2,429 Matching Annotations
  1. May 2022
    1. a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.

      Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?

  2. Apr 2022
    1. Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).

      The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way

    1. while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources

      ROX increases precision of technical replicates (which we don't do much of in our lab)

    2. ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges

      ROX helps normalize these variations

    1. Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).

      This is an interesting argument as to what individual users can do to keep Firefox alive. But the biggest dent on anti-competitive behavior should come from well enforced proper anti-trust regulations the way Europe is doing it. How can browser users contribute to this?

  3. Mar 2022
    1. For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.
    1. no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.

      Sounds like most probe qPCR reactions right? I assume this is in the raw data before baseline subtraction

    2. Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)

      Why sample id? Isn't target and sample type not enough?

    1. a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (

      KanR here is a aminoglycoside nucleotidyltransferase (aadD1), uniprot = P05057 from Staph aureus. This is different from the usual phosphotransferase aphA1/3 used in e.coli

  4. Feb 2022
    1. When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases

      Does this mean that probe-based data without plateau phase cannot be analyzed effectively?

    2. For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample

      For clinical samples where each sample is expected to have a different inhibitor load hence different efficiency

    1. One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package

      The $AsXML exported .rdml file is not valid in RDML-ninja.

      Error message : No rdml_data.xml in compressed RDML file found.

      How to fix this?

  5. Jan 2022
    1. The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.

      using qpcR package for analysis

    1. Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.

      Using qpcR package for qPCR data analysis..

    1. Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1

      I wonder why this fit information was not used for quantification as well?

    1. The ability of a community to receive genes located on mobilizable non-self-transmissible plasmids, on the other hand, would rely on the community’s own content of conjugal plasmids

      Are we assuming here that the secondary conjugation events within the community are more significant than the primary donor with the conjugation helper plasmid?

    1. To ensure unambiguous selection of data points within the window-of-linearity, an iterative algorithm is formulated to search for lines consisting of at least 4 and no more than six data points with the highest R2 value and a slope close to the maximum slope

      Isn't this too small a subset of data? Or is the exponential phase usually <= 6 points?

    1. To cancel out the random variation in individual PCR efficiencies, web-based LinRegPCR, determines for each reaction the centre of the exponential phase from the baseline-corrected fluorescence values and, using the mean PCR efficiency of the assay, constructs an ideal amplification curve which is then used to call the Cq value for the reaction

      Wouldn't this lead to too much dependency on just one data point of the assay - the midpoint of the log-phase?

    1. RT-qPCR targeting SARS-CoV-2 is sensitive to inhibitors that are present in wastewater, leading to false-negative results

      How sensitive is LAMP to contaminants considering the a lot more intricate primer binding reactions are involved. Could there be mispriming and false positives due to contaminants?

  6. Dec 2021
    1. the rapid approach uses a transposase enzyme to simultaneously cleave DNA and attach barcode/adapter sequences

      How efficient is the transposase with supercoiled plasmid DNA compared to long linear genomic DNA fragments it was originally designed for?

    1. an accumulation of single base pair errors will clearly lead to removal of more reads prior to downstream analyses when using an ESV-based approach versus an OTU-based approach.

      I would say the removal of reads caused by errors is better than somehow squeezing them into OTU clusters and risking spurious OTUs (singletons or otherwise). Thoughts?

    2. If your data is high quality, you want improved taxonomic resolution, and you are not concerned about the intra-genomic heterogeneity in the targeted marker genes, an ESV-based approach could be advantageous. Otherwise, a more standard OTU-based approach might be your best bet.
    1. runcate reads after truncLen bases.Reads shorter than this are discarded.

      Is this from 5' end or 3' end?

      How to prevent shorter reads from being discarded?

  7. Nov 2021
    1. You can also overwrite records in a while loop to avoid excessive memory allocation.

      Does for record in reader not overwrite record the same as the while loop?

