2,371 Matching Annotations
  1. Jun 2025
    1. Evo 2 can also leverage its unique representation of biological complexity to generate new genomic sequences

      What is the point in generating genomic sequences with some vague notion such as "naturalness"? - Assuming future adaptations would include prompting to generate specific sequence features; maybe it makes more sense in this context?

    2. previously demonstrated that machine learning models trained on prokaryotic genomic sequences can model the function of DNA, RNA, and proteins

      Elaborate "Can model the function"

    1. VOGDB, which is a database of virus orthologous groups. VOGDB is a multi-layer database that progressively groups viral genes into groups connected by increasingly remote similarity

      Layers: 1. pair-wise sequence similarity 2. sequence profile alignment 3. predicted protein structures

      The first layer is based on pair-wise sequence similarities, the second layer is based on the sequence profile alignments, and the third layer uses predicted protein structures to find the most remote similarity

    1. Specific gut species distinguish left-sided versus right-sided CRC (area under the curve = 0.66) with an enrichment of oral-typical microbes

      It is very surprising that left and right side of colerectal cancers have heterogeneity!

    1. The Trump administration is preparing to cancel a large swath of federal funding for California

      How do you prevent such partisan and vindictive actions by federal government on states?

      Same thing is happening in India - Is there any framework people have seen in a more federated country, maybe Germany?

    1. or methodological differences in screening algorithms.

      This could have been elaborated a bit more. It is too generic and rather obvious

      TODO: try bringing this up to Todd on Slack..

    1. Interesting study that expands the similarity metric used to mark core-genes that determine clade membership and phylogeny by their homology. They sub-sample the similarity problem by predicting 3Di structural strings as opposed to full structure prediction

      • To identify core-genes, we traditionally use amino acid similarity (better than nucleotide.. codon usage differences)
      • Going one step ahead, we can use protein structures/folds to generalize this further for deep clades where amino acid homology is quite low.

      Read more to see how they implement this and how robust is this homology inferred an approximate subsampling like scheme onto 3Di structural strings generated from amino acids like alphafold

    1. , I increasingly use the Nim programming language for data processing tasks. Nim is under-appreciated in computational science but it is a very capable Python replacement for non-numerical data processing. At a high level, Nim is as easy to write as Python and as fast as C

      nim = Interesting cool and fast python like programming language

      How does this compare to Julia?

    1. It’s really helpful to be able to dictate my academic papers using my phone when inspiration hits me, wherever that may be.

      Audio transcription is available with a plug in?

    1. removed potential virulence genes and secretion systems (T3SS and T6SS) to ensure safety

      Would keeping the secretion system enable easier protein purification through secretion tags?

    1. BioReason reasons over unseen biological entities and articulates decision-making through interpretable, step-by-step biological traces, offering a transformative approach for AI in biology that enables deeper mechanistic insights

      Text in and text out: - Answers questions like

      What are biological effects of this mutation and what disease it causes - (Summarized the example from fig 1)

    1. Designs primers for clade specific (pan-specific) viral qPCR, single or tiled amplicon sequencing

      • Can include degeneracy..

      • How is single different from qPCR? only amplicon length maybe?

      • Is it really better than Olivar? Why?

      • Can this make the MSA as well? That’s too specialized - there are already CLI tools out there

    1. Extremophile Campaign: In Your Home (ECIYH)

      Really cool citizen science campaign!

      I'm curious who are the scientists behind this. Find and document here/in a page note

    2. really cold places like near your air conditioner drip tray

      Is the drip tray really that cold? Would be nice to get a temperature measurement as well!

    1. identified 90% more genus-level phage-host interactions than traditional assembly-based methods

      how do you know their ground truth / if these are false calls?

    1. While some tech giants neared or imposed widespread layoffs last year, compensation for their CEOs climbed as much as tens of millions of dollars, according to an ABC News analysis of data released by research firm Equilar in May and June.

      How much of this is due to automatic factors such as stock valuation gains?

    1. Metabolome analyses identify 15 mediating metabolites in pregnancy that improve ADHD prediction

      Good to add more support than self reported diet by surveys

  2. May 2025
    1. ISCB will grant remote presentation options for reasons associated to maternity/paternity leave, care for a family member, personal/medical disability, sickness, financial hardship, or potential visa problems.

      potential visa problems: argue for USA re-entry issues

    1. Interesting paper about nucleotide sequence divergence using SCO genes (single-copy ortholog). They are thinking about a threshold for species identification in Eukaryotes like we do in prokaryotes

      Neat part is they bring different taxa of wide ranging kingdoms to compare on the same plots! (don’t know if this is novel…)

      In prokaryotes, homologous recombination, the basis of gene flow, depends directly on the degree of genomic sequence divergence, whereas in sexually reproducing eukaryotes, reproductive incompatibility can stem from changes in very few genes

      Although no single threshold delineates species, eukaryotic populations with >1% genome-wide sequence divergence are likely separate species, whereas prokaryotic populations with 1% divergence are still able to recombine and thus can be considered the same species.

