Case11: Female, 48 years onset, 54 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 54, GAA Activity at ~8.5 pmol/min/mg before ERT and ~9 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs*45)

ClinVar: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Late Onset Pompe Disease

Case10: Male, 50 years onset, 52 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 53, GAA Activity at ~13 pmol/min/mg before ERT and ~15 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.784G>A (p.Glu262Lys)

ClinVar: 188806 https://www.ncbi.nlm.nih.gov/clinvar/variation/188806/

gnomAD: East Asian 5.016e-5, Overall 1.417e-5 http://gnomad.broadinstitute.org/variant/17-78081447-G-A

CaseAddInfo: Late Onset Pompe Disease

Case5: Male, 65 years onset, 72 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 72, GAA Activity at ~6 pmol/min/mg before ERT and ~10.5 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs*45)

ClinVar: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Late Onset Pompe Disease

Case14: Female, 15 years onset, 16 years diagnosis, Italy

HPOsFreeText: See Group Phenotypes, ERT started at 16, GAA Activity at ~8 pmol/min/mg before ERT and ~12 after

GroupGenotypingMethod: PCR Amplification and GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1927G>A (p.Gly643Arg)

ClinVar: 4023 https://www.ncbi.nlm.nih.gov/clinvar/variation/4023/

gnomAD: European (Non-Finnish) 3.667e-5, Overall 2.479e-5 http://gnomad.broadinstitute.org/variant/17-78086713-G-A

CaseAddInfo: Late Onset Pompe Disease

Case29: Female, 50 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 354 meters, Forced Vital Capacity at 116%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case37: Female, 62 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 475 meters, Forced Vital Capacity at 94%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case33: Female, 79 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 312 meters, Forced Vital Capacity at 113%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1560C>G (p.Asn520Lys)

CAID: CA401367200 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1560C%3EG

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case16: Female, 61 years report

HPOsFreeText: 7 years of ERT completed, 6 Minute Walking Test at 392 meters, Forced Vital Capacity at 52%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.693-1G>C

CAID: CA401362948 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-1G%3EC

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

Case32: Female, 45 years report

HPOsFreeText: ERT not started, 6 Minute Walking Test at 533 meters, Forced Vital Capacity at 77%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.1888+1G>A

CAID: CA8815511 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1888%2B1G%3EA

gnomAD: European (Non-Finnish) 9.843e-6, Overall 4.375e-6 http://gnomad.broadinstitute.org/variant/17-78086511-G-A

CaseAddInfo: Late Onset Pompe Disease

Case9: Female, 34 years report

HPOsFreeText: 6 years of ERT completed, 6 Minute Walking Test at 452 meters, Forced Vital Capacity at 76%

GenotypingMethod: GAA Gene Sequencing

Variant1: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

Variant2: NM_000152.4:c.1688A>T (p.Gln563Leu)

CAID: CA401368995 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1688A%3ET

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

CaseOPOPD-70: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.47 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2238G>T (p.Trp746Cys)

CAID: CA401324771 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2238G%3ET

gnomAD: Not in gnomAD

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CasePDC-9: Female, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 0.98, MS/MS ennzyme activity at 0.83

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2815_2816delGT (p.Val939Leufs)

ClinVar: 371481 https://www.ncbi.nlm.nih.gov/clinvar/variation/371481/

gnomAD:East Asian 1.631e-4, Overall 1.194e-5 http://gnomad.broadinstitute.org/variant/17-78093082-CTG-C

CaseAddInfo: Patient is either a carrier or has a pseudodeficency allele

CaseOPTPD-6: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.50 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

CaseAddInfo: One Pompe Mutation allele and Two Pseudodeficency Mutation alleles, Nomenclature indicates patient is homozygous for Variant 1 and Variant 2 is in cis with one copy, 70 other patients have the same genotype

CaseOPOPD-11: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.98 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.701C>T (p.Thr234Met)

ClinVar: CA8814994 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.701C%3ET

gnomAD: South Asian 3.266e-5, Overall 1.196e-5 http://gnomad.broadinstitute.org/variant/17-78081364-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation and One Pseudodeficency Mutation

CaseLP-1: Female, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 0.44, MS/MS ennzyme activity at 0.08

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.3:c.424_440del (p.Ser142Leufs*29)

CAID: CA658795228 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.424_440del17

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1958C>A (p.Thr653Asn)

CAID: CA8815557 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1958C%3EA

gnomAD: East Asian 2.548e-4, Overall 1.825e-5 http://gnomad.broadinstitute.org/variant/17-78086744-C-A

CaseAddInfo: Suspected Late Onset Pompe Disease

CaseIP2-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.09 umol/hr/L, Serum CK at 458 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.872T>C (p.Leu291Pro)

CAID: CA401363854 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.872T%3EC

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant3: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates Variant 1 and 2 are in trans, also that Variant 3 is in cis with only one of them

CasePDC-1: Female, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 1.15, MS/MS ennzyme activity at 1.2

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: Patient is either a carrier or has a pseudodeficency allele, Second allele is wildtype

CaseLP-2: Female, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 0.85, MS/MS ennzyme activity at 0.42

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.671G>A (p.Arg224Gln)

CAID: CA8814958 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.671G%3EA

gnomAD: African 8.060e-5, Overall 2.549e-5 http://gnomad.broadinstitute.org/variant/17-78079672-G-A

Variant2: NM_000152.4:c.752C>T (p.Ser251Leu)

ClinVar: 325781 https://www.ncbi.nlm.nih.gov/clinvar/variation/325781/

gnomAD: East Asian 2.760e-3, Overall 3.540e-4 http://gnomad.broadinstitute.org/variant/17-78081415-C-T

Variant3: NM_000152.4:c.761C>T (p.Ser254Leu)

ClinVar: 325782 https://www.ncbi.nlm.nih.gov/clinvar/variation/325782/

gnomAD: East Asian 2.759e-3, Overall 1.947e-4 http://gnomad.broadinstitute.org/variant/17-78081424-C-T

CaseAddInfo: Suspected Late Onset Pompe Disease, Nomenclature indicates Variants 2 and 3 are in cis

CaseOPOPD-5: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.97 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.503G>C (p.Arg168Pro)

CAID: CA401361673 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.503G%3EC

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation and One Pseudodeficency Mutation

CaseIP-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: 4MU enzyme activity at 0.43, MS/MS ennzyme activity at 0.13

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant in literature as c.1396C>T, however the reference has G there. Corrected for poossible typo.

Variant1: NM_000152.4:c.1396G>T (p.Val466Phe)

CAID: CA401366509 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1396G%3ET

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

CaseAddInfo: Infantile Onset Pompe Disease

CaseLP2-2: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.08 umol/hr/L, Serum CK at 109 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.424_440del17 (p.Ser142Leufs*29)

CAID: CA658795228 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.424_440del17

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1958C>A (p.Thr653Asn)

CAID: CA8815557 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1958C%3EA

gnomAD: East Asian 2.548e-4, Overall 1.825e-5 http://gnomad.broadinstitute.org/variant/17-78086744-C-A

CaseAddInfo: Late Onset Pompe Disease

CaseIP2-11: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.15 umol/hr/L, Serum CK at 662 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1935C>A (p.Asp645Glu)

ClinVar: 4029 https://www.ncbi.nlm.nih.gov/clinvar/variation/4029/

gnomAD: East Asian 1.729e-3, Overall 1.240e-4 http://gnomad.broadinstitute.org/variant/17-78086721-C-A

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant3: NM_000152.4:c.2303C>T (p.Pro768Leu)

CAID: CA401324900 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2303C%3ET

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Nomenclature indicates that Variant 1 and 3 are in trans and that 2 is in cis with one of them

CaseOPOPD-47: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.83 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1461C>G (p.Phe487Leu)

CAID: CA401366857 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1461C%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPOPD-52: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.13 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.1850T>G (p.Val617Gly)

CAID: CA401369628 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1850T%3EG

gnomAD: Not in gnomAD

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele

CaseOPM-2: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

CAID: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation, Nomenclature indicates Variants 1 and 2 are in cis and the other allele is Wildtype

CaseOPOPD-10: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 1.34 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.693-5C>T

ClinVar: CA8814990 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.693-5C%3ET

gnomAD: East Asian 3.516e-4, Overall 3.900e-5 http://gnomad.broadinstitute.org/variant/17-78081351-C-T

Variant2: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

CaseAddInfo: One Pompe Mutation and One Pseudodeficency Mutation

CaseLP2-7: Male, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.22 umol/hr/L, Serum CK at 89 U/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.752C>T (p.Ser251Leu)

ClinVar: 325781 https://www.ncbi.nlm.nih.gov/clinvar/variation/325781/

gnomAD: East Asian 2.760e-3, Overall 3.540e-4 http://gnomad.broadinstitute.org/variant/17-78081415-C-T

Variant2: NM_000152.4:c.761C>T (p.Ser254Leu)

ClinVar: 325782 https://www.ncbi.nlm.nih.gov/clinvar/variation/325782/

gnomAD: East Asian 2.759e-3, Overall 1.947e-4 http://gnomad.broadinstitute.org/variant/17-78081424-C-T

Variant3: NM_000152.4:c.1054C>T (p.Gln352Ter)

CAID: CA294891876 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA294891876

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

CaseOPOPD-67: Female, Taiwan, Birth diagnosis

HPOsFreeText: GAA (MS/MS) enzyme activity at 0.93 umol/hr/L

GenotypingMethod: GAA Gene Sequencing and PCR Amplification

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2236T>G (p.Trp746Gly)

ClinVar: 556431 https://www.ncbi.nlm.nih.gov/clinvar/variation/556431/

gnomAD: East Asian 6.410e-4, Overall 3.186e-5 http://gnomad.broadinstitute.org/variant/17-78090813-T-G

CaseAddInfo: One Pompe Mutation allele and One Pseudodeficency Mutation allele, 2 other patients have this genotype

Case88

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.836G>A (p.Trp279*)

CAID: CA401363637 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.836G%3EA

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case12

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2560C>T (p.Arg854*)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.1654delC (p.Leu552Serfs*26)

CAID: CA658795262 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1654delC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease

Case65

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.1798C>T (p.Arg600Cys)

CAID: CA8815481 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1798C%3ET

gnomAD: South Asian 3.267e-5, Overall 4.025e-6 http://gnomad.broadinstitute.org/variant/17-78086420-C-T

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case1

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1075G>T (p.Gly359Ter)

