The existence of objective reality, for example,which CSJ denies
I strongly feel that you are putting words into poor CSJ's mouth but I don't know enough about it to elaborate.
The existence of objective reality, for example,which CSJ denies
I strongly feel that you are putting words into poor CSJ's mouth but I don't know enough about it to elaborate.
Again, though, the identity or positionality of the mentor is irrelevant tothe evaluation of merit when using these sorts of quantitative metrics.
In the real world, the personality of the mentor matters a lot to the success of their trainees. And this effect would be a lot more prominent if the evaluation of "merit" would be truely objective and blind to the stellar scientific accomplishments of their mentors - which arguably should have nothing to do with the mentees according to this statement of yours
But the value of just counting, however imperfect, should be obvious
No. You are comparing just counting to not at all counting as if there was nothing in the middle
The first isthat their rejection of objectivity undermines their credibility. If there is no objectivity, thentheir claims are not objectively true.
this is a straw man scratching their head and sneezing some words..
These perspectives often view science as a tool of power, are hostile to the centralliberal principle of free inquiry and open discussion, and are closed to calls to justify theirclaims on scientific grounds
Can both not be possible? Science is liberal and free inquiry and open discussion among the participants and wields power over the non-participants whom it excludes from participation by flawed definitions of "merit"
These core principles, which have served us well for centuries, are under attack byideologies originating in postmodernism and Critical Theory,6,10,14 versions of which rejectobjective reality in favor of “multiple narratives” promulgated by different identity groupsand “alternative ways of knowing.”
This is a straw-man argument. This is only a small part of a few versions (your words) of critical theory, so cannot be used to discredit the whole thing
Because objectivetruth exists, ultimate consensus among truthseeking actors—scientists—is possible.
The existence of 'objective truth' means nothing if there are no seekers for it among the scientific community.
we offer a liberal, humanisticalternative that is compatible with maximizing scientific advances.
I don't see your humanistic alternative; Will read the last part again to make sure
Thestatuses, identities, and demographics of scientists are irrelevant to this great sifting ofvalid versus invalid ideas.
This is completely untrue. The scientific method is definitely objective but the scientific enteririse is driven by people and incorporates their identities and biases in the kind of questions they even ask. For example, women scientists entering newly in certain fields have started asking questions that haven't been touched so far. For example, they have incorporated the unseen elements of unpaid domestic work in the household as essential elements in macroeconomic thinking.
Fulfilling this responsibility, however, is being hindered by a new, alarming clashbetween liberal epistemology and identitybased ideologies.
I would love to see evidence for this statement. How exactly is the "objective" pursuit of truth being hindered by social justice and diversity objectives?
How did we get here? Science provided solutions to such calamities as famineand plague, transforming them “from incomprehensible and uncontrollable forces ofnature into manageable challenges.”
Completely agree. Still have to see how this relates to "merit"
guides(color=guide_legend(nrow=2, byrow=TRUE))
Don’t waste time and energy collecting metrics you’ll never be able to use. Learn as much as you can from the failures themselves, and then move on.
The conclusion is illogical and does not follow from the premises. You say that the metrics might not be informative unless there is a model they go with, and now you say to discard metrics altogether rather than have a model.
And you would also need some metrics collected when failures occur too in order to learn from them right?
Many people rush to collect data without first considering whether they can come up with a model powerful enough to interpret the data. I
This makes sense
Analysis of your incident data may shed light on your incidents. But incident data really can’t tell you anything about your reliability.
Aren't these two statements in contradiction?
the diversity of native plants and animals declined with the invasion of alien plants, communities and ecosystems were rarely negatively affected
Can't make this statement with certainty unless a suite of ecosystem functions were measured..
an alien species is invasive only if it threatens the native biodiversity of recipient ecosystems and negatively affects ecosystem functions, which could lead to detrimental socioeconomic impacts
needing to have socioeconomic impacts is very narrow minded eh? quite capitalism centric + anthropocentric
most known alien microorganisms are pathogens51, their impact is expected to be negative at all levels.
Is this a selection effect due to what is studied so far?
Negative effects are easier to see.. Are they prone to be higher magnitude too?
Several invasive microorganisms infect mainly native plants as their primary host
why?
transfer efficiencies between them were similar to those seen with parental partners (0.21)
that is quite high, is this T/D?
The resulting constructs (the pMATING series) could be self-transferred through a variety of prokaryotic and eukaryotic recipients employing such a rationally designed conjugal delivery device.
eukaryotic is quite surprising. how about gram positives?
Assuming each sequence in our downloaded database represented a unique species
is the database poor in species resolution? SILVA ssu 99 seems to have good species level annotations
the antagonistic symbiotic relationship between the wasps and their insect hosts allowed the wasp larvae to acquire insect pathogens that subsequently evolved to benefit the wasp
due to close phylogenetic distance between wasp and the host insect?
labs(fill='Legend Title')
command to change the title of the legend
Earn 75,000 bonus miles when you spend $4,000 on purchases in the first 3 months from account opening, equal to $750 in travel.
