PatientID: 30

KindredID: 11

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 30) has a son (patient 31) who was genetically confirmed with the mutation, who was asymptomatic at the time of analysis. She also has a father (patient 32, CNS hemangioblastoma at 42), a brother 1 (patient 33, CNS hemangioblastoma at 28), brother 2 (patient 34, CNS hemangioblastoma at 30), and uncle (patient 35, retinal angioma at 60) who passed away before they could be diagnosed/ genetically confirmed with the mutation.

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at 28, retinal angioma at 26, renal cell carcinoma at 37, and multiple pancreatic cysts/tumors at 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336). This mutation was also published in PMID 32179488 in reference to one patient with VHL disease type 1 in this paper with the c.227_229del variant. However, it is unclear whether patient #27, #28, or #30 is specifically published in PMID 32179488.

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F76del (c.227_229del)

LegacyVariant: F76del (c.224_226delTCT)

CaseProblemVariantFreeText: The protein coding change for this variant is listed in this paper as p.F76Cfs*138. However the DNA change listed in this paper (c.224_226delTCT) is equivalent to c.227_229delTCT, and results in p.F76del. This variant is entered on CIViC with p.F76del. As a note the latter c. nomenclature is preferred due to the 3' rule.

ClinVarID: N/A

CAID: CA357012; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 259

KindredID: 100

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24. The proband's son, patient 260, was asymptomatic at the time of analysis.

CasePresentingHPOs: N/A

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24.

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1-2 Deletion (c.1-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1-2 Deletion

MultipleGeneVariants: N/A

PatientID: 81

KindredID: 27

Case: M, 38Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 81) had 3 family members confirmed with the mutation: his aunt 2 (patient 85) had pancreatic cysts and/or tumors at age 50, his cousin/ the son of Aunt 2 was asymptomatic at the time of assessment, and the granddaughter of aunt 2 was also asymptomatic at the time of assessment. The proband also had 3 family members who passed away before diagnosis/ before confirming the mutation: his mother (patient 82) had a CNS hemangioblastoma at 33, his Aunt 1 (patient 83) had a CNS hemangioblastoma at 32, and his cousin/ the son of Aunt 1 (patient 84) had a CNS hemangioblastoma at 30.

CasePresentingHPOs: HP:0010797; HP:0001732; HP:0001737; HP:0005584; HP:0002666 (Hemangioblastoma, Abnormality of the pancreas, Pancreatic cysts, Renal cell carcinoma, Pheochromocytoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at age 28, and renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 38.

CaseNotHPOs: HP:0009711(Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172; https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 71

KindredID: 25

Case: F, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband has the same mutation as her son (patient no.72). Her son did not present with hemangioblastoma, multiple pancreatic cysts/tumors, retinal angioma, renal cell carcinoma, or pheochromocytoma, and is apparently asymptomatic.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The patient presented with renal cell carcinoma at age 28, multiple pancreatic cysts/tumors at age 28, and hemangioblastoma at age 30.

CaseNotHPOs: HP:0009711; HP:0002666 (Retinal capillary hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182978, https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 104

KindredID: 35

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 104, presented with multiple pancreatic cysts/tumors at age 27. Their sister, patient 105 presented with pancreatic cysts/tumors at age 28. Their mother presented with a CNS hemangioblastoma at 45 but passed away before diagnosis/genetic testing.

CasePresentingHPOs: HP:0001737; HP:0001732 (Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160; https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 30Y0M, Vietnamese

DiseaseAssertion: VHL

FamilyInfo: None - The diagnosis of VHL had not been established in her parents or her relatives, who lived in Vietnam without further evaluation.

CasePresentingHPOs: HP:0009711; HP:0001737 (retinal capillary hemangioma; pancreatic cysts)

CaseHPOFreeText: At 28Y presented with multiple retinal capillary hemangioma (complicated tractional retinal detachment and multiple large angiomas) and multiple pancreatic cysts. Underwent PPV combined with relaxing retinectomy.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A