ClinVar: 420101 https://www.ncbi.nlm.nih.gov/clinvar/variation/420101/

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case39

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs*45)

CAID: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Infantile Onset Pompe Disease, 1 more patient has the same genotype

Case49

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.-32-17_-32-10delins TCCCTGCTGAGCCTCCTACAGGCCTCCCGC

CAID: CA913184750 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184750

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.1447G>A (p.Gly483Arg)

ClinVar: 285157 https://www.ncbi.nlm.nih.gov/clinvar/variation/285157/

gnomAD: African 6.170e-5, Overall 7.972e-6 http://gnomad.broadinstitute.org/variant/17-78084535-G-A

CaseAddInfo: Infantile Onset Pompe Disease

Case77

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.2560C>T (p.Arg854*)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Adult Late Onset Pompe Disease

Case30

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1327-2A>C

CAID: CA401366173 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.1327-2A%3EC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease, Patient is homozygous for this variant

Case53

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant: NM_000152.4:c.1655T>C (p.Leu552Pro)

ClinVar: 279811 https://www.ncbi.nlm.nih.gov/clinvar/variation/279811/

gnomAD: European (Non-Finnish) 7.053e-5, Overall 3.188e-5 http://gnomad.broadinstitute.org/variant/17-78085800-T-C

CaseAddInfo: Juvenile Late Onset Pompe Disease

Case4

HPOsFreeText: See Group Phenotypes

CasePreviousTesting: Sanger sequencing

CaseMethod1: Sanger sequencing and PCR Amplification

CaseMethod2: Whole Exome Sequencing (WES)

CaseGenotypingMethod: Patients were previously confirmed with Pompe disease by Sanger sequencing to capture the pathogenic variants. The process was repeated as part of the study taking care to amplify the coding regions and exon/intron boundaries to compare with the WES results afterwards.

Variant1: NM_000152.4:c.148_859-11del (p.Glu50Hisfs*37; exons2–4deletion)

CAID: CA658795223 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.148_859-11del

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.685_686insCGGC (p.Arg229fsProfs*102)

CAID: CA658795233 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.685_686insCGGC

gnomAD: Not in gnomAD

CaseAddInfo: Infantile Onset Pompe Disease

CaseLOPD-3: 2 weeks diagnosis

HPOsFreeText: GAA activity 2.7 (nmol · h−1 · mg−1), Mean percentage of normal 3.7%

GenotypingMethod: Newborn Screening Panels

Variant: NM_000152.4:c.2647-7G>A

ClinVar: 551106 https://www.ncbi.nlm.nih.gov/clinvar/variation/551106/

gnomAD: South Asian 3.266e-5, Overall 1.780e-5 http://gnomad.broadinstitute.org/variant/17-78092445-G-A

CaseAddInfo: Late Onset Pompe Disease, Patient is homozygous for the above variant

CaseLOPD-7: 24 years diagnosis

CasePresentingHPOs: HP:0003236, HP:0012378, HP:0002910 (Increased serum CK, Fatigue, Elevated transaminases)

HPOsFreeText: GAA activity 4.0 (nmol · h−1 · mg−1), Mean percentage of normal 5.6%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2481+102_2646+31del (p.Gly828_Asn882del) (exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

CaseAddInfo: Late Onset Pompe Disease

CaseLOPD-11: 8.3 years diagnosis

HPOsFreeText: GAA activity 2.0 (nmol · h−1 · mg−1), Mean percentage of normal 2.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 http://www.ncbi.nlm.nih.gov/clinvar/variation/4027

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

Chromosomal code not provided

Variant2: NP_000143.2:p.Q743∗ 

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease

CasePD/VOUS-5: 1.7 years diagnosis

HPOsFreeText: GAA activity 9.16 (nmol · h−1 · mg−1), Mean percentage of normal 12.9%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Variant3: NM_000152.4:c.1424C>T (p.Pro475Leu)

CAID: CA8815314 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.3:c.1424C%3ET

gnomAD: South Asian 1.307e-4, Overall 2.009e-5 http://gnomad.broadinstitute.org/variant/17-78083841-C-T

CaseAddInfo: Patient has one pseudodeficency allele and one allele of uncertain significance, Nomenclature claims Variant 1 and 2 are in cis

CasePD/VOUS-7: 3 weeks diagnosis

HPOsFreeText: GAA activity 3.43 (nmol · h−1 · mg−1), Mean percentage of normal 4.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Multiple interpretations of p.G615R possible

Variant3: NP_000143.2:p.G615R

CAID: PA113309 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NP_000143.2%3Ap.G615R

gnomAD: N/A

CaseAddInfo: Patient has one pseudodeficency allele and one allele of uncertain significance, Nomenclature claims Variant 1 and 2 are in cis

CasePD/Pathogenic-6: 4 weeks diagnosis

HPOsFreeText: GAA activity 8.8 (nmol · h−1 · mg−1), Mean percentage of normal 12.3%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.1726G>A (p.Gly576Ser)

ClinVar: 92467 https://www.ncbi.nlm.nih.gov/clinvar/variation/92467/

gnomAD: East Asian 0.1427, Overall 0.01700 http://gnomad.broadinstitute.org/variant/17-78085871-G-A

Variant2: NM_000152.4:c.2065G>A (p.Glu689Lys)

ClinVar: 4030 https://www.ncbi.nlm.nih.gov/clinvar/variation/4030/

gnomAD: East Asian 0.2355, Overall 0.05524 http://gnomad.broadinstitute.org/variant/17-78087041-G-A

Chromosomal code not provided

Variant3: NP_000143.2:p.N87Tfs*55

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 1 and 2 are in cis

CasePD/Pathogenic-10: 2 weeks diagnosis

HPOsFreeText: GAA activity 5.5 (nmol · h−1 · mg−1), Mean percentage of normal 7.8%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 https://www.ncbi.nlm.nih.gov/clinvar/variation/4020/

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Variant2: NM_000152.4:c.2161G>T (p.Glu721Ter)

CAID: CA401370611 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2161G%3ET

gnomAD: Not in gnomAD

Variant3: NM_000152.4:c.2237G>T (p.Trp746Leu)

ClinVar: 284776 https://www.ncbi.nlm.nih.gov/clinvar/variation/284776/

gnomAD: European (Non-Finnish) 1.244e-4, Overall 7.798e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-T

CaseAddInfo: Patient has one pseudodeficency allele and one pathogenic allele, Nomenclature claims Variant 2 and 3 are in cis

CaseLOPD-15: 2 weeks diagnosis

HPOsFreeText: GAA activity 3.6 (nmol · h−1 · mg−1), Mean percentage of normal 5.1%

GenotypingMethod: Newborn Screening Panels

Variant1: NM_000152.4:c.271G>A (p.Asp91Asn)

ClinVar: 4020 http://www.ncbi.nlm.nih.gov/clinvar/variation/4020

gnomAD: European (Non-Finnish) 0.03291, Overall 0.02049 http://gnomad.broadinstitute.org/variant/17-78078656-G-A

Chromosomal code not provided

Variant2: NP_000143.2:p.V740Gfs*55

ClinVar: N/A

gnomAD: N/A

Chromosomal code not provided and typo likely

Variant3: NP_000143.2:p.T234 mol/L

ClinVar: N/A

gnomAD: N/A

CaseAddInfo: Late Onset Pompe Disease, Nomenclature claims Variant 1 and 2 are in cis

Patient1: female, 22 yo, Caucasian

CasePresentingHPOs: HP:0003710, HP:0003326, HP:0040081, HP:0045040, HP:0002910

HPOsFreeText: CK = 571 U/l, LDH = 301 U/l, ASAT = 85 U/l, ALAT = 84 U/l, GAA activity = 0.31nmol/spot x21hrs, small droplet lipid deposits in the muscle fibres of vastus lateralis

CaseNotHPOs: HP:0003457, HP:0009051, HP:0001639, HP:0002111, HP:0002093

NotHPOsFreeText: MRI of thigh muscles showed no abnormalities, no changes in the PAS positive inclusions

CaseAddInfo: 14yo at symptom onset, no family history of neuromuscular disease

CasePreviousTesting: EMG, MRI, muscle biopsy of mm. vastus lateralis, hematoxylin and eosin stain, Peri acid-Schiff reaction, Acid phosphatase staining,transthoracic echocardiogram, respiratory function test

CaseGenotypingMethod: Sanger Sequencing

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Patient2: female, 29 yo, Caucasian

CasePresentingHPOs: HP:0003724, HP:0008988, HP:0003691, HP:0003391, HP:0003551, HP:0040081, HP:0002910, HP:0003557, HP:0100295, HP:0100295, HP:0009051, HP:0004356, HP:0002111

HPOsFreeText: paravertebral muscle atrophy, atrophies with paresis grade of 3-4 MRC, cannot stand from squatting position, impaired overhead work, CK = 1390 U/l, AST = 65 U/l, ALAT = 72 U/L, symmetrical atrophy of thigh muscle, fatty deposits in m. adductor magnus, flause signal elevation in the mm. semimembranosus and mm. biceps femoris bilateral, reticulation in the proximal vastus intermedius and vastus lateralis, vacuolated muscle fibres, PAS-positive glycogen storage with enhanced lysosomal activity in the PAS staining, increased lysosomal activity, GAA activity = 0.22nmol/spot x 21hrs

CaseNotHPOs: HP:0001639

CaseAddInfo:

CasePreviousTesting: MRI of thigh muscle, muscle biopsy of mm. vastus lateralis, hematoxylin and eosin stain, Peri acid-Schiff reaction, Acid phosphatase staining, transthoracic echocardiogram, respiratory function test

CaseGenotypingMethod: Sanger Sequencing

Variant: NM_000152.4(GAA):c.-32-13T>G

Clinvar: 4027, https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: 0.003582, http://exac.broadinstitute.org/variant/17-78078341-T-G

Case3: Female, Swedish, 64 years report, 48 years onset

CasePresentingHPOs: HP:0008956 (Thigh muscle atrophy)

HPOsFreeText: 6-min walk test achieved 369 m, MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 2.8/2.7 (L), On the medications Zopiklon and Ketoprofen

NotHPOsFreetext: Not on ERT

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.2560C>T (p.Arg854Ter)

ClinVar: 4034 https://www.ncbi.nlm.nih.gov/clinvar/variation/4034/

gnomAD: African 1.891e-3, Overall 2.090e-4 http://gnomad.broadinstitute.org/variant/17-78092070-C-T

Variant2: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Late Onset Pompe Disease

