation/inhibition balance in the visual cortex; however, the paradigm does not allow to distinguish the effects of sight recovery from those of visual deprivation (i.e. in patients who were born blind but recovered vision after several months/years vs. patients who were born blind and never recovered vision); moreover, the link between electrophysiological findings and cortical excitation/inhibition is tentative and its interpretation remains speculative.

      Strengths:

      The findings are undoubtedly useful for the community, as they contribute towards characterising the many ways in which this special population differs from normally sighted individuals. The combination of MRS and EEG measures is a promising strategy to estimate a fundamental physiological parameter - the balance between excitation and inhibition in the visual cortex, which animal studies show to be heavily dependent upon early visual experience. Thus, the reported results pave the way for further studies, which may use a similar approach to evaluate more patients and control groups.

      Weaknesses:

      The main methodological limitation is the lack of an appropriate comparison group or condition to delineate the effect of sight recovery (as opposed to the effect of congenital blindness). Few previous studies suggested that Excitation/Inhibition ratio in the visual cortex is increased in congenitally blind patients; the present study reports that E/I ratio decreases instead. The authors claim that this implies a change of E/I ratio following sight recovery. However, supporting this claim would require showing a shift of E/I after vs. before the sight-recovery surgery, or at least it would require comparing patients who did and did not undergo the sight-recovery surgery (as common in the field).

      There are also more technical limitations related to the correlation analyses, which are partly acknowledged in the manuscript. A bland correlation between GLX/GABA and the visual impairment is reported, but this is specific to the patients group (N=10) and would not hold across groups (the correlation is positive, predicting the lowest GLX/GABA ratio values for the sighted controls - opposite of what is found). There is also a strong correlation between GLX concentrations and the EEG power at the lowest temporal frequencies. Although this relation is intriguing, it only holds for a very specific combination of parameters (of the many tested): only with eyes open, only in the patients group.

      Conclusions:

      The main claim of the study is that sight recovery impacts the excitation/inhibition balance in the visual cortex, estimated with MRS or through indirect EEG indices. However, due to the weaknesses outlined above, the study cannot distinguish the effects of sight recovery from those of visual deprivation. Moreover, many aspects of the results are interesting but their validation and interpretation require additional experimental work.

      Comments on revisions:

      The authors' revisions did not substantially alter the manuscript. As such, my assessment above remains unaltered.

    1. Reviewer #3 (Public review):

      Summary:

      The authors investigate the extent to which the responses of different layers of a vision model (VGG-11) can be linked to the cascade of responses (namely, type-I, type-II and N400) in the human brain when reading words. To achieve maximal consistency between, they add noisy-activations to VGG and finetune it on a character recognition task. In this setup, they observe various similarities between the behavior of VGG and the brain when presented with various transformations of the words (added noise, font modification etc).

      Strengths:<br /> - The paper is well written and well presented<br /> - The topic studied is interesting.<br /> - The fact that the response of the CNN on unseen experimental contrasts such as adding noise correlated with previous results on the brain is compelling.

      Weaknesses:<br /> - The paper is rather qualitative in nature. In particular, the authors show that some resemblance exists between the behavior of some layers and some parts of the brain, but it is hard to quantitively understand how strong the resemblences are in each layer, and the exact impact of experimental settings such as the frequency balancing (which seems to only have a very moderate effect according to figure 5)<br /> - The experiments only consider a rather outdated vision model (VGG)

      Comments on revisions:

      After rebuttal, the authors significantly strengthened their results. I now find the paper much more convincing, and thank the author for their careful consideration of the reviewers' suggestions.

    1. Reviewer #2 (Public review):

      Wolbachia are maternally transmitted bacteria that can manipulate host reproduction in various ways. Some Wolbachia induce male killing (MK), where the sons of infected mothers are killed during development. Several MK-associated genes have been identified in Homona magnanima, including Hm-oscar and wmk-1-4, but the mechanistic links between these Wolbachia genes and MK in the native host are still unclear.

      In this manuscript, Arai et al. show that Hm-oscar is the gene responsible for Wolbachia-induced MK in Homona magnanima. They provide evidence that Hm-Oscar functions through interactions with the sex determination system. They also found that Hm-Oscar disrupts sex determination in male embryos by inducing female-type dsx splicing and impairing dosage compensation. Additionally, Hm-Oscar suppresses the function of Masc. The manuscript is well-written and presents intriguing findings. The results support their conclusions regarding the diversity and commonality of MK mechanisms, contributing to our understanding of the mechanisms and evolutionary aspects of Wolbachia-induced MK.

    1. Reviewer #2 (Public review):

      This paper examines the reproducibility of results reported by the Murphy lab regarding transgenerational inheritance of a learned avoidance behavior in C. elegans. It has been well established by multiple labs that worms can learn to avoid the pathogen pseudomonas aeruginosa (PA14) after a single exposure. The Murphy lab has reported that learned avoidance is transmittable to 4 generations and dependent on a small RNA expressed by PA14 that elicits the transgenerational silencing of a gene in C. elegans. The Hunter lab now reports that although they can reproduce inheritance of the learned behavior by the first generation (F1), they cannot reproduce inheritance in subsequent generations.

      This is an important study that will be useful for the community. Although they fail to identify a "smoking gun", the study examine several possible sources for the discrepancy, and their findings will be useful to others interested in using these assays. The preference assay appears to work in their hands in as much as they are able to detect the learned behavior in the P0 and F1 generations, suggesting that the failure to reproduce the transgenerational effect is not due to trivial mistakes in the protocol. The authors provide a full protocol and highlight key deviations from the Murphy lab protocol. The authors provide good evidence that no single protocol modification was sufficient on its own to explain the divergent results. It remains possible that protocol differences affected the assay cumulatively or that other uncontrolled factors were responsible. Nevertheless, the authors provide good evidence that the trans-generational effect reported by the Murphy lab lacks experimental robustness, calling into question its ecological relevance in the wild.

    1. Reviewer #3 (Public review):

      Chen et al have identified a new candidate gene for high myopia, ZC3H11A, and using a knock-out mouse model, have attempted to validate it as a myopia gene and explain a potential mechanism. They identified 4 heterozygous missense variants in highly myopic teenagers. These variants are in conserved regions of the protein, and predicted to be damaging, but the only evidence the authors provide that these specific variants affect protein function is a supplement figure showing decreased levels of IκBα after transfection with overexpression plasmids (not specified what type of cells were transfected). This does not prove that these mutations cause loss of function, in fact it implies they have a gain-of-function mechanism. They then created a knock-out mouse. Heterozygotes show myopia at all ages examined but increased axial length only at very early ages. Unfortunately, the authors do not address this point or examine corneal structure in these animals. They show that the mice have decreased B-wave amplitude on electroretinogram (a sign of retinal dysfunction associated with bipolar cells), and decreased expression of a bipolar cell marker, PKCα. On electron microscopy, there are morphologic differences in the outer nuclear layer (where bipolar, amacrine, and horizontal cell bodies reside). Transcriptome analysis identified over 700 differentially expressed genes. The authors chose to focus on the PI3K-AKT and NF-κB signaling pathways and show changes in expression of genes and proteins in those pathways, including PI3K, AKT, IκBα, NF-κB, TGF-β1, MMP-2 and IL-6, although there is very high variability between animals. They propose that myopia may develop in these animals either as a result of visual abnormality (decreased bipolar cell function in the retina) or by alteration of NF-κB signaling. These data provide an interesting new candidate variant for development of high myopia, and provide additional data that MMP2 and IL6 have a role in myopia development. For this revision, none of my previous suggestions have been addressed.

    1. Reviewer #2 (Public review):

      Summary:

      The authors present a straightforward and convincing demonstration of a reagent and workflow that they collectively term "MagIC-cryo-EM", in which magnetic nanobeads combined with affinity linkers are used to specifically immobilize and locally concentrate complexes that contain a protein-of-interest. As a proof of concept, they localize, image, and reconstruct H1.8-bound nucleosomes reconstructed from frog egg extracts. The authors additionally devised an image-processing workflow termed "DuSTER", which increases the true positive detections of the partially ordered NPM2 complex. The analysis of the NPM2 complex {plus minus} H1.8 was challenging because only ~60 kDa of protein mass was ordered. Overall, single-particle cryo-EM practitioners should find this study useful.

      Strengths:

      The rationale is very logical and the data are convincing.

      Weaknesses:

      I have seen an earlier version of this study at a conference. The conference presentation was much easier to follow than the current manuscript. It is as if this manuscript had undergone review at another journal and includes additional experiments to satisfy previous reviewers. Specifically, the NPM2 results don't seem to add much to the main story (MagIC-cryo-EM) and read more like an addendum. The authors could probably publish the NPM2 results separately, which would make the core MagIC results (sans DusTER) easier to read.

      Comments on revisions:

      The authors have addressed my concerns. Congratulations!

    1. Reviewer #3 (Public review):

      Summary:

      Previous studies have analyzed the binding of ZapD to FtsZ and provided images of negatively stained toroids and straight bundles, where FtsZ filaments are presumably crosslinked by ZapD dimers. Toroids without ZapD have also been previously formed by treating FtsZ with crowding agents. The present study is the first to apply cryoEM tomography, which can resolve the structure of the toroids in 3D. This shows a complex mixture of filaments and sheets irregularly stacked in the Z direction and spaced radially. The most important interpretation would be to distinguish FtsZ filaments from ZapD crosslinks, This is less convincing. The authors seem aware of the ambiguity: "However, we were unable to obtain detailed structural information about the ZapD connectors due to the heterogeneity and density of the toroidal structures, which showed significant variability in the conformations of the connections between the filaments in all directions." Therefore, the reader may assume that the crosslinks identified and colored red are only suggestions, and look for their own structural interpretations. But readers should also note some inconsistencies in stoichiometry and crosslinking arrangements that are detailed under "weaknesses."

      Strengths.

      This is the first cryoEM tomography to image toroids and straight bundles of FtsZ filaments bound to ZapD. A strength is the resolution, which. at least for the straight bundles. is sufficient to resolve the ~4.5 nm spacing of ZapD dimers attached to and projecting subunits of an FtsZ filament. Another strength is the pelleting assay to determine the stoichiometry of ZapD:FtsZ (although this also leads to weaknesses of interpretation).

      Weaknesses

      The stoichiometry presents some problems. Fig. S5 uses pelleting to convincingly establish the stoichiometry of ZapD:FtsZ. Although ZapD is a dimer, the concentration of ZapD is always expressed as that of its subunit monomers. Fig. S5 shows the stoichiometry of ZapD:FtsZ to be 1:1 or 2:1 at equimolar or high concentrations of ZapD. Thus at equimolar ZapD, each ZapD dimer should bridge two FtsZ's, likely forming crosslinks between filaments. At high ZapD, each FtsZ should have it's own ZapD dimer. However, this seems contradicted by later statements in Discussion and Results. (1) "At lower concentrations of ZapD, .. toroids are the most prominent structures, containing one ZapD dimer for every four to six FtsZ molecules." Shouldn't it be one ZapD dimer for every two FtsZ? (2) "at the high ZapD concentration...a ZapD dimer binds two FtsZ molecules connecting two filaments." Doesn't Fig. S5 show that each FtsZ subunit has its own ZapD dimer? And wouldn't this saturate the CTD sites with dimers and thus minimize crosslinking?

      A major weakness is the interpretation of the cryoEM tomograms, specifically distinguishing ZapD from FtsZ. The distinction of crosslinks seems based primarily on structure: long continuous filaments (which often appear as sheets) are FtsZ, and small masses between filaments are ZapD. The density of crosslinks seems to vary substantially over different parts of the figures. More important, the density of ZapD's identified and colored red seem much lower than the stoichiometry detailed above. Since the mass of the ZapD monomer is half that of FtsZ, the 1:1 stoichiometry in toroids means that 1/3 of the mass should be ZapD and 2/3 FtsZ. However, the connections identified as ZapD seem much fewer than the expected 1/3 of the mass. The authors conclude that connections run horizontally, diagonally and vertically, which implies no regularity. This seems likely, but as I would suggest that readers need to consider for themselves what they would identify as a crosslink.

      In contrast to the toroids formed at equimolar FtsZ and ZapD, thin bundles of straight filaments are assembled in excess ZapD. Here the stoichiometry is 2:1, which would mean that every FtsZ should have a bound ZapD DIMER. The segmentation of a single filament in Fig. 5e seems to agree with this, showing an FtsZ filament with spikes emanating like a picket fence, with a 4.5 nm periodicity. This is consistent with each spike being a ZapD dimer, and every FtsZ subunit along the filament having a bound ZapD dimer. But if each FtsZ has its own dimer, this would seem to eliminate crosslinking. The interpretative diagram in Fig. 6, far right, which shows almost all ZapD dimers bridging two FtsZs on opposite filaments, would be inconsistent with this 2:1 stoichiometry.

      In the original review I suggested a control that might help identify the structures of ZapD in the toroids. Popp et al (Biopolymers 2009) generated FtsZ toroids that were identical in size and shape to those here, but lacking ZapD. These toroids of pure FtsZ were generated by adding 8% polyvinyl chloride, a crowding agent. The filamentous substructure of these toroids in negative stain seemed very similar to that of the ZapD toroids here. CryoET of these toroids lacking ZapD might have been helpful in confirming the identification of ZapD crosslinks in the present toroids. However, the authors declined to explore this control.

      Finally, it should be noted that the CTD binding sites for ZapD should be on the outside of curved filaments, the side facing the membrane in the cell. All bound ZapD should project radially outward, and if it contacted the back side of the next filament, it should not bind (because the CTD is on the front side). The diagram second to right in Fig. 6 seems to incorporate this abortive contact.

    1. Reviewer #2 (Public review):

      Summary:

      The authors carry out a careful and rigorous quantitative analysis of RecB transcript and protein levels at baseline and in response to DNA damage. Using single-molecule FISH and Halo-tagging in order to achieve sensitive measurements, they provide evidence that enhanced RecB protein levels in response to DNA damage are achieved through a post-transcriptional mechanism mediated by the La-like RNA binding protein, Hfq. In terms of biological relevance, the authors suggest that this mechanism provides a way to control the optimum level of RecB expression as both deletion and over-expression are deleterious. In addition, the proposed mechanism provides a new framework for understanding how transcriptional noise can be suppressed at the protein level.

      Strengths:

      Strengths of the manuscript include the rigorous approaches and orthogonal evidence to support the core conclusions, for example, the evidence that altering either Hfq or its recognition sequence on the RNA similarly enhance the protein to RNA ratio of RecB. The writing is clear and the experiments are well-controlled. The modeling approaches provide essential context to interpret the data, particularly given the small numbers of molecules per cell. The interpretations are careful and well supported. The findings

      Weaknesses:

      Future studies (and possibly new experimental tools) will be needed to provide further insight into the relevance of the findings to more subtle changes in RecB levels than that occurring in response to extensive DNA damage.

    1. Reviewer #2 (Public review):

      Summary:

      Many aspects of the study are carefully done, and in the grand scheme this is a solid contribution. I have no "big-picture" concerns about the approach or methodology. However, in numerous places the manuscript is unnecessarily vague, ambiguous, or confusing. Tightening up the presentation will magnify their impact.

      Strengths:

      (1) The study includes urine donors from males of three strains each with three social states, as well as females in two states. This diversity significantly enhances their ability to interpret their results.

      (2) Several distinct analyses are used to explore the question of whether AOB MCs are biased towards specific states or different between estrus and non-estrus females. The results of these different analyses are self-reinforcing about the main conclusions of the study.

      (3) The presentation maintains a neutral perspective throughout while touching on topics of widespread interest.

      Weaknesses:

      (1) Introduction:<br /> The discussion of the role of the VNS and preferences for different male stimuli should perhaps include Wysocki and Lepri 1991

      (2) Results:<br /> a) Given the 20s gap between them, the distinction between sample application and sympathetic nerve trunk stimulation needs to be made crystal clear; in many places, "stimulus application" is used in places where this reviewer suspects they actually mean sympathetic nerve trunk stimulation.<br /> b) There appears to be a mismatch between the discussion of Figure 3 and its contents. Specifically, there is an example of an "adjusted" pattern in 3A, not 3B.<br /> c) The discussion of patterns neglects to mention whether it's possible for a neuron to belong to more than one pattern. For example, it would seem possible for a neuron to simultaneously fit the "ICR pattern" and the "dominant adjusted pattern" if, e.g., all ICR responses are stronger than all others, but if simultaneously within each strain the dominant male causes the largest response.

      (3) Discussion:<br /> a) The discussion of chemical specificity in urine focuses on volatiles and MUPs (citation #47), but many important molecules for the VNS are small, nonvolatile ligands. For such molecules, the corresponding study is Fu et al 2015.<br /> b) "Following our line of reasoning, this scarcity may represent an optimal allocation of resources to separate dominant from naïve males": 1 unit out of 215 is roughly consistent with a single receptor. Surely little would be lost if there could be more computational capacity devoted to this important axis than that? It seems more likely that dominance is computed from multiple neuronal types with mixed encoding.

      (4) Methods:<br /> a) Male status, "were unambiguous in most cases": is it possible to put numerical estimates on this? 55% and 99% are both "most," yet they differ substantially in interpretive uncertainty.<br /> b) Surgical procedures and electrode positioning: important details of probes are missing (electrode recording area, spacing, etc).<br /> c) Stimulus presentation procedure: Are stimuli manually pipetted or delivered by apparatus with precise timing?<br /> d) Data analysis, "we applied more permissive criteria involving response magnitude": it's not clear whether this is what's spelled out in the next paragraph, or whether that's left unspecified. In either case, the next paragraph appears to be about establishing a noise floor on pattern membership, not a "permissive criterion."<br /> e) Data analysis, method for assessing significance: there's a lot to like about the use of pooling to estimate the baseline and the use of an ANOVA-like test to assess unit responsiveness.<br /> But:<br /> i) for a specific stimulus, at 4 trials (the minimum specified in "Stimulus presentation procedure") kruskalwallis is questionable. They state that most trials use 5, however, and that should be okay.<br /> ii) the methods statement suggests they are running kruskalwallis individually for each neuron/stimulus, rather than once per neuron across all stimuli. With 11 stimuli, there is a substantial chance of a false-positive if they used p < 0.05 to assess significance. (The actual threshold was unstated.) Were there any multiple comparison corrections performed? Or did they run kruskalwallis on the neuron, and then if significant assess individual stimuli? (Which is a form of multiple-comparisons correction.)

    1. Reviewer #2 (Public review):

      Summary:

      Pinho et al. developed a new auditory-visual sensory preconditioning procedure in mice and examined the contribution of the dorsal and ventral hippocampus to learning in this task. Using photometry they observed activation of the dorsal and ventral hippocampus during sensory preconditioning and conditioning. Finally, the authors combined their sensory preconditioning task with DREADDs to examine the effect of inhibiting specific cell populations (CaMKII and PV) in the DH on the formation and retrieval/expression of mediated learning.

      Strengths:

      The authors provide one of the first demonstrations of auditory-visual sensory preconditioning in male mice. Research on the neurobiology of sensory preconditioning has primarily used rats as subjects. The development of a robust protocol in mice will be beneficial to the field, allowing researchers to take advantage of the many transgenic mouse lines. Indeed, in this study, the authors take advantage of a PV-Cre mouse line to examine the role of hippocampal PV cells in sensory preconditioning.

      Weaknesses:

      (1) The authors report that sensory preconditioning was observed in both male and female mice. However, their data only supports sensory preconditioning in male mice. In female mice, both paired and unpaired presentations of the light and tone in stage 1 led to increased freezing to the tone at test. In this case, fear to the tone could be attributed to factors other than sensory preconditioning, for example, generalization of fear between the auditory and visual stimulus.

      (2) In the photometry experiment, the authors report an increase in neural activity in the hippocampus during both phase 1 (sensory preconditioning) and phase 2 (conditioning). In the subsequent experiment, they inhibit neural activity in the DH during phase 1 (sensory preconditioning) and the probe test, but do not include inhibition during phase 2 (conditioning). It was not clear why they didn't carry forward investigating the role of the hippocampus during phase 2 conditioning. Sensory preconditioning could occur due to the integration of the tone and shock during phase two, or retrieval and chaining of the tone-light-shock memories at test. These two possibilities cannot be differentiated based on the data. Given that we do not know at which stage the mediate learning is occurring, it would have been beneficial to additionally include inhibition of the DH during phase 2.

      (3) In the final experiment, the authors report that inhibition of the dorsal hippocampus during the sensory preconditioning phase blocked mediated learning. While this may be the case, the failure to observe sensory preconditioning at test appears to be due more to an increase in baseline freezing (during the stimulus off period), rather than a decrease in freezing to the conditioned stimulus. Given the small effect, this study would benefit from an experiment validating that administration of J60 inhibited DH cells. Further, given that the authors did not observe any effect of DREADD inhibition in PV cells, it would also be important to validate successful cellular silencing in this protocol.

    1. Reviewer #2 (Public review):

      Streptococcus pyogenes, or group A streptococci (GAS) can cause diseases ranging from skin and mucosal infections, to plasma invasion, and post-infection autoimmune syndromes. M proteins are essential GAS virulence factors that include an N-terminal hypervariable region (HVR). M proteins are known to bind to numerous human proteins; a small subset of M proteins were reported to bind collagen, which is thought to promote tissue adherence. In this paper, the authors characterize M3 interactions with collagen and its role in biofilm formation. Specifically, they screened different collagen type II and III variants for full-length M3 protein binding using an ELISA-like method, detecting anti-GST antibody signal. By statistical analysis, hydrophobic amino acids and hydroxyproline were found to positively support binding, whereas acidic residues and proline negatively impacted binding (Table 1). The authors applied X-ray crystallography to determine the structure of the N-terminal domain (42-151 amino acids) of M3 protein (M3-NTD). M3-NTD dimmer (PDB 8P6K) forms a T-shaped structure with three helices (H1, H2, H3), which are stabilized by a hydrophobic core, inter-chain salt bridges and hydrogen bonds on H1, H2 helices, and H3 coiled coil. The conserved Gly113 serves as the turning point between H2 and H3 (Figure 5). The M3-NTD is co-crystalized with a 24-residue peptide, JDM238, to determine the structure of M3-collagen binding. The structure (PDB 8P6J) shows that two copies of collagen in parallel bind to H1 and H2 of M3-NTD. Among the residues involved in binding, conserved Try96 is shown to play a critical role supported by structure and isothermal titration calorimetry (ITC). The authors also apply a crystal-violet assay and fluorescence microscopy to determine that M3 is involved in collagen type I binding, but not M1 or M28 (Figure 9). Tissue biopsy staining indicates that M3 strains co-localize with collagen IV-containing tissue, while M1 strains do not. The authors provide generally compelling evidence to show that GAS M3 protein binds to collagen, and plays a critical role in forming biofilms, which contribute to disease pathology. This is a very well-executed study and a well-written report relevant to understanding GAS pathogenesis and approaches to combatting disease; data are also applicable to emerging human pathogen Streptococcus dysgalactiae. One caveat that was not entirely resolved is if/how different collagen types might impact M3 binding and function. Due to the technical constraints, the in vitro structure and other binding assays use type II collagen whereas in vivo, biofilm formation assays and tissue biopsy staining use type I and IV collagen; it was unclear if this difference is significant. One possibility is that M3 has an unbiased binding to all types of collagens, only the distribution of collagens leads to the finding that M3 binds to type IV (basement membrane) and type I (varies of tissue including skin), rather than type II (cartilage).

    1. Reviewer #2 (Public review):

      Summary:

      In "Founder effects arising from gathering dynamics systematically bias emerging pathogen surveillance" Bradford and Hang present an extension to the SIR model to account for the role of larger than pairwise interactions in infectious disease dynamics. They explore the impact of accounting for group interactions on the progression of infection through the various sub-populations that make up the population as a whole. Further, they explore the extent to which interaction heterogeneity can bias epidemiological inference from surveillance data in the form of IFR and variant growth rate dynamics. This work advances the theoretical formulation of the SIR model and may allow for more realistic modeling of infectious disease outbreaks in the future.

      Strengths:

      (1) This work addresses an important limitation of standard SIR models. While this limitation has been addressed previously in the form of network-based models, those are, as the authors argue, difficult to parameterize to real-world scenarios. Further, this work highlights critical biases that may appear in real-world epidemiological surveillance data. Particularly, over-estimation of variant growth rates shortly after emergence has led to a number of "false alarms" about new variants over the past five years (although also to some true alarms).

      (2) While the results presented here generally confirm my intuitions on this topic, I think it is really useful for the field to have it presented in such a clear manner with a corresponding mathematical framework. This will be a helpful piece of work to point to to temper concerns about rapid increases in the frequency of rare variants.

      (3) The authors provide a succinct derivation of their model that helps the reader understand how they arrived at their formulation starting from the standard SIR model.

      (4) The visualizations throughout are generally easy to interpret and communicate the key points of the authors' work.

      (5) I thank the authors for providing detailed code to reproduce manuscript figures in the associated GitHub repo.

      Weaknesses:

      (1) The authors argue that network-based SIR models are difficult to parameterize (line 66), however, the model presented here also has a key parameter, mainly P_n, or the distribution of risk groups in the population. I think it is important to explore the extent to which this parameter can be inferred from real-world data to assess whether this model is, in practice, any easier to parameterize.

      (2) The authors explore only up to four different risk groups, accounting for only four-wise interactions. But, clearly, in real-world settings, there can be much larger gatherings that promote transmission. What was the justification for setting such a low limit on the maximum group size? I presume it's due to computational efficiency, which is understandable, but it should be discussed as a limitation.

      (3) Another key limitation that isn't addressed by the authors is that there may be population structure beyond just risk heterogeneity. For example, there may be two separate (or, weakly connected) high-risk sub-groups. This will introduce temporal correlation in interactions that are not (and can not easily be) captured in this model. My instinct is that this would dampen the difference between risk groups shown in Figure 2A. While I appreciate the authors's desire to keep their model relatively simple, I think this limitation should be explicitly discussed as it is, in my opinion, relatively significant.

    1. Reviewer #2 (Public review):

      Summary:

      The study introduces new tools for measuring intracellular Ca2+ concentration gradients around retinal rod bipolar cell (rbc) synaptic ribbons. This is done by comparing the Ca2+ profiles measured with mobile Ca2+ indicator dyes versus ribbon-tethered (immobile) Ca2+ indicator dyes. The Ca2+ imaging results provide a straightforward demonstration of Ca2+ gradients around the ribbon and validate their experimental strategy. This experimental work is complemented by a coherent, open-source, computational model that successfully describes changes in Ca2+ domains as a function of Ca2+ buffering. In addition, the authors try to demonstrate that there is heterogeneity among synaptic ribbons within an individual rbc terminal.

      Strengths:

      The study introduces a new set of tools for estimating Ca2+ concentration gradients at ribbon AZs, and the experimental results are accompanied by an open-source, computational model that nicely describes Ca2+ buffering at the rbc synaptic ribbon. In addition, the dissociated retinal preparation remains a valuable approach for studying ribbon synapses. Lastly, excellent EM.

      Weaknesses:

      Heterogeneity in the spatiotemporal dynamics of Ca2+ influx was not convincingly related to ribbon size, nor was the functional relevance of Ca2+ dynamics to rod bipolars demonstrated (e.g., exocytosis to different postsynaptic targets). In addition, the study would benefit from the inclusion of the Ca2+ currents that were recorded in parallel with the Ca2+ imaging.

    1. Reviewer #2 (Public review):

      Summary:

      The study offers a thorough analysis of the prevalence of pain in women with polycystic ovary syndrome (PCOS) and its associations with health outcomes across various racial groups. Furthermore, the research investigates the prevalence of PCOS and pain among different racial demographics, as well as the increased risk of developing various conditions in comparison to individuals who have PCOS alone.

