The choice to protect our environment rests with each of us
Not everyone has choice, affordability, trust in water supply..
The choice to protect our environment rests with each of us
Not everyone has choice, affordability, trust in water supply..
a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.
Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?
However, they were so fond of its diverse uses that they minimized the hazards it posed
by 'minimized' you mean downplayed
can be a file path to the package or a package object.
This installs the branch that is currently checked out -- since that is what is in the directory that devtools::install() looks at.
putative ∼97 kbp crAssphage genome (accession code: JQ995537)
This record was removed because the sequence was not directly determined by the submitter. GenBank: JQ995537.1
Instead check this : MAG Genbank : BK010471
Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).
The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way
GenExpDB is the world’s largest repository for E. coli gene expression data. This site is a widely used public resource for gene expression analysis.
Low ROX ABI: 7500, 7500 Fast, ViiA 7™, QuantStudio™
Quantstudio 3 requires low ROX
while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources
ROX increases precision of technical replicates (which we don't do much of in our lab)
ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges
ROX helps normalize these variations
ROX is normalising for the attributes of the qPCR mixture, such as volume differences, presence of bubble etc.
passive reference ROX helps with these
differences in reaction volumes due to pipetting errors can bias the results. Also, issues associated with the qPCR instrument, such as the optics, can also influence the fluorescent signal generated.
passive reference ROX helps with these
Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).
This is an interesting argument as to what individual users can do to keep Firefox alive. But the biggest dent on anti-competitive behavior should come from well enforced proper anti-trust regulations the way Europe is doing it. How can browser users contribute to this?
If I am applying for a J visa, my current DS-2019 is issued by the same institution as the institution listed on my previous visa.
Same for F visa, mentioned in this page - https://www.ustraveldocs.com/cn/cn-niv-visarenew.asp
Is this requirement specific to Chinese applicants?
The MRV fee is valid and may be used to schedule an interview appointment in the country where it was purchased within one year of the date of payment
For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.
no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.
Sounds like most probe qPCR reactions right? I assume this is in the raw data before baseline subtraction
Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)
Why sample id? Isn't target and sample type not enough?
a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (
KanR here is a aminoglycoside nucleotidyltransferase (aadD1), uniprot = P05057 from Staph aureus. This is different from the usual phosphotransferase aphA1/3 used in e.coli
When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases
Does this mean that probe-based data without plateau phase cannot be analyzed effectively?
For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample
For clinical samples where each sample is expected to have a different inhibitor load hence different efficiency
One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package
The $AsXML exported .rdml file is not valid in RDML-ninja.
Error message :
No rdml_data.xml in compressed RDML file found.
How to fix this?
tryptophan
tryptophan would add autofluorescence.. - Shyam
The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.
using qpcR package for analysis
Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.
Using qpcR package for qPCR data analysis..
Data were normalized using the 2–ΔΔCT method
Why didn't you use the efficiencies determined by the qpcR package?
Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1
I wonder why this fit information was not used for quantification as well?
The ability of a community to receive genes located on mobilizable non-self-transmissible plasmids, on the other hand, would rely on the community’s own content of conjugal plasmids
Are we assuming here that the secondary conjugation events within the community are more significant than the primary donor with the conjugation helper plasmid?
the sigmoidal response curve is symmetric on the logarithm of x
will not fit when 0 is included in the data, right?
Try with an actual exponential. You’ll probably want a self-starting function to avoid the “singular gradient” error — read more in my post on the subject.
To ensure unambiguous selection of data points within the window-of-linearity, an iterative algorithm is formulated to search for lines consisting of at least 4 and no more than six data points with the highest R2 value and a slope close to the maximum slope
Isn't this too small a subset of data? Or is the exponential phase usually <= 6 points?
To cancel out the random variation in individual PCR efficiencies, web-based LinRegPCR, determines for each reaction the centre of the exponential phase from the baseline-corrected fluorescence values and, using the mean PCR efficiency of the assay, constructs an ideal amplification curve which is then used to call the Cq value for the reaction
Wouldn't this lead to too much dependency on just one data point of the assay - the midpoint of the log-phase?
RT-qPCR targeting SARS-CoV-2 is sensitive to inhibitors that are present in wastewater, leading to false-negative results
How sensitive is LAMP to contaminants considering the a lot more intricate primer binding reactions are involved. Could there be mispriming and false positives due to contaminants?
the rapid approach uses a transposase enzyme to simultaneously cleave DNA and attach barcode/adapter sequences
How efficient is the transposase with supercoiled plasmid DNA compared to long linear genomic DNA fragments it was originally designed for?
. This is the first reported case of conjugative transfer of a naturally occurring plasmid between gram-negative and gram-positive bacteria.
