PatientID: 20

KindredID: 20

Case: 19Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711 (hemangioblastoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 13

KindredID: 13

Case: 20Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711 (hemangioblastoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister (the proband) also had this mutation and presented with hemangioblastoma (age 35), retinal angioma (age 37), pancreatic cysts or tumours (age 37), and renal cell carcinoma (age 39). Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: None

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666, HP:0009715, HP:0010797, HP:0005584, HP:0001732, HP:000971(pheochromocytoma, Papillary cystadenoma of the epididymis, hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 101

KindredID: 34

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 99) presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 40. Their mother (patient 100) presented with a CNS hemangioblastoma at age 50 and multiple pancreatic cysts/tumors at age 63, but passed away before diagnosis/ genetic testing. Their sister (patient 101) had the mutation and presented with a CNS hemangioblastoma and a retinal angioma at age 51. Their second sister (sister 2, patient 102) passed away before diagnosis/genetic testing but presented with a CNS hemangioblastoma at 40, renal cell carcinoma at 43 and multiple pancreatic cysts/tumors at 43. Their brother (patient 103), who also passed away before diagnosis/genetic testing, presented with a CNS hemangioblastoma and retinal angioma at age 47.

CasePresentingHPOs: HP:0010797, HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The sister (patient 101) presented with a CNS hemangioblastoma and a retinal angioma at age 51.

CaseNotHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0002666 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98N (c.292T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750883, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: Sex Unknown, 39Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister also had this mutation but was asymptomatic. Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732, HP:0009711 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 35. At age 37 she presented with retinal angioma and pancreatic cysts or tumours. At age 39 she presented with renal cell carcinoma.

CaseNotHPOs: HP:0002666, HP:0009715 (pheochromocytoma, Papillary cystadenoma of the epididymis)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

Using polymerase chain reaction (PCR)-direct sequencing and universal primer quantitative fluorescent multiplex–PCR, mutations in VHL gene in 19 VHL disease families recruited from the Department of Urology, Peking University First Hospital in the period from 2009 to 2012 were examined. One proband and their sister (family 1) were found to carry the mutation c.292T>A in exon 1 of the VHL gene. The proband presented with hemangioblastoma at age 35, retinal angioma and pancreatic cysts or tumours at age 37, and renal cell carcinoma at age 39. The patient had positive VHL family history and their first sister also carried this germline mutation but was asympromatic. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.This family was previously published in 29330336.