      Strengths:

      The study emphasizes pain as a significant comorbidity of PCOS, an area that is critically underexplored in existing literature. The findings regarding the increased prevalence of some of the diseases in the PCOS + pain group provide valuable direction for future research and clinical care. I believe physicians should incorporate pain score assessments into their clinical practice to improve patient's quality of life and raise awareness about pain management. If future research focuses on the mechanisms of pain, it would provide a better understanding of pain and allow for a focus on the underlying causes rather than just symptomatic management. The study also highlights the association between PCOS+pain and various comorbidities, such as obesity, hypertension, and type 2 diabetes, as well as conditions like infertility and ovarian cysts, offering a holistic view of the burden of PCOS.

      Weaknesses:

      Due to the nature of the retrospective study, some data may not be readily available in the system. Instead of simply categorizing participants based on whether they experience pain, it would be more useful to employ a pain scale or questionnaire to better understand the severity and type of patients' pain. This approach would allow for a more thorough analysis of pain improvement following treatment with the three widely used medications for PCOS. Additionally, it would be beneficial for the authors to specify subtypes of the disease rather than generalizing conditions, such as mentioning specific digestive system disorders or mental health disorders. The lack of detailed analysis of specific disorders limits the depth of the findings. This may cause authors to make incorrect conclusions.

    1. Reviewer #2 (Public review):

      The present study, led by Thomas and collaborators, aims to describe the firing activity of individual motor units in mice during locomotion. To achieve this, they implanted small arrays of eight electrodes in two heads of the triceps and performed spike sorting using a custom implementation of Kilosort. Simultaneously, they tracked the positions of the shoulder, elbow, and wrist using a single camera and a markerless motion capture algorithm (DeepLabCut). Repeated one-minute recordings were conducted in six mice at five different speeds, ranging from 10 to 27.5 cm·s⁻¹.

      From these data, the authors reported that:

      (1) a significant portion of the identified motor units was not consistently recruited across strides,<br /> (2) motor units identified from the lateral head of the triceps tended to be recruited later than those from the long head,<br /> (3) the number of spikes per stride and peak firing rates were correlated in both muscles, and<br /> (4) the probability of motor unit recruitment and firing rates increased with walking speed.

      The authors conclude that these differences can be attributed to the distinct functions of the muscles and the constraints of the task (i.e., speed).

      Strengths:

      The combination of novel electrode arrays to record intramuscular electromyographic signals from a larger muscle volume with an advanced spike sorting pipeline capable of identifying populations of motor units.

      Weaknesses:

      (1) There is a lack of information on the number of identified motor units per muscle and per animal.

      (2) All identified motor units are pooled in the analyses, whereas per-animal analyses would have been valuable, as motor units within an individual likely receive common synaptic inputs. Such analyses would fully leverage the potential of identifying populations of motor units.

      (3) The current data do not allow for determining which motor units were sampled from each pool. It remains unclear whether the sample is biased toward high-threshold motor units or representative of the full pool.

      (4) The behavioural analysis of the animals relies solely on kinematics (2D estimates of elbow angle and stride timing). Without ground reaction forces or shoulder angle data, drawing functional conclusions from the results is challenging.

      Major comments:

      (1) Spike sorting

      The conclusions of the study rely on the accuracy and robustness of the spike sorting algorithm during a highly dynamic task. Although the pipeline was presented in a previous publication (Chung et al., 2023, eLife), a proper validation of the algorithm for identifying motor unit spikes is still lacking. This is particularly important in the present study, as the experimental conditions involve significant dynamic changes. Under such conditions, muscle geometry is altered due to variations in both fibre pennation angles and lengths.

      This issue differs from electrode drift, and it is unclear whether the original implementation of Kilosort includes functions to address it. Could the authors provide more details on the various steps of their pipeline, the strategies they employed to ensure consistent tracking of motor unit action potentials despite potential changes in action potential waveforms, and the methods used for manual inspection of the spike sorting algorithm's output?

      (2) Yield of the spike sorting pipeline and analyses per animal/muscle

      A total of 33 motor units were identified from two heads of the triceps in six mice (17 from the long head and 16 from the lateral head). However, precise information on the yield per muscle per animal is not provided. This information is crucial to support the novelty of the study, as the authors claim in the introduction that their electrode arrays enable the identification of populations of motor units.

      Beyond reporting the number of identified motor units, another way to demonstrate the effectiveness of the spike sorting algorithm would be to compare the recorded EMG signals with the residual signal obtained after subtracting the action potentials of the identified motor units, using a signal-to-residual ratio.

      Furthermore, motor units identified from the same muscle and the same animal are likely not independent due to common synaptic inputs. This dependence should be accounted for in the statistical analyses when comparing changes in motor unit properties across speeds and between muscles.

      (3) Representativeness of the sample of identified motor units

      However, to draw such conclusions, the authors should exclusively compare motor units from the same pool and systematically track violations of the recruitment order. Alternatively, they could demonstrate that the motor units that are intermittently active across strides correspond to the smallest motor units, based on the assumption that these units should always be recruited due to their low activation thresholds.

      One way to estimate the size of motor units identified within the same muscle would be to compare the amplitude of their action potentials, assuming that all motor units are relatively close to the electrodes (given the selectivity of the recordings) and that motoneurons innervating more muscle fibres generate larger motor unit action potentials.

      Currently, the data seem to support the idea that motor units that are alternately recruited across strides have recruitment thresholds close to the level of activation or force produced during slow walking. The fact that recruitment probability monotonically increases with speed suggests that the force required to propel the mouse forward exceeds the recruitment threshold of these "large" motor units. This pattern would primarily reflect spatial recruitment following the size principle rather than flexible motor unit control.

      (4) Analysis of recruitment and firing rates

      The authors currently report active duration and peak firing rates based on spike trains convolved with a Gaussian kernel. Why not report the peak of the instantaneous firing rates estimated from the inverse of the inter-spike interval? This approach appears to be more aligned with previous studies conducted to describe motor unit behaviour during fast movements (e.g., Desmedt & Godaux, 1977, J Physiol; Van Cutsem et al., 1998, J Physiol; Del Vecchio et al., 2019, J Physiol).

      (5) Additional analyses on behaviour

      The authors currently analyse motor unit recruitment in relation to elbow angle. It would be valuable to include a similar analysis using the angular velocity observed during each stride, as higher velocity would place each muscle in a less favourable position on the force-velocity relationship for generating the required force. More broadly, comparing stride-by-stride changes in firing rates with changes in elbow angular velocity would further strengthen the final analyses presented in the results section.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates the role of spinal astrocytes in mediating stress-induced pain hypersensitivity, focusing on the LC (locus coeruleus)-to-SDH (spinal dorsal horn) circuit and its mechanisms. The authors aimed to delineate how LC activity contributes to spinal astrocytic activation under stress conditions, explore the role of noradrenaline (NA) signaling in this process, and identify the downstream astrocytic mechanisms that influence pain hypersensitivity.

      The authors provide strong evidence that 1-hour restraint stress-induced pain hypersensitivity involves the LC-to-SDH circuit, where NA triggers astrocytic calcium activity via alpha1a adrenoceptors (alpha1aRs). Blockade of alpha1aRs on astrocytes - but not on Vgat-positive SDH neurons - reduced stress-induced pain hypersensitivity. These findings are rigorously supported by well-established behavioral models and advanced genetic techniques, uncovering the critical role of spinal astrocytes in modulating stress-induced pain.

      However, the study's third aim - to establish a pathway from astrocyte alpha1aRs to adenosine-mediated inhibition of SDH-Vgat neurons - is less compelling. While pharmacological and behavioral evidence is intriguing, the ex vivo findings are indirect and lack a clear connection to the stress-induced pain model. Despite these limitations, the study advances our understanding of astrocyte-neuron interactions in stress-pain contexts and provides a strong foundation for future research into glial mechanisms in pain hypersensitivity.

      Strengths:

      The study is built on a robust experimental design using a validated 1-hour restraint stress model, providing a reliable framework to investigate stress-induced pain hypersensitivity. The authors utilized advanced genetic tools, including retrograde AAVs, optogenetics, chemogenetics, and subpopulation-specific knockouts, allowing precise manipulation and interrogation of the LC-SDH circuit and astrocytic roles in pain modulation. Clear evidence demonstrates that NA triggers astrocytic calcium activity via alpha1aRs, and blocking these receptors effectively reduces stress-induced pain hypersensitivity.

      Weaknesses:

      Despite its strengths, the study presents indirect evidence for the proposed NA-to-astrocyte(alpha1aRs)-to-adenosine-to-SDH-Vgat neurons pathway, as the link between astrocytic adenosine release and stress-induced pain remains unclear. The ex vivo experiments, including NA-induced depolarization of Vgat neurons and chemogenetic stimulation of astrocytes, are challenging to interpret in the stress context, with the high CNO concentration raising concerns about specificity. Additionally, the role of astrocyte-derived D-serine is tangential and lacks clarity regarding its effects on SDH Vgat neurons. The astrocyte calcium signal "dip" after LC optostimulation-induced elevation are presented without any interpretation.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Yamaguchi et al. provides compelling evidence for the formation of a 3:3 complex between the ectodomain of ADAM22 and LGI1, as demonstrated using single-particle cryo-EM and HS-AFM. This represents the first instance in which the 3:3 complex has been resolved sufficiently to enable molecular modeling, allowing the authors to identify key interfaces mediating ADAM22-LGI1 interactions. HS-AFM revealed weak interactions within the 3:3 complexes, suggesting the dynamic nature of ADAM22-LGI1 interactions, which may play a role in modulating synaptic activity.

      Strength:

      A strength of this study lies in the novel identification of the 3:3 complexes, captured at an unprecedented level of resolution and validated by HS-AFM. This discovery, together with the authors' previous findings demonstrating a 2:2 stoichiometry, gives rise to an intriguing hypothesis regarding the dynamic nature of the ADAM22-LGI1 complex in regulating both cis- and trans-synaptic interactions.

      Weakness:

      The functional significance of these two complexes in the context of synapse remains speculative. Additionally, the structural presentations in Figures 1-3 (especially Figures 2-3) lack the clarity needed for general readers to fully understand the authors' key points. Enhancing the quality of these visual representations would greatly improve accessibility and comprehension.

    1. Reviewer #2 (Public review):

      Summary:

      Autophagy (macroautophagy) is known to be essential for muscle function in flies and mammals. To date, many mitophagy (selective mitochondrial autophagy) receptors have been identified in mammals and other species. While the loss of mitophagy receptors has been shown to impair mitochondrial degradation (e.g., OPTN and NDP52 in Parkin-mediated mitophagy and NIX and BNIP3 in hypoxia-induced mitophagy) at the level of cultured cells, it remains unclear, especially under physiological conditions in vivo. In this study, the authors revealed that one of the receptors BNIP3 plays a critical role in mitochondrial degradation during muscle remodeling in vivo.

      Overall, the manuscript provides solid evidence that BNIP3 is involved in mitophagy during muscle remodeling with in vivo analyses performed. In particular, all experiments in this study are well-designed. The text is well written and the figures are very clear.

      Strengths:

      (1) In each experiment, appropriate positive and negative controls are used to indicate what is responsible for the phenomenon observed by the authors: e.g. FIP200, Atg18, Stx17 siRNAs during DIOM remodeling in Figure 2 and Full, del-LIR, del-MER in Figure 5.

      (2) Although the transcriptional dynamics of DIOM remodeling during metamorphosis is autophagy-independent, the transcriptome data obtained by the authors would be valuable for future studies.

      (3) In addition to the simple observation that loss of BNIP3 causes mitochondrial accumulation, the authors further observed that, by combining siRNA against STX17, which is required for fusion of autophagosomes with lysosomes, BNIP3 KO abolishes mitophagosome formation, which will provide solid evidence for BNIP3-mediated mitophagy. Furthermore, using a Gal80 temperature-sensitive approach, the authors showed that mitochondria derived from larval muscle, but not those synthesized during hypertrophy, remain in BNIP3 KO fly muscles.

      Weaknesses:

      (1) Because BNIP3 KO causes mitochondrial accumulation, it is expected that adult flies will have some physiological defects, but this has not been fully analyzed or sufficiently mentioned in the manuscript.

      (2) In Figure 5, the authors showed that BNIP3 binds to Atg18a by co-IP, but no data are provided on whether MER-mut or del-MER attenuates the affinity for Atg18a.

    1. Reviewer #2 (Public review):

      This manuscript addresses a fundamental problem of immunology - the persistence mechanisms of tissue-resident memory T cells (TRMs). It introduces a novel quantitative methodology, combining the in vivo tracing of T-cell cohorts with rigorous mathematical modeling and inference. Interestingly, the authors show that immigration plays a key role in maintaining CD4+ TRM populations in both skin and lamina propria (LP), with LP TRMs being more dependent on immigration than skin TRMs. This is an original and potentially impactful manuscript. However, several aspects were not clear and would benefit from being explained better or worked out in more detail.

      (1) The key observations are as follows:

      a) When heritably labeling cells due to CD4 expression, CD4+ TRM labeling frequency declines with time. This implies that CD4+ TRMs are ultimately replenished from a source not labeled, hence not expressing CD4. Most likely, this would be DN thymocytes.

      b) After labeling by Ki67 expression, labeled CD4+ TRMs also decline - This is what Figure 1B suggests. Hence they would be replaced by a source that was not in the cell cycle at the time of labeling. However, is this really borne out by the experimental data (Figure 2C, middle row)? Please clarify.

      (2) For potential source populations (Figure 2D): Please discuss these data critically. For example, CD4+ CD69- cells in skin and LP start with a much lower initial labeling frequency than the respective TRM populations. Could the former then be precursors of the latter? A similar question applies to LN YFP+ cells. Moreover, is the increase in YFP labeling in naïve T cells a result of their production from proliferative thymocytes? How well does the quantitative interpretation of YFP labeling kinetics in a target population work when populations upstream show opposite trends (e.g., naïve T cells increasing in YFP+ frequency but memory cells in effect decreasing, as, at the time of labeling, non-activated = non-proliferative T cells (and hence YFP-) might later become activated and contribute to memory)?

      (3) Please add a measure of variation (e.g., suitable credible intervals) to the "best fits" (solid lines in Figure 2).

      (4) Could the authors better explain the motivation for basing their model comparisons on the Leave-One-Out (LOO) cross-validation method? Why not use Bayesian evidence instead?

    1. Reviewer #2 (Public review):

      Summary:

      Sleep plays a critical role in memory consolidation, but the neural mechanisms underlying this relationship remain poorly understood. The authors present novel findings implicating two small neuronal groups with inhibitory connections, PAM-a1 to DPM, in sleep regulation and LTM consolidation. However, whether the PAM-a1 to DPM microcircuit promotes LTM consolidation through sleep regulation requires further investigation.

      Strengths:

      The authors report several novel findings. Brief activation or inhibition of PAM-a1 neurons, or brief inhibition of DPM neurons during the first few hours after training, impairs 24-hour LTM. Notably, these brief manipulations disrupt sleep for many hours afterward, particularly at night. Interestingly, disruption of PAM-a1 and DPM neurons impairs sleep and appetitive memory consolidation only under starvation conditions, and pharmacological induction of sleep during the night rescues the LTM defects. These findings suggest that PAM-a1 and DPM neurons are involved in sleep regulation and LTM consolidation under starvation. These are important findings that advance our understanding of the link between sleep and memory consolidation.

      Weaknesses:

      Some claims lack sufficient evidence or clarity:

      (1) All sleep experiments are conducted under the "training" (temperature-change) condition. While genotypic controls are helpful, additional no-training controls are required to confirm that the observed differences are due to training rather than unknown genotype-related factors. The fact that experimental genotypes exhibit significantly altered sleep even before "training" (e.g., Figs. 7H, J, K, 8A, B, D) highlights the necessity of these controls.

      (2) Previous studies on disrupted memory due to sleep reduction have primarily examined conditions with severe sleep deprivation. In contrast, this report claims that relatively small decreases in total sleep accompanied by sleep fragmentation are responsible for impaired memory consolidation. It remains unclear whether sleep fragmentation at this level is truly critical for memory consolidation. The authors should cause sleep loss and fragmentation of similar magnitude through other means and determine whether it can impair LTM.

      (3) The authors employed a neural activity reporter to show that starvation increases the basal activity of PAM-a1 but not DPM neurons in untrained flies (Figures 9C-E). They observed small increases in the activity of both neuron groups immediately after training but not one hour later. Given the inhibitory connection from PAM-a1 to DPM, it is unclear why both neuron groups show increased activity after training. Additionally, as the authors acknowledge, it is puzzling how the inactivation of PAM-a1 produces similar effects on sleep and memory as DPM inhibition and PAM-a1 activation. Further experiments are needed to clarify these findings, such as manipulating PAM-a1 activity during the one-hour post-training period and evaluating the effect on DPM activity. Including data from training under fed conditions would provide a more comprehensive understanding of state-dependent neural activity. Even if certain experiments are not feasible, these issues warrant further discussion. It is also important to clarify that the term "synchronized" does not imply single-spike-level synchrony.

      (4) The authors considered that PAM-a1 and DPM might function in parallel, independent pathways for sleep and LTM. They rejected this possibility based on the lack of additive effects when both neuronal groups were simultaneously inactivated. However, they found that MB299B-labelled neurons exert stronger memory effects than MB043B-labelled neurons, while MB043B neurons have stronger sleep effects. If sleep is a primary driver of memory consolidation, a stronger correlation between memory and sleep effects would be expected. This observation merits further discussion.

      (5) Given prior knowledge that PAM neurons are heterogeneous and that the R58E02 driver is broadly expressed, data in Figures 1-5 concerning PAM are outdated. The use of more restricted PAM-a1 drivers from the outset would make the manuscript easier to read and interpret.

      (6) Some figures lack relevant data, certain experiments are missing necessary controls, and anomalies are present in some data sets.

    1. Reviewer #3 (Public review):

      Summary:

      In this manuscript, the authors apply tissue expansion and tiling light sheet microscopy to study allometric growth and regeneration in planaria. They developed image analysis pipelines to help them quantify different neuronal subtypes and muscles in planaria of different sizes and during regeneration. Among the strengths of this work, the authors provide beautiful images that show the potential of the approaches they are taking and their ability to quantify specific cell types in relatively large numbers of whole animal samples. Many of their findings confirm previous results in the literature, which helps validate the techniques and pipelines they have applied here. Among their new observations, they find that the body wall muscles at the anterior and posterior poles of the worm are organized differently and show that the muscle pattern in the posterior head of beta-catenin RNAi worms resembles the anterior muscle pattern. They also show that glial cell processes appear to be altered in beta-catenin or insulin receptor-1 RNAi worms. Weaknesses include some over-interpretation of the data and lack of consideration or citation of relevant previous literature, as discussed below.

      Strengths:

      This method of tissue expansion will be useful for researchers interested in studying this experimental animal. The authors provide high-quality images that show the utility of this technique. Their analysis pipeline permits them to quantify cell types in relatively large numbers of whole animal samples.

      The authors provide convincing data on changes in total neurons and neuronal sub-types in different-sized planaria. They report differences in body wall muscle pattern between the anterior and posterior poles of the planaria, and that these differences are lost when a posterior head forms in beta-catenin RNAi planaria. They also find that glial cell projections are reduced in insulin receptor-1 RNAi planaria.

      Comments on revisions:

      The authors have satisfactorily addressed the major concerns of the previous reviewers.

    1. Reviewer #2 (Public review):

      Summary:

      This work reports the discovery of a new rhodopsin from reef-building corals that is characterized experimentally, spectroscopically, and by simulation. This rhodopsin lacks a carboxylate-based counterion, which is typical for this family of proteins. Instead, the authors find that a chloride ion stabilizes the protonated Schiff base and thus serves as a counterion.

      Strengths:

      This work focuses on the rhodopsin Antho2a, which absorbs in the visible spectrum with a maximum at 503 nm. Spectroscopic studies under different pH conditions, including the mutant E292A and different chloride concentrations, indicate that chloride acts as a counterion in the dark. In the photoproduct, however, the counterion is identified as E292.

      These results lead to a computational model of Antho2a in which the chloride is modeled in addition to the Schiff base. This model is improved using the hybrid QM/MM simulations. As a validation, the absorption maximum is calculated using the QM/MM approach for the protonated and deprotonated E292 residue as well as the E292A mutant. The results are in good agreement with the experiment. However, there is a larger deviation for ADC(2) than for sTD-DFT. Nevertheless, the trend is robust since the wt and E292A mutant models have similar excitation energies. The calculations are performed at a high level of theory that includes a large QM region.

      Weaknesses:

      I have a couple of questions about this study:

      (1) I find it suspicious that the absorption maximum is so close to that of rhodopsin when the counterion is very different. Is it possible that the chloride creates an environment for the deprotonated E292, which is the actual counterion?

      (2) The computational protocol states that water molecules have been added to the predicted protein structure. Are there water molecules next to the Schiff base, E292, and Cl-? If so, where are they located in the QM region?

      (3) If the E292 residue is the counterion in the photoproduct state, I would expect the retinal Schiff base to rotate toward this side chain upon isomerization. Can this be modeled based on the recent XFEL results on rhodopsin?

    1. Reviewer #2 (Public review):

      Summary:

      Immune assays enable the analysis of immune responses in vitro. These assays generate time series image data across several experimental conditions. The imaging parameters such as the imaging modality and the number of channels can vary across experiments. A challenge in the field is the lack of (open source) tools to process and analyze these data. R. Torro, et. al. developed an open source end-to-end pipeline for the analysis of image data from these immune assays. The pipeline is designed with a GUI and is suited for experimental biologists with no coding experience. The authors have incorporated several existing methods and tools for individual tasks such as for segmentation and cell tracking, and incorporated them with custom methods where necessary such as for tracking cell state transitions.

      Strengths:

      (1) The tool is extremely well-documented and easy to install.

      (2) Applicable to a wide variety of imaging modalities and analysis.

      (3) There are several different options for each step, such as segmentation using traditional methods or deep learning methods, and all the analysis steps are integrated in one place with a GUI. The no-coding requirement makes this a very powerful tool for biologists and has the potential to enable a wide variety of analyses.

      Weakness:

      (1) It would be good to provide documentation on how to make the tool applicable for applications and analysis other than for immune profiling since most methods integrated here are applicable well beyond immune profiling. For example, a user might want to use the tool just for the segmentation of their IF microscopy-images.

      (2) They applied Celldetective to two immune assays. The authors present the results from these assays and use the results to validate their assay. However, they have not included data that demonstrates results obtained via this pipeline are comparable to results obtained with other pipelines and/or if these results are consistent with what is expected in the literature.

    1. Reviewer #2 (Public Review):

      This is a nice paper illustrating the use of equilibrium/non-equilibrium MD simulations to explore allosteric communication in the Spike protein. The results are described in detail and suggest a complex network of signal transmission patterns. The topic is not completely novel as it has been studied before by the same authors and the impact of glycosylation is moderated and localized at the furin site, so not many new conclusions emerge here. It is suggested that mutations are commonly found in the communication pathway which is interesting, but the authors fail to provide evidence that this is related to a positive selection and not simply to a random effect related to mutations at points that are not crucial for stability or function. One interesting point is the connection of the FA site with an additional site binding heme group. It will be interesting to see reversibility, i.e. removal of the ligand at this site is producing perturbation at the FA site?, does it produce other effects suggesting a cascade of allosteric effects? Finally, the paper lacks details to help reproducibility, in particular, I do not see details on D-NEMD calculations. One interesting point is the connection of the FA site with an additional site binding heme group.

    1. Reviewer #2 (Public review):

      Summary

      ZFHX3 is a transcription factor expressed in discrete populations of adult SCN and was shown by the authors previously to control circadian behavioral rhythms using either a dominant missense mutation in Zfhx3 or conditional null Zfhx3 mutation using the Ubc-Cre line (Wilcox et al., 2017). In the current manuscript, the authors assess the function of ZFHX3 by using a multi-omics approach including ChIPSeq in wildtype SCNs and RNAseq of SCN tissues from both wildtype and conditional null mice. RNAseq analysis showed a loss of oscillation in Bmal1 and changes in expression levels of other clock output genes. Moreover, a phase advance gene transcriptional profile using the TimeTeller algorithm suggests the presence of a regulatory network that could underlie the observed pattern of advanced activity onset in locomotor behavior in knockout mice.

      In Figure 1, the authors identified the ZFHX3 bound sites using ChIPseq and compared the loci with other histone marks that occur at promoters, TSS, enhancers and intergenic regions. And the analysis broadly points to a role for ZFHX3 in transcriptional regulation. The vast majority of nearly 40000 peaks overlapped H3K4me3 and K27ac marks, active promoters which also included genes falling under the GO category circadian rhythms. However, no significant differential ZFHX3 bound peaks were detected between ZT3 and ZT15. In these experiments, it is not clear if and how the different ChIP samples (ZFHX3 and histone PTM ChIPs) were normalized/downsampled for analysis. Moreover, it seems that ZFHX3 binding or recruitment has little to do with whether the promoters are active.

      Based on an enrichment of ARNT domains next to K4Me3 and K27ac PTMs, the authors propose a model where the core-clock TFs and ZFHX3 interact. If the authors develop other assays beyond just predictions to test their hypothesis, it would strengthen the argument for a role in circadian transcription in the SCN. It would be important in this context to perform a ChIP-seq experiment for ZFHX3 in the knockout animal (described from Figure 2 onwards) to eliminate the possibility of non-specific enrichment of signal from "open chromatin'. Alternatively, a ChIPseq analysis for BMAL1 or CLOCK could also strengthen this argument to identify the sites co-occupied by ZFHX3 and core-clock TFs.

      Next, they compared locomotor activity rhythms in floxed mice with or without tamoxifen treatment. As reported before in Wilcox et al 2017, the loss of ZFHX3 led to a shorter free running period and reduced amplitude and earlier onset of activity. Overall, the behavioral data in Figure 2 and supplementary figure 2 has been reported before and are not novel.

      Next, the authors performed RNAseq at 4hr intervals on wildtype and knockout animals maintained in light/dark cycles to determine the impact of loss of ZFHX3. Overall transcriptomic analysis indicated changes in gene expression in nearly 36% of expressed genes, with nearly half being upregulated while an equal fraction was downregulated. Pathways affected included mostly neureopeptide neurotransmitter pathways. Surprisingly, there was no correlation between the direction in change in expression and TF binding since nearly all the sites were bound by ZFHX3 and the active histone PTMs. The ChIP-seq experiment for ZFHX3 in the UBC-Cre+Tam mice again could help resolve the real targets of ZFHX3 and the transcriptional state in knockout animals.

      To determine the fraction of rhythmic transcripts, Using dryR, the authors categorise the rhythmic transcriptome (about 7% in all) into modules that include genes that lose rhythmicity in the KO, gain rhythmicity in the KO or remain unaffected or partially affected. The analysis indicates that a large fraction of the rhythmic transcriptome is affected in the KO model. However, among core-clock genes only Bmal1 expression is affected showing a complete loss of rhythm. The authors state a decrease in Clock mRNA expression (line 294) but the panel figure 4A does not show this data. Instead it depicts the loss in Avp expression - {{ misstated in line 321 ( we noted severe loss in 24-h rhythm for crucial SCN neuropeptides such as Avp (Fig. 3a).}}

      However, core-clock genes such as Pers and Crys show minor or no change in expression patterns while Per2 and Per3 show a ~2hr phase advance. While these could only weakly account for the behavioral phase advance, the authors used TimeTeller to assess circadian phase in wildtype and ZFHX3 deficient mice. This approach clearly indicated that while the clock is not disrupted in the knockout animals, the phase advance can be correctly predicted from a network of gene expression patterns.