The basic idea is that abundant sequences are more likely to generate erroneous sequences than rare sequences
hmm?
an accumulation of single base pair errors will clearly lead to removal of more reads prior to downstream analyses when using an ESV-based approach versus an OTU-based approach.
I would say the removal of reads caused by errors is better than somehow squeezing them into OTU clusters and risking spurious OTUs (singletons or otherwise). Thoughts?
If your data is high quality, you want improved taxonomic resolution, and you are not concerned about the intra-genomic heterogeneity in the targeted marker genes, an ESV-based approach could be advantageous. Otherwise, a more standard OTU-based approach might be your best bet.
runcate reads after truncLen bases.Reads shorter than this are discarded.
Is this from 5' end or 3' end?
How to prevent shorter reads from being discarded?
You can also overwrite records in a while loop to avoid excessive memory allocation.
Does for record in reader not overwrite record the same as the while loop?
, independent inference by sample is trivially parallelizable and enables total computation time to scale linearly and memory requirements to remain flat with increasing sample number, allowing ASVs to be inferred from arbitrarily large data sets.
It is observed that parallel processing of individual samples (unpooled) underestimates rare taxa (discarding them among sequencing noise) Reference: Fierer lab
Side scatter measurement provides information about the internal complexity (i.e. granularity) of a cell. The interface between the laser and intracellular structures causes the light to refract or reflect. Cellular components that increase side scatter include granules and the nucleus (1).
FSC intensity is proportional to the diameter of the cell, and is primarily due to light diffraction around the cell.
Chimeric reads occur when one sequencing read aligns to two distinct portions of the genome with little or no overlap. Chimeric reads are indicative of structural variation. Chimeric reads are also called split reads.
The mergePairs(..., justConcatenate=TRUE) option allows the paired reads to be joined without any overlap, but with 10Ns inserted in between the forward and reverse reads. The chimera removal and assignTaxonomy functions will handle such merged reads
In case of non-overlapping paired ends
Representing alignments
Good intro on the data structure of alignments
For a fully functional device you additionally require four magnets with a diameter of 3 mm and a height of 2 mm.
magnets here -https://www.apexmagnets.com/magnets/3mm-x-2mm-disc-neodymium-magnet
Where are the magnets going in?
geom_point( ## draw horizontal lines instead of points shape = 95, size = 10, alpha = .2
I didn't know there were > 95 shape values. The documentation only showed 24! https://ggplot2.tidyverse.org/reference/scale_shape.html
we designed the medium to contain a minimal amount of undefined ingredients that are typically used to cover unknown nutrient requirements
yeast extract
A self-transmissible RK2 helper plasmid facilitated the spread of mobilizable CRISPR/Cas
Why have two plasmids instead of having just one self transmissible one?
direct labelling”, in which the plot region itself contains the labels for groups of points instead of using a legend. This usually makes the plot easier to read because it puts the labels closer to the data.
SNAP-Capture Magnetic Beads are used to selectively immobilize and magnetically separate a SNAP-tag fusion protein from solution using magnetic agarose beads
transmembrane β-strands are highly conserved and that the surface-exposed regions display the highest variability, not only in sequence but also in length.
Promise for Broad host membrane surface display?
we establish Saturated Programmable Insertion Engineering (SPINE), an unbiased, comprehensive, and targeted domain insertion library generation technique using oligo library synthesis and multi-step Golden Gate cloning
So, here is how I manage it, if the line height cannot be reduced sufficiently by the numeric entry/spinbox: Try clicking the question-mark (un-set variable inline height).If that does not resolve the issue, activate the Tt button ("outer" text style) and set the font height to something small and linespacing to something small and click the questionmark.Then de-activate Tt (outer) and edit the text normally.i.e. The outer style overrides the inner style.
high-throughput 16S rRNA analysis were used to track changes in the bacterial community with Rpf addition, which could reveal the key functional populations contributing to the enhanced phenol degradation under high salinity conditions
Why would the 16s DNA content change with the resuscitation?
Do viable, non culturable organisms have lower 16s gene abundance or are harder to lyse and extract from?
A modeling study based on kinetic annealing confirmed this notion (23).
Read
Kraken (https://ccb.jhu.edu/software/kraken2/) is one of the most frequently used tools to classify microbial community taxonomic information
Really? I thought it is relatively new to the taxonomic field
openCyto package is designed to facilitate the application of automated gating methods in a sequential way to mimic the construction of a manual gating scheme.
Flow Cytometry Analysis with R: the flowCore package
slides.pdf are informative
Various algorithms are available for this process2
We sought to reduce the time needed for allele enrichment by putting a selective pressure against the WT allele at the nucleotide level using CRISPR-Cas9 nuclease.