    1. , independent inference by sample is trivially parallelizable and enables total computation time to scale linearly and memory requirements to remain flat with increasing sample number, allowing ASVs to be inferred from arbitrarily large data sets.

      It is observed that parallel processing of individual samples (unpooled) underestimates rare taxa (discarding them among sequencing noise) Reference: Fierer lab

    1. The mergePairs(..., justConcatenate=TRUE) option allows the paired reads to be joined without any overlap, but with 10Ns inserted in between the forward and reverse reads. The chimera removal and assignTaxonomy functions will handle such merged reads

      In case of non-overlapping paired ends

    1. we designed the medium to contain a minimal amount of undefined ingredients that are typically used to cover unknown nutrient requirements

      yeast extract

    1. A self-transmissible RK2 helper plasmid facilitated the spread of mobilizable CRISPR/Cas

      Why have two plasmids instead of having just one self transmissible one?

  8. Oct 2021
    1. transmembrane β-strands are highly conserved and that the surface-exposed regions display the highest variability, not only in sequence but also in length.

      Promise for Broad host membrane surface display?

    1. So, here is how I manage it, if the line height cannot be reduced sufficiently by the numeric entry/spinbox: Try clicking the question-mark (un-set variable inline height).If that does not resolve the issue, activate the Tt button ("outer" text style) and set the font height to something small and linespacing to something small and click the questionmark.Then de-activate Tt (outer) and edit the text normally.i.e. The outer style overrides the inner style.
    1. high-throughput 16S rRNA analysis were used to track changes in the bacterial community with Rpf addition, which could reveal the key functional populations contributing to the enhanced phenol degradation under high salinity conditions

      Why would the 16s DNA content change with the resuscitation?

      Do viable, non culturable organisms have lower 16s gene abundance or are harder to lyse and extract from?

    1. Kraken (https://ccb.jhu.edu/software/kraken2/) is one of the most frequently used tools to classify microbial community taxonomic information

      Really? I thought it is relatively new to the taxonomic field

    1. We sought to reduce the time needed for allele enrichment by putting a selective pressure against the WT allele at the nucleotide level using CRISPR-Cas9 nuclease.

      Using this will make HiSCRIBE the same as SCRIBE?

    1. Exercising caution when interpreting oligotyping results is warranted, because the 16S rRNA gene, even at full length, can miss important genetic variation underlying ecological and evolutionary differentiation between species

      On the other hand, an individual bacterial cell can house multiple copies of 16s gene that differ slightly to each other.

  9. Sep 2021
    1. print_median(@benchmark linear_access(data, 4096))

      The linear access is taking 435 times longer than random access?

      This is in contradiction from the explanation above. Is this a mistake in the order the results are presented?

  10. Aug 2021
    1. scale_x_discrete(guide = guide_axis(n.dodge = 2))

      With guide_axis(), we can add dodge to our axis label texts to avoid overlapping texts. In the code below, we have used guide_axis() function with n.dodge=2 inside scale_x_discrete() to dodge overlapping text on x-axis.

    1. Considering that DNA molecules consist of double strands of phosphate-deoxyribose backbone and bases that contain a large number of phosphate groups, we next tested if the DNA in the used columns could be effectively removed using a phosphoric acid solution

      phosphate will compete with DNA for binding the column?

    1. The ability of RSF1010 to transfer at high frequencies is remarkable considering its dependency on the availability of compatible conjugation machinery in trans. These data indicate a high prevalence of naturally occurring conjugative elements in sand filter communities

      Or more likely is the possibility that the first transfer is much more abundant than subsequent secondary transfers in the 24 hour duration of this experiment

    2. In contrast to previous work (Li et al., 2018), pKJK5 showed relatively lower transfer frequencies than RP4 (~1 order of magnitude difference) across all water work microbial communities

      Are you able to explain the possible reasons for this difference?

    1. The best estimate of the PCR efficiency of an assay is obtained by calculating the arithmetic mean of the Eamc determined from all reactions of a specific target

      Assumption is that errors in efficiency across replicates is additive..?