Case6: Female, French, 26 years report, 21 years onset

CasePresentingHPOs: HP:0008956 (Thigh muscle atrophy)

HPOsFreeText: 6-min walk test achieved 496 m, MRC score is 3/5 (thigh/calf), Forced vital capacity sitting/supine is 2.2/1.9 (L), Has started ERT,On the medication Perindopril

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.525delT (p.Glu176Argfs)

ClinVar: 4033 https://www.ncbi.nlm.nih.gov/clinvar/variation/4033/

gnomAD: European (Non-Finnish) 1.880e-4, Overall 9.959e-5 http://gnomad.broadinstitute.org/variant/17-78078909-CT-C

CaseAddInfo: Late Onset Pompe Disease

Case1: Female, Danish, 38 years report, 25 years onset

CasePresentingHPOs: HP:0008956 (Thigh muscle atrophy)

HPOsFreeText: 6-min walk test achieved 531 m, MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 2.8/2.2 (L)

NotHPOsFreetext: Not on ERT

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.307T>G (p.Cys103Gly)

ClinVar: 92483 https://www.ncbi.nlm.nih.gov/clinvar/variation/92483/

gnomAD: European (Non-Finnish) 7.874e-6, Overall 3.578e-6 http://gnomad.broadinstitute.org/variant/17-78078692-T-G

CaseAddInfo: Late Onset Pompe Disease

Case7: Male, Danish, 20 years report, 1 year onset

HPOsFreeText: MRC score is 4/5 (thigh/calf), Forced vital capacity sitting/supine is 5.6/5.3 (L), Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.2228A>G (p.Gln743Arg)

CAID: CA401324753 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.2228A%3EG

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.2237G>C (p.Trp746Ser)

ClinVar: 188484 https://www.ncbi.nlm.nih.gov/clinvar/variation/188484/

gnomAD: African 3.210e-4, Overall 7.089e-5 http://gnomad.broadinstitute.org/variant/17-78090814-G-C

Variant3: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 http://gnomad.broadinstitute.org/variant/17-78078341-T-G

CaseAddInfo: Late Onset Pompe Disease, Nomenclature indicates Variants 1 and 2 are in cis

Case4: Male, French, 65 years report, 55 years onset

HPOsFreeText: 6-min walk test achieved 540 m, MRC score is 5/5 (thigh/calf), Forced vital capacity sitting/supine is 2.7/1.8 (L), On the medications Statin and Allopurinol, Has started ERT

CaseNotHPOs: HP:0008956 (Thigh muscle atrophy)

GroupGenotypingMethod: Mutation Analysis on the GAA Gene

Variant1: NM_000152.4:c.-32-13T>A

CAID: CA913184742 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913184742

gnomAD: Not in gnomAD

Variant2: NM_000152.4:c.3G>A

CAID: CA401359809 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.3G%3EA

gnomAD: European (Non-Finnish) 8.945e-6, Overall 4.041e-6 http://gnomad.broadinstitute.org/variant/17-78078388-G-A

CaseAddInfo: Late Onset Pompe Disease

GroupPresentingHPOs: HP:0001324, HP:0001270, HP:0002205, HP:0002098, HP:0001635, HP:0001640, HP:0011968

HPOsFreeText: IOPD, reduced GAA activity, paucity of movements

GroupNotHPOs:

NumberMales: 14

NumberFemales: 11

CountryOrigin: mainland China; 12 patients from southern China, 13 from northern China

Ethnicity: Chinese

Race: Chinese

AgeRange: median age at symptom onset = 3.4mo, median age at diagnosis = 4.9mo

TotalNumber: 25

FamilyInfo: Parents of those individuals with mutations were sequenced

NoFamily: n/a

GroupAddInfo: all patients diagnosed with IOPD between 2013 and 2016 at Shanghai Children's Medical Center. Of the 24 untreated patients, non survived beyond 1.5yrs, only surviving (Patient 25) was 7mo at last follow-up.

GroupPreviousTesting: IOPD diagnosed via reduced GAA enzyme activity in leukocytes or DBS (PMID: 16702880)

GroupGenotypingMethod: DNA isolated from blood samples, coding exons (2-20) and intron/exon boundaries of GAA gene amplified via PCR (primers: PMID: 10338092), resulting DNA was sequenced with ABI3730XL sequencer then was analyzed with Mutation Survey or DNA Variant Analysis software, novel mutations were screened in 60 normal individuals (120 alleles) via direct sequencing and no novel variants were found among these suggesting those found in study patients are uncommon polymorphisms.

fragments containing a mutation in the patients were amplified and sequenced for the corresponding parents

Phylogenetic conservation of missense mutations analyzed with ClustalX program, and pathogenicity of novel variants predicited with MutationTaster, sorting intolerant from tolerant (SIFT), and PolyPhen-2

Variant: NM_000152.4(GAA):c.2662G>T (p.Glu888Ter)

this was identified (by present study) as the most common variant in northern Chinese patients, heterozygous for 5 patients, homozygous for one patient

ClinVar: 578595, https://www.ncbi.nlm.nih.gov/clinvar/variation/578595/

gnomAD: 1.65e-05, http://exac.broadinstitute.org/variant/17-78092467-G-T

Case16HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 0.1 umol/h/L, GAA activity at 33% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.722_723delTT (p.Phe241Cysfs*?)

CAID: CA658795235 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.722_723delTT

gnomAD: Not in gnomAD

CaseAddInfo:

Case15HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 8.3 pmol/spot/hr, GAA activity at 35% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.2482_2646del165 (p.Gly828_Asn882del) (Exon 18 del)

ClinVar: 4031 https://www.ncbi.nlm.nih.gov/clinvar/variation/4031/

gnomAD: Not in gnomAD

CaseAddInfo:

Case21HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 0.8 U/g, GAA activity at 8.9% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

No information given to identify where the variant is

Variant2: NM_000152.4: IVS15+2T>A

ClinVar:

gnomAD:

CaseAddInfo:

Case12HPOsFreeText: 20 mg/kg GAA treatment, GAA activity at 4 nmol/punch/hr, GAA activity at 15% lower limit of normal

CaseAddInfo: Late Onset Pompe Disease

CaseGenotypingMethod: Method not described, only that the diagnosis was "confirmed … based on 2 GAA gene mutations"

Variant1: NM_000152.4:c.-32-13T>G

ClinVar: 4027 https://www.ncbi.nlm.nih.gov/clinvar/variation/4027/

gnomAD: Ashkenazi Jewish 5.541e-3, Overall 3.401e-3 https://gnomad.broadinstitute.org/variant/17-78078341-T-G

Variant2: NM_000152.4:c.546+1G>T

CAID: CA401361913 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_000152.4%3Ac.546%2B1G%3ET

gnomAD: Not in gnomAD

CaseAddInfo:

CaseGM01565: Female, 16 years report, Caucasian, Europe

CasePresentingHPOs: HP:0003153 (Cystathioninuria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband is a homozygote for this variant.

CasePreviousTesting: N/A

CaseGenotypingMethod: Primers were developed and the CTH exons 1-12 and exon-intron boundaries were PCR amplified and sequenced. All sequence variations were verified by restriction enzyme analysis and/or repeat sequencing.

Variant: NM_001902.5:c.200C>T (p.Thr67Ile)

ClinVar: 2939 https://www.ncbi.nlm.nih.gov/clinvar/variation/2939/

gnomAD: Ashkenazi Jewish 9.934e-3, Overall 6.308e-3 https://gnomad.broadinstitute.org/variant/1-70881670-C-T

CaseGM01454: Male, 7 years report, Asian, China

CasePresentingHPOs: HP:0003153 (Cystathioninuria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband is a homozygote for this variant.

CasePreviousTesting: N/A

CaseGenotypingMethod: Primers were developed and the CTH exons 1-12 and exon-intron boundaries were PCR amplified and sequenced. All sequence variations were verified by restriction enzyme analysis and/or repeat sequencing.

Variant: CTH, 2-BP DEL, 940CT AKA: NM_001902.5:c.784_785del (p.Leu262Thrfs*21)

ClinVar: 2937 https://www.ncbi.nlm.nih.gov/clinvar/variation/2937/

gnomAD: East Asian 1.088e-4, Overall 7.960e-6 https://gnomad.broadinstitute.org/variant/1-70897822-ACT-A

CaseDII-2: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 970 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.561G>A (p.Trp187Ter)

ClinVar: 102736 https://www.ncbi.nlm.nih.gov/clinvar/variation/102736/

gnomAD: 0.00001760, https://gnomad.broadinstitute.org/variant/12-103249059-C-T

Variant2: NM_000277.3(PAH):c.782G>C (p.Arg261Pro)

ClinVar: 102832 https://www.ncbi.nlm.nih.gov/clinvar/variation/102832/

gnomAD: Not in gnomAD

CaseAII-4: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 2085 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband for Family A

Variant1: NM_000277.3(PAH):c.165del (p.Phe55fs)

ClinVar: 611 https://www.ncbi.nlm.nih.gov/clinvar/variation/611/

gnomAD: 0.00002639, https://gnomad.broadinstitute.org/variant/12-103306571-CA-C?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.143T>C (p.Leu48Ser)

ClinVar: 608 https://www.ncbi.nlm.nih.gov/clinvar/variation/608/

gnomAD: 0.001025, https://gnomad.broadinstitute.org/variant/12-102912816-A-G?dataset=gnomad_r3

CaseBI-1: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 375 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.1222C>T (p.Arg408Trp)

ClinVar: 577 https://www.ncbi.nlm.nih.gov/clinvar/variation/577/

gnomAD: 0.001766, https://gnomad.broadinstitute.org/variant/12-102840493-G-A?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.688G>A (p.Val230Ile)

ClinVar: 102784 https://www.ncbi.nlm.nih.gov/clinvar/variation/102784/

gnomAD: 0.0009025, https://gnomad.broadinstitute.org/variant/12-102855154-C-T?dataset=gnomad_r3

CaseEI-1: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 430 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.1066-11G>A

ClinVar: 607 https://www.ncbi.nlm.nih.gov/clinvar/variation/607/

gnomAD: 0.0004116, https://gnomad.broadinstitute.org/variant/12-103237568-C-T

Variant2: NM_000277.3(PAH):c.533A>G (p.Glu178Gly)

ClinVar: 92746 https://www.ncbi.nlm.nih.gov/clinvar/variation/92746/

gnomAD: 0.0001473, https://gnomad.broadinstitute.org/variant/12-103249087-T-C

CaseAI-1: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 330 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.143T>C (p.Leu48Ser)