      Strengths

      The authors use a multiomic strategy in order to reveal the role of the ZFHX3 transcription factor with a combination of TF and histone PTM ChIPseq, time-resolved RNAseq from wildtype and knockout mice and modeling the transcriptomic data using TimeTeller. The RNAseq experiments are nicely controlled and the analysis of the data indicates a clear impact on gene-expression levels in the knockout mice and the presence of a regulatory network that could underlie the advanced activity onset behavior.

      Weaknesses

      It is not clear whether ZFHX3 has a direct role in any of the processes and seems to be a general factor that marks H3K4me3 and K27ac marked chromatin. Why it would specifically impact the core-clock TTFL clock gene expression or indeed daily gene expression rhythms is not clear either. Details for treatment of different ChIP samples (ZFHX3 and histone PTM ChIPs) on data normalization for analysis are needed. The loss of complete rhythmicity of Avp and other neuropeptides or indeed other TFs could instead account for the transcriptional deregulation noted in the knockout mice.

      Comments on revisions:

      The authors addressed the majority of my criticisms. They also explained that some requested experiments are beyond the scope of the current manuscript, while others are technically not feasible. I do not have any further concerns.

    1. Reviewer #2 (Public review):

      In their study, Avraham-Davidi et al. combined scRNA-seq and spatial mapping studies to profile two preclinical mouse models of colorectal cancer: Apcfl/fl VilincreERT2 (AV) and Apcfl/fl LSL-KrasG12D Trp53fl/fl Rosa26LSL-tdTomato/+ VillinCreERT2 (AKPV). In the first part of the manuscript, the authors describe the analysis of the normal colon and dysplastic lesions induced in these models following tamoxifen injection. They highlight broad variations in immune and stromal cell composition within dysplastic lesions, emphasizing the infiltration of monocytes and granulocytes, the accumulation of IL-17+gdT cells, and the presence of a distinct group of endothelial cells. A major focus of the study is the remodeling of the epithelial compartment, where the most significant changes are observed. Using non-negative matrix factorization, the authors identify molecular programs of epithelial cell functions, emphasizing stemness, Wnt signaling, angiogenesis, and inflammation as major features associated with dysplastic cells. They conclude that findings from scRNA-seq analyses in mouse models are transposable to human CRC. In the second part of the manuscript, the authors aim to provide the spatial context for their scRNA-seq findings using Slide-seq and TACCO. They demonstrate that dysplastic lesions are disorganized and contain tumor-specific regions, which contextualize the spatial proximity between specific cell states and gene programs. Finally, they claim that these spatial organizations are conserved in human tumors and associate region-based gene signatures with patient outcomes in public datasets. Overall, the data were collected and analyzed using solid and validated methodology to offer a useful resource to the community.

      Main comments:

      (1) Clarity<br /> The manuscript would benefit from a substantial reorganization to improve clarity and accessibility for a broad readership. The text could be shortened and the number of figure panels reduced to emphasize the novel contributions of this work while minimizing extensive discussions on general and expected findings, such as tissue disorganization in dysplastic lesions. Additionally, figure panels are not consistently introduced in the correct order, and some are not discussed at all (e.g., Figure S1D; Figure 3C is introduced before Figure 3A; several panels in Figure 4 are not discussed). The annotation of scRNA-seq cell states is insufficiently explained, with no corresponding information about associated genes provided in the figures or tables. Multiple annotations are used to describe cell groups (e.g., TKN01 = γδ T and CD8 T, TKN05 = γδT_IL17+), but these are not jointly accessible in the figures, making the manuscript challenging to follow. It is also not clear what is the respective value of the two mouse models and time points of tissue collection in the analysis.

      (2) Novelty<br /> While the study is of interest, it does not present major findings that significantly advance the field or motivate new directions and hypotheses. Many conclusions related to tissue composition and patient outcomes, such as the epithelial programs of Wnt signaling, angiogenesis, and stem cells, are well-established and not particularly novel. Greater exploration of the scRNA-seq data beyond cell type composition could enhance the novelty of the findings. For instance, several tumor microenvironment clusters uniquely detected in dysplastic lesions (e.g., Mono2, Mono3, Gran01, Gran02) are identified, but no further investigation is conducted to understand their biological programs, such as applying nNMF as was done for epithelial cells. Additional efforts to explore precise tissue localization and cellular interactions within tissue niches would provide deeper insights and go beyond the limited analyses currently displayed in the manuscript.

      (3) Validation<br /> Several statements made by the authors are insufficiently supported by the data presented in the manuscript and should be nuanced in the absence of proper validation. For example:<br /> (a) RNA velocity analyses: The conclusions drawn from these analyses are speculative and need further support.<br /> (b) Annotations of epithelial clusters as dysplastic: These annotations could have been validated through morphological analyses and staining on FFPE slides.<br /> (c) Conservation of mouse epithelial programs in human tumors: The data in Figure S5B does not convincingly demonstrate the enrichment of stem cell program 16 in human samples. This should be more explicitly stated in the text, given the emphasis placed on this program by the authors.<br /> (d) Figure S6E: Cluster Epi06 is significantly overrepresented in spatial data compared to scRNA-seq, yet the authors claim that cell type composition is largely recapitulated without further discussion, which reduces confidence in other conclusions drawn.<br /> Furthermore, stronger validation of key dysplastic regions (regions 6, 8, and 11) in mouse and human tissues using antibody-based imaging with markers identified in the analyses would have considerably strengthened the study. Such validation would better contextualize the distribution, composition, and relative abundance of these regions within human tumors, increasing the significance of the findings and aiding the generation of new pathophysiological hypotheses.

    1. Reviewer #2 (Public review):

      In this study, the authors investigate the structure of breathing rhythms in freely moving mice during exploratory behaviour in the absence of explicit cues or tasks. Additionally, they link behavioural states, derived from sniffing frequency and speed movement data, to the neural activity recorded in the olfactory bulb (OB). To further characterize OB neuronal responses, the authors introduce the concept of "sniff fields" which consider the joint distribution of sniff frequency and the latency from inhalation. Lastly, they explore how OB neurons encode spatial information, and they compare this finding with previously known spatially encoding cells in the hippocampus.

      The authors successfully establish that breathing in freely moving mice is structured even in the absence of explicit olfactory cues. By simultaneously recording sniffing and movement data, they find that this structure is associated with movement in a non-linear manner and can be modelled using a Hidden Markov Model (HMM). Interestingly, they demonstrate that neuronal activity in the OB tracks this behavioural structure by showing that HMM states can effectively cluster the neural data. Additionally, they describe OB activity using sniff fields, advancing our understanding of how individual neurons encode sniffing properties such as frequency and phase. Furthermore, they report unprecedented findings showing that some OB neurons encode place independently of the sniffing field contribution. Overall, the authors provide valuable insights regarding the contribution of different behavioural variables to OB activity.

      However, some of the conclusions presented by the authors are not fully supported by the data provided. Quantitative analysis and statistical tests are missing from the description of the breathing structure. Regarding spatial encoding, the authors claim in the abstract that "at the population level, a mouse's location can be decoded from olfactory bulb with similar accuracy to hippocampus". However, they show that place was significantly decoded in only 18/31 sessions from OB activity, and in 12/13 sessions from hippocampal activity. No further comparison of decoding accuracy between OB and HPC is provided. Moreover, it is unclear whether place contributes independently of movement, which was previously shown in this study to influence neuronal activity.

      Additionally, there is a lack of methodological detail regarding the experimental procedures, which could affect the interpretation of the data. Specifically, information is missing on aspects such as head-fixed conditions, the number of mice used per experiment, and the number of sessions per mouse.

      Studying mice behaviour in more naturalistic conditions, without explicit tasks, is a very interesting approach that provides new insights into the structure of sniffing and its neuronal representation. The fact that some OB neurons encode spatial information is highly relevant beyond the field of olfaction, even though this information was not as accessible as in the hippocampus. I believe the manuscript would benefit from a revision to ensure the text aligns more closely with the data presented in the figures.

    1. Reviewer #2 (Public review):

      This nice study explores the role of phospholipid scramblase 1 (PLSCR1) in regulating antiviral immunity and host morbidity during influenza A virus (IAV) infection. The authors identify PLSCR1 as a critical regulator of interferon-lambda receptor 1 (IFNLR1) expression, acting through enzymatic-independent mechanisms. Using PLSCR1-deficient and conditional overexpression mouse models, the study demonstrates that PLSCR1 enhances antiviral responses and mitigates inflammation, potentially through modulating type III interferon (IFN-λ) signaling. While the findings underline the importance of PLSCR1 in early viral control and tissue homeostasis, they also highlight its cell-specific functions, particularly in ciliated airway epithelial cells. This work contributes to understanding the interplay between host factors and antiviral pathways, paving the way for novel therapeutic strategies targeting host proteins.

      Specific Comments:

      (1) The statement that type I interferons are expressed by "almost all cells" is inaccurate (line 61). Type I IFN production is also context-dependent and often restricted to specific cell types upon infection or stimulation.

      (2) The antiviral response is assessed solely through flu M gene expression. Incorporating infectious virus titers (e.g., TCID50 or plaque assay) would provide a more robust and direct measure of antiviral activity.

      (3) While mRNA expression of interferons is measured, protein levels (e.g., through ELISA) should also be quantified to establish the functional relevance of IFN expression changes.

      (4) It is unclear whether reduced IFNLR1 expression translates to defective downstream signaling or antiviral responses after IFN-λ treatment in PLSCR1-deficient cells. This is particularly pertinent given the increase in IFN-λ ligand in vivo, which might compensate for receptor downregulation.

      (5) Detailed gating strategies for immune cell subsets are absent and should be included for clarity and reproducibility.

      (6) The study does not definitively establish that reduced IFN-λ signaling causes the observed in vivo phenotype. Increased morbidity and mortality in PLSCR1-deficient mice could also stem from elevated TNF-α levels and lung damage, as proinflammatory cytokines and/or enhanced lung damage are known contributors to influenza morbidity and mortality. This point warrants detailed discussions.

    1. Reviewer #2 (Public review):

      Summary:

      Sleep has not only been shown to support the strengthening of memory traces but also their transformation. A special form of such transformation is the abstraction of general rules from the presentation of individual exemplars. The current work used large online experiments with hundreds of participants to shed further light on this question. In the training phase participants saw composite items (scenes) that were made up of pairs of spatially coupled (i.e., they were next to each other) abstract shapes. In the initial training, they saw scenes made up of six horizontally structured pairs and in the second training phase, which took place after a retention phase (2 min awake, 12 hour incl. sleep, 12 h only wake, 24 h incl. sleep), they saw pairs that were horizontally or vertically coupled. After the second training phase, a two-alternatives-forced-choice (2-AFC) paradigm, where participants had to identify true pairs versus randomly assembled foils, was used to measure performance on all pairs. Finally, participants were asked five questions to identify, if they had insight into the pair structure and post-hoc groups were assigned based on this. Mainly the authors find that participants in the 2 minute retention experiment without explicit knowledge of the task structure were at chance level performance for the same structure in the second training phase, but had above chance performance for the vertical structure. The opposite was true for both sleep conditions. In the 12 h wake condition these participants showed no ability to discriminate the pairs from the second training phase at all.

      Strengths:

      All in all, the study was performed to a high standard and the sample size in the implicit condition was large enough to draw robust conclusions. The authors make several important statistical comparisons and also report an interesting resampling approach. There is also a lot of supplemental data regarding robustness.

      Weaknesses:

      My main concern regards the small sample size in the explicit group and the lack of experimental control.

    1. Reviewer #2 (Public review):

      Summary:

      In their study 'AI-Based Discovery and CryoEM Structural Elucidation of a KATP Channel Pharmacochaperone', ElSheikh and colleagues undertake a computational screening approach to identify candidate drugs that may bind to an identified binding pocket in the SUR1 subunit of KATP channels. Other KATP channel inhibitors such as glibenclamide have been previously shown to bind in this pocket, and in addition to inhibition KATP channel function, these inhibitors can very effectively rescue cell surface expression of trafficking deficient KATP mutations that cause excessive insulin secretion (Congenital Hyperinsulinism). However, a challenge for their utility for treatment of hyperinsulinism has been that they are powerful inhibitors of the channels that are rescued to the channel surface. In contrast, successful therapeutic pharmacochaperones (eg. CFTR chaperones) permit function of the channels rescued to the cell membrane. Thus, a key criteria for the authors' approach in this case was to identify relatively low affinity compounds that target the glibenclamide binding site (and be washed off) - these could potentially rescue KATP surface expression, but also permit KATP function.

      Strengths:

      The main findings of the manuscript include:

      (1) Computational screening of a large virtual compound library, followed by functional screening of cell surface expression, which identified several potential candidate pharmacochaperones that target the glibenclamide binding site.

      (2) Prioritization and functional characterization of Aekatperone as a low affinity KATP inhibitor which can be readily 'washed off' in patch clamp, and cell based efflux assays. Thus the drug clearly rescues cell surface expression, but can be manipulated experimentally to permit function of rescued channels.

      (3) Determination of the binding site and dynamics of this candidate drug by cryo-EM, and functional validation of several residues involved in drug sensitivity using mutagenesis and patch clamp.

      The experiments are well-conceived and executed, and the study is clearly described. The results of the experiments are very straightforward and clearly support the conclusions drawn by the authors. I found the study to provide important new information about KATP chaperone effects of certain drugs, with interesting considerations in terms of ion channel biology and human disease.

      Context and remaining challenges:

      (1) The chaperones can effectively rescue KATP trafficking mutants, but clearly not as strongly as the higher affinity inhibitor glibenclamide. There is likely a challenging relationship between efficacy of trafficking rescue and channel inhibition (ie. rescued channels are inhibited and therefore non-functional) that will need to be overcome in terms of applying drugs of this class. This is recognized and clarified appropriately by the authors both in their experimental approaches and discussion. In experiments it is straightforward to wash off the chaperone, but this would not be the case in an organism.

      (2) Recent developments with ion channel trafficking correctors in the CFTR field illustrate the importance of investigating underlying mechanisms. Development of pharmacological tools and approaches in other channel types (such as KATP or other transporters and channels) will build our understanding of pathways involved in regulating maturation of membrane proteins, and ways to manipulate them.

      Comments on revised version:

      I have no further suggestions, thank you for the detailed response.

    1. Reviewer #2 (Public review):

      Summary:

      The authors introduced a computational framework, DyNoPy, that integrates residue coevolution analysis with molecular dynamics (MD) simulations to identify functionally important residues in proteins. DyNoPy identifies key residues and residue-residue coupling to generate an interaction graph and attempts to validate using two clinically relevant β-lactamases (SHV-1 and PDC-3).

      Strengths:

      DyNoPy could not only show clinically relevance of mutations but also predict new potential evolutionary mutations. Authors have provided biologically relevant insights into protein dynamics which can have potential applications in drug discovery and understanding molecular evolution.

      Comments on latest version:

      I appreciate the efforts of the authors to address my comments.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript from Hammond et al., investigates the modularity of the segmentation clock and morphogenesis in early vertebrate development, focusing on how these processes might independently evolve to influence the diversity of segment numbers across vertebrates.

      Methodology: The study uses a previously published computational model, parameterized for zebrafish, to simulate and analyse the interactions between the segmentation clock and the morphogenesis of the pre-somitic mesoderm (PSM). Their model integrates cell advection, motility, compaction, cell division, and the synchronization of the embryo clock. Three alternative scenarios of PSM morphogenesis were modeled to examine how these changes affect the segmentation clock.

      Model System: The computational model system combines a representation of cell movements and the phase oscillator dynamics of the segmentation clock within a three-dimensional horseshoe-shaped domain mimicking the geometry of the vertebrate embryo PSM. The parameters used for the mathematical model are mostly estimated from previously published experimental findings.

      Key Findings and Conclusions: (1) The segmentation clock was found to be broadly robust against variations in morphogenetic processes such as cell ingression and motility; (2) Changes in the length of the PSM and the strength of phase coupling within the clock significantly influenced the system's robustness; (3) The authors conclude that the segmentation clock and PSM morphogenesis exhibited developmental modularity (i.e. relative independence), allowing these two phenomena to evolve independently, and therefore possibly contributing to the diverse segment numbers observed in vertebrates.

      Major comments from the original round of review:

      (1) The key conclusion drawn by the authors (that there is robustness, and therefore modularity, between the morphogenetic cellular processes modeled and the embryo clock synchronization) stems directly from the modeling results appropriately presented and discussed in the manuscript.

      The model comprises some strong assumptions, however all have been clearly explained and the parameterization choices are supported by experimental findings, providing biological meaning to the model. Estimated parameters are well explained, and seem reasonable assumptions (from the embryology perspective).

      (2) This study, as is, achieves its proposed goal of evaluating the potential robustness of the embryo clock to changes in (some) morphogenetic processes. The authors do not claim that the model used is complete, and they properly identify some limitations, including the lack of cell-cell interactions. Given the recognized importance of cellular physical interactions for successful embryo development, including them in the model would be a significant addition in future studies.

      (3) The authors have deposited all the code used for analysis in a public GitHub repository that is updated and available for the research community.

      (4) In page 6, the authors justify their choice of clock parameters for cells ingressing the PSM: "As ingressing cells do not appear to express segmentation clock genes (Mara et al. (2007)), the position at which cells ingress into the PSM can create challenges for clock patterning, as only in the 'off' phase of the clock will ingressing cells be in-phase with their neighbors."

      However, there are several lines of evidence (in chick and mouse), that some oscillatory clock genes are already being expressed as early as in the gastrulation phase (so prior to PSM ingression) (Feitas et al, 2001 [10.1242/dev.128.24.5139]; Jouve et al, 2002 [10.1242/dev.129.5.1107]; Maia-Fernandes at al, 2024 [10.1371/journal.pone.0297853]).

      Question: Is this also true in zebrafish? (I.e. is there any recent experimental evidence that the clock genes are not expressed at ingression, since the paper cited to support this assumption is from 2007).

      If they are expressed in zebrafish (as they are in mouse and chick), then the cell addition should have random clock gene periods when they enter the PSM and not start all with a constant initial phase of zero. Probably this will not impact the results since the cells will also be out of phase with their neighbors when they "ingress", however, it will model more closely the biological scenario (and avoid such criticism).

      Significance:

      GENERAL ASSESSMENT

      This study uses a previously published model to simulate alternative scenarios of morphogenetic parameters to infer the potential independence (termed here modularity) between the segmentation clock and a set of morphogenetic processes, arguing that such modularity could allow the evolution of more flexible body plans, therefore partially explaining the variability in the number of segments observed in the vertebrates. This question is fundamental and relevant, yet still poorly researched. This work provides a comprehensive simulation with a model that tries to simplify the many morphogenetic processes described in the literature, reducing it to a few core fundamental processes that allow drawing the conclusions sought. It provides theoretical insight to support a conceptual advance in the field of evolutionary vertebrate embryology.

      ADVANCE

      This study builds on a model recently published by Uriu et al. (eLife, 2021) that incorporates quantitative experimental data within a modeling framework including cell and tissue-level parameters, allowing the study of multiscale phenomena active during zebrafish embryo segmentation. Uriu's publication reports many relevant and often non-intuitive insights uncovered by the model, most notably the description of phase vortices formed by the synchronizing genetic oscillators interfering with the traveling-wave front pattern.

      However, this model can be further explored to ask additional questions beyond those described in the original paper. A good example is the present study, which uses this mathematical framework to investigate the potential independence between two of the modeled processes, thereby extracting extra knowledge from it. Accordingly, the present study represents a step forward in the direction of using relevant theoretical frameworks to quantitatively explore the landscape of complex molecular hypotheses in silico, and with it shed some light on fundamental open questions or inform the design of future experiments in the lab.

      The study incorporates a wide range of existing literature on the developmental biology of vertebrates. It comprehensively cites prior work, such as the foundational studies by Cooke and Zeeman on the segmentation clock and the role of FGF signaling in PSM development as discussed by Gomez et al. The literature properly covers the breadth of knowledge in this field.

      AUDIENCE

      Target audience: This study is relevant for fundamental research in developmental biology, specifically targeting researchers who focus on early embryo development and morphogenesis from both experimental and theoretical perspectives. It is also relevant for evolutionary biologists investigating the genetic factors that influence vertebrate evolution, as well as to computational biologists and bioinformatics researchers studying developmental processes and embryology.

      Developmental researchers studying the segmentation clock in other vertebrate model organisms (namely mouse and chick), will find this publication especially valuable since it provides insights that can help them formulate new hypotheses to elucidate the molecular mechanisms of the clock (for example finding a set of evolutionarily divergent genes that might interfere with PSM length).<br /> Additionally, this study provides a set of cellular parameters that have yet to be measured in mouse and chick, therefore guiding the design of future experiments to measure them, allowing the simulation of the same model with sets of parameters from different vertebrate model organisms, therefore testing the robustness of the findings reported for zebrafish.

    1. Reviewer #2 (Public review):

      Summary:

      The manuscript reports an fMRI study looking at whether there is animacy organization in a non-primate, mammal, the domestic dog, that is similar to that observed in humans and non-human primates (NHPs). A simple experiment was carried out with four kinds of stimulus videos (dogs, humans, cats, and cars), and univariate contrasts and RSA searchlight analysis was performed. Previous studies have looked at this question or closely associated questions (e.g. whether there is face selectivity in dogs). The import of the present study is that it looks at multiple types of animate objects, dogs, humans, and cats, and tests whether there was overlapping/similar topography (or magnitude) of responses when these stimuli were compared to the inanimate reference class of cars. The main finding was of some selectivity for animacy though this was primarily driven by the dog stimuli, which did overlap with the other animate stimulus types, but far less so than in humans.

      Strengths:

      I believe that this is an interesting study in so far as it builds on other recent work looking at category-selectivity in the domestic dog. Given the limited number of such studies, I think it is a natural step to consider a number of different animate stimuli and look at their overlap. While some of the results were not wholly surprising (e.g. dog brains respond more selectively for dogs than humans or cats), that does not take away from their novelty, such as it is. The findings of this study are useful as a point of comparison with other recent work on the organization of high-level visual function in the brain of the domestic dog.

      Weaknesses:

      (1) One challenge for all studies like this is a lack of clarity when we say there is organization for "animacy" in the human and NHP brains. The challenge is by no means unique to the present study, but I do think it brings up two more specific topics.

      First, one property associated with animate things is "capable of self-movement". While cognitively we know that cars require a driver, and are otherwise inanimate, can we really assume that dogs think of cars in the same way? After all, just think of some dogs that chase cars. If dogs represent moving cars as another kind of self-moving thing, then it is not clear we can say from this study that we have a contrast between animate vs inanimate. This would not mean that there are no real differences in neural organization being found. It was unclear whether all or some of the car videos showed them moving. But if many/most do, then I think this is a concern.

      Second, there is quite a lot of potential complexity in the human case that is worth considering when interpreting the results of this study. In the human case, some evidence suggests that animacy may be more of a continuum (Sha et al. 2015), which may reflect taxonomy (Connolly et al. 2012, 2016). However moving videos seem to be dominated more by signals relevant to threat or predation relative to taxonomy (Nastase et al. 2017). Some evidence suggests that this purported taxonomic organization might be driven by gradation in representing faces and bodies of animals based on their relative similarity to humans (Ritchie et al. 2021). Also, it may be that animacy organization reflects a number of (partially correlated) dimensions (Thorat et al. 2019, Jozwik et al. 2022). One may wonder whether the regions of (partial) overlap in animate responses in the dog brain might have some of these properties as well (or not).

      (2) It is stated that previous studies provide evidence that the dog brain shows selectivity to "certain aspects of animacy". One of these already looked at selectivity for dog and human faces and bodies and identified similar regions of activity (Boch et al. 2023). An earlier study by Dilks et al. (2015), not cited in the present work (as far as I can tell), also used dynamic stimuli and did not suffer from the above limitations in choosing inanimate stimuli (e.g. using toy and scene objects for inanimate stimuli). But it only included human faces as the dynamic animate stimulus. So, as far as stimulus design, it seems the import of the present study is that it included a *third* animate stimulus (cats) and that the stimuli were dynamic.

      (3) I am concerned that the univariate results, especially those depicted in Figure 3B, include double dipping (Kriegesorte et al. 2009). The analysis uses the response peak for the A > iA contrast to then look at the magnitude of the D, H, C vs iA contrasts. This means the same data is being used for feature selection and then to estimate the responses. So, the estimates are going to be inflated. For example, the high magnitudes for the three animate stimuli above the inanimate stimuli are going to inherently be inflated by this analysis and cannot be taken at face value. I have the same concern with the selectivity preference results in Figure 3E.

      I think the authors have two options here. Either they drop these analyses entirely (so that the total set of analyses really mirrors those in Figure 4), or they modify them to address this concern. I think this could be done in one of two ways. One would be to do a within-subject standard split-half analysis and use one-half of the data for feature selection and the other for magnitude estimation. The other would be to do a between-subject design of some kind, like using one subject for magnitude estimation based on an ROI defined using the data for the other subjects.

      (4) There are two concerns with how the overlap analyses were carried out. First, as typically carried out to look at overlap in humans, the proportion is of overlapping results of the contrasts of interest, e.g, for face and body selectivity overlap (Schwarlose et al. 2006), hand and tool overlap (Bracci et al. 2012), or more recently, tool and food overlap (Ritchie et al. 2024). There are a number of ways of then calculating the overlap, with their own strengths and weaknesses (see Tarr et al. 2007). Of these, I think the Jaccard index is the most intuitive, which is just the intersection of two sets as a proportion of their union. So, for example, the N of overlapping D > iA and H > iA active voxels is divided by the total number of unique active voxels for the two contrasts. Such an overlap analysis is more standard and interpretable relative to previous findings. I would strongly encourage the authors to carry out such an analysis or use a similar metric of overlap, in place of what they have currently performed (to the extent the analysis makes sense to me).

      Second, the results summarized in Figure 3A suggest multiple distinct regions of animacy selectivity. Other studies have also identified similar networks of regions (e.g. Boch et al. 2023). These regions may serve different functions, but the overlap analysis does not tell us whether there is overlap in some of these portions of the cortex and not in others. The overlap is only looked at in a very general sense. There may be more overlap locally in some portions of the cortex and not in others.

      (5) Two comments about the RSA analyses. First, I am not quite sure why the authors used HMAX rather than layers of a standardly trained ImageNet deep convolutional neural network. This strikes me also as a missed opportunity since many labs have looked at whether later layers of DNNs trained on object categorization show similar dissimilarity structures as category-selective regions in humans and NHPs. In so far as cross-species comparisons are the motivation here, it would be genuinely interesting to see what would happen if one did a correlation searchlight with the dog brain and layers of a DNN, a la Cichy et al. (2016).

      Second, from the text is hard to tell what the models for the class- and category-boundary effects were. Are there RDMs that can be depicted here? I am very familiar with RSA searchlight and I found the description of the methods to be rather opaque. The same point about overlap earlier regarding the univariate results also applies to the RSA results. Also, this is again a reason to potentially compare DNN RDMs to both the categorical models and the brains of both species.

      (6) There has been emphasis of late on the role of face and body selective regions and social cognition (Pitcher and Ungerleider, 2021, Puce, 2024), and also on whether these regions are more specialized for representing whole bodies/persons (Hu et al. 2020, Taubert, et al. 2022). It may be that the supposed animacy organization is more about how we socialize and interact with other organisms than anything about animacy as such (see again the earlier comments about animacy, taxonomy, and threat/predation). The result, of a great deal of selectivity for dogs, some for humans, and little for cats, seems to readily make sense if we assume it is driven by the social value of the three animate objects that are presented. This might be something worth reflecting on in relation to the present findings.