Using this will make HiSCRIBE the same as SCRIBE?
Exercising caution when interpreting oligotyping results is warranted, because the 16S rRNA gene, even at full length, can miss important genetic variation underlying ecological and evolutionary differentiation between species
On the other hand, an individual bacterial cell can house multiple copies of 16s gene that differ slightly to each other.
print_median(@benchmark linear_access(data, 4096))
The linear access is taking 435 times longer than random access?
This is in contradiction from the explanation above. Is this a mistake in the order the results are presented?
Next generation sequencing data analysis
scale_x_discrete(guide = guide_axis(n.dodge = 2))
With guide_axis(), we can add dodge to our axis label texts to avoid overlapping texts. In the code below, we have used guide_axis() function with n.dodge=2 inside scale_x_discrete() to dodge overlapping text on x-axis.
Considering that DNA molecules consist of double strands of phosphate-deoxyribose backbone and bases that contain a large number of phosphate groups, we next tested if the DNA in the used columns could be effectively removed using a phosphoric acid solution
phosphate will compete with DNA for binding the column?
High pH favors the breakage of the hydrogen bonds
probably by de-protonating the OH groups involved in the hydrogen bonding?
The ability of RSF1010 to transfer at high frequencies is remarkable considering its dependency on the availability of compatible conjugation machinery in trans. These data indicate a high prevalence of naturally occurring conjugative elements in sand filter communities
Or more likely is the possibility that the first transfer is much more abundant than subsequent secondary transfers in the 24 hour duration of this experiment
extracted
enriched?
In contrast to previous work (Li et al., 2018), pKJK5 showed relatively lower transfer frequencies than RP4 (~1 order of magnitude difference) across all water work microbial communities
Are you able to explain the possible reasons for this difference?
The best estimate of the PCR efficiency of an assay is obtained by calculating the arithmetic mean of the Eamc determined from all reactions of a specific target
Assumption is that errors in efficiency across replicates is additive..?
ΔCq indicates the difference between the mean Cq in control and treatment groups for the target as well as the reference
By writing \(E_{tar}\) in the equation, the assumption is the the efficiency is the same for the control and the treatment groups. This would hold unless there is large differences in efficiency between those -- assuming they differ by batch of processing/extraction etc.
This assumption wouldn't hold if each reaction has a slightly different efficiency
a ‘single’ curve model ignores sources of run-to-run variability
ignores variability that is intrinsic to the standard curve and not universal to both standards and unknown samples -- this variability is taken care of in the single curve per run model
Previous studies report from repeated instrument runs of the same calibration curve that there are often minor variations in the slope (<3%), but significant differences between intercept values
does "same calibration curve" implies the same serial dilutions or freshly made dilutions for each run?
this mechanism may broadly contribute to the importance of IncQ plasmids as agents of bacterial gene transfer in nature
what special features of IncQ make this mechanism viable? - the replication mechanism?
that uses highly accessible and inexpensive materials.
How easily are these materials available?
gold nanoparticles (AuNPs)
are gold nanoparticles highly accessible in developing countries?
pBGC was introduced into the wild-type isolate collection by electroporation, and all pOXA-48-carrying and pOXA-48-free clones were competed against their pBGC-carrying parental strain
Is the burden of carrying pBGC included somehow in the analysis?
Were pBGC carrying isolates competed with the parent isolates without any plasmid to do this?
The presence of the entire pOXA-48_K8 plasmid was confirmed by sequencing the complete genomes of the 50 transconjugant clones, which also revealed the genetic relatedness of the isolates
was this done after the growth to determine fitness effects? could the plasmid be lost midway through that experiment?
replicate plasmid fitness effects in natural bacterial hosts, which remain largely unexplored
fitness effects would also be greatly dependent on the environment and measuring fitness as max growth rate, max OD in well shaken single species liquid cultures also might not replicate plasmid fitness effects in the natural gut ecosystem.
Given this, what is the specific advantage in using natural isolates?
select clones which were naive to pOXA-48_K8, but ecologically compatible with it
How can residence in a patient from a certain ward be termed as "ecological compatibility"
Thorough and well written article
Diagnosing and treating fungal diseases needs special training
What does this entail? Special protocols for storing, lysing fungi?
To facilitate indel identification, we developed an online tool called Poly Peak Parser (available at http://yost.genetics.utah.edu/software.php) that is able to separate chromatogram data containing ambiguous base calls into wild-type and mutant allele sequences
TURBO™ DNase is a genetically engineered form of bovineDNase I with greater catalytic efficiency than conventionalDNase I at higher salt concentrations and lower DNAconcentrations.
salt here => monovalent salts (Na+ etc.)