    2. Measuring the sequence divergence (eukANI) between 173 pairs of sister species representing 65 orders of eukaryotes, we find that the degree of sequence similarity between species varies considerably across taxonomic groups and is not consistent for species within a genus

      Does sister species = same genus?

    3. 67 eukaryotic “odb10” datasets from the Benchmarking Universal Single-Copy Orthologs (BUSCO) website (busco.ezlab.org), which specifies the SCOs common to members of selected taxonomic group

      On avg, how many SCOs are common to taxonomic groups. Is that a large enough number (> 10s?..) to estimate variation like this?

    4. In prokaryotes, homologous recombination, the basis of gene flow, depends directly on the degree of genomic sequence divergence, whereas in sexually reproducing eukaryotes, reproductive incompatibility can stem from changes in very few genes.

      Does the data in the fig 1 change drastically if any of the BUSCO genes are involved in reproductive compatibility? Since variation in these won't be representative of the rest of the eukaryotic genome?

    5. even in cases in which organisms themselves are neither in hand nor witnessed

      Intereresting choice of phrases: - in hand = isolated - witnessed = ? / microscopy?

      These must be experimentalists writing this!

    1. See how this tool is different from seqera.

      (Peter van Heusden @ Slack) The problem has been finding the right combination of platform and business model. So you've got Seven Bridges and DNANexus, but they're not playing in our world. Funding from Gates et al have turned Terra into a low cost to use platform and Theiagen has built what seems like a effective business on that. Again, platform and business model seem key. Seqera, those others I just mentioned, the platform is the business. Because of nextflow, Seqera can leverage the vast volunteer effort of the nf-core community but it still is different to the low-cost platform with paid support that Theiagen has developed (and made useable through their investment in workflows, containers, etc). I think that some of those other platforms that were discussed over on #infrastructure give potential for similar developments.

    1. Interesting paper that claims to improve 16S taxonomic classification -- on par with WGS using ML. Read more to figure out -

      • How does this work? What’s the ML magic doing here?

      • Is it really as good as WGS?:

        • Considering that the 16S region itself doesn’t have full information to resolve species..!?

        • And this is also using short read only: 16S-V4,V4

    2. compared the taxonomic profiles at multiple levels derived from both 16S amplicon sequencing and WGS using an in-house produced microbiome dataset

      This is short read data of 16S V3,V4 regions. Not 16S full length // Should have been clarified in the paper!

      V3-V4 hypervariable region of the 16S rRNA gene was amplified using the primers 338 F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT).

    1. Bcell and BOTU, which represent the genome-sequenced proportions of cells and taxa (at 100%, > 98.6%, or > 97% identities in the 16S-V4 region) in a specific prokaryotic biome, respectively

      How are Cells and Taxa defined here?

    2. the cell and taxon proportions of genome-sequenced bacteria or archaea on earth remain unknown.

      They are calculating the fraction of taxa within metagenomic datasets (like earth microbiome project) that have been fully genome sequenced.

      They are doing this by sequence alignment of the 16S-V4 region - For cell: 100% identity to genome - ?/ For taxa:> 97% identity to {some set of genomes?}

    3. we conducted a large-scale sequence alignment between the data released by the EMP and the sequenced bacterial or archaeal genomes in the public database

      How is this different from taxonomic profiling that the earth microbiome project would have already done?

    1. Vendor lock-in is everywhere — Wix, Shopify, no-code platforms, even overly restrictive SaaS tools. If you haven’t written the code, don’t truly own or control the product and data, and can’t deploy or host it wherever and however you choose — then you haven’t actually built anything.

      I would say shopify and Wix are definitely useful for quite a few people who wouldn't otherwise make a website.

      But for those who are able to do it with other means, giving up freedoms with a vendor lock-in might not be worth it will be my interpretation of this statement

    2. LLMs and code assistants are amazing — but they’re just tools. Like a power drill vs. a screwdriver. Faster, maybe smarter, but still dependent on the person holding them.

      profound!

    1. the eukaryotic cytoplasmic density is typically 5% denser than seawater, there is a constant risk of sinking below the euphotic zone and forfeiting their energy-producing capabilities.1515.Bryan, A.K. ∙ Goranov, A. ∙ Amon, A. ...Measurement of mass, density, and volume during the cell cycle of yeastProc. Natl. Acad. Sci. USA. 2010; 107:999-1004CrossrefScopus (216)PubMedGoogle Scholar

      from yeast; does this translate to marine eukaryotes? - Yeast media is also pretty salty like E. coli 's LB and seawater so this might translate?

