Ectomorphic mesomo~ph:

Endomorphic mesomorph:

Ectomorphic endomorph:

Mesomorphic endomor~:

Endomorph-ectom9££E:

Mesomorph-endomorph:

Mesomorph-endomorph:

Balanced ectomorph:

Balanced mesomorph:

Balanced endomorph:

SOHATOCHART

Somatotyping Children

Limitations of the Rating Form

Third Component Rating

Second Component Rating

First Component Rating

SOMATOTYPING

Calf

Biceps

Femur

Humerus

Calf

Primary culture of E. coli was grown in LB medium containing either ampicillin (Amp) and/or kanamycin (Kan) to final concentration of 100 j..tg/ml and 25 J..tg/ml respectively. Depending on the vector construct, antibiotics were used for expression of different proteins as described in Table 3.1. Medium was inoculated with 1 ml glycerol stock of E. coli and incubated overnight at 37 oc at 200 rpm.

Preparation of primary culture of E. coli cells

Blood was drawn from appropriate source into heparinised tubes. The blood sample was centrifuged at 4000 rpm for 15 min ( 4 °C). The supernatant was discarded, and the erythrocytes (pellet) were subsequently washed thrice with chilled isotonic buffer [0.01 M PBS (pH 7.4)] by centrifugation at 4000 rpm and 4°C for 15 min. The washed erythrocytes were lysed in water. The resultant red cell lysate was then dialyzed extensively against PBS (pH 7.4) at 4°C to obtain stripped hemoglobin (hemoglobin devoid of bound allosteric modulators like BPG). The stripped hemoglobin was then loaded onto a pre-equilibrated DE52 column (30cm x 15cm) after extensive dialysis against 0.05 M tris acetate buffer (pH 8.5). The protein was eluted from the column employing a linear gradient of 500 ml each of 0.05 M tris acetate (pH 8.5) and 0.05 M tris acetate (pH 7) at a flow rate of 50 ml/hour. The purified hemoglobin was estimated spectrophotometrically at 540 nm (molar extinction coefficient= 53236 cm-1/M) and stored at -70°C till further use.

Purification of hemoglobin from bloo

Vancouver-based Contextual Genomics has launched two molecular hotspot assays for detecting genomic mutations in blood and solid tumors. <!--//--><![CDATA[// ><!-- document.addEventListener("googletagEvent", function () { let hideOnMobile = "0"; let isMobileQuery = false; if (typeof window.dataLayerValues === "undefined" || !window.dataLayerValues.hasOwnProperty('isMobileQuery') || window.dataLayerValues.isMobileQuery) { isMobileQuery = window.dataLayerValues.isMobileQuery; } // Don't display the ad unit if this is a mobile browser and we're supposed to hide the unit in mobile view. if (isMobileQuery && hideOnMobile === '1') { return; } let hideOnDesktop = "0"; // Don't display this ad unit if this is a desktop broser and we're supposed to hide the mobile ad unit if(!isMobileQuery && hideOnDesktop === '1') { return; } googletag.cmd.push(function () { googletag.display('content-embed-one'); }); }); //--><!]]> The new version of the company’s Find It solid tumor panel now screens for 146 somatic genome alterations, and 23 exons in 30 cancer-associated genes, to help identify precision cancer treatments and recognize drug-resistant mutations. New additions to the panel include tests for mutations in the POLE gene, which have been associated with colorectal cancer as well as immunodeficiency.

After breakfast they made ready to say farewell, as nearly heavy of heart3 as was possible on such a morning; cool, bright, and clean under a washed autumn sky of thin blue. The air came fresh from the North-West.They rode off along a path and looked out from the hill-top over lands under the morning. It was now as clear and far-seen as it had been veiled and misty when they stood upon the knoll in the Forest. They took a deep draught of the air.4Their way wound along the floor of the hollow, and round the green feet of a steep hill into another deeper and broader valley. As they journeyed the sun mounted, and grew hot. Each time they climbed a ridge the breeze seemed to have grown less. When they caught a glimpse of the country westward the distant Forest seemed to be smoking, as if the fallen rain was steaming up again. A shadow now lay round the edge of sight, a dark haze above which the sky was like a blue cap.5 On that side the hills were higher and looked down upon them; and all those hills were crowned with green mounds, and on some were standing stones, pointing upwards like jagged teeth out of green gums. The view was somehow disquieting; so they turned from the sight and went down into the hollow circle. In the midst of it there stood a single stone, standing tall under the sun above, and at this hour casting no shadow. They set their backs6 against the east side of the stone. It was cool, as if the sun had had no power to warm it. There they took food and drink.Riding over the hills, and eating their fill,7 lying a little too long; these things are, perhaps, enough to explain what happened. How­ever, that may be: they woke suddenly from a sleep they had never meant to take. The standing stone was cold, and it cast a long pale shadow. The sun was gleaming through the mist; north, south, and east, the fog was thick, cold and white. The air was silent, heavy and chill.

Humanities faculty, unlike their STEM counterparts, do not have labs. We do not have a place for our work and no one sees our process.

However, that work (and it is intellectual labor) is invisible and largely undervalued.

Academics are constantly being told that they need to make their work more relevant and accessible to the public. Blogging about your work hits both of those marks. It also means that you have to translate your work from academese to language that non-academics will understand (i.e. jargon) and also foreground the relevance of your work. You have to tell people why your work is important and what it adds to the world.

As a result, I suggest that one thing that all humanities scholars can do to take a baby step in the direction of digital humanities is to maintain a blog about their research.

“People will use this data in ways we can’t even imagine yet,” Mr. Stowell said, “and I think that is one of the most exciting developments in the humanities.”

Mr. Edelstein said that many of his senior colleagues view his work as whimsical, the result of playing with technological toys. But he argues such play can lead to discoveries.

“You would think if England was this fountainhead of freedom and religious tolerance,” he said, “there would have been greater continuing interest there than what our correspondence map shows us.”

Even historians, who have used databases before, have been slow to embrace the trend. Just one of the nearly 300 main panels scheduled for next year’s annual meeting of the American Historical Association covers digital matters.

Mr. Bobley said the emerging field of digital humanities is probably best understood as an umbrella term covering a wide range of activities, from online preservation and digital mapping to data mining and the use of geographic information systems.

