Female New Zealand White rabbit (Small Animal Facility, National Institute of Immunology, New Delhi, India), 6 months of age was immunized intramuscularly with r-bZP3-DT conjugate equivalent to 125 Jlg of r-bZP3 (expressed in SG13009[pREP4] cells) in 0.9% saline emulsified with Squalene and Arlacel "A" in a ratio of 4: I and
705 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
Immunization of Rabbit
-
For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.
-
Purification and Conjugation
-
IMMUNOGENICITY AND IN VIVO CONTRACEPTIVE EFFICACY
-
Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).
-
Immunocytochemical Localization of Recombinant Proteins in Infected Cells
-
Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.
-
Analysis ofr-bZP3 in VI, V2, V3 and V4 Infected Cells and Supernatant
-
Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.
-
Radiolabeling of Recombinant Proteins in Infected S/9 Cells
-
Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.
-
Expression 'Of bZP3 in BEVS
-
For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.
-
Screening of the Recombinant Viruses
-
The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.
-
Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.
-
Plaque Assay for Isolating Viruses
-
Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
-
Construction of Recombinant Viruses
-
AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.
-
Cell Culture Techniques
-
650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.
-
The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at
-
Screening of the Recombinant Transfer Vector
-
(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
-
Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
-
Plasmid Construction
-
EXPRESSION IN BACULOVIRUS
-
Peptide antisera were generated in the laboratory against peptides PI, 23-45 aa residues with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVL VE), P2, 300-322 aa residues (CSFSKSSNSWFPVEGPADICQCC) and P3, 324-347 aa residues (KGDCGTPSHSRRQPHVVSQWSRSA) corresponding to bZP3 precursor protein in rabbits and were used to determine their reactivity with the r-bZP3 protein expressed in E. coli in an enzyme linked immunosorbent assay (ELISA). Microtitration plates were coated with 200 ng of r-bZP3 or I J.tg/well of the peptide. HRPO conjugated goat anti-rabbit Ig at I :5000 dilution was used as revealing Ab.
-
Reactivity with Anti-peptide Sera
-
E. coli strains deficient in specific proteases were used to study their influence on the expression of r-bZP3. BL21 (DE3) and BL21 (pLysS) deficient in ompT and ion proteases and DF5 carrying a targeted mutation of the ptr gene, were transformed with the pQE-bZP3 plasmid. Colonies obtained were grown 0/N and subcultured next morning and grown till A6oo=0.7. Cultures were then induced with 0.5 mM IPTG for 3 h. Harvested cells were checked by SDS-P AGE and immunoblotting.
-
Expression of r-bZP3 in Different E. coli Strains
-
Conditions for expression of r-bZP3 in SG 13009[pREP4] cells transformed with the pQE-bZP3 plasmid were standardized. Cells were grown till A6oo=0.7 and induced with different concentrations of IPTG (0.5, 1, 2, or 4 mM) for a constant time period (3h) or induced with a 0.5 mM IPTG for different time periods (0, 1, 2, 3 or 5 h). Cells were harvested and analyzed by SDS-PAGE and immunoblot as described above.
-
Standardization of Expression Conditions
-
A I 00 ml culture was grown and induced according to the procedure mentioned above. The culture was divided into 2 aliquots and cells were pelleted down. For cytosolic localization, one pellet was resuspended in 5 ml of sonication buffer (50 mM Na-phosphate, pH 7.8, 300 mM NaCI). The sample was frozen and then thawed in ice-water and cells lysed by brief sonication. The sample was centrifuged at I 0,000 g for 20 min. The soup and the pellet represent the soluble and insoluble components of the cell pellet. In order to check for periplasmic localization, the 2nd aliquot of cells was resuspended in I 0 ml of hypertonic solution (30 mM Tris, pH 8, 20% sucrose, 1 mM EDT A) and incubated at RT for 10 min with shaking. Cells were centrifuged at 8,000 g for 10 min. The pellet was subjected to osmotic shock in 5 mM MgS04. Cells were stirred for 10 min in an ice water bath, centrifuged at 8000 g at 4°C for I 0 min. The soup collected represented the periplasmic fraction. The fractions were analyzed by 0.1% SDS-1 0% PAGE and Western blotting as described above.
-
Intracellular Localization
-
The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.
-
SDS-PAGE and Immunoblot
-
The pQE-bZP3 plasmid was transformed in Ml5[pREP4] and SG13009[pREP4] bacterial strains provided with the kit. The transformed colonies were analyzed for expression. A single transformed colony was inoculated and grown overnight at 37oc in 1 ml of LB containing 100 J..Lg/ml of ampicillin and 25 J..Lg/ml of kanamycin. Cells were subcultured 1:10, next morning and grown until cell density reached an A600 of approximately 0.6-0.7. The cells were further grown in the presence of isopropyl P-D thiogalactopyranoside (IPTG) to induce expression of the fusion protein under the T -5 promoter. The cells were collected by centrifugation at 13,000 g for 60 sec and the resulting pellet was stored at -700C until used.
-
Expression in MJS[pREP4] and SG13009[pREP4] E. coli Strains
-
vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
-
Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B
-
PCR Amplification and Cloning in pQE30 Vector
-
CLONING AND EXPRESSION IN E. coli
-
The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).
-
Analysis of Sequence
-
Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.
-
Sequencing of bZP3
-
centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.
-
A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,
-
Large Scale Plasmid DNA Isolation
-
mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.
-
Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents
-
Small Scale Plasmid DNA Isolation
-
E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
-
Preparation of Competent Cells and Transformation
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
Media Composition and Bacterial Culture
-
ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.
-
The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and
-
Agarose Gel Electrophoresis, Digestion and Ligation
-
Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.
-
PCR Amplification of bZP3
-
CLONING AND SEQUENCING OF bZP3
-
Radioisotopes: dCTP[a-32p] (3000 Ci/mM), dATP[a_35s] (1250 Ci/ mM) and 35s Met (I 000 Ci/ mM), were procured from NEN Life Sciences Products, Boston, MA, USA Others: Ni-nitrilo-tri-acetic acid (NTA) affinity resin from Qiagen; Membranes for Western blotting were obtained from BioRad; Hybond N and X-ray films were from Amersham; DNA and protein analysis softwares, PCgene from IntelliGenetics, Inc., Mountain View, CA, USA and Lasergene from DNASTAR Inc., Madison, Wisconsin, USA; Ultrafilteration assembly and YM5 membranes from Amicon Corp., Lexington, MA, USA.
-
from Gibco BRL; ampicillin, kanamycin and neutral red were from Sigma; FCS, was obtained from Biological Industries, Hibbutz Beit, Haemek, Israel. Bacterial Strains and Plasmids: M15[pREP4] and SG13009[pREP4] from Qiagen GmbH, Hilden, Germany, DH5a, BL21 (DE3) and BL21(pLysS) from Stratagene, La Jolla, USA, DF5 cells were kindly provided by Prof. K. Dharmalingam, Madurai Kamraj University, Madurai, Tamil Nadu, India. pBluescriptll SK( +) vector from Stratagene, pQE30 from Qiagen, pBacPAK8 vector from Clonetech Laboratories Inc., Palo Alto, CA, USA and pAcSecG2T vector, from Pharmingen, San Diego, CA, USA were obtained. Kits: Poly AT® tract mRNA isolation system and Riboclone® eDNA synthesis system from Promega Inc.; Geneclean® II kit from Bio 101 Inc., La Jolla, USA;Plasmid Midi kit and QIAexpress™ from Qiagen GmbH, Hilden, Germany; Sequenase version 2.0 DNA sequencing kit and Multiprime DNA labeling system from Amersham, Little Chalfont, Buckinghamshire, UK; BacPAK™ baculovirus expression system from Clonetech and Baculogold™ transfection kit from Pharmingen. Primers: Various oligonucleotide primers used were custom made by Rama Biotechnologies India Pvt. Ltd., Secunderab_ad, AP, India. Enzymes: Various restriction enzymes used and Vent DNA polymerase were procured from New England Biolabs, Beverly, MA, USA. Taq DNA polymerase was obtained from Stratagene. Antibodies and Conjugates: Goat anti-GST Ab was obtained from Pharmacia Biotech, Uppsala, Sweden. The following secondary revealing Abs were used: i) goat anti-mouse immunoglobulin G (lgG)-horse radish peroxidase (HRPO) from BioRad; ii) goat anti-rabbit IgG-HRPO (Pierce Chemical Co.); iii) goat anti-monkey IgG-HRPO (Sigma); iv) anti-rabbit-FITC and v) anti-goat-HRPO (Reagent Bank, Nil, New Delhi) vi) anti-mouse FITC (Dakopatts a/s, Glostrup, Denmark).