ClinVar: 608 https://www.ncbi.nlm.nih.gov/clinvar/variation/608/

gnomAD: 0.001025, https://gnomad.broadinstitute.org/variant/12-102912816-A-G?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.898G>T (p.Ala300Ser)

ClinVar: 92751 https://www.ncbi.nlm.nih.gov/clinvar/variation/92751/

gnomAD: 0.006318, https://gnomad.broadinstitute.org/variant/12-102851701-C-A?dataset=gnomad_r3

CaseDI-1: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 365 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.561G>A (p.Trp187Ter)

ClinVar: 102736 https://www.ncbi.nlm.nih.gov/clinvar/variation/102736/

gnomAD: 0.00001760, https://gnomad.broadinstitute.org/variant/12-103249059-C-T

Variant2: NM_000277.3(PAH):c.898G>T (p.Ala300Ser)

ClinVar: 92751 https://www.ncbi.nlm.nih.gov/clinvar/variation/92751/

gnomAD: 0.006318, https://gnomad.broadinstitute.org/variant/12-102851701-C-A?dataset=gnomad_r3

CaseAII-5: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 440 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.165del (p.Phe55fs)

ClinVar: 611 https://www.ncbi.nlm.nih.gov/clinvar/variation/611/

gnomAD: 0.00002639, https://gnomad.broadinstitute.org/variant/12-103306571-CA-C?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.898G>T (p.Ala300Ser)

ClinVar: 92751 https://www.ncbi.nlm.nih.gov/clinvar/variation/92751/

gnomAD: 0.006318, https://gnomad.broadinstitute.org/variant/12-102851701-C-A?dataset=gnomad_r3

CaseAII-3: N/A

CasePresentingHPOs: N/A

HPOsFreeText: Pretreatment phenylalanine level at 370 umol/L

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: N/A

Variant1: NM_000277.3(PAH):c.165del (p.Phe55fs)

ClinVar: 611 https://www.ncbi.nlm.nih.gov/clinvar/variation/611/

gnomAD: 0.00002639, https://gnomad.broadinstitute.org/variant/12-103306571-CA-C?dataset=gnomad_r3

Variant2: NM_000277.3(PAH):c.898G>T (p.Ala300Ser)

ClinVar: 92751 https://www.ncbi.nlm.nih.gov/clinvar/variation/92751/

gnomAD: 0.006318, https://gnomad.broadinstitute.org/variant/12-102851701-C-A?dataset=gnomad_r3

Case2929: Male, 4 months diagnosis, Czech

CasePresentingHPOs: HP:0001270, HP:0011344, HP:0003153, HP:0003698, HP:0002300, HP:0004484, HP:0008454 (Motor delay, Severe psychomotor retardation, Cystathioninuria, Difficulty standing, Mutism, Craniofacial asymmetry, Lumbar kyphosis)

HPOsFreeText: Unknown total homocysteine (N/A μM/l; reference 5.1–13.9), Elevated cystathionine (5.4 μM/l; reference 0.04–0.34), Unknown total cysteine (N/A μmol/l; reference 203–369), Response to B6 treatment unknown

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CasePMIDs: 615480

CaseAddInfo: Patient is homozygous for this mutation, Proband is born of father-daughter incest and is therefore consanguineous

CasePreviousTesting: Cystathionine (Cysta), total cysteine (tCys), and total homocysteine (tHcy) panels

CaseGenotypingMethod: PCR amplification of CTH coding regions and exon-intron boundaries was performed. These fragments were sequenced and aligned with a reference to find mutations. Those found were confirmed by restriction digest of 100 controls.

Variant: NM_001902.5:c.589C>T (p.Arg197Cys)

CAID: CA906222 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_001902.5%3Ac.589C%3ET

gnomAD: South Asian 1.312e-4, Overall 6.378e-5 https://gnomad.broadinstitute.org/variant/1-70895477-C-T

Case2930: Female, 3 weeks diagnosis, United States

CasePresentingHPOs: HP:0003153 (Cystathioninuria)

HPOsFreeText: Elevated total homocysteine (18.2 μM/l; reference 5.1–13.9), Elevated cystathionine (11.8 μM/l; reference 0.04–0.34), Normal total cysteine (246 μmol/l; reference 203–369)

CaseNotHPOs: HP:0001270, HP:0001263, HP:0100543, HP:0030972 (Motor delay, Global developmental delay, Cognitive impairment, Abnormal systemic blood pressure)

NotHPOsFreeText: Unresponsive to B6 treatment

CaseAddInfo: Patient is compound heterozygous for these mutations, Parental testing has confirmed these variants are in trans

CasePreviousTesting: Cystathionine (Cysta), total cysteine (tCys), and total homocysteine (tHcy) panels

CaseGenotypingMethod: PCR amplification of CTH coding regions and exon-intron boundaries was performed. These fragments were sequenced and aligned with a reference to find mutations. Those found were confirmed by restriction digest of 100 controls.

Variant1: NM_001902.5:c.932C>T (p.Thr311Ile)

CAID: CA340839077 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_001902.5%3Ac.932C%3ET

gnomAD: Not in gnomAD

Variant Too Long

Variant2: NP_001893.2:p.Gly57_Gln196del

ClinVar:

gnomAD:

CaseF4P: 4 yrs report, India

CasePresentingHPOs: HP:0001010, HP:0000750, HP:0001249, HP:0006801, HP:0004923 (Hypopigmentation of the skin, Delayed speech and language development, Intellectual disability, Brisk deep tendon reflexes, Hyperphenylalaninemia)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Family is consanguinous, Parents were confirmed heterozygous, Variant disrupts the WT donor site and is predicted to alter splicing

CasePreviousTesting: Blood phenylalanine before treatment was 1150 μmol/l, Blood tyrosine before treatment was 30 μmol/l, PKU diagnosis was based on ferric chloride test on patient urine samples and detection of elevated Phenylalanine levels in blood samples by using HPLC, in addition to analysis of clinical features.

CaseGenotypingMethod: Genomic DNA was isolated from blood samples of proband and family members. PCR amplification and sequencing was used to screen for mutations. Each mutation was confirmed by bi-directional DNA sequencing.

Variant: NM_000277.3(PAH):c.60+5G>A

ClinVar: 120281 https://www.ncbi.nlm.nih.gov/clinvar/variation/120281/

gnomAD: Not in gnomAD

CaseF5S: 21 yrs report, India

CasePresentingHPOs: N/A

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Variant has been shown to abolish canonical splice donor site and lead to a null protein

CasePreviousTesting: Blood phenylalanine before treatment was 1698 μmol/l, Blood tyrosine before treatment was 37 μmol/l

CaseGenotypingMethod: N/A

Variant: NM_000277.3(PAH):c.842+1G>A

ClinVar: 599 https://www.ncbi.nlm.nih.gov/clinvar/variation/599/

gnomAD: 0.00007752, http://gnomad.broadinstitute.org/variant/12-103246592-C-T

CaseF5P: 18 yrs report, India

CasePresentingHPOs: N/A

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband for Family 5, Variant has been shown to abolish canonical splice donor site and lead to a null protein

CasePreviousTesting: Blood phenylalanine before treatment was 1260 μmol/l, Blood tyrosine before treatment was 36 μmol/l

CaseGenotypingMethod: N/A

Variant: NM_000277.3(PAH):c.842+1G>A

ClinVar: 599 https://www.ncbi.nlm.nih.gov/clinvar/variation/599/

gnomAD: 0.00007752, http://gnomad.broadinstitute.org/variant/12-103246592-C-T

CaseF1S: 5 yrs report, India

CasePresentingHPOs: N/A

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Variant is demonstrated to activate a cryptic splice site and abolish the canon splice site leading to a premature termination and nonsense-mediated decay

CasePreviousTesting: Blood phenylalanine before treatment was 1431 μmol/l, Blood tyrosine before treatment was 35 μmol/l

CaseGenotypingMethod: N/A

Variant: NM_000277.3(PAH):c.169-2A>G

ClinVar: 555212 https://www.ncbi.nlm.nih.gov/clinvar/variation/555212/

gnomAD: 0.00003267, http://gnomad.broadinstitute.org/variant/12-103288698-T-C

CaseF2P: 2 yrs report, India

CasePresentingHPOs: HP:0001010, HP:0000750, HP:0001249, HP:0006801, HP:0004923 (Hypopigmentation of the skin, Delayed speech and language development, Intellectual disability, Brisk deep tendon reflexes, Hyperphenylalaninemia)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Family is consanguinous, Parents were confirmed heterozygous, Variant may not undergo NMD however would be missing essential domains and is predicted to be null

CasePreviousTesting: Blood phenylalanine before treatment was 1619 μmol/l, Blood tyrosine before treatment was 60 μmol/l, PKU diagnosis was based on ferric chloride test on patient urine samples and detection of elevated Phenylalanine levels in blood samples by using HPLC, in addition to analysis of clinical features.

CaseGenotypingMethod: Genomic DNA was isolated from blood samples of proband and family members. PCR amplification and sequencing was used to screen for mutations. Each mutation was confirmed by bi-directional DNA sequencing.

Variant: NM_000277.3:c.1177_1178insT (p.Asn393Ilefs*2)

CAID: CA16020958 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA16020958

gnomAD: Not in gnomAD

CaseCA2: Male, 17 months death

CasePresentingHPOs: HP:0001644, HP:0001875, HP:0001508, HP:0003535 (Dilated cardiomyopathy, Neutropenia, Failure to thrive, 3-Methylglutaconic aciduria)

HPOsFreeText: N/A

CaseNotHPOs: HP:0003107 (Abnormal circulating cholesterol concentration)

NotHPOsFreeText: N/A

CaseAddInfo: Family history of high urinary 3-MGC

CasePreviousTesting: N/A

CaseGenotypingMethod: The TAZ gene was PCR amplified in three fragments and directly sequenced in the mother and proband.

Variant: NM_000116.4:c.548T>G (p.Val183Gly)

CAID: CA415183843, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA415183843

gnomAD: Not in gnomAD

CaseCA4: Male, 6 months death

CasePresentingHPOs: HP:0001644, HP:0001508 (Dilated cardiomyopathy, Failure to thrive)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Cardiac transplant 11 months after presentation; Variant also found in mother and grandmother

CasePreviousTesting: N/A

CaseGenotypingMethod: The TAZ gene was PCR amplified in three fragments and directly sequenced in obligate heterozygotes, III.2, a heterozygous carrier, and III.4.

