[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the KrasC118S mutation in the context of its role in carcinogenesis and tumor development, particularly in relation to urethane-induced lung tumors characterized by oncogenic Q61R/L mutations in Kras. Functional: The passage implies that the KrasC118S mutation alters the molecular behavior of Kras in the context of tumorigenesis, as it is assessed for its impact on carcinogenesis and tumor development.

Gene→Variant (gene-first): 4843:C118S 3845:Q61R/L

Genes: 4843 3845

Variants: C118S Q61R/L

[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 7

Evidence Type(s): Oncogenic, Prognostic

Justification: Oncogenic: The passage discusses the KrasC118S variant in the context of its role in mouse models, indicating that it does not lead to significant developmental or physiological defects, which suggests its involvement in tumor development or progression. Prognostic: The passage mentions the median lifespan of KrasC118S/C118S mice compared to Kras+/+ mice, indicating a potential correlation with disease outcome, although the difference was not statistically significant.

Gene→Variant (gene-first): 4843:C118S

Genes: 4843

Variants: C118S

[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 6

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 4843:C118S

Genes: 4843

Variants: C118S

[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the C118S mutation affects the ability of eNOS to stimulate the MAPK pathway and provides evidence of altered molecular function through immunoblot analysis of protein levels and activity. Oncogenic: The passage indicates that the C118S mutation is important for carcinogen-induced lung tumorigenesis, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): 4843:C118S 4843:G353>C 4846:S1177D

Genes: 4843 4846

Variants: C118S G353>C S1177D

[Paragraph-level] PMCID: PMC4234187 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the C118S mutation specifically blocks redox-dependent reactions that lead to Ras activation, indicating an alteration in molecular function. Oncogenic: The context of the study involves investigating the effect of the C118S mutation on Ras function during tumorigenesis, suggesting that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 4843:C118 4843:C118S 4843:G353 transversion to C 4843:G353>C

Genes: 4843

Variants: C118 C118S G353 transversion to C G353>C

[Paragraph-level] PMCID: PMC2970593 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses mutations in the TK domain of EGFR that are critical for its activity, indicating that these variants alter molecular function related to protein activity. Oncogenic: The context of the mutations being in the TK domain of EGFR suggests that they may contribute to tumor development or progression, as this domain is often implicated in oncogenic signaling pathways.

Gene→Variant (gene-first): 1956:C797 NA:E734 NA:T785 1956:E868 1956:L858 1956:R831 NA:W731 1956:Y801

Genes: 1956 NA

Variants: C797 E734 T785 E868 L858 R831 W731 Y801

[Paragraph-level] PMCID: PMC2970593 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage states that the L858R mutation was found to increase sensitivity to the EGFR inhibitor, Erlotinib, indicating a correlation with treatment response. Oncogenic: All mutations mentioned in the passage, including C797Y, E734Q, E868G, L831H, L858R, T785A, W731L, and Y801H, are described as somatic mutations that contribute to tumor development, as they were identified in the tyrosine kinase domain of EGFR in cancer samples.

Gene→Variant (gene-first): 1956:C797Y 1956:E734Q 1956:E868G 1956:L831H 1956:L858R 1956:T785A 1956:W731L 1956:Y801H

Genes: 1956

Variants: C797Y E734Q E868G L831H L858R T785A W731L Y801H

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 19

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the SF3B1K700E mutation can be therapeutically targeted, indicating a correlation with treatment response to etoposide and olaparib, which are specific therapies. Oncogenic: The SF3B1K700E mutation is implicated in tumor development, as the passage describes its role in creating an HR defect and its effects on tumor growth in xenograft models.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the SF3B1 K700E variant contributes to cellular deficits characteristic of BRCA1/2 loss, indicating its role in tumor development or progression. Functional: The variant K700E is shown to alter the recruitment of Rad51 to replication forks and affects replication fork stability, demonstrating a change in molecular function.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the SF3B1K700E variant affects replication fork dynamics and efficiency of replication fork restart, indicating an alteration in molecular function related to DNA replication. Oncogenic: The context of the study involves assessing the impact of the SF3B1K700E mutation on cellular processes relevant to tumor development, such as replication fork dynamics, which suggests a role in oncogenesis.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The D210N variant is described as being catalytically inactivated, which alters its ability to resolve R-loops, indicating a change in molecular function. Oncogenic: The passage discusses the role of the D210N variant in the context of R-loop accumulation and genome instability, which are associated with tumor development and progression.

Gene→Variant (gene-first): 246243:D210N

Genes: 246243

Variants: D210N

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the K700E mutation alters molecular function by inducing unscheduled R-loops and affecting replication fork dynamics.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the SF3B1K700E mutation alters the molecular function of homologous recombination (HR) by affecting the formation and resolution of Rad51 foci, indicating a defect in the later stages of HR. Oncogenic: The SF3B1K700E mutation is implicated in tumor development or progression as it affects the ability of cells to resolve recombination intermediates, which is a critical process in maintaining genomic stability in cancer cells.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the SF3B1K700E variant alters the ability of cells to resolve DNA double-strand breaks (DSBs) and impairs homologous recombination (HR) repair, indicating a change in molecular function related to DNA repair mechanisms. Oncogenic: The SF3B1K700E mutation is described as cancer-associated and is shown to contribute to defects in DNA repair, which is a characteristic of oncogenic variants that promote tumor development or progression.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC7612475 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Functional

Justification: Predictive: The K700E mutation in SF3B1 increases cellular sensitivity to ionising radiation and various chemotherapeutic agents, including PARP inhibitors, indicating a correlation with treatment response. Functional: The K700E mutation alters HR efficiency and induces unscheduled R-loop formation, replication fork stalling, and defective replication fork restart, demonstrating an impact on molecular function.

Gene→Variant (gene-first): 23451:K700E

Genes: 23451

Variants: K700E

[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Prognostic

Justification: Predictive: The passage suggests that patients with E545K/E542K mutations had shorter progression-free survival (PFS) and overall survival, indicating a potential role of these mutations in resistance to hormone therapy. Prognostic: The mention of shorter PFS and overall survival in patients with the E545K/E542K mutations indicates a correlation with disease outcome independent of therapy.

Gene→Variant (gene-first): 5290:E542K 5290:E545K

Genes: 5290

Variants: E542K E545K

[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the correlation between PIK3CA mutations (H1047R, E545K, E542K) and the efficacy of everolimus, indicating that these variants are associated with prolonged progression-free survival (PFS) in patients treated with this therapy. Oncogenic: The mention of PIK3CA mutations in the context of their role in tumor development and the efficacy of a cancer treatment suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047R

[Paragraph-level] PMCID: PMC5355930 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage discusses the prevalence of PIK3CA mutations, including specific variants, in a patient population, indicating their association with the disease context. Predictive: The mention of higher prevalence of PIK3CA mutations in the everolimus arm compared to the placebo arm suggests a correlation with treatment response, indicating predictive value.

Gene→Variant (gene-first): 5290:E542K 5290:E545K 5290:H1047R

Genes: 5290

Variants: E542K E545K H1047R

[Paragraph-level] PMCID: PMC3184204 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predisposing, Diagnostic, Functional

Justification: Predisposing: The passage describes the discovery of the GATA2 gene as a predisposition gene for myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML), indicating that the variants are associated with inherited risk for developing these diseases. Diagnostic: The variants are used to define and classify familial forms of MDS and AML, as they are reported to segregate with the disease in multiple families, which supports their role in diagnosis. Functional: The passage mentions that the mutations have differential effects on transactivation of target genes, cellular differentiation, apoptosis, and global gene expression, indicating that they alter molecular or biochemical function.

Gene→Variant (gene-first): 2624:c.1061C>T 2624:c.1063_1065delACA 2624:p.Thr354Met 6688:p.Thr355del

Genes: 2624 6688

Variants: c.1061C>T c.1063_1065delACA p.Thr354Met p.Thr355del

[Paragraph-level] PMCID: PMC5613053 Section: ABSTRACT PassageIndex: 2

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the ability of gilteritinib to block mutated FLT3, including the D835Y and F691 mutations, and its correlation with improved survival in models of FLT3-driven AML, indicating a response to therapy. Oncogenic: The D835Y and F691 mutations in FLT3 are implicated in the pathogenesis of acute myeloid leukemia (AML), suggesting that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2322:D835Y 2322:F691

Genes: 2322

Variants: D835Y F691

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how gilteritinib inhibits FLT3-D835Y and FLT3-ITD-D835Y, indicating a correlation between the variant and response to the therapy, which is a predictive context. Functional: The passage describes how gilteritinib interacts with FLT3 at the F691 position and discusses the structural implications of the D835Y mutation, indicating an alteration in molecular function related to the binding of the inhibitor.

