Look at filmmaker Anubhav Sinha’s last three films. He went for Muslim minority story (Mulk) then he went to do a Dalit-related, anti-caste-related story in Article 15, and now he has gone for domestic violence (Thappad). He has touched religion, caste and gender.

P.putida Competent Cells

P. aeruginosa cells were made competent utilizing a microcentrifuge-based procedure.

Combining acetate with borate retains the deficiencies of both

The voltage is kept low, ∼10 V/cm, where cm refers to the length of the gel

Between them, the three buffers cover all of the molecular biologist’s DNA gel needs

Since most of the power produced in the electrophoretic process is dissipated as heat the following detrimental effects can result: • an increased rate of diffusion of sample and buffer ions leading to broadening of the separated samples • the formation of convection currents, which leads to mixing of separated samples; • thermal instability of samples that are rather sensitive to heat (e.g. denaturation of DNA) • a decrease of buffer viscosity hence a reduction in the resistance of the medium

Using a lower concentration running buffer (0.25x TAE) and higher voltage (300 V), agarose gels can be run 33% faster.

found that the P R promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P R/cmtO and P R/tetO, were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively

Currently, the majority of quorum sensing systems used in synthetic biology rely on self-produced small molecules that result in spatially and temporally self-organized systems, which can not be easily externally regulated

All replication in R6K relies on the two essential components of a minimal replicon, the γ ori, and its cognate Rep, π protein, encoded by the pir gene

appropriately selecting sets of functionally redundant species and adding their abundances can help identify environmental drivers of microbiome composition

in most conceivable cases, we study a particular microbiome in order to understand, predict, and potentially control its functioning, with no particular regard for species content.

Since currentanalytical technologies for genes and metabolites provideonly a “snapshot” information at the time of measurement,temporal shift s in plan t an d microbial physiologies hav e bee na majo r obstacl e to detaile d analyses. Therefore, a stabl e syn‐thetic system may facilitate clearer investigations of plant-microbe interactions, leading to unique insights in this field

transformation efficiencies using a chemical transformation protocol

Fully autoclavable racks (moist heat, 121°C, 20 min., 1 bar); remove blister packaging before autoclaving

Here we present a detailed, genome-wide transcriptomics and proteomics dataset of E. coli grown under 34 different conditions. Additionally, we provide measurements of doubling times and in-vivo metabolic fluxes through the central carbon metabolism

sequences from tRNAs are italic

But humans, we have demonstrated, are not inherently self-interested.

some anthropologists now argue that millions of years of evolution have hard-wired us for altruism, not self-interest.

Since each strand is replicated independently, it is possible for the ssDNA form to accumulate.

Previously, we and others have shown that the inclusion of an antitoxin and the careful balancing of toxin and antitoxin expression levels across relevant conditions can mitigate this effect, resulting in a kill switch that is evolutionarily stable over biologically relevant periods

Cells are aliquoted into chilled tubes, frozen in a dry ice bath and stored at −80 °C until use.

Solutions can be autoclaved for 15-20 minutes at a maximum of 121 °C. There will be some hydrolysis to glucose and fructose, depending in part on how rapidly the autoclave comes to the required temperature and pressure. Care must be taken to prevent solutions from caramelizing.

V. natriegens grows rapidly in BHIN complex medium with a μ of up to 4.43 h−1 (doubling time of 9.4 min) as well as in minimal medium supplemented with various industrially relevant substrates.

Antibiotic concentrations used for plasmid selection in V. natriegens: ampicillin–carbenicillin 100 µg ml−1, kanamycin 75 µg ml−1, chloramphenicol 5 µg ml−1, spectinomycin 100 µg ml−1. E. coli experiments were performed in standard LB and M9 media.

model incorporated the time series correlation structure through an autoregressive model of order 1 for the error process

might also translate to other respiratory

. For example, when applied to the sewershed 177MUD#203 (Fig. 3B) the predictive model could be used to estimate positivity rate during periods 178when clinical testing data was sparse. This approach illustrates the power of using wastewater 179viral load to forecast positivity rates in communitie

. We observed a 110strong cross-correlation up to fourteen days

A moving average is commonly used with time series data to smooth out short-term fluctuations and highlight longer-term trends or cycles. The threshold between short-term and long-term depends on the application, and the parameters of the moving average will be set accordingly.