Encapsulation also helped cells survive acidic environments (pH 4)
How? isnt the media in equilibrium with the core?
Escherichia coli was not reliably distinguished from Shigella and other Escherichia species sharing the high 16S rRNA gene sequence similarity to each other
Is this due to sequencing error rate of nanopore or the 16s are really that identical?
Goals of this paper
Questions
Evidence for functional relevance of PTU
ANIL20 refers to the total length of the shortest plasmid in the comparison.
What does this mean if the shortest plasmid is really short - < 5 kb like the engineered plasmids and the larger plasmid is a real 50 kb plasmid? What does similarity of such a small region to such a large plasmid mean?
This causes that otherwise unrelated plasmids show certain fragments of their genomes with high ANI values
If they share the same MGE sequences, what else do you mean by otherwise unrelated? What does two plasmids being related mean to you guys?
this trend dissipated when we looked within the Enterobacteriaceae family (Fig. 1e, f), indicating that the plasmid-encoded genome is widely shared among different genera in this family
This could be an artifact due to proteobacteria being by far, the most studied family among bacteria?
it is unclear whether, at the distal end of this phylogeny, there is anything similar to a “molecular species”: a group of genetically coherent genomes that evolve together.
Considering that the concept of microbial species with functional similarity based on genetic similarity is itself debated. For example: There could be two strains, differing by a single nucleotide of some important gene, loosing a function with a huge consequence.. The same could be true for plasmids too if there are mutations in a particular origin of replication etc.
determining the host range of a certain plasmid requires ways to establish which plasmids can be considered equivalent
Or to determine the functional elements that determine host range and establish equivalence only within those sequences
To separate cells from electronic background noise and abiotic particles, it is recommended to include nucleic acid stains
Is a stain expected to be more homogenous signal compared to a fluorescent protein expression population of cells?
Because of the technical complexity of manufacturing coronavirus vaccines, waiving intellectual-property rights, by itself, would have little effect
Is this only relevant to the newer mRNA technology?
However, even in unexposed barley seedlings 16% of the cells were induced after 24 h, suggesting the presence of other aromatic compounds were inducing xis-int expression from the regulatable tbuT promoter.
or leaky expression of the Xis-int?
two isogenic mutants of the bacterium Pseudomonas stutzeri.
If they each have a deletion in individual genes, how can they be called isogenic?
Their growth rates might also be different
. Thus, we conclude that genetic variants of the consumer are unlikely to cause the emergence of the two patterns of spatial self-organization.
The conclusion should be that this assay cannot test for the genetic variant theory unless variants can be isolataed prima-facie and the experiment reproduced with variant (of one or both strains) vs the original mixed population
If the “consumer first” pattern were caused by genetic variants, then the number of “consumer first” patterns that emerge per range expansion should depend on the initial cell densities of the producer or consumer.
The pattern is caused by the interaction of the two strains, so altering their ratio will also change the pattern even if it is not caused by genetic variants. How do you control for that?
From this result, we considered that las promoter (BBa_J64010) was not regulated by lasR and 3O-C12-HSL.
Could the RBS be too weak that expression is not seen?
As the speed of unperturbed electrophoretic polynucleotide passage precludes the resolution of individual nucleotides, a DNA- or RNA-binding motor enzyme is added to the system to gain a processive and slowed down passage (millisecond scale per nucleotide) of the polynucleotide through the nanopore
single-stranded polynucleotide is electrophoretically threaded through a protein or solid-state nanopore.
. For example, if a miscalling occurs at the end of a hairpin in a top strand read, the bottom strand read would correctly basecall this sequence before the hairpin is encountered
strand bias example
prepared for nanopore sequencing. This procedure involves end preparation, adapter ligation and incubation with the motor protein
What is this motor protein, helicase? It is not mentioned in the nanopore ligation sequencing kit explanation. Does it come attached to the adapters?
an inhibitor-resistant high-fidelity DNA polymerase
This is Q5 polymerase that was used!
The Hardware may be used solely with the Consumables.
this is very limiting and seems to go overboard to normal patent protection
sequencing adapters, supplied in the kit, are ligated onto the prepared ends.
What is the function of these adapters
variables or computations to group by
data-masking
The basal level of T7-dependent tran-scription in this strain can be reduced by constitutive produc-tion of T7 lyzozyme, a natural inhibitor of T7 RNAP, usingplasmids pLysS and pLysE
simultaneously regulating transcription and translation, we show how basal expression of an inducible system can be reduced, with little impact on the maximum expression rate. Using this approach, we create several stringent expression systems displaying >1000-fold change in their output after induction
From fig 4a: basal expression did not really reduce in 2 out of 3 stringent expression systems designed and seems to be already low in the native Ptac (black line). This is a misleading claim in the abstract which could have been worded better.

