PatientID: N/A

KindredID: 7

Case: M, 58Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Patient had family history of VHL disease. Patient’s nephew presented with renal cell carcinoma at 30, patient's sister/brother presented with a hemangioblastoma at age 39 and then retinal capillary hemangioma, renal cell carcinoma, and abnormality of the pancreas at age 57. Patient’s sister presented with a hemangioblastoma at age 40. All three of these family members were genetically tested and possessed the same mutation. Patient’s other brother presented with a hemangioblastoma at age 35 but died before diagnosis and genetic testing.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0009711, HP:0005584 (retinal capillary hemangioma, renal cell carcinoma)

CaseHPOFreeText: Patient presented with retinal hemangioma at age 25 and renal cell carcinoma at age 54.

CaseNotHPOs: HP:0002666, HP:0030393, HP:0010797, HP:0001732 (pheochromocytoma, endolymphatic sac tumor, hemangioblastoma, abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

GroupID: 27

Case: 45Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0006880; HP:0005584 (cerebellar hemangioblastoma; renal cell carcinoma)

CaseHPOFreeText: patient had cerebellar hemangioblastoma diagnosed at 25Y, and RCC diagnosed at 45Y

CaseNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma; pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.Q145* (c.433C>T) 

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625249 https://www.ncbi.nlm.nih.gov/clinvar/variation/625249/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q145* (c.433C>T) 

MultipleGeneVariants: N/A

PatientID: 136

KindredID: 51

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 136) has a mother (patient 137) who presented with a CNS hemangioblastoma at 32, and renal cell carcinoma/ pheochromocytoma at 38. However, no DNA sample was available for his mother's genetic testing.

CasePresentingHPOs: HP:0010797, HP:0001737, HP:0001732, HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband (patient 136) presented with multiple pancreatic cysts/tumors at 21, renal cell carcinoma at 23, and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P146Gfs*14 (c.435_436ins)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131810, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131810

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_2_frameshift_variant

CivicName: P146Gfs*14 (c.435_436insGG)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 19

Case: F, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive. The patient's son was the proband (1) and carried the mutation but was asymptomatic. The proband's uncle (7) carried the mutation and presented with symptoms. The proband's cousin (9) and first cousin once removed (22) were also found to have the mutation but were asymptomatic.

CohortInfo: 20 unrelated VHL families from an ethnically diverse cohort containing both affected and unaffected individuals.

CasePresentingHPOs:HP:0010797, HP:0005584, HP:0001732, HP:0000077 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, abnormality of the kidney)

CaseHPOFreeText: The patient presented with a hemangioblastoma at ages 17, 24, 30. At age 25 she presented with renal cell carcinoma and abnormalities of the kidney and pancreas.

CaseNotHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma )

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cysts.

CasePreviousTesting: N/A

PreviouslyPublished: 31368132

SupplementalData: Supplementary file 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: p.W88* (c.476G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 182978 https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 60

KindredID: 23

Case: M, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.

CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

GroupID: 6B

DiseaseAssertion: assumed VHL

GroupSize: 9

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Chinese

GroupAgeRange: 33.8Y +/- 17.6Y

GroupInfo: Clinical characteristics of 258 patients from 80 unrelated Chinese families were reported in this study. Grouped by the 21 mutations found, 3 families with 13 members total were described. it is unclear how many distinct families are reported in group 6B. 9 individuals were described. Phenotypic information was given for this mutation.

GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584; HP:0001737; HP:0009715 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma, pancreatic cysts, papillary cystadenoma of the epididymis)

GroupHPOFreeText: 7 of the 9 members presented with CNS hemangioblastoma (mean age of 29.9Y), 2/9 had retinal angiomas at 25Y and 35Y, 1 had renal cell carcinoma (at 30Y), pancreatic cysts in 2 members (with an age of onset of 30 and 31Y), and 1 member with a genital system tumor (epididymis or broad ligament) at 24Y

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: No patients were given with pheochromocytoma

GroupPreviousTesting: N/A

PreviouslyPublished: 29330336; 28388566

SupplementalData: N/A

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 1

Case: F, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: No family history.

CasePresentingHPOs: HP:0006880; HP:0002894; HP:0005584 (Cerebellar Hemangioblastoma; neoplasm of the pancreas; renal cell carcinoma)

CaseHPOFreeText: At 35-year old, the female patient was diagnosed with VHL due to clinical presentation of pancreatic serous cystic neoplasm and renal cell carcinoma, and cerebellar hemangioblastomas that were surgically removed at age 21. The patient had underwent total pancreatectomy and right nephrectomy for pancreatic serous cystic neoplasm (SCN) and renal cell carcinoma (RCC), respectively. 4 years later, tumors in the liver were detected by CT scan and radiographically diagnosed as metasta-ses of the pancreatic SCN or RCC. Again, morphology and immunohistochemical findings of the resected tumors again were similar to the primary pancreatic SCN, thus diagnosed as multiple metachronous liver metastases of pancreatic SCN. As of 47Y, the patient has remained disease-free without any recurrence after the third operation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 21673464

SupplementalData: N/A

Variant: p.N78I (c.233A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223169 https://www.ncbi.nlm.nih.gov/clinvar/variation/223169/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: N78I (c.233A>T)

MultipleGeneVariants: N/A