Sign up before major travel (2,000 $ for 2 people is reasonable in 3 months)
Bins used for plotting:
What does bins mean? in the sense of a histogram?
amperometric sensor was then modified to detect an endocrine disruptor.
which one? should have been in the abstract
optical signals are often difficult to detect in situ5,6,7,8
electrical signals easier because the electrical sensors can be miniaturized better?
Some people argue that the Welch’s t-test should be the default choice for comparing the means of two independent groups since it performs better than the Student’s t-test when sample sizes and variances are unequal between groups, and it gives identical results when sample sizes are variances are equal. In practice, when you are comparing the means of two groups it’s unlikely that the standard deviations for each group will be identical. This makes it a good idea to just always use Welch’s t-test, so that you don’t have to make any assumptions about equal variances.
Non-parametric tests don’t make as many assumptions about the data, and are useful when one or more of the common statistical assumptions are violated. However, the inferences they make aren’t as strong as with parametric tests.
In practice, a data set with a sufficient number of replicates forms an approximately normal distribution
you mean that the <average> of the dataset is normally distributed?
Transcription of the araBAD genes under control of the pBAD promoter is induced about 300-fold above a basal uninduced level within 3 s of the addition of arabinose to cells growing on glycerol in minimal salts medium
This system can efficiently create genome modifications in multiple phages without the need for counterselection
This implies 100% efficiency? but you are seeing 99% efficiency of single base substitutions only..
Does this claim make sense?
Nonparametric statistics are often preferred to parametric tests when the sample size is small and the data are skewed or contain outliers.
when to use parametric versus nonparametric tests [8,9,10]
Noteworthy for its longstanding influence is thebook “Nonparametric statistics for the behavioralsciences” by Siege
Highly cited book from 1956!
Siegel (1956) pointed out that traditional parametric tests should not be used with extremely small samples, because these tests have several strong assumptions underlying their use. The t-test requires that observations are drawn from a normally distributed population and the two-sample t-test requires that the two populations have the same variance. According to Siegel (1956), these assumptions cannot be tested when the sample size is small. Siegel (1957) stated that “if samples as small as 6 are used, there is no alternative to using a nonparametric statistical test unless the nature of the population distribution is known exactly” (p. 18).
Vmax has a low-level natural resistance to kanamycin but is more susceptible to other antibiotics. When selecting on Kan plates, Vmax with KanR will simply grow faster than Vmax without KanR. Larger colonies=KanR. Other antibiotics select against Vmax but must have a dosage change compared to E. coli.
Wash the culture in fresh LB before adding glycerol, to avoid problems with reviving the culture later
To prepare V. natriegens cells for −80 °C storage, an overnight culture of V. natriegens was washed in fresh medium before storage in glycerol. Cultures were centrifuged for 1 min at 20,000g and the supernatant was removed. The cell pellet was resuspended in fresh LB3 medium and glycerol was added to 20% final concentration. The stock was quickly vortexed and stored at −80 °C. Bacterial glycerol stocks stored in this manner are viable for at least five years.
source: Lee, Henry H., et al. "Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi." Nature microbiology 4.7 (2019): 1105-1113.
ecovery media (5 BHI + v2 + 68 mM Sucrose )
Four inducible promoters were found to function in V. natriegens
Lac, Pbad (arabinose), lambda promoter
Vmax@SGIDNA.com
Is the genotype of Vmax proprietary? I could not locate any references in the SGI website as well
To prepare V. natriegens cells for −80 °C storage, an overnight culture of V. natriegens was washed in fresh medium before storage in glycerol
For best results, use only LB-Miller agar plates. Do not use LB-Lennox or LB-Luriaplates (Vmax™ growth will be suboptimal).
Vibrio natriegens strain containing a major extracellular nuclease knockout and insertion of an IPTG-inducible T7 RNA polymerase cassette for expression of genes under a T7 promoter.
dns nuclease- (Gibson et al)
(a)colE1(b)SC101(c)RSF1010
we successfully demonstrated challenging clonings such as Gibson Assembly with 5 and Aquacloning with 3 fragments as well as 8 part golden-gate reactions.
all downstream manipulations with V. natriegens ATCC14048 Δdns cells were performed with antibiotic selection (kanamycin (200 μg/mL), chloramphenicol (2 μg/mL), carbenicillin (100 μg/mL))
A survey of 230 diverse bacterial and archaeal genomes found evidence of DNA methylation in 93% of genomes, with a diverse array of methylated motifs (834 distinct motifs; average of three motifs per organism)
conjugative plasmids have broad-host ranges23, are resistant to restriction-modification systems24, are easy to engineer with large coding capacities25, and do not require a cellular receptor26 that would provide a facile mechanism for bacterial resistance.
