PatientID: 2

KindredID: 4

Case: F, 41Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Thirteen patients with a supratentorial hemangioblastoma.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: The patient had a right temporal hemangioblastoma at age 25. After surgery the patient was disease free. The patient was followed up 16 years later.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType:exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 136

KindredID: 51

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 136) has a mother (patient 137) who presented with a CNS hemangioblastoma at 32, and renal cell carcinoma/ pheochromocytoma at 38. However, no DNA sample was available for his mother's genetic testing.

CasePresentingHPOs: HP:0010797, HP:0001737, HP:0001732, HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband (patient 136) presented with multiple pancreatic cysts/tumors at 21, renal cell carcinoma at 23, and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P146Gfs*14 (c.435_436ins)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131810, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131810

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_2_frameshift_variant

CivicName: P146Gfs*14 (c.435_436insGG)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 19

Case: F, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive. The patient's son was the proband (1) and carried the mutation but was asymptomatic. The proband's uncle (7) carried the mutation and presented with symptoms. The proband's cousin (9) and first cousin once removed (22) were also found to have the mutation but were asymptomatic.

CohortInfo: 20 unrelated VHL families from an ethnically diverse cohort containing both affected and unaffected individuals.

CasePresentingHPOs:HP:0010797, HP:0005584, HP:0001732, HP:0000077 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, abnormality of the kidney)

CaseHPOFreeText: The patient presented with a hemangioblastoma at ages 17, 24, 30. At age 25 she presented with renal cell carcinoma and abnormalities of the kidney and pancreas.

CaseNotHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma )

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cysts.

CasePreviousTesting: N/A

PreviouslyPublished: 31368132

SupplementalData: Supplementary file 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: p.W88* (c.476G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 182978 https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 200

KindredID: 77

Case: F, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 200) has six family members who passed away before diagnosis/ had no DNA sample available. Of the family who passed away before diagnosis: the proband's aunt 1 (patient 202) had a CNS hemangioblastoma at 27; the daughter of aunt 1 (patient 203) had a pheochromocytoma at 31; aunt 2 (patient 205) had a CNS hemangioblastoma at 43, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 48. Of the family for whom no DNA sample was available: the proband's mother (patient 201) had a CNS hemangioblastoma at 51, multiple pancreatic cysts/tumors at 46, and a pheochromocytoma at 25; the grandson of aunt 1 (patient 204) had a pheochromocytoma at age 9; and the son of aunt 2 (patient 206) had a pheochromocytoma at 16 and renal cell carcinoma + multiple pancreatic cysts/tumors at 21.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a pheochromocytoma and renal cell carcinoma at 36.

CaseNotHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0002666; HP:0005584 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Renal cell carcinoma )

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 60

KindredID: 23

Case: M, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.

CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 83 (Cousin)

KindredID: 18

Case: F, 50Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (25Y), retinal angioma (16Y) and pancreatic tumors or cysts (undefined) (22Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: A point mutation (c.712C>T) was found. Being that this variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A