I do see that table 1 reflects basal expression as a percentage of the maximum expression, so maybe this is what is being referred to in the abstract?
Both L2 and the gene of interest (GOI) are separately transcribed by PL1 promoters and the product of L2 activates translation of the GOI transcript.
Repeating the same promoter Pl1 twice could cause evolutionary instability due to recombination. How to avoid that?
mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli
I wonder if this insulation will be applicable to other gram negatives? (or other gram positives too?)
the very idea that you could "know" what certain mutations would do — i.e., that you'd know what you'd create and what effect it would have on humans
This is a disingenuous argument. there are many things whose effects on humans can be fairly hypothesised without such experimentation.
It seems that there is precedent and scientific merit to the expectation that a furin cleavage site between the S1 and S2 subunits of the spike proteins can enhance the fusion and hence infectivity of the holder of the spike protein.
None of the staff at the Wuhan Institute were infected with SARS-CoV-2; they were PCR/antibody negative
Isn't this rather suspicious that nobody from this institute happened to be infected as a part of the general transmission in the city?
it should be the default hypothesis.
Why?
explain the puzzling fact that SARS2 has not changed since it first appeared in humans
how substantial of a change are you considering? There have been many mutations in the spike protein which have gotten fixed in distinct sub-populations of variants in various regions/countries..
pMgrB; PLfurOpMgrB; PLfurO
Does using the same promoter for the Cr and the Ta cause recombination?
Using the phoA gene and phoA fusions to monitor expression in these vectors, we show that the ratio of induction/repression can be 1,200-fold, compared with 50-fold for PTAC-based vectors
with glucose?
AraC is already a preferred system within the field for experiments requiring low levels of leak.
With glucose added?
While the talks continue, Iran is keeping up the pressure by adding to its stockpile of highly enriched uranium and the equipment to make it, all in violation of the deal.
That is an unfair statement, considering that context that the deal is no longer operational.
cells are resuspended in ∼1.5 mL transformation storage buffer
100 fold concentration from culture volume (150 ml) to final aliquots (1.5 ml) is a lot for chemical competent cells. For E. coli this is generally 10-20 fold only. I have only seen electrocompetent cells being that concentrated.
This needs to be tried out and verified
It is reported that functional metagenomic selections identify genes with less than 65% amino acid identity to known resistance genes
How do you verify that these are actually causing resistance and not some native transporters etc. that pre-evolve resistance mechanisms?
simpler ribozymes ('hammerhead' and 'hairpin') are RNAs that catalyse site spe-cific scission of single stranded target RNAs bearing a consensus cleavage site.
to study which conditions are necessary to generate interaction patterns like symbiosis or competition, and how higher order community structure can emerge from these
By generation, you mean through evolution?
These functions may arise from genomic scale differential expression and genetic polymorphism at the protein level, established throughout the microbiome/plant co-evolution and could explain its superiority over the maize resident plant-borne microbiome.
Could the differential gene expression have something to do with being passaged on artificial culture media and other in vitro manipulations such as cryo-preservation?
Repeating the same experiment but this time sampling the native maize microbiome into culture based collections and inoculating sterelized maize with this might explain a part of this?
more than one-third of the total stalk bacterial endophytes grew specifically in one of the three culture media used, regardless of the type of media
Is this a one off thing due to random variation or reproducible?
A total of 17 wells containing highly abundant bacteria from the sugarcane core microbiome was selected to construct a synthetic community.
Also curious to see the results on growth promotion of Maize, if all the wells are included (both high and low abundance bacteria)
tested for growth viability
on plates/solid medium
see Figure S2 for transformation efficiencies using a chemical transformation protocol
max of 2e5 CFU/ug plasmid
ssrA degradation tags depend on a short sequence on the N terminus of the protein for quick degradation by the ClpX system in E. coli
Shouldn't it be C terminus?
found that conjugation frequency curves strongly resemble bacterial growth curves, with a lag phase occurring after initial mixing of donor and recipient cells, followed by a period of increasing conjugation (e.g., an exponential phase) that typically ends in a plateau (e.g., a stationary phase)
Does it depend on what growth phase the initial donor and recipients were taken from before mixing?
The FDA clearance and a marked up media highlighting the popularity of the drug prior to the publication of its research could also be the reason why human cognitive biases could have added to the ‘placebo effect’ in a small number of patients
This is a very interesting positive feedback loop. It is almost hypothesizing that the official approval or positive press of any intervention would increase the magnitude of the placebo effect. I wonder how this could be tested in a rigorous manner ... some kind of delayed arms in a trial?