Bacterial cells are typically one thousandth the volume of mammalian cells, which places them near the edge of instrument detection. At this size it can be challenging to differentiate viable cells from debris of similar size
Detailed descriptions, assumptions, limitations and test cases of many popular statistical methods for ecological research can be found in the GUSTAME server (Buttigieg and Ramette, 2014), and in the review by Paliy and Shankar (2016).
condensing the information into two- or three-dimensional spaces. A very good overview of techniques to achieve this was written by Paliy and Shankar (2016).
There are several widely used tool collections, e.g., QIIME 2 [13], mothur [14], usearch [15], and vsearch [16], and 1-stop pipelines, e.g., LotuS [17], with new approaches continually being developed, e.g., OCToPUS [18] and PEMA [19]
Recently, redox-responsive biomolecules such as phenazines have been used in several electrochemical strategies to interrogate a range of biological activities30,31 and to control gene expression in living cells32,33, where the redox status of the biomolecules could be measured or manipulated by application of electronic potentials
There are two main reasons to use logarithmic scales in charts and graphs.
The data values are spread out better with the logarithmic scale. This is what I mean by responding to skewness of large values.
In Figure 2 the difference is multiplicative. Since 27 = 26 times 2, we see that the revenues for Ford Motor are about double those for Boeing. This is what I mean by saying that we use logarithmic scales to show multiplicative factors
One reason for choosing a dot plot rather than a bar chart is that it is less cluttered. We will be learning other benefits of dot plots in this and future posts.
A dot plot is judged by its position along an axis; in this case, the horizontal or x axis. A bar chart is judged by the length of the bar. I don’t like using lengths with logarithmic scales. That is a second reason that I prefer dot plots over bar charts for these data.
Using a logarithmic axes on a bar graph rarely make sense.
1000 cells per sample were sorted into microwells by flow cytometry, heat treated to extract DNA, and used as template for a duplex ddPCR reaction
What is the use for sorting 10,000 cells in this experiment to get avg copies? Can't you directly use diluted cultures?
Also the cysG copies in fig 4b is ~ <100, which is 5x lower than expected, how do you explain that?
with a 10,000 cell count/20 ul ddPCR reaction, you would expect 500 copies/ul assuming a single chromosome per cell
The genre kicked off with “Maps of Time” (2004), by David Christian, and includes such practitioners as Mr. Harari, Steven Pinker, Jared Diamond and Francis Fukuyama.
Books similar to "Guns, Germs and Steel"
geNomad uses marker information to demarcate provirus boundaries.
Can it also find boundaries of hybrid-transposon-plasmids?
Notes Using some machine learning to identify plasmids and viruses - I’m curious what signatures of plasmids are being identified
here's a trivial example of why the "standard" geometric mean is not a good estimate of central tendency when you have values near zero.
o improve accuracy, Sony hasintroduced the Weighted Least Square Method (WLSM) al-gorithm. In WLSM, the square value of residuals are individu-ally weighted
The weight is imposed so that theresiduals in bright channels are relatively under weightedcompared to dim channels
Impossible Foods, Zymergen, Pivot Bio, Novartis, and Calyxt
and for P. putida, Ap, Sill" Su, or Nal at 200 j.tg/ml, Cm at400 j.tg/ml, and Km or Tc at 25 j.tg/ml
Makes a minimal RP4 that is self transmissible
Ramsay, J. P. & Firth, N. Diverse mobilization strategies facilitate transfer of non-conjugative mobile genetic elements. Curr. Opin. Microbiol. 38, 1–9 (2017)
Read this - to figure out, how often do plasmids with OriT but no relaxase occur?
Context :
Further, numerous small plasmids do not encode for relaxases and undergo transfer by exploiting the relaxosome of other conjugative elements in trans85,6
A cryptic rolling-circle plasmid from a commensal Escherichia coli has two inversely oriented oriTs and is mobilised by a B/O plasmid
context:
Further, numerous small plasmids do not encode for relaxases and undergo transfer by exploiting the relaxosome of other conjugative elements in trans85,6
RIVET has been used as a promoter-trap method to identify bacterial and fungal genes induced during infection (6–8) and as a tool to analyze the spatiotemporal patterns of induction of such genes (9).
Package ‘flowWorkspace’
for a structured list of functions visit here - https://rglab.github.io/flowWorkspace/reference/index.html
rbind2(cytoset, cytoset)
Outputs a flowset ; so try this :
rbind2(fl1, fl2) %>% flowSet_to_cytoset()
taxa should be monophyletic
on a single branch?
glyphosate (the most common pesticide used globally) inhibits growth of bacteria
from the cited source's abstract :
Glyphosate inhibits aromatic amino acid biosynthesis (shikimate pathway), and is toxic to beneficial gut bacteria in cattle and chickens. Effects of glyphosate on gut bacteria in marine herbivorous turtles were assessed in vitro.
Studying the effects of temperature—along with other climate change-induced environmental disruptions
It's quite complicated. How can we make the case for homeostasis/ super effects by intersection of multiple climate change effects
thepotential "glycosyl transferase" enzymes thathave been chose
how many candidate enzymes and how did you choose them?
docked to theactive site of the glycosyltransferase enzyme by usingAutodock software
How will you get the list of glycosyltransferases?