Linear mixed models are an extension of simple linear models to allow both fixed and random effects, and are particularly used when there is non independence in the data, such as arises from a hierarchical structure

Adjusted R-squared values

Let’s fit regression line to our model:

partial amplification of the dcp gene, located in close proximity to terC, opposite the oriC region

list

Replication begins

pWV01 is a cryptic plasmid originally purified from Streptococcus cremoris [7]. Its RCR origin has been used to create over 20 cloning vectors

Copy numbers of the oriV region and gfp gene on the plasmid relative to a chromosomal gene were determined by qPCR. The chromosomal gene dapA was set up as the reference gene

Plasmids were isolated from saturated overnight cultures using the PureLink Plasmid DNA Miniprep Kit (Invitrogen)

IS186-mediated integration of the plasmid into the chromosome or deletion of these accessory genes from an evolved plasmid that remained capable of self-replication conferred greater fitness benefits than SP formation

reduce the copy number of full-length plasmids in a cell, SP evolution can rapidly alleviate much of the burden of newly acquired accessory genes

consistent with an insertion of an IS186 element into the pQGS plasmid repF gene were detected by day 6 (Fig. 2e, f). IS186 is one of the most active insertion sequences (ISs) in E. coli. It inserted into pQGS at a site matching its preferred target site of 5′-GGGG(N6/N7)CCCC

Plasmid DNA isolated from cultures

The deletions leading to SP formation were nearly always flanked by short, near-perfect sequence homologies with lengths of 7–15 base pairs (Supplementary Table 1), suggesting that SPs may form through RecA-independent processes

serially transferred through 1:2000 daily dilutions

RSF1010, R1162, and R300B plasmids isolated independently from Escherichia coli, Pseudomonas aeruginosa, and Salmonella enterica serovar Typhimurium, respectively, are the best-characterized members of this group

Designed probes were modified at the 5′ end with the fluorophore FAM for the reference gene cysG and HEX for the plasmid marker oriT, and furthermore modified at the 3′ end with the quencher BHQ-1

Among the fully sequenced BHR plasmids, most are classified as the well-known incompatibility groups, such as IncP-1 (41 plasmids), IncW (5 plasmids), and IncU (4 plasmids), based on the backbone genes

first fast sorting step

broad-host-range plasmid RSF1010 is a member of the IncQ group of plasmids, which stably replicate in a wide variety of gram-negative and gram-positive bacteria, including E. coli and several strains of cyanobacteria

although RSF1010 is not self-transmissible, it harbors an origin of transfer and mobilization genes and can co-opt type IV secretion machinery of other self-transmissible plasmids such as RK2 and RP4

impairing the nicking activity of the RSF1010 MobA protein facilitates cloning manipulations, it significantly reduces conjugation efficiency. We addressed this problem by editing the plasmid and conjugation system to restore conjugation efficiency.

S17-1 λpir, which is kanamycin sensitive and streptomycin/trimethoprim resistant

Conditionally replicating plasmids of the R6K family (IncX) are very often used to deliver gene-inactivating elements in enteric bacteria (11, 28, 38). The replication of these plasmids requires the pir-encoded Π protein, which is usually provided in trans in the donor strain

expression is tightly regulated

targeting the genome with a single CRISPR RNA (crRNA) and selecting only for survival after editing, PaeCas3c is a rapid, counter-selection-free approach to programmable large-scale genome engineering and genome minimization

Cas3 systems raises the possibility of its development as a tool for large genomic deletions, such as the targeted removal of entire genes, gene clusters, islands, prophages or plasmids

Orthogonal ribosomes created through association of the altered 16S rRNA with large ribosomal subunit selectively translate the reporter mRNA containing the orthogonal ribosome binding site

fluorescein isothiocyanate (Sigma-Aldrich, CAS: 3326-32-7) dissolved in PBS

calibrants for red fluorescence, such as TexasRed, are currently being investigated.