    2. ΔCq indicates the difference between the mean Cq in control and treatment groups for the target as well as the reference

      By writing \(E_{tar}\) in the equation, the assumption is the the efficiency is the same for the control and the treatment groups. This would hold unless there is large differences in efficiency between those -- assuming they differ by batch of processing/extraction etc.

      This assumption wouldn't hold if each reaction has a slightly different efficiency

    1. a ‘single’ curve model ignores sources of run-to-run variability

      ignores variability that is intrinsic to the standard curve and not universal to both standards and unknown samples -- this variability is taken care of in the single curve per run model

    2. Previous studies report from repeated instrument runs of the same calibration curve that there are often minor variations in the slope (<3%), but significant differences between intercept values

      does "same calibration curve" implies the same serial dilutions or freshly made dilutions for each run?

    1. this mechanism may broadly contribute to the importance of IncQ plasmids as agents of bacterial gene transfer in nature

      what special features of IncQ make this mechanism viable? - the replication mechanism?

  11. Jul 2021
    1. that uses highly accessible and inexpensive materials.

      How easily are these materials available?

      1. Gold nanoparticles
      2. ACE2 protein
      3. The electrical detection unit
    1. pBGC was introduced into the wild-type isolate collection by electroporation, and all pOXA-48-carrying and pOXA-48-free clones were competed against their pBGC-carrying parental strain

      Is the burden of carrying pBGC included somehow in the analysis?

      Were pBGC carrying isolates competed with the parent isolates without any plasmid to do this?

    2. The presence of the entire pOXA-48_K8 plasmid was confirmed by sequencing the complete genomes of the 50 transconjugant clones, which also revealed the genetic relatedness of the isolates

      was this done after the growth to determine fitness effects? could the plasmid be lost midway through that experiment?

    3. replicate plasmid fitness effects in natural bacterial hosts, which remain largely unexplored

      fitness effects would also be greatly dependent on the environment and measuring fitness as max growth rate, max OD in well shaken single species liquid cultures also might not replicate plasmid fitness effects in the natural gut ecosystem.

      Given this, what is the specific advantage in using natural isolates?

    4. select clones which were naive to pOXA-48_K8, but ecologically compatible with it

      How can residence in a patient from a certain ward be termed as "ecological compatibility"

    1. TURBO™ DNase is a genetically engineered form of bovineDNase I with greater catalytic efficiency than conventionalDNase I at higher salt concentrations and lower DNAconcentrations.

      salt here => monovalent salts (Na+ etc.)

  12. Jun 2021
    1. Escherichia coli was not reliably distinguished from Shigella and other Escherichia species sharing the high 16S rRNA gene sequence similarity to each other

      Is this due to sequencing error rate of nanopore or the 16s are really that identical?

    1. Goals of this paper

      1. What are the barriers of HGT across organisms of increasing phylogenetic distance?
      2. What determines the host range of conjugative elements (ICE, MGE, plasmids etc.)

      Questions

      1. What does two plasmids being "related" mean to you guys? What does the sequence similarity or proteome similarity tell?

      Evidence for functional relevance of PTU

      1. PTUs have some correspondence with Inc groups and Mob types (both being more functionally informative) `
    2. ANIL20 refers to the total length of the shortest plasmid in the comparison.

      What does this mean if the shortest plasmid is really short - < 5 kb like the engineered plasmids and the larger plasmid is a real 50 kb plasmid? What does similarity of such a small region to such a large plasmid mean?

    3. This causes that otherwise unrelated plasmids show certain fragments of their genomes with high ANI values

      If they share the same MGE sequences, what else do you mean by otherwise unrelated? What does two plasmids being related mean to you guys?

    4. this trend dissipated when we looked within the Enterobacteriaceae family (Fig. 1e, f), indicating that the plasmid-encoded genome is widely shared among different genera in this family

      This could be an artifact due to proteobacteria being by far, the most studied family among bacteria?