This alliance of geeks and poets has generated exhilaration and also anxiety. The humanities, after all, deal with elusive questions of aesthetics, existence and meaning, the words that bring tears or the melody that raises goose bumps. Are these elements that can be measured? Advertisement Continue reading the main story “The digital humanities do fantastic things,” said the eminent Princeton historian Anthony Grafton. “I’m a believer in quantification. But I don’t believe quantification can do everything. So much of humanistic scholarship is about interpretation.”

I can see how the drama of this moment is enticing. It offers a grandeur, a sweeping purity to our possibly flawed and fumbling and ambivalent selves. It justifies all our failings and setbacks and mediocrities; it wasn’t us, it was men, or the patriarchy, holding us back, objectifying us. It is easier to think, for instance, that we were discriminated against than that our story wasn’t good enough or original enough to be published in The Paris Review, or even that it did not meet the editor’s highly idiosyncratic yet widely revered tastes. Or that a man said something awful and sexual to us while we were working on a television show, and we got depressed and could never again achieve what we might have. And yet do we really in our hearts believe that is the whole story? Is this a complete and satisfying explanation? There is, of course, sexism, which looms and shadows us in all kinds of complicated and unmappable ways, but is it the totalizing force, the central organizing narrative, of our lives? This is where the movement veers from important and exhilarating correction into implausibility and rationalization. (One of the deeply anonymous says, “This seems like such a boring way to look at your life.”)

I have a feeling that if one met @yoloethics or the rest of her Twitter cohort in person, they would seem normal, funny, smart, well read. But the vicious energy and ugliness is there beneath the fervor of our new reckoning, adeptly disguised as exhilarating social change. It feels as if the feminist moment is, at times, providing cover for vindictiveness and personal vendettas and office politics and garden-variety disappointment, that what we think of as purely positive social change is also, for some, blood sport.

It can be hard to disentangle one man and the things he may or may not have done from hundreds of years of sexist oppression.

“I like Lorin,” she told me. “I don’t have a personal stake in this.” She then informed me that he had sexually harassed two interns at Farrar, Straus and Giroux, where he had worked before his Paris Review tenure, leading to hushed-up, sealed settlements. She delivered this piece of highly specific information so confidently that I did not stop and think, even though I teach in a journalism department: Is this factually correct?

The night the New York Times broke the news of Stein’s resignation, I was with one of the deeply anonymous women in a coffee shop, and after I left she ran out and caught up to me on the dark street to tell me about it. When I got home, I saw that @MegaMoira had tweeted a photo of the piece with the words, “champagne anyone.” I thought of the email Lorin had sent me when my book on writers’ deaths, The Violet Hour, came out. It was such a strange, private project, but in a few lines he made it vivid again to me, renewed and energized me on a long winter afternoon to sit down and start something new. However one feels about the end of an era at The Paris Review, it doesn’t seem like a time for celebration.

However, after the list came out but before Lorin Stein resigned as editor of The Paris Review, she tweeted: “every profile of Lorin Stein calls him ‘skinny and bespectacled’ but here’s the thing: he’s not that skinny.” She added: “I guess ‘bespectacled, bald, and busting out [of] the bespoke shirts he’s still having made with 15 year old measurements’ doesn’t have the same ring to it.” Later, these tweets were deleted. But if we could think in less gendered terms for a moment, one could reasonably ask: Who is harassing whom?

I feel blessed to live in a society where you are free to walk through the city at night. I just don’t think those of us who are privileged white women with careers are really that afraid.

Here is what the last few days have reminded me: white men, even those on the left, are so safe, so insulated from the policies of a reactionary presidency, that many of them view politics as entertainment, a distraction without consequences, in which they get to indulge their vanity by fantasizing that they are on the side of good. . . . The morning after the election, I found the penis-shaped shot glass in my kitchen and threw it against the wall. I am not proud of this, but it felt good to destroy something a white man loved.

Every woman, every day, when she leaves her house, starts to think about safety. Can I go here? Should I go out there?. . . Do I need to find a taxi? Is the taxi driver going to rape me? You know, women are so hemmed in by fear of men, it profoundly limits our lives.

In 1996, a six-year-old boy with Coke-bottle glasses, Johnathan Prevette, was suspended from school for sexual harassment after kissing a little girl on the cheek.

Can this possibly be a good thing?

For years, women confined their complaints about sexual harassment to whisper networks for fear of reprisal from men.

Before the piece was even finished, let alone published, people were calling me “pro-rape,” “human scum,” a “harridan,” a “monster out of Stephen King’s ‘IT,’?” a “ghoul,” a “bitch,” and a “garbage person”—all because of a rumor that I was planning to name the creator of the so-called Shitty Media Men list.

No one would talk to me for this piece. Or rather, more than twenty women talked to me, sometimes for hours at a time, but only after I promised to leave out their names, and give them what I began to call deep anonymity.

I am not trying to suggest that the list makers don’t understand the difference in scale between leering and assault, but rather that the blurring of common (if a little sleazy) behavior and serious sexual harassment reveals a lot about how they think. For them, the world is overrun with leering monsters you have to steer around, as if in a video game.

To do a close reading of the list: some of the offenses on the spreadsheet (“creepy DMs,” “weird lunch ‘dates,’” “leering,” “flirting,” “violent language,” and “leading on multiple women online”) seem not quite substantial or rare enough to put into the category of sexual misconduct. I am not even sure they merit a warning to a hopeful young employee. I have graduate students who go on to work for these sorts of publications, and I am very mother-hen-ish about them. But I can’t imagine sitting with one of my smart, ambitious students in my office, lined with shelves of books like The Second Sex and A Room of One’s Own and I Love Dick and The Argonauts, saying, “Before you go work there, I just want to warn you, that guy might leer at you.” I would worry I was being condescending, treating her like a child who doesn’t know how to handle herself in the world

(“It feels Maoist,” says one of the deeply anonymous, while others question whether the list was ever designed to remain clandestine in the first place.)

The Shitty Media Men list, the anonymously crowd-sourced spreadsheet chronicling sexual misconduct in the publishing world, is a good example. If we think of how we would feel about a secretly circulating, anonymously crowd-sourced list of Muslims who might blow up planes, the strangeness of the document snaps into focus.

(One of the editors of n+1, Dayna Tortorici, tweets: “I get the queasiness of no due process. But . . . losing your job isn’t death or prison.”)