-
Chemicals: Tris, glycine, acrylamide, N', N'-methylene bisacrylamide, sodium dodecyl sulfate (SDS), N', N', N', N'-tetramethylethylene diamine (TEMED), ammonium persulfate (APS), ~-mercaptoethanol (BME), 4-chloronaphthol, urea, guanidine HCl, guanidine isothiocyanate (GITC), sarcosyl, sodium citrate, phenol, ficoll, polyvinylpyrrolidone (PVP), agarose, bromophenol blue, Coomassie brilliant blue, ethidium bromide, calcium chloride and bicinchoninic acid (BCA) were obtained from Sigma Chemical Co., St. Louis, MO, USA. LMP agarose and isopropyl ~-D thiogalactopyranoside (IPTG) were from Amresco, Solon, USA. Molecular weight standards were obtained from Gibco-BRL, Grand Island, NY, USA, or Bio-Rad Laboratories, Hercules, CA, USA. Reagents for enzyme immunoassays viz., bovine serum albumin (BSA), orthophenylene diamine (OPD) were procured from Sigma, while Tween-20 was obtained from Amresco. Reagents for conjugation and immunization, viz. diphtheria toxoid (DT) and tetanus toxoid (TT) were from Serum Institute, Pune, India while glutaraldehyde, L-lysine, 2, 6, 10, 15, 19, 23-hexamethyl-2, 6, 10, 14, 18, 22-tetracosa-hexane (Squalene) and mannide monooleate (Arlacel A) were procured from Sigma; Pergonal® was obtained from Laboratoires Serono S.A., Aubonne, Switzerland; Sodium phthalyl derivative of lipopolysaccharide (SPLPS) was kindly provided by the lmmunoendocrinology Laboratory, National Institute of Immunology (Nil), New Delhi. Reagents used in the estimation of progesterone such as gelatin, charcoal, dextran, 3H-progesterone and anti-progesterone Ab were provided by the WHO Matched Reagent Assay Programme while diphenoxazole (PPO), 1-4 bis (5-phenyl-2-oxazolyl) benzene (POPOP), and mercury-[(o-carboxyphenyl)thio]ethyl sodium salt (Thimerosal) were obtained from Sigma. Media and Antibiotics: Bacto-tryptone, bacto yeast extract and bacto agar were from Difco Laboratories, Detroit, USA; Grace's insect cell medium and antibiotic-antimycotic
-
REAGENTS
Tags
- Method-3-Method-7
- Method-3-Method-2
- Method-1-Method-1-detail
- Method-4-Method-1-detail
- Material-1
- Method-1-Method-3
- Method-3-Method-detail
- Method-1-Method-4
- Method-2-Method-6
- Method-2-Method-8-detail
- Method-2-Method-2-detail
- Method-3-Method-4-detail
- Method-3-Method-9
- Method-1-Method-3-detail
- Method-3-Method-5
- Method-4
- Method-3-Method-5-detail
- Method-2-Method-5-detail
- Method-1-Method-6
- Method-3-Method-1
- Method-2-Method-8
- Method-1-Method-6-detail
- Method-3-Method-10-detail
- Method-3-Method-2-detail
- Method-2-Method-4
- Method-1-Method-8
- Method-3-Method-9-detail
- Method-2-Method-3-detail
- Method-2-Method-2
- Method-3
- Method-1-Method-2-detail
- Method-2-Method-6-detail
- Method-1-Method-2
- Method-4-Method-1
- Method-2
- Material-1-detail
- Method-3-Method-7-detail
- Method-1-Method-4-detail
- Method-1-Method-5-detail
- Method-3-Method-10
- Method-1-Method-1
- Method-3-Method-8
- Method-3-Method-1-detail
- Method-2-Method-5
- Method-3-Method-6-detail
- Method-4-Method-2
- Method-2-Method-1
- Method-1-Method-5
- Method-1
- Method-1-Method-7
- Method-3-Method-6
- Method-3-Method-3-detail
- Method-3-Method-4
- Method-2-Method-1-detail
- Method-3-Method-3
- Method-1-Method-7-detail
- Method-4-Method-2-detail
- Method-2-Method-3
- Method-1-Method-8-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
NATIONAL INSTITUTE OF IMMUNOLOGY NEW DELHI FEBRUARY 1998
-
JA WAHARLAL NEHRU UNIVERSITY
-
RENUKAKAUL
-
CLONING, SEQUENCING AND EXPRESSION OF BONNET MONKEY (Macaca radiata) ZONA PELLUCIDA-3 (ZP3) GLYCOPROTEIN AND ITS IMMUNOGENICITY
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
~hCG and HBsAg sequences were accessed from GenBank or NBRF database on a Microvax II computer and sequence analysis performed using the HPLOT and AMPHI programmes. HPLOT is based on the algorithm of Kyte and Doolittle ( 1982 ) and plots the hydrophobic and hydrophilic segments of the protein by scanning the whole length of the sequence in blocks of a few residues. The window size used was 6 amino acids. AMPHI is based on the algorithm of Margalit et al., ( 1985 ) and predicts the amphipathic segments of the proetin which correspond to alpha helices and are therefore, likely candidates for being T cell epitopes.
-
Computer analysis.
-
for 3 hours at room temperature or OIN at 4 °c. The excess antibody was washed by washing the filters with PBST for 15 minutes with at least three changes. The filters were subsequently incubated in the appropriate dilution of the second antibody for one hour at room temperature. Dilutions of the primary as well as secondary antibody were made in 3 % BSA in PBST. Following incubation with the second antibody, the filters were washed vigorously with PBST for 5 minutes. The washing was repeated 5-6 times. Finally, the filters were washed twice in PBS and colour developed with DAB ( 0.5 mg I ml in PBS ) containing 6 ul I 10 ul of 30 % H2o2. The colour reaction was stopped after 5 -10 minutes by washing the filters with distilled water.