    5. it is unclear whether, at the distal end of this phylogeny, there is anything similar to a “molecular species”: a group of genetically coherent genomes that evolve together.

      Considering that the concept of microbial species with functional similarity based on genetic similarity is itself debated. For example: There could be two strains, differing by a single nucleotide of some important gene, loosing a function with a huge consequence.. The same could be true for plasmids too if there are mutations in a particular origin of replication etc.

    6. determining the host range of a certain plasmid requires ways to establish which plasmids can be considered equivalent

      Or to determine the functional elements that determine host range and establish equivalence only within those sequences

    1. To separate cells from electronic background noise and abiotic particles, it is recommended to include nucleic acid stains

      Is a stain expected to be more homogenous signal compared to a fluorescent protein expression population of cells?

    1. Because of the technical complexity of manufacturing coronavirus vaccines, waiving intellectual-property rights, by itself, would have little effect

      Is this only relevant to the newer mRNA technology?

    1. However, even in unexposed barley seedlings 16% of the cells were induced after 24 h, suggesting the presence of other aromatic compounds were inducing xis-int expression from the regulatable tbuT promoter.

      or leaky expression of the Xis-int?

    1. two isogenic mutants of the bacterium Pseudomonas stutzeri.

      If they each have a deletion in individual genes, how can they be called isogenic?

      Their growth rates might also be different

    2. . Thus, we conclude that genetic variants of the consumer are unlikely to cause the emergence of the two patterns of spatial self-organization.

      The conclusion should be that this assay cannot test for the genetic variant theory unless variants can be isolataed prima-facie and the experiment reproduced with variant (of one or both strains) vs the original mixed population

    3. If the “consumer first” pattern were caused by genetic variants, then the number of “consumer first” patterns that emerge per range expansion should depend on the initial cell densities of the producer or consumer.

      The pattern is caused by the interaction of the two strains, so altering their ratio will also change the pattern even if it is not caused by genetic variants. How do you control for that?

    1. From this result, we considered that las promoter (BBa_J64010) was not regulated by lasR and 3O-C12-HSL.

      Could the RBS be too weak that expression is not seen?

    1. As the speed of unperturbed electrophoretic polynucleotide passage precludes the resolution of individual nucleotides, a DNA- or RNA-binding motor enzyme is added to the system to gain a processive and slowed down passage (millisecond scale per nucleotide) of the polynucleotide through the nanopore
    1. prepared for nanopore sequencing. This procedure involves end preparation, adapter ligation and incubation with the motor protein

      What is this motor protein, helicase? It is not mentioned in the nanopore ligation sequencing kit explanation. Does it come attached to the adapters?

  13. May 2021

    Tags

    Annotators

    1. simultaneously regulating transcription and translation, we show how basal expression of an inducible system can be reduced, with little impact on the maximum expression rate. Using this approach, we create several stringent expression systems displaying >1000-fold change in their output after induction

      From fig 4a: basal expression did not really reduce in 2 out of 3 stringent expression systems designed and seems to be already low in the native Ptac (black line). This is a misleading claim in the abstract which could have been worded better. file


      I do see that table 1 reflects basal expression as a percentage of the maximum expression, so maybe this is what is being referred to in the abstract?

    2. Both L2 and the gene of interest (GOI) are separately transcribed by PL1 promoters and the product of L2 activates translation of the GOI transcript.

      Repeating the same promoter Pl1 twice could cause evolutionary instability due to recombination. How to avoid that?

    1. mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli

      I wonder if this insulation will be applicable to other gram negatives? (or other gram positives too?)

    1. the very idea that you could "know" what certain mutations would do — i.e., that you'd know what you'd create and what effect it would have on humans

      This is a disingenuous argument. there are many things whose effects on humans can be fairly hypothesised without such experimentation.