Gene→Variant (gene-first): 2322:D835 2322:D835Y 2322:F691

Genes: 2322

Variants: D835 D835Y F691

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how mutations such as FLT3-D835Y and FLT3-F691 confer resistance to FLT3 inhibitors, indicating a correlation with treatment response and sensitivity to specific therapies like gilteritinib and quizartinib. Oncogenic: The variants FLT3-D835Y and FLT3-F691 are implicated in tumor development and progression, as evidenced by their expression in Ba/F3 cells and the observed antitumor efficacy of gilteritinib in xenograft models.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 2322:F691 L 2322:F691I

Genes: 2322

Variants: D835Y F691 F691 L F691I

[Paragraph-level] PMCID: PMC5613053 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the inhibitory activity of gilteritinib against FLT3 containing specific mutations, indicating a correlation with response to therapy. Oncogenic: The mention of D835Y and F691 L/I mutations in the context of FLT3 suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2322:D835Y 2322:F691 L/I

Genes: 2322

Variants: D835Y F691 L/I

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 25

Evidence Type(s): Diagnostic

Justification: Diagnostic: The passage discusses the classification of variants as Pathogenic and Likely Pathogenic, indicating their association with specific diseases or subtypes, which aligns with the definition of diagnostic evidence.

Gene→Variant (gene-first): 5728:A79T 5728:C211W 5728:E157G 5728:H123Q 5728:I135V 5728:I203V 5728:I400V 5728:K342N 5728:K402N 5728:L345V 5728:L70V 5728:M35V 5728:N117S 5728:N228S 5728:N340D 5728:N340H 5728:N356D 5728:P354Q 5728:Q298E 5728:S229T 5728:T202I 5728:T78A 5728:W274L 5728:Y176C 5728:Y180H 5728:Y65C

Genes: 5728

Variants: A79T C211W E157G H123Q I135V I203V I400V K342N K402N L345V L70V M35V N117S N228S N340D N340H N356D P354Q Q298E S229T T202I T78A W274L Y176C Y180H Y65C

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how various PTEN variants, including A126D, A126P, C124S, G129E, H123Q, P354Q, P38H, Q396R, R130L, and R130Q, alter the molecular function of PTEN by affecting pAKT levels, indicating changes in biochemical activity. Oncogenic: The variants are described in the context of their effects on the PI3-AKT signaling pathway and their ability to exhibit loss of function (LoF) or gain of function (GoF), which are indicative of their roles in tumor development or progression.

Gene→Variant (gene-first): 5728:A126D 5728:A126P 5728:C124S 5728:G129E 5728:H123Q 5728:P354Q 5728:P38H 5728:Q396R 5728:R130L 5728:R130Q

Genes: 5728

Variants: A126D A126P C124S G129E H123Q P354Q P38H Q396R R130L R130Q

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants affect protein stability and abundance, indicating that they alter molecular function, which is supported by the use of western blot analysis and flow cytometry to measure these changes.

Gene→Variant (gene-first): 5728:H93Y 5728:P354Q 5728:R130L 5728:R14G 5728:R15S 5728:T78A

Genes: 5728

Variants: H93Y P354Q R130L R14G R15S T78A

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how PTEN variants affect sensorimotor neural circuit function and chemotaxis in C. elegans, indicating that these variants alter molecular or biochemical function. Oncogenic: The context of the passage suggests that the PTEN variants are involved in a pathway related to tumor development or progression, particularly given the focus on mutations in a cancer-related gene.

Gene→Variant (gene-first): 5728:A79T 5728:C124S 5728:D268E 5728:G132D 5728:P354Q 5728:T167N 5728:Y176C

Genes: 5728

Variants: A79T C124S D268E G132D P354Q T167N Y176C

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how various PTEN variants, including C124S, I101T, G132D, D268E, and A79T, alter neuronal growth processes and synapse density, indicating that these variants affect molecular or biochemical functions in neuronal cultures. Oncogenic: The passage mentions that the PHTS variant A79T exhibits a gain-of-function (GoF) phenotype in axonal growth, suggesting that it contributes to tumor development or progression in the context of its association with ASD.

Gene→Variant (gene-first): 5728:A79T 5728:C124S 5728:D268E 5728:G132D 5728:I101T

Genes: 5728

Variants: A79T C124S D268E G132D I101T

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how various PTEN variants, including C124S, G129E, N117S, and Q298E, alter developmental rates in Drosophila, indicating that these variants affect molecular or biochemical function related to insulin signaling and eclosion timing. Oncogenic: The mention of the known gain-of-function variant 4A inducing lethality suggests that some variants contribute to tumor development or progression, aligning with oncogenic behavior.

Gene→Variant (gene-first): 5728:C124S 5728:G129E 5728:N117S 5728:Q298E

Genes: 5728

Variants: C124S G129E N117S Q298E

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the C124S variant alters molecular interactions and functions within the context of PI3P metabolism and signaling, indicating a change in biochemical activity. Oncogenic: The C124S variant is described in the context of genetic interactions that may contribute to tumor development or progression, as it is involved in a synthetic dosage lethality screen related to PTEN's role in cancer biology.

Gene→Variant (gene-first): 5728:C124S

Genes: 5728

Variants: C124S

[Paragraph-level] PMCID: PMC7190743 Section: RESULTS PassageIndex: 3

Evidence Type(s): Diagnostic, Oncogenic, Functional

Justification: Diagnostic: The passage discusses the classification of variants, including C124S, G129E, R130X, and R335X, in relation to their association with conditions such as ASD, PHTS, and somatic cancer, indicating their role in defining or confirming these diseases. Oncogenic: The passage mentions that C124S and G129E have been found in somatic cancer, indicating that these variants contribute to tumor development or progression. Functional: The passage describes several variants, including C124S and G129E, as having well-characterized disruptions on protein function, indicating that they alter molecular or biochemical function.

Gene→Variant (gene-first): 5728:C124S 5728:G129E 5728:R130X 5728:R335X 5728:Y138L

Genes: 5728

Variants: C124S G129E R130X R335X Y138L

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the relationship between p53 mutations (including R175H, R248W, R273H, R282W) and resistance to chemotherapy, specifically noting that cells with these mutations showed higher viability and increased IC50 for various drugs, indicating a correlation with drug resistance. Oncogenic: The passage implies that the p53 mutations contribute to tumor behavior by affecting cell response to chemotherapy, suggesting their role in tumor development or progression.

Gene→Variant (gene-first): 7157:R175H 7157:R248W 7157:R273H 7157:R282W

Genes: 7157

Variants: R175H R248W R273H R282W

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 10

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the association between p53 mutations (R248, R282) and the expression of CYP3A4, a drug metabolism enzyme, indicating a correlation with drug clearance and potential response to chemotherapeutic drugs. Functional: The passage describes how p53 mutations (R248, R282) alter the expression levels of the CYP3A4 enzyme, demonstrating a change in molecular function related to drug metabolism.

Gene→Variant (gene-first): 7157:R175 7157:R175H 7157:R248 7157:R248W 7157:R273 7157:R273H 7157:R282 7157:R282W

Genes: 7157

Variants: R175 R175H R248 R248W R273 R273H R282 R282W

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 8

Evidence Type(s): Prognostic, Functional

Justification: Prognostic: The passage mentions that R248Q/W and R282W are associated with mortality, indicating a correlation with disease outcome. Functional: The passage discusses the enrichment of specific gene sets linked to cellular respiration and drug metabolism enzymes for certain mutations, suggesting alterations in molecular function.

Gene→Variant (gene-first): 7157:R175H 7157:R248Q/W 7157:R248W 7157:R273H 7157:R282W

Genes: 7157

Variants: R175H R248Q/W R248W R273H R282W

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Predictive

Justification: Diagnostic: The passage indicates that the R282 mutation is associated with drug metabolism enzymes, suggesting its role in defining or classifying a specific biological context related to drug metabolism. Predictive: The mention of the R282 mutation in relation to drug metabolism enzymes implies a potential correlation with response or sensitivity to therapies that involve these enzymes.

Gene→Variant (gene-first): 7157:R282

Genes: 7157

Variants: R282

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 6

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses the association of R248 and R282 mutations with shorter patient survival, indicating a correlation with disease outcome independent of therapy. Oncogenic: The mention of mice carrying the humanized mutation on R248 exhibiting significantly shorter survival time suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 7157:R175 7157:R248 7157:R273 7157:R282

Genes: 7157

Variants: R175 R248 R273 R282

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 4

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses how mutations at Arg248 and Arg282 correlate with significantly shorter overall survival times, indicating a relationship between these variants and disease outcome independent of therapy. Oncogenic: The mention of p53 mutations, including those at Arg248 and Arg282, suggests a role in tumor development or progression, as these mutations are associated with survival outcomes in cancer patients.