Can you see why some of us are whispering? It is the sense of viciousness lying in wait, of violent hate just waiting to be unfurled, that leads people to keep their opinions to themselves, or to share them only with close friends. I recently saw a startling reminder of this when Wesley Yang published an insightful and conflicted piece in Tablet called “Farewell to a Scoundrel,” about former Paris Review editor Lorin Stein and the feminist moment.

Sonicated cells of E. coli having recombinant vector was centrifuged. Supernatant was dispensed into 0.2 % v/v xylan agar plate and incubated for 4 h. The plates were then flooded with Congo red solution (0.2 % w/v) for 30 min and destained with 1M NaCl solution till a clear zone of xylan hydrolysis was visible. The plates were gently shaken on a shaker to accelerate the process of staining/destaining

Qualitative detection of xylanolytic activity by plate assay

Preparation of electrocompetent cells (E. coli cells) A protocol was employed. The procedure was carried out in cold under sterile conditions as follows: •A single colony of E. coli DH10B/ DH5α/XL1blue was inoculated in 20 mL of LB medium and grown overnight at 30 °C. •500 mL LB medium was inoculated with 5mL of this overnight grown culture of the E. coli and incubated with vigorous shaking (250 rpm) at 30 °C until an A600of 0.5 - 0.8 was achieved. •The cells were chilled in ice for 10-15 min and transferred to prechilled Sorvall® centrifuge tubes and sedimented at 4,000 rpm for 20 min at 4 °C. •The supernatant was decanted and cells were resuspended in 500 mL of sterile ice-cold water, mixed well and centrifuged as described above. •The washing of the cells described above was repeated with 250 mL of sterile ice-cold water, following which cells were washed with 40 mL of ice-cold 10 % (v/v) glycerol and centrifuged at 4,000 rpm for 10 min. •The glycerol solution was decanted and the cell volume was recorded. The cells were resuspended in an equal volume of ice-cold 10 % glycerol. •Cells were then dispensed in 40 μL volumes and stored at -80 °C until required.

Electrotransformation

The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)

Insert DNA preparation

Purity of the DNA extracted from various environmental samples was confirmed by subjecting the extracted DNA to restriction digestion. DNA was digested with Sau3AI (New England Biolabs). One μg of metagenomic DNA in 20 μL reaction mixture was treated with 0.5 U of Sau3AI and incubated at 37 °Cfor 10 min. The reaction was terminated at 80 °C for 20 min and the digested DNA was fractionated on 1.2 % (w/v) agarose gel.

Restriction digestion

The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.

Determination of DNA quantity and purity

as well as commercial methods (MN kit, Germany; Mo-Bio kit, CA, USA; Zymo soil DNA kit, CA, USA) according to the manufacturer’s protocols and compared in terms of DNA yield and purity.

The soil DNA from Pantnagar and Lonar soil samples were also extracted by various manual (Desai and Madamwar, 2007; Agarwal et al., 2001; Yamamoto et al., 1998

Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.

Commercial kits

Comparison of yield and purity of crude DNA

Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min

PROTOCOL FOR OPTIMIZATION OF HUMIC ACID-FREE DNA FROM ALKALINE SOILS

Various strains of Escherchia coli (DH5α, XL1Blue, DH10B) were used as hosts for the propagation of recombinant vectors. In addition, Bacillus subtilis was used as a host for the expression of xylanase gene from the recombinant vector pWHMxyl. Different vectors used in this investigation are listed in

BACTERIAL STRAINS

Soil, sediment, effluent, and water samples have been collected from various hot and alkaline regions of India and Japan in sterile polyethylene bags/bottles. The samples were transported to the laboratory and preserved at 4 °C. Temperature and pH of the samples was recorded.

COLLECTION OF SAMPLES

or DNA isolationJrom P. Jalciparum, genomic DNA kit from Qiagen (Germany) was used. Isolation was done following manufacturer's instructions. Briefly, infected erythrocytes (5 ml at 10% parasitemia) were centrifuged at 3,000 g for 2 min. The cells were washed once in cold PBS and resuspended in 1 ml. Following which, 10 ilL of 5% saponin (final concentration 0.05%) was added and' mixed gently. After lysis, the mix was immediately centrifuged at 6,000 g for' 5min. Further steps were, carried out according to the manufacturer's instructions to isolate genomic DNA. DNA was quantified by measuring absorbance at 260 nm I using a UV -spectrophotometer

Genomic DNA Isolation from Parasite Culture

lasmodium Jalciparum strain 3D7 (MR4, American Type Culture Collection) was i used for all the experiments except where gametocyte rich culture was required. I For generating gametocytes, 3D7 A a variant of 3D7 was used. The parasite was cultured as describerl below:

lasmodiumfalciparum culture

~PL mutants were generated using QuickChange site-directed mutagenesis kit (Stratagene). Mutagenesis reactions were performed in accordance with the manufacturer's protocol using pAC28 (wild type ~PL gene fragment cloned in pET28c, section 2.3.3.1) as template. The details of oligonucleotides used for generating the mutant clones are given in table 3.1. Translationally silent restriction sites were engineered in the oligonucleotides whenever possible, in order to facilitate preliminary screening of mutant clones. Mutant clones were screened by restriction endonuclease analysis and confirmed by automated DNA sequencing

Site directed mutagenesis to generate RGPL mutant clones

Bilateral oophorectomy, the surgical removal of both the ovaries, was performed in mice to simulate a condition of estrogen depletion. All procedures in mice were performed after obtaining approval from the Institutional Animal Ethics Committee (National Institute of Immunology, New Delhi). Female BALB/c mice were used in the study

Assay for cell viability by propidium iodide dye exclusion method

THP-1 acute monocytic leukemia cell line (TIB-202) was purchased from American type culture collection (ATCC) (Manassas, VA). These suspension cells were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS. They were sub-cultured when the cell density reached ~1X106 per mL. To induce differentiation of these monocytic suspension cell cultures to adherent macrophage phenotype, they were subjected to treatment with PMA at a concentration of 10 ng/mL for 36 h. Forty eight hours prior to experimentation, the cells were transferred to phenol-red free RPMI-1640 medium supplemented with 10% dextran-coated charcoal stripped FCS. This was performed to remove all traces of exogenous estrogens as phenol red in culture medium is known to be a weak estrogen (1) and FCS contains multiple steroid hormones which are removed upon stripping with dextran-coated charcoal. MCF-7, a breast carcinoma cell line was obtained from ATCC (Manassas, VA). They were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS and were routinely sub-cultured when the cells reached a confluency of around 80%