    1. explore an alternative index design based on k-mer minimizers and integer compression methods

      Summary: Compression is achieved by merging the colour sets of k-mers by "similarity"

      (from Our contribution section)

      In short, our solution merges the color sets of k-mers in a coherent way, e.g., those that share the same minimizer (smallest substring). This allows to save storage space (as the number of indexed sets reduces dramatically).Unlike Bloom- filter based solutions, where approximate color sets are created by merging the color sets of k-mers drawn at random (k-mers that hash to the same bit positions in the filter), we merge them based on their “similarity”.

    1. we obtain the expression for terminal speed of a spherical object moving under creeping flow conditions

      what is d in this equation? characteristic length scale or diameter of object

      • creeping flow = stokes flow ; low reynold's number / high viscousity conditions
    1. we develop a proof of concept framework for training a machine learning (ML) algorithm to model bacterial genome composition

      Bag of genes model

    1. Summary: human mitochondrial DNA is harder to remove than nuclear DNA from metagenomic datasets meant to house microbial sequences. Stool, oral and skin are especially prone to this mtDNA contamination - Removal by mapping paired reads to a reference genome - Reference genomes lacking mtDNA implicated in leaving them in the databases? - Stringency in having both pairs of read map don't work for small & circular mtDNA (16.5 kb) - + having a single end map to the reference increases spurious matches off-target reads reducing microbial reads

      Therefore, extensive validation of the available pipelines is still required.

      In our view, the most reliable approach to systematically minimize human DNA and mtDNA contamination in public metagenomic samples would be for the maintainers of public archives to routinely check for this information prior to making records public.

    2. small, circular nature of the mitochondrial genome allows reads to span the start and end positions, leading to incomplete exclusion of mtDNA
    1. he likens freedom to income. He states, “Someone with very limited income has little freedom to choose.”

      Do you disagree with this statement then?

    1. we quantitatively compared classification methods differing in read length (raw reads, contigs and MAGs), overall search approach (Kaiju, Kraken2, RiboFrame and kMetaShot), as well as source databases to assess the classification performances at both the genus and species levels using an in silico-generated mock community

      The mock community data is that of whole genomes of ~20 organisms

      Reference genomes of 14 bacterial species frequently observed in AGS and activated sludge microbial communities were downloaded from NCBI RefSeq ... + - genomes of Candidatus Moranbacteria and Solirubrobacter bacterium 67 − 14 (reported in AGS and activated sludge studies), retrieved from GenBank, -- as these genera lack official reference genomes. - To incorporate microbial eukaryotes and bacteriophages, the reference genomes of Diploscapter spp., Paramecium spp. and a T4 bacteriophage species were also included. Notably, Paramecium spp. were selected

      Simulated untargeted sequencing of these genomes was performed using InSilicoSeq (ISS) v2.01 [27], emulating sequencing via Illumina NovaSeq

    1. hard-to-lyse bacteria such as Gram-positive strains were detected at lower abundance

      This is confusing. Do you mean had lower sensitivity / higher LOD?

      From Discussion

      This globally aligns with previously reported detection limits of 90 CFU/mL for Gram positive S. aureus and 15 CFU/mL for Gram negative E. coli [16].

    1. benefit of plasmid-borne CRISPR-Cas is severely reduced against TA-encoding competitor plasmids, but only when plasmid-borne CRISPR-Cas is horizontally transferred

      Interesting. Good paper with a well setup experiments. It is intuitive that the long term effect of the toxin-antitoxin (TA) system would outselect any efforts to degrade a plasmid carrying it by any means, including CRISPR-cas.

      It is nice to see that this this toy example system has been validated in a broader ecosystem with bioinformatic analysis.

      Finally, we further tested our theory and generalized our experimental results by bioinformatically analysing plasmids carrying CRISPR-Cas systems and their target plasmids and found that these targeted plasmids did not typically encode TA systems.

      CRISPR-Cas systems are common on bacterial chromosomes (∼42% of chromosomes carry a CRISPR-Cas system), but are also found on ∼3% of plasmids. (Pinilla-Redondo et al., 2022). Plasmid-borne CRISPR-Cas systems can be nucleolytic or silence gene expression, and have been implicated in plasmid warfare (reviewed in (Koonin and Makarova, 2024)): plasmids’ CRISPR spacers tend to match other, competing plasmids – particularly those of similar size which occupy the same niche (Pinilla-Redondo et al., 2022; Benz et al., 2024).