However, its hightoxicity restricts its use in the pharmaceutical field
Need to mention clinical applications are limited due to in-vivo toxicity
Glycosyltransferaseenzymes catalyse the glycosylation reactions, which leads to a decreasein the toxicity of celastrol.
Is this already known? Then what's new about the proposal? is it the in-vivo biotransformation?
E. coli BL21(DE3) strain was preferred forthe production of recombinant protein inthis study, thanks to all these properties andits well-known knowledge
very vague. needs a better statement for the choice of BL21 strain
This molecule,unlike other VOCs, originated only from lung cancer cells. It has been found that theHeneicosane molecule works in nature as a pheromone of some species.
what is common between lung cancer and mosquito pheromone?
Celastrol is one of the most important triterpenoid molecules used in ancient times in China
for what?
Bart Smet's group has a paper that gives the opposite conclusion reg the R vs K strategists. Would be interesting to read this in parallel and comment. Is this Smets et al., 1993 cited here?
A vector with the mScarlet-I protein construct under the nptII promoter from
How strong is this promoter? Would there be a strong selection for breaking the plasmid -- especially in faster growing r stragetegists.
From the cited paper, it seems like a strong promoter -
The expression of the fluorescence protein genes is driven by the nptII promoter of the neomycin phosphotransferase gene (i.e., kanamycin resistance gene). The nptII promoter is considered constitutive, strong and was previously used to drive fluorescent protein expression from chromosomal insertions (Ledermann et al., 2015; Ramirez-Mata et al., 2018).
conjugation of the TOL plasmid was found to increase with the specific growth rate of both the donor and recipient (Smets et al., 1993, Seoane et al., 2010). This suggests a relationship of faster-growing bacteria (r-strategists) being able to transfer and receive degradative plasmids better than the slower-growing K-strategists
This could also do with the numbers of bacteria and nothing to do with the r vs K strategies right?
How does this reconcile with the conclusion from this paper (check discussion)
showed conjugation preferences towards a slow-growing ecological growth strategy, except when NAH7 was in a mixed synthetic community
For each culture, a total of 106 cells were added. Naphthalene was added to the NAH7 conjugation cultures by adding naphthalene crystals to the CBM medium which ensured the medium was continually saturated with naphthalene
liquid conjugation
Novosphingobium aromaticivorans F199donor harboring pNL1; 16S copy number: 3
Interesting choice of donor. Why?
All data were analyzed using RStudio, version 1.4.1103. Experimental replicates for all data were averaged and reported with standard error.
You make me sad. R makes it so easy to plot all the replicates. Why did you hide your data under the cloak of standard deviations?!
Bars are colored by whether naphthalene was added and at which hour the sample was taken.
No legend for the blue colours :(
To quantify conjugation via fluorescence-activated cell sorting (FACS), genes encoding constitutive fluorescence of mScarlet-I were inserted onto the NAH7 and pNL1 plasmids.
Aha, using a brighter protein. Did they mention the reason for red vs typically used green fluorescence?
these transfer regimens were evident for not only the donor transferring the plasmid, but also the recipient receiving it (Sysoeva et al., 2019).
Would be nice to conceptualize an elaborate experiment where donors (later recipients) are harvested at every 30 min and conjugated in throughput for defined amount of times with recipients fixed at a certain growth phase.. will make a matrix maybe?
Historically, bacterial evolution has favored two general ecological growth strategies: high reproduction rate (r-strategists or copiotrophs) or optimal resource utilization (K-strategists or oligotrophs)(Atlas and Bartha, 1997)
Has evolution favoured these or is this an artifact of our categorization in extremes/ the parameters we are looking at? If you look at another dimension you could get more categories maybe?
environmentally-friendly
how?
Care should be taken to avoid severe ecological disturbance when introducing an alien species.
unintended consequences
confirmed to participate in protein remineralization in sediments
Remineralization = breakdown or transformation of organic matter (those molecules derived from a biological source) into its simplest inorganic forms Source : Wikipedia
Abundance and diversity of archaea in coastal ecosystems
I like the % comparison of these abundance estimates to total prokaryotes!
Archaea mediate four major processes that strongly impact the coastal blue carbon ecosystems, namely, CO2 fixation, organic biopolymer transformation, CH4 production, and CH4 oxidation
Would be helpful to add if these are exclusive to archaea or mostly done by archaea?
That's greater than taking all the humans who lived throughout time, multiplied by the number of grains of sand on Earth, multiplied by the number of atoms in the universe.
Wow, this is an excellent statement to help people imagine large numbers
Digestion is recommended whenever DNA input is greater than 75 ng
we show that they have shaped the evolution and host range of plasmids
that's quite a stretch
We found a hierarchy of avoidance, with plasmid genes avoiding 6-bp palindromes significantly more on average than core and non-core chromosomal genes
Why distinguish core and non core? double stranded breaks anywhere in the genome kill the cells right?