At the same time, many quorum-sensing systems are known to regulate traits that strongly depend on the local cell composition, like conjugative transfer6,7,8, which suggests that cells may profit from limiting their communication range to nearby cells.
Conjugative transfer is one of the phenotypes of quorum sensing, there are many others which could be activated simultaneously. The argument says that conjugative transfer depends on the local cell composition, but why does that translate to cells profiting from limiting the communication range?
This enables cells to accurately detect micron scale changes in the community composition
This seems like an unsubstantiated phenotype being attributed to short range quorum sensing
GelRed, SYBR-Gold, and SYBR-Green must be applied after the run (staining bath) and can't be used with the precast method.
This exception should also be applicable for TAE gels right? But many labs in Rice U use prestained gelgreen gels for TAE -- so why would LAB not work?
What about gelgreen?
https://biotium.com/product/gelgreen-nucleic-acid-gel-stain/
the concentration is calculated based on the fraction of droplets that is empty (that is, the fraction that does not contain any target DNA).
Formula for Calculating Concentration
unexpected extra cluster of positive droplets with fluorescence intensity less than the cluster containing the target of interest can be caused by a sequence variant in the target of interest
The solution is multilateral action in international institutions and international endeavors outside the WTO.
I hate to say that this solution is very vague and needs to be elaborated
undermining private IP rights would eliminate the incentives that inspire innovation, thus preventing the discovery and development of knowledge for new goods and services that the world needs
Much of the discovery of knowledge is publicly funded research which has little to do with intellectual property rights and is not justified to be included in this statement.
The primary justification for granting and protecting IP rights is that they are incentives for innovation, which is the main source for long‐term economic growth and enhancements in the quality of human life
Innovation for it's own sake when the products of such innovation are not reaching their intended consumers in order to alleviate the actual problem they were designed to solve seems rather pointless. Intellectual property rights were designed to encourage innovation, with the goal that such innovation would eventually be beneficial to society. Here there should always be a nuanced balance between the theoretical benefits of innovation and the actual benefits it is leading to on the ground. Hence any discussion of innovation should include the access and utility of such innovations to all stakeholders.
practical reality of a world in which many medicines would simply not exist if it were not for the existence of IP rights and the protections they are afforded.
There are always alternate incentives such as fixed cash awards, and subsidy transfers with fixed ceiling which could serve as incentive for innovation in such pandemic situations. It is not all or none
have warned that allowing their COVID-19 vaccines to be copied without their permission through recourse to compulsory licensing “would undermine innovation and raise the risk of unsafe viruses
Innovation is one thing but the safety of vaccines is for regulatory bodies to determine. Pharmaceutical companies have absolutely no say in this matter hence this is a straw man fallacy argument
There is no evidence that intellectual property rights are a genuine barrier for accessibility of COVID‐19‐related medicines and technologies
There are serious vaccine shortages in the developing countries, one key reason for which is that the developed countries have earmarked a lions share of the initial vaccine doses and due to limited manufacturing of the vaccine to satisfy the whole world's needs. Increased vaccine availability by enabling generic local manufacturers would enable much faster vaccination in all countries and providing essential doses for modest vaccination in the poorer countries
Earthworms don’t do well in these hot temperatures compared to red wigglers which have a higher tolerance for temperature differences (they can survive at temperatures between 32 and 95°F / 0 - 35°C).
Earthworms can survive 0-35C
QXDeveloperusestheformulaandvariablesshownbelow
The similarity between pBBR1 and some plasmids of gram-positive bacteria has led us to precisely examine its mobilization function
These similarities are all located in the RSA and the amino-terminal half of the pBBR1 Mob protein. Source: from the same paper below
The pUB origin of replication stems from Staphylococcus aureus and is known to be active in a wide range of low GC Gram-positive bacteria (Firmicutes)
For many scientists, a new discovery is followed by a plan to make money, to form a company and get a patent.
I doub't this assertion is valid.
bacteria10
Only intracellular pathogen bacteria infecting mammalian cells has been reported in 10. Would be interesting to see if this works for a culture of E. coli
this expression contains two infix calls:
Infix is where the function is not prefixed like usual f(.,.) so a <- b or a + b are infix calls
Plasmids are then recovered from yeast DNA by transforming into E. coli
Is this step necessary?
, a hot-start PCR enzyme that prevents non-specific amplification from mispriming or primer-dimer formation during reaction mixture preparation
So it doesn't prevent primer dimers forming during the reaction then? That is misleading marketing
dsDNA substrate is best for insertions or deletions greater than approximately 20 nucleotides, while ssDNA substrate is best for point mutations or changes of only a few base pairs.
In contrast, SLiCE is an in vitro recombination method facilitated by bacterial cell extracts.