Cell lines and cell culture

Cell culture techniques

was subsequently used as a probe model to carry out molecular replacement for one of the Fab-peptide complex; remainmg three Fab-peptide complexes were solved by using Ppy-LH as search model. The structure of antigen bound 36-65 Fab (2A61) was used for molecular replacement of two Fab-peptide complexes of the same antibody. AMoRe (Navaza, 1994) and Phaser packages from CCP4 suite (Elizabeth Potterton, 2003) were used for structure determination of antigen free BBE6.12H3 Fab and its complexes with peptide, respectively. The solution for 36-65 complexes was determined by using MOLREP from CCP4 suite. Both for MOLREP and AMoRe, calculations for rotation/translation functions were carried out using structure factors from 8 to 4 A resolutions. The transformation matrices obtained from AMoRe for antigen free Fab was utilized to orient the models in the corresponding unit cell. However, both Phaser and MOLREP have a module which automatically does orientation. The packing function of Phaser also checks for possible clashes or voids between the symmetry related molecules. All the solutions were unambiguous. For outputs of AMoRe and MOLREP the crystal packing was examined using Coot (Emsley P, 2004) to ascertain the absence of steric clashes or large voids between symmetry related molecules. Calculations of the Matthews coefficient (Kantardjieff and Rupp, 2003) indicated presence of two molecules for antigen free Fab and a single Fab molecule for all Fab-peptide complexes within the asymmetric unit.

wavelength component in three dimensions inversely proportional to their values of h, k and /. The image of the object can be reconstructed by recombining the individual sine waves as occur in the objective lens of the microscope. Since it is not possible to focus the X-rays, only the intensities could be recorded with the loss of phases, well known as phase problem of crystallography. Macromolecular crystal structures are usually solved using one of the three techniques; multiple isomorphous replacement (MIR), multiple anomalous dispersion (MAD) or molecular replacement (MR). Of the three, MR is generally used in cases where a structural homolog is available. Since the structure of a number of antibodies is already known, MR is the method of choice for structure determination of antibody Fab. The molecular replacement method, involves orienting and positioning a model molecule in the experimental unit cell through rotations and translations. The rotation function developed by Rossman and Blow ( 1962), involves rotation of the Patterson function of one group or molecule with respect to the other in all possible ways and the ultimate superimposition of the two Patterson functions. The translation function deals with positioning the oriented molecule in the unit cell of the unknown structure. It utilizes the cross vectors between various symmetrically related molecules for positioning the probe in the target unit cell. The translation function is carried out by moving the oriented model in small increments along all three directions and calculating the correlation between observed and calculated intensities. From the solutions obtained, the one with the highest correlation and lowest R-factor was chosen for molecular replacement. The structure of the Fab of putative anti-NP germ line mAb Nl G9 was used for molecular replacement. The refined model of the native unliganded germline Fab

The goal of diffraction analysis is reconstruction of the detailed structure of the asymmetric unit from a diffraction pattern. The diffraction pattern breaks down the structure into discrete sine waves. Any shape can be presented in three dimensions as the sum of sine waves of varying amplitudes and phases. The individual reflections of a diffraction pattern represent such waves, which have

Structure determination using molecular replacement

a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.

One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves

Crystallization

secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.

Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,

Generation of ascites from mice

All the peptides used in this study were synthesized by solid phase method on an automated peptide synthesizer (Applied Biosystems, Model 431A), using F-moc (9-fluorenylmethyloxycarbonyl) chemistry on a p-hydroxymethyl phenoxymethyl polystyrene resin (Nova Biochem). For the peptide synthesis, 0.1 mmol of the resin was used and deprotected using 20% piperidine in N-methyl-pyrrolidone (NMP). Subsequently 0.5nmol of the first amino acid was added and coupling was performed usmg DCC-HoBt (dicyclohexylcarbodiimide-hydroxybezotriazole) ester formation method. All other amino acids were coupled by DCC ester coupling. Amino acids and solutions required for peptide synthesis were procured from Nova Biochem and Applied Biosystems, respectively. After completion of synthesis, deprotection was carried out in 20% piperidine/DMF. Finally, the resin was shrunk using ether and dried under vacuum for a minimum of four hours. The cleavage was performed in dark using 94% TF A, 5% anisole, EDT and water accompanied by continuous stirring for two hours. The resin was then filtered and washed with DCM and the solution was evaporated on a rotary evaporator (Buchi, Switzerland) till only a small quantity of DCM/cleavage mixture is left. Cold anhydrous diethyl ether was added to the filtrate to aid in the separation of scavengers from the mixture. The peptides were then extracted with water using a separating funnel. Extraction was followed by evaporation of residual diethyl ether on the rotary evaporator. Total aqueous layer was then frozen as a thin film and lyophilized.

Procedure for peptide synthesis

The crystallographic analysis of the anti-( 4-hydroxy-3-nitrophenyl)-acetyl (anti-NP) and the anti-p-azophenylarsonate (anti-Ars) germline mAbs, BBE6.12H3 and 36-65 bound to various peptides derived from the screening of a random phage library would yield valuable information regarding their promiscuous binding abilities, associated with a primary immune response. The primary requirement for the crystallographic analysis was the preparation of adequate quantities of pure Fab (fragment antigen binding). Purified Fab fragment of both the mAbs was used for subsequent crystallization experiments with various peptide ligands. The X-ray intensity data for the crystals obtained were collected followed by structure determination, iterative steps of crystallographic refinement and model building. The refined models were structurally validated and then subjected to rigorous analysis. This chapter provides a brief background of the methods utilized and details of the experimental protocols followed.

Introduction

METHODS

Compositions of the different solutions used in this study are described in appendix.

acrylamide, TEMED were obtained from Bio-Rad laboratories (California, USA). Coomassie Plus protein assay reagent was purchased from Pierce (111inois, USA). All other chemicals were at least of analytical grade and were from Qualigens . laboratories (Bombay, India). HSA was from alpha therapeutic corporation (California, USA). Bacto-tryptone, yeast extract, and bacto-agar were obtained from Difco laboratories (Detroit, USA).