    1. Summary

      • Uses marker gene list to differentiate between strains ; could it work will a full core genome alignment?

      ChronoStrain: a sequence quality- and time-aware Bayesian model for profiling strains in longitudinal samples

      define a ‘strain’ as a cluster of marker sequences (subsequences from reference genomes) where the threshold used to define these clusters is an arbitrary user-specified variable.

    1. unlike regions such as the US or the UK, a very small number of VPNs are actually fit for use within the UAE, which is why choosing a VPN for this particular part of the world can be tricky

      why?

    1. A more advanced and easier to use workflow manager will be developed that overtakes nextflow in popularity and community support

      Does snakemake fit?

      Redun satisfies many of these criteria Desirable criteria - python, cloud support, GUI for monitoring

    1. The new session is attached to the current terminal unless -d is given.

      Issue with running this

      Tmux sessions persist only as long as at least one window or pane remains open (usually with a running shell or a long-lived process). If the command finishes instantly, the session will terminate right away and won't appear in the session list (source: perplexity)

    1. Summary - ANI is good for closely related microbial species - For distant ones, Amino acid is better (AAI)

      Implementation: - Identify markers among the 122 single copy proteins with HMMs - Break protein sequence into k-mers, k = 4 amino acids - Find jacard distance between 2 organisms as an estimator of AAI! - Process done very fast and comparable accuracy to rRNA phylogeny!

      Briefly, FastAAI performs, (i) identification of marker proteins in each genome using a set of 122 universal SCP represented by hidden Markov models (HMMs) (Supplementary Table S6, and below), (ii) extraction of tetramers for each protein per genome, (iii) estimation of Jaccard indices based on the tetramers extracted from proteins shared by a genome pair, (iv) estimation of the average Jaccard index (⁠ ⁠) followed by its translation to estimated AAI values

  3. Apr 2025
    1. Proksee (https://proksee.ca) provides users with a powerful, easy-to-use, and feature-rich system for assembling, annotating, analysing, and visualizing bacterial genomes

      How does this compare to IGV?

    1. Bakta is reported to find sligthly more of everything compare to prokka

      Bakta: improved accuracy to Prokka, in finding short ORFs - assigns cross-refs to RefSeq, UniProt - higher memory footprint, database size

    1. Snippy

      Variant calling tool default settings are robust ; good for bacteria.

      Underneath the hood, it simply is a pipeline that utilizes a short-read alignment using bwa mem followed by variant calling using FreeBayes. It works incredibly well for multiple tasks

    1. By writing a paper, you’re going to have to take all these bits of evidence into account, weigh them and figure out how to  articulate them correctly. That’s a  process of character building

      Why chatGPT can't replace writing

    1. Cornetto enables us to generate highly complete diploid human genome assemblies using only a single LRS platform

      no need to polish assembly with higher accuracy illumina or PacBio?

    1. Micromonas has a flagellum and is motile, with an estimated swimming speed of 100mm/s (i.e., 75 body lengths/s) and is strongly phototactic

      Micromonas pusilla

    2. Because of their low Re picoplanktondo not sink through the water column as individual cells; they can sink only if pack-aged into larger material (e.g., through predation, fecal pellet, and marine snow for-mation)

      Check for similar affirmations from other sources

      due to their tiny size, all picoplankton, whether eukaryotic or prokaryotic, have low Reynolds numbers (Re), indicating that their movement is dominated by viscous forces, rather than inertial force

    Tags

    Annotators

    1. When nutrients run out they will often aggregate into flocs that sink quickly out of the photic zone

      for small celled diatom species ~ 5 - 50 um size range. - What is the physical effect that causes the flocs to sink? - Higher density vs larger size?

      This might work the same for microalgae as well?

    1. formal equation for the action of coding mutations on fitness

      Action of coding mutation on fitness = evolutionary importance of site \(*\) amino acid similarity

    1. each unique k-mer is stored only once

      Do you also store the counts of each k-mer then?

      k-mer counting is quite resource-intensive, as storing large numbers of k-mers along with their counts is expensive in terms of both memory and time.

    1. Comparing a set of given sequences is a common task

      Find homology, construct phylogenetic tree, overlap detection + graphs (for genome assembly) etc.

      Comparing a set of given sequences is a common task involved in many bioinformatics applications, such as homology detection [1], overlap detection and the construction of overlap graphs [2,3,4], phylogenetic tree reconstruction, and isoform detection from circular consensus sequence (CCS) reads [5], to name a few.