What is the advantage of in vitro recombination by bacterial extracts as opposed to in vivo method?
perhaps immunity will fade faster, for instance. But holding to the current dosing schedules means a slower vaccination program and more deaths.
But going ahead to gamble with what could be an not sufficiently effective or temporary single dose without a line of sight for second dose could mean that once they discover and suggest people to take second doses, many people might lose trust and not show up for the second dose. This will be an irreversible effect on public trust on the vaccine
when assembling Escherichia coli K12 MG1655. This genome can only be assembled into a single contig when the read length exceeds the size of the longest repeat in the genome, a multi-copy rDNA operon
Demonstrates that if the read length exceeds the longest repeat, then automated assembly becomes straightforward
AS-PCR was developed over 30 years ago (Petruska et al., 1988; Wu et al., 1989) and is commonly used for molecular genotyping in laboratory diagnostics
When you have the data-variable in a function argument (i.e. an env-variable that holds a promise2), you need to embrace the argument by surrounding it in doubled braces, like filter(df, {{ var }})
will show in real-time what downstream processes have been completed for each sample.
This is impossible unless we upload data after each step. That would be too much work to expect from people who are busy in the wetlab
filtered onto a track-etched membrane (pore size: 0.2 µm, Whatman CycloporeTM, UK). Filters were placed on agar-solidified (15 g/l) SW or MC medium
Phanta Max Super-Fidelity DNA Polymerase is a new generation superior enzyme based on Pfu DNA Polymerase for robust PCR with extreme fidelity. High amplification efficiency and template adaptability makes Phanta Max suitable for almost all PCR reactions. The unique extension factor, specificity-promoting factors and plateau-inhibiting factor in Phanta Max greatly improve its long-fragment amplification ability, specificity and yield
The enzyme offers fast amplification and strong strand displacement capabilities, making it ideal for nucleic acid amplification methods such as whole genome amplification, multiple displacement amplification and isothermal amplification.
IsoFast™ Bst Polymerase
patent protections and the profits they derive are a requirement for the innovation that yields lifesaving medicines.
This is true. But if there are many lives that are not being saved, then what's the use of this innovation other than being a paper tiger?
the kinetics of hybridization remain poorly understood, and no models or algorithms have been reported that accurately predict hybridization rate constants from sequence and reaction conditions (temperature and salinity). This knowledge deficiency has adversely impacted the research community by requiring either trial-and-error optimization of DNA primer and probe sequences for new genetic regions of interest, or brute-force use of thousands of DNA probes for target enrichment
Why does kinetics impact the design of primer and probe sequences? Isn't it determined completely by thermodynamics?
resulting suspension was transferred onto sterile 0,2 μm nitrocellulose filters (Advantec) that were placed over 10% TSB agar media
2 ml of mating suspension was transferred to a sterile 0.22-μm Cyclopore membrane (Whatman) by vacuum filtration (<0.4 mbar)
Patients in the placebo group received identical-looking tablets and drops
what was the composition of the placebo?
use of plasmid DNA enabled lower depth sequencing, and assemblies sufficient for full antimicrobial resistance gene annotation were obtained with as few as 2,000 to 5,000 reads, which could be acquired in 20 min of sequencing
Make sure the 3′ end of the primer contains a C or G residue, because T and A residues bind more easily to DNA in a non-specific way
This sounds wrong. G/C bind stronger hence provide for a better anchor for polymerase to start.
G/C has more propensity for non specific binding though
methylated motifs. These motifs often differ among species and strains24,25, making it possible to use combinations of methylated motifs (endogenous epigenetic barcode) for metagenomic binning.
This is interesting. If methyl transferases are carried on mobile genetic elements, horizontally transferred to closely related organisms, shouldn't they share methylation signatures?
Which would make the motifs not differ among species and strains?
Our method takes advantage of these endogenous epigenetic barcodes to resolve individual reads and assembled contigs into species- and strain-level bins
Do individual strains or closely related species vary so much in their methylation signatures?
This work facilitates the reporting of promoters in absolute units, the variability in their activity across a population, and their quantitative toll on cellular resources
Looks like this has been done in the past. Ido Golding's work already measures low numbers of copy number, mRNA counts simultaneously in phage infected E coli using microscopy + clever statistics
getting severely ill when infected with TB if they inherited two copies of a rare variant of the immune gene TKY2, called P1104A.
The article could have benefited from a short mechanistic explanation of the mechanism behind this
Table10.Pre-RunErrorIndicators
The TURBO DNA-free™ Kit contains reagents for the efficient, complete digestion of DNA along with the removal of the enzyme and divalent cations post-digestion.