Agarose, ampici11in, ammonium acetate, ammonium persulfate, 1-acetyl 2-phenyl hydrazine, ~-mercaptuahanol, boric acid, calcium chloride, chloramphenicol, citric acid, coomassie blue 0250, creatine phosphate, creatine phosphokinase, DEPC, dialysis tubing, disodium hydrogen phosphate, dithioerythritol, dithiothreitol, DMPG, DOPG, DMPA, EDT A, ethidium bromide, glucose, glycerol, GSSG, guanidine hydrochloride, heparin, haemin., HEPES, IPTG, kanamycin, L-glycine, L-arginine, lithium chloride, magnesium acetate, magnesium sulfate, MES, PEG 8000, potassium acetate, potassium chloride, RNase free BSA, SDS, sucrose, sodium acetate, sodium dihydrogen phosphate, spermidine, sodium bicarbonate, sigmacote, Tris base, Triton X-100, urea and uridine were obtained from Sigma chemical Co. (St. Louis, USA). Trizol reagent, PCR buffer, magnesium chloride solution for PCR, RPMI-1640, leucine free RPMI, DMEM, trypsin, Fetal calf serum, antibiotic-antimycotic solution were purchased from Life Technologies (Maryland, USA). NTPs, dNTPs, cation exchange resins: S-sepharose and SP-sepharose were obtained from Pharmacia Biotech (Uppsala, Sweden). Bromophenol blue, xylene cyanol, acrylamide, bis

Chemicals

For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.

Purification and Conjugation

(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.

Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect

Plasmid Construction

vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.

Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B

PCR Amplification and Cloning in pQE30 Vector

The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).

Analysis of Sequence

Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.

Sequencing of bZP3

centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.

A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,

Large Scale Plasmid DNA Isolation

mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.

Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents

Small Scale Plasmid DNA Isolation

E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.

Preparation of Competent Cells and Transformation

All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.

Media Composition and Bacterial Culture

ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.

The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and

Agarose Gel Electrophoresis, Digestion and Ligation

Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.

PCR Amplification of bZP3

CLONING AND SEQUENCING OF bZP3

Radioisotopes: dCTP[a-32p] (3000 Ci/mM), dATP[a_35s] (1250 Ci/ mM) and 35s Met (I 000 Ci/ mM), were procured from NEN Life Sciences Products, Boston, MA, USA Others: Ni-nitrilo-tri-acetic acid (NTA) affinity resin from Qiagen; Membranes for Western blotting were obtained from BioRad; Hybond N and X-ray films were from Amersham; DNA and protein analysis softwares, PCgene from IntelliGenetics, Inc., Mountain View, CA, USA and Lasergene from DNASTAR Inc., Madison, Wisconsin, USA; Ultrafilteration assembly and YM5 membranes from Amicon Corp., Lexington, MA, USA.

from Gibco BRL; ampicillin, kanamycin and neutral red were from Sigma; FCS, was obtained from Biological Industries, Hibbutz Beit, Haemek, Israel. Bacterial Strains and Plasmids: M15[pREP4] and SG13009[pREP4] from Qiagen GmbH, Hilden, Germany, DH5a, BL21 (DE3) and BL21(pLysS) from Stratagene, La Jolla, USA, DF5 cells were kindly provided by Prof. K. Dharmalingam, Madurai Kamraj University, Madurai, Tamil Nadu, India. pBluescriptll SK( +) vector from Stratagene, pQE30 from Qiagen, pBacPAK8 vector from Clonetech Laboratories Inc., Palo Alto, CA, USA and pAcSecG2T vector, from Pharmingen, San Diego, CA, USA were obtained. Kits: Poly AT® tract mRNA isolation system and Riboclone® eDNA synthesis system from Promega Inc.; Geneclean® II kit from Bio 101 Inc., La Jolla, USA;Plasmid Midi kit and QIAexpress™ from Qiagen GmbH, Hilden, Germany; Sequenase version 2.0 DNA sequencing kit and Multiprime DNA labeling system from Amersham, Little Chalfont, Buckinghamshire, UK; BacPAK™ baculovirus expression system from Clonetech and Baculogold™ transfection kit from Pharmingen. Primers: Various oligonucleotide primers used were custom made by Rama Biotechnologies India Pvt. Ltd., Secunderab_ad, AP, India. Enzymes: Various restriction enzymes used and Vent DNA polymerase were procured from New England Biolabs, Beverly, MA, USA. Taq DNA polymerase was obtained from Stratagene. Antibodies and Conjugates: Goat anti-GST Ab was obtained from Pharmacia Biotech, Uppsala, Sweden. The following secondary revealing Abs were used: i) goat anti-mouse immunoglobulin G (lgG)-horse radish peroxidase (HRPO) from BioRad; ii) goat anti-rabbit IgG-HRPO (Pierce Chemical Co.); iii) goat anti-monkey IgG-HRPO (Sigma); iv) anti-rabbit-FITC and v) anti-goat-HRPO (Reagent Bank, Nil, New Delhi) vi) anti-mouse FITC (Dakopatts a/s, Glostrup, Denmark).

Chemicals: Tris, glycine, acrylamide, N', N'-methylene bisacrylamide, sodium dodecyl sulfate (SDS), N', N', N', N'-tetramethylethylene diamine (TEMED), ammonium persulfate (APS), ~-mercaptoethanol (BME), 4-chloronaphthol, urea, guanidine HCl, guanidine isothiocyanate (GITC), sarcosyl, sodium citrate, phenol, ficoll, polyvinylpyrrolidone (PVP), agarose, bromophenol blue, Coomassie brilliant blue, ethidium bromide, calcium chloride and bicinchoninic acid (BCA) were obtained from Sigma Chemical Co., St. Louis, MO, USA. LMP agarose and isopropyl ~-D thiogalactopyranoside (IPTG) were from Amresco, Solon, USA. Molecular weight standards were obtained from Gibco-BRL, Grand Island, NY, USA, or Bio-Rad Laboratories, Hercules, CA, USA. Reagents for enzyme immunoassays viz., bovine serum albumin (BSA), orthophenylene diamine (OPD) were procured from Sigma, while Tween-20 was obtained from Amresco. Reagents for conjugation and immunization, viz. diphtheria toxoid (DT) and tetanus toxoid (TT) were from Serum Institute, Pune, India while glutaraldehyde, L-lysine, 2, 6, 10, 15, 19, 23-hexamethyl-2, 6, 10, 14, 18, 22-tetracosa-hexane (Squalene) and mannide monooleate (Arlacel A) were procured from Sigma; Pergonal® was obtained from Laboratoires Serono S.A., Aubonne, Switzerland; Sodium phthalyl derivative of lipopolysaccharide (SPLPS) was kindly provided by the lmmunoendocrinology Laboratory, National Institute of Immunology (Nil), New Delhi. Reagents used in the estimation of progesterone such as gelatin, charcoal, dextran, 3H-progesterone and anti-progesterone Ab were provided by the WHO Matched Reagent Assay Programme while diphenoxazole (PPO), 1-4 bis (5-phenyl-2-oxazolyl) benzene (POPOP), and mercury-[(o-carboxyphenyl)thio]ethyl sodium salt (Thimerosal) were obtained from Sigma. Media and Antibiotics: Bacto-tryptone, bacto yeast extract and bacto agar were from Difco Laboratories, Detroit, USA; Grace's insect cell medium and antibiotic-antimycotic

REAGENTS

added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.