Variant: NM_000116.5(TAZ):c.589G>A (p.Gly197Arg)

ClinVar: 11105, https://www.ncbi.nlm.nih.gov/clinvar/variation/11105/

gnomAD: Not in gnomAD

CaseWA: Female, 5 yrs onset, French-Canadian

CasePresentingHPOs: HP:0002013, HP:0001944, HP:0001289, HP:0002367, HP:0001942, HP:0031962, HP:0001987, HP:0003236, HP:0001946, HP:0002919, HP:0000651, HP:0012120 (Vomiting, Dehydration, Confusion, Visual hallucinations, Metabolic acidosis, Elevated serum anion gap, Hyperammonemia, Elevated serum creatine kinase, Ketosis, Ketonuria, Diplopia, Methylmalonic aciduria)

HPOsFreeText: Low incorporation of 14C-propionate (4.1 nmol propionate/mg protein/18 h; control mean 10.8, SD 3.7) with no response to hydroxycobalamin

CaseNotHPOs: HP:0002151 (Increased serum lactate)

NotHPOsFreeText: N/A

CaseAddInfo: Parents are non-consanguineous with unremarkable family history, Treatment with carnitine and restricted protein intake normalized symptoms, Sequencing of the mother revealed Variant 2 without Variant 1 confirming compound heterozygosity

CasePreviousTesting: Metabolic acidosis values w/ elevated anion gap (pH = 6.96, bicarbonate 3.5 mmol/L and pCO2 15.9 mm Hg, anion gap 25.5 mmol/L); Mild hyperammonemia (107 μmol/L; ref. < 50); Elevated creatine kinase (from 498 IU/L initially up to 3062 IU/L, ref. < 150); Organic acid profiles were analyzed via gas chromatography–mass spectrometry with Table 1 showing relevant organic acid values; Proband was negative for propionyl-coA carboxylase deficency (811 pmol/min/mg protein with control mean 1123, PCCA and PCCB variants were negative) and ruled out MUT/cobalamin issues as well; Fusion experiments showed negative results for mut, cblA, and cblB complementation but no increase in activity when fused with MCEE confirming the pathway blockage

CaseGenotypingMethod: Extracted DNA from blood was amplified and three coding exons/splice site junctions of MCEE were Sanger sequenced. A deletion/duplicaiton analysis yeilded normal results. To search for an intronic sequence variant, total RNA was extracted and reverse-transcribed to confirm a 92-bp insertion between Exons 2 and 3. Resulting sequencing of this genomic area revealed a deep intronic variant that created a new consensus donor splice site that leads to a premature stop codon.

Variant1: NM_032601.4(MCEE):c.139C>T (p.Arg47Ter)

ClinVar: 2343, http://www.ncbi.nlm.nih.gov/clinvar/variation/2343

gnomAD: 0.0004884, https://gnomad.broadinstitute.org/variant/2-71351575-G-A

Variant2: NM_032601.3:c.379-644A>G

CAID: CA892631472, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA892631472

gnomAD: Not in gnomAD

CaseOS-104_II-1: Male, Birth onset, Turkey

CasePresentingHPOs: HP:0001992, HP:0001324, HP:0002317 (Organic aciduria, Muscular hypotonia, Unsteady gait)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001263, HP:0001252 (Global developmental delay, Muscle weakness)

NotHPOsFreeText: N/A

CaseAddInfo: Parents are consanguineous, Two younger brothers are unaffected, The variant results in a frameshift that extends the WT protein to 408 AAs and affects the C-terminal peptidase domain

CasePreviousTesting: GS-MS analysis identified urinary organic acids dominated by N-aceylated AAs, supported by NMR spectroscopy of urine samples with serum samples being negative; Metabolite pattern of brother was unremarkable; Values of excreted AAs are in Table 1; Ultrasound, electromyography, and NMR tomography of the musculature from the lower extremities showed unremarkable results; Routine histological, histochemical, enzyme histochemical, and immunohistochemical studies did not reveal any significant myopathological abnormalities

CaseGenotypingMethod: Genomic DNA was extracted from blood samples or after EBV transformation of peripheral blood lymphocytes. Exons and exon-intron boundaries were amplified and bidirectionally sequenced.

Variant: NM_000666.3(ACY1):c.1102_1103AC[3] (p.Pro369fs)

ClinVar: 18109, https://www.ncbi.nlm.nih.gov/clinvar/variation/18109/

gnomAD: Not in gnomAD

CaseOS-120_II-1: Female, Birth onset, German/Italian

CasePresentingHPOs: HP:0001992, HP:0011343 (Organic aciduria, Moderate global developmental delay)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Younger brother is unaffected; Proband is confirmed compound heterozygous as mother is heterozygous for R353C but father is unavailable

CasePreviousTesting: GS-MS analysis identified urinary organic acids dominated by N-aceylated AAs, supported by NMR spectroscopy of urine samples with serum samples being negative; Values of excreted AAs are in Table 1; Neuropediatric evaluation performed

CaseGenotypingMethod: Genomic DNA was extracted from blood samples or after EBV transformation of peripheral blood lymphocytes. Exons and exon-intron boundaries were amplified and bidirectionally sequenced.

Variant1: NM_000666.3(ACY1):c.699A>C (p.Glu233Asp)

ClinVar: 18111, https://www.ncbi.nlm.nih.gov/clinvar/variation/18111/

gnomAD: 0.0001846, https://gnomad.broadinstitute.org/variant/3-52021204-A-C

Variant2: NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys)

ClinVar: 18110, https://www.ncbi.nlm.nih.gov/clinvar/variation/18110/

gnomAD: 0.004135 (4 homozygotes), https://gnomad.broadinstitute.org/variant/3-52022837-C-T

Case2: Male, 1y 7m, Chinese

HPOsFreeText: (at 11 days) 1.69 C4 umol/L, 0.19 C4/C2, 2.38 C4/C3

NotHPOsFreeText: normal urine isobutyrylglycine

Case2 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: same as group

CaseMethod2: same as group

CaseGenotypingMethod: same as group

Variant: NM_014384.2:c.286G>A (p.Gly96Ser)

ClinVar: n/a

CAID: CA6372895

gnomAD: 0.001453 (East Asian)

CaseAddInfo:

Case7: Male, 6m, Chinese

CasePresentingHPOs: HP:0002248, HP:0001290, HP:0008872, HP:0002572 (haematemesis, hypotonia, feeding difficulties in infancy, recurrent vomiting)

HPOsFreeText: (at 19 days) 1.01 C4 umol/L, 0.38 C4/C2, 1.61 C4/C3

NotHPOsFreeText: normal urine isobutyrylglycine

Case7 (Level 2):

CasePreviousTesting: same as group

CaseMethod1: same as group

CaseMethod2: same as group

CaseGenotypingMethod: same as group

Variant1: NM_014384.2:c.444G>T (p.Pro148=)

ClinVar: n/a

CAID: CA6372946

gnomAD: 0.0002772 (Other)

Variant2: NM_014384.2:c.1176G>T (p.Arg392Ser)

ClinVar: n/a

CAID: CA6373249

gnomAD: 0.0001088 (East Asian)

CaseAddInfo: trans heterozygous, inherited one allele from each parent

Case 14 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group __

Variant1: NM_015506.2(MMACHC):c.658_660delAAG (p.Lys220del)

ClinVar: 95707

CAID: CA223197

gnomAD: 0.0003071 (East Asian)

Variant2: NM_015506.2(MMACHC):c.567dupT (p.Ile190Tyrfs*13)

ClinVar: 556708

CAID: CA522810899

gnomAD: [0.0001024] (https://gnomad.broadinstitute.org/variant/1-45974604-G-GT) (East Asian)

CaseAddInfo: proband genotype, unknown cis or trans, no phenotypic info, sibling (fetus) carrier for p.K220del maternal variant

Case 2 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group

Variant1: NM_015506.2(MMACHC):c.217C > T

ClinVar: 203825

CAID: CA312728

gnomAD: 0.00005560 (East Asian)

Variant2: NM_015506.2(MMACHC):c.658_660delAAG

ClinVar: 95707

CAID: CA223197

gnomAD: 0.0003071 (East Asian)

CaseAddInfo: proband genotype, unknown cis or trans, not any phenotypic info given, sibling (fetus) carrier of p.R73X maternal variant

Case 15 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group

__

Variant1: NM_015506.2(MMACHC):c.394C > T (p.Arg132Ter)

ClinVar: 1423

CAID: CA251787

gnomAD: 0.0007190 (South Asian)

Variant2: NM_015506.2(MMACHC):c.615C > A (p.Tyr205Ter)

ClinVar: 558292

CAID: CA340133688

gnomAD: 0.0006427 (East Asian)

CaseAddInfo: proband genotype, unknown cis or trans, no phenotypic info, sibling (fetus) carries both variants

Case 13 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group __

Variant1: NM_015506.2(MMACHC):c.609G > A (p.Trp203Ter)

ClinVar: 30800

CAID: CA259906

gnomAD: 0.0005562 (East Asian)

CaseAddInfo: proband genotype, homozygous, no phenotypic info, sibling (fetus) carrier for p.W203X variant

Case 16 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group

Variant1: NM_015506.2(MMACHC):c.217C > T (p.Arg73Ter)

ClinVar: 203825

CAID: CA312728

gnomAD: 0.00005560 (East Asian)

CaseAddInfo: proband genotype, homozygous, no phenotypic info, sibling (fetus) is a carrier of variant

Case 5 (Level 2)

**CasePreviousTesting: ** same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group

Variant1: NM_015506.2(MMACHC):c.626dupT (p.Thr210Aspfs*35)

ClinVar: not in ClinVar

CAID: Not in ClinGen

gnomAD: not in gnomAD

Variant2: NM_015506.2(MMACHC):c.609G > A (p.Trp203Ter)

ClinVar: 30800

CAID: CA259906

gnomAD: 0.0005562 (East Asian)

CaseAddInfo: proband genotype, unknown cis or trans, no phenotypic info, sibling (fetus) carrier for c.626dupT maternal variant

Case 6 (Level 2)

CasePreviousTesting: same as group

CaseMethod1: PCR

CaseGenotypingMethod: same as group

Variant1: NM_015506.2(MMACHC):c.658_660delAAG (p.Lys220del)

ClinVar: 95707

CAID: CA223197

gnomAD: 0.0003071 (East Asian)

Variant2: NM_015506.2(MMACHC):c.609G > A (p.Trp203Ter)

ClinVar: 30800

CAID: CA259906

gnomAD: 0.0005562 (East Asian)

CaseAddInfo: proband genotype, unknown cis or trans, no phenotypic info, sibling (fetus) carrier for both variants

CaseKO: Male, 22 yrs report, Serbia

CasePresentingHPOs: HP:0002076, HP:0002017, HP:0000505, HP:0002357, HP:0003474, HP:0004302, HP:0001269, HP:0012229, HP:0011288, HP:0002321, HP:0000622 (Migraine, Nausea and vomiting, Visual impairment, Dysphasia, Sensory impairment, Functional motor deficit, Hemiparesis, CSF pleocytosis, EEG with parietal sharp slow waves, Vertigo, Blurred vision)

HPOsFreeText: Mechanosensitivity

CaseNotHPOs: HP:0011182, HP:0001251, HP:0001250 (Interictal epileptiform activity, Ataxia, Seizure)

NotHPOsFreeText: N/A

CaseAddInfo: No evidence of headache attacks with focal neurological deficits in any other family member, but the patient’s father was found to suffer from migraine without aura

CasePreviousTesting: Responsive to treatment with ibuprofen; Mild head trauma is a trigger; Neuroimaging during attacks was normal; Screen for variants in CACNA1A, ATP1A2, SCN1A, and PRRT2 was negative

CaseGenotypingMethod: All exons and exon-intron boundaries of the SLC1A3 gene were seuqenced and a variant was found that segregates with the phenotype.