      It seems that there is precedent and scientific merit to the expectation that a furin cleavage site between the S1 and S2 subunits of the spike proteins can enhance the fusion and hence infectivity of the holder of the spike protein.

    2. None of the staff at the Wuhan Institute were infected with SARS-CoV-2; they were PCR/antibody negative

      Isn't this rather suspicious that nobody from this institute happened to be infected as a part of the general transmission in the city?

    1. explain the puzzling fact that SARS2 has not changed since it first appeared in humans

      how substantial of a change are you considering? There have been many mutations in the spike protein which have gotten fixed in distinct sub-populations of variants in various regions/countries..

    1. Using the phoA gene and phoA fusions to monitor expression in these vectors, we show that the ratio of induction/repression can be 1,200-fold, compared with 50-fold for PTAC-based vectors

      with glucose?

    1. While the talks continue, Iran is keeping up the pressure by adding to its stockpile of highly enriched uranium and the equipment to make it, all in violation of the deal.

      That is an unfair statement, considering that context that the deal is no longer operational.

    1. cells are resuspended in ∼1.5 mL transformation storage buffer

      100 fold concentration from culture volume (150 ml) to final aliquots (1.5 ml) is a lot for chemical competent cells. For E. coli this is generally 10-20 fold only. I have only seen electrocompetent cells being that concentrated.

      This needs to be tried out and verified

    1. It is reported that functional metagenomic selections identify genes with less than 65% amino acid identity to known resistance genes

      How do you verify that these are actually causing resistance and not some native transporters etc. that pre-evolve resistance mechanisms?

    1. to study which conditions are necessary to generate interaction patterns like symbiosis or competition, and how higher order community structure can emerge from these

      By generation, you mean through evolution?

    1. These functions may arise from genomic scale differential expression and genetic polymorphism at the protein level, established throughout the microbiome/plant co-evolution and could explain its superiority over the maize resident plant-borne microbiome.

      Could the differential gene expression have something to do with being passaged on artificial culture media and other in vitro manipulations such as cryo-preservation?

      Repeating the same experiment but this time sampling the native maize microbiome into culture based collections and inoculating sterelized maize with this might explain a part of this?

    2. more than one-third of the total stalk bacterial endophytes grew specifically in one of the three culture media used, regardless of the type of media

      Is this a one off thing due to random variation or reproducible?

    3. A total of 17 wells containing highly abundant bacteria from the sugarcane core microbiome was selected to construct a synthetic community.

      Also curious to see the results on growth promotion of Maize, if all the wells are included (both high and low abundance bacteria)

    1. ssrA degradation tags depend on a short sequence on the N terminus of the protein for quick degradation by the ClpX system in E. coli

      Shouldn't it be C terminus?

    1. found that conjugation frequency curves strongly resemble bacterial growth curves, with a lag phase occurring after initial mixing of donor and recipient cells, followed by a period of increasing conjugation (e.g., an exponential phase) that typically ends in a plateau (e.g., a stationary phase)

      Does it depend on what growth phase the initial donor and recipients were taken from before mixing?

  14. Apr 2021
    1. The FDA clearance and a marked up media highlighting the popularity of the drug prior to the publication of its research could also be the reason why human cognitive biases could have added to the ‘placebo effect’ in a small number of patients

      This is a very interesting positive feedback loop. It is almost hypothesizing that the official approval or positive press of any intervention would increase the magnitude of the placebo effect. I wonder how this could be tested in a rigorous manner ... some kind of delayed arms in a trial?

    1. At the same time, many quorum-sensing systems are known to regulate traits that strongly depend on the local cell composition, like conjugative transfer6,7,8, which suggests that cells may profit from limiting their communication range to nearby cells.

      Conjugative transfer is one of the phenotypes of quorum sensing, there are many others which could be activated simultaneously. The argument says that conjugative transfer depends on the local cell composition, but why does that translate to cells profiting from limiting the communication range?