    1. I just love the look of amazement when anyone looks into the Foldscope for the first time, particularly little kids," Pandiarajan says. "When their eyes light up, I know that's the moment they will embrace science and learning for the rest of their lives."
    1. We show that sylph’s ANI estimation is accurate and apply it to species-level profiling through a principled 95% ANI cutoff

      Read this paper to figure out why 95% cutoff is called "Principled"

    2. This tool is good for taxonomic assignment of low abundance organisms from metagenome sequencing data. - low abundance makes it harder to assemble genomes, which is the standard way to assign taxonomy confidently?

      Key innovation

      key innovation in sylph is a statistical model based on zero-inflated Poisson statistics to debias containment ANI under low coverage

      How does this differ from kraken2? - Kraken 2 uses short exact matches to a database (causes false positives) which are controlled by abundance cutoffs and confidence thresholds

      Differ from sourmash? - k-mer sketching approaches have ANI estimation bias for low-abundance genomes due to incomplete read coverage - Will need arbitrary thresholds to work for low abundance micro-organisms

    3. ‘marker gene methods’ and not to be confused with 16S sequencing

      I guess universal marker gene methods use shortgun/metagenomic sequencing data so is not comparable to amplicon sequencing of 16S?

    4. However, such methods usually use databases that are difficult to build and hard for users to customize.

      such methods =

      Species-specific or universal marker gene methods (hereafter denoted as ‘marker gene methods’

    1. maximum growth rates were collected

      Is the antibiotic treatment hitting the cells at the maximum growth rate stage? Or can we assume the proportion of current growth rate to maximum observed is the same across all clones?

  4. Mar 2025
    1. Each overlapping primer pair is checked to see if it can be added to any pool other than the leading primer pair’s pool.

      It gives higher primacy to primers of earlier amplicons?

    1. for k-mer-based tools like Kraken 2, there is no single value of k that consistently yields optimal results across all scenarios

      This isn't an issue if k-mer size can be tweaked automatically? Don't know if there is any tool doing this?

    1. You have well-curated data, relevant to your task, already labeled with preferred outputs. You need this data for effective fine-tuning.

      Use fine tuning when

    1. the deep learning method D-SCRIPT (a deep learning PPI prediction method shown to have state-of-the-art performance [86] in non-model organisms) to infer the initial, noisy PPI network.

      What is the input to this network?

      requires only the amino acid sequences of two proteins and predicts a probability of interaction

    1. A clear statement of the nature of the intrusive judicial inquiry a parent company could be subjected to in such cases was provided by Lord Bingham when the litigation reached the House of Lords as follows:

      Intrusive Judicial Inquiry into Parent Company Liability Lord Bingham’s statement in the House of Lords highlights the level of scrutiny that a parent company may face in transnational tort claims. Courts assess whether the parent company played an active role in controlling the subsidiary’s operations, particularly in matters of health, safety, and environmental standards. This includes an inquiry into:

      Corporate Oversight – The extent to which the parent company exercised control over subsidiaries. Knowledge and Responsibility – What the parent company’s directors and employees knew or ought to have known about the subsidiary’s activities. Decision-Making and Action – Whether the parent company took positive steps to ensure compliance or failed to act, leading to harm. Documentary Evidence – Courts examine internal company records, including: Board meeting minutes Reports from directors and employees Correspondence related to oversight of the subsidiary Jurisdiction and Access to Justice The House of Lords upheld jurisdiction in the UK by applying the Connelly principle, which states that English courts should hear cases if there is a real risk that justice would not be accessible in the foreign jurisdiction. This was based on:

      The complexity of the litigation, making it difficult to fund and pursue in South Africa. The need for extensive corporate records, which were primarily located in the UK parent company’s offices. Precedents in Parent Company Liability By 2001, English courts had ruled on three key cases affirming parent company liability, establishing that:

      The legal principle was not controversial. UK courts should retain jurisdiction under forum non conveniens grounds when justice could not be obtained abroad. Impact on Transnational Litigation This judicial approach set an important precedent, paving the way for future cases like Chandler v Cape (2012) and Okpabi v Shell (2021), reinforcing the principle that parent companies may owe a duty of care to individuals harmed by the actions of their foreign subsidiaries.

  5. academic.oup.com academic.oup.com
    1. When I began my work, jazz was a stunt,” was Duke Ellington’s later critique of some of this music11Close—but the slick professionalism of the Harlem stride style also served to expand the audience for African American music in the face of discrimination from cultural elites, both within and without the black community, and despite a severe economic downturn.

      for final

    1. within the internal perspective. They are first-order claims about what is right or wrong in specific counterfactual conditions, and can thus be glossed in expressivist terms. This is underpinned by the fact that our moral attitudes respond to natural features of the world. We judge that kicking dogs is wrong because of the pain they suffer when kicked, not because we happen to disapprove of such behaviour. Quasi-realists can therefore hold that kicking dogs remains wrong in worlds at which our counterparts approve of it, for o

      .kjgjjhk

    1. Moreover, just like cognitive disinhibition, schizotypy is correlated with creativity, verbal and visual, with one caveat: Desiring isolation, being introvertive, lacking a capacity for pleasure—these do not predict creativity. They don’t make you more creative, according to the studies.

