2,401 Matching Annotations
  1. Apr 2023
    1. Assuming each sequence in our downloaded database represented a unique species

      is the database poor in species resolution? SILVA ssu 99 seems to have good species level annotations

    1. the antagonistic symbiotic relationship between the wasps and their insect hosts allowed the wasp larvae to acquire insect pathogens that subsequently evolved to benefit the wasp

      due to close phylogenetic distance between wasp and the host insect?

    1. Earn 75,000 bonus miles when you spend $4,000 on purchases in the first 3 months from account opening, equal to $750 in travel.

      Sign up before major travel (2,000 $ for 2 people is reasonable in 3 months)

  2. Mar 2023
    1. optical signals are often difficult to detect in situ5,6,7,8

      electrical signals easier because the electrical sensors can be miniaturized better?

    1. Some people argue that the Welch’s t-test should be the default choice for comparing the means of two independent groups since it performs better than the Student’s t-test when sample sizes and variances are unequal between groups, and it gives identical results when sample sizes are variances are equal. In practice, when you are comparing the means of two groups it’s unlikely that the standard deviations for each group will be identical. This makes it a good idea to just always use Welch’s t-test, so that you don’t have to make any assumptions about equal variances.
    1. In practice, a data set with a sufficient number of replicates forms an approximately normal distribution

      you mean that the <average> of the dataset is normally distributed?

    1. This system can efficiently create genome modifications in multiple phages without the need for counterselection

      This implies 100% efficiency? but you are seeing 99% efficiency of single base substitutions only..

      Does this claim make sense?

    1. Noteworthy for its longstanding influence is thebook “Nonparametric statistics for the behavioralsciences” by Siege

      Highly cited book from 1956!

      Siegel (1956) pointed out that traditional parametric tests should not be used with extremely small samples, because these tests have several strong assumptions underlying their use. The t-test requires that observations are drawn from a normally distributed population and the two-sample t-test requires that the two populations have the same variance. According to Siegel (1956), these assumptions cannot be tested when the sample size is small. Siegel (1957) stated that “if samples as small as 6 are used, there is no alternative to using a nonparametric statistical test unless the nature of the population distribution is known exactly” (p. 18).

    1. Wash the culture in fresh LB before adding glycerol, to avoid problems with reviving the culture later

      To prepare V. natriegens cells for −80 °C storage, an overnight culture of V. natriegens was washed in fresh medium before storage in glycerol. Cultures were centrifuged for 1 min at 20,000g and the supernatant was removed. The cell pellet was resuspended in fresh LB3 medium and glycerol was added to 20% final concentration. The stock was quickly vortexed and stored at −80 °C. Bacterial glycerol stocks stored in this manner are viable for at least five years.

      source: Lee, Henry H., et al. "Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi." Nature microbiology 4.7 (2019): 1105-1113.

    1. conjugative plasmids have broad-host ranges23, are resistant to restriction-modification systems24, are easy to engineer with large coding capacities25, and do not require a cellular receptor26 that would provide a facile mechanism for bacterial resistance.
    1. Recently, redox-responsive biomolecules such as phenazines have been used in several electrochemical strategies to interrogate a range of biological activities30,31 and to control gene expression in living cells32,33, where the redox status of the biomolecules could be measured or manipulated by application of electronic potentials
    1. There are two main reasons to use logarithmic scales in charts and graphs.
      • respond to skewness towards large values / outliers by spreading out the data.
      • show multiplicative factors rather than additive (ex: b is twice that of a).

        The data values are spread out better with the logarithmic scale. This is what I mean by responding to skewness of large values.

      In Figure 2 the difference is multiplicative. Since 27 = 26 times 2, we see that the revenues for Ford Motor are about double those for Boeing. This is what I mean by saying that we use logarithmic scales to show multiplicative factors

    2. One reason for choosing a dot plot rather than a bar chart is that it is less cluttered. We will be learning other benefits of dot plots in this and future posts.
      • Length of bar/line has no meaning in a log-scale

        A dot plot is judged by its position along an axis; in this case, the horizontal or x axis. A bar chart is judged by the length of the bar. I don’t like using lengths with logarithmic scales. That is a second reason that I prefer dot plots over bar charts for these data.