    1. Reviewer #2 (Public review):

      Summary:

      The authors completed a statistically rigorous analysis of the synchronization of sharp-wave ripples in the hippocampal CA1 across and within hemispheres. They used a publicly available dataset (collected in the Buzsaki lab) from 4 rats (8 sessions) recorded with silicon probes in both hemispheres. Each session contained approximately 8 hours of activity recorded during rest. The authors found that the characteristics of ripples did not differ between hemispheres, and that most ripples occurred almost simultaneously on all probe shanks within a hemisphere as well as across hemispheres. The differences in amplitude and exact timing of ripples between recording sites increased slightly with the distance between recording sites. However, the phase coupling of ripples (in the 100-250 Hz range), changed dramatically with the distance between recording sites. Ripples in opposite hemispheres were about 90% less coupled than ripples on nearby tetrodes in the same hemisphere. Phase coupling also decreased with distance within the hemisphere. Finally, pyramidal cell and interneuron spikes were coupled to the local ripple phase and less so to ripples at distant sites or the opposite hemisphere.

      Strengths:

      The analysis was well-designed and rigorous. The authors used statistical tests well suited to the hypotheses being tested, and clearly explained these tests. The paper is very clearly written, making it easy to understand and reproduce the analysis. The authors included an excellent review of the literature to explain the motivation for their study.

      Weaknesses:

      The authors state that their findings (highly coincident ripples between hemispheres), contradict other findings in the literature (in particular the study by Villalobos, Maldonado, and Valdes, 2017), but fail to explain why this large difference exists. They seem to imply that the previous study was flawed, without examining the differences between the studies.

      The paper fails to mention the context in which the data was collected (the behavior the animals performed before and after the analyzed data), which may in fact have a large impact on the results and explain the differences between the current study and that by Villalobos et al. The Buzsaki lab data includes mice running laps in a novel environment in the middle of two rest sessions. Given that ripple occurrence is influenced by behavior, and that the neurons spiking during ripples are highly related to the prior behavioral task, it is likely that exposure to novelty changed the statistics of ripples. Thus, the authors should analyze the pre-behavior rest and post-behavior rest sessions separately. The Villalobos et al. data, in contrast, was collected without any intervening behavioral task or novelty (to my knowledge). Therefore, I predict that the opposing results are a result of the difference in recent experiences of the studied rats, and can actually give us insight into the memory function of ripples.

      In one figure (5), the authors show data separated by session, rather than pooled. They should do this for other figures as well. There is a wide spread between sessions, which further suggests that the results are not as widely applicable as the authors seem to think. Do the sessions with small differences between phase coupling and amplitude coupling have low inter-hemispheric amplitude coupling, or high phase coupling? What is the difference between the sessions with low and high differences in phase vs. amplitude coupling? I noticed that the Buzsaki dataset contains data from rats running either on linear tracks (back and forth), or on circular tracks (unidirectionally). This could create a difference in inter-hemisphere coupling, because rats running on linear tracks would have the same sensory inputs to both hemispheres (when running in opposite directions), while rats running on a circular track would have different sensory inputs coming from the right and left (one side would include stimuli in the middle of the track, and the other would include closer views of the walls of the room). The synchronization between hemispheres might be impacted by how much overlap there was in sensory stimuli processed during the behavior epoch.

      The paper would be a lot stronger if the authors analyzed some of the differences between datasets, sessions, and epochs based on the task design, and wrote more about these issues. There may be more publicly available bi-hemispheric datasets to validate their results.

    1. Reviewer #2 (Public review):

      Summary:

      Chen et al. describe by different techniques that UBA7 and UBE2L6 readily form a complex that is covalently linked by a disulfide bond involving the active site cysteines of UBA6 and UBE2L6. Furthermore, they determined cryo-EM structures of the disulfide-linked UBY7-UBE2L6 complex in the absence and presence of ISG15. They propose that this disulfide-linked complex blocks ISGylation by temporarily rendering UBA7 inactive.

      Strengths:

      The authors employ a wide variety of techniques to study the formation of the binary Uba7-UBE2L6 and ternary UBA7-UBE2L6-ISG15 complexes including the structural characterization of the two complexes by cryo-EM. Despite the shortcomings (see below), the authors provide numerous valuable data that characterize the first steps of the ISGylation pathway, namely the activation of ISG15 and its transfer to UBE2L6.

      Weaknesses:

      (1) The authors correctly state that "Immune responses often entail the generation or reactive oxygen species, antioxidant defense mechanisms, and redox signaling" (1st sentence of 3rd paragraph in the Introduction). Based on the data presented in this study these cellular responses should lead to the formation of the covalent UBA7-UBE2L6. Since this complex renders UBA7 inactive, thus preventing it from initiating the ISGylation cascade in response to viral infections, the underlying cellular logic of complex formation remains a mystery.

      The bulk of their work describes in vitro experiments, which will certainly not reflect the in vivo situation and hence one cannot rule out that this complex will not form inside cells. The authors have also observed this complex in HEK293T cells, however, this involved overexpression of both proteins and one can thus not rule out that the disulfide-linked complex will not form at physiological protein levels. Furthermore, this cellular model appears not to be a suitable system.

      (2) The authors carried out a comparative analysis of E1-E2 disulfide bond formation with UBA1, the major activating enzyme for ubiquitin, and UBE2L3, a ubiquitin-specific E2. The choice of UBE2L3 was motivated by its close relationship to UBE2L6. From these studies, the authors conclude that UBA1 does not form the corresponding complex. Given that there are over 30 ubiquitin-specific E2s this conclusion does not rest on a very solid basis, since, as demonstrated for example in this study (PMID: 22949505), at least yeast Uba1 forms a disulfide-linked complex with Cdc34. Another study documenting the formation of a disulfide-linked complex between Uba1 and an E2 enzyme, in this case, Rad6, (PMID: 35613580) is even cited by the authors. If the authors want to make the argument that Uba1 does not form corresponding E1-E2 complexes, they need to repeat their experiments with a representative panel of human E2 enzymes and the two enzymes employed in the aforementioned studies (Cdc34 and Rad6) or, more precisely, their human counterparts represent obvious starting points. Depending on the outcome of these studies the experiments with the CCL mutants need to be revisited.

    1. Reviewer #2 (Public review):

      Summary

      This paper combines a biological topic of interest with the demonstration of important theoretical/methodological advances. Fitness inference is the foundation of the quantitative analysis of adapting systems. It is a hard and important problem and this paper highlights a compelling approach (MPL) first presented in (1) and refined in (2), roughly summarized in equation 12.

      (1) Sohail, M. S., Louie, R. H., McKay, M. R. & Barton, J. P. Mpl resolves genetic linkage in fitness inference from complex evolutionary histories. Nature biotechnology 39, 472-479 (2021).<br /> (2) Shimagaki, K. & Barton, J. P. Bézier interpolation improves the inference of dynamical models from data. Physical Review E 107, 024116 (2023).

      The authors find that positive selection shapes the variable regions of env in shared patterns across two patient donors. The patterns of positive selection are interesting in and of themselves, they confirm the intuition that hyper-variation in env is the result of immune evasion rather than a broadly neutral landscape (flatness). They show that the immune evasion patterns due to CD8 T and naive B-cell selection are shared across patients. Furthermore, they suggest that a particular evolutionary history (larger flux to high fitness states) is associated with bNAb emergence. Mimicking this evolutionary pattern in vaccine design may help us elicit bNAbs in patients in the future.

      There is a lot of information to be found in the full fitness landscape of env. The enormous strength of reversion-to-consensus in the patterns is a known pattern of HIV post-infection populations but they are nicely quantified here. Agreement between SHIV and HIV evolution is shown. They find selection is larger for autologous antibodies than the bNAbs themselves (perhaps bNAbs are just too small a component of the host response to drive the bulk of selection?), and that big fitness increases precede antibody breadth in rhesus macaques, suggesting that this fitness increase is the immune challenge required to draw forth a bNAb. This is all of high interest to HIV researchers.

      Strength of evidence

      One limitation is, of course, that the fitness model is constant in time when the immune challenge is variable and changing. This simplification may complicate some interpretations.

      Equation 12 in the methods is really a beautiful tool because it is so simple, but accounts for linkage and can be solved precisely even in the presence of detailed mutational and selection models. However, the reliance on incomplete observations of the frequency leads to complications that must be carefully (re)addressed here.

      For instance, the consistent finding of strong selection in hypervariable regions is biologically intuitive but so striking, that I worry that it might be the result of a bias for selection in high entropy regions. Mutational and covariance terms in equation 12 might be underestimated, due to finite sampling effect in highly diverse populations. Sampling effects lead to zeros in x(t) when actual frequency zeros might be rare at the population sizes of HIV viral loads and mutation rates. Both mutational flux and C underestimation will bias selection upward in eq. 12. The prior papers (1) and (2) seem to show robustness to finite sampling effects, but, again, more care needs to be shown that this robustness transfers to the amino acid inference under these conditions. That synonymous sites are rarely selected for in the nucleotide level is a good sign, and it may be a matter of simply fully explaining the amino-acid level model.

      Uncertainty propagates to the later parts of the paper, eg. HIV and SIV shared patterns might be the result of shared biases in the method application. However, this worry does not extend to the apples-to-apples comparison of fitness trajectories across individuals (Figures 5 and 6) which I think are robust (for these sample sizes). The timing evidence is slightly weakened by the fact that bNAb detection is different from bNAb presence and the possibility that fitness increases occurred after the bNAbs appeared remains. Still, their conclusion is plausible and fits in with the other observations which form a coherent and compelling picture.

      Overall this is a convincing paper, part of a larger admirable project of accurately inferring complete fitness landscapes.

    1. Reviewer #2 (Public review):

      Summary:

      This study investigates a low abundance microRNA signature in extracellular vesicles to subtype pancreatic cancer and for early diagnosis. There are several major questions that need to be addressed. Numerous minor issues are also present.

      Strengths:

      The authors did a comprehensive job with numerous analyses of moderately sized cohorts to describe the clinical and translational significance of their miRNA signature.

      Weaknesses:

      There are multiple weaknesses of this study that should be addressed:

      (1) The description of the datasets in the Materials and Methods lacks details. What were the benign lesions from the various hospital datasets? What were the healthy controls from the public datasets? No pancreatic lesions? No pancreatic cancer? Any cancer history or other comorbid conditions? Please define these better.

      (2) It is unclear how many of the controls and cases had both imaging for radiomics and blood for biomarkers.

      (3) The authors should define the imaging methods and protocols used in more detail. For the CT scans, what slice thickness? Was a pancreatic protocol used? What phase of contrast is used (arterial, portal venous, non-contrast)? Any normalization or pre-processing?

      (4) Who performed the segmentation of the lesions? An experienced pancreatic radiologist? A student? How did the investigators ensure that the definition of the lesions was performed correctly? Raidomics features are often sensitive to the segmentation definitions.

      (5) Figure 1 is full of vague images that do not convey the study design well. Numbers from each of the datasets, a summary of what data was used for training and for validation, definitions of all of the abbreviations, references to the Roman numerals embedded within the figure, and better labeling of the various embedded graphs are needed. It is not clear whether the graphs are real results or just artwork to convey a concept. I suspect that they are just artwork, but this remains unclear.

      (6) The DF selection process lacks important details. Please reference your methods with the Boruta and Lasso models. Please explain what machine learning algorithms were used. There is a reference in the "Feature selection.." section of "the model formula listed below" but I do not see a model formula below this paragraph.

      (7) In Figure 2, more quantitative details are needed. How are patients dichotomized into non-obese and obese? What does alcohol/smoking mean? Is it simply no to both versus one or the other as yes? These two risk factors should be separated and pack years of smoking should be reported. The details of alcohol use should also be provided. Is it an alcohol abuse history? Any alcohol use, including social drinking? Similarly, "diabetes" needs to be better explained. Type I, type II, type 3c? P values should be shown to demonstrate any statistically significant differences in the proportions of the patients from one dataset to another.

      (8) In the section "Different expression radiomic features between pancreatic benign lesions and aggressive tumors", there is a reference to "MUJH" for the first time. What is this? There is also the first reference to "aggressive tumors" in the section. Do the authors just mean the cases? Otherwise there is no clear definition of "aggressive" (vs. indolent) pancreatic cancer. This terminology of tumor "aggressiveness" either needs to be removed or better defined.

      (9) Figure 3 needs to have the specific radiomic features defined and how these features were calculated. Labeling them as just f1, f2, etc is not sufficient for another group to replicate the results independently.

      (10) It is not clear what Figure 4A illustrates as regards model performance. What do the different colors represent, and what are the models used here? This is very confusing.

      (11) Figure 5 shows results for many more model runs than the described 10, please explain what you are trying to convey with each row. What are "Test A" and "Test B"? There is no description in the manuscript of what these represent. In the figure caption, there is a reference to "our center data" which is not clear. Be more specific about what that data is.

      (12) Figure 6 describes the subtypes identified in this study, but the authors do not show a multi-variable cox proportional hazards model to show that this subtype classification independently predicts DFS and OS when incorporating confounding variables. This is essential to show the subtypes are clinically relevant. In particular, the authors need to account for the stage of the patients, and receipt of chemotherapy, surgery, and radiation. If surgery was done, we need to know whether they had R1 or R0 resection. The details about the years in which patients were included is also important.

      (13) How do these subtypes compare to other published subtypes?

    1. Reviewer #2 (Public review):

      Summary:

      This study analyzed the consequences of Agbl5 mutation on ependymal cell development and function. The authors first characterize their mutant mouse line reporting a reduced lifespand and severe hydrocephalus. Next, they report a defect in ependymal cell cilia number and motility. They provide evidence for impaired basal body organisation and cilia glutamylation.

      Strengths:

      Description of a mutant mouse which implicates Cytosolic Carboxypeptidase 5 (the product of Agbl5 gene) for proper ependymal cells.

      Weaknesses:

      Description of phenotype is incomplete:

      - Figure 3G - the sequence from the movie is not really informative. Providing beating frequencies as quantification of the data would be more informative.

      - Figure 3 - the quantification of actin network would strengthen the message.

      - Lines 219 -220 - the authors conclude «Taken together, in Agbl5M1/M1 ependymal cells, the expression of genes promoting multiciliogenesis were not impaired but certain proteins associated with differentiated ependymal cells are not properly expressed». However, they do not assess gene but protein expression (IF). In addition, their quantification shows differences in the number of FoxJ1 positive cells which indeed is an impaired expression.

      - Microtubules are involved in the local organization of ciliary basal bodies (see Werner et al., Vladar et al.,2011; Boutin et al., 2014). It would be interesting for the authors to check whether the subapical network of microtubules is glutamylated or not during ependymal cell differentiation and how this network is affected in their mutants.

      - Showing the data mentioned in the discussion on Cep110 would be a nice addition to the paper.

      - Line 354: "The latter serves as a component of tissue polarity that is required for asymmetric PCP protein localization in each cell (Boutin et al., 2014; Vladar et al., 2012)." The cited reference did not demonstrate that this microtubule network is required for asymmetric PCP localization.

  2. southtexascollege.blackboard.com southtexascollege.blackboard.com
    1. Though use make you apt to kill me, Let not to that, self-murder added be, And sacrilege, three sins in killing three.

      In line 16 and 17, the speaker essentially tells the listener that if they were to kill the flea, it would be a ot only self-murder, but the murder of three lives: their own, the speaker's, and the flea's. In line 18, the speaker places the flea on this holy pedestal, treating it as if it were sacred . By doing this, he makes it seem as though killing it would be a greater offense than it really is.

    2. Though parents grudge, and you, w'are met, <br /> And cloistered in these living walls of jet.

      The speaker tells the listener to forget societal norms and barriers, telling them that they have already met in a sacred place, a reference to the temple or flea. The flea creates a close, private area for the two of them to be free from the view of others.

    3. This flea is you and I, and this Our marriage bed, and marriage temple is;

      The speaker tells the listener that the flea signifies their marriage bed and temple. By this logic, it sets the two being already married. By making the flea play the part of a temple and bed, it seemingly makes this small, insignificant bug, play a huge role within the poem.

    1. Reviewer #2 (Public review):

      Summary:

      Here, Fischer et al. attempt to understand the role of parental care, specifically the transport of offspring, in the development of the amphibian microbiome. The amphibian microbiome is an important study system due to its association with host health and disease outcomes. This study provides vertical transfer of bacteria through parental transport of tadpoles as a mechanism influencing tadpole microbiome composition. This paper gives insight into the relative roles of the environment, species, and parental care in determining microbiome composition in amphibians.

      The authors determine the time of bacterial colonization during tadpole development using PCR, observing that tadpoles were not colonized by bacteria prior to hatching from the vitelline membrane. By doing this, the impact of transport can be more accurately assessed in their laboratory experiments. The authors found that caregiver species influenced community composition, with transported tadpoles sharing a greater proportion of their skin communities with the transporting species.

      In a comparison of three sympatric amphibian species that vary in their reproductive strategies, the authors found that tadpole community diversity was not reflective of habitat diversity, but may be associated with the different reproductive strategies of each species. Parental care explained some of the variance of tadpole microbiomes between species, however, transportation by conspecific adults did not lead to more similar microbiomes between tadpoles and adults compared to species that do not exhibit parental transport.

      I did not find any major weaknesses in my review of this paper. The work here could potentially benefit from absolute abundance levels for shared ASVs between adults and tadpoles to more thoroughly understand the influences of vertical transmission that might be masked by relative abundance counts. This would only be a minor improvement as I think the conclusions from this work would likely remain the same, however.

    1. Reviewer #2 (Public review):

      Summary

      The study investigated whether memory retrieval followed soon by extinction training results in a short-term memory deficit when tested - with a reinstatement test that results in recovery from extinction - soon after extinction training. Experiment 1 documents this phenomenon using a between-subjects design. Experiment 2 used a within-subject control and saw that the effect is also observed in a control condition. In addition, it also revealed that if testing is conducted 6 hours after extinction, there is not effect of retrieval prior to extinction as there is recovery from extinction independently of retrieval prior to extinction. A third Group also revealed that retrieval followed by extinction attenuates reinstatement when the test is conducted 24 hours later, consistent with previous literature. Finally, Experiment 3 used continuous theta-burst stimulation of the dorsolateral prefrontal cortex and assessed whether inhibition of that region (vs a control region) reversed the short-term effect revealed in Experiments 1 and 2. The results of control groups in Experiment 3 replicated the previous findings (short-term effect), and the experimental group revealed that these can be reversed by inhibition of the dorsolateral prefrontal cortex.

      Strengths

      The work is performed using standard procedures (fear conditioning and continuous theta-burst stimulation) and there is some justification of the sample sizes. The results replicate previous findings - some of which have been difficult to replicate and this needs to be acknowledged - and suggest that the effect can also be observed in a short-term reinstatement test.

      The study establishes links between the memory reconsolidation and retrieval-induced forgetting (or memory suppression) literatures. The explanations that have been developed for these are distinct and the current results integrate these, by revealing that the DLPFC activity involved in retrieval-extinction short-term effect. There is thus some novelty in the present results, but numerous questions remain unaddressed.

      Weakness

      The fear acquisition data is converted to a differential fear SCR and this is what is analysed (early vs late). However, the figure shows the raw SCR values for CS+ and CS- and therefore it is unclear whether acquisition was successful (despite there being an "early" vs "late" effect - no descriptives are provided).

      In Experiment 1 (Test results) it is unclear whether the main conclusion stems from a comparison of the test data relative to the last extinction trial ("we defined the fear recovery index as the SCR difference between the first test trial and the last extinction trial for a specific CS") or the difference relative to the CS- ("differential fear recovery index between CS+ and CS-"). It would help the reader assess the data if Fig 1e presents all the indexes (both CS+ and CS-). In addition, there is one sentence which I could not understand "there is no statistical difference between the differential fear recovery indexes between CS+ in the reminder and no reminder groups (P=0.048)". The p value suggests that there is a difference, yet it is not clear what is being compared here. Critically, any index taken as a difference relative to the CS- can indicate recovery of fear to the CS+ or absence of discrimination relative to the CS-, so ideally the authors would want to directly compare responses to the CS+ in the reminder and no-reminder groups. In the absence of such comparison, little can be concluded, in particular if SCR CS- data is different between groups. The latter issue is particularly relevant in Experiment 2, in which the CS- seems to vary between groups during the test and this can obscure the interpretation of the result.

      In experiment 1, the findings suggest that there is a benefit of retrieval followed by extinction in a short-term reinstatement test. In Experiment 2, the same effect is observed to a cue which did not undergo retrieval before extinction (CS2+), a result that is interpreted as resulting from cue-independence, rather than a failure to replicate in a within-subjects design the observations of Experiment 1 (between-subjects). Although retrieval-induced forgetting is cue-independent (the effect on items that are suppressed [Rp-] can be observed with an independent probe), it is not clear that the current findings are similar, and thus that the strong parallels made are not warranted. Here, both cues have been extinguished and therefore been equally exposed during the critical stage.

      The findings in Experiment 2 suggest that the amnesia reported in Experiment 1 is transient, in that no effect is observed when the test is delayed by 6 hours. The phenomena whereby reactivated memories transition to extinguished memories as a function of the amount of exposure (or number of trials) is completely different from the phenomena observed here. In the former, the manipulation has to do with the number of trials (or total amount of time) that the cues are exposed. In the current Experiment 2, the authors did not manipulate the number of trials but instead the retention interval between extinction and test. The finding reported here is closer to a "Kamin effect", that is the forgetting of learned information which is observed with intervals of intermediate length (Baum, 1968). Because the Kamin effect has been inferred to result from retrieval failure, it is unclear how this can be explained here. There needs to be much more clarity on the explanations to substantiate the conclusions.<br /> There are many results (Ryan et al., 2015) that challenge the framework that the authors base their predictions on (consolidation and reconsolidation theory), therefore these need to be acknowledged. These studies showed that memory can be expressed in the absence of the biological machinery thought to be needed for memory performance. The authors should be careful about statements such as "eliminate fear memores" for which there is little evidence.

      The parallels between the current findings and the memory suppression literature are speculated in the general discussion, and there is the conclusion that "the retrieval-extinction procedure might facilitate a spontaneous memory suppression process". Because one of the basic tenets of the memory suppression literature is that it reflects an "active suppression" process, there is no reason to believe that in the current paradigm the same phenomenon is in place, but instead it is "automatic". In other words, the conclusions make strong parallels with the memory suppression (and cognitive control) literature, yet the phenomena that they observed is thought to be passive (or spontaneous/automatic). Ultimately, it is unclear why 10 mins between the reminder and extinction learning will "automatically" suppress fear memories. Further down in the discussion it is argued that "For example, in the well-known retrieval-induced forgetting (RIF) phenomenon, the recall of a stored memory can impair the retention of related long-term memory and this forgetting effect emerges as early as 20 minutes after the retrieval procedure, suggesting memory suppression or inhibition can occur in a more spontaneous and automatic manner". I did not follow with the time delay between manipulation and test (20 mins) would speak about whether the process is controlled or automatic. In addition, the links with the "latent cause" theoretical framework are weak if any. There is little reason to believe that one extinction trial, separated by 10 mins from the rest of extinction trials, may lead participants to learn that extinction and acquisition have been generated by the same latent cause.

      Among the many conclusions, one is that the current study uncovers the "mechanism" underlying the short-term effects of retrieval-extinction. There is little in the current report that uncovers the mechanism, even in the most psychological sense of the mechanism, so this needs to be clarified. The same applies to the use of "adaptive".

      Whilst I could access the data in the OFS site, I could not make sense of the Matlab files as there is no signposting indicating what data is being shown in the files. Thus, as it stands, there is no way of independently replicating the analyses reported.

      The supplemental material shows figures with all participants, but only some statistical analyses are provided, and sometimes these are different from those reported in the main manuscript. For example, the test data in Experiment 1 is analysed with a two-way ANOVA with main effects of group (reminder vs no-reminder) and time (last trial of extinction vs first trial of test) in the main report. The analyses with all participants in the sup mat used a mixed two-way ANOVA with group (reminder vs no reminder) and CS (CS+ vs CS-). This makes it difficult to assess the robustness of the results when including all participants. In addition, in the supplementary materials there are no figures and analyses for Experiment 3.

      One of the overarching conclusions is that the "mechanisms" underlying reconsolidation (long term) and memory suppression (short term) phenomena are distinct, but memory suppression phenomena can also be observed after a 7-day retention interval (Storm et al., 2012), which then questions the conclusions achieved by the current study.

      References:

      Baum, M. (1968). Reversal learning of an avoidance response and the Kamin effect. Journal of Comparative and Physiological Psychology, 66(2), 495.<br /> Chalkia, A., Schroyens, N., Leng, L., Vanhasbroeck, N., Zenses, A. K., Van Oudenhove, L., & Beckers, T. (2020). No persistent attenuation of fear memories in humans: A registered replication of the reactivation-extinction effect. Cortex, 129, 496-509.<br /> Ryan, T. J., Roy, D. S., Pignatelli, M., Arons, A., & Tonegawa, S. (2015). Engram cells retain memory under retrograde amnesia. Science, 348(6238), 1007-1013.<br /> Storm, B. C., Bjork, E. L., & Bjork, R. A. (2012). On the durability of retrieval-induced forgetting. Journal of Cognitive Psychology, 24(5), 617-629.

      Comments on revisions:

      The authors have revised the manuscript but most of my concerns have remained unaddressed.

      (1) There are still no descriptive statistics to substantiate learning in Experiment 1.

      (2) In the revised analyses, the authors now show that CS- changes in different groups (for example, Experiment 2) so this means that there is little to conclude from the differential scores because these depend on CS-. It is unclear whether the effects arise from CS+ performance or the differential which is subject to CS- variations.

      (3) The notion that suppression is automatic is speculative at best

      (4) It still struggle with the parallels between these findings and the "limbo" literature. Here you manipulated the retention interval, whereas in the cited studies the number of extinction (exposure) was varied. These are two completely different phenomena.

      (5) My point about the data problematic for the reconsolidation (and consolidation) frameworks is that they observed memory in the absence of the brain substrates that are needed for memory to be observed. The answer did not address this. I do not understand how the latent cause model can explain this, if the only difference is the first ITI. Wouldn't participants fail to integrate extinction with acquisition with a longer ITI?

      (6) The materials in the OSF site are the same as before, they haven't ben updated.

      (7) Concerning supplementary materials, the robustness tests are intended to prove that you 1) can get the same results by varying the statistical models or 2) you can get the same results when you include all participants. Here authors have done both so this does not help. Also, in the rebuttal letter, they stated "Please note we did not include non-learners in these analyses " which contradicts what is stated in the figure captions "(learners + non learners)"

      (8) Finally, the literature suggesting that reconsolidation interference "eliminates" a memory is not substantiated by data nor in line with current theorising, so I invite a revision of these strong claims.

      Overall, I conclude that the revised manuscript did not address my main concerns.

    1. Reviewer #3 (Public review):

      Summary:

      The manuscript by Wu D. et al. explores an innovative approach in immunometabolism and obesity by investigating the potential of targeting macrophage Inositol-requiring enzyme 1α (IRE1α) in cases of overnutrition. Their findings suggest that pharmacological inhibition of IRE1α could influence key aspects such as adipose tissue inflammation, insulin resistance, and thermogenesis. Notable discoveries include the identification of High-Fat Diet (HFD)-induced CD9+ Trem2+ macrophages and the reversal of metabolically active macrophages' activity with IRE1α inhibition using STF. These insights could significantly impact future obesity treatments.