Gene→Variant (gene-first): 7157:Arg248 7157:Arg282 7157:G245 7157:R175 7157:R248 7157:R249S 7157:R273 7157:R282 7157:Y220

Genes: 7157

Variants: Arg248 Arg282 G245 R175 R248 R249S R273 R282 Y220

[Paragraph-level] PMCID: PMC3973211 Section: RESULTS PassageIndex: 2

Evidence Type(s): Prognostic

Justification: Prognostic: The passage indicates that mutations at Arg282 and Arg248 are associated with shorter patient survival, which correlates with disease outcome independent of therapy.

Gene→Variant (gene-first): 7157:Arg248 7157:Arg282

Genes: 7157

Variants: Arg248 Arg282

[Paragraph-level] PMCID: PMC5481739 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the somatic DNMT3A-V716F mutation and its predicted effect on methyltransferase activity, indicating that the variant alters molecular function. Oncogenic: The mention of the somatic DNMT3A-V716F mutation in the context of a tumor suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1788:V716F

Genes: 1788

Variants: V716F

[Paragraph-level] PMCID: PMC7293710 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses how the KRASG12V mutation correlates with increased sensitivity to the antiproliferation therapy of metformin, indicating a predictive relationship between the variant and treatment response. Oncogenic: The KRASG12V mutation is implicated in tumor development as it is mentioned in the context of its effect on cell viability and sensitivity to therapy in colorectal cancer cell lines.

Gene→Variant (gene-first): 3845:G12V

Genes: 3845

Variants: G12V

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 15

Evidence Type(s): Predictive, Oncogenic, Functional

Justification: Predictive: The passage discusses the response of KB1(L1363P)P mammary tumors to targeted therapies, indicating that these tumors responded significantly better to cisplatin and the PARP inhibitor AZD2461, which correlates the variant with treatment response. Oncogenic: The variant is associated with tumor development and progression, as it is discussed in the context of mammary tumors and their response to therapies, suggesting a role in cancer biology. Functional: The passage describes how the variant affects the ability of tumor cells to induce RAD51 foci in response to gamma-radiation, indicating an alteration in molecular function related to DNA repair mechanisms.

Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P

Genes: 7158

Variants: L1363P p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 14

Evidence Type(s): Predictive

Justification: Predictive: The variant L1363P is associated with a response to cisplatin and PARP inhibition, indicating its correlation with treatment sensitivity.

Gene→Variant (gene-first): 7158:L1363P

Genes: 7158

Variants: L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses how KB1(L1363P)P mammary tumors are classified as predominantly carcinosarcomas, indicating that the variant is used to define and classify a specific tumor subtype. Oncogenic: The variant L1363P is associated with the development of carcinosarcomas, suggesting that it contributes to tumor progression and development, which aligns with oncogenic behavior.

Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P

Genes: 7158

Variants: L1363P p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the variant L1363P is associated with mammary tumors exhibiting EMT-like phenotypes, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 7158:L1363P

Genes: 7158

Variants: L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the Brca1 p.L1363P variant contributes to tumor formation and accelerates tumor development in a mouse model, indicating its role in tumor progression. Functional: The passage indicates that the Brca1 p.L1363P variant has a functional defect that compromises BRCA1-mediated homologous recombination repair (HRR), suggesting an alteration in molecular function.

Gene→Variant (gene-first): 7158:L1363P 7158:p.L1363P

Genes: 7158

Variants: L1363P p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Justification: Oncogenic: The variant p.L1363P is associated with a defect in mammary tumor suppression, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses increased sensitivity to cisplatin and PARP1 inhibition in the context of the Brca1 p.L1363P variant, indicating a correlation with treatment response. Functional: The variant p.L1363P is shown to severely attenuate BRCA1-PALB2 binding, which alters the molecular function related to homologous recombination repair (HRR).

Gene→Variant (gene-first): 672:leucine to proline 7158:p.L1363P 672:p.L1407P

Genes: 672 7158

Variants: leucine to proline p.L1363P p.L1407P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the variant p.L1363P alters the binding ability of BRCA1 to PALB2 and affects its activity in homologous recombination repair (HRR), demonstrating a change in molecular function.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses the evaluation of the functional consequences of the Brca1 p.L1363P variant, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses a functional analysis of the Brca1 p.L1363P variant, indicating that it alters embryonic development and leads to growth defects in mice, which demonstrates its impact on molecular or biochemical function. Oncogenic: The analysis of the Brca1 p.L1363P variant in the context of embryonic development and its comparison to Brca1-null mice suggests that it may contribute to tumor development or progression, as it is associated with severe phenotypes similar to pathogenic mutations in Brca1.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage indicates that the homozygous variant p.L1363P in Brca1 leads to embryonic lethality in mice, suggesting that it contributes to tumor development or progression.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 3

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variant p.L1407P disrupts the interaction of BRCA1 with PALB2 and predicts that it disables the alpha-helical structure of the coiled-coil domain, indicating an alteration in molecular function. Oncogenic: The use of CRISPR/Cas9 to model the BRCA1 variant in mice suggests that the variant contributes to tumor development or progression, as it is being studied in the context of a gene essential for embryonic development and cancer biology.

Gene→Variant (gene-first): 672:4220T>C 7158:p.L1363P 672:p.L1407P

Genes: 672 7158

Variants: 4220T>C p.L1363P p.L1407P

[Paragraph-level] PMCID: PMC7612117 Section: RESULTS PassageIndex: 2

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 7158:p.L1363P

Genes: 7158

Variants: p.L1363P

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic

Justification: Diagnostic: The passage discusses the correlation of MIB-1 labeling indices with the diagnosis and grade of tumors, indicating that the K27M variant is associated with specific tumor classifications.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 5

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the transformation of tumors associated with the K27M variant, indicating its role in tumor development and progression, particularly in the context of glioblastoma transformation.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of H3 K27M-mutant tumors and provides demographic information, indicating that the variant is associated with specific histological diagnoses and patient characteristics. Oncogenic: The mention of H3 K27M in the context of tumors suggests that this somatic variant contributes to tumor development or progression, as it is identified in mutant tumors.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC5822176 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Prognostic, Oncogenic

Justification: Diagnostic: The passage discusses the H3 K27M mutation's association with various tumor types, indicating its role in defining and classifying these tumors, particularly in pediatric and adult cohorts. Prognostic: The passage mentions survival outcomes for patients with H3 K27M-mutant tumors, comparing mean survival times between adults and pediatric patients, which indicates a correlation with disease outcome. Oncogenic: The H3 K27M mutation is described as contributing to tumor development in various glioma types, indicating its role as a somatic variant involved in tumor progression.

Gene→Variant (gene-first): 3417:K27M

Genes: 3417

Variants: K27M

[Paragraph-level] PMCID: PMC3288377 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of the p.K27M mutation in DIPGs and its association with this specific subtype of brain tumors, indicating its role in defining or classifying the disease. Oncogenic: The p.K27M and p.G34R mutations are described as somatic mutations found in pediatric gliomas, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 3021:p.G34R 3021:p.K27M

Genes: 3021

Variants: p.G34R p.K27M

[Paragraph-level] PMCID: PMC6368247 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the emergence of the ESR1 Y537S mutation in the context of resistance to CDK4/6 inhibitors, indicating a correlation with treatment response and resistance. Oncogenic: The mention of the ESR1 Y537S mutation as a new driver mutation suggests that it contributes to tumor development or progression, particularly in the context of breast cancer.

Gene→Variant (gene-first): 5728:Y537S

Genes: 5728

Variants: Y537S

[Paragraph-level] PMCID: PMC5122709 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Diagnostic, Oncogenic

Justification: Predictive: The passage discusses patients treated with BRAF inhibitors, specifically mentioning the BRAF V600E mutation, which correlates with response to these therapies. Diagnostic: The passage states that all patients tested positive for the BRAF V600E mutation, indicating its use in defining or confirming the presence of a specific subtype of melanoma. Oncogenic: The BRAF V600E mutation is implicated in the development of melanoma, suggesting its role as a somatic variant contributing to tumor progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC2789045 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the FGFR3 mutations (S249C, Y375C, and K652E) alter molecular signaling pathways, specifically the phosphorylation of various proteins, indicating a change in biochemical function. Oncogenic: The passage describes how the mutant FGFR3 variants induce morphological transformation, cell proliferation, and anchorage-independent growth, which are indicative of their role in tumor development and progression.