-
apparatus. At the end of the run, the gel was equilibrated for 15 minutes in the transfer buffer ( 25 mM Tris base,, 192 mM glycine, 20% V/V methanol). Immunoblotting was performed essentially as described by Towbin et al., 1979 ) . The proteins-were blotted on to nitrocellulose Schleicher and Schuell ) for 16 hours in LKB Transphor apparatus. After the completion of electric transfer of proteins, the nitrocellulose paper was washed with PBS 10 mM sodium phosphate buffer, pH 7.4, 0.9 % saline for 10 minutes at room temperature, with gentle rocking to wash off any adhering traces of acrylamide gel. The filter was then stained with a dilute solution of amide black. This was made by diluting 5 fold with water, a solution of 0. 2 % ami do black containing 45 % v;v methanol and 10 % v;v acetic acid. The staining was done for 5 10 seconds and the filter washed immediately with distilled water. The proteins transferred to the gel could be seen at this stage. The lane containing protein molecular weight standards was cut out and . preserved by drying and storage in dark. The filter could be cut into appropriate lanes at this stage. The filter was destained by repeated washing with PBS containing 0.2 % Tween-20 ( PBST ) . After the filter destained completely, it was incubated with 3 % BSA made in PBST for 1 hour at room temperature. During this and in all the subsequent steps, incubation of the filter was performed on a rocker platform to ensure a uniform treatment. The filters were then incubated in the appropriate dilution of the primary antibody
-
Electrophoretic separation of protein samples was carried out on 12.5 % SDS-PAGE in a discontinuous system as described by Laemmli ( 1970 ). The samples were reduced by boiling for 3 minutes in sample buffer containing J3-mercaptoethanol. The samples were then centrifuged for 5 minutes at 10,000 rpm to pellet down all particulate matter, prior to loading on the gel. Electrophoresis was carried out at 100 volts in a LKB vertical slab gel electrophoresis
-
Western blot.
-
The culture supernates containing the assiociated hCG heterodimer as described above, were tested for their ability to inhibit hCG induced testosterone production by Leydig cells. Leydig cell suspensions were prepared from NMRI inbred adult male mice essentially by the procedure of Van Damme et al., 1974 with modifications. The procedure has been described previously Pal, 1989 and involved the measu~ement of the testosterone produced by the Leydig cells following stimulation with culture supernate containing the associated alpha and beta subunits of hCG.
-
Leydig cell bioassay.
-
then estimated by monitoring its competitive binding to the hCG recepto~ in the presence of radiolabelled hCG. The testes homogenates from 10 -14 week old Wistar outbred rats were prepared by the method of Dighe and Moudgal ( 1983 ), and the receptor assay 1975 ), with 1989 ) .
-
Culture supernate from stable clones secreting alpha hCG was mixed with the culture supernate from stable clones showing J3hCG activity. The mixing was done with shaking at 37°C for 16 hours, to allow the two subunits to associate. The presence of the heterodimer in the culture supernate was
-
Radioreceptor assay.
-
The RIA for alpha hCG was similar to that used to estimate ~hCG. A monoclonal antibody specific to alpha hCG ( Gupta et al. , 1985 was used for the assay. The standard used was total hCG.
-
RIA for alpha hCG.
-
added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.
-
J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was
-
Quantitative determination of alpha hCG or J3hCG was performed by RIA using subunit specific antisera.
-
Radioimmunoassays.
-
conjugated to fluorescene isothiocyanate ( FITC ) or horse radish peroxidase HRP ) , added. In case of the FITC staining, the cells were finally mounted in a medium containing 0. 1 % para-phenylenediamine PPD and 90 % glycerol in NKH buffer, to retard fading of the fluorescent label. In case of HRP staining, the colour was developed with 0. 05 % DAB ( 3', 3-diaminobenzidine tetrahydrochloride ) in NKH buffer with 0. 002 % hydrogen peroxide. The colour was developed for 15 mins. and the reaction stopped by rinsing in phosphate buffer. The cells were examined under a standard 1 ight microscope for HRP staining or a fluorescent microscope ( for FITC staining ) .
-
Cells were grown to subconfluence on polylysine coated glass coverslips contained in plastic dishes. After washing with NKH buffer ( 145 mM NaCl, 5 mM KCl, 15 mM Hepes, pH 7. 4 ) , the cells were fixed for 10 mins. in 70 % ethanol at room temperature. The cells were again rinsed extensively in NKH buffer and the appropriate dilution of primary antibody added. Following OIN incubation at 4°c, the cells were washed 3 X with NKH buffer and the appropriate second antibody,
-
Immunocytochemistry.
-
Following transfection with calcium phosphate or lipofectin, the cells were selected for neomycin resistance by using the analogue G418 Geniticin in the culture medium. After 48 ·hours post -transfection, the cells were harvested and replated at a lower density ( 0.5 x 104 cells I 60 mm dish). Culture medium containing G418 was then added to the cells. G418 was used at two concentrations -400 ug I ml and 500 ug 1 ml. The cells were cultured in G418 containing medium for 2 - 3 weeks. During this period, the mock transfected cells and the cells transfected with plasmid lacking neo gene, died and the transformed cells formed colonies. Individual G418 resistant colonies were picked up and propagated as independent clones. The culture supernates from these clones were analysed by RIA for BhCG. The stability of the BhCG secreting clones was assessed by culturing with several passages over a few weeks in media with or without G418.
-
Isolation of stable clones.
-
Lipofectin was kindly provided by Syntex, Inc., USA as an aqueous solution containing 1 mg I ml of 1 ipid ( DOTMA DOPE; 50 50 ). The procedure used was as described by Feigner et al., 1987 with appropriate I modifications as suggested in the user s notes. Lipofection was done with 0.5 x 106 cells seeded on a 60 mm plate. For each plasmid, the lipofection was performed in duplicate. The amount and quality of the plasmid DNA used ranged from 400 ng of crude DNA prepared by the mini prep method, to 5 ug of highly purified, cesium banded DNA. The appropriate amount of DNA was suspended in 1.5 ml of serum free DMEM. In another tube, 30 ug of lipofectin was suspended in 1.5 ml of serum free DMEM. The two solutions were mixed. The cells were washed twice with HBSS to totally wash off all traces of serum. The DNA 1 lipofectin mix was then applied to the cells and the cells incubated for 4 hours at 37°C. Next, 3 ml of media containing 10 % FCS was added and the incubation continued at 3 7°C for 16 hours. The culture supernate was then aspirated off and fresh medium added to the cells. The selection for stable clones was started after 48 hours by the procedure described below.
-
Using lipofectin.
-
PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.
-
Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with
-
Using calcium phosphate.
-
Stable transfection was performed into CHO-K1 cells by the following procedures
-
stable transfection.
-
rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.
-
ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were
-
1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass
-
Transient expression of the cloned gene product was studied by transfection performed with
-
Transient expression.
-
Transfection.
-
with glutamine. Rat-2 and FWIL cells were cultured in IMDM supplemented with glutamine. All media were supplemented with 10 % fetal calf serum~ The cells were maintained in a 5 % co2 atmosphere and were split after 72 hours in culture, at a ratio of 1 : 15 approximately. For splitting the adherent cells, the cells were washed once with HBSS and 0.1 % trypsin in PBS added to the cells. The flask was shaken briefly to ensure a uniform distribution of trypsin over the cells. The cells were incubated in trypsin for 1 - 2 minutes after which 2 ml of FCS was added to the cells to inactivate the trypsin. The trypsin was carefully aspirated from the flask and fresh culture medium was added into the flask. The cells were dislodged from the bottom of the flask by gently tapping the flask against the working bench. Alternately, the cells were resuspended by vigorous pipetting up and down of the medium. The cells were centrifuged at 1500g for 5 minutes at room temperature and the supernate was discarded aseptically. The cells were resuspended in a known volume of fresh culture medium, an aliquot counted on a haemocytometer, and then accordingly seeded at the desired density in a fresh flask. For long term storage, the cells were frozen in a mixture of 95 ~ 0 culture medium and 5 ~ 0 DMSO in liquid nitrogen.
-
eHO-Kl cells were cultured in Ham s F-12 med1a. NIH3T3, mouse LMtk-and HeLa cells were cultured in DMEM supplemented
-
Growth and maintenance of cell lines.