      Strengths:

      The study's key strengths lie in its identification of specific macrophage subsets and the demonstration that inhibiting IRE1α can reverse the activity of these macrophages. This provides a potential new avenue for developing obesity treatments and contributes valuable knowledge to the field.

      Weaknesses:

      The research lacks an in-depth exploration of the broader metabolic mechanisms involved in controlling diet-induced obesity (DIO). Addressing this gap would strengthen the understanding of how targeting IRE1α might fit into the larger metabolic landscape.

      Impact and Utility:

      The findings have the potential to advance the field of obesity treatment by offering a novel target for intervention. However, further research is needed to fully elucidate the metabolic pathways involved and to confirm the long-term efficacy and safety of this approach. The methods and data presented are useful, but additional context and exploration are required for broader application and understanding.

      Comments on revisions:

      The authors have satisfactorily addressed all of my previous concerns.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript presents data demonstrating NopT's interaction with Nod Factor Receptors NFR1 and NFR5 and its impact on cell death inhibition and rhizobial infection. The identification of a truncated NopT variant in certain Sinorhizobium species adds an interesting dimension to the study. These data try to bridge the gaps between classical Nod-factor-dependent nodulation and T3SS NopT effector-dependent nodulation in legume-rhizobium symbiosis. Overall, the research provides interesting insights into the molecular mechanisms underlying symbiotic interactions between rhizobia and legumes.

      Strengths:

      The manuscript nicely demonstrates NopT's proteolytic cleavage of NFR5, regulated by NFR1 phosphorylation, promoting rhizobial infection in L. japonicus. Intriguingly, authors also identify a truncated NopT variant in certain Sinorhizobium species, maintaining NFR5 cleavage but lacking NFR1 interaction. These findings bridge the T3SS effector with the classical Nod-factor-dependent nodulation pathway, offering novel insights into symbiotic interactions.

      Weaknesses:

      (1) In the previous study, when transiently expressed NopT alone in Nicotiana tobacco plants, proteolytically active NopT elicited a rapid hypersensitive reaction. However, this phenotype was not observed when expressing the same NopT in Nicotiana benthamiana (Figure 1A). Conversely, cell death and a hypersensitive reaction were observed in Figure S8. This raises questions about the suitability of the exogenous expression system for studying NopT proteolysis specificity.

      (2) NFR5 Loss-of-function mutants do not produce nodules in the presence of rhizobia in lotus roots, and overexpression of NFR1 and NFR5 produces spontaneous nodules. In this regard, if the direct proteolysis target of NopT is NFR5, one could expect the NGR234's infection will not be very successful because of the Native NopT's specific proteolysis function of NFR5 and NFR1. Conversely, in Figure 5, authors observed the different results.

      (3) In Figure 6E, the model illustrates how NopT digests NFR5 to regulate rhizobia infection. However, it raises the question of whether it is reasonable for NGR234 to produce an effector that restricts its own colonization in host plants.

      (4) The failure to generate stable transgenic plants expressing NopT in Lotus japonicus is surprising, considering the manuscript's claim that NopT specifically proteolyzes NFR5, a major player in the response to nodule symbiosis, without being essential for plant development.

      Comments on the revised version:

      My concerns regarding the potential function of NopT during nodule symbiosis have been adequately addressed in the revised manuscript. Therefore, I have no further questions about this version, aside from a few minor suggestions:

      (1) Please carefully check the text formatting throughout the manuscript to ensure consistency with scientific conventions and the journal's standards. For example, Line 105-117 and line119-131.<br /> (2) The term "detrimental" in line 624 may not accurately describe the function of NopT in rhizobial infection. Since the authors propose that NopT proteolytically cleaves NFR5 and suppresses NF signaling as a potential fine-tuning mechanism for legume symbiosis, a more precise term may be needed.<br /> (3) Lines 632-634 are somewhat unclear. If NopT serves as a strategy for rhizobia to evade detection by plant immunity, then knocking out NopT should, in theory, inhibit rhizobial infection. Clarification on this point would be beneficial.

    1. Reviewer #2 (Public review):

      Summary:

      Dasari et al present an interesting study investigating the use of 'microbiota age' as an alternative to other measures of 'biological age'. The study provides several curious insights into biological ageing. Although 'microbiota age' holds potential as a proxy of biological age, it comes with limitations considering the gut microbial community can be influenced various non-age related factors, and various age-related stressors may not manifest in changes in the gut microbiota.

      Strengths:

      The dataset this study is based on is impressive, and can reveal various insights into biological ageing and beyond. The analysis implemented is extensive and of high level.

      Weaknesses:

      The key weakness is the use of microbiota age instead of e.g., DNA-methylation based epigenetic age as a proxy of biological ageing, for reasons stated in the summary. DNA methylation levels can be measured from faecal samples, and as such epigenetic clocks too can be non-invasive.

      In the first round of review, I provided authors a list of minor edits, which they have implemented in the revised version of the manuscript.

    1. Reviewer #2 (Public review):

      Hass et al. use in vivo and ex vivo mouse models to explore and validate the use of glucose and lactate by the outer retina. While the authors' conclusions are not totally novel, their work uses powerful in vivo models to validate, strengthen, and support their conclusions. This data is an important step forward in the field's understanding of retinal metabolism.

      They performed in vivo metabolite tracing with 5 different fuel sources and found that glucose was the primary fuel for TCA in the retina. While performing these experiments they measured the circulating levels of the tracer metabolites to ensure steady-state labeling which aids in the interpretation of the results. Showing the levels of the labeled tracer in the retina would be a nice addition to establishing if the tracer is getting into the target tissue.

      To support their conclusions that the photoreceptors are the primary consumers of glucose in the retina, the authors used multiple mouse models either with photoreceptor degeneration or a retina lacking the primary glucose transporter. While the photoreceptor degeneration mouse model has some caveats that make interpreting the data challenging, the glucose transporter KO models are a powerful tool to show the changes in metabolite levels between the retina and RPE in a retina. These retinas are not degenerated and have more subtle metabolic rearrangements. Therefore decreases in glucose consumption and lactate export can confidently be attributed to the changes in the photoreceptor metabolism. This model also allowed the authors to show that when glucose uptake is limited the photoreceptors can use lactate.

      The authors show in vivo data to support that the RPE uses lactate from the photoreceptors as a fuel source. They do very short-term tracing in vivo to show that the RPE has reduced lactate levels and TCA labeling in a mouse model lacking photoreceptors. There is no deficiency when the RPE is measured ex vivo. These data clearly show that the adjacent photoreceptor activity is impacting RPE metabolism.

      The manuscript is well-written, and thorough and does a very good job detailing and explaining methods and concepts that are not straightforward. The authors address (and do not bury) confusing data that does not necessarily support their conclusions (for example glycolytic intermediates in Figure 3C being elevated. The authors even perform additional experiments to clarify artifacts they observed in the tracing of the degeneration model due to short-term ischemia.

    1. Reviewer #2 (Public review):

      The author investigates the role of background noise on EEG-assessed speech tracking in a series of five experiments. In the first experiment the influence of different degrees of background noise is investigated and enhanced speech tracking for minimal noise levels is found. The following four experiments explore different potential influences on this effect, such as attentional allocation, different noise types and presentation mode.

      The step-wise exploration of potential contributors to the effect of enhanced speech tracking for minimal background noise is compelling. The motivation and reasoning for the different studies is clear and logical and therefore easy to follow. The results are discussed in a concise and clear way. While I specifically like the conciseness, one inevitable consequence is that not all results are equally discussed in depth.

      Based on the results of the five experiments, the authors conclude that the enhancement of speech tracking for minimal background noise is likely due to stochastic resonance. Given broad conceptualizations of stochasitc resonance as noise benefit this is a reasonable conclusion.

      This study will likely impact the field as it provides compelling support questioning the relationship between speech tracking and speech processing.

      Comments on revisions:

      All my previous comments were addressed nicely. Some of the comments were mere curiosity questions that were nicely entertained, even though they were not of direct relevance to the manuscript. I like the addition of the amplitude envelope analysis to the supplementary material as it offers direct comparison of those different methods. My only tiny tiny critic is (which bears no significance), that due to the many rearrangement changes in the marked changes document, the changes of content get buried and hard to see.

    1. Reviewer #2 (Public review):

      Summary:

      Desveaux et al. performed Elisa and translocation assays to identify among 34 cystic fibrosis patients which ones produced antibodies against P. aeruginosa type three secretion system (T3SS). The authors were especially interested in antibodies against PcrV and PcsF, two key components of the T3SS. The authors leveraged their binding assays and flow cytometry to isolate individual B cells from the two most promising sera, and then obtained monoclonal antibodies for the proteins of interest. Among the tested monoclonal antibodies, P3D6 and P5B3 emerged as the best candidates due to their inhibitory effect on the ExoS-Bla translocation marker (with 24% and 94% inhibition, respectively). The authors then showed that P5B3 binds to the five most common variants of PcrV, while P3D6 seems to recognize only one variant. Furthermore, the authors showed that P3D6 inhibits translocon formation, measured as cell death of J774 macrophages. To get insights into the P3D6-PcrV interaction, the authors defined the crystal structure of the P3D6-PcrV complex. Finally, the authors compared their new antibodies with two previous ones (i.e., MEDI3902 and 30-B8).

      Strengths:

      (1) The article is well written.

      (2) The authors used complementary assays to evaluate the protective effect of candidate monoclonal antibodies.

      (3) The authors offered crystal structure with insights into the P3D6 antibody-T3SS interaction (e.g., interactions with monomer vs pentamers).

      (4) The authors put their results in context by comparing their antibodies with respect to previous ones.

      Weaknesses:

      (1) The authors used a similar workflow to the one previously reported in Simonis et al. 2023 (antibodies from cystic fibrosis patients that included B cell isolation, antibody-PcrV interaction modeling, etc.) but the authors do not clearly explain how their work and findings differentiate from previous work.

      (2) Although new antibodies against P. aerugisona T3SS expand the potential space of antibody-based therapies, it is unclear if P3D6 or P5B3 are better than previous antibodies. In fact, in the discussion section authors suggested that the 30-B8 antibody seems to be the most effective of the tested antibodies.

      (3) The authors should explain better which of the two antibodies they have discovered would be better suited for follow-up studies. It is confusing that the authors focused the last sections of the manuscript on P3D6 despite P3D6 having a much lower ExoS-Bla inhibition effect than P5B3 and the limitation in the PcrV variant that P3D6 seems to recognize. A better description of this comparison and the criteria to select among candidate antibodies would help readers identify the main messages of the paper.

      (4) This work could strongly benefit from two additional experiments:<br /> a) In vivo experiments: experiments in animal models could offer a more comprehensive picture of the potential of the identified monoclonal antibodies. Additionally, this could help to answer a naïve question: why do the patients that have the antibodies still have chronic P. aeruginosa infections?<br /> b) Multi-antibody T3SS assays (i.e., a combination of two or more monoclonal antibodies evaluated with the same assays used for characterization of single ones). This could explore the synergistic effects of combinatorial therapies that could address some of the limitations of individual antibodies.

    1. Reviewer #2 (Public review):

      Summary:

      In the current study, the authors aim to identify the mode of action/molecular mechanism of characterized a fungicide, quinofumelin, and its biological impact on transcriptomics and metabolomics in Fusarium graminearum and other Fusarium species. Two sets of data were generated between quinofumelin and no treatment group, and differentially abundant transcripts and metabolites were identified. The authors further focused on uridine/uracil biosynthesis pathway, considering the significant up- and down-regulation observed in final metabolites and some of the genes in the pathways. Using a deletion mutant of one of the genes and in vitro biochemical assays, the authors concluded that quinofumelin binds to the dihydroorotate dehydrogenase.

      Strengths:

      Omics datasets were leveraged to understand the physiological impact of quinofumelin, showing the intracellular impact of the fungicide. The characterization of FgDHODHII deletion strains with supplemented metabolites clearly showed the impact of the enzyme on fungal growth.

      Weaknesses:

      Some interpretation of results is not accurate and some experiments lack controls. The comparison between quinofumelin-treated deletion strains, in the presence of different metabolites didn't suggest the fungicide is FgDHODHII specific. A wild type is required in this experiment.

      Potential Impact: Confirming the target of quinofumelin may help understand its resistance mehchanism, and further development of other inhibitory molecules against the target.

      The manuscript would benefit more in explaining the study rationale if more background on previous characterization of this fungicide on Fusarium is given.

    1. Reviewer #2 (Public review):

      Summary:

      Recent studies indicate a beneficial role for moderate-intensity exercise in early osteoarthritis (OA). This manuscript by Jia et al. investigates the role of cartilage intermediate layer protein (CILP) and moderate exercise in maintaining hyaline cartilage integrity following anterior cruciate ligament transection (ACLt) in rats. Single-cell RNA-sequencing of OA and OA+ exercise knee joints from rats at 4 weeks post-ACLt revealed the upregulation of CILP and a higher Col2/Col1 ratio in OA knee chondrocytes from ACLt rats that exercised on a treadmill. CILP was downregulated in the damaged portions, compared to healthy regions of knee cartilage of patients undergoing total knee arthroplasty. In the rat ACLt model, CILP is downregulated in the OA cartilage but not in OA + exercise cartilage. Using CLIP1 over-expression and knockdown in passage 3 cultures of primary rat chondrocytes, the authors demonstrate that the loss of CILP is associated with higher ROS, lipid peroxidation, and iron content in chondrocytes whereas its overexpression is protective against these changes. CILP binds to Keap1, and its overexpression disrupts Keap1/Nrf2 interaction and attenuates Nrf2 ubiquitination. The authors conclude that exercise protects the articular cartilage intermediate zone and the associated upregulation of CILP facilitates Keap1-Nrf2 interaction to prevent chondrocyte ferroptosis and hyaline cartilage fibrosis.

      Strengths:

      The study is interesting, and the experiments are conducted well. The methodology is well-described. The data presented strongly support the downregulation of CILP in human OA cartilage and its potential role in regulating Keap1/Nrf2 interaction and chondrocyte ferroptosis.

      Weaknesses:

      The data do not support a role for CILP in exercise-mediated inhibition of hyaline cartilage fibrosis in early OA. The reason for selecting CILP from the ScRNA-seq for further analysis is not clear. The manuscript is put together sloppily. The abstract, introduction, and results were written confusingly, and hard to follow. Some of the figures were confusing as well. Still, the study is interesting.

    1. Reviewer #2 (Public review):

      In this manuscript, Popli et al investigated the roles of autophagy related gene, Atg14, in the female reproductive tract (FRT) using conditional knockout mouse models. By ablation of Atg14 in both oviduct and uterus with PR-Cre (Atg14 cKO), authors discovered that such females are completely infertile. They went on to show that Atg14 cKO females have impaired embryo implantation as well as embryo transport from oviduct to uterus. Further analysis showed that Atg14 cKO leads to increased pyroptosis in oviduct, which disrupts oviduct epithelial integrity and leads to obstructive oviduct lumen and impaired embryo transport. Authors concluded that Atg14 is critical for maintaining the oviduct homeostasis and keeping the inflammation under check to enable proper embryo transport.

      Comments on revisions: Authors have addressed all my concerns in this revised version, which is substantial improved compared to the original version. I have no further comments.

    1. Reviewer #2 (Public review):

      Summary:

      This manuscript explores the role of the C-terminal tail of EmrE in controlling uncoupled proton flux. Leakage occurs in the wild-type transporter under certain conditions but is amplified in the C-terminal truncation mutant D107. The authors use an impressive combination of growth assays, transport assays, NMR on WT and mutants with and without key substrates, classical MD, and reactive MD to address this problem. Overall, I think that the claims are well supported by the data, but I am most concerned about the reproducibility of the MD data, initial structures used for simulations, and the stochasticity of the water wire formation. These can all be addressed in a revision with more simulations as I point out below. I want to point out that the discussion was very nicely written, and I enjoyed reading the summary of the data and the connection to other studies very much.

      Strengths:

      The Henzler-Wildman lab is at the forefront of using quantitative experiments to probe the peculiarities in transporter biophysics, and the MD work from the Voth lab complements the experiments quite well. The sheer number of different types of experimental and computational approaches performed here is impressive.

      Weaknesses:

      The primary weaknesses are related to the reproducibility of the MD results with regard to the formation of water wires in the WT and truncation mutant. This could be resolved with simulations starting from structures built using very different loops and C-terminal tails.

      The water wire gates identified in the MD should be tested experimentally with site-directed mutagenesis to determine if those residues do impact leak.

    1. Reviewer #2 (Public review):

      This manuscript proposes that primary hepatocytes can replicate their DNA without the six-subunit ORC. This follows previous studies that examined mice that did not express ORC1 in the liver. In this study, the authors suppressed expression of ORC2 or ORC1 plus ORC2 in the liver.

      Comments:

      (1) I find the conclusion of the authors somewhat hard to accept. Biochemically, ORC without the ORC1 or ORC2 subunits cannot load the MCM helicase on DNA. The question arises whether the deletion in the ORC1 and ORC2 genes by Cre is not very tight, allowing some cells to replicate their DNA and allow the liver to develop, or whether the replication of DNA proceeds via non-canonical mechanisms, such as break-induced replication. The increase in the number of polyploid cells in the mice expressing Cre supports the first mechanism, because it is consistent with few cells retaining the capacity to replicate their DNA, at least for some time during development.

      (2) Fig 1H shows that 5 days post infection, there is no visible expression of ORC2 in MEFs with the ORC2 flox allele. However, at 15 days post infection, some ORC2 is visible. The authors suggest that a small number of cells that retained expression of ORC2 were selected over the cells not expressing ORC2. Could a similar scenario also happen in vivo?

      (3) Figs 2E-G show decreased body weight, decreased liver weight and decreased liver to body weight in mice with recombination of the ORC2 flox allele. This means that DNA replication is compromised in the ALB-ORC2f/f mice.

      (4) Figs 2I-K do not report the number of hepatocytes, but the percent of hepatocytes with different nuclear sizes. I suspect that the number of hepatocytes is lower in the ALB-ORC2f/f mice than in the ORC2f/f mice. Can the authors report the actual numbers?

      (5) Figs 3B-G do not report the number of nuclei, but percentages, which are plotted separately for the ORC2-f/f and ALB-ORC2-f/f mice. Can the authors report the actual numbers?

      (6) Fig 5 shows the response of ORC2f/f and ALB-ORC2f/f mice after partial hepatectomy. The percent of EdU+ nuclei in the ORC2-f/f (aka ALB-CRE-/-) mice in Fig 5H seems low. Based on other publications in the field it should be about 20-30%. Why is it so low here? The very low nuclear density in the ALB-ORC2-f/f mice (Fig 5F) and the large nuclei (Fig 5I) could indicate that cells fire too few origins, proceed through S phase very slowly and fail to divide.

      (7) Fig 6F shows that ALB-ORC1f/f-ORC2f/f mice have very severe phenotypes in terms of body weight and liver weight (about on third of wild-type!!). Fig 6H and 6I, the actual numbers should be presented, not percentages. The fact that there are EYFP negative cells, implies that CRE was not expressed in all hepatocytes.

      (8) Comparing the EdU+ cells in Fig 7G versus 5G shows very different number of EdU+ cells in the control animals. This means that one of these images is not representative. The higher fraction of EdU+ cells in the double-knockout could mean that the hepatocytes in the double-knockout take longer to complete DNA replication than the control hepatocytes. The control hepatocytes may have already completed DNA replication, which can explain why the fraction of EdU+ cells is so low in the controls. The authors may need to study mice at earlier time points after partial hepatectomy, i.e. sacrifice the mice at 30-32 hours, instead of 40-52 hours.

      (9) Regarding the calculation of the number of cell divisions during development: the authors assume that all the hepatocytes in the adult liver are derived from hepatoblasts that express Alb. Is it possible to exclude the possibility that pre-hepatoblast cells that do not express Alb give rise to hepatocytes? For example, the cells that give rise to hepatoblasts may proliferate more times than normal giving rise to a higher number of hepatoblasts than in wild-type mice.

      (10) My interpretation of the data is that not all hepatocytes have the ORC1 and ORC2 genes deleted (eg EYFP-negative cells) and that these cells allow some proliferation in the livers of these mice.

      My comments regarding the previous version still stand, since the authors did not perform experiments to address them.

    1. Reviewer #2 (Public review):

      Summary:

      The authors tried to test the hypothesis that Cdk8 and Cdk19 stabilize the cytoplasmic CcNC protein, the partner protein of Mediator complex including CDK8/19 and Mediator protein via a kinase-independent function by generating induced double knockout of Cdk8/19. However the evidence presented suffer from a lack of focus and rigor and does not support their claims.

      Strengths:

      This is the first comprehensive report on the effect of a double knockout of CDK8 and CDK19 in mice on male fertility, hormones and single cell testicular cellular expression. The inducible knockout mice led to male sterility with severe spermatogenic defects, and the authors attempted to use this animal model to test the kinase-independent function of CDK8/19, previously reported for human. Single cell RNA-seq of knockout testis presented a high resolution of molecular defects of all the major cell types in the testes of the inducible double knockout mice. The authors also have several interesting findings such as reentry into cell cycles by Sertoli cells, loss of Testosterone in induced dko that could be investigated further.

      Weaknesses:

      The claim of reproductive defects in the induced double knockout of CDK8/19 resulted from the loss of CCNC via a kinase-independent mechanism is interesting but was not supported by the data presented. While the construction and analysis of the systemic induced knockout model of Cdk8 in Cdk19KO mice is not trivial, the analysis and data is weakened by systemic effect of Cdk8 loss, making it difficult to separate the systemic effect from the local testis effect.

      The analysis of male sterile phenotype is also inadequate with poor image quality, especially testis HE sections. Male reproductive tract picture is also small and difficult to evaluate. The mice crossing scheme is unusual as you have three mice to cross to produce genotypes, while we could understand that it is possible to produce pups of desired genotypes with different mating schemes, such vague crossing scheme is not desirable and of poor genetics practice. Also using TAM treated wild type as control is ok, but a better control will be TAM treated ERT2-cre; CDK8f/f or TAM treated ERT2 Cre CDK19/19 KO, so as to minimize the impact from well-recognized effect of TAM.

      While the authors proposed that the inducible loss of CDK8 in the CDK19 knockout background is responsible for spermatogenic defects, it was not clear in which cells CDK8/19 genes are interested and which cell types might have a major role in spermatogenesis. The authors also put forward the evidence that reduction/loss of Testosterone might be the main cause of spermatogenic defects, which is consistent with the expression change in genes involved in steroigenesis pathway in Leydig cells of inducible double knockout. But it is not clear how the loss of Testosterone contributed to the loss of CcnC protein.

      The authors should clarify or present the data on where CDK8 and CDK19 as well as CcnC are expressed so as to help the readers to understand which tissues that both CDK might be functioning and cause the loss of CcnC. It should be easier to test the hypothesis of CDK8/19 stabilize CcnC protein using double knock out primary cells, instead of the whole testis.

      Since CDK8KO and CDK19KO both have significantly reduced fertility in comparison with wildtype, it might be important to measure the sperm quantity and motility among CDK8 KO, CDK19KO and induced DKO to evaluate spermatogenesis based on their sperm production.

      Some data for the inducible knockout efficiency of Cdk8 were presented in Supplemental figure 1, but there is no legend for the supplemental figures, it was not clear which band represented deletion band, which tissues were examined? Tail or testis? It seems that two months after the injection of Tam, all the Cdk8 were completely deleted, indicating extremely efficient deletion of Tam induction by two-month post administration. Were the complete deletion of Cdk8 happening even earlier ? an examination of timepoints of induced loss would be useful and instructional as to when is the best time to examine phenotypes.

      The authors found that Sertoli cells re-entered cell cycle in the inducible double knockout but stop short of careful characterization other than increased expression of cell cycle genes.

      Overall this work suffered from a lack of focus and rigor in the analysis and lack of sufficient evidence to support their main conclusions.

      Comments on revisions:

      This reviewer appreciated the authors' effort in improving the quality of this manuscript during their revision. While some concerns remain, the revision is a much improved work and the authors addressed most of my major concerns.<br /> Figure 2E CDK8 and CDK19 immunofluorescent staining images seem to show CDK8 and CDK19 location are completely distinct and in different cells, the authors need to elaborate on this results and discuss what such a distinct location means in line of their double knockout data.

    1. Reviewer #2 (Public review):

      Summary:

      Here the authors have shown the role of sex differences in MHO phenotype, which increases the scope for research in this area.

      Strengths:

      The study provides a detailed idea of how the genes are regulated in sex sex-dependent manner.

      Weaknesses:

      The mechanistic details are missing

    1. Reviewer #2 (Public review):

      Summary:

      In this work, the authors wish to explore the metabolic support mechanisms enabling lamellocyte encapsulation, a critical antiparasitic immune response of insects. They show that S-adenosylmethionine metabolism is specifically important in this process through a combination of measurements of metabolite levels and genetic manipulations of this metabolic process.

      Strengths:

      The metabolite measurements and the functional analyses are generally very strong, and clearly show that the metabolic process under study is important in lamellocyte immune function.

      Previous weaknesses:

      The previous version of the manuscript contained RNAseq data that were inadequately explained. In this version, the treatment and representation of these data are significantly improved, such that they no longer represent a significant weakness. This version also contains increased evidence that SAM transmethylation is directly required for encapsulation.

    1. Reviewer #2 (Public review):

      Summary:

      Wang et al. developed a set of optical sensors to monitor Rab protein activity. Their investigation into Rab activity in dendritic spines during structural long-term plasticity (sLTP) revealed sustained Rab10 inactivation (>30min) and transient Rab4 activation (~5 min). Through pharmacological and genetic manipulation to constitutively activate or inhibit Rab proteins, the authors discovered that Rab10 negatively regulates sLTP and AMPA receptor trafficking, while Rab4 positively influences sLTP but only during the transient phase. These optical sensors provide new tools for studying Rab activity in cell biology and neurobiology. The distinct kinetics and functions of Rab proteins are important for understanding synaptic plasticity. However, there are some concerns regarding result inconsistencies within this manuscript and with prior work.

      Strengths:

      (1) The introduction of a series of novel sensors that can address numerous questions in Rab biology.<br /> (2) The use of multiple methods to manipulate Rab proteins to reveal the roles of Rab10 and Rab4 in LTP.<br /> (3) The discovery of Rab4 activation and Rab10 inhibition with different kinetics during sLTP, correlating with their functional roles in the transient (Rab4) and both transient and sustained (Rab10) phases of sLTP.

      Weaknesses:

      (1) The discrepancy between spine phenotype and sLTP potential with Rab10 perturbation remains unexplained (refer to previous Weakness #4). The basal state is the outcome of many activity-dependent processes that are physiologically relevant. It is also unclear why different preparations would yield different results. These can be experimentally addressed, and it is at least important to highlight and discuss the discrepancies.<br /> (2) In the response, the authors estimated that the bleed-through from mEGFP-Rab is ~3% and the red channel signal from FRET changes is ~20%. The context of these percentages is unclear. Are they percentages of the total signal in the red channel, or does 3% refer to 3% of the green channel signal? Additionally, there is no explanation of how these numbers were estimated.<br /> (3) The changes in the fEPSP slope in response to theta burst stimulation (a decrease followed by a gradual increase) differ from prior publications (e.g. PMID: 1359925, 3967730, 19144965, 20016099). The explanation of these differences due to different conditions in response to Reviewer's recommendation #6 does not seem sufficient.