Gene→Variant (gene-first): 2261:K652E 2261:S249C 2261:Y375C

Genes: 2261

Variants: K652E S249C Y375C

[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Prognostic

Justification: Prognostic: The passage indicates that the SNPs are suggested to play a crucial role in the prognosis of HNSCC, which correlates with disease outcome.

Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936

Genes: NA 388325 341019

Variants: rs16879870 rs2641256 rs2761591 rs854936

[Paragraph-level] PMCID: PMC7099049 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Functional

Justification: Prognostic: The passage discusses the association of SNPs with HNSCC survival, indicating that these variants correlate with disease outcome, specifically overall survival, independent of therapy. Functional: The passage mentions that the genotype of rs16879870 and rs854936 is significantly associated with the expression of specific genes in cancer tissues, suggesting that these variants alter molecular function.

Gene→Variant (gene-first): NA:rs16879870 388325:rs2641256 341019:rs2761591 NA:rs854936

Genes: NA 388325 341019

Variants: rs16879870 rs2641256 rs2761591 rs854936

[Paragraph-level] PMCID: PMC9900321 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the efficacy of a small-molecule KRASG12D inhibitor, MRTX1133, in treating pancreatic ductal adenocarcinoma, indicating a correlation between the Gly-to-Asp mutation and response to therapy. Oncogenic: The Gly-to-Asp mutation in the KRAS oncogene is described as contributing to tumor development in pancreatic ductal adenocarcinoma, as it is found in more than 90% of patients with this cancer type.

Gene→Variant (gene-first): 3845:Gly-to-Asp

Genes: 3845

Variants: Gly-to-Asp

[Paragraph-level] PMCID: PMC3542862 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses somatic mutations in PIK3CA (including R115P, E542K, H1047L, and H1047R) that contribute to the pathophysiology of macrodactyly, indicating their role in tumor development or progression through activation of the PI3K/AKT signaling pathway. Functional: The passage mentions that the identified mutations lead to AKT activation, which indicates that these variants alter molecular or biochemical function related to cell signaling pathways.

Gene→Variant (gene-first): 5290:E542K 5290:H1047L 5290:H1047R 5163:R115P

Genes: 5290 5163

Variants: E542K H1047L H1047R R115P

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 9

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that KRAS G12C and G13D mutations are associated with inferior progression-free survival (PFS) and overall survival (OS) in mCRC patients, suggesting a correlation with disease outcome independent of therapy. Diagnostic: The mention of KRAS mutations being associated with heterogeneous outcomes compared to unmutated tumors implies that these variants can be used to classify or define a disease subtype in mCRC.

Gene→Variant (gene-first): 3845:G12C 3845:G13D

Genes: 3845

Variants: G12C G13D

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the correlation of KRAS mutations, including specific variants like G12C and G13D, with inferior overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Diagnostic: The passage mentions that mutations in KRAS were diagnosed in tumors, indicating that these mutations are used to classify or define the disease.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses how KRAS G12C and G13D mutations correlate with inferior progression-free and overall survival in metastatic colorectal cancer patients, indicating their prognostic significance. Diagnostic: The mention of KRAS mutations being associated with tumor characteristics suggests their role in classifying or defining the disease subtype in colorectal cancer.

Gene→Variant (gene-first): 3845:G12C 3845:G13D

Genes: 3845

Variants: G12C G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 11

Evidence Type(s): Prognostic, Oncogenic

Justification: Prognostic: The passage discusses the correlation of KRAS exon 2 variants, specifically G12C and G13D, with overall survival (OS) and progression-free survival (PFS), indicating their impact on disease outcome independent of therapy. Oncogenic: The mention of KRAS exon 2 variants suggests their role in tumor development or progression, as they are associated with inferior survival outcomes in patients with mutated tumors compared to non-mutated tumors.

Gene→Variant (gene-first): 3845:G12C 3845:G12D 3845:G12V 3845:G13D

Genes: 3845

Variants: G12C G12D G12V G13D

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 10

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses the median progression-free survival (PFS) and overall survival (OS) associated with specific KRAS mutations, indicating a correlation with disease outcomes independent of therapy. Diagnostic: The mention of KRAS exon 2 mutant tumor subtypes suggests that these variants are used to classify or define a specific disease subtype.

Gene→Variant (gene-first): 3845:A146T 3845:G12C 3845:G12D 3845:G13D 3845:Q61H

Genes: 3845

Variants: A146T G12C G12D G13D Q61H

[Paragraph-level] PMCID: PMC4999563 Section: RESULTS PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that tumors carrying BRAF V600E mutations were identified, suggesting an association with the classification of the tumors. Oncogenic: The mention of BRAF V600E mutations in tumors implies a role in tumor development or progression, characteristic of oncogenic variants.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC9837058 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how mutations in PIK3CA, including G1049R, H1047R, and M1043I/L, contribute to the activation of the PI3K pathway, indicating their role in tumor development or progression. Functional: The passage describes how specific mutations alter the conformation and binding properties of the p110alpha subunit, indicating that these variants affect molecular function related to PI3K activation.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043I/L

Genes: 5290

Variants: G1049R H1047R M1043I/L

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the H1047R variant alters the binding interactions and structural dynamics of the protein in response to pY binding, indicating a change in molecular function.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 18

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the H1047R and G1049R variants alter the molecular interactions and conformations within the kinase domain, indicating a change in biochemical function related to the protein's activity. Oncogenic: The evidence suggests that the H1047R and G1049R variants contribute to activation through disruption of the inhibitory conformation, which is indicative of their role in tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 17

Evidence Type(s): Functional

Justification: Functional: The passage discusses changes observed for the H1047R variant in the context of HDX-MS experiments, indicating that it alters molecular or biochemical function, specifically in terms of perturbations in conformation.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how C-terminal mutations, including M1043L, H1047R, G1049R, and N1068fs, affect the inhibitory interaction with the C-terminus, indicating an alteration in molecular function. Oncogenic: The mention of "oncogenic mutation" in relation to M1043L, H1047R, and G1049R suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants H1047R, G1049R, M1043L, and N1068fs alter membrane binding and ATPase activity, indicating changes in molecular function. Oncogenic: The variants are described in the context of their effects on membrane binding and ATPase activity, which suggests a role in tumor development or progression.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the intrinsic ATPase activity of the p110alpha mutants, indicating that the variants G1049R, H1047R, and M1043L alter molecular function by exhibiting significantly increased ATPase activity compared to wild type. Oncogenic: The context of the passage implies that the variants are somatic mutations in a cancer-related gene, contributing to tumor development or progression through their altered biochemical activity.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:M1043L 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R M1043L N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses frequent oncogenic mutants and their role in tumor samples, indicating that these variants contribute to tumor development or progression. Functional: The analysis of the mutants and their binding to full-length p85alpha suggests that these variants alter molecular or biochemical function, specifically in the context of their interaction with regulatory complexes.

Gene→Variant (gene-first): 5290:G1049R 5290:H1047R 5290:H1047R/L 5290:M1043L 5290:M1043L/I 5290:N1044K 5290:N1068fs

Genes: 5290

Variants: G1049R H1047R H1047R/L M1043L M1043L/I N1044K N1068fs

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the H1047R mutation in the context of its role in activating the kinase domain and increasing membrane binding, indicating its contribution to tumor development or progression. Functional: The passage describes how the H1047R mutation alters the molecular interactions and structural organization of the kinase domain, affecting its binding properties and functionality.

Gene→Variant (gene-first): 5290:H1047R 5290:His1047 5290:Met1043

Genes: 5290

Variants: H1047R His1047 Met1043

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the E726K variant in the context of oncogenic mutations and its association with conformational changes that contribute to tumor development, indicating its role in cancer progression. Functional: The passage describes how the E726K variant leads to conformational changes affecting the interaction between the ABD and p85 with the catalytic core, suggesting an alteration in molecular function.

Gene→Variant (gene-first): 5290:E726K

Genes: 5290

Variants: E726K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the N345K variant affects the molecular interactions and binding of the p110alpha/p85alpha complex to membranes, indicating an alteration in biochemical function.

Gene→Variant (gene-first): 5290:N345K

Genes: 5290

Variants: N345K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 4

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses oncogenic mutants (N345K, G106V, and G118D) and their expected role in promoting ABD/iSH2 disengagement, indicating their contribution to tumor development or progression. Functional: The data suggests that the variants alter the dynamics of the ABD-p85 complex and its interaction with the p110alpha catalytic core, indicating a change in molecular function related to binding and mobility.

