PatientID: N/A

KindredID: 7

Case: M, 58Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Patient had family history of VHL disease. Patient’s nephew presented with renal cell carcinoma at 30, patient's sister/brother presented with a hemangioblastoma at age 39 and then retinal capillary hemangioma, renal cell carcinoma, and abnormality of the pancreas at age 57. Patient’s sister presented with a hemangioblastoma at age 40. All three of these family members were genetically tested and possessed the same mutation. Patient’s other brother presented with a hemangioblastoma at age 35 but died before diagnosis and genetic testing.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0009711, HP:0005584 (retinal capillary hemangioma, renal cell carcinoma)

CaseHPOFreeText: Patient presented with retinal hemangioma at age 25 and renal cell carcinoma at age 54.

CaseNotHPOs: HP:0002666, HP:0030393, HP:0010797, HP:0001732 (pheochromocytoma, endolymphatic sac tumor, hemangioblastoma, abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 60

KindredID: 23

Case: M, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.

CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Not significant - the paper states that the parents and siblings were negative for the mutation (indicating de novo).

CasePresentingHPOs: HP:0002666; HP:0009711; HP:0000479; HP:0012045 (pheochromocytoma, retinal capillary hemangioma, abnormal retinal morphology, retinal flecks)

CaseHPOFreeText: patient was referred for eye exam as part of a VHL screening program at 25Y. She has been diagnosed with bilateral pheochromocytoma at the age of 14 after an episode of acute hypertensive encephalopathy. Ophthalmoscopy disclosed in her right eye a small retinal hemangioma (1 disc diameter wide) along with feeder vessels in the mid-periphery and multiple, small, whitish, dome-shaped lesions scattered in the deeper layers of the posterior retina. Fluorescein and indocyanine green angiography confirmed the presence of the retinal hemangioma; multiple window-defects were also seen at the posterior pole and pericentral retina and hypofluorescent dots. (Unusual alterations of the deep retinal layers).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T157I (c.470C>T)

LegacyVariant: p.T157I (c.683C>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 223223 https://www.ncbi.nlm.nih.gov/clinvar/variation/223223/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: T157I (c.470C>T)

MultipleGeneVariants: N/A

PatientID: 83 (Cousin)

KindredID: 18

Case: F, 50Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (25Y), retinal angioma (16Y) and pancreatic tumors or cysts (undefined) (22Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: A point mutation (c.712C>T) was found. Being that this variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 6B

DiseaseAssertion: assumed VHL

GroupSize: 9

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Chinese

GroupAgeRange: 33.8Y +/- 17.6Y

GroupInfo: Clinical characteristics of 258 patients from 80 unrelated Chinese families were reported in this study. Grouped by the 21 mutations found, 3 families with 13 members total were described. it is unclear how many distinct families are reported in group 6B. 9 individuals were described. Phenotypic information was given for this mutation.

GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584; HP:0001737; HP:0009715 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma, pancreatic cysts, papillary cystadenoma of the epididymis)

GroupHPOFreeText: 7 of the 9 members presented with CNS hemangioblastoma (mean age of 29.9Y), 2/9 had retinal angiomas at 25Y and 35Y, 1 had renal cell carcinoma (at 30Y), pancreatic cysts in 2 members (with an age of onset of 30 and 31Y), and 1 member with a genital system tumor (epididymis or broad ligament) at 24Y

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: No patients were given with pheochromocytoma

GroupPreviousTesting: N/A

PreviouslyPublished: 29330336; 28388566

SupplementalData: N/A

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A