    1. Reviewer #2 (Public review):

      Summary:

      The present study by Le Gac et al. investigates the vasoconstriction of cerebral arteries during neurovascular coupling. It proposes that pyramidal neurons firing at high frequency lead to prostaglandin E2 (PGE2) release and activation of arteriolar EP1 and EP3 receptors, causing smooth muscle cell contraction. The authors further claim that interneurons and astrocytes also contribute to the vasoconstriction via neuropeptide Y (NPY) and 20-hydroxyeicosatetraenoic acid (20-HETE) release, respectively. The study mainly uses brain slices and pharmacological tools in combination with Emx1-Cre;Ai32 transgenic mice expressing the H134R variant of channelrhodopsin-2 (ChR2) in the cortical glutamatergic neurons for precise photoactivation. Stimulation with 470 nm light using 10-second trains of 5-ms pulses at frequencies from 1-20 Hz revealed small constrictions at 10 Hz and robust constrictions at 20 Hz, which were abolished by TTX and partially inhibited by a cocktail of glutamate receptor antagonists. Inhibition of cyclooxygenase-1 (COX-1) or -2 (COX-2) by indomethacin blocked the constriction both ex vivo (slices) and in vivo (pial artery), and inhibition of EP1 and EP3 showed the same effect ex vivo. Single-cell RT-PCR from patched neurons confirmed the presence of the PGE2 synthesis pathway. While the data are convincing, the overall experimental setting presents some limitations. How is the activation protocol comparable to physiological firing frequency? The delay (minutes) between the stimulation and the constriction appears contradictory to the proposed pathway, which would be expected to occur rapidly. The experiments are conducted in the absence of vascular "tone," which further questions the significance of the findings. Some of the targets investigated are expressed by multiple cell types, which makes the interpretation difficult; for example, cyclooxygenases are also expressed by endothelial cells. Finally, how is the complete inhibition of the constriction by the NPY Y1 receptor antagonist BIBP3226 consistent with a direct effect of PGE2 and 20-HETE in arterioles? Overall, the manuscript is well-written with clear data, but the interpretation and physiological relevance have some limitations. However, vasoconstriction is a rather understudied phenomenon in neurovascular coupling, and the present findings may be of significance in the context of pathological brain hypoperfusion.

    1. Reviewer #3 (Public review):

      Summary:

      Most previous studies have focused on the contributions of Abeta and amyloid plaques in the neuronal degeneration associated with Alzheimer's disease, especially in the context of impaired synaptic transmission and plasticity which underlies the impaired cognitive functions, a hallmark in AD. But processes independent of Abeta and plaques are much less explored, and to some extent, the contributions of these processes are less well understood. Luo et all addressed this important question with an array of approaches, and their findings generally support the contribution of beta-CTF-dependent but non-Abeta dependent process to the impaired synaptic properties in the neurons. Interestingly, the above process appears to operate in a cell-autonomous manner. This cell-autonomous effect of beta-CTF as reported here may facilitate our understanding of some potential important cellular processes related to neurodegeneration. Although these findings are valuable, it is key to understand the probability of this process occurring in a more natural condition, such as when this process occurring in many neurons at the same time. This will put the authors' findings into a context for a better understanding of their contribution to either physiological or pathological processes, such as Alzheimer's. The experiments and results using cell system are quite solid, but the in vivo results are incomplete and hence less convincing (see below). The mechanistic analysis is interesting but primitive, and does not add much more weight to the significance. Hence, further efforts from the authors are required to clarify, and solidify their results, in order to provide a complete picture and support for the authors' conclusions.

      Strengths:

      (1) The authors have addressed an interesting and potentially important question<br /> (2) The analysis using the cell system are solid and provides strong support for the authors' major conclusions. This analysis has used various technical approaches to support the authors' conclusions from different aspects and most of these results are consistent with each other.

      Weaknesses:

      (1) The relevance of the authors' major findings to the pathology, especially the Abeta-dependent processes is less clear, and hence the importance of these findings may be limited.<br /> (2) In vivo analysis is incomplete, with certain caveats in the experimental procedures and some of the results need to be further explored to confirm the findings.<br /> (3) The mechanistic analysis is rather primitive and does not add further significance.

      Comments on revisions:

      The authors have satisfactorily addressed my main questions.

    1. Reviewer #2 (Public review):

      Summary:

      Disruption of the nicotinamide adenine dinucleotide (NAD) de novo Synthesis Pathway, by which L-tryptophan is converted to NAD results in multi-organ malformations which collectively has been termed Congenital NAD Deficiency Disorder (CNDD).

      While NAD de novo synthesis is primarily active in the liver postnatally, the site of activity prior to and during organogenesis is unknown. However, mouse embryos are susceptible to CNDD between E7.5-E12.5, before the embryo has developed a functional liver. Therefore, NAD de novo synthesis is likely active in another cell or tissue during this time window of susceptibility.

      The body of work presented in this paper continues the corresponding author's labs investigation of the cause and effects of NAD Deficiency and the primary goal was to determine the cell or tissue responsible for NAD de novo synthesis during early embryogenesis.

      The authors conclude that visceral yolk sac endoderm is the source of NAD de novo synthesis, which is essential for mouse embryonic development, and furthermore that the dynamics of NAD synthesis are conserved in human equivalent cells and tissues, the perturbation of which results in CNDD.

      Strengths:

      Overall, the primary findings regarding the source of NAD synthesis, the temporal requirement and conservation between rodent and human species is quite novel and important for our understanding of NAD synthesis and function and role in CNDD.

      The authors used UHPLC-MS/MS to quantify NAD+ and NAD-related metabolites and showed convincingly that the NAD salvage pathway can compensate for the loss of NAD synthesis in Haao-/- embryos, then determined that Haao activity was present in the yolk sac prior to hepatic development identifying this organ as the site of de novo NAD synthesis. Dietary modulation between E7.5-10.5 was sufficient to induce CNDD phenotypes, narrowing the window of susceptibility, and then re-analysis of RNA-seq datasets suggested the endoderm was the cell source of NAD synthesis.

      Weaknesses:

      Page 4 and Table S4. The descriptors for malformations of organs such as the kidney and vertebrae are quite vague and uninformative. More specific details are required to convey the type and range of anomalies observed as a consequence of NAD deficiency.

      Can the authors define whether the role for the NAD pathway in a couple of tissue or organ systems is the same. By this I mean is the molecular or cellular effect of NAD deficiency the same in the vertebrae and organs such as the kidney. What unifies the effects on these specific tissues and organs and are all tissues and organs affected. If some are not, can the authors explain why they escape the need for the NAD pathway.

      Page 5 and Figure 6C. The expectation and conclusion for whether specific genes are expressed in particular cell types in scRNA-seq datasets depends on number of cells sequenced, the technology (methodology) used, the depth of sequencing and also the resolution of the analysis. It is therefore essential to perform secondary validation of the analysis of scRNA-seq data. At a minimum, the authors should perform in situ hybridization or immunostaining for Tdo2, Afmid, Kmo, Kynu, Haao, Qprt and Nadsyn1 or some combination thereof at multiple time points during early mouse embryogenesis to truly understand the spatiotemporal dynamics of expression and NAD synthesis.

      Absolute functional proof of the yolk sac endoderm as being essential and required for NAD synthesis in the context of CNDD might require conditional deletion of Haao in the yolk sac versus embryo using appropriate Cre driver lines or in the absence of a conditional allele, could be performed by tetraploid embryo-ES cell complementation approaches. But temporal dietary intervention can also approximate the same thing by perturbing NAD synthesis then the yolk sac is the primary source versus when the liver becomes the primary source in the embryo.

      In further revisions, the authors have added data to Supp Table 4 and Supplemental Figures 1 and 2

      Although the authors did not perform in situ hybridization for some of the genes requested to define the critical cell type of expression, available scRNA-sequencing suggests the yolk sac endoderm are the only likely source of NAD synthesis prior to its synthesis in the liver. Absolute functional proof of the yolk sac endoderm as being essential and required for NAD synthesis in the context of CNDD still requires validation but nonetheless it seems likely given the absence of a functional liver in embryos prior to E12.5. The authors provided some additional data pertaining to the type of kidney and vertebral anomalies observed which makes this data more complete.

    1. Reviewer #2 (Public review):

      Brickwedde et al. investigate the role of alpha oscillations in allocating intermodal attention. A first EEG study is followed up with a MEG study that largely replicates the pattern of results (with small to be expected differences). They conclude that a brief increase in the amplitude of auditory and visual stimulus-driven continuous (steady-state) brain responses prior to the presentation of an auditory - but not visual - target speaks to the modulating role of alpha that leads them to revise a prevalent model of gating-by-inhibition.

      Overall, this is an interesting study on a timely question, conducted with methods and analysis that are state-of-the-art. I am particularly impressed by the author's decision to replicate the earlier EEG experiment in MEG following the reviewer's comments on the original submission. Evidently, great care was taken to accommodate the reviewer's suggestions.

      Nevertheless, I am struggling with the report for two main reasons: It is difficult to follow the rationale of the study, due to structural issues with the narrative and missing information or justifications for design and analysis decisions, and I am not convinced that the evidence is strong, or even relevant enough for revising the mentioned alpha inhibition theory. Both points are detailed further below.

      Strength/relevance of evidence for model revision: The main argument rests on 1) a rather sustained alpha effect following the modality cue, 2) a rather transient effect on steady-state responses just before the expected presentation of a stimulus, and 3) a correlation between those two. Wouldn't the authors expect a sustained effect on sensory processing, as measured by steady-state amplitude irrespective of which of the scenarios described in Figure 1A (original vs revised alpha inhibition theory) applies? Also, doesn't this speak to the role of expectation effects due to consistent stimulus timing? An alternative explanation for the results may look like this: Modality-general increased steady-state responses prior to the expected audio stimulus onset are due to increased attention/vigilance. This effect may be exclusive (or more pronounced) in the attend-audio condition due to higher precision in temporal processing in the auditory sense or, vice versa, too smeared in time due to the inferior temporal resolution of visual processing for the attend-vision condition to be picked up consistently. As expectation effects will build up over the course of the experiment, i.e., while the participant is learning about the consistent stimulus timing, the correlation with alpha power may then be explained by a similar but potentially unrelated increase in alpha power over time.

      Structural issues with the narrative and missing information: Here, I am mostly concerned with how this makes the research difficult to access for the reader. I list the major points below:

      In the introduction the authors pit the original idea about alpha's role in gating against some recent contradictory results. If it's the aim of the study to provide evidence for either/or, predictions for the results from each perspective are missing. Also, it remains unclear how this relates to the distinction between original vs revised alpha inhibition theory (Fig. 1A). Relatedly if this revision is an outcome rather than a postulation for this study, it shouldn't be featured in the first figure.

      The analysis of the intermodulation frequency makes a surprise entrance at the end of the Results section without an introduction as to its relevance for the study. This is provided only in the discussion, but with reference to multisensory integration, whereas the main focus of the study is focussed attention on one sense. (Relatedly, the reference to "theta oscillations" in this sections seems unclear without a reference to the overlapping frequency range, and potentially more explanation.) Overall, if there's no immediate relevance to this analysis, I would suggest removing it.

    1. Reviewer #2 (Public review):

      Summary:

      The authors have used the UK Biobank data to interrogate the association between plasma metabolites and glaucoma.

      (1) They initially assessed plasma metabolites as predictors of glaucoma: The addition of NMR-derived metabolomic data to existing models containing clinical and genetic data was marginal.

      (2) They then determined whether certain metabolites might protect against glaucoma in individuals at high genetic risk: Certain molecules in bioenergetic pathways (lactate, pyruvate, and citrate) conferred protection.

      (3) They provide support for protection conferred by pyruvate in a murine model.

      Strengths:

      (1) The huge sample size supports a powerful statistical analysis and the opportunity for the inclusion of multiple covariates and interactions without overfitting the models.

      (2) The authors have constructed a robust methodology and statistical design.

      (3) The manuscript is well written, and the study is logically presented.

      (4) The figures are of good quality.

      (5) Broadly, the conclusions are justified by the findings.

      Weaknesses:

      (1) Although it is an invaluable treasure trove of data, selection bias and self-reporting are inescapable problems when using the UK Biobank data for glaucoma research. The high-impact glaucoma-related GWAS publications (references 26 and 27) referenced in support of the method suffer the same limitations. This doesn't negate the conclusions but must be taken into consideration. The authors might note that it is somewhat reassuring that the proportion of glaucoma cases (4%) is close to what would be expected in a population-based study of 40-69-year-olds of predominantly white ethnicity.

      (2) As noted by the authors, a limitation is the predominantly white ethnicity profile that comprises the UK Biobank.

      (3) Also as noted by the authors, the study is cross-sectional and is limited by the "correlation does not imply causation" issue.

      (4) The optimal collection, transport, and processing of the samples for NMR metabolite analysis is critical for accurate results. Strict policies were in place for these procedures, but deviations from protocol remain an unknown influence on the data.

      (5) In addition, all UK Biobank blood samples had unintended dilution during the initial sample storage process at UK Biobank facilities. (Julkunen, H. et al. Atlas of plasma NMR biomarkers for health and disease in 118,461 individuals from the UK Biobank. Nat Commun 14, 604 (2023) Samples from aliquot 3, used for the NMR measurements, suffered from 5-10% dilution. (Allen, Naomi E., et al. Wellcome Open Research 5 (2021): 222.) Julkunen et al. report that "The dilution is believed to come from mixing of participant samples with water due to seals that failed to hold a system vacuum in the automated liquid handling systems. While this issue is likely to have an impact on some of the absolute biomarker concentration values, it is expected to have limited impact on most epidemiological analyses."

      Impact:

      The findings advance personalized prognostics for glaucoma that combine metabolomic and genetic data. In addition, the protective effect of certain metabolites influences further research on novel therapeutic strategies.

    1. Reviewer #2 (Public review):

      Summary:

      This paper investigates the neuronal encoding of the relationship between head and body orientations in the brain. Specifically, the authors focus on the angular relationship between the head and body by employing virtual avatars. Neuronal responses were recorded electrophysiologically from two fMRI-defined areas in the superior temporal sulcus and analyzed using decoding methods. They found that: (1) anterior STS neurons encode head-body angle configurations; (2) these neurons distinguish aligned and opposite head-body configurations effectively, whereas mirror-symmetric configurations are more difficult to differentiate; and (3) an upside-down inversion diminishes the encoding of head-body angles. These findings advance our understanding of how visual perception of individuals is mediated, providing a fundamental clue as to how the primate brain processes the relationship between head and body - a process that is crucial for social communication.

      Strengths:

      The paper is clearly written, and the experimental design is thoughtfully constructed and detailed. The use of electrophysiological recordings from fMRI-defined areas elucidated the mechanism of head-body angle encoding at the level of local neuronal populations. Multiple experiments, control conditions, and detailed analyses thoroughly examined various factors that could affect the decoding results. The decoding methods effectively and consistently revealed the encoding of head-body angles in the anterior STS neurons. Consequently, this study offers valuable insights into the neuronal mechanisms underlying our capacity to integrate head and body cues for social cognition-a topic that is likely to captivate readers in this field.

      Weaknesses:

      I did not identify any major weaknesses in this paper; I only have a few minor comments and suggestions to enhance clarity and further strengthen the manuscript, as detailed in the Private Recommendations section.

    1. Reviewer #2 (Public review):

      Summary:

      The work seeks to improve the detection of RNA m6A modifications using Nanopore sequencing through improvements in raw data analysis. These improvements are said to be in the segmentation of the raw data, although the work appears to position the alignment of raw data to the reference sequence and some further processing as part of the segmentation, and result statistics are mostly shown on the 'data-assigned-to-kmer' level.

      As such, the title, abstract, and introduction stating the improvement of just the 'segmentation' does not seem to match the work the manuscript actually presents, as the wording seems a bit too limited for the work involved.

      The work itself shows minor improvements in m6Anet when replacing Nanopolish eventalign with this new approach, but clear improvements in the distributions of data assigned per kmer. However, these assignments were improved well enough to enable m6A calling from them directly, both at site-level and at read-level.

      Strengths:

      A large part of the improvements shown appear to stem from the addition of extra, non-base/kmer specific, states in the segmentation/assignment of the raw data, removing a significant portion of what can be considered technical noise for further analysis. Previous methods enforced the assignment of all raw data, forcing a technically optimal alignment that may lead to suboptimal results in downstream processing as data points could be assigned to neighbouring kmers instead, while random noise that is assigned to the correct kmer may also lead to errors in modification detection.

      For an optimal alignment between the raw signal and the reference sequence, this approach may yield improvements for downstream processing using other tools.<br /> Additionally, the GMM used for calling the m6A modifications provides a useful, simple, and understandable logic to explain the reason a modification was called, as opposed to the black models that are nowadays often employed for these types of tasks.

      Weaknesses:

      The work seems limited in applicability largely due to the focus on the R9's 5mer models. The R9 flow cells are phased out and not available to buy anymore. Instead, the R10 flow cells with larger kmer models are the new standard, and the applicability of this tool on such data is not shown. We may expect similar behaviour from the raw sequencing data where the noise and transition states are still helpful, but the increased kmer size introduces a large amount of extra computing required to process data and without knowledge of how SegPore scales, it is difficult to tell how useful it will really be. The discussion suggests possible accuracy improvements moving to 7mers or 9mers, but no reason why this was not attempted.

      The manuscript suggests the eventalign results are improved compared to Nanopolish. While this is believably shown to be true (Table 1), the effect on the use case presented, downstream differentiation between modified and unmodified status on a base/kmer, is likely limited as during actual modification calling the noisy distributions are usually 'good enough', and not skewed significantly in one direction to really affect the results too terribly.

      Furthermore, looking at alternative approaches where this kind of segmentation could be applied, Nanopolish uses the main segmentation+alignment for a first alignment and follows up with a form of targeted local realignment/HMM test for modification calling (and for training too), decreasing the need for the near-perfect segmentation+alignment this work attempts to provide. Any tool applying a similar strategy probably largely negates the problems this manuscript aims to improve upon.

      Finally, in the segmentation/alignment comparison to Nanopolish, the latter was not fitted(/trained) on the same data but appears to use the pre-trained model it comes with. For the sake of comparing segmentation/alignment quality directly, fitting Nanopolish on the same data used for SegPore could remove the influences of using different training datasets and focus on differences stemming from the algorithm itself.

      Appraisal:

      The authors have shown their method's ability to identify noise in the raw signal and remove their values from the segmentation and alignment, reducing its influences for further analyses. Figures directly comparing the values per kmer do show a visibly improved assignment of raw data per kmer. As a replacement for Nanopolish eventalign it seems to have a rather limited, but improved effect, on m6Anet results. At the single read level modification modification calling this work does appear to improve upon CHEUI.

      Impact:

      With the current developments for Nanopore-based modification largely focusing on Artificial Intelligence, Neural Networks, and the like, improvements made in interpretable approaches provide an important alternative that enables a deeper understanding of the data rather than providing a tool that plainly answers the question of whether a base is modified or not, without further explanation. The work presented is best viewed in the context of a workflow where one aims to get an optimal alignment between raw signal data and the reference base sequence for further processing. For example, as presented, as a possible replacement for Nanopolish eventalign. Here it might enable data exploration and downstream modification calling without the need for local realignments or other approaches that re-consider the distribution of raw data around the target motif, such as a 'local' Hidden Markov Model or Neural Networks. These possibilities are useful for a deeper understanding of the data and further tool development for modification detection works beyond m6A calling.

    1. Reviewer #2 (Public review):

      The authors address the question of differences in the development of the central complex (Cx), a brain structure mainly controlling spatial orientation and locomotion in insects, which can be traced back to the neuroblast lineages that produce the Cx structure. The lineages are called type-II neuroblast (NB) lineages and assumed to be conserved in insects. While Tribolium castaneum produces a functional larval Cx that only consists of one part of the adult Cx structure, the fan-shaped body, in Drosophila melanogaster a non-functional neuropile primordium is formed by neurons produced by the embryonic type-II NBs which then enter a dormant state and continue development in late larval and pupal stages.

      The authors present a meticulous study demonstrating that type-II neuroblast (NB) lineages are indeed present in the developing brain of Tribolium castaneum. In contrast to type-I NB lineages, type-II NBs produce additional intermediate progenitors. The authors generate a fluorescent enhancer trap line called fez/earmuff which prominently labels the mushroom bodies but also the intermediate progenitors (INPs) of the type-II NB lineages. This is convincingly demonstrated by high resolution images that show cellular staining next to large pointed labelled cells, a marker for type-II NBs in Drosophila melanogaster. Using these and other markers (e.g. deadpan, asense), the authors show that the cell type composition and embryonic development of the type-II NB lineages are similar to their counterparts in Drosophila melanogaster. Furthermore, the expression of the Drosophila type-II NB lineage markers six3 and six4 in subsets of the Tribolium type-II NB lineages (anterior 1-4 and 1-6 type-II NB lineages) and the expression of the Cx marker skh in the distal part of most of the lineages provide further evidence that the identified NB lineages are equivalent to the Drosophila lineages that establish the central complex. However, in contrast to Drosophila, there are 9 instead of 8 embryonic type-II NB lineages per brain hemisphere and the lineages contain more progenitor cells compared to the Drosophila lineages. The authors argue that the higher number of dividing progenitor cells supports the earlier development of a functional Cx in Tribolium.

      While the manuscript clearly shows that type-II NB lineages similar to Drosophila exist in Tribolium, it does not establish a direct link between the characteristics of these lineages and a functional larval Cx in Tribolium, i.e., it does not identify the cause of the heterochronic development of the Cx in these insects. However, the detailed study lays the foundation for lineage tracing and gene function experiments that will elucidate if the higher number of Tribolium type-II NB lineage progenitors, the additional lineage and the timing of developmental progression of the progenitors can indeed be linked with the earlier function of the Cx and/or if other components are required for establishing the functional larval neural circuits in Tribolium such as e.g. larval born neurons as is the case in Drosophila.

    1. Reviewer #3 (Public review):

      Summary:

      This study employs an optogenetics approach aimed at activating oncogene (KRASG12V) expression in a single somatic cell, with a focus on following the progression of activated cell to examine tumourigenesis probabilities under altered tissue environments. The research explores the role of stemness factors (VENTX/NANOG/OCT4) in facilitating oncogenic RAS (KRASG12V)-driven malignant transformations. Although the evidence provided is incomplete, the authors propose an important mechanism whereby reactivation of re-programming factors correlates with the increased likelihood of a mutant cell undergoing malignant transformation.

      Strengths:

      · Innovative Use of Optogenetics: The application of optogenetics for precise activation of KRAS in a single cell is valuable to the field of cancer biology, offering an opportunity to uncover insight into cellular responses to oncogenic mutations.<br /> · Important Observations: The findings concerning stemness factors' role in promoting oncogenic transformation are important, contributing data to the field of cancer biology.

      Weaknesses:

      Lack of Methodological Clarity: The manuscript lacks detailed descriptions of methodologies, making it difficult to fully evaluate the experimental design and reproducibility, rendering incomplete evidence to support the conclusion. Improving methodological transparency and data presentation will crucially strengthen the paper's contributions to understanding the complex processes of tumorigenesis.

      Sub-optimal Data Presentation and Quality:<br /> The resolution of images through-out the manuscript are too low. Images presented in Figure 2 and Figure 4 are of very low resolution. It is very hard to distinguish individual cells and in which tissue they might reside.<br /> Lack of quantitative data and control condition data obtained from images of higher magnification limits the ability to robustly support the conclusions.

      Here are some details:<br /> · Tissue specificity of the cells express KRASG12V oncogene: In this study, the ubiquitin promoter was used to drive oncogenic KRASG12V expression. Despite this, the authors claim to activate KRAS in a single brain cell based on their localized photo-activation strategy. However, upon reviewing the methods section, the description was provided that 'Localized uncaging was performed by illumination for 7 minutes on a Nikon Ti microscope equipped with a light source peaking at 405 nm, Figure 1. The size of the uncaging region was controlled by an iris that defines a circular illumination with a diameter of approximately 80 μm.' It is surprising that an epi-fluorescent microscope with an illumination diameter of around 80μm can induce activation in a single brain cell beneath skin tissue. Additionally, given that the half-life for mTFP maturation is around 60 minutes, it is likely that more cells from a variety of different lineages could be activated, but the fluorescence would not be visible until more than 1-hour post-illumination. Authors might want to provide more evidence to support their claim on the single cell KRAS activation.<br /> · Stability of cCYC: The manuscript does not provide information on the half-life and stability of cCYC. Understanding these properties is crucial for evaluating the system's reliability and the likelihood of leakiness, which could significantly influence the study's outcomes.<br /> · Metastatic Dissemination claim: Typically, metastatic cancer cells migrate to and proliferate within specific niches that are conducive to outgrowth, such as the caudal hematopoietic tissue (CHT) or liver. In Figure 3 A, an image showing the presence of mTFP expressing cells in both the head and tail regions of the larva, with additional positive dots located at the fin fold. This is interpreted as "metastasis" by the authors. However, the absence of supportive cellular compartment within the fin-fold tissue makes the presence of mTFP-positive metastatic cells there particularly puzzling. This distribution raises concerns about the spatial specificity of the optogenetic activation protocol.<br /> The unexpected locations of these signals suggest potential ectopic activation of the KRAS oncogene, which could be occurring alongside or instead of targeted activation. This issue is critical as it could affect the interpretation of whether the observed mTFP signal expansion over time is due to actual cell proliferation and infiltration, or merely a result of ectopic RAS transgene activation.<br /> · Image Resolution Concerns: The cells depicted in Figure 3C β, which appear to be near the surface of the yolk sac and not within the digestive system as suggested in the MS, underscore the necessity for higher-resolution imaging. Without clearer images, it is challenging to ascertain the exact locations and states of these cells, thus complicating the assessment of experimental results.<br /> · The cell transplantation experiment is lacking protocol details: The manuscript does not adequately describe the experimental protocols used for cell transplantation, particularly concerning the origin and selection of cells used for injection into individual larvae. This omission makes it difficult to evaluate the reliability and reproducibility of the results. Such as the source of transplanted cells:<br /> • If the cells are derived from hyperplastic growths in larvae where RAS and VX (presumably VENTX) were locally activated, the manuscript fails to mention any use of fluorescence-activated cell sorting (FACS) to enrich mTFP-positive cells. Such a method would be crucial for ensuring the specificity of the cells being studied and the validity of the results.<br /> • If the cells are obtained from whole larvae with induced RAS + VX expression, it is notable and somewhat surprising that the larvae survived up to six days post-induction (6dpi) before cells were harvested for transplantation. This survival rate and the subsequent ability to obtain single cell suspensions raise questions about the heterogeneity of the RAS + VX expressing cells that transplanted.<br /> · Unclear Experimental Conditions in Figure S3B: The images in Figure S3B lack crucial details about the experimental conditions. It is not specified whether the activation of KRAS was targeted to specific cells or involved whole-body exposure. This information is essential for interpreting the scope and implications of the results accurately.<br /> · Contrasting Data in Figure S3C compared to literatures: The graph in Figure S3C indicates that KRAS or KRAS + DEX induction did not result in any form of hyperplastic growth. This observation starkly contrasts with previous literature where oncogenic KRAS expression in zebrafish led to significant hyper-proliferation and abnormal growth, as evidenced by studies such as those published in and Neoplasia (2018), DOI: 10.1016/j.neo.2018.10.002; Molecular Cancer (2015), DOI: 10.1186/s12943-015-0288-2; Disease Models & Mechanisms (2014) DOI: 10.1242/dmm.007831. The lack of expected hyperplasia raises questions about the experimental setup or the specific conditions under which KRAS was expressed. The authors should provide detailed descriptions of the conditions under which the experiments were conducted in Figure S3B and clarifying the reasons for the discrepancies observed in Figure S3C are crucial. The authors should discuss potential reasons for the deviation from previous reports.<br /> Further comments:<br /> Throughout the study, KRAS-activated cell expansion and metastasis are two key phenotypes discussed that Ventx is promoting. However, the authors did not perform any experiments to directly show that KRAS+ cells proliferate only in Ventx-activated conditions. The authors also did not show any morphological features or time-lapse videos demonstrating that KRAS+ cells are motile, even though zebrafish is an excellent model for in vivo live imaging. This seems to be a missed opportunity for providing convincing evidence to support the authors' conclusions.<br /> There were minimal experimental details provided for the qPCR data presented in the supplementary figures S5 and S6, therefore, it is hard to evaluate results obtained.