    1. 1000 cells per sample were sorted into microwells by flow cytometry, heat treated to extract DNA, and used as template for a duplex ddPCR reaction

      What is the use for sorting 10,000 cells in this experiment to get avg copies? Can't you directly use diluted cultures?

      Also the cysG copies in fig 4b is ~ <100, which is 5x lower than expected, how do you explain that?

      with a 10,000 cell count/20 ul ddPCR reaction, you would expect 500 copies/ul assuming a single chromosome per cell

    1. The genre kicked off with “Maps of Time” (2004), by David Christian, and includes such practitioners as Mr. Harari, Steven Pinker, Jared Diamond and Francis Fukuyama.

      Books similar to "Guns, Germs and Steel"

    1. Notes Using some machine learning to identify plasmids and viruses - I’m curious what signatures of plasmids are being identified

  3. Feb 2023
    1. Ramsay, J. P. & Firth, N. Diverse mobilization strategies facilitate transfer of non-conjugative mobile genetic elements. Curr. Opin. Microbiol. 38, 1–9 (2017)

      Read this - to figure out, how often do plasmids with OriT but no relaxase occur?

      Context :

      Further, numerous small plasmids do not encode for relaxases and undergo transfer by exploiting the relaxosome of other conjugative elements in trans85,6

    2. A cryptic rolling-circle plasmid from a commensal Escherichia coli has two inversely oriented oriTs and is mobilised by a B/O plasmid

      context:

      Further, numerous small plasmids do not encode for relaxases and undergo transfer by exploiting the relaxosome of other conjugative elements in trans85,6

    1. glyphosate (the most common pesticide used globally) inhibits growth of bacteria

      from the cited source's abstract :

      Glyphosate inhibits aromatic amino acid biosynthesis (shikimate pathway), and is toxic to beneficial gut bacteria in cattle and chickens. Effects of glyphosate on gut bacteria in marine herbivorous turtles were assessed in vitro.

    2. Studying the effects of temperature—along with other climate change-induced environmental disruptions

      It's quite complicated. How can we make the case for homeostasis/ super effects by intersection of multiple climate change effects

    1. docked to theactive site of the glycosyltransferase enzyme by usingAutodock software

      How will you get the list of glycosyltransferases?

    2. However, its hightoxicity restricts its use in the pharmaceutical field

      Need to mention clinical applications are limited due to in-vivo toxicity

    3. Glycosyltransferaseenzymes catalyse the glycosylation reactions, which leads to a decreasein the toxicity of celastrol.

      Is this already known? Then what's new about the proposal? is it the in-vivo biotransformation?

    1. E. coli BL21(DE3) strain was preferred forthe production of recombinant protein inthis study, thanks to all these properties andits well-known knowledge

      very vague. needs a better statement for the choice of BL21 strain

    2. This molecule,unlike other VOCs, originated only from lung cancer cells. It has been found that theHeneicosane molecule works in nature as a pheromone of some species.

      what is common between lung cancer and mosquito pheromone?

    1. Bart Smet's group has a paper that gives the opposite conclusion reg the R vs K strategists. Would be interesting to read this in parallel and comment. Is this Smets et al., 1993 cited here?

    2. A vector with the mScarlet-I protein construct under the nptII promoter from

      How strong is this promoter? Would there be a strong selection for breaking the plasmid -- especially in faster growing r stragetegists.

      From the cited paper, it seems like a strong promoter -

      The expression of the fluorescence protein genes is driven by the nptII promoter of the neomycin phosphotransferase gene (i.e., kanamycin resistance gene). The nptII promoter is considered constitutive, strong and was previously used to drive fluorescent protein expression from chromosomal insertions (Ledermann et al., 2015; Ramirez-Mata et al., 2018).

    3. conjugation of the TOL plasmid was found to increase with the specific growth rate of both the donor and recipient (Smets et al., 1993, Seoane et al., 2010). This suggests a relationship of faster-growing bacteria (r-strategists) being able to transfer and receive degradative plasmids better than the slower-growing K-strategists

      This could also do with the numbers of bacteria and nothing to do with the r vs K strategies right?

