A vector with the mScarlet-I protein construct under the nptII promoter from

conjugation of the TOL plasmid was found to increase with the specific growth rate of both the donor and recipient (Smets et al., 1993, Seoane et al., 2010). This suggests a relationship of faster-growing bacteria (r-strategists) being able to transfer and receive degradative plasmids better than the slower-growing K-strategists

For each culture, a total of 106 cells were added. Naphthalene was added to the NAH7 conjugation cultures by adding naphthalene crystals to the CBM medium which ensured the medium was continually saturated with naphthalene

Novosphingobium aromaticivorans F199donor harboring pNL1; 16S copy number: 3

All data were analyzed using RStudio, version 1.4.1103. Experimental replicates for all data were averaged and reported with standard error.

Bars are colored by whether naphthalene was added and at which hour the sample was taken.

To quantify conjugation via fluorescence-activated cell sorting (FACS), genes encoding constitutive fluorescence of mScarlet-I were inserted onto the NAH7 and pNL1 plasmids.

these transfer regimens were evident for not only the donor transferring the plasmid, but also the recipient receiving it (Sysoeva et al., 2019).

Historically, bacterial evolution has favored two general ecological growth strategies: high reproduction rate (r-strategists or copiotrophs) or optimal resource utilization (K-strategists or oligotrophs)(Atlas and Bartha, 1997)

environmentally-friendly

Care should be taken to avoid severe ecological disturbance when introducing an alien species.

confirmed to participate in protein remineralization in sediments

Abundance and diversity of archaea in coastal ecosystems

Archaea mediate four major processes that strongly impact the coastal blue carbon ecosystems, namely, CO2 fixation, organic biopolymer transformation, CH4 production, and CH4 oxidation

That's greater than taking all the humans who lived throughout time, multiplied by the number of grains of sand on Earth, multiplied by the number of atoms in the universe.

Digestion is recommended whenever DNA input is greater than 75 ng

we show that they have shaped the evolution and host range of plasmids

We found a hierarchy of avoidance, with plasmid genes avoiding 6-bp palindromes significantly more on average than core and non-core chromosomal genes

For the most common target length (6 bp) we show that target avoidance is strongly correlated with the taxonomic distribution of R-M systems and is greater in plasmid genes

As an initial proxy for restriction targets, we first analysed the avoidance of short palindromes in each pangenome component for k=4 and k=6

bacteria possessing cognate R-M systems have higher rates of horizontal gene flow between them

This addictive quality may contribute to their occasional occurrence on MGEs such as plasmids: around 10.5% of plasmids carry R-M systems (Oliveira, Touchon, and Rocha 2014) and experiments have shown R-M system carriage can lead to increased plasmid stability in cells

We report that the EcoRI restriction endonuclease-modification methylase (rm) gene pair stabilizes plasmids that carry it

maths historian George Joseph’s book The Crest of the Peacock: Non-European Roots of Mathematics (1991) and the ongoing encyclopaedic series Science Across Cultures, edited by Helaine Selin

Artificial proteins fine-tuned to five distinct lysozyme families showed similar catalytic efficiencies as natural lysozymes, with sequence identity to natural proteins as low as 31.4%. ProGen is readily adapted to diverse

requires experiments that alter climate in combination with manipulations of microbial communities.

While measurements at each scale do exist for plant-associated microbes, integration across scales is missing for any single system

Data that combine multiplicatively, like rates, are actually very common outside of economics too. The key is to recognize when a measured variables is affected by many (semi) independent forces, each of which scales that variable up or down — rather than simply adding or subtracting a fixed amount to it. This is often true in the natural sciences.

the use of constructed wetlands to generate cellulosic biofuel using waste nitrogen from wastewater treatment

total abundances of archaea and bacteria in these sediments increase with latitude

Increases in solar radiation, temperature and freshwater inputs to surface waters strengthen ocean stratification and consequently reduce transport of nutrients from deep water to surface waters, which reduces primary productivity

received 3-CA every day (press-disturbed), every 2, 3, 4, 5, 6, or 7 days (intermediately-disturbed), or never (undisturbed)

as assessed by 16S rRNA gene terminal restriction fragment length polymorphism (T-RFLP)