Variant: NM_004172.5:c.1159A>C (p.Thr387Pro)

CAID: CA359482299, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA359482299

gnomAD: Not in gnomAD

CaseJE: Male, 10 yrs report,

CasePresentingHPOs: HP:0002131, HP:0004374, HP:0001319, HP:0001270, HP:0001350, HP:0002076, HP:0010547, HP:0001272, HP:0002381, HP:0002181, HP:0011182, HP:0045084, HP:0001289, HP:0002078, HP:0007034, HP:0007772, HP:0011289 (Episodic ataxia, Hemiplegia/hemiparesis, Neonatal hypotonia, Motor delay, Slurred speech, Migraine, Muscle flaccidity, Cerebellar atrophy, Aphasia, Cerebral edema, Interictal epileptiform activity, Limb myoclonus, Confusion, Truncal ataxia, Generalized hyperreflexia, Impaired smooth pursuit, EEG with temporal sharp slow waves)

HPOsFreeText: Left visual field neglect, Episodic left hemifield distortion

CaseNotHPOs: HP:0000639, HP:0000570, HP:0007670, HP:0000267 (Nystagmus, Impaired saccades, Abnormal vestibulo-ocular reflex, Cranial asymmetry)

NotHPOsFreeText: N/A

CaseAddInfo: Variant is confirmed heterozygous de novo via parental testing and confirmed paternity; No family member has any neurological signs or symptoms

CasePreviousTesting: Previously screened for CACNA1A and ATP1A2 with negative results; Episodic migraine attacks led to progressive right-sided headache and left-sided symptoms such as weakness and visual field neglect; Comprehensive metabolic workup revealed no abnormality in the CSF, serum, and urine; MRI showed a diffuse right-sided cortical hyperintensity most prominent in fluid-attenuated inversion recovery (FLAIR); EEG showed subclinical seizure activity in the left frontal temporal cortex and diffuse slowing on the right

CaseGenotypingMethod: DNA was extracted from blood samples. All exons and flanking intronic regions of SLC1A3 were PCR-amplified and directly sequenced. These were confirmed via resequencing.

Variant: NM_004172.5(SLC1A3):c.869C>G (p.Pro290Arg)

ClinVar: 9441, https://www.ncbi.nlm.nih.gov/clinvar/variation/9441/

gnomAD: Not in gnomAD

Case1: Amish

HPOsFreeText: GA1 confirmed

Case (Level 2)

CasePreviousTesting: GA1 confirmed

CaseMethod1: PCR

CaseMethod2: MaeII restriction digest

CaseGenotypingMethod: same as Amish group

Variant: NM_000159.3(GCDH):c.1262C>T (p.Ala421Val)

ClinVar: 2082

gnomAD: 0.0002867 (European non-Finnish)

CaseAddInfo: homozygous, founder allele in Amish of Lancaster County from immigrant from Switzerland to US in early 18th century. 4 non-Amish patients were found heterozygous for this allele with central European ancestry.

CaseBH: Male, Somalia, 8 yrs report

CasePresentingHPOs: HP:0003026, HP:0001511, HP:0000973, HP:0008936, HP:0000023, HP:0008780, HP:0000519, HP:0000639, HP:0011493, HP:0001263, HP:0001999, HP:0000337, HP:0000325, HP:0000494, HP:0000160, HP:0000977, HP:0001181, HP:0002119, HP:0005116 (Short long bone, Intrauterine growth retardation, Cutis laxa, Truncal hypotonia, Inguinal hernia, Congenital bilateral hip dislocation, Developmental cataract, Nystagmus, Central opacification of the cornea, Global developmental delay, Abnormal facial shape, Broad forehead, Triangular face, Downslanted palpebral fissures, Narrow mouth, Soft skin, Adducted thumb, Ventriculomegaly, Arterial tortuosity)

HPOsFreeText: At age 8 years, his height was 96 cm (Z=−5.8) and weight was 11.6 kg (Z=−7.26); Head circumference was 45.4 cm, (Z=−5.0) which is the 50th centile for a 10-month-old boy; Walked with support

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Parents are consanguineous fourth cousins, Had an older sister and younger brother who were developmentally appropriate and well grown

CasePreviousTesting: N/A

CaseGenotypingMethod: PYCR1 and ALDH18A1 were Sanger sequenced in the proband which revealed a single variant. Chromosomal SNP microarray showed no regions of homozygosity or any other deletions or duplications. Whole Exome Sequencing of genomic DNA from the proband was performed for confirmation again only revealing the single heterozygous missense variant in ALDH18A1. Copy-number analysis was performed and identified no significant variation. Sequencing of the parents revealed a de novo inheritance pattern.

Variant: NM_002860.3:c.377G>A (p.Arg126His)

CAID: CA377706756 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA377706756

gnomAD: Not in gnomAD

Case1: Male, 3 months diagnosis/death, Egypt, African

CasePresentingHPOs: HP:0001999, HP:0011968, HP:0001531, HP:0001270, HP:0001252, HP:0003468, HP:0001636, HP:0001274 (Dysmorphic facial features, Poor feeding, Failure to thrive in infancy, Motor delay, Muscle hypotonia, Abnormal vertebrae, Tetraology of Fallot, Agenesis of corpus callosum)

HPOsFreeText: Agenesis of the cingulate gyrus

CaseNotHPOs:

NotHPOsFreeText:

CaseAddInfo: Parents are consanguinous, Proband is homozygous for this mutation, Died a few days after hospital admission in infancy

CasePreviousTesting: Increased levels of S-2-carboxypropyl-cysteamine and S-2-carboxypropyl-cysteine, Fibroblast and liver homogenates of patient 1 showed normal hydratase activities towards methacrylyl-CoA (as well as crotonyl-CoA and tiglyl-CoA),

CasePMIDs: 7122152

CaseGenotypingMethod: After confirming low HICBH activity in fibroblasts of the patients, the gene was analyzed at the genomic level and the mRNA level in both patients using sequence analysis.

Variant: NM_014362.3:c.220-9T>G

ClinVar: 1144 https://www.ncbi.nlm.nih.gov/clinvar/variation/1144/

gnomAD: Not in gnomAD

Case2: Male, Caucasian, 9 months onset

CasePresentingHPOs: HP:0011968, HP:0001270, HP:0001251, HP:0002376, HP:0002121, HP:0000737, HP:0002317, HP:0002599, HP:0002078, HP:0012389, HP:0001310, HP:0001337, HP:0001254, HP:0001942, HP:0002329, HP:0001308, HP:0002599, HP:0001332, HP:0002181, HP:0002134 (Poor feeding, Delayed motor milestones, Ataxia, Developmental regression, Absence seizures, Irritability, Unsteady gait, Head titubation, Truncal ataxia, Appendicular hypotonia, Dysmetria, Tremor, Lethargy, Metabolic acidosis, Drowsiness, Tongue fasciculation, Head titubation, Dystonia, Cerebral edema, Abnormality of the basal ganglia)

HPOsFreeText: Head bobbing at 4 months, Rolled over at 5 mo but lost the ability at 10 mo, Reaching out and grasping objects at 4 mo but lost the ability at 13 mo, Eye rolling episodes at 9 months, Lost ability to finger feed at 10 months, Inability to sit unsupported, At 14 months blood pH was 7.29 with a base deficit of 15.8 mmol/L, Sluggish papillary responses, Pooling of secretions in the mouth, No improvement on treatment with thiamine or a combination of vitamin C, vitamin E, and ubiquinone, Signal abnormalities in the globus pallidus and the midbrain

CaseNotHPOs: HP:0000639, HP:0002151, HP:0001987, HP:0003116, HP:0012443 (Nystagmus, Increased serum lactate, Hyperammonemia, Abnormal echocardiogram, Abnormality of brain morphology)

NotHPOsFreeText: N/A

CaseAddInfo: Parents were nonconsanguinous, Proband is compound heterozygous for these mutations with parental testing

CasePreviousTesting: Pyruvate dehydrogenase and pyruvate carboxylase in cultured human skin fibroblasts, Activities of respiratory chain complexes in a muscle biopsy, Marked reduction of complex I (patient 0.089, controls 0.104–0.268) and a borderline reduction of complex IV (patient 0.013, controls 0.014–0.034), Organic acid analysis during ketotic episodes showed excessive excretion of 3-hydroxybutyrate and acetoacetate and moderate excretion of lactate, 2-hydroxyisovalerate, 2-oxoisocaproate, dicarboxylic acids (C6, C8, C10), and methylmalonate, with normal levels of methylcitrate as opposed to normal levels when well, Urine amino acid analysis, Elevated levels of hydroxy-C4-carnitine (patient 0.45-1.73 μM, controls <0.4 μM) even when not ketotic

CaseGenotypingMethod: After confirming low HICBH activity in fibroblasts of the patients, the gene was analyzed at the genomic level and the mRNA level in both patients using sequence analysis.