      How does this reconcile with the conclusion from this paper (check discussion)

      showed conjugation preferences towards a slow-growing ecological growth strategy, except when NAH7 was in a mixed synthetic community

    4. For each culture, a total of 106 cells were added. Naphthalene was added to the NAH7 conjugation cultures by adding naphthalene crystals to the CBM medium which ensured the medium was continually saturated with naphthalene

      liquid conjugation

    5. All data were analyzed using RStudio, version 1.4.1103. Experimental replicates for all data were averaged and reported with standard error.

      You make me sad. R makes it so easy to plot all the replicates. Why did you hide your data under the cloak of standard deviations?!

    6. To quantify conjugation via fluorescence-activated cell sorting (FACS), genes encoding constitutive fluorescence of mScarlet-I were inserted onto the NAH7 and pNL1 plasmids.

      Aha, using a brighter protein. Did they mention the reason for red vs typically used green fluorescence?

    7. these transfer regimens were evident for not only the donor transferring the plasmid, but also the recipient receiving it (Sysoeva et al., 2019).

      Would be nice to conceptualize an elaborate experiment where donors (later recipients) are harvested at every 30 min and conjugated in throughput for defined amount of times with recipients fixed at a certain growth phase.. will make a matrix maybe?

    8. Historically, bacterial evolution has favored two general ecological growth strategies: high reproduction rate (r-strategists or copiotrophs) or optimal resource utilization (K-strategists or oligotrophs)(Atlas and Bartha, 1997)

      Has evolution favoured these or is this an artifact of our categorization in extremes/ the parameters we are looking at? If you look at another dimension you could get more categories maybe?

    1. confirmed to participate in protein remineralization in sediments

      Remineralization = breakdown or transformation of organic matter (those molecules derived from a biological source) into its simplest inorganic forms Source : Wikipedia

    2. Abundance and diversity of archaea in coastal ecosystems

      I like the % comparison of these abundance estimates to total prokaryotes!

    3. Archaea mediate four major processes that strongly impact the coastal blue carbon ecosystems, namely, CO2 fixation, organic biopolymer transformation, CH4 production, and CH4 oxidation

      Would be helpful to add if these are exclusive to archaea or mostly done by archaea?

    1. We found a hierarchy of avoidance, with plasmid genes avoiding 6-bp palindromes significantly more on average than core and non-core chromosomal genes

      Why distinguish core and non core? double stranded breaks anywhere in the genome kill the cells right?

    2. For the most common target length (6 bp) we show that target avoidance is strongly correlated with the taxonomic distribution of R-M systems and is greater in plasmid genes

      Is this any 6 bp palindrome or a specific sequence that is known for the specific R-M system under question?

      • How do you know if this site would be methylated (hence protected) or not just by looking for this in genomes?
      • For example, a broad host plasmid just entering a new host might be more inclined to keep low on palindromes compared to a plasmid that's mostly localized right?
      • Is there any way to correlate palindrome signal to presence of OriT in plasmids?
    3. As an initial proxy for restriction targets, we first analysed the avoidance of short palindromes in each pangenome component for k=4 and k=6

      Why did you skip 8? Because it's too rare?

    4. This addictive quality may contribute to their occasional occurrence on MGEs such as plasmids: around 10.5% of plasmids carry R-M systems (Oliveira, Touchon, and Rocha 2014) and experiments have shown R-M system carriage can lead to increased plasmid stability in cells

      Interesting, I wonder if increased stability is only due to the restriction of something else? - How was this stability measured?

    1. We report that the EcoRI restriction endonuclease-modification methylase (rm) gene pair stabilizes plasmids that carry it
      • How was this stability measured?
  4. Jan 2023
    1. Artificial proteins fine-tuned to five distinct lysozyme families showed similar catalytic efficiencies as natural lysozymes, with sequence identity to natural proteins as low as 31.4%. ProGen is readily adapted to diverse

      why should I use ProGen to get the same activity as natural?

