Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Manuscript number: RC-2025-03174

Corresponding author(s): Cristina, Tocchini and Susan, Mango

1. General Statements

We thank the reviewers for their thoughtful and constructive comments. We were pleased that the reviewers found our study “rigorous”, “well presented”, “technically strong”, and “novel”. We are also grateful for their recognition that our work identifies a function for a HOT region in gene regulation and provides new insights into the role of the uHOT in controlling dlg-1 expression.

Point-by-point description of the revisions

We have addressed the reviewers’ concerns by clarifying and refining the text, particularly regarding the intron 1 results, improving the quantitation and statistical analyses, and making adjustments and additions to text and figures.

Specific responses to each point are provided below in blue.

Reviewer #1

1. • The results fully support the authors conclusions regarding the significant role of the upstream HOT region ("uHOT") with strong fluorescence activity and substantial phenotypic effects (i.e., the animals have very low brood sizes and rarely progress through hatching). This data is well presented and technically well done.* Thank you.

2. In my view, their conclusions regarding the intronic HOT region are speculative and unconvincing. See below for main criticisms.*

We agree, and have made changes throughout the manuscript to make this point clearer. Specifically, we contextualize the role of intron 1 as a putative enhancer in reporter assays, but not in endogenous, physiological conditions. Some examples are:

Abstract: “(…) In contrast, the intronic region displays weak enhancer-like activity when tested in transcriptional reporter assays but is dispensable in transcriptional control when studied at the endogenous locus. Our findings reveal how HOT regions contribute to gene regulation during animal development and illustrate how regulatory potential identified in isolated contexts can be selectively deployed or buffered within the native genomic architecture.”

Background: “(…) The HOT region in the first intron possesses weak transcriptional capabilities that are restricted to epidermal cells as observed in transcriptional reporters, but seem to not be employed in physiological contexts.” As it will become clear reading this updated version of the manuscript, we cannot exclude at present a functional role during non-physiological conditions (e.g., stress)

Results and discussion: “(…) This is in contrast with what the reporter experiments showed, where intron 1 alone was permissive for transcription and slightly enhanced the FL transgene expression levels (Figure 1F,G and S4). (…)”

Other changes can be found highlighted in yellow in the manuscript.

• Furthermore, their conclusions about interactions between the two tested regions is speculative and they show no strong evidence for this claim.*

We thank the reviewer for raising this concern. To avoid overstating our conclusions, we now frame the potential interaction between the two studied HOT regions strictly in the context of previously published ARC-C data (Huang et al., 2022). We clarify in the revised text that these interactions have been observed in earlier work during larval stages (Huang et al., 2022), but remain to be validated during embryogenesis, and we present them solely as contextual information rather than as a central conclusion.

In Results and discussion section we wrote: “(…) Although the presence of a fountain at this locus remains to be confirmed during embryogenesis, Accessible Region Conformation Capture (ARC-C), a method that maps chromatin contacts anchored at accessible regulatory elements, showed that the putative HOT region interacts with other DNA sequences, including the first intron of dlg-1 (1). (…)”

* The authors claim that not all the phenotypic effects seen from deleting the uHOT region are specific to the dlg-1 gene. This is an interesting model, but the authors show essentially no data to support this or any explanation of what other gene might be regulated.*

We appreciate the reviewer’s comment and have revised the manuscript to ensure that the possibility of additional regulatory effects from the uHOT region is presented as a hypothesis rather than a claim. Our study was designed to investigate HOT-region–based transcriptional regulation rather than chromatin interactions, and we now make this scope more explicit in the text. The revised discussion highlights that, although ARC-C data suggest the uHOT region may contact other loci, the idea that these interactions contribute to the observed phenotypes remains speculative and will require dedicated future work.

In Results and discussion section we wrote: “(…) Because, as previously shown, the upstream HOT region exhibits chromatin interactions with other genomic loci (1), its depletion might affect gene expression of beyond dlg-1 alone. An intriguing hypothesis is that these phenotypes do not arise only from the reduction in dlg-1 mRNA and DLG-1 protein levels, but also from synergistic, partial loss-of-function phenotypes involving other genes (24). (…)”

* Finally, some of the hypotheses in the text could be more accurately framed by the authors. They claim HOT regions are often considered non-functional (lines 189-191). Also, they claim that correct expression levels and patterning is usually regulation by elements within a few hundred basepairs of the CDS (lines 78-80). These claims are not generally accepted in the field, despite a relatively compact genome. Notably, both claims were tested and disproven by Chen et al (2014), Genome Research, where the authors specifically showed strong transcriptional activity from 10 out of 10 HOT regions located up to 4.7 kb upstream of their nearest gene. Chen et al. 2014 is cited by Tocchini et al. and it is, therefore, surprisingly inconsistent with the claims in this manuscript.*

We thank the reviewer for this comment and have revised the text to clarify our intended meaning and avoid framing discussion points as absolute claims. We changed “often” to “frequently” in both sentences so that they better reflect general trends rather than universal rules.

The revised text now reads: “Controversially, C. elegans sequences that dictate correct expression levels and patterning are frequently located within a few hundred base-pairs (bp) (maximum around 1,000–1,500 bp) from a gene’s CDS (3,13–15),”;

And: “HOT regions in C. elegans, as well as other systems, have been predominantly associated with promoters and were frequently considered non-functional or simply reflective of accessible chromatin (25).”

Regarding the comparison to Chen et al., 2014, we note that their reporters did not include a reference baseline for “strong” transcriptional activity, and only five of the ten tested HOT regions were located more than 1.5 kb from the nearest TSS. Therefore, our phrasing is consistent with their findings while describing general trends observed in the C. elegans genome rather than absolute rules. We have also ensured that these sentences are presented as discussion points rather than definitive claims. We hope these revisions make the framing and context clearer to the reader. The fluorescence expression from the intronic HOT region is not visible by eye and the quantification shows very little expression, suggestive of background fluorescence. Although the authors show statistical significance in Figure 1G, I would argue this is possibly based on inappropriate comparisons and/or a wrong choice statistical test. The fluorescence levels should be compared to a non-transgenic animal and/or to a transgenic animal with the tested region shuffled but in an equivalent

We understand the reviewer’s concern regarding the low fluorescence levels observed for the intronic HOT reporter. To address this, we have now included a Figure S4 with higher-exposure versions of the embryos shown in Figure 1. These panels confirm that the nuclear signal is genuine: embryos without a functional transcriptional transgene do not display any comparable fluorescence, aside from the characteristic cytoplasmic granules associated with embryonic autofluorescence. Similar reference images have also been added to Figure S3 to clarify the appearance of autofluorescence under the same imaging conditions.

Regarding the quantitation analyses, as suggested by the reviewers, we now consistently quantify fluorescence by calculating the mean intensity for each embryo (biological replicates) and performing statistical analyses on these values. This approach ensures that the statistical tests are applied to independent biological measurements.

* I would suggest the authors remove their claims about the intronic enhancer and the interaction between the two regions. And I would suggest softening the claims about the uHOT regulation of another putatitive gene.*

We have revised the manuscript to avoid definitive claims regarding the presence of an interaction between the two studied HOT regions. These points are now presented strictly as hypotheses within the discussion, suggested by previously published ARC-C data rather than by our own experimental evidence. Likewise, we have softened our statements regarding the possibility that the uHOT region may regulate additional gene(s). This idea is now framed as a speculative model that will require dedicated future studies, rather than as a conclusion of the present work. Quotes can be found in the previous points (#3 and #4) raised by Reviewer 1.

* The authors would need to demonstrate several things to support their current claims. The major experiments necessary are:*

1. • Insert single-copy transgene with a minimal promoter and the intronic sequence scrambled to generate a proper baseline control. It is very possible that the intronic sequence does drive some expression, but the current control is not appropriate for statistical comparison (e.g., only the transgene with intron 1 contains the minimal promoter from pes-10, which may have baseline transcriptional activity even without the intron placed in front of the transgene).* We thank the reviewer for this suggestion. We agree that a scrambled-sequence control can be informative in some contexts; however, in this case we believe the existing data already address the concern. In our dataset, all uHOT reporter constructs—each containing the same minimal promoter—show consistent background levels in the absence of regulatory input, providing an internal baseline for comparison. For this reason, we consider the current controls sufficient to interpret the effects of the intronic region in reporter assays.

In general, the minimal Δpes-10 promoter is specifically designed to have negligible basal transcriptional activity on its own, and this property has been extensively validated in previous studies (reference included in the revised manuscript).

* It is not very clear why the authors did not test intron 1 within the H2B of the transgene and just the minimal promoter in front of the transgene, but only in the context of the full-length promoter. The authors show a minor difference in expression levels for the full-length (FL) and full-length with intron 1 (FL-INT1) but show a large statistical differnce. The authors use an inappropriate statistical test (T-test) for this experiment and treat many datapoints from the same embryo as independent, which is clearly not the case. Even minor differences in staging, transgene silencing in early development, or variability would potentially bias their data collection.*

We thank the reviewer for this comment. Our goal was to assess the potential contribution of intron 1 in two complementary contexts: (i) on its own, upstream of a minimal promoter, to test whether it can in principle support transcription, and (ii) within the full-length promoter construct, which more closely reflects the endogenous configuration. For this reason, we did not generate an additional construct placing intron 1 within the H2B reporter driven only by the minimal promoter, as we considered this redundant with the information provided by the existing INT1 and FL-INT1 reporters.

Regarding the statistical analysis, we agree that treating multiple measurements from the same embryo as independent is not appropriate. In the revised manuscript, we now use the mean fluorescence intensity per embryo as a single biological replicate and perform all statistical tests on these independent values. This approach avoids pseudo-replication and ensures that the analysis is robust to variability in staging or transgene behavior. The conclusions remain the same.

* The authors claim, based on ARC-C data previously published by their lab (Huang et al. 2022) that the dlg-1 HOT region interacts with "other" genomic regions. This is potentially interesting but the evidence for this should be included in the manuscript itself, perhaps by re-analyzing data from the 2022 manuscript?*

We thank the reviewer for this suggestion. The chromatin-interaction data referred to in the manuscript originate from the work of Huang et al., 2022, published by the Ahringer lab. As these ARC-C datasets are already publicly available and thoroughly analyzed in the original publication, we felt that reproducing them in our manuscript was not necessary for supporting the limited contextual point we make. Our intent is simply to note that previous work reported contacts between the uHOT region and additional loci. To address the reviewer’s concern, we have revised the manuscript to make clear that we are referencing previously published ARC-C observations and that we do not present these interactions as new findings from our study.

For example, in Results and discussion section we wrote: “(…) Because, as previously shown, the upstream HOT region exhibits chromatin interactions with other genomic loci (1), its depletion might affect gene expression beyond dlg-1 alone. An intriguing hypothesis is that these phenotypes do not arise only from the reduction in dlg-1 mRNA and DLG-1 protein levels, but also from a synergistic, partial loss-of-function phenotypes involving other genes (24). (…)”

* The fluorescence quantification is difficult to interpret from the attached data file (Table S1). For the invidividual values, it is unclear how many indpendent experiments (different embryos) were conducted. The authors should clarify if every data value is from an independent embryo or if they used several values from the same embryo. If they did use several values from the same embryo, how did they do this? Did they take very cell? Or did they focus on specific cells? How did they ensure embryo staging?*

We thank the reviewer for pointing this out. To clarify the quantification procedure, we have expanded the description in the Methods section (“Live imaging: microscopy, quantitation, and analysis”). The revised text now specifies that each data point represents the normalized fluorescence value obtained from three nuclei (or five junctions, depending on the construct), all taken from the same anatomical positions across embryos. Two independent biological replicates were performed for each experiment, with each embryo contributing a single averaged value.

As noted in the figure legends, the specific nuclei used for quantification are indicated in each panel (with dashed outlines), and a reference nucleus marked with an asterisk allows unambiguous identification of the same positions across all conditions. We are happy to further refine this description if additional clarification is needed.

* The authors also do not describe how they validated single-copy insertions (partial transgene deletions in integrants are not infrequent and they only appear to use a single insertion for each strain). This should be described and or added as a caveat if no validation was performed.*

The authors also do not describe any validation for the CRISPR alleles, either deletions or insertion of the synthetic intron into dlg-1. How were accurate gene edits verified.

We thank the reviewer for highlighting the importance of validating the genetic constructs. We have now clarified this more explicitly in the revised Methods section and in Table S1. All single-copy transgene insertions and all CRISPR-generated alleles were verified by genotyping and Sanger sequencing to confirm correct integration and the absence of unintended rearrangements.

• *

I am not convinced the statistical analysis of the fluorescence data is correct. Unless the authors show that every datapoint in the fluorescence quantification is independent, then I would argue they vastly overestimate the statistical significance. Even small differences are shown to have "***" levels of significance, which does not appear empirically plausible.

We thank the reviewer for highlighting this point. To ensure that each data point represents an independent measurement, we now calculate the mean fluorescence per embryo (from three nuclei or five junctions) and use these per-embryo means as biological replicates for statistical testing. Two independent experiments were performed for each condition. Statistical differences were evaluated using a one-tailed t-test on the per-embryo means, as indicated in the revised Methods section.

After this adjustment, the differences remain statistically significant, although less extreme than in the initial analysis (now p * *

This study is so closely related to the Chen et al study, that I believe this study should be discussed in more detail to put the data into context.

We thank the reviewer for this suggestion. While we refer to Chen et al., 2014 as a relevant prior study for context, we believe that our work addresses distinct questions and experimental approaches. Specifically, our study focuses on HOT region-based transcriptional regulation in the dlg-1 locus and its functional dissection in vivo, which is conceptually and methodologically different from the scope of Chen et al., 2014 where the author tested the functionality of HOT region-containing promoters in the context of single-copy integrated transcriptional reporters. We hope this is clearer to the reader in the revised manuscript.

* Add H2B to the mNG in Figure 1 in order to understand where the first intron was inserted.*

We thank the reviewer for this suggestion. A schematic representation of the transgene is already provided above the corresponding images to indicate the location of the first intron.

For additional clarity, we have now added the following sentence in the main text: “In the other, intron 1 was inserted in the FL transgene within the H2B coding sequence (at position 25 from the ATG), preserving the canonical splice junctions with AG at the end of the first exon and a G at the beginning of the second exon, so that it acted as a bona fide intron (FL-INT1) (Figure 1F).”

This should help readers understand the placement of the intron without requiring modifications to the figure itself.__ __

Reviewer #2

1) The authors suggest that the region upstream of the dlg-1 gene is a HOT region. Although they highlight that other broad studies pick up this region as a HOT region, it would be good that the authors dive into the HOT identity of the region and characterize it, as it is a major part of their study. In addition to multiple TFs binding to the site, there are different criteria by which a region would be considered a HOT region. E.g. is there increased signal on this region in the IgG ChIP-seq tracks? Is the area CpG dense?

We thank the reviewer for this suggestion. In the manuscript and Figure S1, we show several features of HOT regions, including transcription factor binding and chromatin marks. To further characterize the dlg-1 uHOT region, we have added the following sentence to the text: “The conserved region is positioned approximately four Kb from the CDS of dlg-1 in a CpG-dense sequence (2), and is overlapping and bordered by chromatin marks typically found in enhancers (5,16).”

This addition provides additional evidence supporting the identity of the region as a HOT region, complementing the features already presented.

* 2) When describing the HOT region, they refer to Pol II binding as 'confirming its role as a promoter': non-promoter regions can also have Pol II binding, especially enhancers. Having binding of Pol II does not confirm its role as promoter. On the contrary, seeing the K27ac and K4me1 would point towards it being an enhancer.*

The sentence has been revised to clarify the interpretation of Pol II binding: “This HOT site also contains RNA Pol II peaks during embryogenesis (Figure S1C), supporting its role as a promoter or enhancer (9).” This wording avoids overinterpreting Pol II binding alone, while acknowledging that the HOT region may have both promoter and enhancer characteristics.

We would like to note that the relevant chromatin marks (H3K27ac and H3K4me1), which are indicative of enhancer activity, are described in the text: “(…) Specifically, it is enriched in acetylated lysine 27 (H3K27ac) and mono- and di-methylated lysine 4 of histone H3 (H3K4me1/2), and depleted from tri-methylated lysine 4 of histone H3 (H3K4me3) (Figure S1D) (5,16). (…)”

These changes clarify that the HOT region may have enhancer characteristics and avoid overinterpreting the Pol II signal.

* 3) In S1B, the authors show TF binding tracks. They also have a diagram of the region subsets (HOT1-4) that were later tested. What is their criteria for dividing the HOT region into those fragments? From looking at Fig S1, the 'proper' HOT region (ie. Where protein binding occurs) seems to be divided into two (one chunk as part of HOT3 and one chunk as part of HOT4). Can the authors comment on the effects of this division?*

To clarify the criteria for dividing the HOT region into subregions, we have added the following sentence to the main text: “The subregions were chosen taking into account (i) enrichment of putative TF binding sites (uHOT1 for PHA-4, uHOT2 for YAP-1 and NHR-25, uHOT3 for ELT-3, and uHOT4 for PHA-4 and others (e.g., ELT-1 and ELT-3)), (ii) Pol II binding peaks, and (iii) histone modification peaks (Fig. S1C,D).”

This description explains the rationale behind the division and clarifies why the HOT region was split into these four fragments for functional testing.

* 4) For the reporter experiments, the first experiments carry the histone H2B sequence and the second set of experiments (where the HOT region is dissected) carry a minimal promoter Δ*pes-10 (MINp). The results could be affected by the addition of these sequences. Is there a reason for this difference? Can the authors please justify it?

The difference in reporter design reflects the distinct goals of the two sets of experiments. The H2B sequence, coupled to mNG, is used as a coding sequence throughout the first part of the study (reporter analysis). This is commonly used to (i) concentrate the fluorescence signal (mNG) into nuclei (H2B) and (ii) be able to identify specific cells more accurately for quantitation reasons (intensity and consistency). The Δpes-10 promoter is instead used to analyze whether specific sequences possess enhancer potential: this promoter alone possesses the sequences that can allow transcription only in the presence of transcription factors that bind to the studied sequence placed upstream it.

To clarify this distinction in the manuscript, we have added the following sentence: “(…) Each region was paired with the minimal promoter Δpes-10 (MINp) (Figure 1D) and generated four transcriptional reporters. Δpes-10 is commonly used to generate transcriptional reporter aimed at assessing candidate regulatory enhancer sequences (20). The minimal promoter drives expression only when transcription factors bind to the tested upstream sequence and test enhancer activity. (…)”

5) Regarding the H2B sequence: ' 137: first intron [...] inserted in the FL transgene within the H2B sequence, acting as an actual intron (FL-INT1)': how was the location of the insertion chosen? Does it disrupt H2B? can it be that the H2B sequence contributed to dampening down the expression of mNG and disrupting it makes it stronger? It would be important to run the first experiments with minimal promoters and not with the H2B sequence.