Non-metric multidimensional scaling (NMDS, unconstrained ordination) shows temporal dispersion effect

3-CA,41 which is also known to inhibit both organic carbon removal and nitrification in sludge reactors

To investigate their roles, well-replicated time series experiments are needed.

need to understand what governs the relative balance between stochastic and deterministic processes

In a deposition, an engineer at Tesla made this all but explicit: “We want to let the customer know that, No. 1, you should have confidence in your vehicle: Everything is working just as it should. And, secondly, the reason for your accident or reason for your incident always falls back on you.”

The output .clstr file looks like

although the ocean and rainforest seem to be two different extremes of dissimilar environments, surf and turf have several similarities. One similarity that is present in both environments, yet seems counterintuitive is the fact both a reef and a rainforest are essentially nutrient desserts. Both ocean water and forest soil contain low levels of biologically relevant nutrients, and as a result, organisms have developed creative and sometimes symbiotic/mutualistic strategies to thrive in these nutrient-poor environments.

Each flowerpot was filled with soil-bacteria pellets from about 4L of culture, which corresponds to about 20 g (dry weight) of soil

inoculate 50 mL LB in 250 mL Erlenmeyer flasks

At the time of writing, there is an open bug in Snakemake (version 5.8.2) on Windows systems that prevents requesting specific files from the command line when those files are in a subdirectory.

When running on Windows using Git Bash and Anaconda, the previous code will not work. Multiline strings containing multiple shell commands are not executed correctly. The simplest workaround is to add &&\ to the end of all lines except the last inside the multiline shell command:

One thing you’ve probably noticed is that all of our rules are using Python strings

We need to add wordcount.py as a dependency of each of our data files so that the rules will be executed if the script changes

Before sequencing your plasmids, we linearize them so that we get mostly full-length sequence reads

If the pipeline does not produce a consensus for your target, you can download the raw reads from your dashboard and bin them yourself, but please note that raw reads are much more noisy and error-prone (~98.3% accurate) than consensus reads.

The SWW aimed to mimic the average conditions and nutrient proportions of conventional domestic wastewater.

However, long-term live imaging is laborious and equipment intensive, because a single microscope often has to be monopolized for the duration of the experiment

For each of the libraries, we screened for the presence of all possible STMs used in a given experiment, with the requirement that all spike-ins for a given STM needed to be present

The advantage of merging these paired-end reads later is that the quality can be improved (if overlapping bases are the same in both reads, there is a higher likelihood that the correct base was called) so there is no need for trimming here.

In the absence of inducer, basal activity of these EilR-regulated promoters fell below that of the three routinely used inducible systems PBAD, Ptet, and Ptrc

We estimated read counts for eachisolate by assigning trimmed and merged reads that perfectly matched a known isolate 16S rRNAV4-V5 sequence to that isolate. Reads that did not match a known isolate were discarded.

that if mutations are sufficiently abundant (for instance, if they are generated at an early PCR cycle), they might still give rise to a spurious OTU.

a flavour with the same Ubuntu engine under the hood, but with a lightweight desktop environment, and with lighter application programs. the ultra-light Lubuntu or the medium light Ubuntu MATE or Xubuntu.

Primers to target the DXS gene24 (one copy per genome) and the ampicillin resistance gene on the plasmid were created using the Primer3Plus design tool

With this simple realization, a number of groups have realized that HTS datasets are actually count-compositions

Identification of type IV conjugative systems that are systematically excluded from metagenomic bins

the box plot of ANCOM-BC had the shortest width, suggesting that it not only successfully estimates the true sampling fractions and eliminates bias due to its variability, but it also has the smallest variance which is not the case with other methods.