      The abstract should highlight the point that multiple properties can be simultaneously optimized.

      the company website does some good marketing of this - https://www.profluent.bio/technology

    1. requires experiments that alter climate in combination with manipulations of microbial communities.

      community manipulation needs to be methodical with changing whole consortia, not just single microbe studies

    2. While measurements at each scale do exist for plant-associated microbes, integration across scales is missing for any single system

      Needs mechanistic information

    1. Data that combine multiplicatively, like rates, are actually very common outside of economics too. The key is to recognize when a measured variables is affected by many (semi) independent forces, each of which scales that variable up or down — rather than simply adding or subtracting a fixed amount to it. This is often true in the natural sciences.
    1. Increases in solar radiation, temperature and freshwater inputs to surface waters strengthen ocean stratification and consequently reduce transport of nutrients from deep water to surface waters, which reduces primary productivity

      There are many interconnected variables affecting the process. It is really complex.

      Hence it makes it all the more difficult to communicate to common public in clear unambiguous terms

    1. received 3-CA every day (press-disturbed), every 2, 3, 4, 5, 6, or 7 days (intermediately-disturbed), or never (undisturbed)

      What was the concentration of 3-CA received?

    2. as assessed by 16S rRNA gene terminal restriction fragment length polymorphism (T-RFLP)

      why do RFLP? Does this have any more information than 16S sequence based metagenomics?

    3. Non-metric multidimensional scaling (NMDS, unconstrained ordination) shows temporal dispersion effect

      why a different ordination for time?

    4. 3-CA,41 which is also known to inhibit both organic carbon removal and nitrification in sludge reactors

      So is the efficiency of certain processes that go down inspite of higher diversity because of the 3-CA directly? If so changing to a different disturbance might answer this question?

    5. To investigate their roles, well-replicated time series experiments are needed.

      These experiments are required, but are they enough to understand the driving forces though?

    6. need to understand what governs the relative balance between stochastic and deterministic processes

      How does your study help understanding the drivers of sochata processes?

    1. In a deposition, an engineer at Tesla made this all but explicit: “We want to let the customer know that, No. 1, you should have confidence in your vehicle: Everything is working just as it should. And, secondly, the reason for your accident or reason for your incident always falls back on you.”

      That sounds very much like a religion. Or could also be a statement from an authoritarian leader. Confidence has to be earned, not simply gotten by asking

    1. although the ocean and rainforest seem to be two different extremes of dissimilar environments, surf and turf have several similarities. One similarity that is present in both environments, yet seems counterintuitive is the fact both a reef and a rainforest are essentially nutrient desserts. Both ocean water and forest soil contain low levels of biologically relevant nutrients, and as a result, organisms have developed creative and sometimes symbiotic/mutualistic strategies to thrive in these nutrient-poor environments.

      Interesting point that there is a regime of low nutrients which enables higher diversity. I'll look for some references! Here's a Minute Earth video explaining this very well - https://youtu.be/mWVATekt4ZA

    1. Each flowerpot was filled with soil-bacteria pellets from about 4L of culture, which corresponds to about 20 g (dry weight) of soil

      Way too much cells for soil right?

    1. When running on Windows using Git Bash and Anaconda, the previous code will not work. Multiline strings containing multiple shell commands are not executed correctly. The simplest workaround is to add &&\ to the end of all lines except the last inside the multiline shell command:
    1. We need to add wordcount.py as a dependency of each of our data files so that the rules will be executed if the script changes

      would be interesting if this worked even for updating a .yaml config file. But I wonder how the snakemake would know where to start running the pipeline from ; and since the whole workflow is dependent on the config file, re-running the whole thing defeats the purpose of snakemake

  5. www.plasmidsaurus.com www.plasmidsaurus.com
    1. Before sequencing your plasmids, we linearize them so that we get mostly full-length sequence reads

      How is this linearized in a sequence independent manner?

    2. If the pipeline does not produce a consensus for your target, you can download the raw reads from your dashboard and bin them yourself, but please note that raw reads are much more noisy and error-prone (~98.3% accurate) than consensus reads.

      Look for binning tools - Example - LRBinner = reference free binning approach for nanopore. Ref : Wickramarachchi, Anuradha, and Yu Lin. "Binning long reads in metagenomics datasets using composition and coverage information." Algorithms for Molecular Biology 17.1 (2022): 1-15. bmc 202

    1. For each of the libraries, we screened for the presence of all possible STMs used in a given experiment, with the requirement that all spike-ins for a given STM needed to be present

      Looks like you are looking for exact matches of the STM sequences or rather the STM identifier/id only, using R. - Is there a neat/quick way of doing this using BLAST or any mapping tool allowing for some errors in the sequence?