      ??

    2. with no regard for the truth of the assertion. To others and to himself, he willfully defied reality. He’d reverse himself, too. If particular lines of argument failed to persuade, he’d advocate others. He’d throw people off by adopting their position as his own. He’d say an idea was crazy, then a week later call it great.

      this sounds horrible

    1. Despite the short history of bioinformatics, several software efforts have evolved into a pipeline model

      history of toolchaining for bioinformatics

    1. the advantages of computational pipelines over ad hoc scripts, even for simple tasks, are all more apparent with increasingly complex datasets and the use of parallel processing.

      why pipelines vs ad hoc scripts - track dependencies (statically inferred, DAGs) - rules reused for many files (parallelization) - data tracking (rapid development in subsets of pipeline ~ changing parameters,ie. avoid duplicate work when resuming workflows.)

    1. capable of identifying the common markers for each cell type and furnishing encyclopedic explanations rooted in domain expertise

      Where is this domain expertise coded? RAG?

    2. BIA builds the Anndata from the sequence read data following standard practice, i.e., aligning public FASTQ files with Cell Ranger software

      Would be useful to store the Anndata into some cache for papers that are reused? assuming this generation is an intensive process

    1. healthy individuals contained higher abundances of sugars, myo-inositol, and ellagic acid

      Sugars here is a proxy for vegetable fibres?

    1. says that US tech companies are losing "billions" through having to comply with regulations such as the Digital Markets Act (DMA), and having to obtain user consent for their data to be used for advertising purposes

      These things are more important than billions in the long term

    2. US companies face "substantial financial burdens" due to the European Union's digital regulations

      Can the EU provide something short term to compensate the cost of digital regulations for companies that are smaller/struggling?

    1. The performance of the enhanced bioluminescent reporterphagosensor was carefully evaluated under conditions with target bacteria at differentphases

      Did you mean different "concentrations", because I couldn't find any figure that shows different growth phases of bacteria.

      It might be useful to discuss that coli forms that contaminate drinking water or other low nutrient samples might typically be in the stationary phase. You can cite this paper for evidence of phage T4 infecting stationary phase bacteria -

      Bryan, D., El-Shibiny, A., Hobbs, Z., Porter, J., & Kutter, E. M. (2016). Bacteriophage T4 infection of stationary phase E. coli: life after log from a phage perspective. Frontiers in microbiology, 7, 1391.

    2. (D) Dose-response curves

      fig 6D: did you test without any bacteria or not? Could indicate with a non-detected (ND) label in the chart and clarify in the legend

    3. (B-C) Specificity of reporter phage-based methodsfor the detection of viable E.coli;

      fig 6B: x-axis should list organism names instead of the ATCC numbering for understandability. Organism name could be shortened as P. putida etc. the ATCC numbers can be clarified in the figure legend or methods section as a table/list. Clarify what Mix means in legend

      fig 6C: mention in legend what the non-viable E. coli is such as heat killed E. coli etc.

    4. detection of viable E. coliin juice (1-6), water (7-12), milk (13-18), lettuce (19-24), beef (25-30) samples.

      fig 6H: mention the type of sample in the x-axis label. Clarify the colour map title, is it CFU/ml?

    5. 4 Conclusions

      Extensions to this work should be added to the discussions 1. Detecting different concentrations of E. coli among a mixture of other bacteria would be interesting to know about the specificity. 2. Detecting contamination in real samples or when spiked with unknown contaminating source such as sewage wastewater would be a useful extension to this work.

    6. samples including water, juice and milk was inoculated with E. coli at variousconcentrations.

      Does the detection depend on the growth phase of E. coli and how does this correspond to the real world scenario?

    7. Therefore,T4 phages with short latency times and high burst sizes are promising reporter phagecandidates.

      For perspective, you could mention an estimate of the quickest possible detection with this method using short latency, high burst size T4 phages with citations

    8. Optimization of (A) capture time, (B)phage concentration, and (C) detection time of reporter phages.

      Fig 5A: figure legend is too short. Add a short one line description of capture efficiency / how it was measured. This is useful to make the figure self explanatory without referring to methods

    9. (B)T4Δsoc::nluc and (C) T4 wild type;

      fig 3B,C: Use bars of a single colour to improve readability and minimize distraction with multiple colours

      fig 3B-E: Describe what the a, b, c, d above the bars are in the figure legend

    10. To quantify E. coli incomplex food matrices, the samples were incubated with phage-magnetic nanocarriers

      need to mention what samples were used

    11. H) Lysis properties of reporter T4 phage.

      ? / fig 3H: Needs a negative control of phage without E. coli cells to confirm that the luminiscence happens only upon infection