According to an extensive simulation study1, among the available methods for DA analysis, only ANCOM performs well in controlling FDR while maintaining high power, as long as the sample size is not too small

green fluorescent protein containing a degradation tag (GFPmut3_LAA)

Consequently, amplicons produced with these primers were removed leaving amplicons corresponding to eight variable regions (V1, V2, V3, V4, V5, V6, V7, and V8) for the MVRSION method.

DMSO has been successfully used to improve the performance of RT-PCR [10] and SangerSequencing [11].

This consensus .fastq file will be delivered with your standard sequencing results, whereas the .fastq file for the raw read data must be requested during order submission (as above) and will be delivered via a separate raw data link.

As such we believe that it was important to test these methods on a wide range of different real-world datasets in order to gain an understanding of how they differed from one another

If every number between 0 and 1 had equal probability of being chosen, method 2 would be a valid hypothesis test—but not a good one.

The advantages of using SSU rRNA for community fingerprinting are many: (i) This gene is found in all cellular life forms. (ii) It is a highly conserved gene, serving to a large degree as a reliable molecular chronometer. (iii) It is seldom transferred horizontally. (iv) It possesses both conserved and variable regions, so that the conserved regions can be targeted by polymerase chain reaction (PCR) primers and the variable ones be used as identifying markers. A handful of other genes, such as the large subunit (LSU) rRNA share these properties, but the length of ~1,500 bp of the bacterial SSU rRNA made it amenable to early molecular techniques, and the impressive body of knowledge that has since accumulated on the basis of this gene makes a switch to other markers very impractical, except in certain sub-fields such as mycology, where ITS and LSU are widely used.

QuantStudio™ 7 Flex Real-Time PCR System features a decoupled six-by-six-color filter set thatsupports the dyes shown in the following table.

Actions=Editor

Path/to/AppImage

chmod +x *.AppImage

Fundamentally, all real-time thermal cyclers are engineered to detect fluorescein (FAM) first and foremost, so dyes with longer wavelength emission may be detected less sensitively

For those shorter than 25 bases, a standard (dual labeled) BHQ™ Probe may be perfectly satisfactory.

the majority of chimeras are believed to arise from incomplete extension. During subsequent cycles of PCR, a partially extended strand can bind to a template derived from a different but similar sequence. This then acts as a primer that is extended to form a chimeric sequence

Koodankulam: What the Media Didn’t Tell Us

Rahul Gandhi’s comparison is great fodder for intellectual debate, but it is not good politics. When the country is in ‘wartime’, the adornments of peace do not sit very well. This comparison is a peacetime jewel. In a war zone, only the cannons, pistols and swords do well.

To perform bacterial genome assembly, we suggest using the third-party de novo assembly tool Flye3. This analysis package represents a complete pipeline, taking raw nanopore reads as input, and producing polished contigs as output. We also recommend one round of polishing with Medaka4. These tools can be found on GitHub

droplet digital PCR for simultaneous detection of plasmid and genomic DNA in sorted cells

For each of these two subpopulations, 1000 cells were sorted

pop.MFI computes and returns the median fluorescence intensity for each marker. They are typ-ically used as the arguments passed to gh_pop_get_stats method to perform the sample-wisepopulation stats calculations

Additionally, make sure to use both forward and side scatter on log scale when measuring microparticles or microbiological samples like bacteria. These types of particles generate dim scatter signals that are close to the cytometer’s noise, so it’s often necessary to visualize signal on a log scale in order to separate the signal from scatter noise.

By introducing rationally selected combinations of folding-enhancing mutations into GFP templates and screening for brightness and expression rate in human cells, we developed mGreenLantern, a fluorescent protein having up to sixfold greater brightness in cells than EGFP

But Poisson statisticspredicts that there will be some empty droplets (1,642 empty droplets) and gives a preciserelationship between the average number of copies/droplet and the expected fraction ofempty droplets.

Note that for creating perfect PDF files for printing, it’s better to turn to a dedicated desktop publishing software such as Scribus, which can also import SVG files.