The location of the intron insertion within the H2B coding sequence was chosen to preserve proper splicing and avoid disrupting H2B protein. We added the following sentence to clarify this point: “(…) In the other, the intron was inserted in the FL transgene within the H2B coding sequence (at position 25 from the ATG), preserving the canonical splice junctions with AG at the end of the first exon and a G at the beginning of the second exon, so that it acted as a bona fide intron (FL-INT1) (Figure 1F). (…)”

* 6) Have the authors explored the features of the sequences underlying the different HOT subregions? (e.g. running a motif enrichment analysis)? Is there anything special about HOT3 that could make it a functional region? It would be good to compare uHOT3 vs the others that do not drive the correct pattern. Since it's a HOT region, it may not have a special feature, but it is important to look into it.*

We thank the reviewer for this suggestion. To clarify the rationale for dividing the HOT region into four subregions, we have added the following sentence to the main text: “(…) The subregions were chosen taking into account (i) enrichment of putative TF binding sites (uHOT1 for PHA-4, uHOT2 for YAP-1 and NHR-25, uHOT3 for ELT-3, and uHOT4 for PHA-4 and others (e.g., ELT-1 and ELT-3)), (ii) Pol II binding peaks, and (iii) histone modification peaks (Fig. S1C,D). (…)”

While uHOT3 does not appear to possess unique sequence features beyond these general HOT-region characteristics, this approach allowed us to systematically test which fragments contribute to transcriptional activity and patterning.

7) For comparisons, the authors run t-tests. Is the data parametric? Otherwise, it would be more suitable to use a non-parametric test.

To ensure that each data point represents an independent biological replicate, we now calculate the mean fluorescence intensity per embryo and perform statistical tests on these per-embryo means. The data meet the assumptions of parametric tests, and we use a one-tailed t-test as indicated in the Methods.

* 1) The authors work with C. elegans embryos at comma stage, according to the methods section. It would be good if the authors mentioned it in the main text so that the reader is informed.*

Thanks for this suggestion. We added this sentence in the main text: “(…) Live imaging and quantitation analyses on embryos at the comma stage (used throughout the study for consistency purposes) showed (…)”.

* 2) 'Notably, the upstream HOT region is located more than four kilo-bases (Kb) away the CDS, and the one in the first intron contains enhancer sites, too.': what do they mean by 'enhance sites, too'. Is the region known as a functional enhancer? If so, could you please provide the reference?*

Here the clarification from the revised text: “(…) Notably, the upstream HOT region is located more than four kilo-bases (Kb) away the CDS, and the one in the first intron does not only contain two TSS but also three enhancer sites (8). (…)”

* 3) 'We hypothesized the upstream HOT region is the main driver of dlg-1 transcriptional regulation.': this sentence needs more reasoning. What led to this hypothesis? Is it the fact of seeing multiple TFs binding there? The chromatin marks?*

The reasoning behind the hypothesis is described in the preceding paragraph, and to make this connection clearer, we have revised the sentence to begin with: “Considering all of this information, we hypothesized the upstream HOT region is the main driver of dlg-1 transcriptional regulation. (…)”.

This change explicitly links the hypothesis to the observed TF binding and chromatin marks described above.

* 4) The labels of S1B are too wide, as if they have stretched the image. Could the authors please correct this?*

Yes, we agree with Reviewer 2. We corrected this.

* 5) This sentence does not flow with the rest of the text '84 - cohesins have been shown to organize the DNA in a way that active enhancers make contacts in the 3D space forming "fountains" detectable in Hi-C data (17,18).': is there a reason to explain this? I would remove it if not, as it can confuse the reader.*

We thank the reviewer for this comment. We agree that the sentence could potentially interrupt the flow; however, it is important for introducing the concept of “fountains” in 3D genome organization, which is necessary to understand the subsequent statement: “(…) Although the presence of a fountain at this locus remains to be confirmed during embryogenesis, Accessible Region Conformation Capture (ARC-C), a method that maps chromatin contacts anchored at accessible regulatory elements, showed that the putative HOT region interacts with other DNA sequences, including the first intron of dlg-1 (1). (…)”.

Therefore, we have retained this sentence to provide the necessary background for readers.

* 6) The authors mentioned that 'ARC-C data showed the putative HOT region interacts with other DNA sequences, including the first intron of dlg': have the authors analysed the data from the previous paper? A figure with the relevant data could illustrate this interaction so that the reader knows which specific region has been shown to interact with which. This would also bring clarity as to why they chose intron1 for additional experiments.*

We thank the reviewer for this suggestion. We have examined the relevant ARC-C data from the previous publication (Huang et al., 2022). However, as these results are already published, we do not feel it is necessary to reproduce them in our manuscript. The mentioning of these interactions is intended only to introduce the concept for discussion and to provide context for why intron 1 was considered in subsequent experiments

* 7) 'two deletion sequences spanning from the beginning (uHOT) or the end (Short) of the HOT region until the dlg-1 CDS': From the diagrams of the figure, I understand that uHOT has the distal region deleted, and the short HOT has the distal and the upstream regions deleted. Is this correct? Could you clarify this in the text? E.g. 'we designed two reporters - one containing the sequence starting at the HOT region and ending at the dlg-1 CDS, and the other without the HOT region, but rather starting downstream of it until the dlg-1 CDS'.*

To clarify the design of the reporters, we have revised the text as follows: “(…) To test this idea, we generated three single-copy, integrated transcriptional reporters carrying a histone H2B sequence fused to an mNeon-Green (mNG) fluorescent protein sequence under the transcriptional control of the following dlg-1 upstream regions: (i) a full-length sequence (“FL” = Distal + uHOT + Proximal sequences), (ii) one spanning from the beginning of the HOT region to the dlg-1 CDS (“uHOT” = uHOT + Proximal sequences), and (iii) one starting at the end of the HOT region and ending at the dlg-1 CDS (“Short” = Proximal sequence) (Figure 1A-C). (…)”

This description clarifies which parts of the upstream region are included in each reporter and matches the schematics in Figure 1.

* 8) 'Specifically, it spanned from bp 5,475,070 to 5,475,709 on chromosome X and removed HOT2 and HOT2 sequences' - this is unclear to me. What sequences are removed? HOT2 and 3?*

Thanks for spotting this typo. It has now been corrected.

* 9) 'ARC-C' is not introduced. Please spell out what this is. Accessible Region Conformation Capture (ARC-C). It would be helpful to include a sentence of what it is, as it will not be known by many readers.*

You are right, we changed into: “(…) Although the presence of a fountain at this locus remains to be confirmed during embryogenesis, Accessible Region Conformation Capture (ARC-C), a method that maps chromatin contacts anchored at accessible regulatory elements, showed that the putative HOT region interacts with other DNA sequences, including the first intron of dlg-1 (1). (...)”

* 10) Fig 1 B, diagram on the right: the H2B sequence is missing. I see that is indicated in the legend as part of mNG but this can be misleading. Could the authors add it to the diagram for clarification?*

Yes, you are right. We added this in the figure.__ __

Reviewer #3

The authors' claims are generally supported by the data, thoug the last sentence of the abstract was a bit overstated. They state that they "reveal the function of HOT regions in animals development...."; it would be more accurate to state that they linked the role of an upstream HOT region to dlg-1 regulation, and their findings hint that this element could have additional regulatory functions. The authors can either temper their conclusions or try RNA-seq experiments to find additional genes that are misregulated by the delta-uHOT deletion allele. [OPTIONAL]. Another [OPTIONAL] experiment that would strengthen the claims is to perform RNAi knockdown or DLG-1 protein depletion and link that to phenotype to show that the dlg-1 mRNA and DLG-1 protein changes seen in the uHOT mutant do not explain the lethality observed.

We thank the reviewer for this comment. We have studied HOT region function in the context of a model organism, C. elegans; therefore, we believe that describing our findings as revealing a function of HOT regions in animal development is accurate. The sentence aims at noting that these observations may provide broader insights into HOT region regulation. We changed the last sentence of the abstract into: “(…) Our findings reveal how HOT regions contribute to gene regulation during animal development and illustrate how regulatory potential identified in isolated contexts can be selectively deployed or buffered within the native genomic architecture. (…)”.

We note that RNA-seq is beyond the scope of this study; our discussion of potential effects on other genes is intended only as a hypothesis for future work. RNAi of dlg-1 has been previously reported and is cited in the manuscript, providing context for the phenotypes observed and discussed.

1. * When printed out I cannot read what the tracks are in Fig S1. Adding larger text to indicate what those tracks are is necessary.* Yes, you are right. We changed this in the figure.

2. *

3. Line 79. I would change the word "usually" to "frequently" in the discussion about regulatory element position. While promoters ranging from a few hundred to 2000 basepairs are frequently used, there are numerous examples where important enhancers can be further away.*

Corrected.

* Line 93-95. The description of the reporters was very confusing. When referring to the deletion sequences it sounds like that is what is missing rather than what is included. Rather, if I understand correctly the uHOT is the sequence from the start of the uHOT to the CDS and Short starts at the end of uHOT (omitting it). Adding the promoter fragments to the figure would improve clarity.*

To clarify the design of the reporters, we have revised the text as follows: “(…) To test this idea, we generated three single-copy, integrated transcriptional reporters carrying a histone H2B sequence fused to an mNeon-Green (mNG) fluorescent protein sequence under the transcriptional control of the following dlg-1 upstream regions: (i) a full-length sequence (“FL” = Distal + uHOT + Proximal sequences), (ii) one spanning from the beginning of the HOT region to the dlg-1 CDS (“uHOT” = uHOT + Proximal sequences), and (iii) one starting at the end of the HOT region and ending at the dlg-1 CDS (“Short” = Proximal sequence) (Figure 1A-C). (…)”

This description clarifies which parts of the upstream region are included in each reporter and matches the schematics in Figure 1.

* Line 108. Re-work the phrase "increase majorly". Majorly increase would be better.*

We thank the reviewer for this suggestion. The verb is used here as an infinitive (“to increase majorly”), and in standard English the infinitive is usually not split. Therefore, we have kept the phrasing as it currently appears in the manuscript.

* Line 153-154. The deletion indicates that HOT2 and HOT2 were removed. Was one supposed to be HOT3?*

Thanks for spotting this typo. It has now been corrected.

* In the figure legends the number of animals scored and the number of biological repeats is missing.*

Added.

* Figure 1 title in the legend. Should read "main driver" not "man driver".*

Thanks for spotting this typo. It has now been corrected.

* The references need to be gone through carefully and cleaned up. There are numerous gene and species names that are not italicized. There are also extra elements added by the reference manager such as [Internet].*

Thanks for pointing it out. We used Zotero and the requested formatting from the journal of our choice. We will discuss with their team how to go through this issue.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

High occupancy target (HOT) regions are genomic sequences in C. elegans that are bound by large numbers of transcription factors and emerged from systematic ChIP-seq studies. Whether they play physiologically important roles in gene regulation is not clear. in In this manuscript, Tocchini et al. examine the function of two HOT regions using a combination of promoter reporters, genome editing, and smFISH. One HOT region is upstream of the dlg-1 gene and other is in the first intron of dlg-1.

The claims about the impact of the upstream HOT region on dlg-1 expression are convincing. Omitting the sequence in a promoter reporter reduces expression, the element is sufficient to drive expression from a MINp::mNG reporter, and deletion of the element reduces dlg-1 expression and causes developmental defects. The claims about the intronic HOT region need to be tempered slightly. The element drives weak expression in a MINp::mNG reporter but the replacement of the dlg-1 first intron with a syntron had no effect on expression, limiting the claims that be made about this regulatory element. The authors' claims are generally supported by the data, thoug the last sentence of the abstract was a bit overstated. They state that they "reveal the function of HOT regions in animals development...."; it would be more accurate to state that they linked the role of an upstream HOT region to dlg-1 regulation, and their findings hint that this element could have additional regulatory functions. The authors can either temper their conclusions or try RNA-seq experiments to find additional genes that are misregulated by the delta-uHOT deletion allele. [OPTIONAL]. Another [OPTIONAL] experiment that would strengthen the claims is to perform RNAi knockdown or DLG-1 protein depletion and link that to phenotype to show that the dlg-1 mRNA and DLG-1 protein changes seen in the uHOT mutant do not explain the lethality observed.

There are elements of the manuscript that must be improved for clarity/accuracy.

1. When printed out I cannot read what the tracks are in Fig S1. Adding larger text to indicate what those tracks are is necessary.
2. Line 79. I would change the word "usually" to "frequently" in the discussion about regulatory element position. While promoters ranging from a few hundred to 2000 basepairs are frequently used, there are numerous examples where important enhancers can be further away.
3. Line 93-95. The description of the reporters was very confusing. When referring to the deletion sequences it sounds like that is what is missing rather than what is included. Rather, if I understand correctly the uHOT is the sequence from the start of the uHOT to the CDS and Short starts at the end of uHOT (omitting it). Adding the promoter fragments to the figure would improve clarity.
4. Line 108. Re-work the phrase "increase majorly". Majorly increase would be better.
5. Line 153-154. The deletion indicates that HOT2 and HOT2 were removed. Was one supposed to be HOT3?
6. In the figure legends the number of animals scored and the number of biological repeats is missing.
7. Figure 1 title in the legend. Should read "main driver" not "man driver",
8. The references need to be gone through carefully and cleaned up. There are numerous gene and species names that are not italicized. There are also extra elements added by the reference manager such as [Internet].

Referee cross-commenting

I agree with the comments from the previous reviewers. The suggested experiments are reasonable. Reviewer 1's point about the Chen et al 2014 Genome Res paper is really important. I put the revision as unknown as it depended on whether they did the optional experiments I suggested. If they revise their text, tempering claims, adjusting statistical analyses, then that could be 1-3 months. If they did the RNA-seq that I suggested, that would be a longer timeline.

Significance

The study is generally rigorously done. Strengths are that this work finds a function for a HOT region in gene regulation. Limitations are that the work is currently very thorough regulatory element bashing. They convincingly demonstrate the role of uHOT in regulating dlg-1 and suggest that the reduction of DLG-1 levels does not explain the phenotype. This finding is of interest to basic researchers in gene regulation. Without going into that discrepancy more, the significance is limited. Linking HOT regions to novel regulatory mechanisms controlling multiple genes would be broadly interesting to the gene regulation and developmental biology.

I am a C. elegans molecular biologist with expertise in gene regulatory networks.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

The authors investigate the functionality of a HOT region located upstream of the dlg-1 gene in Caenorhabditis elegans. This region is bound by multiple proteins and enriched for H3K27ac and H3K4me1, features characteristic of enhancers. Using reporter assays, they dissect the region and identify a sub-fragment, HOT3, as responsible for driving gene expression in epidermis, with a pattern similar to that of dlg-1 itself. Deletion of this region leads to downregulation of dlg-1 and lethality before or shortly after hatching, in contrast to complete dlg-1 knockouts, which die at mid-embryogenesis. They further examine the role of the gene's first intron, previously reported to physically interact with the HOT region. Incorporating intron 1 into the reporter construct slightly increases expression, suggesting an additive regulatory effect. However, replacing intron 1 with a synthetic sequence at the endogenous locus does not cause major changes. Overall, this study demonstrates that HOT regions can play a functional role in gene regulation, challenging the prevailing view that they are largely non-functional.

Major comments:

Overall, the paper lacks to explain their reasoning on choosing certain conditions and it also lacks on discussions on relevant topics, highlighted below.

1) The authors suggest that the region upstream of the dlg-1 gene is a HOT region. Although they highlight that other broad studies pick up this region as a HOT region, it would be good that the authors dive into the HOT identity of the region and characterize it, as it is a major part of their study. In addition to multiple TFs binding to the site, there are different criteria by which a region would be considered a HOT region. E.g. is there increased signal on this region in the IgG ChIP-seq tracks? Is the area CpG dense?

2) When describing the HOT region, they refer to Pol II binding as 'confirming its role as a promoter': non-promoter regions can also have Pol II binding, especially enhancers. Having binding of Pol II does not confirm its role as promoter. On the contrary, seeing the K27ac and K4me1 would point towards it being an enhancer.

3) In S1B, the authors show TF binding tracks. They also have a diagram of the region subsets (HOT1-4) that were later tested. What is their criteria for dividing the HOT region into those fragments? From looking at Fig S1, the 'proper' HOT region (ie. Where protein binding occurs) seems to be divided into two (one chunk as part of HOT3 and one chunk as part of HOT4). Can the authors comment on the effects of this division?

4) For the reporter experiments, the first experiments carry the histone H2B sequence and the second set of experiments (where the HOT region is dissected) carry a minimal promoter Δpes-10 (MINp). The results could be affected by the addition of these sequences. Is there a reason for this difference? Can the authors please justify it?

5) Regarding the H2B sequence: ' 137: first intron [...] inserted in the FL transgene within the H2B sequence, acting as an actual intron (FL-INT1)': how was the location of the insertion chosen? Does it disrupt H2B? can it be that the H2B sequence contributed to dampening down the expression of mNG and disrupting it makes it stronger? It would be important to run the first experiments with minimal promoters and not with the H2B sequence.

6) Have the authors explored the features of the sequences underlying the different HOT subregions? (e.g. running a motif enrichment analysis)? Is there anything special about HOT3 that could make it a functional region? It would be good to compare uHOT3 vs the others that do not drive the correct pattern. Since it's a HOT region, it may not have a special feature, but it is important to look into it.

7) For comparisons, the authors run t-tests. Is the data parametric? Otherwise, it would be more suitable to use a non-parametric test.

Minor comments:

1) The authors work with C. elegans embryos at comma stage, according to the methods section. It would be good if the authors mentioned it in the main text so that the reader is informed.

2) 'Notably, the upstream HOT region is located more than four kilo-bases (Kb) away the CDS, and the one in the first intron contains enhancer sites, too.': what do they mean by 'enhance sites, too'. Is the region known as a functional enhancer? If so, could you please provide the reference?

3) 'We hypothesized the upstream HOT region is the main driver of dlg-1 transcriptional regulation.': this sentence needs more reasoning. What led to this hypothesis? Is it the fact of seeing multiple TFs binding there? The chromatin marks?

4) The labels of S1B are too wide, as if they have stretched the image. Could the authors please correct this?

5) This sentence does not flow with the rest of the text '84 - cohesins have been shown to organize the DNA in a way that active enhancers make contacts in the 3D space forming "fountains" detectable in Hi-C data (17,18).': is there a reason to explain this? I would remove it if not, as it can confuse the reader.

6) The authors mentioned that 'ARC-C data showed the putative HOT region interacts with other DNA sequences, including the first intron of dlg': have the authors analysed the data from the previous paper? A figure with the relevant data could illustrate this interaction so that the reader knows which specific region has been shown to interact with which. This would also bring clarity as to why they chose intron1 for additional experiments.

7) 'two deletion sequences spanning from the beginning (uHOT) or the end (Short) of the HOT region until the dlg-1 CDS': From the diagrams of the figure, I understand that uHOT has the distal region deleted, and the short HOT has the distal and the upstream regions deleted. Is this correct? Could you clarify this in the text? E.g. 'we designed two reporters - one containing the sequence starting at the HOT region and ending at the dlg-1 CDS, and the other without the HOT region, but rather starting downstream of it until the dlg-1 CDS'.

8) 'Specifically, it spanned from bp 5,475,070 to 5,475,709 on chromosome X and removed HOT2 and HOT2 sequences' - this is unclear to me. What sequences are removed? HOT2 and 3?

9) 'ARC-C' is not introduced. Please spell out what this is. Accessible Region Conformation Capture (ARC-C). It would be helpful to include a sentence of what it is, as it will not be known by many readers.

10) Fig 1 B, diagram on the right: the H2B sequence is missing. I see that is indicated in the legend as part of mNG but this can be misleading. Could the authors add it to the diagram for clarification?