For the most common target length (6 bp) we show that target avoidance is strongly correlated with the taxonomic distribution of R-M systems and is greater in plasmid genes
Is this any 6 bp palindrome or a specific sequence that is known for the specific R-M system under question?
As an initial proxy for restriction targets, we first analysed the avoidance of short palindromes in each pangenome component for k=4 and k=6
Why did you skip 8? Because it's too rare?
bacteria possessing cognate R-M systems have higher rates of horizontal gene flow between them
how much higher than usual?
This addictive quality may contribute to their occasional occurrence on MGEs such as plasmids: around 10.5% of plasmids carry R-M systems (Oliveira, Touchon, and Rocha 2014) and experiments have shown R-M system carriage can lead to increased plasmid stability in cells
Interesting, I wonder if increased stability is only due to the restriction of something else? - How was this stability measured?
We report that the EcoRI restriction endonuclease-modification methylase (rm) gene pair stabilizes plasmids that carry it
maths historian George Joseph’s book The Crest of the Peacock: Non-European Roots of Mathematics (1991) and the ongoing encyclopaedic series Science Across Cultures, edited by Helaine Selin
Artificial proteins fine-tuned to five distinct lysozyme families showed similar catalytic efficiencies as natural lysozymes, with sequence identity to natural proteins as low as 31.4%. ProGen is readily adapted to diverse
why should I use ProGen to get the same activity as natural?
The abstract should highlight the point that multiple properties can be simultaneously optimized.
the company website does some good marketing of this - https://www.profluent.bio/technology
requires experiments that alter climate in combination with manipulations of microbial communities.
community manipulation needs to be methodical with changing whole consortia, not just single microbe studies
While measurements at each scale do exist for plant-associated microbes, integration across scales is missing for any single system
Needs mechanistic information
Data that combine multiplicatively, like rates, are actually very common outside of economics too. The key is to recognize when a measured variables is affected by many (semi) independent forces, each of which scales that variable up or down — rather than simply adding or subtracting a fixed amount to it. This is often true in the natural sciences.
the use of constructed wetlands to generate cellulosic biofuel using waste nitrogen from wastewater treatment
total abundances of archaea and bacteria in these sediments increase with latitude
what's dominating in the tropics then?
Increases in solar radiation, temperature and freshwater inputs to surface waters strengthen ocean stratification and consequently reduce transport of nutrients from deep water to surface waters, which reduces primary productivity
There are many interconnected variables affecting the process. It is really complex.
Hence it makes it all the more difficult to communicate to common public in clear unambiguous terms
received 3-CA every day (press-disturbed), every 2, 3, 4, 5, 6, or 7 days (intermediately-disturbed), or never (undisturbed)
What was the concentration of 3-CA received?
as assessed by 16S rRNA gene terminal restriction fragment length polymorphism (T-RFLP)
why do RFLP? Does this have any more information than 16S sequence based metagenomics?
Non-metric multidimensional scaling (NMDS, unconstrained ordination) shows temporal dispersion effect
why a different ordination for time?
3-CA,41 which is also known to inhibit both organic carbon removal and nitrification in sludge reactors
So is the efficiency of certain processes that go down inspite of higher diversity because of the 3-CA directly? If so changing to a different disturbance might answer this question?
To investigate their roles, well-replicated time series experiments are needed.
These experiments are required, but are they enough to understand the driving forces though?
need to understand what governs the relative balance between stochastic and deterministic processes
How does your study help understanding the drivers of sochata processes?
In a deposition, an engineer at Tesla made this all but explicit: “We want to let the customer know that, No. 1, you should have confidence in your vehicle: Everything is working just as it should. And, secondly, the reason for your accident or reason for your incident always falls back on you.”
That sounds very much like a religion. Or could also be a statement from an authoritarian leader. Confidence has to be earned, not simply gotten by asking
The output .clstr file looks like
how can the output be changed to show the exact number of mismatches/gaps to the reference?
although the ocean and rainforest seem to be two different extremes of dissimilar environments, surf and turf have several similarities. One similarity that is present in both environments, yet seems counterintuitive is the fact both a reef and a rainforest are essentially nutrient desserts. Both ocean water and forest soil contain low levels of biologically relevant nutrients, and as a result, organisms have developed creative and sometimes symbiotic/mutualistic strategies to thrive in these nutrient-poor environments.
Interesting point that there is a regime of low nutrients which enables higher diversity. I'll look for some references! Here's a Minute Earth video explaining this very well - https://youtu.be/mWVATekt4ZA
Each flowerpot was filled with soil-bacteria pellets from about 4L of culture, which corresponds to about 20 g (dry weight) of soil
Way too much cells for soil right?
inoculate 50 mL LB in 250 mL Erlenmeyer flasks
Isn't pooled colonies more diverse than liquid cultures?
At the time of writing, there is an open bug in Snakemake (version 5.8.2) on Windows systems that prevents requesting specific files from the command line when those files are in a subdirectory.