J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was

PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.

Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with

Using calcium phosphate.

rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.

ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were

1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass

Transient expression of the cloned gene product was studied by transfection performed with

Transient expression.

hours. The NC filters having bound DNA liberated from bacterial colonies, were set up for hybridisation with radioactive probes as described by Maniatis et al., ( 1982 ). The filters were washed thoroughly with a solution containing 50 mM Tris.Cl, pH 8.0, 1 M NaCl, 1 mM EDTA, 1 % SDS, at 42°C, for 1 hour, to wash off any residual bacterial debris and agar etc. Prehybridisation and hybridisation was performed in aqueous solution without formamide in 5 X SSPE. The filters were washed up to a stringency of 0.2 X sse at 65°e.

Colonies bound to nitrocellulose filter ( NC ) were lysed to liberate the DNA which was hybridised as described by Maniatis et al., 1982 ) . To obtain sharper autoradiography signals, the nitrocellulose filter bearing colonies was first overlaid on a 3 MM Whatman paper impregnated with 10 % SDS till the NC wetted evenly. The NC was peeled off and overlaid on another 3 MM paper impregnated with the denaturing solution. In this manner, the NC was successively treated with denaturing and neutralising solutions. Finally, the NC filter was air dried, sandwiched between two sheets of 3 MM paper and baked at 80°C for two

Colony hybridisation.

400 ci 1 mmole to 3000 ci 1 mmole. The nick translation reaction was set up as recommended by the manufacturer of the kit, using about 0.5 ug DNA. The reaction was incubated at 12 -14 °C for 90 minutes, except in the case of small fragments ( 500 bp ) when the reaction was incubated for 45 minutes only. The reaction was terminated by the addition of stop buffer supplied with the kit.

DNA was labelled using the nick translation kits supplied by BRL or NEN, USA, or Amersham, UK. The 32P-deTP was from either NEN or Amersham, UK, at a concentration of 10 mei I ml. The specific activity of the label ranged from

Nick translation.

bands seen in the DNA size marker, were marked with a ball -point pen at the places where small holes had been pierced in the gel earlier ( see above ). Thus it was easy to monitor the size of the fragments showing hybridisation to the probe. The gel was then peeled off and the membrane w~shed in 6 X sse with gentle rocking for 10 minutes to wash away any residual agarose sticking to the membrane. After air drying at room temperature, the membrane was baked at so0e for two hours. The baked filter was stored at room temperature in a dessicator, if not used immediately. The dehydrated gel was restained in water containing 0.5 ug I ml ethidium bromide for 30 minutes and examined on a short wave UV transilluminator to check for the presence of any DNA fragments that escaped blotting. The absence of any residual bands indicated that the transfer was complete.

Restriction fragments of DNA resolved on agarose gel were transferred to nylon membrane ( GeneScreen or GeneScreen Plus by the capillary blotting procedure of Southern ( 1975 ) as described by Maniatis et al., ( 1982 ) . After the completion of electrophoresis, the gel was stained and photographed as described earlier. Position of the various bands obtained in the DNA size marker lane were marked by piercing small holes at the two ends of each band in the gel with a yellow tip. The gel was then denatured, neutralised and blotted essentially as described by Maniatis et al., ( 1982 ) . Locally available coarse absorbent paper was used to make the paper towels of the appropriate size. In case of genomic DNA from mammalian cells, the agarose gel was first treated with 0.25 M HCl for 10 minutes, followed by the rest of the procedure as mentioned above. The transfer buffer was 20 X SSPE in all cases. To prevent the absorption of fluid from the 3 MM paper under the gel directly to the blotting paper atop the nylon membrane, the gel was surrounded with polythene sheets to minimise the direct contact between the blotting paper and the 3 MM paper placed under the gel. The blotting was performed for 18 -24 hours. After the transfer was over, the paper towels and the 3 MM papers on top of the nylon filter were peeled off. The gel along with the attached membrane, was turned over and kept on a clean sheet of 3 MM paper with the gel side up. The position of the gel slots was marked with a ball -point pen. Also, the positions of the

southern blot.

Colony lifts were performed essentially as described by Maniatis et al. , 1982 ) . Recombinant colonies were grown 0/N at 37°C to have well separated colonies. The colonies were overlaid with 80 mm diameter nitrocellulose filter circles BA 85, S & S and after the filter became wet throughout, it was peeled off in a single, smooth motion, avoiding the smearing of the bacterial colonies. The plate was reincubated at 37°C for a few hours to regenerate the colonies. The colonies transferred to the filter were lysed to bind the liberated DNA to the nitrocellulose.

Colony lifts.

Transfer of DNA.

were stored at -70°C for at least six months without any significant loss in the competence.

A single ~.coli colony taken from an agar plate was used to inoculate 10 ml of LB and incubated 0/N at 37°C in an incubator-shaker. Next day, 0. 5 ml of this freshly grown culture was used to inoculate 100 ml of LB in a 500 ml flask. The culture was incubated at 37°C in an incubator -shaker and absorbance of the growing culture was monitored at 620 nm. When the A620 reached 0. 4 -0. 5 ( in about 120 -150 minutes), the flask was rapidly chilled by shaking in ice. The cells were harvested in sterile, chilled centrifuge bottles at 4, ooog for 10 minutes at 4 °c. The pellet was gently resuspended in 50 ml sterile, ice cold 100 mM cacl2 and the cells incubated in ice for 30 minutes. The cells were again centrifuged as above and the pellet resuspended in 6.5 ml of sterile, chilled, 100 mM cac12 containing 15 % glycerol. The cells were resuspended very gently, and a 200 ul aliquot was transformed with a standard plasmid DNA to check the competence of the cells. Meanwhile, the rest of the competent cells were incubated in ice for 16 -18 hours, to increase the competence of the cells a further few fold. After ascertaining high transformation efficiency of the competent cells, the cells were dispensed as 200 ul aliquots into prechilled, sterile 1.5 ml eppendorf tubes. These cells