To auto-fill login information, use the following default shortcuts: On Windows: Ctrl + Shift + L
Pointing to the country's priority list, announced way ahead of the vaccine rollout earlier this month, he said, "In the first seven to eight months, we are focused on the 30 crore people, about which we have talked quite often and we know who those people are, who are the needier".
Is this an appeal for their votes?
viXra will be open to anybody for both reading and submitting articles. We will not prevent anybody from submitting and will only reject articles in extreme cases of abuse, e.g. where the work may be vulgar, libellous, plagiaristic or dangerously misleading.
What if ArXiv claimed they were also rejecting articles only in extreme cases. But since they don't have the staff to vet all the submissions they receive, they came up with the endorsement system.
I don't see this new platform as solving any problem - this model will break when the scale of submissions increases
Our preferred gender pronoun for generic references is the female: “she”, “her”, etc.
Excellent!
Plate-reader measurements of bacterial growth in the presence of various antibiotic concentrations were used for MIC values. For the strains used in conjugative experiments (both within and across genera) as well as the post-conjugation transconjugants,
Can the presence of the sweetness affect the MIC on any way? Can this be controlled for?
He picked himself for the match so as to fulfill the BCCI criterion (which requires state administrators to have at least one first-class match experience) for becoming a selector at the state level. After the match, he appointed himself as the chairman of selectors of HPCA Ranji trophy cricket team
Wow! smells like conflict of interest, ain't it?
curcumin doesn’t have any of the basic qualifications of a good pharmaceutical. Studies have shown that rats absorb less than 1% of the curcumin they eat.
This is a great argument if curcumin is being talked about as a pharmaceutical in the typical sense.
But when consumed as a regular part of Indian cuisine, turmeric is generally added into hot oil along with other whole spices - this could possibly alter the bio availability of curcumin (as it could for fat soluble vitamins?)
Urban Governance in India -- Episode 31 of The Seen and the Unseen (w Shruti Rajagopalan)
Disconnect between power and accountability. Decentralization in politics
A ribosome typically covers 10 codon positions and hence ℓ = 10 with the A-site of the ribosome located at the sixth codon position in this segment
6th position from the downstream (3') side?
We have identified several safe insertion regions (SIRs) within E. coli MG1655 that do not contain any known genes or regulatory regions
Aminimumof%20basepairsinacompletelyhomologoussegmentisrequiredforsignificantrecombination.Thereisanexponentialincreaseinthefre-quencyofrecombinationwhenthelengthofhomologousDNAisincreasedfrom20basepairsto74basepairsandanapparentlylinearincreasewithlongerDNAsegments.Mis-matcheswithinahomologoussegmentcandramaticallyde-creasethefrequencyofrecombination.
A minimum of 20 base pairs in a completely homologous segment is required for significant recombination. There is an exponential increase in the frequency of recombination when the length of homology increases from 20 to 74 bp and an apparently linear increase with longer DNA segments. Mismatches within a homologous segment can dramatically decrease the frequency of recombination.
However, to our knowledge, there is no study that compares microbial communities in different CW designs with different wetland plant species treating pesticides.
I would want to see a more persuasive reason for why the different designs need to be studied rather than just that no study has done it so far
newly acquired spacers derived from pTrig were 34 times more prevalent in response to the signal than without, increasing from 0.038(±0.004)% to 1.28(±0.03)% among all arrays in the cell populations
Dynamic range of 34 is much smaller than 400. It is interesting to understand what causes this.
cellular data recorders offer the capacity to measure biologically relevant signals15,16,17,18,19 in places that are otherwise difficult to access, such as inside the body20,21, and over time22
Dr Samiran Panda, a scientist at the Indian Council of Medical Research (ICMR), told The Wire Science earlier this week that the “mode” is effectively a single-arm clinical trial that wouldn’t have have a placebo and whose results wouldn’t be published in peer-reviewed journals – but with everything else being the same.
Single arm clinical trials - good reference here Evans, Scott R. "Clinical trial structures." Journal of experimental stroke & translational medicine 3.1 (2010): 8.
Key points from explainer video - Soil biodiversity conservation Youtube
Here, we present the development and application of the BioMe plate, a redesigned microplate device in which pairs of wells are separated by porous membranes
This variant presents 14 non-synonymous mutations, 6 synonymous mutations and 3 deletions. The multiple mutations present in the viral RNA encoding for the spike protein (S) are of most concern, such as the deletion Δ69-70, deletion Δ144, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H
a 2 mm buffer overlay
does this mean 2 mm buffer above the gel?
RSF1010 is maintained at a copy-number of about 10-12 per chromosome in E coli, P. aeruginosa and S. enterica sv.Typhimurium (Frey and Bagdasarian, 1989)