  6. Dec 2022
    1. The advantage of merging these paired-end reads later is that the quality can be improved (if overlapping bases are the same in both reads, there is a higher likelihood that the correct base was called) so there is no need for trimming here.

      But won't the reads where the bases don't match just be discarded? When the quality deterioration is particularly bad, wouldn't trimming retain more reads overall? And since the merging will anyway retain these bases in either read, there isn't any sequence information lost either.

      Is this incorrect?

    1. In the absence of inducer, basal activity of these EilR-regulated promoters fell below that of the three routinely used inducible systems PBAD, Ptet, and Ptrc
      • does the Ptet also have a palindromic sequence that is optimized?
      • Was Ptet a part of the Marionette collection of sensors optimized by directed evolution?
    1. We estimated read counts for eachisolate by assigning trimmed and merged reads that perfectly matched a known isolate 16S rRNAV4-V5 sequence to that isolate. Reads that did not match a known isolate were discarded.

      Since a mapping tool is not mentioned, is this done using string match in R or something?

    1. that if mutations are sufficiently abundant (for instance, if they are generated at an early PCR cycle), they might still give rise to a spurious OTU.

      DADA2

  7. Nov 2022
    1. With this simple realization, a number of groups have realized that HTS datasets are actually count-compositions

      have dramatically different statistical properties than do counts

    1. the box plot of ANCOM-BC had the shortest width, suggesting that it not only successfully estimates the true sampling fractions and eliminates bias due to its variability, but it also has the smallest variance which is not the case with other methods.

      The microbial absolute abundances in the ecosystem are generated from the log-normal distribution

      Is the log-normal model used to simulate the data particularly favorable to the linear regression method of ANCOM-BC?

    1. According to an extensive simulation study1, among the available methods for DA analysis, only ANCOM performs well in controlling FDR while maintaining high power, as long as the sample size is not too small

      How small is too small?

    1. green fluorescent protein containing a degradation tag (GFPmut3_LAA)

      BLAST matches the GFPmut3 sequence in rGFP and fGFP to this - so the Voigt lab authors cloned this with the partial degron tag without the LAA amino acids for this paper :

      Yang, Lei, et al. "Permanent genetic memory with> 1-byte capacity." Nature methods 11.12 (2014): 1261-1266.

    1. Consequently, amplicons produced with these primers were removed leaving amplicons corresponding to eight variable regions (V1, V2, V3, V4, V5, V6, V7, and V8) for the MVRSION method.

      7 out of 14 primer pairs were discarded but they are still able to cover V1-V8 variable regions

    1. DMSO has been successfully used to improve the performance of RT-PCR [10] and SangerSequencing [11].

      reference 10 only talks about PCR and not RT-PCR. I'm interested in the effect of DMSO on RT.

      This paper shows that 6% DMSO is optimal for RT-PCR with recombinant Thermus thermophilus DNA pol (rTth): Sidhu, Maninder K., Mei-June Liao, and Abbas Rashidbaigi. "Dimethyl sulfoxide improves RNA amplification." Biotechniques 21.1 (1996): 44-47.

      Biotechniques, 1996

  8. www.plasmidsaurus.com www.plasmidsaurus.com
    1. This consensus .fastq file will be delivered with your standard sequencing results, whereas the .fastq file for the raw read data must be requested during order submission (as above) and will be delivered via a separate raw data link.

      Note: consensus .fastq file has only 1 read (which is the consensus read)

    1. As such we believe that it was important to test these methods on a wide range of different real-world datasets in order to gain an understanding of how they differed from one another

      But I see it very hard to generalize your conclusions from the real world dataset based analysis in this paper. So there are tradeoffs with either method of validation

    1. If every number between 0 and 1 had equal probability of being chosen, method 2 would be a valid hypothesis test—but not a good one.

      Interesting. How would it be a valid hypothesis test? I guess I'll have to see what's a hypothesis test?