When running on Windows using Git Bash and Anaconda, the previous code will not work. Multiline strings containing multiple shell commands are not executed correctly. The simplest workaround is to add &&\ to the end of all lines except the last inside the multiline shell command:
One thing you’ve probably noticed is that all of our rules are using Python strings
or lists of strings?
We need to add wordcount.py as a dependency of each of our data files so that the rules will be executed if the script changes
would be interesting if this worked even for updating a .yaml config file. But I wonder how the snakemake would know where to start running the pipeline from ; and since the whole workflow is dependent on the config file, re-running the whole thing defeats the purpose of snakemake
Before sequencing your plasmids, we linearize them so that we get mostly full-length sequence reads
How is this linearized in a sequence independent manner?
If the pipeline does not produce a consensus for your target, you can download the raw reads from your dashboard and bin them yourself, but please note that raw reads are much more noisy and error-prone (~98.3% accurate) than consensus reads.
Look for binning tools - Example - LRBinner = reference free binning approach for nanopore. Ref : Wickramarachchi, Anuradha, and Yu Lin. "Binning long reads in metagenomics datasets using composition and coverage information." Algorithms for Molecular Biology 17.1 (2022): 1-15. bmc 202
The SWW aimed to mimic the average conditions and nutrient proportions of conventional domestic wastewater.
However, long-term live imaging is laborious and equipment intensive, because a single microscope often has to be monopolized for the duration of the experiment
Good argument for memory
For each of the libraries, we screened for the presence of all possible STMs used in a given experiment, with the requirement that all spike-ins for a given STM needed to be present
Looks like you are looking for exact matches of the STM sequences or rather the STM identifier/id only, using R. - Is there a neat/quick way of doing this using BLAST or any mapping tool allowing for some errors in the sequence?
The advantage of merging these paired-end reads later is that the quality can be improved (if overlapping bases are the same in both reads, there is a higher likelihood that the correct base was called) so there is no need for trimming here.
But won't the reads where the bases don't match just be discarded? When the quality deterioration is particularly bad, wouldn't trimming retain more reads overall? And since the merging will anyway retain these bases in either read, there isn't any sequence information lost either.
Is this incorrect?
In the absence of inducer, basal activity of these EilR-regulated promoters fell below that of the three routinely used inducible systems PBAD, Ptet, and Ptrc
We estimated read counts for eachisolate by assigning trimmed and merged reads that perfectly matched a known isolate 16S rRNAV4-V5 sequence to that isolate. Reads that did not match a known isolate were discarded.
Since a mapping tool is not mentioned, is this done using string match in R or something?
that if mutations are sufficiently abundant (for instance, if they are generated at an early PCR cycle), they might still give rise to a spurious OTU.
DADA2
a flavour with the same Ubuntu engine under the hood, but with a lightweight desktop environment, and with lighter application programs. the ultra-light Lubuntu or the medium light Ubuntu MATE or Xubuntu.
Primers to target the DXS gene24 (one copy per genome) and the ampicillin resistance gene on the plasmid were created using the Primer3Plus design tool
With this simple realization, a number of groups have realized that HTS datasets are actually count-compositions
have dramatically different statistical properties than do counts
Identification of type IV conjugative systems that are systematically excluded from metagenomic bins
the box plot of ANCOM-BC had the shortest width, suggesting that it not only successfully estimates the true sampling fractions and eliminates bias due to its variability, but it also has the smallest variance which is not the case with other methods.
The microbial absolute abundances in the ecosystem are generated from the log-normal distribution
Is the log-normal model used to simulate the data particularly favorable to the linear regression method of ANCOM-BC?
According to an extensive simulation study1, among the available methods for DA analysis, only ANCOM performs well in controlling FDR while maintaining high power, as long as the sample size is not too small
How small is too small?
green fluorescent protein containing a degradation tag (GFPmut3_LAA)
BLAST matches the GFPmut3 sequence in rGFP and fGFP to this - so the Voigt lab authors cloned this with the partial degron tag without the LAA amino acids for this paper :
Yang, Lei, et al. "Permanent genetic memory with> 1-byte capacity." Nature methods 11.12 (2014): 1261-1266.
Consequently, amplicons produced with these primers were removed leaving amplicons corresponding to eight variable regions (V1, V2, V3, V4, V5, V6, V7, and V8) for the MVRSION method.
7 out of 14 primer pairs were discarded but they are still able to cover V1-V8 variable regions
DMSO has been successfully used to improve the performance of RT-PCR [10] and SangerSequencing [11].
reference 10 only talks about PCR and not RT-PCR. I'm interested in the effect of DMSO on RT.
This paper shows that 6% DMSO is optimal for RT-PCR with recombinant Thermus thermophilus DNA pol (rTth): Sidhu, Maninder K., Mei-June Liao, and Abbas Rashidbaigi. "Dimethyl sulfoxide improves RNA amplification." Biotechniques 21.1 (1996): 44-47.