-
transferred to another plastic box containing 2 X sse, 1 % SDS and washed at room temperature by gentle rocking for 15 minutes. The buffer was then changed and the washing continued at 60 in a shaking water bath for 30 minutes. Depending on the homology between the probe and the immobil ised DNA, the washing conditions were varied. The stringency ranged from 1 X sse, 1 % SDS, at 65°e to 0.2 X sse, 1 % SDS, at 65°e. After the washing, the filters were immediately sealed into plastic bags and put for autoradiography. Special care was taken to not to allow the filters to dry during any stage which might otherwise cause permanent binding of the probe to the filter preventing the reprobing of the same filter with a different probe at a later time. For autoradiography, the plastic bag containing the washed filter was fixed on a 3 MM Whatman sheet and placed securely ins ide a X ray cassette with one or two intensifying screens, and a X -ray film was placed over the filter in a dark room. The cassette was kept at -7o0e for the desired length of exposure. The film was taken out in the dark room, developed for approximately 3 minutes, washed in water for one minute to wash off all the developer adhering to the film, and fixed for 5 minutes. Finally, the film was washed in cold water for 10 minutes and air dried
-
The prehybridisation and hybridisation of the Southern filters was carried out as described by Maniatis et al., ( 1982 ), with some modifications. In all stages, the SDS concentration was maintained at 1 % to minimise the background likely to occur on the nylon membrane. Prehybridisation was done at 68°C, for 4 - 6 hours, with 0.1 ml of prehybridisation buffer for each square centimeter of the membrane. The probe was denatured by immersing the eppendorf tube in a boiling water bath for 10 minutes and added directly to the bag containing prehybridisation mix. Hybridisation was done in aqueous system, at 68°e, without the use of formam ide, for 18 - 2 4 hours, in a plastic bag kept submerged in a water bath, without any shaking. At the end of hybridisation, the filter was taken out of the bag and quickly immersed in a plastic box containing 5 X sse, 1 % SDS at room temperature. After 15 minutes, the filter was
-
Hybridisation of southern filters.
-
hours. The NC filters having bound DNA liberated from bacterial colonies, were set up for hybridisation with radioactive probes as described by Maniatis et al., ( 1982 ). The filters were washed thoroughly with a solution containing 50 mM Tris.Cl, pH 8.0, 1 M NaCl, 1 mM EDTA, 1 % SDS, at 42°C, for 1 hour, to wash off any residual bacterial debris and agar etc. Prehybridisation and hybridisation was performed in aqueous solution without formamide in 5 X SSPE. The filters were washed up to a stringency of 0.2 X sse at 65°e.
-
Colonies bound to nitrocellulose filter ( NC ) were lysed to liberate the DNA which was hybridised as described by Maniatis et al., 1982 ) . To obtain sharper autoradiography signals, the nitrocellulose filter bearing colonies was first overlaid on a 3 MM Whatman paper impregnated with 10 % SDS till the NC wetted evenly. The NC was peeled off and overlaid on another 3 MM paper impregnated with the denaturing solution. In this manner, the NC was successively treated with denaturing and neutralising solutions. Finally, the NC filter was air dried, sandwiched between two sheets of 3 MM paper and baked at 80°C for two
-
Colony hybridisation.
-
Hybridisa.tion of DNA L RNA bound to nylon membranes.
-
eppendorf tube was put at the bottom of the column to collect the eluate. The column was respun as before and the purified probe collected in the eppendorf tube, the unincorporated nucleotides remaining within the column. One ul aliquot from the purified probe was diluted 100 fold, mixed well and 1 ul aliquots were put in triplicate into 3 ml scintillation fluid containing vials which were counted in a Beckman Liquid Scintillation Counter. The total radioactivity of the probe was calculated by multiplying the mean radioactivity of the three diluted samples with a factor of 104 ( dilution factor, 102, total reaction volume, 102 ). The specific activity of the probes ranged from 1 X 107 to 5 x·1o7 cpm 1 ug DNA. The probe purified by the above method did not require any further purification.
-
The nick translated probe was purified by a spun column procedure to remove the unincorporated nucleotides. A sterile 1 ml syringe was plugged at the lower end with siliconised glass wool. The syringe was then filled with Bio-gel P-4 Bio Rad Laboratories, USA ) equilibrated in advance with TE. For doing this, 30 grammes of Bio-gel P-4 was slowly added into 250 ml of TE ensuring a good dispersion of the powder. This was then autoclaved at 15 psi for 20 minutes. After cooling, the supernate was decanted and replaced with an equal volume of sterile TE. The slurry was stored at 4°C. The slurry was poured upto the 1 ml mark in the syringe. The syringe was placed into a centrifuge tube and spun at 2000 · rpm for 3 minutes. The column was packed by repeating this process till the packed column volume reached 1 ml mark. Next, 50 ul of 2 mg 1 ml denatured salmon sperm DNA was loaded as carrier and the column spun as before. 100 ul of TE was then added to the column and it was respun as before. Finally, the nick translation reaction was diluted to 100 ul with TE and loaded on to the column. A sterile 1.5 ml
-
Purification of the probe.
-
400 ci 1 mmole to 3000 ci 1 mmole. The nick translation reaction was set up as recommended by the manufacturer of the kit, using about 0.5 ug DNA. The reaction was incubated at 12 -14 °C for 90 minutes, except in the case of small fragments ( 500 bp ) when the reaction was incubated for 45 minutes only. The reaction was terminated by the addition of stop buffer supplied with the kit.
-
DNA was labelled using the nick translation kits supplied by BRL or NEN, USA, or Amersham, UK. The 32P-deTP was from either NEN or Amersham, UK, at a concentration of 10 mei I ml. The specific activity of the label ranged from
-
Nick translation.
-
32~ -labelling of DNA.
-
Following electrophoretic resolution of total RNA, the gels were blotted on to GeneScreen membrane as described by Maniatis et al., 1982 ) .. The RNA gel to be used for blotting was not stained with ethidium bromide. The blotting was performed in 20 X sse or 20 X SSPE, OIN.
-
Northern blot.
-
bands seen in the DNA size marker, were marked with a ball -point pen at the places where small holes had been pierced in the gel earlier ( see above ). Thus it was easy to monitor the size of the fragments showing hybridisation to the probe. The gel was then peeled off and the membrane w~shed in 6 X sse with gentle rocking for 10 minutes to wash away any residual agarose sticking to the membrane. After air drying at room temperature, the membrane was baked at so0e for two hours. The baked filter was stored at room temperature in a dessicator, if not used immediately. The dehydrated gel was restained in water containing 0.5 ug I ml ethidium bromide for 30 minutes and examined on a short wave UV transilluminator to check for the presence of any DNA fragments that escaped blotting. The absence of any residual bands indicated that the transfer was complete.
-
Restriction fragments of DNA resolved on agarose gel were transferred to nylon membrane ( GeneScreen or GeneScreen Plus by the capillary blotting procedure of Southern ( 1975 ) as described by Maniatis et al., ( 1982 ) . After the completion of electrophoresis, the gel was stained and photographed as described earlier. Position of the various bands obtained in the DNA size marker lane were marked by piercing small holes at the two ends of each band in the gel with a yellow tip. The gel was then denatured, neutralised and blotted essentially as described by Maniatis et al., ( 1982 ) . Locally available coarse absorbent paper was used to make the paper towels of the appropriate size. In case of genomic DNA from mammalian cells, the agarose gel was first treated with 0.25 M HCl for 10 minutes, followed by the rest of the procedure as mentioned above. The transfer buffer was 20 X SSPE in all cases. To prevent the absorption of fluid from the 3 MM paper under the gel directly to the blotting paper atop the nylon membrane, the gel was surrounded with polythene sheets to minimise the direct contact between the blotting paper and the 3 MM paper placed under the gel. The blotting was performed for 18 -24 hours. After the transfer was over, the paper towels and the 3 MM papers on top of the nylon filter were peeled off. The gel along with the attached membrane, was turned over and kept on a clean sheet of 3 MM paper with the gel side up. The position of the gel slots was marked with a ball -point pen. Also, the positions of the
-
southern blot.