    1. The advantages of using SSU rRNA for community fingerprinting are many: (i) This gene is found in all cellular life forms. (ii) It is a highly conserved gene, serving to a large degree as a reliable molecular chronometer. (iii) It is seldom transferred horizontally. (iv) It possesses both conserved and variable regions, so that the conserved regions can be targeted by polymerase chain reaction (PCR) primers and the variable ones be used as identifying markers. A handful of other genes, such as the large subunit (LSU) rRNA share these properties, but the length of ~1,500 bp of the bacterial SSU rRNA made it amenable to early molecular techniques, and the impressive body of knowledge that has since accumulated on the basis of this gene makes a switch to other markers very impractical, except in certain sub-fields such as mycology, where ITS and LSU are widely used.

      very crisp summary

    Tags

    Annotators

    1. Actions=Editor

      causes error

      **-thinkpad:/usr/share/applications$ desktop-file-validate obsidian.desktop obsidian.desktop: error: action "Editor" is defined, but there is no matching "Desktop Action Editor" group

    2. Path/to/AppImage

      the root folder ~ is /home/*username* so you would write the path like this /home/prashant/Downloads/setup_files/Obsidian-1.0.0.AppImage

  9. Oct 2022
    1. the majority of chimeras are believed to arise from incomplete extension. During subsequent cycles of PCR, a partially extended strand can bind to a template derived from a different but similar sequence. This then acts as a primer that is extended to form a chimeric sequence
    1. Rahul Gandhi’s comparison is great fodder for intellectual debate, but it is not good politics. When the country is in ‘wartime’, the adornments of peace do not sit very well. This comparison is a peacetime jewel. In a war zone, only the cannons, pistols and swords do well.

      very crisp summary

    1. To perform bacterial genome assembly, we suggest using the third-party de novo assembly tool Flye3. This analysis package represents a complete pipeline, taking raw nanopore reads as input, and producing polished contigs as output. We also recommend one round of polishing with Medaka4. These tools can be found on GitHub
    1. droplet digital PCR for simultaneous detection of plasmid and genomic DNA in sorted cells

      did they shear or digest their genomic DNA to improve ddPCR detection (as recommended by biorad protocol?)

    2. For each of these two subpopulations, 1000 cells were sorted

      find out how these 1,000 cells were lysed after sorting - could there be any loss during pelleting to concentrate the cells?

    1. Additionally, make sure to use both forward and side scatter on log scale when measuring microparticles or microbiological samples like bacteria. These types of particles generate dim scatter signals that are close to the cytometer’s noise, so it’s often necessary to visualize signal on a log scale in order to separate the signal from scatter noise.
    1. By introducing rationally selected combinations of folding-enhancing mutations into GFP templates and screening for brightness and expression rate in human cells, we developed mGreenLantern, a fluorescent protein having up to sixfold greater brightness in cells than EGFP
  10. Sep 2022
    1. But Poisson statisticspredicts that there will be some empty droplets (1,642 empty droplets) and gives a preciserelationship between the average number of copies/droplet and the expected fraction ofempty droplets.

      @Esther?

  11. Aug 2022
    1. Note that for creating perfect PDF files for printing, it’s better to turn to a dedicated desktop publishing software such as Scribus, which can also import SVG files.

      why?

    1. 3 uL diluted ROX per 20 uL reaction

      for undiluted ROX : 1.5ul/1ml master mix -- add this once per aliquot and label in as ROX added

      2.25 ul / 1.5 ml master mix

    1. Avoid the use of spectral schemes to represent sequential data because the spectral order of visible light carries no inherent magnitude message. Readers do not automatically perceive violet as greater than red even though the two colors occupy opposite ends of the color spectrum. Rainbow color schemes are therefore not appropriate if the data to be mapped or graphed represent a distribution of values ranging from low to high
  12. Jul 2022
    1. A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase.