Preparation of competent E.coli cells.

lectrophoresed on 0.7 % -1.2 % agarose gels in TAE or TBE buffer. Choice of the percentage of agarose and the electrophoresis buffer system was made following the guidelines of Maniatis et al., ( 1982 ). In general, upto 1 kb fragments were resolved on 1.2 % agarose gels using TBE buffer. For most other purposes, TAE buffer was used. Agarose gel electrophoresis was carried out as described by Maniatis et al., ( 1982 ) . The run was stopped when the bromophenol blue dye migrated to within 1 em -1.5 em from the edge of ' the gel, except when the sample had fragments smaller than 500 bp, in which case the elctrophoresis was terminated at an earlier stage. The gel was immersed in water containing 0.5 ug I ml ethidium bromide, for 30 minutes, to stain the DNA. When detecting very low amounts of DNA, the staining was done for 60 minutes followed by destaining in 1 mM Mgso4 for one hour at room temperature. The DNA bands were visualised on a short wavelength UV transilluminator ( Fotodyne, Inc., USA and photographed with a Polaroid MP-4 camera using Polaroid type 667 film.

DNA digested with restriction enzymes was

For rapid electrophoretic analysis of plasmid DNA prepared by miniprep protocol, or to monitor the progress of digestion during various cloning procedures, the DNA was resolved on short agarose gels, taking less than one hour for the run. The electrophoresis was carried out in TAE buffer using 8 em long gels with a comb of teeth size 0.4 x 0.2 em. The width of the gel was variable, depending on the number of samples to be analysed. Gels were run at 50 100 volts, till the bromophenol blue dye migrated to within 0.5 em of the edge of the gel.

Mini gel electrophoresis

Electrophoresis of DNA

Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.

ecanted and the pellet dried briefly under vacuum. The final DNA pellet was resuspended in 500 ul of TE. A 1:50 dilution of the sample was used to measure the absorbance at 260 nm and at 280 nm. The A260 and A280 values were used to estimate the concentration and purity of the sample as described by Maniatis et al., ( 1982).

further purified by centrifugation to equilibrium in a 30 ml cesium chloride -ethidium bromide density gradient, as described by Maniatis et al., ( 1982 ) . The band corresponding to closed circular plasmid DNA was collected and further purified by a second centrifugation to equilibrium in a 6. 5 ml cesium chloride -ethidium bromide density gradient. The final DNA band collected from the gradient was extracted with an equal volume of isopropanol which had been previously saturated with TE and cesium chloride. This extraction was repeated twice to completely remove the ethidium bromide from the DNA sample. The DNA was then dialysed against one liter of TE for at least 8 hours, at 4 °c, with several changes of TE. To the dialysed sample, one tenth volume of 3 M sodium acetate, pH 5.2, was added and the DNA precipitated with two volumes of chilled ethanol. The precipitation was carried out 0/N at 0 -20 c. The precipitated centrifugation at 10, 000 rpm, DNA was collected by for 10 minutes. The supernate was carefully d

resuspended in 20 ml of Tris -Glucose solution ( 25 mM Tris. HCl, pH 8. 0; 50 mM Glucose ) . The cells were vortexed followed by repeated pipetting to obtain a uniform cell suspension. To this, 6.0 ml of a freshly prepared lysozyme solution ( 10 mg 1 ml, prepared freshly in sterile distilled water ) was added. The cell suspension was swirled to mix thoroughly and incubated for 5 minutes at room temperature. Next, 0.5 M EDTA was added to a final concentration of 10 mM, the contents swirled to mix and incubated in ice for 20 minutes. Next, 40 ml of a lytic mix containing 0. 1 % SDS and 0. 2 N NaOH was added. This was prepared freshly by mixing 4 ml of 10 % SDS solution into 36 ml of 0.22 N NaOH solution. The solution was mixed by vigorous but brief shaking till the cell lysate became clear, followed by incubation on ice for 5 minutes. Finally, 20 ml of 5 M potassium acetate solution, pH 4.8 was added. Again the contents were swirled to mix, followed by incubation in ice for at least 1 - 2 hours. The lysate was centrifuged at 10,000 rpm for 30 minutes at 4°c. The supernate was filtered through sterilised glass wool kept in a funnel, and collected in a graduated cylinder. The measured volume of the cell lysate was transferred into another centrifuge bottle and two volumes of 95 % ethanol added to precipitate the DNA, at 0 -20 c, 0/N. The DNA was pelleted by centrifugation at 10,000 rpm at 4 °c for 30 minutes. The supernate was carefully poured off and the pellet res~spended in 25 ml of TE ( 10 mM Tris.HCl, pH 8.0; 1 mM EDTA ). The plasmid DNA was

Plasmid DNA was isolated using the alkaline lysis method of Birnboim ( 1979 ) with slight modifications. One liter of TB supplemented with ampicillin @ 50 ug 1 ml was inoculated with 10 ml of a freshly grown primary culture and the culture incubated 0/N at 37°c, in an incubator -shaker. The cells were pelleted by centrifugation at 4000g for 10 minutes at 4 °c. The supernate was discarded and the pellet

Isolation of plasmid DNA.

yeast extract, and 10 g NaCl in distilled water, pH adjusted to 7.5 with NaOH and final volume made up to one liter (Maniatis et al., 1982). Cultures of ~.coli cells transformed with plasmid DNA were grown in media supplemented with 50 ug/ml of ampicillin. For large scale plasmid DNA isolation, ~.coli cells were grown in an enriched medium, Terrific Broth ( TB ) . One liter of TB was prepared by adding 100 ml of a sterile solution of 0.17 M KH2Po4 and 0.72 M K2HPo4 to a sterile solution containing 12 g Bacto -tryptone, 24 g Bacto -yeast extract, 4.0 ml glycerol and water to a final volume of 900 ml ( Tartof and Hobbs, 1987 ) . The media were sterilised by autoclaving at 15 psi for 20 minutes. Heat labile compounds and antibiotics were sterilised by filtration through a 0.45 u nitrocellulose membrane and added to autoclaved media after cooling the same to 55°C. Solid media was prepared by adding 1. 5 % bacto -agar prior to autoclaving. Storage of ~.coli was carried out essentially as described by Maniatis et al., ( 1982).