-
Colony lifts were performed essentially as described by Maniatis et al. , 1982 ) . Recombinant colonies were grown 0/N at 37°C to have well separated colonies. The colonies were overlaid with 80 mm diameter nitrocellulose filter circles BA 85, S & S and after the filter became wet throughout, it was peeled off in a single, smooth motion, avoiding the smearing of the bacterial colonies. The plate was reincubated at 37°C for a few hours to regenerate the colonies. The colonies transferred to the filter were lysed to bind the liberated DNA to the nitrocellulose.
-
Colony lifts.
-
Transfer of DNA.
-
Imrnobilisation of DNA L RNA on~ solid support.
-
lysed directly in 1. 5 ml of solution D ( 4 M guanidium thiocyanate, 25 rnM sodium citrate, pH 7.0, 0.5 % sarcosyl and 0.1 M 2-mercaptoethanol ) . For every 2 ml of the lysate, 0.2 ml of chloroform was added, followed by vigorous mixing for 15 seconds, and incubation on ice for 15 minutes. The lysate was spun at 12, OOOg, at 4 °c for 15 mins. , and the aqueous phase transferred to another tube. RNA was precipitated with an equal volume of isopropanol and incubation at -2o0c for 45 mins. The samples were then spun at 12,000g for 15 mins. at 4°c, and the supernate discarded. The RNA pellet was washed twice with 75 % ethanol. Finally, the pellet was dried briefly under vacuum for 10 -15 mins. and dissolved in 0.5 % SDS. All chemicals and glassware used for handling RNA were treated with diethylpyrocarbonate ( DEPC ) .
-
Total RNA was isolated from cultured mammalian cells by the method of Chornczynski and Sacchi ( 1987 ), with slight modifications. Briefly, cells from a 3.5 ern petri-dish were
-
Isolation of RNA
-
From an 0/N grown culture, 1 ml cells were pelleted in a 1.5 rnl eppendorf tube. The cells wer~ washed once with 100 ul of solution I ( 50 rnM glucose in 25 rnM Tris. HCl ,· pH 8. 0 ) . The cells were pelleted again and resuspended in 70 ul of solution I. To this, 20 ul of a freshly prepared solution of lysozyme 10 rng 1 ml in distilled water was added. The tube was vortexed to mix the contents and incubated in ice for 5 minutes. Next, 10 ul of 0.1 M EDTA, pH 8.0, was added, vortexed and the tube incubated in ice for 5 minutes. Next, 200 ul of solution IV ( 0.2 N NaOH + 1 % SDS was added, the contents vortexed quickly but briefly to mix and incubated in ice for 5 minutes. Finally, 150 ul of 5 M potassium acetate, pH 4. 8 was added and the tube incubated in ice. After 60 minutes, the tube was centrifuged for 10 minutes at 10,000 rpm, at 4°C. 450 ul of the supernate was removed to another tube and DNA precipitated with two volumes of ethanol at -7 0°C for 15 minutes. The DNA pellet was collected by centrifugation and after draining off the supernate, the pellet was washed with 80 % ethanol. The pellet was dried briefly under vacuum and finally resuspended in 150 ul TE. From this, a 10 ul aliquot was used for checking on gel or for•setting up digestions with restriction endon~cleases.
-
Plasmid DNA minipreps.
-
Transformation was performed in chilled 1.5 ml eppendorf tubes, using 200 ul of competent cells and about 50 ng of ligated plasmid DNA. Frozen competent cells were thawed in ice and the DNA was added immediately after thawing. The DNA volume was always kept under 30 ul. The DNA was mixed well with the cells by gentle tapping, and the tube incubated in ice for 3 0 minutes with occasional gentle shaking. The tube was then immersed in a 42°C water bath for 2 minutes, to give a heat shock to the cells. The cells were then incubated in ice for 10 minutes. Next, 1 ml LB was to the cells, and the cells incubated in a 37°C water bath without shaking, for one hour. 50 ul aliquots were plated in triplicate from the transformed cell mixture on suitable antibiotic containing agar plates and incubated 0/N at 37°C to select the transformants. In case of JM105 cells, the transformed cells were plated on antibiotic containing agar plates on which 50 ul of 2 % X-gal ( made in dimethyl formamide ) , and 10 ul of 100 mM IPTG had been spread in advance, to select for the lac-phenotype. The lac-colonies appeared colourless while the lac+ colonies were blue. For each batch of transformations, a negative control was included in which no DNA was added to the cells while keeping the rest of the procedure the same as for the test transformations.
-
Transformation procedure.
-
were stored at -70°C for at least six months without any significant loss in the competence.
-
A single ~.coli colony taken from an agar plate was used to inoculate 10 ml of LB and incubated 0/N at 37°C in an incubator-shaker. Next day, 0. 5 ml of this freshly grown culture was used to inoculate 100 ml of LB in a 500 ml flask. The culture was incubated at 37°C in an incubator -shaker and absorbance of the growing culture was monitored at 620 nm. When the A620 reached 0. 4 -0. 5 ( in about 120 -150 minutes), the flask was rapidly chilled by shaking in ice. The cells were harvested in sterile, chilled centrifuge bottles at 4, ooog for 10 minutes at 4 °c. The pellet was gently resuspended in 50 ml sterile, ice cold 100 mM cacl2 and the cells incubated in ice for 30 minutes. The cells were again centrifuged as above and the pellet resuspended in 6.5 ml of sterile, chilled, 100 mM cac12 containing 15 % glycerol. The cells were resuspended very gently, and a 200 ul aliquot was transformed with a standard plasmid DNA to check the competence of the cells. Meanwhile, the rest of the competent cells were incubated in ice for 16 -18 hours, to increase the competence of the cells a further few fold. After ascertaining high transformation efficiency of the competent cells, the cells were dispensed as 200 ul aliquots into prechilled, sterile 1.5 ml eppendorf tubes. These cells
-
Preparation of competent E.coli cells.
-
All glassware I plasticware used for transformation procedure was sterile and prechilled.
-
Transformation of E.coli.
-
minigel alongwith unligated vector to test the ligation. The ligated DNA was used to transform competent ~.coli cells.
-
Wherever possible, the cloning of DNA fragments was achieved by ligation of compatible sticky ends generated on the vector as well as the insert by digestion with the same enzyme. Self ligation of the linearised vector with compatible sticky ends was minimised by dephosphorylation of the vector DNA using bacterial alkaline phosphatase. The ligation conditions for each batch of T4 DNA ligase were standardised using Hind III generated fragments of lambda DNA as a test sample for sticky end ligation. Routinely, 200 ng of vector DNA was mixed with 2 - 5 fold molar excess of the insert fragment DNA, 2 ul each of the 10 X ligase buffer 500 mM Tris. HCl, pH 7. 5, 100 mM Mgcl2 ) , 10 mM ATP, and 200 mM DTT. The final reaction volume was adjusted to 15 - 2 0 ul with sterile double distilled water, and 0.5 - 1 ul of T4 DNA ligase ( 103 units I ml ) was added. The contents were mixed well and incubated at 13°C for 12 -16 hours. An aliquot of 2 ul was electrophoresed on a
-
Ligation of DNA fragments.