This consensus .fastq file will be delivered with your standard sequencing results, whereas the .fastq file for the raw read data must be requested during order submission (as above) and will be delivered via a separate raw data link.
Note: consensus .fastq file has only 1 read (which is the consensus read)
As such we believe that it was important to test these methods on a wide range of different real-world datasets in order to gain an understanding of how they differed from one another
But I see it very hard to generalize your conclusions from the real world dataset based analysis in this paper. So there are tradeoffs with either method of validation
If every number between 0 and 1 had equal probability of being chosen, method 2 would be a valid hypothesis test—but not a good one.
Interesting. How would it be a valid hypothesis test? I guess I'll have to see what's a hypothesis test?
The advantages of using SSU rRNA for community fingerprinting are many: (i) This gene is found in all cellular life forms. (ii) It is a highly conserved gene, serving to a large degree as a reliable molecular chronometer. (iii) It is seldom transferred horizontally. (iv) It possesses both conserved and variable regions, so that the conserved regions can be targeted by polymerase chain reaction (PCR) primers and the variable ones be used as identifying markers. A handful of other genes, such as the large subunit (LSU) rRNA share these properties, but the length of ~1,500 bp of the bacterial SSU rRNA made it amenable to early molecular techniques, and the impressive body of knowledge that has since accumulated on the basis of this gene makes a switch to other markers very impractical, except in certain sub-fields such as mycology, where ITS and LSU are widely used.
very crisp summary
QuantStudio™ 7 Flex Real-Time PCR System features a decoupled six-by-six-color filter set thatsupports the dyes shown in the following table.
6-plex assay. Useful for troubleshooting droplet digital PCR assays too?
Actions=Editor
causes error
**-thinkpad:/usr/share/applications$ desktop-file-validate obsidian.desktop
obsidian.desktop: error: action "Editor" is defined, but there is no matching "Desktop Action Editor" group
Path/to/AppImage
the root folder ~ is /home/*username* so you would write the path like this /home/prashant/Downloads/setup_files/Obsidian-1.0.0.AppImage
chmod +x *.AppImage
use chmod a+x *.AppImage to make executable file for all users
Fundamentally, all real-time thermal cyclers are engineered to detect fluorescein (FAM) first and foremost, so dyes with longer wavelength emission may be detected less sensitively
For those shorter than 25 bases, a standard (dual labeled) BHQ™ Probe may be perfectly satisfactory.
Nova might be better to have for 1-step ddPCR applications where the BHQ quenchers are unstable due to reduction of the N=N azo bond by the DTT additive
the majority of chimeras are believed to arise from incomplete extension. During subsequent cycles of PCR, a partially extended strand can bind to a template derived from a different but similar sequence. This then acts as a primer that is extended to form a chimeric sequence
Koodankulam: What the Media Didn’t Tell Us
Rahul Gandhi’s comparison is great fodder for intellectual debate, but it is not good politics. When the country is in ‘wartime’, the adornments of peace do not sit very well. This comparison is a peacetime jewel. In a war zone, only the cannons, pistols and swords do well.
very crisp summary
To perform bacterial genome assembly, we suggest using the third-party de novo assembly tool Flye3. This analysis package represents a complete pipeline, taking raw nanopore reads as input, and producing polished contigs as output. We also recommend one round of polishing with Medaka4. These tools can be found on GitHub
droplet digital PCR for simultaneous detection of plasmid and genomic DNA in sorted cells
did they shear or digest their genomic DNA to improve ddPCR detection (as recommended by biorad protocol?)
For each of these two subpopulations, 1000 cells were sorted
find out how these 1,000 cells were lysed after sorting - could there be any loss during pelleting to concentrate the cells?
ddPCR applications guide
pop.MFI computes and returns the median fluorescence intensity for each marker. They are typ-ically used as the arguments passed to gh_pop_get_stats method to perform the sample-wisepopulation stats calculations
Additionally, make sure to use both forward and side scatter on log scale when measuring microparticles or microbiological samples like bacteria. These types of particles generate dim scatter signals that are close to the cytometer’s noise, so it’s often necessary to visualize signal on a log scale in order to separate the signal from scatter noise.
By introducing rationally selected combinations of folding-enhancing mutations into GFP templates and screening for brightness and expression rate in human cells, we developed mGreenLantern, a fluorescent protein having up to sixfold greater brightness in cells than EGFP
But Poisson statisticspredicts that there will be some empty droplets (1,642 empty droplets) and gives a preciserelationship between the average number of copies/droplet and the expected fraction ofempty droplets.
@Esther?
Note that for creating perfect PDF files for printing, it’s better to turn to a dedicated desktop publishing software such as Scribus, which can also import SVG files.
why?