Gene→Variant (gene-first): 5290:G106V 5290:G118D 5290:N345K

Genes: 5290

Variants: G106V G118D N345K

[Paragraph-level] PMCID: PMC9837058 Section: RESULTS PassageIndex: 2

Evidence Type(s): Functional

Justification: Functional: The passage discusses the D915N mutation in the context of its effect on protein conformation and membrane binding, indicating that it alters molecular function as assessed by HDX-MS experiments.

Gene→Variant (gene-first): 5290:D915N

Genes: 5290

Variants: D915N

[Paragraph-level] PMCID: PMC6280667 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the correlation of mutations, including those in splicing components like ZRSR2, with sensitivity to various drugs, indicating a relationship between the variant and treatment response.

Gene→Variant (gene-first): 8233:serine/arginine

Genes: 8233

Variants: serine/arginine

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the tumor forming capacity of cells expressing the ERBB2 E401G variant, indicating that this somatic variant contributes to tumor development as evidenced by increased tumor growth in vivo.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the effects of the ERBB2 E401G and S310F variants on the proliferative and invasive capacities of cancer cells, indicating that these variants alter molecular or biochemical functions related to cell behavior. Oncogenic: The evaluation of the proliferative and invasive capacities of cells expressing the ERBB2 variants suggests that these somatic variants contribute to tumor development or progression.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 15

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants E401G and S310F alter the phosphorylation of downstream signaling pathway proteins, indicating a change in molecular function related to the MAPK pathway. Oncogenic: The evidence suggests that the variants contribute to tumor development or progression by activating signaling pathways associated with cancer, specifically through the ERBB2 dimerization and its effects on downstream signaling.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the E401G and S310F mutations affect the dimer interface stability of the EGFR-HER2 complex, indicating that these variants alter molecular interactions and stability.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional

Justification: Functional: The passage indicates that the variant p.(E401G) alters the stability of the ligand-free EGFR HER2 heterodimer, which suggests a change in molecular function.

Gene→Variant (gene-first): 2176:p.(E401G)

Genes: 2176

Variants: p.(E401G)

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 9

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants E401G and S310F lead to increased phosphorylation levels of HER2 and EGFR, indicating that these variants alter molecular function related to protein activity. Oncogenic: The context of the passage suggests that the variants E401G and S310F contribute to tumor development or progression by enhancing the phosphorylation of key HER family proteins involved in oncogenesis.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional

Justification: Functional: The passage discusses the identification of potential dimerization partners of the HER2 E401G protein, indicating that the variant alters molecular interactions.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 7

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants S310F and E401G alter the C-terminal phosphorylation of HER2, indicating a change in molecular function.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses the ability of the variants E321G, E401G, and S310F to form disulfide-linked dimers, indicating that these variants alter molecular function related to protein interactions.

Gene→Variant (gene-first): 7157:E321G 2176:E401G 2064:S310F

Genes: 7157 2176 2064

Variants: E321G E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional

Justification: Functional: The passage mentions the evaluation of mechanisms for multiple ERBB2 variants, including E321G, E401G, S310F, and D845A, which suggests that these variants are being assessed for their biochemical functions.

Gene→Variant (gene-first): 2064:D845A 7157:E321G 2176:E401G 2064:S310F

Genes: 2064 7157 2176

Variants: D845A E321G E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 4

Evidence Type(s): Functional

Justification: Functional: The passage indicates that ERBB2 E401G has functional properties similar to S310F, suggesting that these variants alter molecular or biochemical function.

Gene→Variant (gene-first): 2176:E401G 2064:S310F

Genes: 2176 2064

Variants: E401G S310F

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage describes the ERBB2 E401G variant as a somatic mutation that is associated with ERBB2 gene amplification, indicating its contribution to tumor development or progression. Functional: The passage mentions that multiple computational tools supported a deleterious effect of the ERBB2 E401G variant on the encoded gene product, suggesting that it alters molecular or biochemical function.

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC8881279 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic

Justification: Diagnostic: The passage mentions the detection of the ERBB2 E401G variant of uncertain significance (VUS) in a patient, indicating its use in defining or classifying a disease context, specifically in a patient with cancer of unknown primary (CUP).

Gene→Variant (gene-first): 2176:E401G

Genes: 2176

Variants: E401G

[Paragraph-level] PMCID: PMC6938308 Section: RESULTS PassageIndex: 2

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage indicates that KRAS codon p.12G and BRAF codon p.600V somatic mutations have been linked to brain AVMs, suggesting their role in defining or classifying the disease. Oncogenic: The mention of likely somatic disease-causing mutations, including KRAS mutations (p.G12D and p.G12V) and BRAF mutations (p.V600E and p.Q636X), indicates that these variants contribute to tumor development or progression.

Gene→Variant (gene-first): 3845:p.12G 673:p.600V 3845:p.G12D 3845:p.G12V 673:p.Q636X 673:p.V600E

Genes: 3845 673

Variants: p.12G p.600V p.G12D p.G12V p.Q636X p.V600E

[Paragraph-level] PMCID: PMC8307492 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the association of the L858R variant with overall survival (OS) in patients treated with first-line EGFR inhibitors, indicating its relevance to treatment response. Oncogenic: The L858R variant is mentioned in the context of EGFR mutations in non-small-cell lung cancer (NSCLC), suggesting its role in tumor development or progression as part of the broader analysis of clinically actionable EGFR mutations.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC8307492 Section: RESULTS PassageIndex: 18

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the T790M mutation as a mechanism of resistance to the EGFR inhibitor osimertinib, indicating its correlation with treatment response. Oncogenic: The T790M mutation is described as contributing to resistance in patients treated with EGFR inhibitors, suggesting its role in tumor progression.

Gene→Variant (gene-first): 1956:G719S 1956:L858R 1956:L861Q 1956:T790M

Genes: 1956

Variants: G719S L858R L861Q T790M

[Paragraph-level] PMCID: PMC10805385 Section: RESULTS PassageIndex: 17

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The passage discusses the overexpression of HOXC10 in KRAS-mutant tumors, specifically mentioning the genotype KRAS G12C/TP53 G245V, indicating that these somatic variants contribute to tumor development or progression. Predictive: The passage mentions the efficacy of combined MEK/BET inhibitors causing tumor regression in KRAS-mutant patient-derived xenograft models, suggesting a correlation between the variants and response to therapy.

Gene→Variant (gene-first): 3845:G12C 7157:G245V

Genes: 3845 7157

Variants: G12C G245V

[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of KRASG12D mutant MEFs to a drug combination, indicating that the variant is associated with resistance to growth inhibition by the therapies tested. Oncogenic: The KRASG12D variant is implicated in tumor behavior, as it is described in the context of MEFs (mouse embryonic fibroblasts) and their growth characteristics, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 3845:G12D

Genes: 3845

Variants: G12D

[Paragraph-level] PMCID: PMC10690049 Section: RESULTS PassageIndex: 6

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the response of KRAS G12C-mutant cells to specific therapies, indicating a correlation between the variant and sensitivity to the drugs MRTX849/AMG510 and KPT9274. Oncogenic: The variant KRAS G12C is implicated in tumor development, as the passage describes its presence in cancer cell lines and their proliferation in response to treatment, suggesting a role in cancer progression.

Gene→Variant (gene-first): 3845:G12C

Genes: 3845

Variants: G12C

The use of the word 'should' is a dark piece of diction in the education world. The public is the populace reading this article; they are the clientele in charge of voting to pass levies, voting for representatives to change the rules educators work with, and they are the ones to call the school when educators attempt to do their jobs. This word might be one of the culprits that drives the most educators from the profession when young teachers are introduced to the occupation, and the position is not what the new teacher believed it ‘should’ be.

Taking the time to examine why young teachers are no longer teachers should be the focus of all final semesters, in my opinion. Granted, institutions are tasked with producing educators, but to address the nationwide shortage, those same institutions have the obligation to shift their focus to developing teachers with longevity.

With teaching experience as a guide, this is absolutely true, but there is so much more to it. It is the extra things that those two actions force you to do as an educator that help teachers stay teachers.

The problem with being resilient and persistent is that burnout is far more prevalent in our world. You cannot light yourself on fire to keep others warm and survive to tell about it, or even better, keep doing it.

T'Challa is realizing that he's being talked about poorly.

start the speech with a statement that the united Indian nations want to address congress as equals

Former SPEAKER OF THE HOUSE

[Paragraph-level] PMCID: PMC7611203 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of specific pathogenic mutations in patients, indicating their association with disease, which supports the use of these variants for classification and diagnosis. Oncogenic: The mention of pathogenic mutations suggests that these variants contribute to tumor development or progression, particularly in the context of BRCA1 and BRCA2 mutations associated with cancer.