-
a 1.5 ml eppendorf tube and the gel slice put into the paper cone. The tube was centrifuged for 10 minutes at room temperature, to elute the DNA into the filtrate. The filtrate was extracted with one volume of phenol I chloroform ( 1:1 vlv ) , and the DNA precipitated from the aqueous phase by the addition of 5 M NaCl to a final concentration of 1 M, and 2 - 3 volumes of ethanol at -20°C, for a few hours. The centrifuged DNA pellet was dissolved in an appropriate volume of TE.
-
After digestion of the plasmid DNA with appropriate restriction enzymes, the DNA fragments were resolved by electrophoresis on preparative agarose gels of a suitable percentage, and stained with ethidium bromide as described above. Depending upon the amount of DNA to be resolved on the gel, the size of the sample well varied from 1.5 em - 5 em x 0.3 em, such that the desired fragment could be cut out with a minimum of agarose accompanying it. The DNA bands were visualised under long wave UV ( 366 nm ), using a hand held monitor model UVGL-58 Mineralight Lamp, UVP, Inc., California, USA), and the desired fragment cut out as a thin agarose slice keeping the size of the slice as small as possible ) . DNA was eluted from the agarose slice by the method of Zhu et al., ( 1985). Briefly, a GeneScreen ( NEN ) or Durapore ( Millipore, GVWP 04 700 membrane was wetted with 200 ul of elution buffer ( 0.1 % SDS +50 mM Tris. HCl, pH 7.5 ), and folded over to form a cone. Meanwhile, the conical lower half of an eppendorf tube was cut off and a hole pierced in the bottom with a hot wire or needle. The membrane was placed into this cone, pushing it as far as possible. This assembly was then transferred to
-
Isolation of restriction fragments of DNA
-
containing 2. 2 M formaldehyde and 50 % V /V formamide. The samples were chilled on ice for 5 mins. and loading buffer added. A Taq I digest of phi X 174 DNA, filled-in wi~h Klenow polymerase using 32P-dCTP, was used as size marker for electrophoresis. The gels were run at <5 Vjcm.
-
Total RNA was resolved in formaldehyde -agarose gels as described by Maniatis et al., ( 1982 ) • In general, the electrophoresis was performed using 1.2 ~ 0 agarose gels containing 2.2 M formaldehyde and 1 X running buffer 0.04 M rnorpholinopropanesulfonic acid -MOPS, pH 7.0; 0.01 M sodium acetate; 0.001 M EDTA ). RNA samples upto 20 ug in 5 ul ) were incubated at 55°c for 15 minutes in 5 X gel buffer
-
Electrophoresis of RNA.
-
lectrophoresed on 0.7 % -1.2 % agarose gels in TAE or TBE buffer. Choice of the percentage of agarose and the electrophoresis buffer system was made following the guidelines of Maniatis et al., ( 1982 ). In general, upto 1 kb fragments were resolved on 1.2 % agarose gels using TBE buffer. For most other purposes, TAE buffer was used. Agarose gel electrophoresis was carried out as described by Maniatis et al., ( 1982 ) . The run was stopped when the bromophenol blue dye migrated to within 1 em -1.5 em from the edge of ' the gel, except when the sample had fragments smaller than 500 bp, in which case the elctrophoresis was terminated at an earlier stage. The gel was immersed in water containing 0.5 ug I ml ethidium bromide, for 30 minutes, to stain the DNA. When detecting very low amounts of DNA, the staining was done for 60 minutes followed by destaining in 1 mM Mgso4 for one hour at room temperature. The DNA bands were visualised on a short wavelength UV transilluminator ( Fotodyne, Inc., USA and photographed with a Polaroid MP-4 camera using Polaroid type 667 film.
-
DNA digested with restriction enzymes was
-
For rapid electrophoretic analysis of plasmid DNA prepared by miniprep protocol, or to monitor the progress of digestion during various cloning procedures, the DNA was resolved on short agarose gels, taking less than one hour for the run. The electrophoresis was carried out in TAE buffer using 8 em long gels with a comb of teeth size 0.4 x 0.2 em. The width of the gel was variable, depending on the number of samples to be analysed. Gels were run at 50 100 volts, till the bromophenol blue dye migrated to within 0.5 em of the edge of the gel.
-
Mini gel electrophoresis
-
Electrophoresis of DNA
-
Agarose ~ electrophoresis
-
mixed with the sample by vortexing, and the DNA loaded on a preparative agarose gel. When digesting vector DNA in preparation for a ligation, the DNA was first purified from the digestion reaction as described in 3.2.4.8. This DNA was then treated with bacterial alkaline phophatase as described by Maniatis et al., 1982 ) • The dephosphorylated DNA was run on a preparative agarose gel to purify the linearised, dephosphorylated vector DNA. The efficiency of dephosphorylation was monitored by self ligation, followed by transformation of competent E.coli cells. Only after achieving efficient dephosphorylation of the vector DNA, was it used for ligation with the insert DNA.
-
For digestions aimed at purification of restriction fragments, 10 -20 ug of DNA was digested in a reaction mixture of about 100 -200 ul volume. Aliquots from the digestion reaction were checked on a minigel after one hour to monitor the extent of digestion. After the digestion was complete, one tenth volume of the 10 X tracking dye was
-
Digestions involving more than one restriction endonuclease were carried out with 2 - 4 ug DNA in a final reaction volume of up to 50 or 100 ul. In these cases, if the two enzymes had radically different optimal assay conditions, the DNA was digested first with the enzyme requiring a lower salt concentration. After incubating for one hour, a 5 ul aliquot from the digestion reaction was electrophoresed on a mini gel to monitor the extent of digestion. Once the digestion was complete, appropriate amount of salt and the
-
second enzyme were added and the incubation continued in an increased final reaction volume, to offset any increase in the glycerol concentration in the new reaction. Alternatively, the DNA was extracted once with phenol/chloroform, once with chloroform, and then precipitated with one half volume of 7.5 M ammonium acetate and two volumes of ethanol. The precipitation was done for 30 minutes at room temperature, and the DNA spun down for 30 minutes at room temperature. The supernate was discarded, pellet washed with 70% ethanol, recentrifuged, dried briefly under vacuum and finally resuspended in 18 ul distilled water. The DNA purified in this manner could then be used for setting up digestion with a second enzyme or for setting up a ligation. For those double digestions where one of the enzymes was known to be active over a broad range of ionic strength conditions, including those required for the optimal activity of the second enzyme, both the enzymes were added simultaneously in the digestion reaction, which was carried out using the optimal conditions of the second enzyme having more stringent assay requirements.
-
Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.
-
All fine chemicals and the thermal cycler used for PCR, were kindly provided by Cetus Corporation, California, USA. 3.2.4. Digestion of DNA with restriction enzymes. DNA samples were digested with restriction endonucleases in the appropriate digestion buffers as recommended by BRL. The digestion buffers were in most cases, supplied by BRL. Composition of the 1 X buffers is given in Table 4.
-
Figure !• Thermal cycle profile of a typical polymerase chain reaction ( PCR ). A typical PCR consists of repititive cycles of multiple temporal segments ( designated here as A - G ) with distinct target temperatures. After making the desired cocktail of template DNA, primers, Taq polymerase and the enzyme buffer, the reaction tube is incubated in a programmable thermal cycler, to incubate the reaction contents at pre-set temperatures for designated periods of time. Segments A -B, template denaturation; c -D, primer annealing; E -F, strand synthesis; G, ramp to the completion of the first cycle prior to the start of the next cycle ( dotted line ) . The duration and target temperature for each segment in an amplification cycle can be varied to suit the desired objectives.