Normally Ubuntu swaps files to disk frequently. Since the disk is a microSD card that's a bit slow and has limited write cycles, it's best to reduce swapping to only when needed.

SARS-CoV-2 viral load peaks prior to symptom onset

example of poor target accessibility, manifested by the significant number of mid-level amplitude droplets (that is, rain), which is resolved by performing a restriction digestion on the DNA before ddPCR

probe hydrolysis due to poor long-term storage

To detect foreign DNA in 5 ml of lake water, 15 ml of lake water must be screened.

average of 5 copies/droplet (the upper end of the recommended loading range), we expect to see about 134 empty droplets in a total of 20,000 droplets

At the extreme ends of the concentration range (for example, fewer than ten copies of target in a well or more than 120,000 copies of target in a well), fewer droplets in a well will lead to slightly larger error bars.

You need to get out of the habit of thinking using quotes is ugly. Not using them is ugly! Why? Because you've created a function that can only be used interactively - it's very difficult to program with it. – hadley

In practice, functional programming is all about hiding for loops, which are abstracted away by the mapper functions that automate the iteration.

If you're using ggplot, you can use scales::pseudo_log_trans() as your transformation object. This will replace your -inf with 0.

SpyCatcher magnetic bead preparation

Kits rock! But understanding what is going on at each stage of the protocol provided with the kit really helps with troubleshooting and modification.

All figures were created using R Statistical Computing Software version 3.6.3 (R Core Team, 2020), relying primarily on the dplyr package (Wickham et al., 2015) for data manipulation and the ggplot2 package (Wickham 2016) for plotting. The code used to create each figure can be found at https://github.com/mkc9953/SARS-CoV-2-WW-EPI/tree/master.

dplyr::coalesce() to replaces NAs with values from other vectors.

While this seems reasonable it is unlikely that tried and true methods for DNA detection that use PCR will ever be significantly deplatformed

Repeated freezing and thawing of the supermix is not recommended. DTT should be aliquoted to multiple tubes and stored at –20°C to minimize freezing and thawing

The next viable way is to use Adobe CC Cleaner tool - which is not publically advertised. If anyone reading this is facing the problem I have described above, download the CC Cleaner Tool here: https://helpx.adobe.com/creative-cloud/kb/cc-cleaner-tool-installation-problems.html 

The next set was on saliva samples, directly on saliva samples

Mu Free Donor (MFDpir) or B2155, which contain integrated rp4-based transfer machinery

LOD was defined as <x>bi + ksbi, where <x>bi equals the mean of the no-template controls, sbi is s.d. of no-template controls and k = 2.479 (99% confidence interval)

combining:5.5 μL probe; 19.8 μL forward primer; 19.8 μL reverse primer; 64.9 μL dH2O(volumes can be scaled up). This 20× master mix can be frozen and used in subsequent experiments

Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)

Nutrient Agar is a general purpose, nutrient medium used for the cultivation of microbes supporting growth of a wide range of non-fastidious organisms.

Different nutrient media were used for selective cultivation of bacteria: kanamycin esculin azide (KAA, Merck Eurolab, Darmstadt, Germany) for enterococci, and Chromocult® agar (Merck) as a selective agent for Enterobacteriaceae. For the heterotrophic plate count the bacterial dilutions were plated on R2A agar

R-2A Agar is formulated as per Reasoner and Geldreich (5). Stressed or injured organismsduring water treatment are unable to grow on high nutrient media, since the faster growing organisms outgrow the former(2). Therefore the use of a low nutrient medium like R-2A Agar incubated for longer incubation periods allows these stressedorganisms to grow well.

MacConkey agar is selective for Gram-negative organisms and helps to differentiate lactose fermenting gram-negative rods from non-lactose fermenting gram-negative rods. It is primarily used for the detection and isolation of members of family enterobacteriaceae and Pseudomonas spp.

genetic devices have been designed for suppressing leaky basal expression levels through the engineering of super‐repressors (Ruegg et al, 2018), exploitation of antisense RNAs (O'Connor & Timmis, 1987), or physical decoupling of regulatory elements along with conditional proteolysis

The neighbour‐joining tree was prepared with the R package {Ape} (Paradis, Claude, & Strimmer, 2004) and visualized using the R package {ggtree} (Yu, Smith, Zhu, Guan, & Lam, 2017).

except for E. coli (which requires Eiken agar

enabling precise control over agronomically-relevant outputs such as flowering time, stress response, or the biosynthesis of added value metabolites.