Gene→Variant (gene-first): 672:c.185delAG 672:c.5266dupC 675:c.5946delT 675:c.6174delT 672:c.68_69delAG

Genes: 672 675

Variants: c.185delAG c.5266dupC c.5946delT c.6174delT c.68_69delAG

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 16

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses median overall survival (OS) in relation to the L858R mutation, indicating that there is no statistically significant difference in OS between patients with the L858R mutation and those with other mutations, which relates to disease outcome. Diagnostic: The mention of the L858R mutation in the context of comparing survival outcomes suggests its role in classifying or defining patient subgroups based on mutational status.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 14

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage discusses time to tumor progression (TTP) in relation to different mutation groups, including L858R, indicating a correlation with disease outcome independent of therapy. Diagnostic: The mention of "classical mutations group" and comparisons with "wild-type" suggests that the L858R variant is used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 12

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the disease control rate (DCR) in relation to specific mutations, indicating a correlation between the presence of mutations (including L858R, G719D, and E746V) and treatment outcomes, which suggests predictive evidence regarding therapy response. Diagnostic: The mention of 'classical' mutations and their association with disease control rates implies that these mutations, including L858R, G719D, and E746V, are used to classify or define a subtype of the disease.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 7

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the incidence of the L858R mutation in relation to patient demographics and histology, indicating its association with specific patient groups and suggesting its role in defining or classifying disease subtypes. Oncogenic: The mention of the L858R mutation in the context of 'classical mutations' and its presence in patients with tumors suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC2360265 Section: RESULTS PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of patient groups based on their mutational status, specifically mentioning the presence of classical mutations such as G719D, E746V, and L858R, which are used to classify patients. Oncogenic: The passage indicates that the reported EGFR mutations, including G719D, E746V, and L858R, were found to be of somatic origin, suggesting their contribution to tumor development or progression.

Gene→Variant (gene-first): 1956:E746V 1956:G719D 1956:L858R

Genes: 1956

Variants: E746V G719D L858R

[Paragraph-level] PMCID: PMC2360265 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the association of classical mutations, including G719X and L858R, with sensitivity to tyrosine kinase inhibitors (TKIs) in patients with NSCLC, indicating a correlation with treatment response. Diagnostic: The mention of classical mutations in the EGFR tyrosine kinase domain being associated with sensitivity to TKIs suggests that these variants can be used to classify or define a subtype of disease in NSCLC patients.

Gene→Variant (gene-first): 1956:G719X 1956:L858R

Genes: 1956

Variants: G719X L858R

[Paragraph-level] PMCID: PMC4385014 Section: RESULTS PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the sensitivity of different cell lines to erlotinib treatment, indicating that the presence of the L858R and T790M mutations correlates with reduced sensitivity to the drug, which is a predictive relationship regarding therapy response. Oncogenic: The L858R and T790M mutations are described in the context of their presence in NSCLC cell lines, suggesting their role in tumor development or progression, which aligns with the definition of oncogenic variants.

Gene→Variant (gene-first): 1956:L858R 1956:T790M

Genes: 1956

Variants: L858R T790M

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 12

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage indicates that the PIK3CA H1047R mutation contributes to tumor development and progression, as it is associated with high-grade astrocytoma (WHO IV) and is linked to localized survival and growth advantages in tumor areas where it is acquired. Functional: The H1047R mutation affects the catalytic domain of PIK3CA, suggesting that it alters the molecular function of the protein, which is further supported by the mention of its role in PI3K activation and associated pathways.

Gene→Variant (gene-first): 5290:H1047R

Genes: 5290

Variants: H1047R

[Paragraph-level] PMCID: PMC4823825 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The K27M mutation is described as an oncogenic mutation associated with high-grade gliomas (HGG) and is present in a majority of the analyzed DIPG samples, indicating its contribution to tumor development or progression.

Gene→Variant (gene-first): 8358:K27M

Genes: 8358

Variants: K27M

ça ressemble un peu à cette extension "Hypothesis" au final, sans avoir besoin d'installer d'extension.

The state of { journalism, the Web–industrial complex, and understanding about the fundamentals of research and scholarship } are so poor that the staff actually had to justify something as simple as citing your sources.

(In 2010, but still… 2010!)

[Paragraph-level] PMCID: PMC4823091 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Predictive, Functional

Justification: Oncogenic: The passage discusses the HER3 V855A somatic mutation's role in the development and progression of non-small cell lung cancer (NSCLC), indicating its contribution to tumor behavior. Predictive: The text mentions that HER-targeted inhibitors potently suppress mutant HER3 activity, suggesting a correlation between the V855A variant and response to targeted therapies. Functional: The passage states that in silico computational modeling predicts that the V855A mutation alters the kinase domain and c-terminal end of the HER3 protein, indicating a change in molecular function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 26

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the V855A mutation alters the activity of HER3, which relates to its molecular function. Oncogenic: The mention of the V855A mutation correlating with a malignant phenotype suggests that it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the conformation of the wild-type HER3 protein, indicating a change in molecular function related to the kinase domain.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 24

Evidence Type(s): Functional

Justification: Functional: The passage discusses the impact of the V855A variant on HER3 protein structure, indicating that it alters molecular or biochemical function.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 23

Evidence Type(s): Predictive

Justification: Predictive: The passage indicates that tumors harboring HER3-V855A may predict response to targeted therapy, suggesting a correlation between the variant and treatment response.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 22

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the effectiveness of HER inhibitors on colony formation in the presence of the V855A variant, indicating a correlation with response to therapy. Oncogenic: The V855A variant is mentioned in the context of colony formation assays, suggesting it contributes to tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 21

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses the growth inhibitory effects of various inhibitors on cells expressing the HER3-V855A variant, indicating a correlation between the variant and response to specific therapies, such as afatinib and erlotinib. Functional: The variant HER3-V855A is examined in the context of its effect on cell growth and response to inhibitors, suggesting that it alters the molecular function of the HER3 receptor in relation to drug sensitivity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the V855A mutation alters the physical interaction between HER3 and HER2, indicating a change in molecular function through enhanced interaction, which is supported by co-immunoprecipitation experiments.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 16

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the HER3-V855A variant enhances trans-phosphorylation of HER2, indicating an alteration in molecular function related to signaling pathways.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 14

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A variant alters the phosphorylation levels of HER3 and AKT, indicating a change in molecular function related to signaling pathways. Oncogenic: The text implies that the V855A variant contributes to transforming activity, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the functional relevance of the HER3-V855A variant, indicating that it alters the growth response of Ba/F3 cells when co-expressed with EGFR, demonstrating a change in molecular function related to TGFalpha treatment. Oncogenic: The passage implies that the HER3-V855A mutation has pathogenic effects, suggesting a role in tumor development or progression, particularly in the context of its interaction with EGFR and response to growth factors.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses the ability of the HER3-V855A variant to alter colony size in response to treatment, indicating a change in molecular or biochemical function. Oncogenic: The variant HER3-V855A is implicated in colony formation, which suggests its role in tumor development or progression.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the transforming potential of the HER3-V855A variant in the context of IL-3-independent growth, indicating that this somatic variant contributes to tumor development or progression as evidenced by the growth response in Ba/F3 cells. Functional: The variant HER3-V855A alters the growth response of Ba/F3 cells when stimulated with NRG1beta, demonstrating a change in molecular function related to HER3/HER2 biological activity.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses the HER3-V855A variant in the context of oncogenic transformation and tumorigenesis, indicating that it may contribute to tumor development when co-expressed with HER2. Functional: The study investigates the functional impact of the HER3-V855A variant in a cellular model, focusing on its properties and effects on cell behavior in a controlled environment.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 8

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the V855A mutation may have a functional effect by altering protein kinase activity, as indicated by its position in a conserved sequence motif and its analysis through structural studies. Oncogenic: The mention of the BRAF-L597V mutation being classified as an intermediate kinase active variant that increases ERK activation suggests that the V855A mutation may contribute to tumor development or progression through its functional implications.

Gene→Variant (gene-first): 673:L597V 1956:L858 1956:L858R 324:V855 324:V855A

Genes: 673 1956 324

Variants: L597V L858 L858R V855 V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 7

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage states that the L858R mutation sensitizes to inhibition by small molecule TKIs, indicating a correlation with response to therapy. Diagnostic: The L858R mutation is described as having the highest prevalence among activating EGFR kinase domain missense mutations, which suggests its use in defining or classifying a subtype of disease.

Gene→Variant (gene-first): 1956:L858R

Genes: 1956

Variants: L858R

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 6

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 1956:L858R 324:V855A

Genes: 1956 324

Variants: L858R V855A

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 5

Evidence Type(s): Oncogenic, Predictive

Justification: Oncogenic: The HER3-V855A mutation was detected in the tumor sample, indicating that it is a somatic variant contributing to tumor development or progression. Predictive: The passage discusses the treatment of patients with advanced NSCLC with erlotinib based on the presence of an EGFR mutation, suggesting a correlation between the mutation and response to therapy.