-
plasmid DNA in a 100 ul mixture having 10 ul of 10 X PCR buffer, 10 ul of 10 mM dNTPs, 3 ul of each primer to give a final primer concentration of 1 uM, and 2.5 units of the Thermus aquaticus thermostable DNA polymerase. PCR reaction buffer ( 10 X ) contains 500 mM KCl, 100 mM Tris. Cl, pH 8 . 3 ' 15 mM MgC12 and 0.1 9.,-0 gelatin. The mixture was subjected to PCR amplification in a programmed thermal cycler block set for 3 0 cycles. The procedure is diagramatically outlined in Fig. 1 and involved four steps : a) The reaction was heated to 95°C for 30 seconds to separate the two strands of the target DNA; b) the reaction was then cooled to 37°C for one minute to allow annealing of the two primers to the template DNA to occur ; c) next, the temperature was raised to 72°C and the reaction maintained at this temperature for 10 minutes, for primer extension to occur; d) at the end of the cycle, the temperature was again raised to 95°C as in step (a) to start a new cycle. In between the steps (a) to (d), one minute ramp times were used to allow the efficient realisation of the set temperature. In the last cycle, the duration of step (c) was extended to ensure the conversion of all single strands into double stranded DNA. At the end of 30 cycles of PCR, a 10 ul aliquot from the PCR reaction was electrophoresed on a 1 % SeaKem I 3 % NuSieve agarose gel in TBE buffer, to resolve the PCR products. The amplified DNA was purified by electrophoresing the entire PCR mixture on a 1 % preparative agarose gel in TAE buffer.
-
Polymerase chain reaction was carried out as described by Scharf et al., ( 1986 ) , witD. some modifications. 23 mer oligonucleotide pri~ers synthesised by the solid phase triester method were designed to flank the target DNA desired to be amplified. A primer was designed to be complementary to , the 5 end of the phCG eDNA (+) strand and I was termed 5 primer ( also see Fig. 20 ) . Another primer was designed to be complementary to the sequence flanking the translation termination codon ( TAA ) of HBsAg (-) strand and this was I 1 I , termed 3 pr1mer. The 5 pr1mer also included the recognition sequence for restriction endonuclease Sal I as an overhang, while the I 3 primer included the recognition sequence for Hind III as an overhang. In addition, two extra bases ( G or C ) flanking the restriction site were included in the sequence of the primers, to improve the enzyme digestion. Thus, the nucleotide sequence of I the 5 primer read as : I I I 5 -GGCGTCGACATGGAGATGTTCCA-3 , while that for the 3 primer read I I as : 5 -CCAAGCTTTTAAATGTATACCCA-3 . A standard PeR· reaction contained 500 ng to 1 ug
-
Polymerase chain reaction ( PCR 1·
-
was added followed by gentle shaking for 90 minutes at room temperature. This DNA was stored at 4°C. The DNA prepared by this method was of sufficient purity for restriction endonuclease cleavage and Southern blotting, but because of RNA contamination, this DNA could not be used for accurate absorbance measurements. However, typically a 30 ul aliquot was expected to contain approximately 10 ug DNA.
-
al., ( 1986). Briefly, about 108 cells were pelleted and the pellet washed twice with 10 mM phosphate buffered saline, pH 7. 4. The pellet was resuspended in 2 ml of a sol uti on containing 0.1 M NaCl, 0.2 M sucrose, 0.01 M EDTA, and 0.3 M Tris, pH 8.0. To this, 125 ul of 10 % SDS was added, mixed by vortexing and the sample incubated at 65°c for at least 30 minutes. Next, 350 ul of 8 M potassium acetate was added, the contents vortexed to mix and incubated on ice for 60 minutes. The lysate was centrifuged at 5000g for 10 minutes at 4 °c. The supernate was transferred to a new tube and extracted with 2 ml of phenol ( saturated previously with TE) and 2 ml of chloroform I isoamyl alcohol ( 24:1 ). The extraction was done by gentle rocking or by inverting the tube. The tube was spun at 1500g for 5 minutes to separate the two phases, and the upper aqueous phase was collected. This was re -extracted with 2 ml of chloroform I isoamyl alcohol as described above and the aqueous phase collected. Then 5 ml of ethanol was added to the aqueous phase to precipitate the DNA. The two layers were mixed slowly to prevent shearing of DNA. The DNA was pelleted by centrifugation at 1500g for 10 minutes at 4°C. The supernate was discarded very carefully, to minimise the loss of the loose DNA pellet. The DNA pellet was washed gently with 5 ml of 80 % ethanol. Again, the tube was centrifuged at 1500g to pellet the DNA and the supernate was discarded. The final DNA pellet was dried partially by letting the tube stand at room temperature for 30 minutes. To resuspend the DNA, 300 ul TE
-
Genomic DNA from cultured mammalian cells was isolated by a rapid procedure, essentially as described by Davis et
-
Isolation of genomic DNA from mammalian cells.
-
ecanted and the pellet dried briefly under vacuum. The final DNA pellet was resuspended in 500 ul of TE. A 1:50 dilution of the sample was used to measure the absorbance at 260 nm and at 280 nm. The A260 and A280 values were used to estimate the concentration and purity of the sample as described by Maniatis et al., ( 1982).
-
further purified by centrifugation to equilibrium in a 30 ml cesium chloride -ethidium bromide density gradient, as described by Maniatis et al., ( 1982 ) . The band corresponding to closed circular plasmid DNA was collected and further purified by a second centrifugation to equilibrium in a 6. 5 ml cesium chloride -ethidium bromide density gradient. The final DNA band collected from the gradient was extracted with an equal volume of isopropanol which had been previously saturated with TE and cesium chloride. This extraction was repeated twice to completely remove the ethidium bromide from the DNA sample. The DNA was then dialysed against one liter of TE for at least 8 hours, at 4 °c, with several changes of TE. To the dialysed sample, one tenth volume of 3 M sodium acetate, pH 5.2, was added and the DNA precipitated with two volumes of chilled ethanol. The precipitation was carried out 0/N at 0 -20 c. The precipitated centrifugation at 10, 000 rpm, DNA was collected by for 10 minutes. The supernate was carefully d
-
resuspended in 20 ml of Tris -Glucose solution ( 25 mM Tris. HCl, pH 8. 0; 50 mM Glucose ) . The cells were vortexed followed by repeated pipetting to obtain a uniform cell suspension. To this, 6.0 ml of a freshly prepared lysozyme solution ( 10 mg 1 ml, prepared freshly in sterile distilled water ) was added. The cell suspension was swirled to mix thoroughly and incubated for 5 minutes at room temperature. Next, 0.5 M EDTA was added to a final concentration of 10 mM, the contents swirled to mix and incubated in ice for 20 minutes. Next, 40 ml of a lytic mix containing 0. 1 % SDS and 0. 2 N NaOH was added. This was prepared freshly by mixing 4 ml of 10 % SDS solution into 36 ml of 0.22 N NaOH solution. The solution was mixed by vigorous but brief shaking till the cell lysate became clear, followed by incubation on ice for 5 minutes. Finally, 20 ml of 5 M potassium acetate solution, pH 4.8 was added. Again the contents were swirled to mix, followed by incubation in ice for at least 1 - 2 hours. The lysate was centrifuged at 10,000 rpm for 30 minutes at 4°c. The supernate was filtered through sterilised glass wool kept in a funnel, and collected in a graduated cylinder. The measured volume of the cell lysate was transferred into another centrifuge bottle and two volumes of 95 % ethanol added to precipitate the DNA, at 0 -20 c, 0/N. The DNA was pelleted by centrifugation at 10,000 rpm at 4 °c for 30 minutes. The supernate was carefully poured off and the pellet res~spended in 25 ml of TE ( 10 mM Tris.HCl, pH 8.0; 1 mM EDTA ). The plasmid DNA was
-
Plasmid DNA was isolated using the alkaline lysis method of Birnboim ( 1979 ) with slight modifications. One liter of TB supplemented with ampicillin @ 50 ug 1 ml was inoculated with 10 ml of a freshly grown primary culture and the culture incubated 0/N at 37°c, in an incubator -shaker. The cells were pelleted by centrifugation at 4000g for 10 minutes at 4 °c. The supernate was discarded and the pellet
-
Isolation of plasmid DNA.