Variant1: NM_014362.4:c.365A>G (p.Tyr122Cys)

ClinVar: 1145 https://www.ncbi.nlm.nih.gov/clinvar/variation/1145/

gnomAD: Latino 4.338e-4, Overall 6.373e-5 https://gnomad.broadinstitute.org/variant/2-191155151-T-C

Variant2: NM_014362.3:c.79-3C>G

ClinVar: 1146 https://www.ncbi.nlm.nih.gov/clinvar/variation/1146/

gnomAD: Not in gnomAD

CaseCHN2.1: Canada, White

CasePresentingHPOs: HP:0008353 (Neutral hyperaminoaciduria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Variants segregate with the disease

CasePreviousTesting: Hartnup aminoaciduria profile was confirmed by ion exchange high performance liquid chromatography

CaseGenotypingMethod: All SLC6A19 exons and flanking introns were directly amplified and sequenced from genomic DNA.

Variant1: NM_001003841.3:c.532C>T (p.Arg178Ter)

CAID: CA3182753, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA3182753

gnomAD: 0.0004414, https://gnomad.broadinstitute.org/variant/5-1212468-C-T

Variant2: NM_001003841.3:c.1213G>A (p.Glu405Lys)

CAID: CA3183103, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA3183103

gnomAD: 0.0001203, https://gnomad.broadinstitute.org/variant/5-1219057-G-A

CaseCHN1.1: Canada, White

CasePresentingHPOs: HP:0008353 (Neutral hyperaminoaciduria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Variants segregate with the disease, Has a sibling with the same variant and amino acid profile

CasePreviousTesting: Hartnup aminoaciduria profile was confirmed by ion exchange high performance liquid chromatography;

CaseGenotypingMethod: All SLC6A19 exons and flanking introns were directly amplified and sequenced from genomic DNA.

Variant1: NM_001003841.3:c.196G>A (p.Gly66Arg)

CAID: CA359061114 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA359061114

gnomAD: Not in gnomAD

Variant2: NM_001003841.3:c.982C>T (p.Arg328Cys)

CAID: CA3182972, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA3182972

gnomAD: 0.0002479, https://gnomad.broadinstitute.org/variant/5-1216767-C-T

CaseAHN16.1: Australia, White

CasePresentingHPOs: HP:0008353 (Neutral hyperaminoaciduria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Variants segregate with the disease

CasePreviousTesting: Hartnup aminoaciduria profile was confirmed by ion exchange high performance liquid chromatography;

CaseGenotypingMethod: All SLC6A19 exons and flanking introns were directly amplified and sequenced from genomic DNA.

Variant1: NM_001003841.3:c.277G>A (p.Gly93Arg)

CAID: CA3182636 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA3182636

gnomAD: 0.0001195, https://gnomad.broadinstitute.org/variant/5-1208935-G-A

Variant2: NM_001003841.3(SLC6A19):c.517G>A (p.Asp173Asn)

ClinVar: 2019 https://www.ncbi.nlm.nih.gov/clinvar/variation/2019/

gnomAD: 0.003016, https://gnomad.broadinstitute.org/variant/5-1212453-G-A

Case9: Male, Turkey, 24 yrs report,

CasePresentingHPOs: HP:0002251, HP:0001321, HP:0001161, HP:0025356, HP:0002474, HP:0000708, HP:0001488, HP:0002317, HP:0000646, HP:0000486 (Aganglionic megacolon, Cerebellar hypoplasia, Hand polydactyly, Psychomotor retardation, Expressive language delay, Behavioral abnormality, Bilateral ptosis, Unsteady gait, Strabismus)

HPOsFreeText: Dysgnathia

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband is homozygous, Parents are consanguineous, cDNA amplification of the exons 8 and 9 in this patient revealed an insertion of 64 base pairs due to the use of a cryptic donor site leading to a premature stop codon and a likely null allele; Proband has two healthy sisters

CasePreviousTesting: Patient fibroblasts were analyzed for mutations in SLC25A21 and activities of KATII with no abnormalities; A metabolic work-up revealed alpha-ketoadipic aciduria and alpha-aminoadipic aciduria; A non-verbal intelligence test yielded a slightly decreased value; A single metabolic decompensation in adulthood was ascribed to Helicobacter pylori and its eradication improved the patient’s well-being.

CaseGenotypingMethod: All 17 exons and flanking intronic sequences of DHTKD1 were Sanger sequenced.

Variant: NM_018706.6:c.1671+1G>A

CAID: CA5407905 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA5407905

gnomAD: 0.0001399, https://gnomad.broadinstitute.org/variant/10-12139996-G-A

Case8: Female

CasePresentingHPOs: HP:0001270, HP:0001252, HP:0011342, HP:0007479 (Motor delay, Muscular hypotonia, Mild motor developmental delay, Congenital nonbullous ichthyosiform erythroderma)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Consanguineity is suspected, Proband is homozygous

CasePreviousTesting: Patient fibroblasts were analyzed for mutations in SLC25A21 and activities of KATII with no abnormalities; Urine AAA and KAA were elevated. Oxidation of radiolabeled AAA in fibroblasts was deficient.

CaseGenotypingMethod: All 17 exons and flanking intronic sequences of DHTKD1 were Sanger sequenced.

CasePMIDs: 1112064, 1112065

Variant: NM_018706.7(DHTKD1):c.2134C>T (p.Arg712Ter)

ClinVar: 572241 https://www.ncbi.nlm.nih.gov/clinvar/variation/572241/

gnomAD: 0.00003267, https://gnomad.broadinstitute.org/variant/10-12149994-C-T

CaseSA3P: Female, 16 months onset, European

CasePresentingHPOs: HP:0001988, HP:0000825, HP:0001987 (Recurrent hypoglycemia, Hyperinsulinemic hypoglycemia, Hyperammonemia)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband is confirmed de novo via parental teting and confirmed paternity

CasePreviousTesting: Protein/leucine restriction was effective at reducing symptoms

CaseGenotypingMethod: Genomic DNA was prepared from all patients via peripheral blood leukocytes. The GLUD1 gene exons 1-13 and the flanking intronic regions were PCR-amplified and directly sequenced. All variants were confirmed via restriction enzyme analysis. Additionally, paternity testing was performed by HLA typing and by southern blot analysis of DNA fragments as well as PCR analysis of STRs.

Variant: NM_005271.5(GLUD1):c.965G>A (p.Arg322His)

ClinVar: 16129, https://www.ncbi.nlm.nih.gov/clinvar/variation/16129/

gnomAD: Not in gnomAD

CaseSA5P: Female, 3 months onset, European

CasePresentingHPOs: HP:0001988, HP:0000825, HP:0001249, HP:0001250 (Recurrent hypoglycemia, Hyperinsulinemic hypoglycemia, Intellectual disability, Seizure)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001987 (Hyperammonemia)

NotHPOsFreeText: N/A

CaseAddInfo: Has father with confirmed variant and similar phenotypes

CasePreviousTesting: Leucine load test showed leucine sensitivity; Protein/leucine restriction and dioxazide was effective at reducing symptoms

CaseGenotypingMethod: Genomic DNA was prepared from all patients via peripheral blood leukocytes. The GLUD1 gene exons 1-13 and the flanking intronic regions were PCR-amplified and directly sequenced. All variants were confirmed via restriction enzyme analysis. Additionally, paternity testing was performed by HLA typing and by southern blot analysis of DNA fragments as well as PCR analysis of STRs.

Variant: NM_005271.5(GLUD1):c.965G>A (p.Arg322His)

ClinVar: 16129, https://www.ncbi.nlm.nih.gov/clinvar/variation/16129/

gnomAD: Not in gnomAD

CaseSA2P: Female, 3 months onset, European

CasePresentingHPOs: HP:0001988, HP:0000825, HP:0001987 (Recurrent hypoglycemia, Hyperinsulinemic hypoglycemia, Hyperammonemia)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Proband is confirmed de novo via parental teting and confirmed paternity

CasePreviousTesting: Leucine load test showed leucine sensitivity in some patients; Protein/leucine restriction was effective at reducing symptoms

CaseGenotypingMethod: Genomic DNA was prepared from all patients via peripheral blood leukocytes. The GLUD1 gene exons 1-13 and the flanking intronic regions were PCR-amplified and directly sequenced. All variants were confirmed via restriction enzyme analysis. Additionally, paternity testing was performed by HLA typing and by southern blot analysis of DNA fragments as well as PCR analysis of STRs.

Variant: NM_005271.5(GLUD1):c.965G>A (p.Arg322His)

ClinVar: 16129, https://www.ncbi.nlm.nih.gov/clinvar/variation/16129/

gnomAD: Not in gnomAD

Case10: Male, Ecuador

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0001561, HP:0001558, HP:0000602, HP:0001622, HP:0001371, HP:0001623, HP:0002804 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Polyhydramnios, Decreased fetal movements, Ophthalmoplegia, Preterm delivery, Contractures, Breech presentation, Arthrogryposis)

HPOsFreeText: Bilateral femoral fractures

CaseNotHPOs: HP:0001627 (Cardiac abnormality)

NotHPOsFreeText: N/A

CaseAddInfo: Severe congenital myopathy, Deceased in 6 weeks

CasePreviousTesting: N/A

CaseGenotypingMethod: After LMOD3 was identified as a potential causal gene, bidirectional Sanger sequencing was performed on DNA in genetically unresolved patients using PCR amplification covering 3 exons.

Variant1: NM_198271.4:c.976G>C (p.Gly326Arg)

CAID: CA353473660 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_198271.4%3Ac.976G%3EC

gnomAD: Not in gnomAD

Variant2: NM_198271.4:c.1372C>T (p.Gln458*)

CAID: CA353470920 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_198271.4%3Ac.1372C%3ET

gnomAD: Not in gnomAD

Case6: Female, Japan, Asian

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0003798, HP:0001561, HP:0001558, HP:0001789, HP:0000252, HP:0001622, HP:0001371 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Nemaline bodies, Polyhydramnios, Decreased fetal movement, Hydrops fetalis, Microcephaly, Preterm delivery, Contractures)

HPOsFreeText: Atrophic myofibers

CaseNotHPOs: HP:0001627 (Cardiac abnormality)

NotHPOsFreeText: N/A

CaseAddInfo: Severe congenital myopathy, Alive at 10 months

CasePreviousTesting: N/A

CaseGenotypingMethod: After LMOD3 was identified as a potential causal gene, bidirectional Sanger sequencing was performed on DNA in genetically unresolved patients using PCR amplification covering 3 exons.