Despite the potency, curcumin has not yet been approved as a therapeutic antiviral agent.

In order to reduce false-negative results related to strain variation, TaqMan oligonucleotides were designed in a very conserved region of the M gene.

The relationship between this diversity and the invasion of antibiotic resistance was investigated using a dilution-to-extinction approach coupled with high-capacity quantitative PCR

our previous studydemonstrated that the manure-borne ARGs proliferated moreeasily ing-irradiated soil than natural soil, indicating thatindigenous soil microorganisms could prevent the dissemina-tion of ARGs from manure to soil

Eachflask received 1.2 g of pig manure as the sourceof ARGs

Four concentrations of the soilsuspension were used as inocula to create a diversity gradient

showing the relationships of ARG abundance with OTU richness, diversity andevenness.

Bars represent averages of four replicates

Little is known, however, about the barriers that microbial diversity provides against microbial invasion

If that is too limited, you need to use a nested or split workflow

Designing Probes for a ddPCR Assay

o perform multiple replacements in each element

ultimate conclusion of the thesis reads “the unknown virus lead to severe pneumonia could be: The SARS-like-CoV from the Chinese rufous horseshoe bat.

However, we recommend that other qPCR targets, including the RdRp or envelope (E) genes are used for the routine detection of 2019-nCoV

we measured the relative abundance of dead cells in cultures of the resistant strain grown at sub-MICR concentrations of streptomycin

LoD = LoB + 1.645(SD low concentration sample)

There is a simple mathematical relationship between the fraction of droplets that are unoccupied (black bar) and the concentration of target molecules.

Some droplets are lost in transfer steps and others are eliminated by the stringent metrics applied by QuantaSoft Software as the droplets pass through the Droplet Reader, resulting ultimately in data from 12,000–16,000 droplets being used in subsequent concentration calculations

Mathematical Analysis of Copy Number Variation in a DNA Sample Using Digital PCR on a Nanofluidic Device.

An estimate of par-titioning error can be found based on the analysis of Dube et al.,39 which models the partitioning as a binomial process.

Digital assays have two sources of error: subsampling error and partitioning error

Partitioning the sample into small containers results in a statistical distribu-tion of targets

because it measures indi-vidual molecules rather than an ensemble concentration

purifying the target of interest from interfering compounds.

Subsampling error sets the lower detection limit at low concentrations and is independent of the instrument, while partitioning error domi-nates at high concentrations and may depend on the sampling and partitioning instrument

The average number of droplets read for each ddPCR was 13,825 with a standard deviation of 1,892 droplets

NTCs showed a low-level background signal of approximately three positive droplets per NTC assay, which could possibly be attributed to low-level template contamination during the preparation of the reaction mixture

simple calibration procedure generated an instrument-specific color compensation matrix that was subsequently stored on the droplet reader and automatically applied to data to eliminate cross talk between FAM and VIC labeled probes.

Poisson distribution can be used in place of other standard curves to determine template concentration, which means that data can be reliably obtained from the same samples across multiple instruments and laboratories.

minimizing the need for local variables

the lowest copy number sample points impacted faster and sronger, then you just need to stabilize by adding a neutral nucleic acid background in your standard curve. I usually use water containig 10ng/microl yeast tRNA to perform serial dilutions. This will first create a reaction background similar to your RTQPCR reaction, but also stabilize your DNA copies; I can freeze and thaw (min 20C) more than 50 times the same standard curve sample without any loss in Cts, from 10E6 to 10E2 copies. When I tested the same standard curve but diluted in water only, then the 10E2 started to be slightly affected after one freeze and thaw and then crashed further; then higher copy numbers samples were also affected after 2 to 3 freeze and thaw.

t is important that the threshold is set at a fixed level for all samples that are to be compared

If you use an inter-plate calibrator for each different GOI and reference gene, then you would have the rationale to use a different threshold for each target and ref. gene on each different plate.