-
Large scale isolation of DNA.
-
yeast extract, and 10 g NaCl in distilled water, pH adjusted to 7.5 with NaOH and final volume made up to one liter (Maniatis et al., 1982). Cultures of ~.coli cells transformed with plasmid DNA were grown in media supplemented with 50 ug/ml of ampicillin. For large scale plasmid DNA isolation, ~.coli cells were grown in an enriched medium, Terrific Broth ( TB ) . One liter of TB was prepared by adding 100 ml of a sterile solution of 0.17 M KH2Po4 and 0.72 M K2HPo4 to a sterile solution containing 12 g Bacto -tryptone, 24 g Bacto -yeast extract, 4.0 ml glycerol and water to a final volume of 900 ml ( Tartof and Hobbs, 1987 ) . The media were sterilised by autoclaving at 15 psi for 20 minutes. Heat labile compounds and antibiotics were sterilised by filtration through a 0.45 u nitrocellulose membrane and added to autoclaved media after cooling the same to 55°C. Solid media was prepared by adding 1. 5 % bacto -agar prior to autoclaving. Storage of ~.coli was carried out essentially as described by Maniatis et al., ( 1982).
-
Composition of growth media used for culturing ~. coli is given in Table 3. For routine propagation, ~.coli cells were grown in Luria Bertani medium LB ) . LB was prepared by dissolving 10 g Bacto -tryptone, 5 g Bacto -
-
Growth and storage of bacteria.
-
All computer software facilities were provided by the NII computer centre.
-
Computer software.
-
Nitrocellulose membranes ( BA85 ) were obtained from Schleicher and Schuell, Germany. GeneScreen and GeneScreen Plus membranes were from DuPont, USA. Millipore membranes ( 0.45 um ) were from Millipore Corporation, USA. 3 MM and 1 MM chromatography filter papers were from Whatman Ltd, U.K.
-
other Materials.
-
All antisera were obtained from the reagent bank at National Institute of Immunology, New Delhi.
-
Antisera.
-
Intensifying screens were from Kiran X-ray Screens, India. X -ray films were from Agfa -Gevaert, Belgium, Kodak, USA, or Hindustan Photo Films, India. Developer and fixer were from Hindustan Photo Films, India.
-
Materials for autoradiography.
-
32p -dCTP specific activity 400 or 800 Ci 1 mmole was from Amersham, UK or from New England Nuclear division of DuPont, USA. 125I was from Amersham.
-
Radioactive chemicals.
-
Ampicillin, tetracycline, chloramphenicol and gentamycin were from Sigma. Geniticin ( G418 ) was from Gibco Laboratories, USA.
-
Antibiotics.
-
Restriction endonucleases, T 4 DNA 1 igase, DNA polymerase I large fragment Klenow ) , bacterial alkaline phosphatase BAP were from BRL, USA and New England Biolabs, USA. Lysozyme and RNase A were from Sigma. Thermus aquaticus thermostable DNA polymerase was kindly provided by Cetus Corporation, California, USA.
-
Enzymes.
-
GTG ) were from FMC Bio Products, USA. SDS, ethidium bromide, calf thymus DNA, cesium chloride, tris base, dithiothreitol, IPTG, X -gal, DAB, ficoll, PVP, chloroquine, coomassie brilliant blue, amido black, bovine serum albumin, were from sigma Chemicals Company ( Sigma ) , USA. DEAE -dextran was from Pharmacia, Sweden. Nick translation kits were from Bethesda Research Laboratories BRL ) , USA, and Amersham International plc, UK. Lipofectin was kindly provided by Syntex, Inc. , USA. J3hCG RIA kit was from ICN Micromedic Systems, Inc., USA. Purified hCG 13,000 I.U./ mg was kindly provided by Dr. Y.Y. Tsang, Population Council, USA. HBsAg detection kit was from Abbott Laboratories, USA. Protein molecular mass standards were from Bio Rad Laboratories, USA. DNA size markers were from BRL. All other chemicals were from Glaxo Laboratories, India, and E. Merck, India.
-
Acrylamide, bisacrylamide, ammonium persulphate, Bio -gel P-4 and TEMED, were from Bio -Rad Laboratories, USA. Agarose ( SeaKem ) and low gelling agarose ( NuSieve
Tags
- Method-5-Method-1-Method-1-detail
- Method-10-detail
- Method-10
- Method-9-detail
- Material-7-detail
- Method-12-Method-2-detail
- Method-11-Method-1-Method-1
- Method-21
- Method-2-Method-2-detail
- Material-6
- Method-15-Method-3
- Method-15
- Method-13
- Method-7-detail
- method-15-method-2
- Material-3-detail
- Method-13-Method-2
- Method-12-Method-1-detail
- Method-9
- Method-17-detail
- Method-3-detail
- Method-19
- Method-8-detail
- Method-3-Method-2-detail
- method-4-method-1-detail
- Method-3
- Method-8-Method-2
- Method-11-Method-1-Method-1-detail
- Method-17
- Method-1-detail
- Method-15-Method-2-Method-1
- Material-10
- Method-5-Method-2
- Method-2-Method-1
- Method-8-Method-1-detail
- Method-13-Method-2-detail
- Method-1
- Method-12-Method-1
- Material-4-detail
- Method-5-Method-2-detail
- Method-18-Method-2
- Method-8-Method-1
- Method-3-Method-3-detail
- Method-2-Method-1-detail
- Method-19-detail
- Method-11-Method-1-Method-2
- Method-13-Method-1
- Method-20-detail
- Material-7
- Method-12-Method-2
- Method-20
- Method-13-Method-1-detail
- Method-11-Method-2
- Method-16
- Method-15-Method-1
- Method-22-detail
- Material-9-detail
- Method-5-Method-1-Method-2-detail
- Method-8
- Method-15-Method-2-Method-1-detail
- Method-18-Method-1-detail
- Method-14-detail
- Method-6
- Method-5
- Material-6-detail
- Material-10-detail
- Method-18-Method-2-detail
- Material-5
- Method-21-detail
- Method-6-detail
- Material-4
- Method-15-Method-1-detail
- Method-2-Method-2
- Method-11-Method-2-detail
- Method-5-Method-1
- Method-14
- Method-2
- Method-12
- Material-8-detail
- Method-18-detail
- Method-15-Method-3-detail
- method-15-method-2-detail
- Method-11-Method-1
- Method-16-detail
- Method-11-Method-1-Method-2-detail
- Method-7
- Material-9
- Material-8
- Material-5-detail
- Method-5-Method-1-Method-1
- Method-11
- Method-8-Method-2-detail
- Method-22
- Method-18
Annotators
URL
-