Gene→Variant (gene-first): 2065:T-to-C 324:V855A 324:p. Val855Ala 324:valine (GTG) to alanine (GCG) at codon 855

Genes: 2065 324

Variants: T-to-C V855A p. Val855Ala valine (GTG) to alanine (GCG) at codon 855

[Paragraph-level] PMCID: PMC4823091 Section: RESULTS PassageIndex: 4

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 324:V855A

Genes: 324

Variants: V855A

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

https://github.com/solbjorg/oberon-riscv

term / defintion

When writing it is important to follow these steps to make the best form of your essay. Following these steps can help you be organized and lay out your thoughts so it can make since when you write the final product.

I think that this is especially helpful for young children who don’t have strong reading skills yet.

It is important to have a positive relationship with your librarian because they can be a great resource for materials, books, and other technology.

[Paragraph-level] PMCID: PMC7545690 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Prognostic, Diagnostic

Justification: Prognostic: The passage indicates that the rs3786362 G allele is significantly associated with progression-free survival (PFS) and overall survival (OS), which are outcomes related to disease prognosis. Diagnostic: The association of the rs3786362 G allele with tumor characteristics suggests it may be used to classify or define disease subtypes, particularly in colorectal cancer (CRC).

Gene→Variant (gene-first): 7298:rs3786362

Genes: 7298

Variants: rs3786362

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 7

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the overall response rates and clinical benefit rates of patients with BRAF V600E positive metastatic colorectal cancer treated with vemurafenib and erlotinib, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC10011885 Section: ABSTRACT PassageIndex: 3

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the use of BRAF V600E mutant colorectal cancer in the context of therapy, specifically mentioning the effectiveness of combination therapy with BRAF inhibitors and EGFR-targeting antibodies, indicating a correlation with treatment response. Oncogenic: The mention of BRAF V600E in the context of metastatic colorectal cancer suggests that this somatic variant contributes to tumor development or progression, as it is associated with a significant clinical problem in this cancer type.

Gene→Variant (gene-first): 673:V600E

Genes: 673

Variants: V600E

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 6

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses somatic mutations, specifically p.K656E and p.V561M, which are described as activating mutations affecting FGFR1, indicating their contribution to tumor development or progression.

Gene→Variant (gene-first): 2260:c.1681G>A 2260:c.1966A>G 2260:p.K656E 2260:p.V561M

Genes: 2260

Variants: c.1681G>A c.1966A>G p.K656E p.V561M

[Paragraph-level] PMCID: PMC8077124 Section: RESULTS PassageIndex: 3

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage discusses the tumor's pathology and mentions the IDH1 (p.R132H) variant as being negative in the tumor, indicating its role in tumor development or progression.

Gene→Variant (gene-first): 3417:p.R132H 673:p.V600E

Genes: 3417 673

Variants: p.R132H p.V600E

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Predictive, Diagnostic

Justification: Predictive: The passage discusses the activity of osimertinib in a patient with the p.L755P mutation, indicating a correlation with treatment response. Diagnostic: The variant p.L755P is described as being present in a patient with NSCLC, suggesting its role in defining or classifying the disease.

Gene→Variant (gene-first): 2064:p.L755P

Genes: 2064

Variants: p.L755P

[Paragraph-level] PMCID: PMC10183391 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Predictive, Oncogenic

Justification: Predictive: The passage discusses the patient's response to osimertinib treatment, indicating that the variant correlates with a therapeutic response. Oncogenic: The variant is described in the context of a tumor mutation in a patient with stage IV NSCLC, suggesting its role in tumor development or progression.

Gene→Variant (gene-first): 2064:c.2262_2264delinsTCC 2064:p.(L755P)

Genes: 2064

Variants: c.2262_2264delinsTCC p.(L755P)

[Paragraph-level] PMCID: PMC7064492 Section: ABSTRACT PassageIndex: 1

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses MAP2K1 mutations, including p.K57N, in the context of their presence in endothelial cells and their role in local tissue overgrowth associated with arteriovenous malformation (AVM), indicating a contribution to tumor development or progression. Functional: The study investigates the effects of the MAP2K1 mutation on local tissue overgrowth, suggesting that the variant alters molecular or biochemical function in the context of AVM pathology.

Gene→Variant (gene-first): 5604:p.K57N

Genes: 5604

Variants: p.K57N

[Paragraph-level] PMCID: PMC7342819 Section: ABSTRACT PassageIndex: 4

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the identification of a germline mutation (PALB2 c.3114-1G>A) and its association with the patient's diagnosis of pancreatic cancer, indicating its role in defining or confirming the disease. Oncogenic: The somatic mutation (PALB2 c.2514+1G>C) is mentioned in the context of molecular profiling, suggesting its contribution to tumor development or progression in the patient with pancreatic cancer.

Gene→Variant (gene-first): 79728:c.2514+1G>C 79728:c.3114-1G>A

Genes: 79728

Variants: c.2514+1G>C c.3114-1G>A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 43

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations (e.g., G142V, M523V, G524D, M537V) alter transactivational activity and regulatory element binding, indicating changes in molecular function. Oncogenic: The analysis of mutations in the context of prostate cancer (PCa) suggests that these variants contribute to tumor development or progression, particularly through their effects on transactivational activity related to cancer-related genes.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 1387:M749I 10514:Q798E 10499:R629Q 10499:T575A

Genes: 2232 367 1387 10514 10499

Variants: G142V G524D M523V M537V M749I Q798E R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 41

Evidence Type(s): Oncogenic, Functional

Justification: Oncogenic: The passage discusses how the M886I variant may drive cancer progression through altered binding and other mechanisms, indicating its role in tumor development. Functional: The passage mentions that the M886I variant may alter binding to co-repressors or co-regulators, which suggests a change in molecular function.

Gene→Variant (gene-first): 9611:M886I

Genes: 9611

Variants: M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 36

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants M749I, Q798E, and H874Y alter the molecular function of the androgen receptor, specifically in terms of their constitutive activity and loss of function in response to DHT. Oncogenic: The passage indicates that the mutations M749I, Q798E, and H874Y may contribute to prostate cancer development and progression, particularly through their effects on androgen receptor signaling and activity.

Gene→Variant (gene-first): 367:H874Y 1387:M749I 10514:Q798E

Genes: 367 1387 10514

Variants: H874Y M749I Q798E

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 35

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations T575A, R629Q, and I672T alter the molecular function of the androgen receptor (AR), affecting its binding and transactivation capabilities, indicating a change in biochemical activity. Oncogenic: The passage mentions that the mutation K630 to glutamine increases transactivational activity and promotes prostate cancer cell survival and growth, suggesting that this variant contributes to tumor development or progression.

Gene→Variant (gene-first): 2908:I672 2908:I672T 10499:R629 10499:R629Q 10499:T575A

Genes: 2908 10499

Variants: I672 I672T R629 R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 34

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants L57Q, G142V, P390L, and P533S alter the function of the androgen receptor, indicating changes in activity in response to DHT, which aligns with evidence of altered molecular or biochemical function. Oncogenic: The variants are described in the context of their roles in tumor development or progression, particularly with references to gain or loss of function in the androgen receptor, which is relevant to cancer biology.

Gene→Variant (gene-first): 2232:G142V 367:L57Q 367:P390L 367:P533S

Genes: 2232 367

Variants: G142V L57Q P390L P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 33

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the AR mutations P390L, T575A, and R629Q affect the molecular function of the androgen receptor, specifically its affinity for regulatory elements, indicating a change in biochemical activity.

Gene→Variant (gene-first): 367:P390L 10499:R629Q 10499:T575A

Genes: 367 10499

Variants: P390L R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 30

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations D879G, H874Y, Q919R, and T877A alter the molecular or biochemical function of the protein, specifically in terms of gain or loss of function and ligand binding activity. Oncogenic: The mention of the mutated AR being expressed in a commonly used prostate cancer cell line (LNCaP) suggests that these mutations may contribute to tumor development or progression.

Gene→Variant (gene-first): 10499:D879G 367:H874Y 367:Q919R 367:T877A

Genes: 10499 367

Variants: D879G H874Y Q919R T877A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 29

Evidence Type(s): Predisposing, Functional

Justification: Predisposing: The variant K720E is implicated in a 6-fold increased risk of prostate cancer, indicating its role in inherited risk for developing the disease. Functional: The passage discusses how mutations K720E and R726L impair binding of co-regulatory proteins and disrupt interactions, indicating that these variants alter molecular function. Additionally, N756's mutation to aspartate resulted in complete loss of function, further supporting its functional impact.