Significance

HOT regions are thought to be artifacts from ChIP-seq experiments. This study provides evidence that at least some HOT regions can have a functional role in gene regulation, emphasizing that they should not be dismissed outright.

The findings will be of interest to researchers investigating the biological nature of HOT regions, as well as to those who have encountered HOT regions in their own sequencing datasets. In addition, researchers studying the regulation of dlg-1 in C. elegans may find this work particularly relevant. I work on gene regulation during embryonic development and my technical expertise is omics and fluorescence microscopy. Since I do not work in C. elegans, I cannot evaluate if the patterns/location of the signal is where they claim it to be, I do not know if the cells marked are epidermal cells.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary:

Provide a short summary of the findings and key conclusions (including methodology and model system(s) where appropriate).

In this manuscript, Tocchini et al. characterize two enhancer regions, one distal and one intronic, of the gene dlg-1 in C. elegans. The two enhancers are termed high-occupancy target (HOT) regions as defined by their binding of most transcription factors, as identified by the modENCODE project. The authors test transcriptional activity of the two HOT regions using single-copy transgene assays and assay their functional relevance by deleting the regions using CRISPR/Cas9 genome editing. The authors observe robust transcriptional activity and functional effects of the distal regulatory element and little evidence for enhancer activity from the intronic enhancer. From these assays, the authors conclude that the distal and intronic enhancers coordinate to fine tune gene expression in a cell-type specific manner.

Major comments:

• Are the key conclusions convincing?

• The results fully support the authors conclusions regarding the significant role of the upstream HOT region ("uHOT") with strong fluorescence activity and substantial phenotypic effects (i.e., the animals have very low brood sizes and rarely progress through hatching). This data is well presented and technically well done.

• In my view, their conclusions regarding the intronic HOT region are speculative and unconvincing. See below for main criticisms.
• Furthermore, their conclusions about interactions between the two tested regions is speculative and they show no strong evidence for this claim.
• The authors claim that not all the phenotypic effects seen from deleting the uHOT region are specific to the dlg-1 gene. This is an interesting model, but the authors show essentially no data to support this or any explanation of what other gene might be regulated.
• Finally, some of the hypotheses in the text could be more accurately framed by the authors. They claim HOT regions are often considered non-functional (lines 189-191). Also, they claim that correct expression levels and patterning is usually regulation by elements within a few hundred basepairs of the CDS (lines 78-80). These claims are not generally accepted in the field, despite a relatively compact genome. Notably, both claims were tested and disproven by Chen et al (2014), Genome Research, where the authors specifically showed strong transcriptional activity from 10 out of 10 HOT regions located up to 4.7 kb upstream of their nearest gene. Chen et al. 2014 is cited by Tocchini et al. and it is, therefore, surprisingly inconsistent with the claims in this manuscript.

The fluorescence expression from the intronic HOT region is not visible by eye and the quantification shows very little expression, suggestive of background fluorescence. Although the authors show statistical significance in Figure 1G, I would argue this is possibly based on inappropriate comparisons and/or a wrong choice statistical test. The fluorescence levels should be compared to a non-transgenic animal and/or to a transgenic animal with the tested region shuffled but in an equivalent - Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

Yes, I would suggest the authors remove their claims about the intronic enhancer and the interaction between the two regions. And I would suggest softening the claims about the uHOT regulation of another putatitive gene. - Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

Yes, the authors would need to demonstrate several things to support their current claims. The major experiments necessary are:

1. Insert single-copy transgene with a minimal promoter and the intronic sequence scrambled to generate a proper baseline control. It is very possible that the intronic sequence does drive some expression, but the current control is not appropriate for statistical comparison (e.g., only the transgene with intron 1 contains the minimal promoter from pes-10, which may have baseline transcriptional activity even without the intron placed in front of the transgene).
2. It is not very clear why the authors did not test intron 1 within the H2B of the transgene and just the minimal promoter in front of the transgene, but only in the context of the full-length promoter. The authors show a minor difference in expression levels for the full-length (FL) and full-length with intron 1 (FL-INT1) but show a large statistical differnce. The authors use an inappropriate statistical test (T-test) for this experiment and treat many datapoints from the same embryo as independent, which is clearly not the case. Even minor differences in staging, transgene silencing in early development, or variability would potentially bias their data collection.
3. The authors claim, based on ARC-C data previously published by their lab (Huang et al. 2022) that the dlg-1 HOT region interacts with "other" genomic regions. This is potentially interesting but the evidence for this should be included in the manuscript itself, perhaps by re-analyzing data from the 2022 manuscript?
4. Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

These experiments are not costly (two transgenes inserted by single-copy transgenesis) nor particularly time-consuming. With cloning, injection, and microscopy, these experiments can be conducted in 6 weeks with relatively few "hands on" hours. The cost should be very reasonably (reagents surely less than €500). - Are the data and the methods presented in such a way that they can be reproduced?

The data are not entirely clear and could benefit from additional details. This is a partial list but shows the general concern.

The fluorescence quantification is difficult to interpret from the attached data file (Table S1). For the invidividual values, it is unclear how many indpendent experiments (different embryos) were conducted. The authors should clarify if every data value is from an independent embryo or if they used several values from the same embryo. If they did use several values from the same embryo, how did they do this? Did they take very cell? Or did they focus on specific cells? How did they ensure embryo staging?

The authors also do not describe how they validated single-copy insertions (partial transgene deletions in integrants are not infrequent and they only appear to use a single insertion for each strain). This should be described and or added as a caveat if no validation was performed.

The authors also do not describe any validation for the CRISPR alleles, either deletions or insertion of the synthetic intron into dlg-1. How were accurate gene edits verified. - Are the experiments adequately replicated and statistical analysis adequate?

I am not convinced the statistical analysis of the fluorescence data is correct. Unless the authors show that every datapoint in the fluorescence quantification is independent, then I would argue they vastly overestimate the statistical significance. Even small differences are shown to have "***" levels of significance, which does not appear empirically plausible.

Minor comments:

• Specific experimental issues that are easily addressable.
• Are prior studies referenced appropriately?

This study is so closely related to the Chen et al study, that I believe this study should be discussed in more detail to put the data into context. - Are the text and figures clear and accurate?

Yes, the text and figurea are clear - Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

Add H2B to the mNG in Figure 1 in order to understand where the first intron was inserted.

Significance

• Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.
• Place the work in the context of the existing literature (provide references, where appropriate).
• State what audience might be interested in and influenced by the reported findings.
• Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

This manuscript shows an incremental advance in our understanding of HOT regions in C. elegans. The authors replicate similar data presented previously (enhancer assays on HOT regions, PMID: 24653213). Importantly, the authors funcationally validate their data with smFISH and CRISPR-mediated deletion of two enhancers (including the substitution of the intron for a synthetic intron), which is, to my knowledge, novel and advances the field. As such, the data presented validate and increase our confidence in prior results on HOT regions. Unfortunately, the more interesting conclusions about HOT region interactions and synergy to direct expression are less well supported. The work will likely be mainly of interest to C. elegans researchers working on transcriptional regulation. My own field of expertise is C. elegans gene regulation and my lab frequently uses transcriptional transgene assays to determine gene expression.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

__Reviewer #1 (Evidence, reproducibility and clarity (Required)): __

This study explores chromatin organization around trans-splicing acceptor sites (TASs) in the trypanosomatid parasites Trypanosoma cruzi, T. brucei and Leishmania major. By systematically re-analyzing MNase-seq and MNase-ChIP-seq datasets, the authors conclude that TASs are protected by an MNase-sensitive complex that is, at least in part, histone-based, and that single-copy and multi-copy genes display differential chromatin accessibility. Altogether, the data suggest a common chromatin landscape at TASs and imply that chromatin may modulate transcript maturation, adding a new regulatory layer to an unusual gene-expression system.

I value integrative studies of this kind and appreciate the careful, consistent data analysis the authors implemented to extract novel insights. That said, several aspects require clarification or revision before the conclusions can be robustly supported. My main concerns are listed below, organized by topic/result section.

TAS prediction * Why were TAS predictions derived only from insect-stage RNA-seq data? Restricting TAS calls to one life stage risks biasing predictions toward transcripts that are highly expressed in that stage and may reduce annotation accuracy for lowly expressed or stage-specific genes. Please justify this choice and, if possible, evaluate TAS robustness using additional transcriptomes or explicitly state the limitation.

TAS predictions derived only from insect-stage RNA-seq data because in a previous study it was shown that there are no significant differences between stages in the 5'UTR procesing in T. cruzi life stages (https://doi.org/10.3389/fgene.2020.00166) We are not testing an additional transcriptome here, because the robustness of the software was already probed in the original article were UTRme was described (Radio S, 2018 doi:10.3389/fgene.2018.00671).

Results - "There is a distinctive average nucleosome arrangement at the TASs in TriTryps": * You state that "In the case of L. major the samples are less digested." However, Supplementary Fig. S1 suggests that replicate 1 of L. major is less digested than the T. brucei samples, while replicate 2 of L. major looks similarly digested. Please clarify which replicates you reference and correct the statement if needed.

The reviewer has a good point. We made our statement based on the value of the maximum peak of the sequenced DNA molecules, which in general is a good indicative of the extension of the digestion achieved by the sample (Cole H, NAR, 2011).

As the reviewer correctly points, we should have also considered the length of the DNA molecules in each percentile. However, in this case both, T. brucei's and L major's samples were gel purified before sequencing and it is hard to know exactly what fragments were left behind in each case. Therefore, it is better not to over conclude on that regard.

We have now comment on this in the main manuscript, and we have clarified in the figure legends which data set we used in each case in the figure legends and in Table S1.

* It appears you plot one replicate in Fig. 1b and the other in Suppl. Fig. S2. Please indicate explicitly which replicate is in each plot. For T. brucei, the NDR upstream of the TAS is clearer in Suppl. Fig. S2 while the TAS protection is less prominent; based on your digestion argument, this should correspond to the more-digested replicate. Please confirm.

The replicates used for the construction of each figure are explicitly indicated in Table S1. Although we have detailed in the table the original publication, the project and accession number for each data set, the reviewer is correct that in this case it was still not completely clear to which length distribution heatmap was each sample associated with. To avoid this confusion, we have now added the accession number for each data set to the figure legends and also clarified in Table S1. Regarding the reviewer's comment on the correspondence between the observed TAS protection and the extent of samples digestion, he/she is correct that for a more digested sample we would expect a clearer NDR. In this case, the difference in the extent of digestion between these two samples is minor, as observed the length of the main peak in the length distribution histogram for sequenced DNA molecules is the same. These two samples GSM5363006, represented in Fig1 b, and GSM5363007, represented in S2, belong to the same original paper (Maree et al 2017), and both were gel purified before sequencing. Therefore, any difference between them could not only be the result of a minor difference in the digestion level achieved in each experiment but could be also biased by the fragments included or not during gel purification. Therefore, I would not over conclude about TAS protection from this comparison. We have now included a brief comment on this, in the figure discussion

* The protected region around the TAS appears centered on the TAS in T. brucei but upstream in L. major. This is an interesting difference. If it is technical (different digestion or TAS prediction offset), explain why; if likely biological, discuss possible mechanisms and implications.

We appreciate the reviewer suggestion. We cannot assure if it is due to technical or biological reasons, but there is evidence that L. major 's genome has a different dinucleotide content and it might have an impact on nucleosome assembly. We have now added a comment about this observation in the final discussion of the manuscript.

Additionally, we analyzed DRIP-seq data for L. major, recently published doi: 10.1038/s41467-025-56785-y, and we observed that the R-loop footprint co-localized with the MNase-protected region upstream of the TAS (new S5 Fig), suggesting that the shift is not related to the MNase-seq technique.

Results - "An MNase sensitive complex occupies the TASs in T. brucei": * The definition of "MNase activity" and the ordering of samples into Low/Intermediate/High digestion are unclear. Did you infer digestion levels from fragment distributions rather than from controlled experimental timepoints? In Suppl. Fig. S3a it is not obvious how "Low digestion" was defined; that sample's fragment distribution appears intermediate. Please provide objective metrics (e.g., median fragment length, fraction 120-180 bp) used to classify digestion levels.

As the reviewer suggests, the ideal experiment would be to perform a time course of MNase reaction with all the samples in parallel, or to work with a fixed time point adding increasing amounts of MNase. However, even when making controlled experimental timepoints, you need to check the length distribution histogram of sequenced DNA molecules to be sure which level of digestion you have achieved.

In this particular case, we used public available data sets to make this analysis. We made an arbitrary definition of low, intermediate and high level of digestion, not as an absolute level of digestion, but as a comparative output among the tested samples. We based our definition on the comparison of __the main peak in length distribution heatmaps because this parameter is the best metric to estimate the level of digestion of a given sample. It represents the percentage of the total DNA sequenced that contains the predominant length in the sample tested. __Hence, we considered:

low digestion: when the main peak is longer than the expected protection for a nucleosome (longer than 150 bp). We expect this sample to contain additional longer bands that correspond to less digested material.

intermediate digestion, when the main peak is the expected for the nucleosome core-protection (˜146-150bp).

high digestion, when the main peak is shorter than that (shorter than 146 bp). This case, is normally accompanied by a bigger dispersion in fragment sizes.

To do this analysis, we chose samples that render different MNase protection of the TAS when plotting all the sequenced DNA molecules relative to this point and we used this protection as a predictor of the extent of sample digestion (Figure 2). To corroborate our hypothesis, that the degree of TAS protection was indeed related to the extent of the MNase digestion of a given sample, we looked at the length distribution histogram of the sequenced DNA molecules in each case. It is the best measurement of the extent of the digestion achieved, especially, when sequencing the whole sample without any gel purification and representing all the reads in the analysis as we did. The only caveat is with the sample called "intermediate digestion 1" that belongs to the original work of Mareé 2017, since only this data set was gel purified. To avoid this problem, we decided to remove this data from figures 2 and S3. In summary, the 3 remaining samples comes from the same lab, and belong to the same publication (Mareé 2022). These sample are the inputs of native MNase ChIp-seq, obtain the same way, totally comparable among each other.

* Several fragment distributions show a sharp cutoff at ~100-125 bp. Was this due to gel purification or bioinformatic filtering? State this clearly in Methods. If gel purification occurred, that can explain why some datasets preserve the MNase-sensitive region.

The sharp cutoff is neither due to gel purification or bioinformatic filtering, it is just due to the length of the paired-end read used in each case. In earlier works the most common was to sequence only 50bp, with the improvement of technologies it went up to 75,100 or 125 bp. We have now clarified in Table S1 the length of the paired-reads used in each case when possible.

* Please reconcile cases where samples labeled as more-digested contain a larger proportion of >200 bp fragments than supposedly less-digested samples; this ordering affects the inference that digestion level determines the loss/preservation of TAS protection. Based on the distributions I see, "Intermediate digestion 1" appears most consistent with an expected MNase curve - please confirm and correct the manuscript accordingly.

As explained above, it's a common observation in MNase digestion of chromatin that more extensive digestion can still result in a broad range of fragment sizes, including some longer fragments. This seemingly counter-intuitive result is primarily due to the non-uniform accessibility of chromatin and the sequence preference of the MNase enzyme, which has a preference for AT reach sequences.

The rationale of this is as follows: when you digest chromatin with MNase and the objective is to map nucleosomes genome-wide, the ideal situation would be to get the whole material contained in the mononucleosome band. Given that MNase is less efficient to digest protected DNA but, if the reaction proceeds further, it always ends up destroying part of it, the result is always far from perfect. The better situation we can get, is to obtain samples were ˜80% of the material is contained in the mononucloesome band. __And here comes the main point: __even in the best scenario, you always get some additional longer bands, such as those for di or tri nucleosomes. If you keep digesting, you will get less than 80 % in the nucleosome band and, those remaining DNA fragments that use to contain di and tri nucleosomes start getting digested as well, originating a bigger dispersion in fragments sizes. How do we explain persistence of Long Fragments? The longest fragments (di-, tri-nucleosomes) that persist in a highly digested sample are the ones that were originally most highly protected by proteins or higher-order structure, or by containing a poor AT sequence content, making their linker DNA extremely resistant to initial cleavage. Once the majority of the genome is fragmented, these few resistant longer fragments become a more visible component of the remaining population, contributing to a broader size dispersion. Hence, you end up observing a bigger dispersion in length distributions in the final material. Bottom line, it is not a good practice to work with under or over digested samples. Our main point, is to emphasize that especially when comparing samples, it important to compare those with comparable levels of digestion. Otherwise, a different sampling of the genome will be represented in the remaining sequenced DNA.

Results - "The MNase sensitive complexes protecting the TASs in T. brucei and T. cruzi are at least partly composed of histones": * The evidence that histones are part of the MNase-sensitive complex relies on H3 MNase-ChIP signal in subnucleosomal fragment bins. This seems to conflict with the observation (Fig. 1) that fragments protecting TASs are often nucleosome-sized. Please reconcile these points: are H3 signals confined to subnucleosomal fragments flanking the TAS while the TAS itself is depleted of H3? Provide plots that compare MNase-seq and H3 ChIP signals stratified by consistent fragment-size bins to clarify this.

What we learned from other eukaryotic organisms that were deeply studied, such as yeast, is that NDRs are normally generated at regulatory points in the genome. In this sense, yeast tRNA genes have a complex with a bootprint smaller than a nucleosome formed by TFIIIC-TFIIB (Nagarajavel, doi: 10.1093/nar/gkt611). On the other hand, many promotor regions have an MNase-sensitive complex with a nucleosome-size footprint, but it does not contain histones (Chereji, et al 2017, doi:10.1016/j.molcel.2016.12.009). The reviewer is right that from Figure 1 and S2 we could observe that the footprint of whatever occupies the TAS region, especially in T. brucei, is nucleosome-size. However, it only shows the size, but it doesn't prove the nature of its components. Nevertheless, those are only MNase-seq data sets. Since it does not include a precipitation with specific antibodies, we cannot confirm the protecting complex is made up by histones. In parallel, a complementary study by Wedel 2017, from Siegel's lab, shows that using a properly digested sample and further immunoprecipitating with a-H3 antibody, the TAS is not protected by nucleosomes at least not when analyzing nucleosome size-DNA molecules. Besides, Briggs et. al 2018 (doi: 10.1093/nar/gky928) showed that at least at intergenic regions H3 occupancy goes down while R-loops accumulation increases. We have now added a new figure 4 replotting R-loops and MNase-ChIP-seq for H3 relative to our predicted TAS showing this anti-correlation and how it partly correlates with MNase protection as well. As a control we show that Rpb9 trends resembles H3 as Siegel's lab have shown in Wedel 2018. Moreover, we analyzed redate from a recently published paper (doi: 10.1038/s41467-025-56785-y) added a new supplemental figure 5 showing that a similar correlation between MNase protection and R-loop footprint occurs in L. major (S5 Fig).

* Please indicate which datasets are used for each panel in Suppl. Fig. S4 (e.g., Wedel et al., Maree et al.), and avoid calling data from different labs "replicates" unless they are true replicates.