    2. This enables cells to accurately detect micron scale changes in the community composition

      This seems like an unsubstantiated phenotype being attributed to short range quorum sensing

    1. The solution is multilateral action in international institutions and international endeavors outside the WTO.

      I hate to say that this solution is very vague and needs to be elaborated

    2. undermining private IP rights would eliminate the incentives that inspire innovation, thus preventing the discovery and development of knowledge for new goods and services that the world needs

      Much of the discovery of knowledge is publicly funded research which has little to do with intellectual property rights and is not justified to be included in this statement.

    3. The primary justification for granting and protecting IP rights is that they are incentives for innovation, which is the main source for long‐​term economic growth and enhancements in the quality of human life

      Innovation for it's own sake when the products of such innovation are not reaching their intended consumers in order to alleviate the actual problem they were designed to solve seems rather pointless. Intellectual property rights were designed to encourage innovation, with the goal that such innovation would eventually be beneficial to society. Here there should always be a nuanced balance between the theoretical benefits of innovation and the actual benefits it is leading to on the ground. Hence any discussion of innovation should include the access and utility of such innovations to all stakeholders.

    4. practical reality of a world in which many medicines would simply not exist if it were not for the existence of IP rights and the protections they are afforded.

      There are always alternate incentives such as fixed cash awards, and subsidy transfers with fixed ceiling which could serve as incentive for innovation in such pandemic situations. It is not all or none

    5. have warned that allowing their COVID-19 vaccines to be copied without their permission through recourse to compulsory licensing “would undermine innovation and raise the risk of unsafe viruses

      Innovation is one thing but the safety of vaccines is for regulatory bodies to determine. Pharmaceutical companies have absolutely no say in this matter hence this is a straw man fallacy argument

    6. There is no evidence that intellectual property rights are a genuine barrier for accessibility of COVID‐​19‐​related medicines and technologies

      There are serious vaccine shortages in the developing countries, one key reason for which is that the developed countries have earmarked a lions share of the initial vaccine doses and due to limited manufacturing of the vaccine to satisfy the whole world's needs. Increased vaccine availability by enabling generic local manufacturers would enable much faster vaccination in all countries and providing essential doses for modest vaccination in the poorer countries

    1. Earthworms don’t do well in these hot temperatures compared to red wigglers which have a higher tolerance for temperature differences (they can survive at temperatures between 32 and 95°F / 0 - 35°C).

      Earthworms can survive 0-35C

    1. The similarity between pBBR1 and some plasmids of gram-positive bacteria has led us to precisely examine its mobilization function

      These similarities are all located in the RSA and the amino-terminal half of the pBBR1 Mob protein. Source: from the same paper below

    1. For many scientists, a new discovery is followed by a plan to make money, to form a company and get a patent.

      I doub't this assertion is valid.

    1. this expression contains two infix calls:

      Infix is where the function is not prefixed like usual f(.,.) so a <- b or a + b are infix calls

    1. , a hot-start PCR enzyme that prevents non-specific amplification from mispriming or primer-dimer formation during reaction mixture preparation

      So it doesn't prevent primer dimers forming during the reaction then? That is misleading marketing

    1. In contrast, SLiCE is an in vitro recombination method facilitated by bacterial cell extracts.

      What is the advantage of in vitro recombination by bacterial extracts as opposed to in vivo method?

      • Is the limitation the transformation efficiency of individual fragments?
    1. perhaps immunity will fade faster, for instance. But holding to the current dosing schedules means a slower vaccination program and more deaths.

      But going ahead to gamble with what could be an not sufficiently effective or temporary single dose without a line of sight for second dose could mean that once they discover and suggest people to take second doses, many people might lose trust and not show up for the second dose. This will be an irreversible effect on public trust on the vaccine

    1. when assembling Escherichia coli K12 MG1655. This genome can only be assembled into a single contig when the read length exceeds the size of the longest repeat in the genome, a multi-copy rDNA operon

      Demonstrates that if the read length exceeds the longest repeat, then automated assembly becomes straightforward

  15. Mar 2021
    1. When you have the data-variable in a function argument (i.e. an env-variable that holds a promise2), you need to embrace the argument by surrounding it in doubled braces, like filter(df, {{ var }})
    1. will show in real-time what downstream processes have been completed for each sample.