Composition of growth media used for culturing ~. coli is given in Table 3. For routine propagation, ~.coli cells were grown in Luria Bertani medium LB ) . LB was prepared by dissolving 10 g Bacto -tryptone, 5 g Bacto -

Growth and storage of bacteria.

The bacterial strains used in this study were ~.coli Kl2 strains, HBlOl ( F-, hsd S20 ( rB-, mB-) , supE44, ara14, ~-, galK2, lacYl, proA2, rpsL20, xyl-5, mtl-1, recA13 ] (Boyer et al., 1969 ), and JM105 ( thi, rpsL, endA, sbcB15, hsdR4, ( lac-proAB ), {F1, traD36, proAB, laciqZ M15 } ]. The mammalian cell lines used are listed in Table 1. Rat-2 is an established rat fibroblast cell line. FWIL (Larrick et al., unpublished) is a human myeloma cell line derived from the fusion of U266 IgE myeloma cells with WIL-2 lymphoblastoid cells. Rat - 2 and FWIL cell lines were kindly provided by Dr. J.W. Larrick, Cetus Corporation, USA. The other four cell lines were obtained from American Type Culture Collection ( ATCC ). The plasmids used in this study are described in Table 2.

Bacterial strains, cell lines and plasrnids.

The membranes were suspended (1.4 x 108 cell equivalent) in 250 III of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 Ilg/ml tunicamycin). Each assay tube was prepared by adding 12.5 III of 1 % Chaps, 2.8 III of 200 IlM GOP-Man, 10 III of GOP-[3H]-Man (1IlCi) and 25 nmol of synthetic substrate (49). The contents were lyophilized and 250 III of membrane suspension (1 .4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The eH] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting. The above assay was then carried out with a range of concentrations of OMJ to assess it's effect on the activity of eMPT enzyme parse.

eMPT inhibition assay

mixture). These samples were lyophilized and 125 III of the reaction mixture was added to each tube. The tubes were then incubated at 25°C for 1 h and the biosynthetic LPG was extracted as described above. 10 III of the solvent E extract was taken for scintillation counting.

1. Mild acid hydrolysis: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.02 N HGI (200 Ill). The mixture was then placed in a 100 °G water bath for 5 minutes. After hydrolysis, the sample was again dried under nitrogen and codried thrice with toluene (0.5 ml). The residue was suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 2. Nitrous acid deamination: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.2 ml of 0.125 M sodium acetate (pH = 4.0) and 0.25 M sodium nitrite. The mixture was incubated at 25 °G for 40 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 3. PI-PLC treatment: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and suspended in 0.4 ml of PI-PlG buffer (0.1 M Tris chloride, pH = 7.4 with 0.1 % deoxycholate) and 0.2 ml of PI-PlG concentrate (B.subtifis culture supernatant) was added. The mixture was then incubated at 37 °G for 16 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. The effect of deoxymannojirimycin (Sigma, Gat. no. 0-9160) on the cell free biosynthesis was carried out. OMJ (5 mg) was dissolved in 1 ml of MQ water and 2.5, 5, 25 and 50 III were transferred to eppendorf tubes separately (which corresponded to 0.5, 1, 5 and 10 IlM concentrations of OMJ in 125 III ofthe reaction

Characterization of biosynthetic LPG

NaGI in 0.1 M glacial acetic acid, 1.2 ml of 0.1 M glacial acetic acid, 0.6 ml of water and 3.6 ml of solvent E. Fractions of 0.6 ml each were collected and assayed for radioactivity.

Parasites (6 X 109) were harvested, pelleted at 3000 g for 10 min, washed with PBS, repelleted and suspended in 10 mL of HEPES buffer (100 mM HEPES-NaOH, pH = 7.4, 50 mM KCI, 10 mM MnCI2, 10 mM MgCI2, 0.1 mM TLCK, 1 Jlg/mL leupeptin) containing 10% glycerol. The cells were disrupted in a Parr nitrogen cavitation bomb (1500 psi, 25 min, 4°C, 3 cycles). The debris was removed by centrifugation at 3000 g for 5 min and the supernatant was centrifuged at 100,000 g for 1 h at 4°C. The resulting membrane pellet was resuspended in 10 mL of HEPES buffer without glycerol and centrifuged again at 100,000 g for 1 h at 4°C. The membranes were finally suspended in 1 mL (13 mg/mL) of HEPES buffer without glycerol. The incubation mixture per reaction contained membrane protein (2 mg) in 125 JlL of 50 mM HEPES-NaOH buffer, pH = 7.2 containing supplements (25 mM KCI, 5 mM MgCI2, 5 mM MnCI2, 0.1 mM TLCK, 1 JlglmL leupeptin, 0.8 mM ATP, 0.4 mM On) with 2 JlM UOP-[3H]-galactose (2 JlCi) and 10 JlM GOP-mannose. The mixture was incubated at 25°C for 1 h, terminated by the addition of CHCI~CH30H (3:2) to give a final ratio of CHCI~CH30H/H20 (3:2:1) and sonicated. The layers were then allowed to separate out after which the lower layer was removed with the aid of a micropipette. The tube containing the upper and intermediate layer was centrifuged (10,000 rpm, 4°C, 5 minutes). The supernatant was discarded and the resultant pellet (membranes) was suspended in 1 mL of CHCI~CH30H/H20 (1:1 :0.3). The solution was again centrifuged (10,000 rpm, 4°C, 5 minutes) and the pellet was extracted with 1 mL of solvent E (H20/ethanol/diethylether/pyridine/NH40H 15:15:5:1 :0.017) thrice. The solvent E extracts were pooled and dried under a stream of nitrogen, suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid and chromatographed over a 1 mL column of phenyl sepharose. Phenyl Sepharose Column of Biosynthetic LPG. The solvent E extract suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid was applied to a column (0.5 x 2 cm) of phenyl sepharose (Pharmacia BioteCh), preequilibrated with 0.1 M NaCI in 0.1 M glacial acetic acid. The column was then washed sequentially with 3 mL of 0.1 M

Cell-free Biosynthesis42 of LPG using Leishmania membranes

Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.

ixture was stirred under argon atmosphere for 2 days.

were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m

Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents

Synthesis of L-Mannose analogue of GOP Mannose (Scheme 18 of Results and Discussion)

(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.

solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H

Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred

Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)