Gene→Variant (gene-first): 367:A765T 9611:K720E 367:N756 367:Q902 367:Q902R 367:R726L 367:Y763C 9611:lysine 720

Genes: 367 9611

Variants: A765T K720E N756 Q902 Q902R R726L Y763C lysine 720

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 28

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how specific mutations, including V757A and Q798E, show impaired binding to co-regulatory proteins and altered transactivational activity, indicating changes in molecular function. Oncogenic: The mention of loss of function mutations clustered in the ligand binding domain (LBD) and their association with reduced transactivational activity suggests a role in tumor development or progression, particularly in the context of antiandrogen treatment.

Gene→Variant (gene-first): 367:A748V 367:A765T 9611:K720E 367:L744F 1387:M749 1387:M749I 9611:M886V 367:N756D 10514:Q798E 367:Q902R 367:R726L 367:S759P 10514:V757A 10514:V757I 367:Y763C

Genes: 367 9611 1387 10514

Variants: A748V A765T K720E L744F M749 M749I M886V N756D Q798E Q902R R726L S759P V757A V757I Y763C

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 27

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the M886I mutation alters the interaction of the androgen receptor (AR) with co-activators and co-repressors, affecting transactivation ability, which indicates a change in molecular function. Oncogenic: The passage implies that the M886I mutation could significantly alter activity in prostate cancer, suggesting a role in tumor development or progression.

Gene→Variant (gene-first): 367:K910R 9611:M886 9611:M886I

Genes: 367 9611

Variants: K910R M886 M886I

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 25

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the variants A586V, A587S, T575A, R629Q, and I672T alter molecular function, specifically their effects on transactivational activity and ligand binding in response to different concentrations of DHT.

Gene→Variant (gene-first): 597:A586V 367:A587S 2908:I672T 10499:R629Q 10499:T575A

Genes: 597 367 2908 10499

Variants: A586V A587S I672T R629Q T575A

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 23

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations (including P533S, G142V, M523V, G524D, and M537V) alter the transactivation activity of the androgen receptor, indicating that these variants affect molecular function related to protein activity in response to DHT. Oncogenic: The passage implies that the mutations contribute to prostate cancer by leading to constitutive transactivation activity, which is a characteristic of oncogenic variants that drive tumor development.

Gene→Variant (gene-first): 2232:G142V 367:G524D 367:M523V 367:M537V 367:P533S

Genes: 2232 367

Variants: G142V G524D M523V M537V P533S

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 22

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the variants P269S, P390L, P514S, and S515G alter transactivational activity in response to DHT, indicating a change in molecular function. Oncogenic: The mention of the variants impacting AR signaling suggests a role in tumor development or progression, as alterations in androgen receptor signaling are often associated with cancer.

Gene→Variant (gene-first): 367:P269S 367:P390L 367:P514S 10514:S515G

Genes: 367 10514

Variants: P269S P390L P514S S515G

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 21

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the S296R mutation alters interaction with the co-repressor N-CoR, causing reduced transactivational activity, and how the P340L mutation affects binding with TFIIF, indicating changes in molecular function. Oncogenic: The passage describes how the P340L mutation can drive prostate cancer progression through reduced growth suppression, indicating its role in tumor development.

Gene→Variant (gene-first): 207:D221H 367:D528G 367:E198G 367:P269S 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 207 367 2232 9611

Variants: D221H D528G E198G P269S P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 20

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the mutations L57Q, E198G, D221H, A234T, S296R, S334P, P340L, P504L, and D528G result in loss of function, indicating that these variants alter molecular or biochemical function. Oncogenic: The mention of mutations leading to loss of function and their association with transactivational ability suggests a role in tumor development or progression, particularly in the context of the mutations being present in AIS (androgens insensitivity syndrome).

Gene→Variant (gene-first): 1387:A234T 207:D221H 367:D528G 367:E198G 367:L57Q 2232:P340L 9611:P504L 367:S296R 367:S334P

Genes: 1387 207 367 2232 9611

Variants: A234T D221H D528G E198G L57Q P340L P504L S296R S334P

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 19

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage indicates that the mutation M537R shows a 23% gain of function at a specific concentration of DHT, suggesting an alteration in molecular or biochemical function. Oncogenic: The mention of gain of function in a low androgen environment implies that the variant may contribute to tumor development or progression, characteristic of oncogenic behavior.

Gene→Variant (gene-first): 367:G166S 367:M537R

Genes: 367

Variants: G166S M537R

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses the conservation and divergence of specific amino acids (T575, R629, I672) in relation to the function of the ligand-binding domain (LBD) of the androgen receptor, indicating that these variants may alter molecular function related to androgen binding.

Gene→Variant (gene-first): 2908:I672 10499:R629 10499:T575

Genes: 2908 10499

Variants: I672 R629 T575

[Paragraph-level] PMCID: PMC3293822 Section: RESULTS PassageIndex: 5

Evidence Type(s): Diagnostic, Functional

Justification: Diagnostic: The passage discusses the conservation of mutated residues in the AR gene and their association with prostate cancer (PCa), indicating that these variants are used to classify or define a disease subtype. Functional: The passage mentions examining amino acids implicated in prostate cancer and suggests a possible role in the mechanics of AR function, indicating that these variants may alter molecular or biochemical function.

Gene→Variant (gene-first): 1387:A234 207:D221 367:D528 367:E198 2232:G142 367:G166 367:G524 367:L57 367:M523 367:M537 367:P269 2232:P340 367:P390 367:P514 10514:P515 367:P533 367:S296 367:S334

Genes: 1387 207 367 2232 10514

Variants: A234 D221 D528 E198 G142 G166 G524 L57 M523 M537 P269 P340 P390 P514 P515 P533 S296 S334

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional, Oncogenic

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the BCL-2 protein to the drug S55746, indicating a change in molecular function related to drug interaction. Oncogenic: The G101V variant is implicated in the context of tumor development as it affects the binding of a therapeutic agent, suggesting its role in cancer progression.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101V 596:V101

Genes: 596

Variants: E152 E152A G101V V101

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 12

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V variant alters the binding affinity of the drug S55746, indicating a change in molecular function related to drug interaction. Predictive: The variant G101V is associated with a change in response to the drug S55746, as indicated by the differences in binding affinity and LC50 concentrations, suggesting its role in treatment sensitivity.

Gene→Variant (gene-first): 596:G101V

Genes: 596

Variants: G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 10

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the E152A mutation alters the binding affinity of the BCL-2 protein to venetoclax, indicating a change in molecular function related to protein binding. Predictive: The evidence suggests that the E152A mutation, when combined with G101V, restores high affinity binding to venetoclax, which implies a correlation with response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:E152A 596:G101A 596:G101V

Genes: 596

Variants: E152 E152A G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 9

Evidence Type(s): Predictive

Justification: Predictive: The passage discusses the role of E152 in venetoclax affinity, indicating a correlation with response or sensitivity to the therapy.

Gene→Variant (gene-first): 596:E152

Genes: 596

Variants: E152

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 8

Evidence Type(s): Predictive, Functional

Justification: Predictive: The passage discusses how the BCL-2 mutants, including G101V, F104L, and F104C, exhibit varying affinities for venetoclax, indicating their role in providing resistance to therapy. Functional: The passage describes how the BCL-2 mutants maintain tight binding to BH3 domains, which alters their molecular function and contributes to their ability to prevent apoptosis.

Gene→Variant (gene-first): 596:F104C 596:F104L 596:G101V

Genes: 596

Variants: F104C F104L G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 6

Evidence Type(s): Functional

Justification: Functional: The passage discusses how the F104L mutation alters the packing environment of the chlorophenyl moiety of the drug, indicating a change in molecular function related to the variant.

Gene→Variant (gene-first): 596:F104 596:F104L 596:L104

Genes: 596

Variants: F104 F104L L104

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 5

Evidence Type(s): Functional, Predictive

Justification: Functional: The passage discusses how the G101V mutation alters drug binding by changing the molecular interactions within the BCL-2 structure, indicating an alteration in biochemical function. Predictive: The evidence suggests that the G101V mutation impacts the binding affinity of venetoclax, which correlates with the response to this specific therapy.

Gene→Variant (gene-first): 596:E152 596:G101 596:G101A 596:G101V

Genes: 596

Variants: E152 G101 G101A G101V

[Paragraph-level] PMCID: PMC6547681 Section: RESULTS PassageIndex: 3

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 596:F104

Genes: 596

Variants: F104