    1. Reviewer #2 (Public review):

      Summary:

      Lai and collaborators use a previously published RNAseq dataset derived from an experimental evolution set up to compare the pleiotropic properties of genes which expression evolved in response to fluctuating temperature for over 100 generations. The authors correlate gene pleiotropy with the degree of parallelisms in the experimental evolution set up to ask: are genes that evolved in multiple replicates more or less pleiotropic?

      They find that, maybe counter to expectation, highly pleiotropic genes show more replicated evolution. And such effect seems to be driven by direct effects (which the authors can only speculate on) and indirect effect through low variance in pleiotropic genes (which the authors indirectly link to genetic variation underlying gene expression variance).

      Weaknesses:

      The results offer new insights into the evolution of gene expression and into the parameters that constrain such evolution, i.e., pleiotropy. Although the conclusions are supported by the data, I find the interpretation of the results a little bit complicated.

      Major comment:

      The major point I ask the authors to address is whether the connection between polygenic adaptation and parallelism can indeed be used to interpret gene expression parallelism. If the answer is not, please rephrase the introduction and discussion, if the answer is yes, please make it explicit in the text why it is so.

      The authors argument: parallelism in gene expression is the same as parallelism in SNP allele frequency (AFC) (see L389-383 here they don't mention that this explanation is derived from SNP parallelism and not trait parallelism, and see Fig1 b). In previous publications the authors have explained the low level of AFC parallelism using a polygenic argument. Polygenic traits can reach a new trait optimum via multiple SNPs and therefore although the trait is parallel across replicates, the SNPs are not necessarily so.

      In the current paper, they seem to be exchanging SNP AFC by gene expression, and to me, those are two levels that cannot be interchanged. Gene expression is a trait, not a SNP, and therefore the fact that a gene expression doesn't replicate cannot be explained by polygenic basis, because again the trait is gene expression itself. And, actually the results of the simulations show that high polygenicity = less trait parallelism (Fig4).

      Now, if the authors focus on high parallel genes (present in e.g. 7 or more replicates) and they show that the eQTLs for those genes are many (highly polygenic) and the AFC of those eQTL are not parallel, then I would agree with the interpretation. But, given that here they just assess gene expression and not eQTL AFC, I do not think they can use the 'highly polygenic = low parallelism' explanation.

      The interpretation of the results to me, should be limited to: genes with low variance and high pleiotropy tend to be more parallel, and the explanation might be synergistic pleiotropy.

      Comments on revisions: The authors didn't really address any of the comments made by any of the reviewers - basically nothing was changed in the main text. Therefore, I leave my original review unchanged.

    1. Reviewer #2 (Public review):

      Summary:

      The present manuscript addresses a longstanding challenge in neuroscience: how the brain assigns credit for delayed outcomes, especially in real-world learning scenarios where decisions and outcomes are separated by time. The authors focus on the lateral orbitofrontal cortex and hippocampus, key regions involved in contingent learning. By integrating fMRI data and behavioral tasks, the authors examined how neural circuits maintain a causal link between past decisions and delayed outcomes. Their findings offer insights into mechanisms that could have critical implications for understanding human decision-making.

      Strengths:

      - The experimental designs were extremely well thought-out. The authors successfully coupled behavioral data and neural measures (through fMRI) to explore the neural mechanisms of contingent learning. This integration adds robustness to the findings and strengthens their relevance.<br /> - The emphasis on the interaction between the lateral orbitofrontal cortex (lOFC) and hippocampus (HC) in this study is very well-targeted. The reported findings regarding their dynamic interactions provide valuable insights into contingent learning in humans.<br /> - The use of advanced modeling framework and analytical techniques allowed the authors to uncover new mechanistic insights regarding a complex case of decision-making process. The methods developed will also benefit analyses of future neuroimaging data on a range of decision-making tasks as well.

      Weaknesses:

      - Given the limited temporal resolution of fMRI and that the measured signal is an indirect measure of neural activity, it is unclear the extent to which the reported causality reflects the true relationship/interactions between neurons in different regions. That said, I believe this concern is minimized by a series of well-thought-out and robust analyses which consistently point to compelling results.

      Comments on revisions:

      Thank you for your thorough point-by-point responses to my comments and questions. After carefully reviewing the responses and additional analyses/results provided, I do not have further comments. Importantly, I believe the authors have done a great job addressing inevitable limitations that are inherent to fMRI signals. The thoughtful analyses used in the study combined with the timely questions the manuscript is able to address make the study an important contribution to the field.

    1. Reviewer #2 (Public review):

      Summary:

      The authors aimed to characterize the cellular phenotype and spatial relationship of cell types infiltrating the islets of Langerhans in human T1D using CODEX, a multiplexed examination of cellular markers

      Strengths:

      Major strengths of this study are the use of pancreas tissue from well-characterized tissue donors, the use of CODEX, a state-of-the-art detection technique of extensive characterization and spatial characterization of cell types and cellular interactions. The authors have achieved their aims with the identification of the heterogeneity of the CD8+ T cell populations in insulitis, the identification of a vasculature phenotype and other markers that may mark insulitis-prone islets, and characterization of tertiary lymphoid structures in the acinar tissue of the pancreas. These findings are very likely to have a positive impact on our understanding (conceptual advance) of the cellular factors involved in T1D pathogenesis which the field requires to make progress in therapeutics.

      Weaknesses:

      A major limitation of the study is the cohort size, which the authors directly state. However, this study provides avenues of inquiry for researchers to gain further understanding of the pathological process in human T1D.

      Comments on revisions:

      The authors have responded well to the 3 critiques. They have addressed my specific comments in their revised text.<br /> I have no further comments.

    1. Reviewer #2 (Public review):

      This revision has further improved the clarity of the paper, better articulating assumptions of the model and data analysis. I particularly appreciate the authors' thorough response to eLife assessment. However, the authors did not provide point-by-point response to the specific comments I had from last round of review and didn't revise the manuscript accordingly, so my major concerns remain.

      At conceptual level, my biggest concern with the model is the lack of constraint on V*(K), which makes the null neutral model too "liberal". On the one hand, the number of descendants of each gene copy must be non-negative; on the other hand, even homogenizing process within an individual is extremely strong, it cannot "spread" gene copies across individuals, so the maximum number of descendants of one gene copy cannot exceed the number of offspring that individual has times C. For these reasons, I believe there must be a theoretical upper bound of the value of V*(K), and the actual V*(K) is likely much smaller under realistic strength of the homogenizing process. When I asked about modeling of the underlying homogenizing process, I did not mean the authors need to include specific molecular process in the model; instead, I am asking the authors to provide some realistic scenarios that can give rise to very large V*(K) values. As a result of the very "liberal" neutral model, although I do agree that rejection of null provides stronger evidence for selection in human, it is unclear whether there is no evidence of selection in mouse. Please see below for my specific comments regarding the definition and assumptions of V*(K) (copied from last review).

      Regarding the data analysis, although I understand the authors' methodology and rationale behind, I am not convinced that high sequence similarity between rDNA copies guarantees no biases in alignment and variant calling. Furthermore, given divergence between species, I am particularly concerned about the practice of aligning reads of different species to human and mus musculus reference sequences. A separate issue is the calculation of divergence level. Instead of using Fst>0.8 as the criterion of calling fixed sites, the authors could calculate the pairwise average divergence between a random copy from one species and a random copy from another species. Mathematically, this could be calculated as p1(1-p2)+p2(1-p1). The observation that the estimated substitution rates for rDNA with and without CpG sites are so close seems to be an indication of technical error. Please also see below for my specific questions about data analysis (copied from last round of review).

      Specific comments from last round of review:

      Questions regarding V*(K)<br /> (1) Another key parameter V*(K) was still not defined within the paper. In response 9, the authors explained that V*(K) refers to "the number of progeny to whom the gene copy of interest is transmitted (K) over a specific time interval". However, the meaning of "progeny" remains unclear. Are the authors referring to the descendent copies of a gene copy, or the offspring individuals (i.e., the living organisms)? For example, if a variant spreads horizontally through homogenizing processes and transmits vertically to multiple offspring individuals, the number of descent gene copies could differ substantially from the number of descendent individuals to whom a gene copy is transmitted to. This distinction needs to be clarified and clearly stated in the paper.

      (2) The authors state that V*(K)>=1 for rDNA genes because of the homogenizing processes (lines 139-141) without providing justification. It is unclear, at least to me, whether homogenizing processes are expected increase or decrease the variance in "reproductive success" across gene copies. Moreover, the authors claim that V*(K) "can potentially reach values in the hundreds and may even exceed C, resulting in C*=C/V*(K)<1" (Response 7). This claim is unlikely to be true, as the minimum value of K is bounded by zero and E(K) is assumed to be 1. Even in the extreme case that 1% gene copies leave large numbers of descends while the others leave none, V*(K) would still be less than 100. Such extreme case seems highly improbable, given realistic rates of the homogenizing processes.

      (3) Regardless of how the authors define V*(K), it is not immediately clear why Equation 1 (N*=NC/V*(K)) holds. Both sides of the equation have their independent meanings, so the authors need to provide a step-by-step derivation demonstrating that they are equal. Only by doing this will the implicit underlying assumptions become clearer. I also strongly recommend that the authors conduct forward-in-time simulations with fixed N, C, V*(K) (however they define it) and μ to confirm that the right side of Equation 1 actually predicts the N* as calculated from the polymorphism level using the equation in line 165.

      Questions about Ne* for multi-copy system

      (1) While Ne is clearly defined in the standard single-copy gene model as the reciprocal of genetic drift (i.e., the decay in heterozygosity), its meaning for multiple-copy genes is unclear. Based on the context, it appears that the authors define Ne as the parameter that fits the population polymorphism level (Hs) using the equation in line 165. This definition is reasonable, but it should be explicitly clarified in the text."

      (2) Without providing justification, the authors assumed that a certain number N* exists for rRNA such that it fits both the polymorphism level (line 156) in recent timescales and divergence level in longer timescales (i.e., in the comparison between Tf and Td). However, if N, C or any other relevant parameters have varied substantially throughout evolution, N* is expected to vary with time, and the same value may not fit both polymorphism and divergence data simultaneously.

      Questions about data analysis

      (1) A significant issue with aligning reads to a single reference genome is reference bias, referring to the phenomenon that reads carrying the reference alleles tend to align more easily than those with one or more non-reference alleles, thus creating a bias in genotype calling or variant allele frequency quantification. As a result, there may be an underrepresentation of non-reference alleles in called variants or an underestimate of non-reference allele frequency, particularly in regions with high genetic diversity. Simply focusing on bi-allelic SNVs is insufficient to minimize reference bias. Given the fourfold increase in diversity within rDNA, the authors must either provide evidence that reference bias is not a significant concern or adopt graph-based reference genomes or more sophisticated alignment algorithms to address this issue.

      (2) The potential for reference bias also renders the analysis of divergence sites unreliable, as aligning reads from one species (e.g. chimpanzee) to the reference of another species (e.g., human) is likely to introduce biases in variant calling between the two. One commonly adopted approach to address this imbalance is to align reads from both species to a third reference genome that is expected to be equidistantly related to both.

      (3) Although it is somewhat reassuring that the estimated divergence rate of rDNA between human and macaque is comparable to that of the rest of the genome, there still remains concern of a under-estimation of divergence in rDNA regions due to reference bias issue. Note that while the "third genome" approach reduces imbalance between two genomes in comparison, it may still under-estimate overall divergence level due to under-calling of non-reference variants.<br /> (4) In response to my question about the similarity in rDNA substitution rates estimated with or without CpG sites, the authors suggest that this "may be due to strong homogenizing forces, which can rapidly fix or eliminate variants" (response17). However, this explanation is insufficient, because the observed substitution rate depends on the mutation rate multiplied by the fixation probability, and accelerated fixation or loss does not alter either. Unless the authors can provide more convincing explanation, technical errors in calling of fixed sites still remain a concern.

      Minor points:

      Line 157: The statement "where μ is the mutation rate of the entire gene" must be wrong, as the heterozygosity calculated with such μ would correspond to the chance of seeing two different haplotypes at gene level, which is incompatible with the empirical calculation specified in Equation 2. Instead, μ must represent the mutation rate per site averaged over the entire gene.

      In response 22, the authors explained that the allele frequency spectrum shown in Fig 3 is folded, because the ancestral allele was not determined. However, this is inconsistent with x-axis Fig 3 ranging between 0 and 1. I suspect the x-axis represents the frequency of the alternative (i.e., non-reference) allele. If so, the reported correlation is inflated, as the reference allele is somewhat random, and a variant at joint ALT allele frequencies of (0.9, 0.9) is no different from a variant at (0.1, 0.1). The proper way of calculate this correlation is to first determine the minor allele frequency across individuals and then calculate the correlation between minor allele frequencies.

      Similarly, in response 14, it is unclear what the x-axis represents. Is it the ALT allele frequency or derived allele frequency? If the former, why are only variants with AF>0.8 defined as fixed variants, while those with AF<0.2 excluded? If it is the latter, please describe how ancestral state is determined.

    1. Reviewer #2 (Public review):

      Summary:

      This theoretical paper examines genetic drift in scenarios deviating from the standard Wright-Fisher model. The authors discuss Haldane's branching process model, highlighting that the variance in reproductive success equates to genetic drift. By integrating the Wright-Fisher model with the Haldane model, the authors derive theoretical results that resolve paradoxes related to effective population size.

      Strengths:

      The most significant and compelling result from this paper is perhaps that the probability of fixing a new beneficial mutation is 2s/V(K). This is an intriguing and potentially generalizable discovery that could be applied to many different study systems.

      The authors also made a lot of effort to connect theory with various real-world examples, such as genetic diversity in sex chromosomes and reproductive variance across different species.

      Comments on previous revisions:

      The author has addressed some of the concerns in my review, and I think the revised manuscript is more clear. I like the discussion about the caveats of the WFH model.

      I hope the authors could also discuss the conditions needed for V(K)/Ne to be a reasonable approximation. It is currently unclear how the framework should be adopted in general.

      The idea about estimating male-female V(K) ratios from population genetic data is interesting. Unfortunately, the results fell short. The accuracy of their estimators (derived using approximation Ne/V(K) approximation, and certain choice of theta, and then theta estimated with Watterson's estimator) should be tested with simulated results before applying to real data. The reliability of their estimator and their results from real data are unclear.

      Arguments made in this paper sometimes lack precision (perhaps the authors want to emphasize intuition, but it seems more confusing than otherwise). For example: The authors stated that "This independence from N seems intuitively obvious: when an advantageous mutation increases to say, 100 copies in determining a population (depending mainly on s), its fixation would be almost certain, regardless of N.". Assuming large Ne, and with approximation, one could assume the probability of loss is e^(-2sn), but the writing about "100 copies" and "almost certain" is very imprecise, in fact, a mutation with s=0.001 segregating at 100 copies in a large Ne population is most probably lost. Whereas in a small population, it will be fixed. Yet the following sentence states "regardless of N. This may be a most direct argument against equating genetic drift, certainly no less important than 1/ N . with N, or Ne (which is supposed to be a function of N's)." I find this new paragraph misleading.

      Some of the statements/wordings in this paper still seem too strong to me.

      Comments on revisions:

      The authors toned down. I am a bit confused because I do not seem to find any point-to-point response to my review.

    1. Reviewer #2 (Public review):

      Summary:

      The authors used a large panel of hepatocellular carcinoma patient-derived xenograft models to test the hypothesis that the developmental dependence of the liver on Jagged1-Notch2 signaling is retained in at least a subset of hepatocellular carcinomas. This led to the identification of two models that were extraordinarily sensitive to well-characterized, specific inhibitory antibodies against Jagged1 or Notch2. Based on additional analyses in these in vivo models, the authors provide compelling evidence that the response is due to the inhibition of human Notch2 and human Jagged1 on tumor cells and that this inhibition leads to a change in gene expression from a progenitor-like state to a hepatocyte-like state accompanied by cell cycle arrest. This change in cell state is associated with up-regulation of HNF4a and CEBPB and increased accessibility of predicted HNF4a and CEBPB genomic binding sites, accompanied by loss of accessibility to sequences predicted to bind TFs linked to multipotent liver progenitors. The authors put forth a plausible model in which inhibition of Notch2 downregulates transcriptional repressors of the Hairy/Enhancer of Split family, leading to increased expression of CEBPB and changes in gene expression that drive hepatocyte differentiation.

      Strengths:

      The strengths of the paper include the breadth of the preclinical screen in PDX models (which may be of an unprecedented size as preclinical trials go), the high quality of the well-characterized antibodies used as therapeutics and as biological perturbagens, the quality of the data and data analysis, and the authors balanced discussion of the strengths and weaknesses of their findings.

      Weaknesses:

      The principal weakness is the inability to clearly demonstrate the "translatability" of the PDX findings to primary human hepatocellular carcinoma.

      Additional Comments:

      Hepatocellular carcinoma is increasing in frequency and is difficult to treat; cure is only possible through early diagnosis and surgery, often in the form of liver transplantation. It is also a common cancer, and so even if only 5% of tumors (a value based on the frequency of super-responders in this preclinical trial) fall into the Jagged1-Notch2 group defined by Seidel et al., the development of an effective therapy for this subgroup would be a very important advance. The chief limitation of their work is that it stops short of identifying primary human hepatocellular carcinomas that correspond to the super-responder PDX models. It can be hoped that their intriguing observations will spur work aimed at filling this gap

      There are several other loose ends. An unusual feature of this model is that both Jagged 1 and Notch2 are expressed in the same cells, and even in the same individual cells. In developmental systems, the expression of ligands and receptors in the same cell generally produces receptor inhibition rather than activation, a phenomenon described as cis inhibition. Their super-responder tumor models appear to break this rule, and how and why this is so remains to be understood. A follow-up question is what explains the observed heterogeneity in tumor cells, both at the level of Notch2 activation and scRNAseq clustering, and whether these different cell states are static or interchangeable.

      Another unanswered issue pertains to the nature of the tumor response to Notch signaling blockade, which appears to be mainly cell cycle arrest. There are a number of human tumors with cell autonomous Notch signaling due to gain of function Notch receptor mutations that also respond to Notch blockade with cell cycle arrest, such as T cell acute lymphoblastic leukemia (T-ALL). In general, clinical trials of pan-Notch inhibitors such as gamma-secretase inhibitors have been disappointing in such tumors, perhaps reflecting a limitation of treatments with significant toxicity that do not kill tumor cells directly. It could be argued that this limitation will be mitigated by the apparently excellent safety profile of Notch2 blocking antibody, which perhaps could be administered for a sustained period, akin to the use of tyrosine kinase inhibitors in chronic myeloid leukemia---but this remains to be determined.

      A minor comment is reserved for the statement in the discussion that "In chronic myelomonocytic leukemia, which results from an inactivating mutation in the y-secretase complex component nicastrin, Notch signaling has a tumor suppressive function, that is mediated through direct repression of CEBPA and PU.1 by HES1 (Klinakis et al., 2011)". Thousands of cases of CMML and related myeloid tumors have been subjected to whole exome and even whole genome sequencing without the identification of Notch signaling pathway mutations. Thus, an important tumor suppressive role for Notch-mediated through HES1 in myeloid tumors is not proven.

    1. Reviewer #2 (Public review):

      Summary/Significance of the findings:

      The authors have done a great job by extensively carrying out transcriptomic and epigenomic analyses in the primary human/mouse monocytes/macrophages to investigate TNF-PGE2 (TP) crosstalk and their regulation by IFN-γ in the Rheumatoid arthritis (RA) synovial macrophages. They proposed that TP induces inflammatory genes via a novel regulatory axis whereby IFN-γ and PGE2 oppose each other to determine the balance between two distinct TNF-induced inflammatory gene expression programs relevant to RA and ICI-arthritis.

      Strengths:

      The authors have done a great job on RT-qPCR analysis of gene expression in primary human monocytes stimulated with TNF and showing the selective agonists of PGE2 receptors EP2 and EP4 22 that signal predominantly via cAMP. They have beautifully shown IFN-γ opposes the effects of PGE2 on TNF-induced gene expression. They found that TP signature genes are activated by cooperation of PGE2-induced AP-1, CEBP, and NR4A with TNF-induced NF-κB activity. On the other hand, they found that IFN-γ suppressed induction of AP-1, CEBP, and NR4A activity to ablate induction of IL-1, Notch, and neutrophil chemokine genes but promoted expression of distinct inflammatory genes such as TNF and T cell chemokines like CXCL10 indicating that TP induces inflammatory genes via IFN-γ in the RA and ICI-arthritis.

      Weaknesses:

      (1) The authors carried out most of the assays in the monocytes/macrophages. How do APC-cells like Dendritic cells behave with respect to this TP treatment similar dosing?

      (2) The authors studied 3h and 24h post-treatment transcriptomic and epigenomic. What happens to TP induce inflammatory genes post-treatment 12h, 36h, 48h, 72h. It is critical to see the upregulated/downregulated genes get normalised or stay the same throughout the innate immune response.

      (3) The authors showed IL1-axis in response to the TP-treatment. Do other cytokine axes get modulated? If yes, then how do they cooperate to reduce/induce inflammatory responses along this proposed axis?

      Overall, the data looks good and acceptable but I need to confirm the above-mentioned criticisms.

    1. Reviewer #3 (Public review):

      Summary:

      Using a mouse model of Staphylococcus aureus gut colonization Lejeune et al demonstrate that the microbiome, immune system, and sex are important contributing factors for whether this important human pathogen persists in the gut. The work begins by describing differential gut clearance of S. aureus in female B6 mice bred at NYU compared to those from Jackson Laboratories (JAX). NYU female mice cleared S. aureus from the gut but NYU male mice and mice of both sexes from JAX exhibited persistent gut colonization. Further experimentation demonstrated that differences between staphylococcal gut clearance in NYU and JAX female mice were attributed to the microbiome. However, NYU male and female mice harbor similar microbiomes, supporting the conclusion that the microbiome cannot account for the observed sex-dependent clearance of S. aureus gut colonization. To identify factors responsible for female clearance of S. aureus, the authors performed RNAseq on intestinal epithelia cells and cells enriched within the lamina propria. This analysis revealed sex-dependent transcriptional responses in both tissues. Genes associated with immune cell function and migration were distinctly expressed between the sexes. To determine which immune cell types contribute to S. aureus clearance Lejeune et al employed genetic and antibody-mediated immune cell depletion. This experiment demonstrated that CD4+ IL17+ cells and neutrophils promote elimination of S. aureus from the gut. Subsequent experiments, including the use of the 'four core genotype model' were conducted to discern between the roles of sex chromosomes and sex hormones. This work demonstrated that sex-chromosome linked genes are not responsible for clearance, increasing the likelihood that hormones play a dominant role in controlling S. aureus gut colonization.

      Strengths:

      A strength of the work is the rigorous experimental design. Appropriate controls were executed and, in most cases, multiple approaches were conducted to strengthen the authors' conclusions. The conclusions are supported by the data.<br /> The following suggestions are offered to improve an already strong piece of scholarship.

      Weaknesses:

      The correlation between female sex hormones and elimination of S. aureus from the gut could be further validated by quantifying sex hormones produced in the four core genotype mice in response to colonization. Additionally, and this may not be feasible, but according to the proposed model administering female sex hormones to male mice should decrease colonization. Finally, knowing whether the quantity of IL-17a CD4+ cells change in the OVX mice has the potential to discern whether the abundance/migration of the cells or their activation is promoted by female sex hormones.

      In the Discussion the authors highlight previous work establishing a link between immune cells and sex hormone receptors, but whether the estrogen (and progesterone) receptor is differentially expressed in response to S. aureus colonization could be assessed in the RNAseq dataset. Differential expression of known X and Y chromosome linked genes were discussed but specific sex hormones or sex hormone receptors, like the estrogen receptor were not. This potential result could be highlighted.

      Comments on revisions:

      The authors have adequately addressed my comments. I have only one minor adjustment: the Esr1 mice should be included the Materials and Methods.

    1. Reviewer #2 (Public review):

      Summary:

      The study by Cao et al. highlights an interesting and important aspect of heat- and thermal biology: the effect of repetitive, long-term heat exposure and its impact on brain function.<br /> Even though peripheral, sensory temperature sensors and afferent neuronal pathways conveying acute temperature information to the CNS have been well established, it is largely unknown how persistent, long-term temperature stimuli interact with and shape CNS function, and how these thermally-induced CNS alterations modulate efferent pathways to change physiology and behavior. This study is therefore not only novel but, given global warming, also timely.

      The authors provide compelling evidence that neurons of the paraventricular thalamus change plastically over three weeks of episodic heat stimulation and they convincingly show that these changes affect behavioral outputs such as social interactions, and anxiety related behaviors.

      Strengths:

      • It is impressive that the assessed behaviors can be (i) recruited by optogenetic fiber activation and (ii) inhibited by optogenetic fiber inhibition when mice are exposed to heat. Technically, when/how long is the fiber inhibition performed? It says in the text "3 min on and 3 min off". Is this only during the 20 minutes heat stimulation or also at other times?<br /> • It is interesting that the frequency of activity in pPVT neurons, as assessed by fiber photometry, stays increased after long-term heat exposure (day 22) when mice are back at normal room temperature. This appears similar to a previous study that found long-term heat exposure to transform POA neurons plastically to become tonically active (https://www.biorxiv.org/content/10.1101/2024.08.06.606929v1 ). Interestingly, the POA neurons that become tonically active by persistent heat exposure described in the above study are largely excitatory and thus these could drive the activity of the pPVT neurons analyzed in this study.<br /> How can it be reconciled that the majority of the inputs from the POA are found to be largely inhibitory (Fig. 2H)? Is it possible that this result stems from the fact that non-selective POA-to-pPVT projections are labelled by the approach used in this study and not only those pathways activated by heat? These points would be nice to discuss.<br /> • It is very interesting that no LTP can be induced after chronic heat exposure (Fig. K-M); the authors suggest that "the pathway in these mice were already saturated" (line 375). Could this hypothesis be tested in slices by employing a protocol to extinguish pre-existing (chronic heat exposure-induced) LTP? This would provide further strength to the findings/suggestion that an important synaptic plasticity mechanism is at play that conveys behavioral changes upon chronic heat stimulation.<br /> • It is interesting that long-term heat does not increase parameters associated with depression (Fig. 1N-Q), how is it with acute heat stress, are those depression parameters increased acutely? It would be interesting to learn if "depression indicators" increase acutely but then adapt (as a consequence of heat acclimation) or if they are not changed at all and are also low during acute heat exposure.

    1. Reviewer #2 (Public review):

      Gaertner and colleagues present a study examining the transcriptomic diversity and spatial location of dopaminergic neurons from mice and examine the changes in gene expression resulting from knock in of the Parkinson's LRRK G2019S risk variant. Overall, I found the manuscript presented their study very clearly, well written with very clear figures for the most part. I am not an expert on mouse neuroanatomy but found their classification reasonably well justified and spatial orientation of dopaminergic neurons within the mouse brain informative and clear. While trends were clear and well presented, the apparent spatial heterogeneity suggests that knowledge of the functional connections and roles of these neurons will be required to better interpret the results presented but nonetheless their findings exposed significant detail that is required for further understanding.