In most of our analysis we used real replicated experiments. Such is the case MNase-seq data used in Figure 1, with the corresponding replicate experiments used in Figure S2; T. cruzi MNase-ChIP-seq data used in Figure 3b and 4a with the respective replicate used in Figures S4 and S5 (now S6 in the revised manuscript). The only case in which we used experiments coming from two different laboratories, is in the case of MNase-ChIP-seq for H3 from T. brucei. Unfortunately, there are only two public data sets coming each of them from different laboratories. The samples used in Fig 3 (from Siegel's lab) whether the IP from H3 represented in S4 and S5 (S6 n the updated version) comes from another lab (Patterton's). To be more rigorous, we now call them data 1 and 2 when comparing these particular case.

The reviewer is right that in this particular case one is native chromatin (Pattertons') while the other one is crosslinked (Siegel's). We have now clarified it in the main text that unfortunately we do not count on a replicate but even under both condition the result remains the same, and this is compatible with my own experience, were crosslinking does not affect the global nucleosome patterns (compared nucleosome organization from crosslinked chromatin MNAse-seq inputs Chereji, Mol Cell, 2017 doi: 10.1016/j.molcel.2016.12.009 and native MNase-seq from Ocampo, NAR, 2016 doi: 10.1093/nar/gkw068).

* Several datasets show a sharp lower bound on fragment size in the subnucleosomal range (e.g., ~80-100 bp). Is this a filtering artifact or a gel-size selection? Clarify in Methods and, if this is an artifact, consider replotting after removing the cutoff.

We have only filtered adapter dimmer or overrepresented sequences when needed. In Figures 2 and S3 we represented all the sequenced reads. In other figures when we sort fragments sizes in silico, such as nucleosome range, dinucleosome or subnucleosome size, we make a note in the figure legends. What the reviewer points is related to the length of the sequence DNA fragment in each experiment. As we explained above, the older data-sets were performed with 50 bp paired-end reads, the newer ones are 75, 100 or 125bp. This is information is now clarified in Table S1.

__Results - "The TASs of single and multi-copy genes are differentially protected by nucleosomes": __

__ __* Please include T. brucei RNA-seq data in Suppl. Fig. S5b as you did for T. cruzi.

We have shown chromatin organization for T. brucei in previous S5b to illustrate that there is a similar trend. Unfortunately, we did not get a robust list of multi-copy genes for T. brucei as we did get for T. cruzi, therefore we do not want to over conclude showing the RNA-seq for these subsets of genes. The limitation is related to the fact that UTRme restrict the search and is extremely strict when calling sites at repetitive regions. Additionally, attending to the request of one reviewer we have now changed the UTR predictions for T. brucei using a different RNA-seq data set from Lister 427(detail in method section). Given that with the new predictions it was even harder to obtain the list of multicopy genes for T. brucei, we decided to remove that figure in the updated version of the manuscript.

* Discuss how low or absent expression of multigene families affects TAS annotation (which relies on RNA-seq) and whether annotation inaccuracies could bias the observed chromatin differences.

The mapping of occurrence and annotations that belong to repetitive regions has great complexity. UTRme is specially designed to avoid overcalling those sites. In other words, there is a chance that we could be underestimating the number of predicted TASs at multi-copy genes. Regarding the impact on chromatin analysis, we cannot rule out that it might have an impact, but the observation favors our conclusion, since even when some TASs at multi-copy genes can remain elusive, we observe more nucleosome density at those places.

* The statement that multi-copy genes show an "oscillation" between AT and GC dinucleotides is not clearly supported: the multi-copy average appears noisier and is based on fewer loci. Please tone down this claim or provide statistical support that the pattern is periodic rather than noisy.

We have fixed this now in the preliminary revised version

* How were multi-copy genes defined in T. brucei? Include the classification method in Methods.

This classification was done the same way it was explained for T. cruzi. However, decided to remove the supplemental figure that included this sorting.

Genomes and annotations: * If transcriptomic data for the Y strain was used for T. cruzi, please explain why a Y strain genome was not used (e.g., Wang et al. 2021 GCA_015033655.1), or justify the choice. For T. brucei, consider the more recent Lister 427 assembly (Tb427_2018) from TriTrypDB. Use strain-matched genomes and transcriptomes when possible, or discuss limitations.

The most appropriate way to analyze high throughput data, is to aline it to the same genome were the experiments were conducted. This was clearly illustrated in a previous publication from our group were we explained how should be analyzed data from the hybrid CL Brener strain. A common practice in the past was to use only Esmeraldo-like genome for simplicity, but this resulted in output artifacts. Therefore, we aligned it to CL Brener genome, and then focused the main analysis on the Esmeraldo haplotype (Beati Plos ONE, 2023). Ideally, we should have counted on transcriptomic data for the same strain (CL Brener or Esmeraldo). Since this was not the case at that moment, we used data from Y strain that belongs to the same DTU with Esmeraldo.

In the case of T. brucei, when we started our analysis and the software code for UTRme was written, the previous version of the genome was available. Upon 2018 version came up, we checked chromatin parameters and observed that it did not change the main observations. Therefore, we continue working with our previous setups.

Reproducibility and broader integration: * Please share the full analysis pipeline (ideally on GitHub/Zenodo) so the results are reproducible from raw reads to plots.

We are preparing a full pipeline in GitHub. We will make it available before manuscript full revision

* As an optional but helpful expansion, consider including additional datasets (other life stages, BSF MNase-seq, ATAC-seq, DRIP-seq) where available to strengthen comparative claims.

We are now including a new figure 4 and a supplemental figure 5 including DRIP-seq and Rp9 ChIP-seq for T. brucei (revised Fig 4) and DRIP-seq for L. major (S5 Fig). Additionally, we added FAIRE-seq data to previous Fig 4 now Fig 5 (revised Fig 5C).

We are analyzing ATAC-seq data for T. brucei.

Regarding BSF MNase-seq, the original article by Mareé 2017 claims that there is not significant difference for average chromatin organization between the two life forms; therefore, is not worth including that analysis.

Optional analyses that would strengthen the study: * Stratify single-copy genes by expression (high / medium / low) and examine average nucleosome occupancy at TASs for each group; a correlation between expression and NDR depth would strengthen the functional link to maturation.

We have now included a panel in suplemental figure 5 (now revised S6), showing the concordance for chromatin organization of stratified genes by RNA-seq levels relative to TAS.

__Minor / editorial comments: __ * In the Introduction, the sentence "transcription is initiated from dispersed promoters and in general they coincide with divergent strand switch regions" should be qualified: such initiation sites also include single transcription start regions.

We have clarified this in the preliminary revised version

* Define the dotted line in length distribution plots (if it is not the median, please clarify) and consider placing it at 147 bp across plots to ease comparison.

The dotted line is just to indicate where the maximum peak is located. It is now clarified in figure legends.

* In Suppl. Fig. 4b "Replicate2" the x-axis ticks are misaligned with labels - please fix.

We have now fixed the figure. Thanks for noticing this mistake.

* Typo in the Introduction: "remodellingremodeling" → "remodeling

Thanks for noticing this mistake, it is fixed in the current version of the manuscript

**Referee cross-commenting** Comment 1: I think Reviewer #2 and Reviewer #3 missed that they authors of this manuscript do cite and consider the results from Wedel at al. 2017. They even re-analysed their data (e.g. Figure 3a). I second Reviewer #2 comment indicating that the inclusion of a schematic figure to help readers visualize and better understand the findings would be an important addition.

Comment 2: I agree with Reviewer #3 that the use of different MNase digestion procedures in the different datasets have to be considered. On the other hand, I don't think there is a problem with figure 1 showing an MNase-protected TAS for T. brucei as it is based on MNase-seq data and reproduces the reported results (Maree et al. 2017). What the Siegel lab did in Wedel et al. 2017 was MNase-ChIPseq of H3 showing nucleosome depletion at TAS, but both results are not necessary contradictory: There could still be something else (which does not contain H3) sitting on the TAS protecting it from MNase digestion.

Reviewer #1 (Significance (Required)):

This study provides a systematic comparative analysis of chromatin landscapes at trans-splicing acceptor sites (TASs) in trypanosomatids, an area that has been relatively underexplored. By re-analyzing and harmonizing existing MNase-seq and MNase-ChIP-seq datasets, the authors highlight conserved and divergent features of nucleosome occupancy around TASs and propose that chromatin contributes to the fidelity of transcript maturation. The significance lies in three aspects: 1. Conceptual advance: It broadens our understanding of gene regulation in organisms where transcription initiation is unusual and largely constitutive, suggesting that chromatin can still modulate post-transcriptional processes such as trans-splicing. 2. Integrative perspective: Bringing together data from T. cruzi, T. brucei and L. major provides a comparative framework that may inspire further mechanistic studies across kinetoplastids. 3. Hypothesis generation: The findings open testable avenues about the role of chromatin in coordinating transcript maturation, the contribution of DNA sequence composition, and potential interactions with R-loops or RNA-binding proteins. Researchers in parasitology, chromatin biology, and RNA processing will find it a useful resource and a stimulus for targeted experimental follow-up.

My expertise is in gene regulation in eukaryotic parasites, with a focus on bioinformatic analysis of high-throughput sequencing data

__Reviewer #2 (Evidence, reproducibility and clarity (Required)): __

Siri et al. perform a comparative analysis using publicly available MNase-seq data from three trypanosomatids (T. brucei, T. cruzi, and Leishmania), showing that a similar chromatin profile is observed at TAS (trans-splicing acceptor site) regions. The original studies had already demonstrated that the nucleosome profile at TAS differs from the rest of the genome; however, this work fills an important gap in the literature by providing the most reliable cross-species comparison of nucleosome profiles among the tritryps. To achieve this, the authors applied the same computational analysis pipeline and carefully evaluated MNase digestion levels, which are known to influence nucleosome profiling outcomes.

In my view, the main conclusion is that the profiles are indeed similar-even when comparing T. brucei and T. cruzi. This was not clear in previous studies (and even appeared contradictory, reporting nucleosome depletion versus enrichment) largely due to differences in chromatin digestion across these organisms. The manuscript could be improved with some clarifications and adjustments:

1. The authors state from the beginning that available MNase data indicate altered nucleosome occupancy around the TAS. However, they could also emphasize that the conclusions across the different trypanosomatids are inconsistent and even contradictory: NDR in T. cruzi versus protection-in different locations-in T. brucei and Leishmania.

We start our manuscript by referring to the first MNase-seq data sets publicly available for each TriTryp and we point that one of the main observations, in each of them, is the occurrence of a change in nucleosome density or occupancy at intergenic regions. In T. cruzi, in a previous publication from our group, we stablished that this intergenic drop in nucleosome density occurs near the trans-splicing acceptor site. In this work, we extend our study to the other members of TriTryps: T. brucei and L. major.

In T. brucei the papers from Patterton's lab and Siegel's lab came out almost simultaneously in 2017. Hence, they do not comment on each other's work. The first one claims the presence of a well-positioned nucleosome at the TAS by using MNase-seq, while the second one, shows an NDR at the TAS by using MNase-ChIP-seq. However, we do not think they are contradictory, or they have inconsistency. We brought them together along the manuscript because we think these works can provide complementary information.

On one hand, we infer data from Pattertons lab is slightly less digested than the sample from Siegel's lab. Therefore, we discuss that this moderate digestion must be the reason why they managed to detect an MNase protecting complex sitting at the TAS (Figure 1). On the other hand, Sigel's lab includes an additional step by performing MNase-ChIP-seq, showing that when analyzing nucleosome size fragments, histones are not detected at the TAS. Here, we go further in this analysis on figure 3, showing that only when looking at subnucleosome-size fragments, we can detect histone H3. And this is also true for T. cruzi.

By integrating every analysis in this work and the previous ones, we propose that TASs are protected by an MNase-sensitive complex (proved in Figure 2). This complex most likely is only partly formed by histones, since only when analyzing sub-nucleosomes size DNA molecules we can detect histone H3 (Figure 3). To be sure that the complex is not entirely made up by histones, future studies should perform an MNse-ChIP-seq with less digested samples. However, it was previously shown that R-loops are enriched at those intergenic NDRs (Briggs, 2018 doi: 10.1093/nar/gky928) and that R-loops have plenty of interacting proteins (Girasol, 2023 10.1093/nar/gkad836). Therefore, most likely, this MNase-sensitive complexed have a hybrid nature made up by H3 and some other regulatory molecules, possibly involved in trans-splicing. We have now added a new figure 4 showing R-loop co-localization with the NDR.

Regarding the comparison between different organisms, after explaining the sensitivity to MNase of the TAS protecting complex, we discuss that when comparing equally digested samples T. cruzi and T. brucei display a similar chromatin landscape with a mild NDR at the TAS (See T. cruzi represented in Figure 1 compared to T. brucei represented in Intermediate digestion 2 in Figure 2, intermediate digestion in the revised manuscript). Unfortunately, we cannot make a good comparison with L. major, since we do not count on a similar level of digestion. However, by analyzing a recently published DRIP-seq data-set for L. major we show that R-loop signal co localize with MNase-protection in a similar way (new S5 Fig).

Another point that requires clarification concerns what the authors mean in the introduction and discussion when they write that trypanosomes have "...poorly organized chromatin with nucleosomes that are not strikingly positioned or phased." On the other hand, they also cite evidence of organization: "...well-positioned nucleosome at the spliced-out region.. in Leishmania (ref 34)"; "...a well-positioned nucleosome at the TASs for internal genes (ref37)"; "...a nucleosome depletion was observed upstream of every gene (ref 35)." Aren't these examples of organized chromatin with at least a few phased nucleosomes? In addition, in ref 37, figure 4 shows at least two (possibly three to four) nucleosomes that appear phased. In my opinion, the authors should first define more precisely what they mean by "poorly organized chromatin" and clarify that this interpretation does not contradict the findings highlighted in the cited literature.

For a better understanding of nucleosome positioning and phasing I recommend the review: Clark 2010 doi:10.1080/073911010010524945, Figure 4. Briefly, in a cell population there are different alternative positions that a given nucleosome can adopt. However, some are more favorable. When talking about favorable positions, we refer to the coordinates in the genome that are most likely covered by a nucleosome and are predominant in the cell population. Additionally, nucleosomes could be phased or not. This refers not only the position in the genome, but to the distance relative to a given point. In yeast, or in highly transcribed genes of more complex eukaryotes, nucleosomes are regularly spaced and phased relative to the transcription start site (TSS) or to the +1 nucleosome (Ocampo, NAR, 2016, doi:10.1093/nar/gkw068). In trypanosomes, nucleosomes have some regular distribution when making a browser inspection but, given that they are not properly phased with respect to any point, it is almost impossible to make a spacing estimation from paired-end data. This is also consistent with a chromatin that is transcribed in an almost constitutive manner.

As the reviewer mention, we do site evidence of organization. We think the original observations are correct, but we do not fully agree with some of the original statements. In this manuscript our aim is to take the best we learned from their original works and to make a constructive contribution adding to the original discussions. In this regard, in trypanosomes there are some conserved patterns in the chromatin landscape, but their nucleosomes are far from being well-positioned or phased. For a better understanding, compare the variations observed in the y axis when representing av. nucleosome occupancy in yeast with those observed in trypanosomes and you will see that the troughs and peaks are much more prominent in yeast than the ones observed in any TryTryp member.

Following the reviewer's suggestion we have now clarified this in the main text.

The paper would also benefit from the inclusion of a schematic figure to help readers visualize and better understand the findings. What is the biological impact of having nucleosomes, di-nucleosomes, or sub-nucleosomes at TAS? This is not obvious to readers outside the chromatin field. For example, the following statement is not intuitive: "We observed that, when analyzing nucleosome-size (120-180 bp) DNA molecules or longer fragments (180-300 bp), the TASs of either T. cruzi or T. brucei are mostly nucleosome-depleted. However, when representing fragments smaller than a nucleosome-size (50-120 bp) some histone protection is unmasked (Fig. 3 and Fig. S4). This observation suggests that the MNase sensitive complex sitting at the TASs is at least partly composed of histones." Please clarify.

We appreciate the reviewer's suggestion to make a schematic figure. We have now added a new Figure 6.

Regarding the biological impact of having mono, di or subnucleosome fragments, it is important to unveil the fragment size of the protected DNA to infer the nature of the protecting complex. In the case of tRNA genes in yeast, at pol III promoters they found footprints smaller than a nucleosome size that ended up being TFIIB-TFIIC (Nagarajavel, doi: 10.1093/nar/gkt611). Therefore, detecting something smaller than a nucleosome might suggest the binding of trans-acting factors different than histones or involving histones in a mixed complex. These mixed complexes are also observed, and that is the case of the centromeric nucleosome which has a very peculiar composition (Ocampo and Clark, Cells Reports, 2015). On the other hand, if instead we detect bigger fragments, it could be indicative of the presence of bigger protecting molecules or that those regions are part of higher order chromatin organization still inaccessible for MNase linker digestions.

Here we show on 2Dplots, that complex or components protecting the TAS have nucleosome size, but we cannot assure they are entirely made up by histones, since, only when looking at subnucleosome-size fragments, we are able to detect histone H3. We have now added part of this explanation to the discussion.

By integrating every analysis in this work and the previous ones, we propose that the TAS is protected by an MNase-sensitive complex (Figure 2). This complex most likely is only partly formed by histones, since only when analyzing sub-nucleosomes size DNA molecules we can detect histone H3 (Figure 3). As explained above, to be sure that the complex is not entirely made up by histones, future studies should perform an MNse-ChIP-seq with less digested samples. However, it was previously shown that R-loops are enriched at those intergenic NDRs (Briggs 2018) and that R-loops have plenty of interacting proteins (Girasol, 2023). Therefore, most likely, this MNase-sensitive complexed have a hybrid nature made up by H3 and some other regulatory molecules. We have now added a new figure 4 showing R-loop partial co-localization with MNase protection.

Some references are missing or incorrect:

we will make a thorough revision

"In trypanosomes, there are no canonical promoter regions." - please check Cordon-Obras et al. (Navarro's group). Thank you for the appropiate suggestion.

Thank you for the appropriate suggestion. We have now added this reference

Please, cite the study by Wedel et al. (Siegel's group), which also performed MNase-seq analysis in T. brucei.

We understand that reviewer number 2# missed that we cited this reference and that we did used the raw data from the manuscript of Wedel et. al 2017 form Siegel's group. We used the MNase-ChIP-seq data set of histone H3 in our analysis for Figures 3, S4 and S6 (in the revised version), also detailed in table S1. To be even more explicit, we have now included the accession number of each data set in the figure legends.

Figure-specific comments: Fig. S3: Why does the number of larger fragments increase with greater MNase digestion? Shouldn't the opposite be expected?

This a good observation. As we also explained to reviewer#1:

It's a common observation in MNase digestion of chromatin that more extensive digestion can still result in a broad range of fragment sizes, including some longer fragments. This seemingly counter-intuitive result is primarily due to the non-uniform accessibility of chromatin and the sequence preference of the MNase enzyme.