10-20 sec
Depends on the amplicon length. For Cheetah Hotstart Qaq it is 1 min / kb reference:
3 uL diluted ROX per 20 uL reaction
for undiluted ROX : 1.5ul/1ml master mix -- add this once per aliquot and label in as ROX added
2.25 ul / 1.5 ml master mix
Avoid the use of spectral schemes to represent sequential data because the spectral order of visible light carries no inherent magnitude message. Readers do not automatically perceive violet as greater than red even though the two colors occupy opposite ends of the color spectrum. Rainbow color schemes are therefore not appropriate if the data to be mapped or graphed represent a distribution of values ranging from low to high
TaqMan MGB Probes
What is the shipping time
A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase.
The engineered WarmStart Luna Reverse Transcriptase also possesses higher thermostability than many other RTs, allowing an optimal reaction temperature of 55°C. For difficult targets/templates, higher RT step temperatures of up to 60°C can be used without compromising Luna performance. Luna one step RT-qPCR kit E3005 manual
Denature for 5 minutes at 65°C. Put promptly on ice.
If denaturation of template RNA is desired
across() is very useful within summarise() and mutate(), but it’s hard to use it with filter() because it is not clear how the results would be combined into one logical vector. So to fill the gap, we’re introducing two new functions if_all() and if_any().
If you are fine making the jump to Rainin, I would recommend that above all. They make the best pipettes in general, and probably by far the best multichannels. Their single pipettes are probably only rivaled by Eppendorf.
Examples
Donor and recipients cells were mixed 1:1 (vol/vol, 0.1 to 1 ml), pelleted (2,000g for 10 min), resuspended in 10–100 µl LB + 300 µM DAP, pipetted onto a LB + 300 µM DAP plate and incubated at 37 °C for 2 h
conjugation with DAP
spotted on 0.45-μm nitrocellulose filters, which were placed on LB agar plates
Conjugation is happening without DAP
harvested in 2 ml of 0.9% NaCl solution
Why not PBS?
This class serves the same purpose as the flowFrame class from the flowCore package: to storequantitative data on cell populations from a single FCS run. The primary difference is in the un-derlying representation of the data. While flowFrame objects store the underlying data matrix inthe exprs slot as an R object, cytoframe objects store the matrix (as well as the data from theother slots) in a C data structure that is accessed through an external pointer. This allows for greateroptimization of data operations including I/O, parsing, transformation, and gating.
The original or engineered proteins used in the R6, R7, R7.3, R10 and R10.3 nanopores have not been disclosed by the company to date
trade secret
One such behavioral trait is seeing all non-human animals as commodities, believing they have been “put on this planet for us to consume”
This could be extended even to plants
Autofluorescence was not subtracted from these populations.
why? Is it mathematically sound to combine the autofluorescence histograms and subtract the mode/median etc. from the rest of the populations?
average (n ≥ 3) population geometric MEFL mean
so arithmetic mean of 3 geometric mean values?
We visualized population-level cellular fluorescence using frequency distributions and violin plots.
How are replicates handled in these plots?
Appendix S5 says
All violins represent data combined from experiments on three separate days except for the max and DAPG sensor violins, where only one replicate was measured.
For background information on how tiling amplicon sequencing works, please prefer to the original “PrimalSeq” protocol paper as tested on Zika Quick et al. Nature Protocols and a follow-up paper Grubaugh, Gangavaparu et al. Genome Biology that focuses on in-host variation and Illumina sequencing.
Indira Gandhi’s image as someone who cared for the poor was seriously dented.
How then did she manage to win again in 1980? This question always seems to puzzle me about our electorate during that time
A "negative lookahead assertion" can be used to remove from consideration any apostrophes, before they are even tested for being punctuation characters. gsub("(?!')[[:punct:]]", "", str2, perl=TRUE)
How does this work? From my knowledge, negative lookahead assertion is used in this format lookfor(?!x)
Source: Regex cheat sheet
df %>% group_by(cat) %>% mutate(id = row_number())
numbering index within a group
Substitution of SuperScript IV for LunaScript RT SuperMix and reaction volume reduced to 10 uL.
Why was this substituted? - Could be lower cost : Superscript (350$/25 rxn) vs Lunascript (250$/50 rxn)
As you can see, the theme author has included a .Site.Params variable called commentsrepo
figure out how to do this for themes that don't have it
The choice to protect our environment rests with each of us
Not everyone has choice, affordability, trust in water supply..
a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.
Interesting paper to read. I was interested an Indian point of view thinking that - Does a language being monopolized by the elite, to produce their scholarship, but not the language of the commoners - such as Sanskrit, Persian and now English in India, prevent it from being a surviving eventually?
However, they were so fond of its diverse uses that they minimized the hazards it posed
by 'minimized' you mean downplayed
can be a file path to the package or a package object.
This installs the branch that is currently checked out -- since that is what is in the directory that devtools::install() looks at.
putative ∼97 kbp crAssphage genome (accession code: JQ995537)
This record was removed because the sequence was not directly determined by the submitter. GenBank: JQ995537.1
Instead check this : MAG Genbank : BK010471
Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).
The primers have degenerate nucleotides like Y, W etc. so might be best to order it the same way
GenExpDB is the world’s largest repository for E. coli gene expression data. This site is a widely used public resource for gene expression analysis.