      This is impossible unless we upload data after each step. That would be too much work to expect from people who are busy in the wetlab

    1. Phanta Max Super-Fidelity DNA Polymerase is a new generation superior enzyme based on Pfu DNA Polymerase for robust PCR with extreme fidelity. High amplification efficiency and template adaptability makes Phanta Max suitable for almost all PCR reactions. The unique extension factor, specificity-promoting factors and plateau-inhibiting factor in Phanta Max greatly improve its long-fragment amplification ability, specificity and yield
    1. The enzyme offers fast amplification and strong strand displacement capabilities, making it ideal for nucleic acid amplification methods such as whole genome amplification, multiple displacement amplification and isothermal amplification.

      IsoFast™ Bst Polymerase

    1. patent protections and the profits they derive are a requirement for the innovation that yields lifesaving medicines.

      This is true. But if there are many lives that are not being saved, then what's the use of this innovation other than being a paper tiger?

    1. the kinetics of hybridization remain poorly understood, and no models or algorithms have been reported that accurately predict hybridization rate constants from sequence and reaction conditions (temperature and salinity). This knowledge deficiency has adversely impacted the research community by requiring either trial-and-error optimization of DNA primer and probe sequences for new genetic regions of interest, or brute-force use of thousands of DNA probes for target enrichment

      Why does kinetics impact the design of primer and probe sequences? Isn't it determined completely by thermodynamics?

    1. use of plasmid DNA enabled lower depth sequencing, and assemblies sufficient for full antimicrobial resistance gene annotation were obtained with as few as 2,000 to 5,000 reads, which could be acquired in 20 min of sequencing
    1. Make sure the 3′ end of the primer contains a C or G residue, because T and A residues bind more easily to DNA in a non-specific way

      This sounds wrong. G/C bind stronger hence provide for a better anchor for polymerase to start.

      G/C has more propensity for non specific binding though

    1. methylated motifs. These motifs often differ among species and strains24,25, making it possible to use combinations of methylated motifs (endogenous epigenetic barcode) for metagenomic binning.

      This is interesting. If methyl transferases are carried on mobile genetic elements, horizontally transferred to closely related organisms, shouldn't they share methylation signatures?

      Which would make the motifs not differ among species and strains?

    2. Our method takes advantage of these endogenous epigenetic barcodes to resolve individual reads and assembled contigs into species- and strain-level bins

      Do individual strains or closely related species vary so much in their methylation signatures?

    1. This work facilitates the reporting of promoters in absolute units, the variability in their activity across a population, and their quantitative toll on cellular resources

      Looks like this has been done in the past. Ido Golding's work already measures low numbers of copy number, mRNA counts simultaneously in phage infected E coli using microscopy + clever statistics

      • Wang, Mengyu, et al. "Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality." Nature microbiology 4.12 (2019): 2118-2127.nature
    1. getting severely ill when infected with TB if they inherited two copies of a rare variant of the immune gene TKY2, called P1104A.

      The article could have benefited from a short mechanistic explanation of the mechanism behind this

    1. Pointing to the country's priority list, announced way ahead of the vaccine rollout earlier this month, he said, "In the first seven to eight months, we are focused on the 30 crore people, about which we have talked quite often and we know who those people are, who are the needier".

      Is this an appeal for their votes?

    1. viXra will be open to anybody for both reading and submitting articles. We will not prevent anybody from submitting and will only reject articles in extreme cases of abuse, e.g. where the work may be vulgar, libellous, plagiaristic or dangerously misleading.

      What if ArXiv claimed they were also rejecting articles only in extreme cases. But since they don't have the staff to vet all the submissions they receive, they came up with the endorsement system.