The rationale of this is as follows: when you digest chromatin with MNase and the objective is to map nucleosomes genome-wide, the ideal situation would get the whole material contained in the mononucleosome band. Given that MNase is less efficient to digest protected DNA but, if the reaction proceeds further, it always ends up destroying part of it, the result is always far from perfect. The better situation we can get, is to obtain samples were ˜80% of the material is contained in the mononucloesome band. __And here comes the main point: __even in the best scenario, you always have some additional longer bands, such as those for di or tri nucleosomes. If you keep digesting, you will get less than 80 % in the nucleosome band and, those remaining DNA fragments that use to contain di and tri nucleosomes start getting digested as well originating a bigger dispersion in fragments sizes. How do we explain persistence of Long Fragments? The longest fragments (di-, tri-nucleosomes) that persist in a highly digested sample are the ones that were originally most highly protected by proteins or higher-order structure, making their linker DNA extremely resistant to initial cleavage. Once most of the genome is fragmented, these few resistant longer fragments become a more visible component of the remaining population, contributing to a broader size dispersion. Hence, there you end up having a bigger dispersion in length distributions in the final material. Bottom line, it is not a good practice to work with under or overdirected samples. Our main point is to emphasize that especially when comparing samples, it important to compare those with comparable levels of digestion. Otherwise, a different sampling of the genome will be represented in the remaining sequenced DNA.

Minor points:

There are several typos throughout the manuscript.

Thanks for the observation. We will check carefully.

Methods: "Dinucelotide frecuency calculation."

We will add a code in GitHub

Reviewer #2 (Significance (Required)):

In my view, the main conclusion is that the profiles are indeed similar-even when comparing T. brucei and T. cruzi. This was not clear in previous studies (and even appeared contradictory, reporting nucleosome depletion versus enrichment) largely due to differences in chromatin digestion across these organisms. Audience: basic science and specialized readers.

Expertise: epigenetics and gene expression in trypanosomatids.

__Reviewer #3 (Evidence, reproducibility and clarity (Required)): __

The authors analysed publicly accessible MNase-seq data in TriTryps parasites, focusing on the chromatin structure around trans-splicing acceptor sites (TASs), which are vital for processing gene transcripts. They describe a mild nucleosome depletion at the TAS of T. cruzi and L. major, whereas a histone-containing complex protects the TASs of T. brucei. In the subsequent analysis of T. brucei, they suggest that a Mnase-sensitive complex is localised at the TASs. For single-copy versus multi-copy genes, the authors show different di-nucleotide patterns and chromatin structures. Accordingly, they propose this difference could be a novel mechanism to ensure the accuracy of trans-splicing in these parasites.

Before providing an in- depth review of the manuscript, I note that some missing information would have helped in assessing the study more thoroughly; however, in the light of the available information, I provide the following comments for consideration.

The numbering of the figures, including the figure legends, is missing in the PDF file. This is essential for assessing the provided information.

We apologized for not including the figure numbers in the main text, although they are located in the right place when called in the text. The omission was unwillingly made when figure legends were moved to the bottom of the main text. This is now fixed in the updated version of the manuscript.

The publicly available Mnase- seq data are manyfold, with multiple datasets available for T. cruzi, for example. It is unclear from the manuscript which dataset was used for which figure. This must be clarified.

This was detailed in Table S1. We have now replaced the table by an improved version, and we have also included the accession number of each data set used in the figure legends.

Why do the authors start in figure 1 with the description of an MNase- protected TAS for T.brucei, given that it has been clearly shown by the Siegel lab that there is a nucleosome depletion similar to other parasites?

We did not want to ignore the paper from Patterton's lab because it was the first one to map nucleosomes genome-wide in T. brucei and the main finding of that paper claimed the existence of a well-positioned nucleosome at intergenic regions, what we though constitutes a point worth to be discussed. While Patterton's work use MNase-seq from gel-purified samples and provides replicated experiments sequenced in really good depth; Siegel's lab uses MNase-ChIP-seq of histone H3 but performs only one experiment and its input was not sequenced. So, each work has its own caveats and provides different information that together contributes to make a more comprehensive study. We think that bringing up both data sets to the discussion, as we have done in Figures 1 and 3, helps us and the community working in the field to enrich the discussion.

If the authors re- analyse the data, they should compare their pipeline to those used in the other studies, highlighting differences and potential improvements.

We are working on this point. We will provide a more detail description in the final revision.

Since many figures resemble those in already published studies, there seems little reason to repeat and compare without a detailed comparison of the pipelines and their differences.

Following the reviewer advice, we are now working on highlighting the main differences that justify analyzing the data the way we did and will be added in the finally revised method section.

At a first glance, some of the figures might look similar when looking at the original manuscripts comparing with ours. However, with a careful and detailed reading of our manuscripts you can notice that we have added several analyses that allow to unveil information that was not disclosed before.

First, we perform a systematic comparison analyzing every data set the same way from beginning to end, being the main difference with previous studies the thorough and precise prediction of TAS for the three organisms. Second, we represent the average chromatin organization relative to those predicted TASs for TriTryps and discuss their global patterns. Third, by representing the average chromatin into heatmaps, we show for the very first time, that those average nucleosome landscape are not just an average, they keep a similar organization in most of the genome. These was not done in any of the previous manuscripts except for our own (Beati, PLOS One 2023). Additionally, we introduce the discussion of how the extension of MNase reaction can affect the output of these experiments and we show 2D-plots and length distribution heatmaps to discuss this point (a point completely ignored in all the chromatin literature for trypanosomes). Furthermore, we made a far-reaching analysis by considering the contributions of each publish work even when addressed by different techniques. Finally, we discuss our findings in the context of a topic of current interest in the field, such as TriTryp's genome compartmentalization.

Several previous Mnase- seq analysis studies addressing chromatin accessibility emphasized the importance of using varying degrees of chromatin digestion, from low to high digestion (30496478, 38959309, 27151365).

The reviewer is correct, and this point is exactly what we intended to illustrate in figure number 2. We appreciate he/she suggests these references that we are now citing in the final discussion. Just to clarify, using varying degrees of chromatin digestion is useful to make conclusions about a given organism but when comparing samples, strains, histone marks, etc. It is extremely important to do it upon selection of similar digested samples.

No information on the extent of DNA hydrolysis is provided in the original Mnase- seq studies. This key information can not be inferred from the length distribution of the sequenced reads.

The reviewer is correct that "No information on the extent of DNA hydrolysis is provided in the original Mnase-seq studies" and this is another reason why our analysis is so important to be published and discussed by the scientific community working in trypanosomes. We disagree with the reviewer in the second statement, since the level of digestion of a sequenced sample is actually tested by representing the length distribution of the total DNA sequenced. It is true that before sequencing you can, and should, check the level of digestion of the purified samples in an agarose gel and/or in a bioanalyzer. It could be also tested after library preparation, but before sequencing, expecting to observe the samples sizes incremented in size by the addition of the library adapters. But, the final test of success when working with MNase digested samples is to analyze length of DNA molecules by representing the histograms with length distribution of the sequenced DNA molecules. Remarkably, on occasions different samples might look very similar when run in a gel, but they render different length distribution histograms and this is because the nucleosome core could be intact but they might have suffered a differential trimming of the linker DNA associated to it or even be chewed inside (see Cole Hope 2011, section 5.2, doi: 10.1016/B978-0-12-391938-0.00006-9, for a detailed explanation).

As the input material are selected, in part gel- purified mono- nucleosomal DNA bands. Furthermore the datasets are not directly comparable, as some use native MNase, while others employ MNase after crosslinking; some involve short digestion times at 37 {degree sign} C, while others involve longer digestion at lower temperatures. Combining these datasets to support the idea of an MNase- sensitive complex at the TAS of T. brucei therefore may not be appropriate, and additional experiments using consistent methodologies would strengthen the study's conclusions.

In my opinion, describing an MNase- sensitive complex based solely on these data is not feasible. It requires specifically designed experiments using a consistent method and well- defined MNase digestion kinetics.

As the reviewer suggests, the ideal experiment would be to perform a time course of MNase reaction with all the samples in parallel, or to work with a fix time point adding increasing amounts of MNase. However, the information obtained from the detail analysis of the length distribution histogram of sequenced DNA molecules the best test of the real outcome. In fact, those samples with different digestion levels were probably not generated on purpose.

The only data sets that were gel purified are those from Mareé 2017 (Patterton's lab), used in Figures 1, S1 and S2 and those from L. major shown in Fig 1. It was a common practice during those years, then we learned that is not necessary to gel purify, since we can sort fragment sizes later in silico when needed.

As we explained to reviewer #1, to avoid this conflict, we decided to remove this data from figures 2 and S3. In summary, the 3 remaining samples comes from the same lab, and belong to the same publication (Mareé 2022). These sample are the inputs of native MNase ChIp-seq, obtain the same way, totally comparable among each other.

Reviewer #3 (Significance (Required)):

Due to the lack of controlled MNase digestion, use of heterogeneous datasets, and absence of benchmarking against previous studies, the conclusions regarding MNase-sensitive complexes and their functional significance remain speculative. With standardized MNase digestion and clearly annotated datasets, this study could provide a valuable contribution to understanding chromatin regulation in TriTryps parasites.

As we have explained in the previous point our conclusions are valid since we do not compare in any figure samples coming from different treatments. The only exception to this comment could be in figure 3 when talking about MNase-ChIP-seq. We have now added a clear and explicit comment in the section and the discussion that despite having subtle differences in experimental procedures we arrive to the same results. This is the case for T. cruzi IP, run from crosslinked chromatin, compared to T. brucei's IP, run from native chromatin.

Along the years it was observed in the chromatin field that nucleosomes are so tightly bound to DNA that crosslinking is not necessary. However, it is still a common practice specially when performing IPs. In our own hands, we did not observe any difference at the global level neither in T. cruzi (unpublished) nor in my previous work with yeast (compared nucleosome organization from crosslinked chromatin MNAse-seq inputs Chereji, Mol Cell, 2017 doi:10.1016/j.molcel.2016.12.009 and native MNase-seq from Ocampo, NAR, 2016 doi: 10.1093/nar/gkw068).

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The authors analysed publicly accessible MNase-seq data in TriTryps parasites, focusing on the chromatin structure around trans-splicing acceptor sites (TASs), which are vital for processing gene transcripts. They describe a mild nucleosome depletion at the TAS of T. cruzi and L. major, whereas a histone-containing complex protects the TASs of T. brucei. In the subsequent analysis of T. brucei, they suggest that a Mnase-sensitive complex is localised at the TASs. For single-copy versus multi-copy genes, the authors show different di-nucleotide patterns and chromatin structures. Accordingly, they propose this difference could be a novel mechanism to ensure the accuracy of trans-splicing in these parasites.

Before providing an in- depth review of the manuscript, I note that some missing information would have helped in assessing the study more thoroughly; however, in the light of the available information, I provide the following comments for consideration.

The numbering of the figures, including the figure legends, is missing in the PDF file. This is essential for assessing the provided information. The publicly available Mnase- seq data are manyfold, with multiple datasets available for T. cruzi, for example. It is unclear from the manuscript which dataset was used for which figure. This must be clarified. Why do the authors start in figure 1 with the description of an MNase- protected TAS for T.brucei, given that it has been clearly shown by the Siegel lab that there is a nucleosome depletion similar to other parasites? If the authors re- analyse the data, they should compare their pipeline to those used in the other studies, highlighting differences and potential improvements. Since many figures resemble those in already published studies, there seems little reason to repeat and compare without a detailed comparison of the pipelines and their differences. Several previous Mnase- seq analysis studies addressing chromatin accessibility emphasised the importance of using varying degrees of chromatin digestion, from low to high digestion (30496478, 38959309, 27151365). No information on the extent of DNA hydrolysis is provided in the original Mnase- seq studies. This key information can not be inferred from the length distribution of the sequenced reads. As the input material are selected, in part gel- purified mono- nucleosomal DNA bands. Furthermore the datasets are not directly comparable, as some use native MNase, while others employ MNase after crosslinking; some involve short digestion times at 37 {degree sign} C, while others involve longer digestion at lower temperatures. Combining these datasets to support the idea of an MNase- sensitive complex at the TAS of T. brucei therefore may not be appropriate, and additional experiments using consistent methodologies would strengthen the study's conclusions. In my opinion, describing an MNase- sensitive complex based solely on these data is not feasible. It requires specifically designed experiments using a consistent method and well- defined MNase digestion kinetics.

Significance

Due to the lack of controlled MNase digestion, use of heterogeneous datasets, and absence of benchmarking against previous studies, the conclusions regarding MNase-sensitive complexes and their functional significance remain speculative. With standardized MNase digestion and clearly annotated datasets, this study could provide a valuable contribution to understanding chromatin regulation in TriTryps parasites.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Siri et al. perform a comparative analysis using publicly available MNase-seq data from three trypanosomatids (T. brucei, T. cruzi, and Leishmania), showing that a similar chromatin profile is observed at TAS (trans-splicing acceptor site) regions. The original studies had already demonstrated that the nucleosome profile at TAS differs from the rest of the genome; however, this work fills an important gap in the literature by providing the most reliable cross-species comparison of nucleosome profiles among the tritryps. To achieve this, the authors applied the same computational analysis pipeline and carefully evaluated MNase digestion levels, which are known to influence nucleosome profiling outcomes.

In my view, the main conclusion is that the profiles are indeed similar-even when comparing T. brucei and T. cruzi. This was not clear in previous studies (and even appeared contradictory, reporting nucleosome depletion versus enrichment) largely due to differences in chromatin digestion across these organisms. The manuscript could be improved with some clarifications and adjustments:

1. The authors state from the beginning that available MNase data indicate altered nucleosome occupancy around the TAS. However, they could also emphasize that the conclusions across the different trypanosomatids are inconsistent and even contradictory: NDR in T. cruzi versus protection-in different locations-in T. brucei and Leishmania.
2. Another point that requires clarification concerns what the authors mean in the introduction and discussion when they write that trypanosomes have "...poorly organized chromatin with nucleosomes that are not strikingly positioned or phased." On the other hand, they also cite evidence of organization: "...well-positioned nucleosome at the spliced-out region.. in Leishmania (ref 34)"; "...a well-positioned nucleosome at the TASs for internal genes (ref37)"; "...a nucleosome depletion was observed upstream of every gene (ref 35)." Aren't these examples of organized chromatin with at least a few phased nucleosomes? In addition, in ref 37, figure 4 shows at least two (possibly three to four) nucleosomes that appear phased. In my opinion, the authors should first define more precisely what they mean by "poorly organized chromatin" and clarify that this interpretation does not contradict the findings highlighted in the cited literature.
3. The paper would also benefit from the inclusion of a schematic figure to help readers visualize and better understand the findings. What is the biological impact of having nucleosomes, di-nucleosomes, or sub-nucleosomes at TAS? This is not obvious to readers outside the chromatin field. For example, the following statement is not intuitive: "We observed that, when analyzing nucleosome-size (120-180 bp) DNA molecules or longer fragments (180-300 bp), the TASs of either T. cruzi or T. brucei are mostly nucleosome-depleted. However, when representing fragments smaller than a nucleosome-size (50-120 bp) some histone protection is unmasked (Fig. 3 and Fig. S4). This observation suggests that the MNase sensitive complex sitting at the TASs is at least partly composed of histones." Please clarify. Some references are missing or incorrect:

"In trypanosomes, there are no canonical promoter regions." - please check Cordon-Obras et al. (Navarro's group).

Please, cite the study by Wedel et al. (Siegel's group), which also performed MNase-seq analysis in T. brucei.

Figure-specific comments:

Fig. S3: Why does the number of larger fragments increase with greater MNase digestion? Shouldn't the opposite be expected?

Fig. S5B: Why not use MNase conditions under which T. cruzi and T. brucei display comparable profiles at TAS? This would facilitate interpretation.

Minor points:

There are several typos throughout the manuscript.

Methods: "Dinucelotide frecuency calculation."

Significance

In my view, the main conclusion is that the profiles are indeed similar-even when comparing T. brucei and T. cruzi. This was not clear in previous studies (and even appeared contradictory, reporting nucleosome depletion versus enrichment) largely due to differences in chromatin digestion across these organisms.

Audience: basic science and specialized readers.

Expertise: epigenetics and gene expression in trypanosomatids.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

This study explores chromatin organization around trans-splicing acceptor sites (TASs) in the trypanosomatid parasites Trypanosoma cruzi, T. brucei and Leishmania major. By systematically re-analyzing MNase-seq and MNase-ChIP-seq datasets, the authors conclude that TASs are protected by an MNase-sensitive complex that is, at least in part, histone-based, and that single-copy and multi-copy genes display differential chromatin accessibility. Altogether, the data suggest a common chromatin landscape at TASs and imply that chromatin may modulate transcript maturation, adding a new regulatory layer to an unusual gene-expression system.

I value integrative studies of this kind and appreciate the careful, consistent data analysis the authors implemented to extract novel insights. That said, several aspects require clarification or revision before the conclusions can be robustly supported. My main concerns are listed below, organized by topic/result section.

TAS prediction:

• Why were TAS predictions derived only from insect-stage RNA-seq data? Restricting TAS calls to one life stage risks biasing predictions toward transcripts that are highly expressed in that stage and may reduce annotation accuracy for lowly expressed or stage-specific genes. Please justify this choice and, if possible, evaluate TAS robustness using additional transcriptomes or explicitly state the limitation.

Results

• "There is a distinctive average nucleosome arrangement at the TASs in TriTryps":
• You state that "In the case of L. major the samples are less digested." However, Supplementary Fig. S1 suggests that replicate 1 of L. major is less digested than the T. brucei samples, while replicate 2 of L. major looks similarly digested. Please clarify which replicates you reference and correct the statement if needed.
• It appears you plot one replicate in Fig. 1b and the other in Suppl. Fig. S2. Please indicate explicitly which replicate is in each plot. For T. brucei, the NDR upstream of the TAS is clearer in Suppl. Fig. S2 while the TAS protection is less prominent; based on your digestion argument, this should correspond to the more-digested replicate. Please confirm. The protected region around the TAS appears centered on the TAS in T. brucei but upstream in L. major. This is an interesting difference. If it is technical (different digestion or TAS prediction offset), explain why; if likely biological, discuss possible mechanisms and implications.

Results

• "An MNase sensitive complex occupies the TASs in T. brucei":
• The definition of "MNase activity" and the ordering of samples into Low/Intermediate/High digestion are unclear. Did you infer digestion levels from fragment distributions rather than from controlled experimental timepoints? In Suppl. Fig. S3a it is not obvious how "Low digestion" was defined; that sample's fragment distribution appears intermediate. Please provide objective metrics (e.g., median fragment length, fraction 120-180 bp) used to classify digestion levels.
• Several fragment distributions show a sharp cutoff at ~100-125 bp. Was this due to gel purification or bioinformatic filtering? State this clearly in Methods. If gel purification occurred, that can explain why some datasets preserve the MNase-sensitive region.
• Please reconcile cases where samples labeled as more-digested contain a larger proportion of >200 bp fragments than supposedly less-digested samples; this ordering affects the inference that digestion level determines the loss/preservation of TAS protection. Based on the distributions I see, "Intermediate digestion 1" appears most consistent with an expected MNase curve - please confirm and correct the manuscript accordingly. Results - "The MNase sensitive complexes protecting the TASs in T. brucei and T. cruzi are at least partly composed of histones":
• The evidence that histones are part of the MNase-sensitive complex relies on H3 MNase-ChIP signal in subnucleosomal fragment bins. This seems to conflict with the observation (Fig. 1) that fragments protecting TASs are often nucleosome-sized. Please reconcile these points: are H3 signals confined to subnucleosomal fragments flanking the TAS while the TAS itself is depleted of H3? Provide plots that compare MNase-seq and H3 ChIP signals stratified by consistent fragment-size bins to clarify this.
• Please indicate which datasets are used for each panel in Suppl. Fig. S4 (e.g., Wedel et al., Maree et al.), and avoid calling data from different labs "replicates" unless they are true replicates.
• Several datasets show a sharp lower bound on fragment size in the subnucleosomal range (e.g., ~80-100 bp). Is this a filtering artifact or a gel-size selection? Clarify in Methods and, if this is an artifact, consider replotting after removing the cutoff. Results - "The TASs of single and multi-copy genes are differentially protected by nucleosomes":
• Please include T. brucei RNA-seq data in Suppl. Fig. S5b as you did for T. cruzi.
• Discuss how low or absent expression of multigene families affects TAS annotation (which relies on RNA-seq) and whether annotation inaccuracies could bias the observed chromatin differences.
• The statement that multi-copy genes show an "oscillation" between AT and GC dinucleotides is not clearly supported: the multi-copy average appears noisier and is based on fewer loci. Please tone down this claim or provide statistical support that the pattern is periodic rather than noisy.
• How were multi-copy genes defined in T. brucei? Include the classification method in Methods.