      The study of the transcriptional effects of the LRRK2 KI was also informative and clearly framed in terms of a focused analyses on the effects of the KI only on dopaminergic neurons.

      I thank the authors for addressing my previous concerns and comments, and feel they have done so well. I agree that as GSEA only includes ranked genes from the specific study, the gene set is already limited to the relevant background.

    1. Reviewer #2 (Public review):

      Summary:

      The authors combined inhibitory neurostimulation (continuous theta-burst stimulation, cTBS) with subsequent MRI measurements to investigate the impact of inhibition of the left anterior temporal lobe (ATL) on task-related activity and performance during a semantic task and link stimulation-induced changes to the neurochemical level by including MR spectroscopy (MRS). cTBS effects in the ATL were compared with a control site in the vertex. The authors found that relative to stimulation of the vertex, cTBS significantly increased the local GABA concentration in the ATL. cTBS also decreased task-related semantic activity in the ATL and potentially delayed semantic task performance by hindering a practice effect from pre to post. Finally, pooled data with their previous MRS study suggest an inverted u-shape between GABA concentration and behavioral performance. These results help to better understand the neuromodulatory effects of non-invasive brain stimulation on task performance.

      Strengths:

      Multimodal assessment of neurostimulation effects on the behavioral, neurochemical, and neural levels. In particular, the link between GABA modulation and behavior is timely and potentially interesting.

      Weaknesses:

      The analyses are not sound. Some of the effects are very weak and not all conclusions are supported by the data since some of the comparisons are not justified. There is some redundancy with a previous paper by the same authors, so the novelty and contribution to the field are overall limited. A network approach might help here.

    1. Reviewer #2 (Public review):

      Summary:

      Fei, Lu, Shi, et al. present a thorough evaluation of the immune cell landscape in pre-eclamptic human placentas by single-cell multi-omics methodologies compared to normal control placentas. Based on their findings of elevated frequencies of inflammatory macrophages and memory-like Th17 cells, they employ adoptive cell transfer mouse models to interrogate the coordination and function of these cell types in pre-eclampsia immunopathology. They demonstrate the putative role of the IGF1-IGF1R axis as the key pathway by which inflammatory macrophages in the placenta skew CD4+ T cells towards an inflammatory IL-17A-secreting phenotype that may drive tissue damage, vascular dysfunction, and elevated blood pressure in pre-eclampsia, leaving researchers with potential translational opportunities to pursue this pathway in this indication.

      They present a major advance to the field in their profiling of human placental immune cells from pre-eclampsia patients where most extant single-cell atlases focus on term versus preterm placenta, or largely examine trophoblast biology with a much rarer subset of immune cells. While the authors present vast amounts of data at both the protein and RNA transcript level, we, the reviewers, feel this manuscript is still in need of much more clarity in its main messaging, and more discretion in including only key data that supports this main message most effectively.

      Strengths:

      (1) This study combines human and mouse analyses and allows for some amount of mechanistic insight into the role of pro-inflammatory and anti-inflammatory macrophages in the pathogenesis of pre-eclampsia (PE), and their interaction with Th17 cells.

      (2) Importantly, they do this using matched cohorts across normal pregnancy and common PE comorbidities like gestation diabetes (GDM).

      (3) The authors have developed clear translational opportunities from these "big data" studies by moving to pursue potential IGF1-based interventions.

      [Editors' note: the authors have provided responses to the previously identified weaknesses]

    1. Reviewer #2 (Public review):

      Summary:

      In this paper, the authors test whether controllability beliefs and associated actions/resource allocation are modulated by things like time, effort, and monetary costs (what they call "elastic" as opposed to "inelastic" controllability). Using a novel behavioral task and computational modeling, they find that participants do indeed modulate their resources depending on whether they are in an "elastic," "inelastic," or "low controllability" environment. The authors also find evidence that psychopathology is related to specific biases in controllability.

      Strengths:

      This research investigates how people might value different factors that contribute to controllability in a creative and thorough way. The authors use computational modeling to try to dissociate "elasticity" from "overall controllability," and find some differential associations with psychopathology. This was a convincing justification for using modeling above and beyond behavioral output and yielded interesting results. Interestingly, the authors conclude that these findings suggest that biased elasticity could distort agency beliefs via maladaptive resource allocation. Overall, this paper reveals some important findings about how people consider components of controllability.

      Weaknesses:

      The primary weakness of this research is that it is not entirely clear what is meant by "elastic" and "inelastic" and how these constructs differ from existing considerations of various factors/calculations that contribute to perceptions of and decisions about controllability. I think this weakness is primarily an issue of framing, where it's not clear whether elasticity is, in fact, theoretically dissociable from controllability. Instead, it seems that the elements that make up "elasticity" are simply some of the many calculations that contribute to controllability. In other words, an "elastic" environment is inherently more controllable than an "inelastic" one, since both environments might have the same level of predictability, but in an "elastic" environment, one can also partake in additional actions to have additional control over achieving the goal (i.e., expend effort, money, time).

    1. Reviewer #2 (Public review):

      Summary:

      Sugimoto et al. explore the relationship between glucose dynamics - specifically value, variability, and autocorrelation - and coronary plaque vulnerability in patients with varying glucose tolerance levels. The study identifies three independent predictive factors for %NC and emphasizes the use of continuous glucose monitoring (CGM)-derived indices for coronary artery disease (CAD) risk assessment. By employing robust statistical methods and validating findings across datasets from Japan, America, and China, the authors highlight the limitations of conventional markers while proposing CGM as a novel approach for risk prediction. The study has the potential to reshape CAD risk assessment by emphasizing CGM-derived indices, aligning well with personalized medicine trends.

      Strengths:

      (1) The introduction of autocorrelation as a predictive factor for plaque vulnerability adds a novel dimension to glucose dynamic analysis.

      (2) Inclusion of datasets from diverse regions enhances generalizability.

      (3) The use of a well-characterized cohort with controlled cholesterol and blood pressure levels strengthens the findings.

      (4) The focus on CGM-derived indices aligns with personalized medicine trends, showcasing the potential for CAD risk stratification.

      Weaknesses:

      (1) The link between autocorrelation and plaque vulnerability remains speculative without a proposed biological explanation.

      (2) The relatively small sample size (n=270) limits statistical power, especially when stratified by glucose tolerance levels.

      (3) Strict participant selection criteria may reduce applicability to broader populations.

      (4) CGM-derived indices like AC_Var and ADRR may be too complex for routine clinical use without simplified models or guidelines.

      (5) The study does not compare CGM-derived indices to existing advanced CAD risk models, limiting the ability to assess their true predictive superiority.

      (6) Varying CGM sampling intervals (5-minute vs. 15-minute) were not thoroughly analyzed for impact on results.

    1. Reviewer #2 (Public review):

      The authors have demonstrated the use of adenine base editors delivered via adeno-associated viruses to introduce edits in the mitochondrial genome. The manuscript describes the methodology well, and the conclusions are aptly supported by the results. It highlights the potential of these base editors to model mtDNA variations in somatic tissues in animal models.

      However, there are a few comments that need to be addressed:

      (1) Limitations of the small sample size need to be explained clearly for the results described.

      (2) It will be beneficial for the readers if some light is shed on the possible reasons why the efficiencies of adenine base editing are lower than those reported for published cytosine base editors to introduce edits in the mitochondrial DNA.

      (3) The conclusion should more explicitly address the limitations and future directions on low editing efficiency and what can be possible optimization steps.

      (4) In Figure 1, A-to-G editing for the genes Mt-Cytb, Mt-CoII, and Mt-Atp6 appears to be strand-specific for the different architectures of adenine base editors. Do authors have a possible hypothesis if one of the strands is more favorable to editing depending on where the TadA8 binds or is it random?

    1. Reviewer #2 (Public review):

      Summary:

      The study expands previous knowledge on the dual ribosome system in zebrafish by demonstrating the expression of maternal ribosomes in the primordial germ cells as well as the formation of hybrid ribosomes combining subunits of maternal and somatic ribosomes. Although the distinction between the two types is clear at the rRNA level, this is not paralleled at the protein level. An attempt to associate the expression of germ-line-specific transcripts to maternal ribosomes remains inconclusive. Thus, evidence for the functional specialisation of ribosomes in this system is still lacking.

      Strengths:

      The experiments are well-conducted and the main conclusions are well-supported.

      Weaknesses:

      The attempt to take advantage of the system to provide an example of functional ribosome specialisation is justified and the expression of maternal-type ribosomes in the germ line may still be key to understanding the expression of classes of mRNA. However, an alternative possibility related to genome evolution and sex determination is equally relevant.

      Assessment following the structure of the manuscript:

      Shah et al.: "A dual ribosomal system in zebrafish soma and germline"

      The zebrafish dual ribosome system is attractive because it offers a favourable setting to look for ribosome specialization and my impression is that this is exactly what the authors set out to do rather than to try to understand why zebrafish have this unusual setup. If this is correct, the title and the abstract should better reflect the authors' aim and main results. The title suggests to the non-specialist that the dual ribosome system is a novel find which obviously is not the case.

      I was a bit confused when reading the introduction. In the first paragraph, it was unclear to me if the degradation of maternal ribosomes is an active process different from normal turnover. I also found the third paragraph slightly out of tune with the discussion section. The dual ribosome setting at the level of ribosomal RNA genes represents an extreme case of sequence heterogeneity and appears to be sporadic in nature in that it only is reported from Plasmodium and zebrafish. The Xenopus example is 5S rRNA (as also mentioned in the discussion section), and the Drosophila example is protein composition, only. If a broader view of ribosome types is intended, there will be more examples, e.g. Trypanosomes that express different stage-dependent ribosomes at the level of rRNA modifications. The occurrence of dual ribosomes in fish should be placed in context with insight from other fish genomes, e.g. Medaka, which has only one type of ribosomes. Also, the duality in zebrafish is not restricted to ribosomes, but also comprises two types of spliceosomes. These observations suggest that the phenomenon should be investigated in the context of genome evolution. This is appropriately brought up in the discussion section, but I believe it would serve the reading of the manuscript if this was made clear from the beginning. With respect to the structural aspects, I am puzzled why one of the few other papers studying this system, Ramachandran et al. RNA 2020 (PMID: 32912962) is not referenced. This paper is focused on ribose methylation of the two types of ribosomal RNA and should be relevant to several aspects of the present study.

      The manuscript reports three novel and important findings. First, the maternal-type ribosomes are expressed in PGCs, where they furthermore are shown to translate germ line-specific transcripts, and in the male germ line. Regardless, the authors wisely decide to maintain the classical terminology of maternal and somatic ribosomes. Second, both types of ribosomes are polysome-associated and thus translationally active at 24 hpf when they are found in equal amounts. An elaborate experiment shows that hybrid ribosomes are formed at this stage. Finally, a RIP experiment fails to show selectivity in ribosomal recruitment of a germ line-specific mRNA based on the nanos3 3´-UTR. There are several other results, but these are mainly confirmatory or negative, albeit of good quality and important to communicate.

      The part of the study that describes differences in protein composition is a bit difficult to follow, partly because of the complexity of the results, and partly because of the disappointment that no parallel changes in proteins to the clear differences in rRNA were observed. Except for the discussion of eS8 in relation to subunit bridging, it is purely descriptive. There is quite a literature on paralog expression (e.g. in yeast and humans) and perhaps it would be possible to relate to the literature in a way that could provide more meaning to the observations. From the M&M section, it appears that the proteomics data were already published in the Leesch and Lorenzo-Orts et al. paper (Nature 2023). They are here found in Table S1 which is presented in a minimal fashion, from which it is time-consuming to extract meaningful information, e.g. on how stringently the ribosomes were prepared.

      The hybrid-ribosome observation is convincing, but additional information on the choice of cycloheximide concentration would be helpful to rule out other interpretations.

      The experiment on translation of primordial germ cell-specific transcripts by maternal ribosomes is a key experiment. Unfortunately, the experiment failed to show selectivity compared to somatic ribosomes, and in my reading, the promise in the abstract of "preferential association" is not quite justified. More importantly, this experiment is not exhaustive, and a more elaborate discussion on the limitations of the experiment and other approaches would be helpful.

      The discussion section is interesting. Importantly, the authors make the non-specialist aware of the peculiarities of laboratory strains of zebrafish with respect to the lack of sex chromosomes and a possible connection between the rDNA locus and sex determination. This information is critical to include in a journal that has a broad readership. I was unable to follow the argument about the 3´half of 5.8S "to play a role" in ribosome degradation based on Locati et al., 2018 (which is missing from the reference list) and "serve as a target for degradation of maternal ribosomes". Kinetic effects on the degradation pattern of rRNA are frequently observed and difficult to interpret.

    1. Reviewer #2 (Public review):

      Summary:

      The analyses of long-time malaria series to investigate the complex relationship between malaria incidence and climate is hampered by the non-stationarity introduced by both changing control interventions and irregular climate events such as the el nino Southern Oscillation (ENSO).

      Strengths:

      By applying wavelets the authors were able to investigate the effect of the major climate factors such as rainfall, air and land temperature, and sea surface temperature (as a measure for ENSO) while at the same time taking into account changing bednet coverage. The wavelet approach is both flexible and powerful and was able to demonstrate well that shorter term. seasonal fluctuation in malaria incidence in Western Kenya is driven by rainfall patterns, while providing some evidence for temperature and SST may predict fluctuations at longer timescales.

      Weaknesses:

      While flexible and able to deal with non-stationarity, the wavelet approach does not really allow investigation of multiple factors at the same time but is limited to uni- and bivariate analyses. This limits the interpretability of the effect of complex climate patterns while also 'adjusting' for the changing control environment. There is also some concern that the choice of the wavelet and transforms used for different analyses (Morelet, Coiflet, maximal overlap discreet transform) may affect the results. The reasons for choosing these particular wavelets and transforms are not always evident.

      The attempt to investigate the effect of longer terms / irregular period climate events is laudable. However, why were the analyses restricted to only ENSO (measured as SST)? Other climate factors such as e.g. the Indian Ocean Dipole (i.e. the difference in SST between the western and eastern Indian Ocean) are also known to affect climate and rainfall patterns in Eastern Africa.

      Nevertheless, this work is a compelling demonstration of the utility of wavelets for the analyses of (non-stationary) epidemiological time series data.

    1. Reviewer #2 (Public review):

      Summary:

      Using the theory of efficient coding, the authors study how neural gains may be adjusted to optimize coding by noisy neural populations while minimizing metabolic costs. The manuscript first presents mathematical results for the general case where the computational goals of the neural population are not specified (the computation is implicit in the assumed tuning curves) and then develops the theory for a specific probabilistic coding scheme. The general theory provides an explanation for firing rate homeostasis at the level of neural clusters with firing rate heterogeneity within clusters, and the specific application further captures stimulus-specific and neuron-specific adaptation in the visual cortex.

      The mathematical derivations, simulations, and application to visual cortex data are solid as far as I can tell.

      In the current format, the significance is difficult to assess fully: the manuscript is a bit sprawling, in the first half the general theory is lengthy and technical, and then in the second half a few phenomena are addressed without a clear relation between them (rate homeostasis, rate heterogeneity, synaptic homeostasis, V1 adaptation, divisive normalization), requiring several ad-hoc choices and assumptions.

      Strengths:

      The problem of efficient coding is a long-standing and important one. This manuscript contributes to that field by proposing a theory of efficient coding through gain adjustments, independent of the computational goals of the system. The main result is a normative explanation for firing rate homeostasis at the level of neural clusters (groups of neurons that perform a similar computation) with firing rate heterogeneity within each cluster. Both phenomena are widely observed, and reconciling them under one theory is important.

      The mathematical derivations are thorough as far as I can tell. Although the model of neural activity is artificial, the authors make sure to include many aspects of cortical physiology, while also keeping the models quite general.

      Section 2.5 derives the conditions in which homeostasis would be near-optimal in the cortex, which appear to be consistent with many empirical observations in V1. This indicates that homeostasis in V1 might be indeed close to the optimal solution to code efficiently in the face of noise.

      The application to the data of Benucci et al 2013 is the first to offer a normative explanation of stimulus-specific and neuron-specific adaptation in V1.

      Weaknesses:

      The novelty and significance of the work are not presented clearly. The relation to other theoretical work, particularly Ganguli and Simoncelli and other efficient coding theories, is explained in the Discussion but perhaps would be better placed in the Introduction, to motivate some of the many choices of the mathematical models used here.

      The manuscript is very hard to read as is, it almost feels like this could be two different papers. The first half seems like a standalone document, detailing the general theory with interesting results on homeostasis and optimal coding. The second half, from Section 2.7 on, presents a series of specific applications that appear somewhat disconnected, are not very clearly motivated nor pursued in-depth, and require ad-hoc assumptions.

      For instance, it is unclear if the main significant finding is the role of homeostasis in the general theory or the demonstration that homeostatic DDC with Bayes Ratio coding captures V1 adaptation phenomena. It would be helpful to clarify if this is being proposed as a new/better computational model of V1 compared to other existing models.

      Early on in the manuscript (Section 2.1), the theory is presented as general in terms of the stimulus dimensionality and brain area, but then it is only demonstrated for orientation coding in V1.

      The manuscript relies on a specific response noise model, with arbitrary tuning curves. Using a population model with arbitrary tuning curves and noise covariance matrix, as the basis for a study of coding optimality, is problematic because not all combinations of tuning curves and covariances are achievable by neural circuits (e.g. https://pubmed.ncbi.nlm.nih.gov/27145916/ )

      The paper Benucci et al 2013 shows that homeostasis holds for some stimulus distributions, but not others i.e. when the 'adapter' is present too often. This manuscript, like the Benucci paper, discards those datasets. But from a theoretical standpoint, it seems important to consider why that would be the case, and if it can be predicted by the theory proposed here.

    1. Reviewer #2 (Public review):

      The metastasis poses a significant challenge in cancer treatment. During the transition from non-invasive cells to invasive metastasis cells, cancer cells usually experience mechanical stress due to a crowded cellular environment. The molecular mechanisms underlying mechanical signaling during this transition remain largely elusive. In this work, the authors utilize an in vitro cell culture system and advanced imaging techniques to investigate how non-invasive and invasive cells respond to cell crowding, respectively.

      The results clearly show that pre-malignant cells exhibit a more pronounced reduction in cell volume and are more prone to spreading compared to non-invasive cells. Furthermore, the study identifies that TRPV4, a calcium channel, relocates to the plasma membrane both in vitro and in vivo (patient's samples). Activation and inhibition of TRPV4 channel can modulate the cell volume and cell mobility. These results unveil a novel mechanism of mechanical sensing in cancer cells, potentially offering new avenues for therapeutic intervention targeting cancer metastasis by modulating TRPV4 activity. This is a very comprehensive study, and the data presented in the paper are clear and convincing. The study represents a very important advance in our understanding of the mechanical biology of cancer.

    1. Reviewer #3 (Public review):

      Summary:

      This is an important paper that investigates the relationship between proteolytic stability of an antibiotic target enzyme and the evolution of antibiotic resistance via increased gene copy number. The target of the antibiotic trimethoprim is dihydrofolate reductase (DHFR). In Escherichia coli, DHFR is encoded by folA and the major proteolysis housekeeping protease is Lon (lon). In this manuscript, the authors report the result of the experimental evolution of a lon mutant strain of E. coli in response to sub-inhibitory concentrations of the antibiotic trimethoprim then investigate the relationship between proteolytic stability of DHFR mutants and the evolution of folA gene duplication. After 25 generations of serial passaging in a fixed concentration of trimethoprim, the authors found that folA duplication events were more common during evolution of the lon strain, than the wt strain. However, with continued passaging, some folA duplications were replaced by a single copy of folA containing a trimethoprim resistance-conferring point mutation. Interestingly, evolution of the lon strain in the setting of increasing concentrations of trimethoprim resulted in evolved strains with different levels of DHFR expression. In particular, some strains maintained two copies of a mutant folA that encoded an unstable DHFR. In a lon+ background, this mutant folA did not express well and did not confer trimethoprim resistance. However, in the lon- background, it displayed higher expression and conferred high-level trimethoprim resistance. The authors concluded that maintenance of the gene duplication event (and the absence of Lon) compensated for the proteolytic instability of this mutant DHFR. In summary, they provide evidence that the proteolytic stability of an antibiotic target protein is an important determinant of the evolution of target gene copy number in the setting of antibiotic selection.

      Strengths:

      The major strength of this paper is identifying an example of antibiotic resistance evolution that illustrates the interplay between the proteolytic stability and copy number of an antibiotic target in the setting of antibiotic selection. The results are rigorous and convincingly support the conclusions. This paper will be of interest to any biologist that studies the evolution of resistance mechanisms or gene duplication.

      Weaknesses:

      The impact of this finding is somewhat limited given that it is a single example that occurred in a lon strain of E. coli. Although the specific mechanism is unlikely to occur naturally, this study represents an important and convincing proof of the principle that gene duplication can provide increased expression demand for an unstable resistance determinant in the setting of antibiotic selection.

    1. Reviewer #2 (Public review):

      Summary:

      This is a timely and original study on the geometry of macroscopic (2.5 mm) brain representations of multiple cues and contexts in Pavlovian fear conditioning. The authors report that these representations differ between initial learning, and reversal learning, and remain stable during extinction.

      Strengths:

      The authors address an important question and use a rigorous experimental methodology.

      Weaknesses:

      The findings are limited (a) by the chosen spatial resolution (2.5 mm) which is far away from what modern fMRI can achieve, and (b) by the statistical analysis method. While transparently reported, their voxel-wise correction for multiple comparisons rests on a false discovery rate (i.e. 5% of the reported findings should be considered false positives) and there is no correction for the number of hypothesis tests (with an exception in some post hoc tests). Furthermore, there are some minor presentation issues that the authors could address to improve clarity.

    1. Reviewer #2 (Public review):

      Summary:

      Alizadeh et al. investigate how varying cellular E/I (excitatory/inhibitory) composition impacts coding across cortical layers. They build on findings from a recent study (Huang et al., 2022) that demonstrated a decrease in the fraction of inhibitory neurons from L2/3 to L4. Using a network of excitatory and inhibitory leaky integrate-and-fire neurons, they systematically assess how these anatomical features influence the dimensionality of network activity and coding capacity. Their key finding is that increasing the proportion of inhibitory neurons enhances the dimensionality of activity and improves the encoding of time-varying stimuli.

      Strengths:

      The authors use a clear methodology and well-established model of network activity that allows them to relate network parameters to the coding properties. They systematically evaluate the impact of the key features of the inhibitory population. Thus, in addition to changing the fraction of inhibitory cells, they control for the inhibitory firing threshold of inhibitory neurons and connection strength between inhibitory and excitatory cells. Furthermore, they show their modeling results are aligned with the analysis of the spiking activity in L2/3 vs. L4 from the Allen Institute data.

      Weaknesses:

      One general shortcoming of this approach is that it focuses on a small preselected number of network features. For example, it is unclear to what extent the results would be affected by other aspects of the organization of cortical columns, such as subclasses of inhibitory cells (SOM, VIP, PV), specific differences in synapses, realistic population sizes, or even connectivity between layers. Similarly, the models of L2/3 and L4 are constrained based on a limited set of observations, and it has not been demonstrated whether the same findings hold true for V1 recordings analyzed by the authors.

      The modeling relies on anatomical data from the barrel cortex, but the decoding comparison is based on V1 data. This raises questions about how anatomical differences between regions may influence the conclusions.

      The coding capacity appears inversely correlated with the firing rate, which in this study is largely influenced by the properties of the inhibitory population. It would be important to confirm that the observed changes in coding capacity and participation ratio are not solely driven by firing rate changes.

    1. Reviewer #2 (Public review):

      Summary:

      This study marks a noteworthy advance in the targeted design of AMPs, leveraging a pioneering deep learning framework to generate potent bifunctional peptides with specificity against both bacteria and viruses. The introduction of a GAN for generation and a GCN-based AMPredictor for MIC predictions is methodologically robust and a major stride in computational biology. Experimental validation in vitro and in animal models, notably with the highly potent P076 against a multidrug-resistant bacterium and P002's broad-spectrum viral inhibition, underpins the strength of their evidence. The findings are significant, showcasing not just promising therapeutic candidates, but also demonstrating a replicable means to rapidly develop new antimicrobials against the threat of drug-resistant pathogens.

      Strengths:

      The de novo AMP design framework combines a generative adversarial network (GAN) with an AMP predictor (AMPredictor), which is a novel approach in the field. The integration of deep generative models and graph-encoding activity regressors for discovering bifunctional AMPs is cutting-edge and addresses the need for new antimicrobial agents against drug-resistant pathogens. The in vitro and in vivo experimental validations of the AMPs provide strong evidence to support the computational predictions. The successful inhibition of a spectrum of pathogens in vitro and in animal models gives credibility to the claims. The discovery of effective peptides, such as P076, which demonstrates potent bactericidal activity against multidrug-resistant A. baumannii with low cytotoxicity, is noteworthy. This could have far-reaching implications for addressing antibiotic resistance. The demonstrated activity of the peptides against both bacterial and viral pathogens suggests that the discovered AMPs have a wide therapeutic potential and could be effective against a range of pathogens.

      Comments on revisions: I have no further comments on revisions.

    1. Reviewer #2 (Public review):

      Summary

      This revised manuscript investigates the role and the mechanism by which PDE1 impacts NSCLC progression. They provide evidence to demonstrate that PDE1 binds to m6A reader YTHDF2, in turn, regulating STAT3 signaling pathway through its interaction, promoting metastasis and angiogenesis.

      Strength:

      The study uncovers a novel PDE1A/YTHDF2/SOCS2/STAT3 pathway in NSCLC progression and the findings provide a potential treatment strategy for NSCLC patients with metastasis.

      Weakness:

      In discussion, it is stated in the revised version that "the role of YTHDF2 in PDE1A-driven tumor metastasis should be elucidated in future studies", however, given that physical interaction of PDE1A and YTHDF2 plays a critical role in PDE1A-mediated NSCLC metastasis, whether YTHDF2 mimicking the effect of PDE1A in metastasis will strength the manuscript.

  3. Feb 2025
    1. Reviewer #3 (Public review):

      Summary:

      This paper aims to investigate how the human brain represents different forms of value and uncertainty that participate in active inference within a free-energy framework, in a two-stage decision task involving contextual information sampling, and choices between safe and risky rewards, which promotes shifting between exploration and exploitation. They examine neural correlates by recording EEG and comparing activity in the first vs second half of trials and between trials in which subjects did and did not sample contextual information, and perform a regression with free-energy-related regressors against data "mapped to source space."

      Strengths:

      This two-stage paradigm is cleverly designed to incorporate several important processes of learning, exploration/exploitation and information sampling that pertain to active inference. Although scalp/brain regions showing sensitivity to the active-inference related quantities do not necessarily suggest what role they play, they are illuminating and useful as candidate regions for further investigation. The aims are ambitious, and the methodologies are impressive. The paper lays out an extensive introduction to the free energy principle and active inference to make the findings accessible to a broad readership.

      Weaknesses:

      It is worth noting that the high lower-cutoff of 1 Hz in the bandpass filter, included to reduce the impact of EEG noise, would remove from the EEG any sustained, iteratively updated representation that evolves with learning across trials, or choice-related processes that unfold slowly over the course of the 2-second task windows. It is thus possible there are additional processes related to the active inference quantities that are missed here. This is not a flaw as one must always try to balance noise removal against signal removal in filter settings - it is just a caveat. As the authors also note, the regions showing up as correlated with model parameters change depending on source modelling method and correction for multiple comparisons, warranting some caution around the localisation aspect.