      I don't see this new platform as solving any problem - this model will break when the scale of submissions increases

  16. Feb 2021
    1. Plate-reader measurements of bacterial growth in the presence of various antibiotic concentrations were used for MIC values. For the strains used in conjugative experiments (both within and across genera) as well as the post-conjugation transconjugants,

      Can the presence of the sweetness affect the MIC on any way? Can this be controlled for?

    1. He picked himself for the match so as to fulfill the BCCI criterion (which requires state administrators to have at least one first-class match experience) for becoming a selector at the state level. After the match, he appointed himself as the chairman of selectors of HPCA Ranji trophy cricket team

      Wow! smells like conflict of interest, ain't it?

    1. curcumin doesn’t have any of the basic qualifications of a good pharmaceutical. Studies have shown that rats absorb less than 1% of the curcumin they eat.

      This is a great argument if curcumin is being talked about as a pharmaceutical in the typical sense.

      But when consumed as a regular part of Indian cuisine, turmeric is generally added into hot oil along with other whole spices - this could possibly alter the bio availability of curcumin (as it could for fat soluble vitamins?)

    1. Urban Governance in India -- Episode 31 of The Seen and the Unseen (w Shruti Rajagopalan)

      Disconnect between power and accountability. Decentralization in politics

    1. A ribosome typically covers 10 codon positions and hence ℓ = 10 with the A-site of the ribosome located at the sixth codon position in this segment

      6th position from the downstream (3') side?

  17. Jan 2021
  18. www-pnas-org.ezproxy.rice.edu www-pnas-org.ezproxy.rice.edu
    1. Aminimumof%20basepairsinacompletelyhomologoussegmentisrequiredforsignificantrecombination.Thereisanexponentialincreaseinthefre-quencyofrecombinationwhenthelengthofhomologousDNAisincreasedfrom20basepairsto74basepairsandanapparentlylinearincreasewithlongerDNAsegments.Mis-matcheswithinahomologoussegmentcandramaticallyde-creasethefrequencyofrecombination.

      A minimum of 20 base pairs in a completely homologous segment is required for significant recombination. There is an exponential increase in the frequency of recombination when the length of homology increases from 20 to 74 bp and an apparently linear increase with longer DNA segments. Mismatches within a homologous segment can dramatically decrease the frequency of recombination.

    1. However, to our knowledge, there is no study that compares microbial communities in different CW designs with different wetland plant species treating pesticides.

      I would want to see a more persuasive reason for why the different designs need to be studied rather than just that no study has done it so far

    1. newly acquired spacers derived from pTrig were 34 times more prevalent in response to the signal than without, increasing from 0.038(±0.004)% to 1.28(±0.03)% among all arrays in the cell populations

      Dynamic range of 34 is much smaller than 400. It is interesting to understand what causes this.

    1. Dr Samiran Panda, a scientist at the Indian Council of Medical Research (ICMR), told The Wire Science earlier this week that the “mode” is effectively a single-arm clinical trial that wouldn’t have have a placebo and whose results wouldn’t be published in peer-reviewed journals – but with everything else being the same.

      Single arm clinical trials - good reference here Evans, Scott R. "Clinical trial structures." Journal of experimental stroke & translational medicine 3.1 (2010): 8.

    1. Key points from explainer video - Soil biodiversity conservation Youtube

      1. Need to be able to see the soil biodiversity (microscopic) - visuals
        • to get people excited
      2. Need data to figure out where this needs conservation
      • Above ground biodiversity is not correlated with below ground (!)
      • Need to harmonize protocols to collect this across the world
      • Along with biodiversity, we should measure function - how the biodiversity affects ecosystem functions
    1. This variant presents 14 non-synonymous mutations, 6 synonymous mutations and 3 deletions. The multiple mutations present in the viral RNA encoding for the spike protein (S) are of most concern, such as the deletion Δ69-70, deletion Δ144, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H