    12. A system forassessing EOP value to present the success of infection by the phage:

      fig 2E: explain the 1-72 numbers in the y-axis briefly in the legend

    13. Selection and cleavage efficiency of T4 phage crRNA targeting;

      Fig 2B: Avoid the use of bars on a log plot. Show raw data points with dots and use a line to show the mean. - re-order the x axis in descending order and shorten the x-axis labels to just the numbers to minimize redundancy

    14. Construction of the T4phage CRISPR system in E. coli;

      Fig 1 image could be improved for better understanding 1. Avoid yellow which is hard to see 2. show much fewer particles and phages for more clarity (2-3 only) 3. could merge C, D and E and Zoom into B

    15. nluc gene with twohomologous sequences (S1 and S2)

      need to mention everywhere (except abstract) that editing was carried out by homologous recombination with CRISPR based counter-selection.

    16. Average values are shown foreach experiment. The error bars represent the standard deviations of the data.

      Please show individual data points as well

    Annotators

    1. women are more likely to seek preventive care, visit doctors and follow health recommendations

      This might not be applicable for frugal South Asian women who are likely to spend less on non-essential purchases and delay their health check-ups and anything preventative until things get serious. - Will look for a good citation for this..

    1. Why not instead give each institution a lump sum of money for research and attach reproducibility and replication and scientific integrity requirements to the funds.

      Is this somewhat the German model of funding?

    Annotators

    1. Practicing is a double-edged sword. Of course, you want to rehearse your talk, but if you rehearse it too much and have a ‘script’ memorized, it can sound robotic. It can also backfire because if you screw up one little bit of the script, it can cause a sort of domino effect and you can end up totally lost.

      I am concerned about this and hence default towards impromptu presentation delivery all the time.

      This works great if there's no hard time constraint, such as in casual settings such as lab meetings, but for talks, there needs to be some hybrid strategy?

  6. Feb 2025
    1. the joint committee’s report to the National Green Tribunal (NGT) pointed out that the RO purifiers also waste almost double the water that they actually purify as ‘reject water’.

      This seems likely to be inaccurate

    2. RO is a simple, yet effective method for filtering out harmful contaminants like TDS (total dissolved solids), host of toxins, arsenic, fluoride, silica, etc. from water

      TDS is not a harmful substance. This is misleading

    3. reverse osmosis filter (RO filter) channels water through a semi-permeable membrane to remove dissolved solids. These dissolved solids include harmful contaminants like lead, mercury, chromium-6, chlorine, etc

      need to do a pre-test to see if the water actually contains any of these in concerning levels before hasting into an RO setup

    1. Consider using the Mann Whitney U test when your data follow a nonnormal distribution, and you have a small sample size. Learn more about the Normal Distribution.

      small sample size ~ < 30 (source?) - (logic) If the sample size is large, central limit theorem will rescue non-normal data to apply t-test

      If you have more than 15 observations in each group, you might want to use the t-test even when you have nonnormal data. The central limit theorem causes the sampling distributions to converge on normality, making the t-test an appropriate choice.

    1. quick thoughts glancing the paper - Why are you flipping the gene instead of the promoter? :

      Better efficiency with a larger flipping region.. - Why did you choose integrase12?

  7. Jan 2025
    1. Take aways: AI will become cheaper and more efficient. - closed source models can cache responses and save computations for repetitive queries - closed source also has possibility of iterative improvements using constant reinforcement learning. - Prioritizing capabilities and deliberate strategy in data selection, carefully designed training objectives.

  8. knowledgecafe.rice.edu knowledgecafe.rice.edu
    1. The court clerk of AI is a process called retrieval-augmented generation, or RAG for short.

      great example! RAG's => special expertise that is domain specific that is retrieved from a well curated library of text.

    1. Test drive with sellers. Buy cars online. Clean title. No hassle. Free AutoCheck report, fraud protection, financing, vehicle service contracts and GAP insurance available.

      Autotrader private seller exchange

    1. identical alignments when searching different databases may not receive the same e-value

      difference in the number of sequences across databases

    1. If the battery ever did need to be replaced, it would run between $2,200 and $2,600 from a Toyota dealer, but it's doubtful that anyone would purchase a new battery for such an old car. Most will probably choose to buy a low-mileage unit from a salvage yard, just as they would with an engine or transmission. We found many units available for around $500.

      battery tips,

    1. addition of IPTG should induce high expression of Cas1 and Cas2 in nongrowing bacteria since they have kept a high copy number of pSCRATCH, while growing bacteria should not express the Cas proteins in sufficient quantities for spacer acquisition

      Any issues with expressing new proteins when non-growing?