Genomes and annotations:

• If transcriptomic data for the Y strain was used for T. cruzi, please explain why a Y strain genome was not used (e.g., Wang et al. 2021 GCA_015033655.1), or justify the choice. For T. brucei, consider the more recent Lister 427 assembly (Tb427_2018) from TriTrypDB. Use strain-matched genomes and transcriptomes when possible, or discuss limitations.

Reproducibility and broader integration:

• Please share the full analysis pipeline (ideally on GitHub/Zenodo) so the results are reproducible from raw reads to plots.
• As an optional but helpful expansion, consider including additional datasets (other life stages, BSF MNase-seq, ATAC-seq, DRIP-seq) where available to strengthen comparative claims. Optional analyses that would strengthen the study:
• Stratify single-copy genes by expression (high / medium / low) and examine average nucleosome occupancy at TASs for each group; a correlation between expression and NDR depth would strengthen the functional link to maturation.

Minor / editorial comments:

• In the Introduction, the sentence "transcription is initiated from dispersed promoters and in general they coincide with divergent strand switch regions" should be qualified: such initiation sites also include single transcription start regions.
• Define the dotted line in length distribution plots (if it is not the median, please clarify) and consider placing it at 147 bp across plots to ease comparison.
• In Suppl. Fig. 4b "Replicate2" the x-axis ticks are misaligned with labels - please fix.
• Typo in the Introduction: "remodellingremodeling" → "remodeling."

Referee cross-commenting

Comment 1: I think Reviewer #2 and Reviewer #3 missed that they authors of this manuscript do cite and consider the results from Wedel at al. 2017. They even re-analysed their data (e.g. Figure 3a). I second Reviewer #2 comment indicating that the inclusion of a schematic figure to help readers visualize and better understand the findings would be an important addition.

Comment 2: I agree with Reviewer #3 that the use of different MNase digestion procedures in the different datasets have to be considered. On the other hand, I don't think there is a problem with figure 1 showing an MNase-protected TAS for T. brucei as it is based on MNase-seq data and reproduces the reported results (Maree et al. 2017). What the Siegel lab did in Wedel et al. 2017 was MNase-ChIPseq of H3 showing nucleosome depletion at TAS, but both results are not necessary contradictory: There could still be something else (which does not contain H3) sitting on the TAS protecting it from MNase digestion.

Significance

This study provides a systematic comparative analysis of chromatin landscapes at trans-splicing acceptor sites (TASs) in trypanosomatids, an area that has been relatively underexplored. By re-analyzing and harmonizing existing MNase-seq and MNase-ChIP-seq datasets, the authors highlight conserved and divergent features of nucleosome occupancy around TASs and propose that chromatin contributes to the fidelity of transcript maturation.

The significance lies in three aspects:

1. Conceptual advance: It broadens our understanding of gene regulation in organisms where transcription initiation is unusual and largely constitutive, suggesting that chromatin can still modulate post-transcriptional processes such as trans-splicing.
2. Integrative perspective: Bringing together data from T. cruzi, T. brucei and L. major provides a comparative framework that may inspire further mechanistic studies across kinetoplastids.
3. Hypothesis generation: The findings open testable avenues about the role of chromatin in coordinating transcript maturation, the contribution of DNA sequence composition, and potential interactions with R-loops or RNA-binding proteins. Researchers in parasitology, chromatin biology, and RNA processing will find it a useful resource and a stimulus for targeted experimental follow-up.

My expertise is in gene regulation in eukaryotic parasites, with a focus on bioinformatic analysis of high-throughput sequencing data

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

The authors do not wish to provide a response at this time.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #4

Evidence, reproducibility and clarity

Major criticisms

The manuscript by Chapa-y-Lazo et al. is confusing. It does not provide precise information about the three photostable monomers developed by different research groups. Please read the review (ref. 17) carefully. The monomeric version analyzed in this study was developed by Ivorra-Molla et al. and should be referred to as StayGold-E138D. This variant excels in dispersibility (monomericity), photostability, and molecular brightness (the product of the molar extinction coefficient and the fluorescence quantum yield). However, when analyzed in animal cells, StayGold-E138D is practically dim, and its brightness is poor. This can be seen in Figures 2, 3, S5, and S6 of the manuscript. The maturation efficiency of the chromophore is not so good in fly embryos. On the other hand, Ando et al. independently developed a monomeric version of StayGold called mStayGold at FPbase and Addgene. Therefore, I think that the authors should acknowledge that their analysis of StayGold monomer behavior is still incomplete. Additionally, the evolution tree of StayGold shown in Figure S2 is incorrect. The side-by side comparison of the three monomeric variants of StayGold, including StayGold-E138D and mStayGold, is documented in a recent preprint. Comparison of monomeric variants of StayGold | bioRxiv

Minor comments

Line 84 z-stacks were acquired using a spinning disc confocal microscope. Line 100 we collected a z-stack through each embryo. Line373 We analyzed the slices from 7 µm to 20.5 µm depth. Line 390 Depth 9 µm to 21 µm was analyzed. It is not clear what "z-stack" means in these sentences.

Significance

Nothing in particular.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Chapa-y-Lazo and colleagues report the detailed characterization of a number of different genetically-encoded fluorescent proteins in Drosophila embryos. The screening and selection of an appropriate fluorescent protein for imaging tasks is an important and often neglected part of experimental design, and datasets such as this one will be extremely useful in guiding decision making for other users. The manuscript is well-written and carefully controlled for different developmental stages and nicely compares the most pertinent properties of FPs such as brightness, photobleaching, and folding time. There would be a couple of additional experiments that would be nice to see but are not strictly necessary for improving the paper as-is, but might be helpful points to include in the discussion.

Comments:

1) All fluorophores in this study were fused to H2Av, at the same insertion site, which makes for a nice and easy comparison between lines. However, histone-binding proteins can sometimes behave unpredictably when tagged with different things and in addition it would be interesting to see if the fusion protein affects the FP properties in anyway. I.e. would sfGFP be brighter than mEmerald when bound to a CAAX sequence or some other organelle? It would be impractical for this study to re-do all the FPs, but the top two hits could be interesting and would potentially be quite interesting if there is a significant difference in behaviour between FPs when bound to different proteins/cellular compartments. Else maybe a mention in the discussion?

2) Another way to compare the fluorophore folding time would be to selectively bleach a portion of the embryo at the same developmental stage and measure the time it takes for each FP to recover to the same intensity as the rest of the embryo. This could potentially control for any delay for developmental reasons.

3) Some of the lines in the figure plots could be a bit thicker - purple and pink when overlapping are hard to distinguish.

Significance

This manuscript will be quite useful for those who are deciding between which fluorescent protein or combination to use for their live-imaging work, and additionally has created a number of useful fly strains in the process. It will hopefully also start a discussion about proper characterization and quantification of fluorescent reporters under different conditions, ideally before all the effort to generate an entirely new genetically modified animal is performed.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

In this manuscript Saunders and colleagues benchmark the brightness, folding speed and photostability of a variety of red (8 versions) and green fluorescent proteins (9 versions), which have been widely used for in vivo imaging. They fused each protein to histone2Av, cloned the fusion into attP constructs and inserted them in the Drosophila genome at the same genetic location. Thus, expression levels can be compared. Nuclei at embryonic cycle 14 were imaged, segmented and fluorescence was quantified. At this early stage the maturation kinetics of the fluorophore can particularly influence its fluorescence intensity.

Additionally, stage 15-16 embryos were imaged at the dorsal side to quantify brightness. As the histone promoter is active in all cells, the fluorescence in the nuclei of all cell types can be quantified. Brightness differences between the different proteins vary a bit between both experiments, likely taking folding versus brightness into account. Generally, sfGFP, mEGFP, mEmerald as well as mStrawberry and mScarlet are the brightest. Next, developmental movies were recorded starting at gastrulation to estimate the folding rates of the different proteins. No large differences of the relative fluorescence increase over time were reported. To estimate photostability, embryos were imaged ventrally shortly before the onset of gastrulation for 2 or 4 hours with high laser intensity and the fluorescence intensity was recorded. Consistent with data in the literature, StayGold is the most photostable green protein, although it is not the brightest from the start, likely to also slower folding. From the red proteins mRFP and mCherry are good choices for long-term imaging.

In summary, these results do not bring huge surprises but are still valuable for future choice of protein tagging for imaging. Best green proteins are mEGFP, mNeonGreen, mStayGold with differences in brightness vs stability. For red, no protein is the clear winner, mScarlet-I is good in folding and brightness but others are better for photostability.

Major comments:

1. Form the methods, it is not clear which promoter is used to drive expression of the histone2Av fusions. I assume this is not UAS but the histone promotor/enhancer. Please clarify.
2. From text is not always what the purpose of the experiment is. For example, it is not mentioned that developmental movies were recorded for the data related to Figure 3 to calculate folding, while bleaching was measured in the movies related to Figure 4. In contrast to simple single time points in Figures 1 and 2.

Minor comments:

1. Please add time to movie 2 and rotate it such that anterior is to the left and dorsal it up.
2. Lines 141 - 144 should refer to Figure 3D not 4D.
3. Movies 3 and 4, please insert time.

Significance

Experiments are well performed and the finding are useful to guide the future choice of fluorophores in Drosophila and possibly other model organisms. Results are not very surprising, as the major finding that StayGold is photostable (but not the brightest) is not entirely new but still reassuring. It is particularly nice to have the differences confirmed by well controlled side-by-side measurements in Drosophila. This will likely guide many Drosophila researchers to tag their favourite protein with StayGold in the future.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary:

This is an outstanding study of high practical value, which provided the systematic performance evaluation of in vivo fluorophores under the same condition in the field of Drosophila developmental biology. By site-integrating 17 green and red fluorescent proteins into the same genomic locus and evaluating their fluorescent intensity (early/late embryos), folding time and photostability on the same imaging platform, this provides a powerful database for researchers.

Major comments:

Q1: All fluorescent proteins are fused with histone H2Av. Will this nuclear localization expression pattern mask the performance differences of fluorescent proteins in other subcellular structures (such as cell membranes, cytoplasm, and cytoskeleton)?

Q2: How do the authors ensure precise developmental synchrony among different embryos to avoid the influence of developmental time differences on fluorescence intensity and folding curves?

Q3: In this study, the authors conduct a quantitative screen of nine green and eight red fluorophore lines in Drosophila. A logical and valuable extension of this work would be a systematic evaluation of newer fluorescent proteins, including promising candidates like mBaoJin, mScarlet3, and mScarlet3-H.

Q4：The study does not discuss the potential for fluorescent proteins to interfere with biological function. Although the proteins were expressed from the identical genomic location, variations in their size, structure, or fusion design may influence the target protein's localization or activity.

Lines 145-147 "The only profile that did not fit well to this phenomenological function was mStayGold which did not display a clear reduction in its rate of intensity increase". What is the reason that causes mStayGold to fail to fit well? Is it related to the unique structure?

Lines 154-156 "For the red fluorophores, the intensity profiles were more varied (Fig. 3E). They could not be reduced to a single curve, unlike the green fluorophores (Fig. S7B). The phenomenological function I(t) did not fit the curves well". Compared with green fluorophores, the intensity profiles of red fluorophores vary greatly, what's the major factors drive this difference?

Lines 206 "Fluorophores including mEGFP and mEmerald displayed a secondary peak in intensity around an hour after experiment initiation. This is consistent with a change in the rate of protein production". What is the mechanism behind the secondary peak, and why is it distinctly observed only in mEGFP and mEmerald?

Minor comments:

Line 143 "curve I(t) = I0 tanh (t-tin/ts) (Fig. 4D, Methods)". It's not Fig. 4D, but Fig. 3D.

Line 145 "time is smallest for Superfolder GFP and longest for mNeonGreen (Fig. 4D)". Not Fig. 4D, but Fig. 3D.

Line159 "mScarlet" must be replaced with "mScarlet-I".

Significance

The systematic performance evaluation of in vivo fluorophores under the same condition will give a comprehensive guidence when choosing fluorescent proteins in the field of Drosophila developmental biology.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Manuscript number: RC-2025-03195R

Point-by-Point Response to Reviewers

We thank the reviewers for their thoughtful and constructive evaluations, which have helped us substantially improve the clarity, rigor, and balance of our manuscript. We are grateful for their recognition that our integrated ATAC-seq and RNA-seq analyses provide a valuable and technically sound contribution to understanding soxB1-2 function and regenerative neurogenesis in planarians.

We have carefully addressed the reviewers' major points as follows:

1. Direct versus indirect regulation by SoxB1-2:____ In the revision, we explicitly acknowledge the limitations of inferring direct regulation from our current datasets and have revised statements throughout the Results and Discussion to emphasize that our findings are correlative.
2. Evidence for pioneer activity:____ Although the pioneer role of SoxB1 transcription factors in well established in other systems, we agree that additional binding or motif data would be required to formally demonstrate SoxB1-2 pioneer function. Accordingly, we performed motif analysis and revised the text throughout to frame SoxB1-2's proposed role as consistent with, rather than demonstrating transcriptional activator activity.
3. Motif enrichment and downstream regulatory interactions:____ In response to Reviewer #1's suggestion, we have included a new motif enrichment analysis in the supplement to contextualize possible co-regulators within the SoxB1-2 network.
4. Data reproducibility and peak-calling consistency:____ We have included sample correlations ____and peak overlaps for ATAC-seq samples in the revision, providing a clearer assessment of reproducibility.
5. Clarification of co-expression and downstream targets:____ We included co-expression plots for soxB1-2 with mecom and castor in the supplemental materials. These plots were generated from previously published scRNA-seq data and demonstrate that cells expressing soxB1-2 also express mecom and __ __We appreciate the reviewers' recognition that our methods are rigorous and our data accessible. We have incorporated all major revisions suggested and believe have strengthened the manuscript's precision, interpretations, and conclusions. Below, we respond to each comment in detail.

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Summary

The authors of this interesting study take the approach of combining RNAi, RNA-seq and ATAC-seq to try to build a regulatory network surrounding the function of a planarian SoxB1 ortholog, broadly required for neural specification during planarian regeneration. They find a number of chromatin regions that differentially accessible (measured by ATAC-seq), associate these with potential genes by proximity to the TSS. They then compare this set of genes with those that are differentially regulated (using RNA-seq), after SoxB1 RNAi mediated knockdown. This allows them the authors some focus on potential directly regulated targets of the planarian SoxB1. Two of these downstream targets, the mecom and castor transcription factors are then studied in greater detail.

Major Comments

I have no suggestions for new experiments that fit sensibly with the scope of the current work. There are other analyses that could be appropriate with the ATAC-seq data, but may not make sense in the content of SoxB1 acting as pioneer factor.

I would like to see motif enrichment analysis under the set of peaks to see if SoxB1 is opening chromatin for a restricted set of other transcription factors to then bind. Much of this could be taken from Neiro et al, eLife 2022 (which also used ATAC-seq) and matched planarians TF families to likely binding motifs. This could add some breadth to the regulatory network. It could be revealing for example if downstream TF also help regulate other targets that SoxB1 makes available, this is pattern often seen for cell specification (as I am sure the authors are aware). Alternatively, it may reveal other candidate regulators.

Thank you for this suggestion. We agree with the reviewers that this analysis should be done. We ran the motif enrichment analysis using the same methods as outlined in Neiro et al. eLife, 2022. We have included a new motif enrichment analysis in the supplement to contextualize possible co-regulators within the SoxB1-2 network.

Overall peak calling consistency with ATAC-sample would be useful to report as well, to give readers an idea of noise in the data. What was the correlation between samples?

__Excellent point. In response to this comment, we ran a Pearson correlation test on replicates within gfp and soxB1-2 RNAi replicates to get an idea of overall correlation between replicates. Additionally, we calculated percent overlap of peaks for biological replicates and between treatment groups. __

While it is logical to focus on downregulated genes, it would also be interesting to look at upregulated genes in some detail. In simple terms would we expect to see the representation of an alternate set of fate decisions being made by neoblast progeny?

This is also an important point that we considered but initially did not pursue it due to the lack of tools to test upregulated gene function. However, the reviewer is correct that this is straightforward to perform computationally. Thus, we have performed Gene Ontology analysis on the upregulated genes in all RNA-seq datasets (soxB1-2 RNAi, mecom RNAi, and castor RNAi). Both mecom and castor datasets did not reveal enrichment within the upregulated portion of the dataset. Genes upregulated after soxB1-2 RNAi were enriched for metabolic, xenobiotic detoxification, potassium homeostasis, and endocytic programs. Rather than indicating a shift toward alternative lineages, including non-ectodermal fates, these signatures are consistent with stress-responsive and homeostatic programs activated following loss of soxB1-2. We did not detect enrichment patterns strongly associated with alternative cell fates. We conclude that this analysis does not formally exclude potential shifts in lineage-specific transcriptional programs, but does support our hypothesis that soxB1-2 functions as a transcriptional activator.

Can the authors be explicit about whether they have evidence for co-expression of SoxB1/castor and SoxB1/mecom? I could find this clearly and it would be important to be clear whether this basic piece of evidence is in place or not at this stage.

We included co-expression plots for soxB1-2 with mecom and castor in the supplemental material. These plots were generated from previously published scRNA-seq data and demonstrate that cells expressing soxB1-2 also express mecom and castor. We have not done experiments showing co-expression via in situ at this time.

Minor comments

Formally loss of castor and mecom expression does mean these cells are absent, strictly the cell absence needs an independent method. It might be useful to clarify this with the evidence of be clear that cells are "very probably" not produced.

We agree that loss of castor and mecom expression does not formally demonstrate the physical absence of these cells, and that independent methods would be required to definitively confirm their loss. In response, we have revised our wording to indicate that castor- and mecom-expressing cells are very likely not being produced, rather than stating that they are absent.

Reviewer #1 (Significance (Required)):

Significance

Strengths and limitations.

The precise exploitation of the planarian system to identify potential targets, and therefore regulatory mechanisms, mediated by SoxB1 is an interesting contribution to the fi eld. We know almost nothing about the regulatory mechanisms that allow regeneration and how these might have evolved, and this work is well-executed step in that direction.

Advance

The paper makes a clear advance in our understanding of an important process in animals (neural specification) and how this happens in the context in the context during an example of animal regeneration. The methods are state-of-the-art with respect to what is possible in the planarian system.