In most programming languages, you can only access the values of a function’s arguments. In R, you can also access the code used to compute them. This makes it possible to evaluate code in non-standard ways: to use what is known as non-standard evaluation

a single TaqMan Fast Virus 1-Step Master Mix protocol has been developed to assay both types of nucleic acid, so you can perform RNA and DNA virus queries next to each other on the same plate using the same handling steps

The present study identifies the best assay for norovirus GI and GII to amplify norovirus genomes efficiently.

A known copy (104/reaction) of Oncorhynchus keta (O. keta) was added in the DNAse and RNAse free water and the Cq value obtained acted as a reference point. If the Cq value of a wastewater sample increases compared to the reference Cq value, the sample is considered to have PCR inhibitors.

adjusted for the time lag, the virus RNA concentrations were highly correlated with the COVID-19 epidemiological curve (R2=0.99) and local hospital admissions (R2=0.99)

The Rn value, or normalized reporter value, is the fluorescent signal from SYBR Green normalized to (divided by) the signal of the passive reference dye for a given reaction. The delta Rn value is the Rn value of an experimental reaction minus the Rn value of the baseline signal generated by the instrument. This parameter reliably calculates the magnitude of the specific signal generated from a given set of PCR conditions

observed discrepancies among RT-qPCR N1, N2 and N3 assays for several water samples in agreement to a previous report (Medema et al., 2020)

But if we do not lift the lockdown with immediate effect, we shall be confronted with mass ruin and a breakdown of all our structures — social, economic and emotional.

Rosario et al. recovered between 63 and 77% of spiked PMMoV in treated wastewater using centrifugal ultrafiltration

Although unnecessary for simple singleplex amplifications, spectral calibration is critical for multiplexed assays so that overlapping fluorescent signals can be resolved from one another.

to concentrate the viruses, the 1‐l aliquot was acidified with 1 mol l−1 acetic acid to pH ~3·0 and then viruses were filtered onto a 47‐mm, 0·45‐μm HA negatively charged nitrocellulose filter

PMMoV concentrations vary over space and time, 106 to 1010 gene copies per liter of domestic wastewater are consistently detected

By far, the most abundant RNA virus identified in the feces of healthy individuals was PMMoV [6], which has also been readily identified in untreated wastewater from numerous locations

may be due to bacterial extracellular enzyme activity and protozoan or metazoan predation

Samples were spiked to achieve final virus concentrations of 5 × 104 PFU mL–1 for MHV, and 6—8 × 105 PFU mL–1 for ϕ6, MS2, and T3—these were low enough to be feasible concentrations present in wastewater (<106 PFU mL–1)

The spiked samples were stirred and then incubated at 4 °C; this temperature is at the low-end of mean municipal wastewater temperatures in the U.S.

Likewise, methods to concentrate and recover nonenveloped enteric viruses from wastewater and other environmental matrices may not be suitable for enveloped viruses.

a SARS coronavirus outbreak in an apartment complex in Hong Kong was attributed to the transport of viruses in wastewater to the air ducts

and some enveloped viruses were measured in wastewater biosolid residuals

Powdery mildew is a common disease which affects a wide variety of vegetable crops including eggplant, peppers and tomatoes, all in the nightshade family

All assays 36testedwere found to be highlyspecific for SARS-CoV-2, with no cross-reactivity with other respiratory 37viruses observed in our analysesregardless of the primer/probe set or kit used.

Of the 217sevendifferent primer/probe sets and one testing kit that we evaluated, all were found to be highly 218specific withno false positive results observed when assays were run on samples positive for a number 219of other respiratory viruses.

we evaluatedassays using sevendifferent primer/probe setsand one assay kit

ice nucleation activity of A. tumefaciens(pAHL-Ice) remained stable for up to 20 h when cells were incubated in the presence of oxo-C6-HSL

Our results demonstrated that the predicted T90 (time for 90% inactivation) of Phi6 under the 12 evaluated conditions varied from 24 min to 117 days depending on temperature, biological activity, and aqueous media composition.