    1. Your analysis is complex - QIIME 2 records the steps you took to be sure that your work will be reproducible by you or others
      • Does this provenance record the parameters used for reach step?
      • Is there also a way of sharing the whole recipe with others that enables something like a one-click reproducibility?

      Because dadasnake has these features which will make it a better tool for particular NGS sequence analysis

    Annotators

    URL

    Tags

    Annotators

    1. This paper is too specific to transcriptomic analysis but it has some inspiration. - This seems more of a substitute for R and python workflows as opposed to a complete tool-chain philosophy that could put together mature command line tools like Nextflow. So this is more relevant for final polishing etc. - They don't mention what backend they are using as the LLM. Is it just making API calls to chatGPT or something they coded themselves? this would be most relevant to know for Omi

    2. result documentation: the copilot now supports the generation of PDFs that include images and detailed analysis

      useful. Need to have customizable sections and added explanations of terms and meanings of measures if user requires.

      How does a html work with clickable/hover hyperlinks for defining key complex terms for first time users?

    1. we demonstrate intragenerational genetic biocontrol, wherein mating with engineered males reduces female lifespan

      how does this persist evolutionarily - would this have higher selective pressure to mutate away?

    1. There are several reporting requirements that apply to you while you are on your STEM extension to ensure that you are maintaining your F-1 status.

      STEM OPT recipients must make a "validation report" to their school every six months starting from the date the 24-month extension begins - Regardless of change in employment

    1. questions about a specific vehicle’s coverageor organization where the vehicle is being reserved, callthe Benefit Administrator at 1-800-825-4062

      Check if Zipcar works as a valid rental car

    2. Trip Cancellation and Interruption benefits pay up to twothousand dollars ($2,000.00) per Insured Person for the non-refundable Common Carrier ticket(s) that You paid for withYour covered Account and/or rewards programs associatedwith Your covered Account.

      only applicable in narrow cases - death, injury, illness or insolvency

    1. Damage which is due and confined to freezing, mechanical or electrical breakdownor failure unless such Damage results from a Theft Covered Event

      not covered

    1. Roadside Dispatch is a pay-per-use roadside assistance program. The programprovides you with security and convenience wherever your travels take you.For roadside assistance, call 1-800-847-2869.

      is this applicable for visa infinite as well?

  9. Dec 2024
    1. A 2007 study published in PLOS ONE confirmed this unique energy mechanism, showing that fungi exposed to high radiation levels grow faster than those in non-radioactive conditions.

      Find this paper and speculate on the mechanism of energy conversion

    1. Melanin may also be able to help the fungus metabolize radiation, but more evidence and research is still needed.[1]

      Would be interesting to see hypotheses as to the mechanism in which energy could be harvested by melanin and any experiments that could test it?

    1. It is known that all plasmids transmissible by conjugation contain a known relaxase [42].

      This is debatable. OriT is enough if Mob relaxase is supplied in trans.

      Kiara wants a fact-check on this

    1. RP4 plasmid (also known as RK2, RP1, and the Birmingham plasmid) stands not only as a model of bacterial conjugation studied over the past 40 years, but also as one of the most conspicuous, broad-host range conjugative plasmids described in the literature. It mediates mating and plasmid transfer between a wide variety of Gram– donors/recipients (8) and is also capable of efficiently conjugating with Gram+, (9) yeast (10,11) and mammalian cells. (12)
    1. Optimization parameters included: (i) molten agar media temperature, (ii) molten agar media agar concentration, and (iii) volumes of E. coli and S. cerevisiae cell suspensions harvested at various optical densities (ODs)

      Best protocol : 60C, 2% agar ; 100 ul each of donor and recipient at OD of 1. - Use 20 - 60% of the mix for fewer and larger colonies

    2. Some conjugation systems, such as IncF, IncH, and IncI plasmids, transfer DNA efficiently in liquid media, while others, including the IncN, IncM, IncP, and IncW plasmids, achieve higher DNA transfer frequencies on solid media [28]. It is suspected that the ability to transfer DNA in different environmental conditions is related to variation in pilus formation, structure, and stability of cells during the conjugation process.
    3. such a protocol may permit more accurate enumeration of transconjugants by avoiding the use of a spreader while plating cells on selective media

      How will this conjugation protocol allow enumeration of only transconjugants by excluding the donors in the mix?

    4. may enhance the ability to transfer plasmids and chromosomes greater than 100 kbp

      This is testable easily ; with a fluorescence carrying plasmid and flow cytometry counting