10-20 sec

3 uL diluted ROX per 20 uL reaction

Avoid the use of spectral schemes to represent sequential data because the spectral order of visible light carries no inherent magnitude message. Readers do not automatically perceive violet as greater than red even though the two colors occupy opposite ends of the color spectrum. Rainbow color schemes are therefore not appropriate if the data to be mapped or graphed represent a distribution of values ranging from low to high

TaqMan MGB Probes

A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase.

Denature for 5 minutes at 65°C. Put promptly on ice.

across() is very useful within summarise() and mutate(), but it’s hard to use it with filter() because it is not clear how the results would be combined into one logical vector. So to fill the gap, we’re introducing two new functions if_all() and if_any().

If you are fine making the jump to Rainin, I would recommend that above all. They make the best pipettes in general, and probably by far the best multichannels. Their single pipettes are probably only rivaled by Eppendorf.

Examples

Donor and recipients cells were mixed 1:1 (vol/vol, 0.1 to 1 ml), pelleted (2,000g for 10 min), resuspended in 10–100 µl LB + 300 µM DAP, pipetted onto a LB + 300 µM DAP plate and incubated at 37 °C for 2 h

spotted on 0.45-μm nitrocellulose filters, which were placed on LB agar plates

harvested in 2 ml of 0.9% NaCl solution

This class serves the same purpose as the flowFrame class from the flowCore package: to storequantitative data on cell populations from a single FCS run. The primary difference is in the un-derlying representation of the data. While flowFrame objects store the underlying data matrix inthe exprs slot as an R object, cytoframe objects store the matrix (as well as the data from theother slots) in a C data structure that is accessed through an external pointer. This allows for greateroptimization of data operations including I/O, parsing, transformation, and gating.

The original or engineered proteins used in the R6, R7, R7.3, R10 and R10.3 nanopores have not been disclosed by the company to date

One such behavioral trait is seeing all non-human animals as commodities, believing they have been “put on this planet for us to consume”

Autofluorescence was not subtracted from these populations.

average (n ≥ 3) population geometric MEFL mean

We visualized population-level cellular fluorescence using frequency distributions and violin plots.

For background information on how tiling amplicon sequencing works, please prefer to the original “PrimalSeq” protocol paper as tested on Zika Quick et al. Nature Protocols and a follow-up paper Grubaugh, Gangavaparu et al. Genome Biology that focuses on in-host variation and Illumina sequencing.

Indira Gandhi’s image as someone who cared for the poor was seriously dented.

A "negative lookahead assertion" can be used to remove from consideration any apostrophes, before they are even tested for being punctuation characters. gsub("(?!')[[:punct:]]", "", str2, perl=TRUE)

df %>% group_by(cat) %>% mutate(id = row_number())

Substitution of SuperScript IV for LunaScript RT SuperMix and reaction volume reduced to 10 uL.

As you can see, the theme author has included a .Site.Params variable called commentsrepo

The choice to protect our environment rests with each of us

a recent study published in Proceedings of the National Academy of Sciences argues that a language’s power doesn’t come from the sheer number of people who speak it, but from who those people are.

However, they were so fond of its diverse uses that they minimized the hazards it posed

can be a file path to the package or a package object.

putative ∼97 kbp crAssphage genome (accession code: JQ995537)

Primer and probes for the RSV A and B N gene were purchased from Integrated DNA Technologies (IDT, San Diego, CA) (Forward primer: CTCCAGAATAYAGGCATGAYTCTCC. Reverse primer: GCYCTYCTAATYACWGCTGTAAGAC. Probe: TAACCAAATTAGCAGCAGGAGATAGATCAG (5′HEX/ZEN/3′IBFQ)).

GenExpDB is the world’s largest repository for E. coli gene expression data. This site is a widely used public resource for gene expression analysis.

Low ROX ABI: 7500, 7500 Fast, ViiA 7™, QuantStudio™

while not required, using a passive reference like ROX dye to normalize data helps achieve a higher level of precision among technical replicates. Without normalization, more replicates may be required to achieve comparable precisions levels, therby increasing the time and resources

ROX fluorescence is affected by anything else that would alter overall fluorescence readings, such as: • Bubbles in wells • Evaporation • Condensation or droplets • Instrument issues, such as electrical surges

ROX is normalising for the attributes of the qPCR mixture, such as volume differences, presence of bubble etc.

differences in reaction volumes due to pipetting errors can bias the results. Also, issues associated with the qPCR instrument, such as the optics, can also influence the fluorescent signal generated.