Audience

This will be of wide interest to developmental biologists, particularly those studying regeneration in planarians and other regenerative systems,and those who study comparative neurodevelopment.

Expertise

I have expertise in functional genomics in the context of stem cells and regeneration, particularly in the planarian model system

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Review - Cathell, et al (RC-2025-03195)

Summary and Significance:

Understanding regenerative neurogenesis has been difficult due to the limited amount of neurogenesis that occurs after injury in most animal species. Planarians, with their adult neurogenesis and robust post-injury response, allow us to get a glimpse into regenerative neurogenesis. The Zayas laboratory previously revealed a key role for SoxB1-2 in maintenance and regeneration of a broad set of sensory and peripheral neurons in the planarian body. SoxB1-2 also has a role in many epidermal fates. Their previous work left open the tempting possibility that SoxB1-2 acts as a very upstream regulator of epidermal and neuronal fates, potentially acting as a pioneer transcription factor within these lineages. In the manuscript currently under review, Cathell and colleagues use ATAC-Seq and RNA-Seq to investigate chromatin changes after SoxB1-2(RNAi). With the experimental limitations in planarians, this is a strong first step toward testing their hypothesis that SoxB1-2acts as a pioneer within a set of planarian lineages. Beyond these cell types, this work is also important because planarian cell fates often rely on a suite of transcription factors, but the nature of transcription factor cooperation has been much less well understood. Indeed, the authors do show that loss of SoxB1-2 by RNAi causes changes in a number of accessible regions of the genome; many of these chromatin changes correspond to changes in gene expression of genes nearby these peaks. The authors also examine in more detail two genes that have genomic and transcriptomic changes after SoxB1-2(RNAi), mecom and castor. The authors completed RNA-Seq on mecom(RNAi) and castor(RNAi) animals, identifying genes downregulated after loss of either factor that are also seen in SoxB1-2(RNAi). The results in this paper are rigorous and very well presented. I will share two major limitations of the study and some suggestions for addressing them, but this work may also be acceptable without those changes at some journals.

Limitation 1:

The paper aims to test the hypothesis that SoxB1-2 is a pioneer transcription factor. Observation that SoxB1-2(RNAi) leads to loss of many accessible regions in the chromatin supports the hypothesis. However, an alternate possibility is that SoxB1-2 leads to transcription of another factor that is a pioneer factor or a chromatin remodeling enzyme; in either of these cases, the accessibility peak changes may not be due to SoxB1-2 directly but due to another protein that SoxB1-2 promotes. The authors describe how they can address this limitation in the future; in the meantime, is it known what the likely binding for SoxB1-2 would be (experimentally or based on homology)? If so, could the authors examine the relative abundance of SoxB1-2 binding sites in peaks that change after SoxB1-2(RNAi)? This could be compared to the abundance of the same binding sequence in non-changing peaks. Enrichment of SoxB1-2 binding sites in ATAC peaks that change after its RNAi would support the argument that chromatin changes are directly due to SoxB1-2.

We appreciate the feedback and agree that distinguishing between direct SoxB1-2 pioneer activity and indirect effects mediated through downstream regulators is an important consideration. While we did not perform a direct abundance analysis of potential chromatin-remodeling cofactors, we conducted a motif enrichment analysis following the approach of Neiro et al. (eLife, 2022), comparing control and soxB1-2(RNAi) peak sets. This analysis revealed that Sox-family motifs, particularly SoxB1-like motifs, were among the most enriched in regions that remain accessible in control animals relative to soxB1-2(RNAi) animals, consistent with a model in which SoxB1-2 directly contributes to establishing or maintaining accessibility at these loci. We have now included this analysis in the supplemental materials to further contextualize potential co-regulators and transcriptional partners within the SoxB1-2 regulatory network. We agree and acknowledge in the report that future studies assessing chromatin remodeling factor expression and abundance will be valuable to definitively separate direct and indirect pioneer activity.

Limitation 2:

The characterization of mecom and castor is somewhat preliminary relative to the deep work in the rest of the paper. I think this could be addressed with a few experiments. The authors could validate RNA-seq findings with ISH to show that cells are lost after reduction of either TF (this would support the model figure). The authors could also try to define whether loss of either TF causes behavioral phenotypes that might be similar to SoxB1-2(RNAi); this would be a second line of evidence that the TFs are downstream of key events in the SoxB1-2

pathway.

Thank you for this suggestion. We agree that additional validation of the mecom and castor RNA-seq results and further phenotypic characterization would strengthen this section. We are currently conducting in situ hybridization experiments to validate transcriptional changes in mecom and castor using the same experimental framework applied to soxB1-2 downstream candidates. We anticipate completing these studies within the next three months and will incorporate the results into future work.

Regarding behavioral phenotypes, we performed preliminary screening for robust behavioral responses, including mechanosensory responses, but did not observe overt defects. However, the lack of established, standardized behavioral assays in planarians presents a current limitation; such assays need to be developed de novo, and predicting specific behavioral phenotypes in advance remains challenging. We fully agree that functional behavioral assays represent an important next step and are actively exploring strategies to systematically develop and implement them going forward.

Other questions or comments for the authors:

Is it known how other Sox factors work as pioneer TFs? Are key binding partners known? I wondered if it would be possible to show that SoxB1-2 is co-expressed with the genes that encode these partners and/or if RNAi of these factors would phenocopy SoxB1-2. This is likely beyond the scope of this paper, but if the authors wanted to further support their argument about SoxB1-2 acting as a pioneer in planarians, this might be an additional way to do it.

In other systems, Sox pioneer factors often act together with POU family transcription factors (for example, Oct4 and Brn2) and PAX family members such as Pax6. In planarians, a POU homolog (pou-p1) is expressed in neoblasts and may represent an interesting candidate co-factor for future investigation in the context of SoxB1-2 pioneer activity. We have also previously examined the relationship between SoxB1-2 and the POU family transcription factors pou4-1 and pou4-2. Although RNAi of these factors does not fully phenocopy soxB1-2 knockdown, pou4-2(RNAi) results in loss of mechanosensation, suggesting that downstream POU factors may contribute to aspects of neural function regulated by SoxB1-2 (McCubbin et al. eLife 2025). We agree that co-expression and functional interaction studies with these candidates would be highly informative, and we view this as an exciting future direction beyond the scope of the current manuscript.

This paper is one of few to use ATAC-Seq in planarians. First, I think the authors should make a bigger deal of their generation of a dataset with this tool! Second, it would be great to know whether the ATAC-Seq data (controls and/or RNAi) will be browsable in any planarian databases or in a new website for other scientists. I believe that in addition to the data being used to test hypotheses about planarians, the data could also be a huge hypothesis generating resource in the planarian community, so I would encourage the authors to both self-promote their contribution and make plans to share it as widely and usably as possible.

Thank you very much for this encouraging feedback. We appreciate the suggestion and have strengthened the text to emphasize the significance of generating this ATAC-seq resource for the planarian field. We agree that these datasets represent a valuable community resource and are committed to making all control and soxB1-2(RNAi) ATAC-seq data publicly accessible.

Reviewer #2 (Significance (Required)):

This paper's strengths are that it addresses an important problem in regenerative biology in a rigorous manner. The writing and presentation of the data are excellent. The paper also provides excellent datasets that will be very useful to other researchers in the fi eld. Finally, the work is one of, if not the first to examine how the action of one transcription factor in planarians leads to changes in the cellular and chromatin environment that could then be acted upon by subsequent factors. This is an important contribution to the planarian fi eld, but also one that will be useful for other developmental neuroscientists and regenerative biologists.

I described a couple of limitations in the review above, but the strengths outweigh the weaknesses.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

The authors investigated the role of soxB1-2 in planarian neural and epidermal lineage specification. Using ATAC-seq and RNA-seq from head fragments after soxB1-2 RNAi, they identified regions of decreased chromatin accessibility and reduced gene expression, demonstrating that soxB1-2 induces neural and sensory programs. Integration of the datasets yielded 31 overlapping candidate targets correlating ATAC-seq and RNA-seq. Downstream analyses of transcription factors that had either/or differentially accessible regulatory region or showed differential expression (castor and mecom) implicated these transcription factors in mechanosensory and ciliary modules. The authors combined additional techniques, such as in situ hybridization to support the observations based on the ATACseq/RNAseq data. The manuscript is clearly written as well as data presentation in the main and supplementary figures. The major claim of the manuscript is that SoxB1-2 is likely a pioneer transcription factor that alters the accessibility of the chromatin, which if true, would be one of the first demonstrations of direct transcriptional regulation in planarians. As described below, I am not certain that this interpretation of the data is more valid than alternative interpretations.

Major comments

1. Direct vs. indirect regulation. The current analysis does not distinguish between direct and indirect soxB1-2 targets, therefore, this analysis cannot indicate whether soxB1-2 functions as a pioneer transcription. ATAC-seq and RNA-seq, as performed here, do not determine whether reduced accessibility or downregulation of gene expression represents a change within existing cells or a reduction in the proportion of specific cell types in the libraries produced. This limitation should be explicitly recognized where causal statements are made. In fact, several pieces of information strongly suggest that indirect effects are abundant in the data: (1) the observed loss of accessibility and gene expression in late epidermal progenitors likely represent indirect effects, indicating that within the timeframe of the experiment, it is impossible (using these techniques) to distinguish between the scenarios. (2) The finding that castor knockdown reduces soxB1-2 expression likely reflects population loss rather than direct regulation, given overlapping expression domains. This further illustrates the difficulty in inferring directionality from such datasets. In order to provide evidence for a more direct association between soxB1-2 and the differentially accessible chromatin regions, a sequence(e.g., motif) analysis would be required. Other approaches to infer direct regulation would have been useful, but they are not available in planarians to the best of my knowledge.

We agree that distinguishing between direct SoxB1-2 pioneer activity and indirect chromatin changes mediated by downstream factors is an important consideration. As suggested, examining the enrichment of SoxB1-2 binding motifs in regions that lose accessibility following soxB1-2(RNAi) can provide supporting evidence for direct regulation.

While we did not conduct a direct abundance analysis of all potential chromatin-remodeling cofactors, we performed a motif enrichment analysis following the methodology of Neiro et al. (eLife, 2022), comparing control-specific and soxB1-2(RNAi)-specific accessible peak sets. Consistent with a direct role for SoxB1-2 in chromatin regulation, Sox-family motifs, particularly SoxB1-like motifs, were among the most significantly enriched in regions that maintain accessibility in control animals relative to soxB1-2(RNAi) animals.

Evidence for pioneer activity. The authors correctly acknowledge that they do not present direct evidence of soxB1-2 binding or chromatin opening. However, the section title in the Discussion could be interpreted as implying otherwise. The claim of pioneer activity should remain explicitly tentative until supported (at least) by motif or binding data.

We have performed suggested motif analysis and changed the language in this section to better fit the data.

Replication and dataset comparability. Both ATAC-seq and soxB1-2 RNA-seq were performed on head fragments, but the number of replicates differ between assays (ATAC-seq n=2 per group, RNA-seq n=4-6). This is of course acceptable, but when interpreting the results, it should be taken into consideration that the statistical power is different when using data collected using different techniques and having a varied number of replicates.

Thank you for raising this important point regarding replication and comparability across datasets. We agree that the differing number of biological replicates between the ATAC-seq and RNA-seq experiments results in different statistical power across assays. We have now clarified this consideration in the manuscript text.

Minor comments

"Thousands of accessible chromatin sites". Please state the number of peaks and the thresholds for calling them. Ensure consistency between text (264 DA peaks) and Figure 1 legend (269 DA peaks).

__We have clarified specific peak numbers and will include the calling parameters in the methods section. Additionally, we will fix the discrepancies between differential peaks. __

Specify the y-axis normalization units in all coverage plots.

We have specified this across plots.

Clarify replicate numbers consistently in the text and figure legends.

We have identified and corrected discrepancies in the figure legends vs text and correct them and ensured they are included consistently across datasets.

Referees cross commenting

The reviews are highly consistent. They recognize the value of the work, and raise similar points. The main shared view is that the current data do not distinguish direct from indirect effects, and claims about pioneer activity should be softened, and further analysis of the differentially accessible peaks could strengthen the link between SoxB1-2 and the chromatin changes.

-I don't think that it's necessary to further characterize experimentally mecom or castor (as suggested), but of course that it could have value.

We thank all three reviewers for their positive assessment of the value of our work aiming to elucidate mechanisms by which SoxB1-2 programs planarian stem cells. In the revision, we have improved the presentation and carefully edited conclusions about the function of SoxB1-2. Performing motif analysis and GO annotation of upregulated genes has strengthened our observation that SoxB1-2 acts as an activator and has revealed putative binding sites.

The preliminary revision does not yet include further characterization of mecom and castor downstream genes. In response to Reviewer #2, we appreciate that additional validation of the mecom and castor RNA-seq results and further phenotypic characterization would strengthen this section. Although we are currently conducting in situ hybridization experiments to validate transcriptional changes in mecom and castor using the same experimental framework applied to soxB1-2 downstream candidates, we also reconsidered, as we did in our first revision, whether this is necessary or better suited for future investigations.

In the revision, we noted that our Discussion points were not balanced and that we emphasized the mecom and castor results in a manner that distracted from the major focus of the work, likely contributing to the impression that additional experimental evidence was required. Therefore, we have revised the section accordingly and streamlined the Discussion to avoid repetitive statements and to focus on the insights gained into the mechanism of SoxB1-2 function in planarian neurogenesis. We remain open to including these additional experiments if the reviewers or handling editors consider them essential; however, we agree that their inclusion is not absolutely necessary.

Reviewer #3 (Significance (Required)):

General assessment. The study offers valuable observations by combining chromatin and transcriptional analysis of planarian neural differentiation. The integration with in situ validation convincingly demonstrates effects on neural tissues and provides a solid resource for future functional work. However, mechanistic interpretation remains limited, partly because of technical limitations of the system. The data support an important role for soxB1-2 in neural and epidermal lineage regulation, but not direct binding or chromatin-opening activity. The authors have previously published analysis of soxB1-2 in planarians, so the addition of ATAC-seq data contributes to solving another piece of the puzzle.

__Advance. __

This is one of the first studies to couple ATAC-seq and RNA-seq in planarian tissue to dissect regulatory logic during regeneration. It identifies new candidate regulators of sensory and epidermal differentiation and identifies soxB1-2 as a likely upstream factor in ectodermal lineage networks. The work extends previous studies on soxB1-2 activity and neural cell production by integrating chromatin and transcriptional layers. In that respect the results are very solid, although the study remains correlative at the mechanistic level.

Audience.

This work will potentially interest researchers interested in regeneration and transcriptional networks. The datasets and gene lists will be valuable references for follow-up studies on planarian ectodermal lineages, and therefore will appeal to this community.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The authors investigated the role of soxB1-2 in planarian neural and epidermal lineage specification. Using ATAC-seq and RNA-seq from head fragments after soxB1-2 RNAi, they identified regions of decreased chromatin accessibility and reduced gene expression, demonstrating that soxB1-2 induces neural and sensory programs. Integration of the datasets yielded 31 overlapping candidate targets correlating ATAC-seq and RNA-seq. Downstream analyses of transcription factors that had either/or differentially accessible regulatory region or showed differential expression (castor and mecom) implicated these transcription factors in mechanosensory and ciliary modules. The authors combined additional techniques, such as in situ hybridization to support the observations based on the ATACseq/RNAseq data. The manuscript is clearly written as well as data presentation in the main and supplementary figures. The major claim of the manuscript is that SoxB1-2 is likely a pioneer transcription factor that alters the accessibility of the chromatin, which if true, would be one of the first demonstrations of direct transcriptional regulation in planarians. As described below, I am not certain that this interpretation of the data is more valid than alternative interpretations.

Major comments

1. Direct vs. indirect regulation. The current analysis does not distinguish between direct and indirect soxB1-2 targets, therefore, this analysis cannot indicate whether soxB1-2 functions as a pioneer transcription. ATAC-seq and RNA-seq, as performed here, do not determine whether reduced accessibility or downregulation of gene expression represents a change within existing cells or a reduction in the proportion of specific cell types in the libraries produced. This limitation should be explicitly recognized where causal statements are made. In fact, several pieces of information strongly suggest that indirect effects are abundant in the data: (1) the observed loss of accessibility and gene expression in late epidermal progenitors likely represent indirect effects, indicating that within the timeframe of the experiment, it is impossible (using these techniques) to distinguish between the scenarios. (2) The finding that castor knockdown reduces soxB1-2 expression likely reflects population loss rather than direct regulation, given overlapping expression domains. This further illustrates the difficulty in inferring directionality from such datasets. In order to provide evidence for a more direct association between soxB1-2 and the differentially accessible chromatin regions, a sequence (e.g., motif) analysis would be required. Other approaches to infer direct regulation would have been useful, but they are not available in planarians to the best of my knowledge.
2. Evidence for pioneer activity. The authors correctly acknowledge that they do not present direct evidence of soxB1-2 binding or chromatin opening. However, the section title in the Discussion could be interpreted as implying otherwise. The claim of pioneer activity should remain explicitly tentative until supported (at least) by motif or binding data.
3. Replication and dataset comparability. Both ATAC-seq and soxB1-2 RNA-seq were performed on head fragments, but the number of replicates differ between assays (ATAC-seq n=2 per group, RNA-seq n=4-6). This is of course acceptable, but when interpreting the results, it should be taken into consideration that the statistical power is different when using data collected using different techniques and having a varied number of replicates.

Minor comments

"Thousands of accessible chromatin sites". Please state the number of peaks and the thresholds for calling them. Ensure consistency between text (264 DA peaks) and Figure 1 legend (269 DA peaks). Specify the y-axis normalization units in all coverage plots. Clarify replicate numbers consistently in the text and figure legends.

Referees cross commenting

The reviews are highly consistent. They recognize the value of the work, and raise similar points. The main shared view is that the current data do not distinguish direct from indirect effects, and claims about pioneer activity should be softened, and further analysis of the differentially accessible peaks could strengthen the link between SoxB1-2 and the chromatin changes.

• I don't think that it's necessary to further characterize experimentally mecom or castor (as suggested), but of course that it could have value.

Significance

General assessment. The study offers valuable observations by combining chromatin and transcriptional analysis of planarian neural differentiation. The integration with in situ validation convincingly demonstrates effects on neural tissues and provides a solid resource for future functional work. However, mechanistic interpretation remains limited, partly because of technical limitations of the system. The data support an important role for soxB1-2 in neural and epidermal lineage regulation, but not direct binding or chromatin-opening activity. The authors have previously published analysis of soxB1-2 in planarians, so the addition of ATAC-seq data contributes to solving another piece of the puzzle.

Advance. This is one of the first studies to couple ATAC-seq and RNA-seq in planarian tissue to dissect regulatory logic during regeneration. It identifies new candidate regulators of sensory and epidermal differentiation and identifies soxB1-2 as a likely upstream factor in ectodermal lineage networks. The work extends previous studies on soxB1-2 activity and neural cell production by integrating chromatin and transcriptional layers. In that respect the results are very solid, although the study remains correlative at the mechanistic level.