      The engineered WarmStart Luna Reverse Transcriptase also possesses higher thermostability than many other RTs, allowing an optimal reaction temperature of 55°C. For difficult targets/templates, higher RT step temperatures of up to 60°C can be used without compromising Luna performance. Luna one step RT-qPCR kit E3005 manual

  13. Jun 2022
    1. across() is very useful within summarise() and mutate(), but it’s hard to use it with filter() because it is not clear how the results would be combined into one logical vector. So to fill the gap, we’re introducing two new functions if_all() and if_any().
    1. Donor and recipients cells were mixed 1:1 (vol/vol, 0.1 to 1 ml), pelleted (2,000g for 10 min), resuspended in 10–100 µl LB + 300 µM DAP, pipetted onto a LB + 300 µM DAP plate and incubated at 37 °C for 2 h

      conjugation with DAP

  14. May 2022
    1. This class serves the same purpose as the flowFrame class from the flowCore package: to storequantitative data on cell populations from a single FCS run. The primary difference is in the un-derlying representation of the data. While flowFrame objects store the underlying data matrix inthe exprs slot as an R object, cytoframe objects store the matrix (as well as the data from theother slots) in a C data structure that is accessed through an external pointer. This allows for greateroptimization of data operations including I/O, parsing, transformation, and gating.
    1. The original or engineered proteins used in the R6, R7, R7.3, R10 and R10.3 nanopores have not been disclosed by the company to date

      trade secret

    1. One such behavioral trait is seeing all non-human animals as commodities, believing they have been “put on this planet for us to consume”

      This could be extended even to plants

    1. Autofluorescence was not subtracted from these populations.

      why? Is it mathematically sound to combine the autofluorescence histograms and subtract the mode/median etc. from the rest of the populations?

    1. We visualized population-level cellular fluorescence using frequency distributions and violin plots.

      How are replicates handled in these plots?

      Appendix S5 says

      All violins represent data combined from experiments on three separate days except for the max and DAPG sensor violins, where only one replicate was measured.

    1. For background information on how tiling amplicon sequencing works, please prefer to the original “PrimalSeq” protocol paper as tested on Zika Quick et al. Nature Protocols and a follow-up paper Grubaugh, Gangavaparu et al. Genome Biology that focuses on in-host variation and Illumina sequencing.
    1. Indira Gandhi’s image as someone who cared for the poor was seriously dented.

      How then did she manage to win again in 1980? This question always seems to puzzle me about our electorate during that time

    1. A "negative lookahead assertion" can be used to remove from consideration any apostrophes, before they are even tested for being punctuation characters. gsub("(?!')[[:punct:]]", "", str2, perl=TRUE)

      How does this work? From my knowledge, negative lookahead assertion is used in this format lookfor(?!x) Source: Regex cheat sheet

    1. Substitution of SuperScript IV for LunaScript RT SuperMix and reaction volume reduced to 10 uL.

      Why was this substituted? - Could be lower cost : Superscript (350$/25 rxn) vs Lunascript (250$/50 rxn)

    1. As you can see, the theme author has included a .Site.Params variable called commentsrepo

      figure out how to do this for themes that don't have it

    1. a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.

      Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?

  15. Apr 2022
    1. Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).

      The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way

    1. while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources

      ROX increases precision of technical replicates (which we don't do much of in our lab)

    2. ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges

      ROX helps normalize these variations

    1. Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).

      This is an interesting argument as to what individual users can do to keep Firefox alive. But the biggest dent on anti-competitive behavior should come from well enforced proper anti-trust regulations the way Europe is doing it. How can browser users contribute to this?

  16. Mar 2022
    1. For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.
    1. no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.

      Sounds like most probe qPCR reactions right? I assume this is in the raw data before baseline subtraction

    2. Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)

      Why sample id? Isn't target and sample type not enough?

    1. a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (

      KanR here is a aminoglycoside nucleotidyltransferase (aadD1), uniprot = P05057 from Staph aureus. This is different from the usual phosphotransferase aphA1/3 used in e.coli

  17. Feb 2022
    1. When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases

      Does this mean that probe-based data without plateau phase cannot be analyzed effectively?

    2. For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample

      For clinical samples where each sample is expected to have a different inhibitor load hence different efficiency

    1. One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package

      The $AsXML exported .rdml file is not valid in RDML-ninja.

      Error message : No rdml_data.xml in compressed RDML file found.

      How to fix this?

  18. Jan 2022
    1. The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.

      using qpcR package for analysis

    1. Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.

      Using qpcR package for qPCR data analysis..

    1. Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1

      I wonder why this fit information was not used for quantification as well?