Hence, to keep things balanced, I think we should constantly oppose the anti-competitive behavior by tech giants and start using Mozilla Firefox (in whatever capacity, even as a secondary browser).

If I am applying for a J visa, my current DS-2019 is issued by the same institution as the institution listed on my previous visa.

The MRV fee is valid and may be used to schedule an interview appointment in the country where it was purchased within one year of the date of payment

For a package pkg, pkg::name returns the value of the exported variable name in namespace pkg, whereas pkg:::name returns the value of the internal variable name. The package namespace will be loaded if it was not loaded before the call, but the package will not be attached to the search path.

no amplification: reactions with less than 7-times overall increase in fluorescence between the first cycles and the last cycles.

Because LinRegPCR calculates a mean PCR efficiency per target, it is essential, that the sample id (= sample name) and the target are correctly annotated (optimally in RDML-TableShaper)

a fragment of the pUC plasmid, comprising the ColE1 origin of replication and ampicillin resistance gene (bp 1645–3556 of pBE-S) for propagation in E. coli, and a piece of plasmid pUB110, including the pUB origin of replication and the kanamycin resistance gene for Bacillus (

When the plateau phase is present, this method can also handle data of probe-based assays, which often show high baselines and noisy ground phases

For such samples, reproducible and reliable quantification is best achieved using the Eamc per biological sample

One can use RDML-ninja or the RDML validator from the RMDL consortium to validate RDML files created by the RDML package

tryptophan

The qPCR reactions were based on SYBR (see Table S1 for the primer sequences). The fluorescence raw data were analyzed based on the R “qpcR” package [22] with the following parameters: methods = “sigfit”, model = l5, type = “Cy0”, which.eff = “sig”, type.eff = “mean.pair”, which.cp = “Cy0”. The means and standard deviations from the permutation analysis were used for the statistics below.

Data analysis was performed in R version 3.4.4. Fluorescence data were imported using the package RDML (Rödiger et al., 2017) and amplification curves fitted using the ‘cm3’ model (Carr and Moore, 2012) implemented in the package qpcR (Ritz and Spiess, 2008). The first derivative (d0) of the model was used as expression value. Expression values for genes of interest were normalised using the geometric mean of the expression values of the reference genes eef1aa and rpl13.

Data were normalized using the 2–ΔΔCT method

Raw fluorescence data from each well were log-transformed and fit to a 4-parameter sigmoidal model using the pcrbatch function in R package qpcR version 1.4-1

The ability of a community to receive genes located on mobilizable non-self-transmissible plasmids, on the other hand, would rely on the community’s own content of conjugal plasmids

the sigmoidal response curve is symmetric on the logarithm of x

Try with an actual exponential. You’ll probably want a self-starting function to avoid the “singular gradient” error — read more in my post on the subject.

To ensure unambiguous selection of data points within the window-of-linearity, an iterative algorithm is formulated to search for lines consisting of at least 4 and no more than six data points with the highest R2 value and a slope close to the maximum slope

To cancel out the random variation in individual PCR efficiencies, web-based LinRegPCR, determines for each reaction the centre of the exponential phase from the baseline-corrected fluorescence values and, using the mean PCR efficiency of the assay, constructs an ideal amplification curve which is then used to call the Cq value for the reaction

RT-qPCR targeting SARS-CoV-2 is sensitive to inhibitors that are present in wastewater, leading to false-negative results

the rapid approach uses a transposase enzyme to simultaneously cleave DNA and attach barcode/adapter sequences

. This is the first reported case of conjugative transfer of a naturally occurring plasmid between gram-negative and gram-positive bacteria.

The basic idea is that abundant sequences are more likely to generate erroneous sequences than rare sequences