Variant: NM_198271.4:c.349C>T (p.Gln117*)

CAID: CA353477271 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_198271.4%3Ac.349C%3ET

gnomAD: Not in gnomAD

Case3: Female, Portugal

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0002804, HP:0001558, HP:0001561, HP:0001371 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Decreased fetal movement, Polyhydramnios, Contracture)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001627 (Cardiac abnormality)

NotHPOsFreeText: N/A

CaseAddInfo: Severe congenital myopathy, Deceased in neonatal period

CasePreviousTesting: N/A

CaseGenotypingMethod: After LMOD3 was identified as a potential causal gene, bidirectional Sanger sequencing was performed on DNA in genetically unresolved patients using PCR amplification covering 3 exons.

Variant: NM_198271.4:c.154del (p.Met52*)

CAID: CA909810717 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_198271.4%3Ac.154delA

gnomAD: Not in gnomAD

Case12a: Male, Afghanistan

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0002804, HP:0001558, HP:0001622, HP:0001623, HP:0003798 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Arthrogryposis, Decreased fetal movement, Preterm delivery, Breech presentation, Nemaline bodies)

HPOsFreeText: Atrophic myofibers

CaseNotHPOs: HP:0001627 (Cardiac abnormality)

NotHPOsFreeText: N/A

CaseAddInfo: Severe congenital myopathy, Deceased in 2 months, Has 2 siblings with same genotype/phenotype

CasePreviousTesting: N/A

CaseGenotypingMethod: After LMOD3 was identified as a potential causal gene, bidirectional Sanger sequencing was performed on DNA in genetically unresolved patients using PCR amplification covering 3 exons.

Variant: NM_198271.4:c.1099_1100delAA (p.Asn367Glnfs*11)

ClinVar: 162218 https://www.ncbi.nlm.nih.gov/clinvar/variation/162218/

gnomAD: South Asian 4.575e-4, Overall 5.625e-5 https://gnomad.broadinstitute.org/variant/3-69168405-GTT-G

Case14a: Female, Australia

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0001561, HP:0001622, HP:0002804, HP:0003798, HP:0001558, HP:0000602 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Polyhydramnios, Nemaline bodies, Decreased fetal movements, Ophthalmoplegia)

HPOsFreeText: Atrophic myofibers, Percutaneous endoscopic gastrostomy performed, Nocturnal noninvasive ventilation

CaseNotHPOs: HP:0001627, HP:0002540 (Cardiac abnormality, Inability to walk)

NotHPOsFreeText: N/A

CaseAddInfo: Typical congenital nemaline myopathy, Alive at 10 yrs, Parents are not consanguineous

CasePreviousTesting: N/A

CaseGenotypingMethod: Linkage analysis combined with homozygosity mapping was used to identify candidate chromosomal loci. Whole exome sequencing in this family revealed likely pathogenic mutations in LMOD3 which agreed with the aforementioned analysis and was consistent with autosomal recessive inheritance.

Variant1: NM_198271.4:c.1103_1105del (p.Asn368del)

ClinVar: 162216 https://www.ncbi.nlm.nih.gov/clinvar/variation/162216/

gnomAD: Not in gnomAD

Variant2: NM_198271.4:c.1201C>T (p.Arg401Ter)

ClinVar: 162217 https://www.ncbi.nlm.nih.gov/clinvar/variation/162217/

gnomAD: African 4.137e-5, Overall 7.135e-6 https://gnomad.broadinstitute.org/variant/3-69168305-G-A

Case5: Female, Japan, Asian

CasePresentingHPOs: HP:0001290, HP:0003324, HP:0002093, HP:0011968, HP:0001283, HP:0003798, HP:0001561, HP:0001558, HP:0100309 (Generalized hypotonia, Generalized muscle weakness, Respiratory insufficiency, Feeding difficulties, Bulbar weakness, Nemaline bodies, Polyhydramnios, Decreased fetal movements, Subdural hemorrhage)

HPOsFreeText: Atrophic myofibers

CaseNotHPOs: HP:0001627 (Cardiac abnormality)

NotHPOsFreeText: N/A

CaseAddInfo: Severe congenital myopathy, Alive at 2 months

CasePreviousTesting: N/A

CaseGenotypingMethod: After LMOD3 was identified as a potential causal gene, bidirectional Sanger sequencing was performed on DNA in genetically unresolved patients using PCR amplification covering 3 exons.

Variant1: NM_198271.4:c.300_304delGACTC (p.Thr101Argfs*4)

CAID: CA913203453 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913203453

gnomAD: Not in gnomAD

Variant1: NM_198271.4:c.601_602delGA (p.Asp201Glnfs*9)

CAID: CA913203454 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA913203454

gnomAD: Not in gnomAD

CaseAN: Male, 78 yrs report, Germany, White

CasePresentingHPOs: HP:0003774, HP:0001638, HP:0000822, HP:0002099, HP:0012125, HP:0001297, HP:0002134, HP:0002549, HP:0000738, HP:0000739, HP:0000746, HP:0002322, HP:0002172, HP:0012120 (Stage 5 chronic kidney disease, Cardiomyopathy, Hypertension, Asthma, Prostate cancer, Stroke, Abnormality of the basal ganglia, Deficit in phonologic short-term memory, Hallucinations, Anxiety, Delusions, Resting tremor, Postural instability, Methylmalonic aciduria)

HPOsFreeText: N/A

CaseNotHPOs: N/A

NotHPOsFreeText: N/A

CaseAddInfo: Mother had dementia, Proband is diagnosed with Parkinson's disease, Sanger sequencing confirmed compound heterozygous as unaffected sons are heterozygous for one variant each

CasePreviousTesting: Montreal Cognitive Assessment (MoCA) score of 17/30 in 2013; Mild MMA-uria, together with increased plasma levels of propionyl-carnitine, was demonstrated in 2016 via metabolic investigation (values in Table 1)

CaseGenotypingMethod: Whole genome sequencing data was analyzed using a pipeline restricted to 681 genes known to cause IEM. Heterozygous mutations in MCEE were identified.

Variant1: NM_032601.4(MCEE):c.139C>T (p.Arg47Ter)

ClinVar: 2343, http://www.ncbi.nlm.nih.gov/clinvar/variation/2343

gnomAD: 0.0004884, https://gnomad.broadinstitute.org/variant/2-71351575-G-A

Variant2: NM_032601.3:c.419del (p.Lys140Argfs*6)

CAID: CA1702578, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA1702578

gnomAD: 0.00007076, https://gnomad.broadinstitute.org/variant/2-71337211-CT-C

Case1: Male, 15 months onset, Iran

CasePresentingHPOs: HP:0006579, HP:0001324, HP:0001336, HP:0000639, HP:0002134, HP:0002282, HP:0002453, HP:0002540, HP:0002463, HP:0006801, HP:0001252, HP:0011443, HP:0001251, HP:0001310, HP:0000565, HP:0001510 (Neonatal jaundice, Muscle weakness, Myoclonus, Nystagmus, Abnormality of the basal ganglia, Heterotopia, Abnormality of the globus pallidus, Inability to walk, Language impairment, Hyperactive deep tendon reflexes, Muscular hypotonia, Abnormality of coordination, Ataxia, Dysmetria, Esotropia, Growth delay)

HPOsFreeText:

CaseNotHPOs: HP:0012443, HP:0012447 (Abnormality of brain morphology, Abnormal myelination)

NotHPOsFreeText:

CaseAddInfo: No parental consanguinity,

CasePreviousTesting: Plasma amino acids and plasma acylcarnitine profile were normal. The organic acid in the urine showed an elevated 3‐hydroxyisovaleric acid (110 mmol/mol creatinine, normal <44 mmol/mol creatinine). Serum biotinidase activity was normal. Blood lactate and ammonia were normal in repeated measurements.

CaseGenotypingMethod: Patient had the IVD exons and exon-intron boundaries analyzed using PCR/Sanger sequencing to follow up on suspected IVA, with no variants found. Whole Exome Sequencing was performed to determine the correct genetic cause of the disorder by evaluating all known exons and their flanking regions. This found two heterozygous missense mutations in HIBCH consistent with the diagnosis. Trio PCR/Sanger sequencing confirmed parental heterozygosity and the variants in the patient.

Variant1: NM_014362.3:c.641C>T (p.Thr214Ile)

CAID: CA349890265 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_014362.3%3Ac.641C%3ET

gnomAD: Not in gnomAD

Variant2: NM_014362.3:c.913A>G (p.Thr305Ala)

CAID: CA62635843 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_014362.3%3Ac.913A%3EG

gnomAD: European (Non-Finnish) 1.767e-5, Overall 7.978e-6 https://gnomad.broadinstitute.org/variant/2-191077780-T-C

CaseST-8: Female, 1 day onset, Germany

CasePresentingHPOs: HP:0006579, HP:0001643, HP:0001410, HP:0001319, HP:0006236, HP:0001786 (Prolonged neonatal jaundice, Patent ductus arteriosus, Decreased liver function, Neonatal hypotonia, Slender metacarpals, Narrow foot)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001250 (Seizure)

NotHPOsFreeText: N/A

CaseAddInfo: Family is non-consanguineous, Proband is compound heterozygous for these variants

CasePreviousTesting: See Group

CaseGenotypingMethod: See Group

Variant1: NM_001123.3:c.893C>A (p.Ala298Asp)

CAID: CA377399006, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA377399006

gnomAD: Not in gnomAD

Variant2: NM_001123.3:c.925C>T (p.Gln309Ter)

CAID: CA377398330, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA377398330

gnomAD: Not in gnomAD

CaseST-6: Male, 1 day onset, Morocco

CasePresentingHPOs: HP:0006579, HP:0001249, HP:0001270, HP:0001324, HP:0004322, HP:0000256, HP:0000316, HP:0006236, HP:0001786, HP:0008070, HP:0000708, HP:0002355, HP:0003202, HP:0002071 (Prolonged neonatal jaundice, Intellectual disability, Motor delay, Muscle weakness, Short stature, Macrocephaly, Hypertelorism, Slender metacarpals, Narrow foot, Sparse hair, Behavioral abnormality, Difficulty walking, Skeletal muscle atrophy, Abnormality of extrapyramidal motor function)

HPOsFreeText: N/A

CaseNotHPOs: HP:0001250 (Seizure)

NotHPOsFreeText: N/A

CaseAddInfo: Family is consanguineous, Proband is homozygous for the variant

CasePreviousTesting: See Group

CaseGenotypingMethod: See Group

Variant: NM_001123.3:c.685_687delinsCC (p.Thr229ProfsTer16)

CAID: CA1139768931, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA1139768931

gnomAD: Not in gnomAD