Audience. This work will potentially interest researchers interested in regeneration and transcriptional networks. The datasets and gene lists will be valuable references for follow-up studies on planarian ectodermal lineages, and therefore will appeal to this community.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Review - Cathell, et al (RC-2025-03195)

Summary and Significance:

Understanding regenerative neurogenesis has been difficult due to the limited amount of neurogenesis that occurs after injury in most animal species. Planarians, with their adult neurogenesis and robust post-injury response, allow us to get a glimpse into regenerative neurogenesis. The Zayas laboratory previously revealed a key role for SoxB1-2 in maintenance and regeneration of a broad set of sensory and peripheral neurons in the planarian body. SoxB1-2 also has a role in many epidermal fates. Their previous work left open the tempting possibility that SoxB1-2 acts as a very upstream regulator of epidermal and neuronal fates, potentially acting as a pioneer transcription factor within these lineages. In the manuscript currently under review, Cathell and colleagues use ATAC-Seq and RNA-Seq to investigate chromatin changes after SoxB1-2(RNAi). With the experimental limitations in planarians, this is a strong first step toward testing their hypothesis that SoxB1-2 acts as a pioneer within a set of planarian lineages. Beyond these cell types, this work is also important because planarian cell fates often rely on a suite of transcription factors, but the nature of transcription factor cooperation has been much less well understood. Indeed, the authors do show that loss of SoxB1-2 by RNAi causes changes in a number of accessible regions of the genome; many of these chromatin changes correspond to changes in gene expression of genes nearby these peaks. The authors also examine in more detail two genes that have genomic and transcriptomic changes after SoxB1-2(RNAi), mecom and castor. The authors completed RNA-Seq on mecom(RNAi) and castor(RNAi) animals, identifying genes downregulated after loss of either factor that are also seen in SoxB1-2(RNAi). The results in this paper are rigorous and very well presented. I will share two major limitations of the study and some suggestions for addressing them, but this work may also be acceptable without those changes at some journals.

Limitation 1:

The paper aims to test the hypothesis that SoxB1-2 is a pioneer transcription factor. Observation that SoxB1-2(RNAi) leads to loss of many accessible regions in the chromatin supports the hypothesis. However, an alternate possibility is that SoxB1-2 leads to transcription of another factor that is a pioneer factor or a chromatin remodeling enzyme; in either of these cases, the accessibility peak changes may not be due to SoxB1-2 directly but due to another protein that SoxB1-2 promotes. The authors describe how they can address this limitation in the future; in the meantime, is it known what the likely binding for SoxB1-2 would be (experimentally or based on homology)? If so, could the authors examine the relative abundance of SoxB1-2 binding sites in peaks that change after SoxB1-2(RNAi)? This could be compared to the abundance of the same binding sequence in non-changing peaks. Enrichment of SoxB1-2 binding sites in ATAC peaks that change after its RNAi would support the argument that chromatin changes are directly due to SoxB1-2.

Limitation 2:

The characterization of mecom and castor is somewhat preliminary relative to the deep work in the rest of the paper. I think this could be addressed with a few experiments. The authors could validate RNA-seq findings with ISH to show that cells are lost after reduction of either TF (this would support the model figure). The authors could also try to define whether loss of either TF causes behavioral phenotypes that might be similar to SoxB1-2(RNAi); this would be a second line of evidence that the TFs are downstream of key events in the SoxB1-2 pathway.

Other questions or comments for the authors:

Is it known how other Sox factors work as pioneer TFs? Are key binding partners known? I wondered if it would be possible to show that SoxB1-2 is co-expressed with the genes that encode these partners and/or if RNAi of these factors would phenocopy SoxB1-2. This is likely beyond the scope of this paper, but if the authors wanted to further support their argument about SoxB1-2 acting as a pioneer in planarians, this might be an additional way to do it. This paper is one of few to use ATAC-Seq in planarians. First, I think the authors should make a bigger deal of their generation of a dataset with this tool! Second, it would be great to know whether the ATAC-Seq data (controls and/or RNAi) will be browsable in any planarian databases or in a new website for other scientists. I believe that in addition to the data being used to test hypotheses about planarians, the data could also be a huge hypothesis generating resource in the planarian community, so I would encourage the authors to both self-promote their contribution and make plans to share it as widely and usably as possible.

Significance

This paper's strengths are that it addresses an important problem in regenerative biology in a rigorous manner. The writing and presentation of the data are excellent. The paper also provides excellent datasets that will be very useful to other researchers in the field. Finally, the work is one of, if not the first to examine how the action of one transcription factor in planarians leads to changes in the cellular and chromatin environment that could then be acted upon by subsequent factors. This is an important contribution to the planarian field, but also one that will be useful for other developmental neuroscientists and regenerative biologists.

I described a couple of limitations in the review above, but the strengths outweigh the weaknesses.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary

The authors of this interesting study take the approach of combing RNAi, RNA-seq and ATAC-seq to try to build a regulatory network surrounding the function of a planarian SoxB1 ortholog, broadly required for neural specification during planarian regeneration. They find a number of chromatin regions that differentially accessible (measured by ATAC-seq), associate these with potential genes by promity to the TSS. They then compare this set of genes with those that are differentially regulated (using RNA-seq), after SoxB1 RNAi mediated knockdown. This allows them the authors some focus on potential directly regulated targets of the planarian SoxB1. Two of these downstream targets, the mecom and castor transcription factors are then studied in greater detail.

Major Comments.

I have no suggestions for new experiments that fit sensibly with the scope of the current work. There are other analyses that could be appropriate with the ATAC-seq data, but may not make sense in the content of SoxB1 acting as pioneer factor.

I would like to see motif enrichment analysis under the set of peaks to see if SoxB1 is opening chromatin for a restricted set of other transcription factors to then bind. Much of this could be taken from Neiro et al, eLife 2022 (which also used ATAC-seq) and matched planarians TF families to likely binding motifs. This could add some breadth to the regulatory network. It could be revealing for example if downstream TF also help regulate other targets that SoxB1 makes available, this is pattern often seen for cell specification (as I am sure the authors are aware). Alternatively, it may reveal other candidate regulators. Overall peak calling consistency with ATAC-sample would be useful to report as well, to give readers an idea of noise in the data. What was the correlation between samples? While it is logical to focus on downregulated genes, it would also be interesting to look at upregulated genes in some detail. In simple terms would we expect to see the representation of an alternate set of fate decisions being made by neoblast progeny? Can the authors be explicit about whether they have evidence for co-expression of SoxB1/castor and SoxB1/mecom? I could find this clearly and it would be important to be clear whether this basic piece of evidence is in place or not at this stage.

Summary

The authors of this interesting study take the approach of combing RNAi, RNA-seq and ATAC-seq to try to build a regulatory network surrounding the function of a planarian SoxB1 ortholog, broadly required for neural specification during planarian regeneration. They find a number of chromatin regions that differentially accessible (measured by ATAC-seq), associate these with potential genes by promity to the TSS. They then compare this set of genes with those that are differentially regulated (using RNA-seq), after SoxB1 RNAi mediated knockdown. This allows them the authors some focus on potential directly regulated targets of the planarian SoxB1. Two of these downstream targets, the mecom and castor transcription factors are then studied in greater detail.

Major Comments.

N suggestions for new experiments that fit sensibly with the scope of the current work. There are other analyses that could be appropriate with the ATAC-seq data but may not make sense in the content of SoxB1 acting as pioneer factor. Overall, the study is executed very well, methods are sound, data and analysis well-presented and narrated, and the results placed in context. The experiments are clearly reproducible and can be built on, all data is accessible to others. Motif enrichment analysis under the set of peaks to see if SoxB1 is opening chromatin for a restricted set of other transcription factors to then bind. Much of this could be taken from Neiro et al, eLife 2022 (which also used ATAC-seq) and matched planarians TF families to likely binding motifs. This could add some breadth to the regulatory network. It could be revealing for example if downstream TF also help regulate other targets that SoxB1 makes available, this is pattern often seen for cell specification (as I am sure the authors are aware). Alternatively, it may reveal other candidate regulators. Overall peak calling consistency with ATAC-sample would be useful to report as well, to give readers an idea of noise in the data. What was the correlation between samples? While it is logical to focus on downregulated genes, it would also be interesting to look at upregulated genes in some detail. In simple terms would we expect to see the representation of an alternate set of fate decisions being made by neoblast progeny? Can the authors be explicit about whether they have evidence for co-expression of SoxB1/castor and SoxB1/mecom? I could find this clearly and it would be important to be clear whether this basic piece of evidence is in place, or not, at this stage.

Minor comments.

Formally loss of castor and mecom expression does mean these cells are absent, strictly the cell absence needs an independent method. It might be useful to clarify this with the evidence of be clear that cells are "very probably" not produced.

Significance

Strengths and limitations.

The precise exploitation of the planarian system to identify potential targets, and therefore regulatory mechanisms, mediated by SoxB1 is an interesting contribution to the field. We know almost nothing about the regulatory mechanisms that allow regeneration and how these might have evolved, and this work is well-executed step in that direction.

Advance

The paper makes a clear advance in our understanding of an important process in animals (neural specification) and how this happens in the context in the context during an example of animal regeneration. The methods are state-of-the-art with respect to what is possible in the planarian system.

Audience

This will be of wide interest to developmental biologists, particularly those studying regeneration in planarians and other regenerative systems, and those who study comparative neurodevelopment.

Expertise

I have expertise in functional genomics in the context of stem cells and regeneration, particularly in the planarian model system

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

In this manuscript, the authors employed fast MAS NMR spectroscopy to investigate the gel aggregation of longer repeat (48×) RNAs, revealing inherent folding structures and interactions (i.e., G-quadruplex and duplex). The dynamic structure of the RNA gel was not resolved at high resolution, and only the structural features-namely, the coexistence of G-quadruplexes and duplexes-were inferred. The 1D and 2D NMR spectra were not assigned to specific atomic positions within the RNA, which makes it difficult to perform molecular dynamics (MD) modeling to elucidate the dynamic nature of the RNA gel. The following comments are provided for the authors' consideration:

Reviewer #1, Comment 1:

Figure 2E and Figure 3A: The data suggest that Ca²⁺ promotes stronger G-quadruplex formation within the RNA gel compared with Mg²⁺. This observation is somewhat puzzling, as Mg²⁺ is generally known to stabilize G-quadruplex structures. The authors should clarify this discrepancy.

__Response: __Mg2+ is also a stabilizer of double-stranded RNA. In most cases, Mg²⁺ stabilizes RNA duplexes more significantly than it stabilizes G-quadruplexes. When Mg2+ is removed and replaced for Ca2+, RNA duplex is destabilized more than G4 structures. We have added a clarification regarding that to the Conclusions section.

Reviewer #1, Comment 2:

Figures 2 and 3: The authors use the chemical shift at δN 144.1 ppm to distinguish between G-quadruplex and duplex structures. How was the reliability of this assignment evaluated? Chemical shifts of RNA atoms can be influenced by various factors such as intermolecular interactions, conformational stress, and local chemical environment, not only by higher-order structures. This point should be substantiated by citing relevant references or by analyzing additional RNA structures exhibiting δN 144.1 ppm signals using NMR spectroscopy.

Response: The assignment was made by comparing the chemical shifts with published data and by comparing the obtained spectra with existing datasets in the lab. We have added an explanation to the Results section and cited the literature. The 144.1 ppm was an illustrative value selected for guiding the discussion and we noted that it could sound too specific. We modified Figure 2 to outline the regions of chemical shifts in accordance with our interpretation of spectra.

Reviewer #1, Comment 3:

The authors state that "Our findings demonstrate that fast MAS NMR spectroscopy enables atomic-resolution monitoring of structural changes in GGGGCC repeat RNA of physiological lengths." This claim appears overstated, as no molecular model was constructed to define atomic coordinates based on NMR restraints.

Response: We agree and we have rewritten the conclusions to be more precise in wording. The new text does not mention “atomic-resolution” anymore.

Reviewer #1, Comment 4: Figure 3B: The experiment using nuclear extracts supplemented with Mg²⁺ to study RNA aggregation via 2D NMR may not accurately reflect intracellular conditions. It would be informative to perform a parallel experiment using nuclear extracts without additional Mg²⁺ to better simulate the native environment for RNA folding.

__Response: __We agree that we have not yet approached physiological conditions and that it would be interesting to obtain data for conditions at physiological Mg2+ concentrations in the range between 0.5 mM – 1 mM. The buffer of purchased nuclear extracts does not contain MgCl2, so some MgCl2 would still need to be added. In our opinion, nuclear extracts are actually not the optimal way to move forward, since they still differ from real in cell environment with the caveat that their composition is not well controlled. Full reconstitution with recombinant proteins might be a better approach because stoichiometry can be better regulated.

__Reviewer #1 (Significance (Required)): __ In this manuscript, the authors employed fast MAS NMR spectroscopy to investigate the gel aggregation of longer repeat (48×) RNAs, revealing inherent folding structures and interactions (i.e., G-quadruplex and duplex). The dynamic structure of the RNA gel was not resolved at high resolution, and only the structural features-namely, the coexistence of G-quadruplexes and duplexes-were inferred. The 1D and 2D NMR spectra were not assigned to specific atomic positions within the RNA, which makes it difficult to perform molecular dynamics (MD) modeling to elucidate the dynamic nature of the RNA gel.

Response: We agree that constraints for molecular dynamics cannot be derived from these data. The focus of this work is methodological: to demonstrate how 1H-15N 2D correlation spectra can be used to characterize G-G pairing in RNA gels directly. Such spectra could be used to study effects of small molecules or interacting proteins for example.

__Reviewer #2 (Evidence, reproducibility and clarity (Required)): __ The manuscript by Kragelj et al. has the potential to become a valuable study demonstrating the role and power of modern solid-state NMR spectroscopy in investigating molecular assemblies that are otherwise inaccessible to other structural biology techniques. However, due to poor experimental execution and incomplete data interpretation, the manuscript requires substantial revision before it can be considered for publication in any journal.

__Reviewer #2, Major Concern __Inspection of the analytical gels of the transcribed RNA clearly shows that the desired RNA product constitutes only about 10% of the total crude transcript. The RNA must therefore be purified, for example by preparative PAGE, before performing any NMR or other biophysical studies. As it stands, all spectra shown in the figures represent a combined signal of all products in the crude mixture rather than the intended 48 repeat RNA. Consequently, all analyses and conclusions currently refer to a heterogeneous mixture of transcripts rather than the specific target RNA.

Response: The estimate of 10% 48xG4C2 on the gel is an overstatement. While multiple bands are visible, they correspond to dimers or multimers of the 48xG4C2 RNA. Transcripts that are longer than 48xG4C2 cannot occur in our transcription conditions. Bands at lower masses than expected are folded RNA. The high repeat length and the presence of Mg²⁺ during transcription promote multimerization, which is not fully reversed by denaturation in urea. If shorter transcripts had arisen from early termination they would be still substantially longer than 24 repeats based of what is visible on the gel and would thus remain within the pathological length range. Therefore, the observed NMR spectra primarily report on 48 repeat lengths.

__Reviewer #2, Specific Comments 1: __The statements: "We show that a technique called NMR spectroscopy under fast Magic Angle Spinning (fast MAS NMR) can be used to obtain structural information on GGGGCC repeat RNAs of physiological lengths. Fast MAS NMR can be used to obtain structural information on biomolecules regardless of their size." on page 1 are not entirely correct. Firstly, not only fast MAS NMR but MAS NMR in general can provide structural information on biomolecules regardless of their size. Fast MAS primarily allows for ¹H-detected experiments, improves spectral resolution, and reduces the required sample amount. Conventional ¹³C-detected solid-state MAS NMR can provide very similar structural information. A more thorough review of relevant literature could help address this issue.

Response: We have clarified the distinction between MAS NMR and Fast MAS NMR in the introduction.

__Reviewer #2, Specific Comments 2: __Secondly, MAS NMR has already been applied to systems of comparable complexity - for instance, the (CUG)₉₇ repeat studied by the Goerlach group as early as 2005. That work provided a comprehensive structural characterization of a similar molecular assembly. The authors are strongly encouraged to cite these studies (e.g., Riedel et al., J. Biomol. NMR, 2005; Riedel et al., Angew. Chem., 2006).

Response: We added a mention of that study in the introduction.

Reviewer #2, Experimental Description 1: The experimental details are poorly documented and need to be described in sufficient detail for reproducibility. Specifically: 1. What was the transcription scale? What was the yield (e.g., xx mg RNA per 1 mL transcription reaction)?

Response: Between 3.5 mg and 4.5 mg per 10 ml transcription reaction. We’ve added this information to the methods.

Reviewer #2, Experimental Description 2: 2. Why was the transcription product not purified? Dialysis only removes small molecules, while all macromolecular impurities above the cutoff remain. What was the dialysis cutoff used?

Response: RNA was purified using dialysis and phenol-chloroform precipitation. We have added the information about molecular weight cutoff for dialysis membranes to the methods.

Reviewer #2, Experimental Description 3: 3. How much RNA was used for each precipitation experiment? Were the amounts normalized? For example, if 10 mg of pellet were obtained, what fraction of that mass corresponded to RNA? Was this ratio consistent across all samples?

Response: In the test gel formations, we used 180.0 µg per condition. We used 108.0 µg of RNA for gelation test in the presence of nuclear extracts. We have not determined the water content in the gels. We added this information to methods and results section.

Reviewer #2, Experimental Description 4: 4. Why is there a smaller amount of precipitate when nuclear extract (NE) or CaCl₂ is added?

Response: The apparent difference in pellet size may reflect variations in water content rather than RNA quantity. While the Figure 1 might entice to directly compare pellet weights across different ion series tests, our primary goal was to determine the minimal divalent-ion concentrations required to reproducibly obtain gels. We have added a clarification in the Results section and in the Figure 1 caption regarding the comparability of conditions

Reviewer #2, Experimental Description 5: 5. The authors should describe NE addition in more detail: What is the composition of NE? What buffer was used (particularly Mg²⁺ and salt concentrations)? Was a control performed with NE buffer-type alone (without NE)?

Response: We have added the full description of NE buffer to the methods section. Its composition is: 40 mM Tris pH 8.0, 100 mM KCl, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT, 25 % glycerol. After mixing the nuclear extract with RNA, the target buffer was: 20 mM Tris pH 8.0, 90 mM KCl, 0.1 mM EDTA, 0.25 mM PMSF, 0.75 mM DTT, 12.5% glycerol, and 10 mM MgCl2.

We have not performed a control with NE buffer-type alone but we confirmed separately that glycerol does not affect gel formation.

Reviewer #2, Experimental Description 6: 6. How much pellet/RNA material was actually packed into each MAS rotor?

Response: Starting with a 5 mg pellet, we packed a rotor with a volume of 3 µl. We added this information to the methods section.

Reviewer #2, Additional Clarifications: P5. What is meant by "selective" in the phrase "We recorded a selective 1D-¹H MAS NMR spectrum of 48×G₄C₂ RNA gels"?

Response: That was a typo. We meant imino-selective. It is now corrected.

__Reviewer #2, Additional Clarifications: __ There are also several contradictions between statements in the text and the corresponding figures. For example: • Page 4: The authors write that "The addition of at least 5 mM Mg²⁺ was required for significant 48×G₄C₂ aggregation." However, Figure 1E shows significant aggregation already at 3 mM MgCl₂ (NE−), and in samples containing NE, aggregation appears even at 1 mM MgCl₂. Was aggregation already present in the sample containing NE but without any added MgCl₂?

Response: We changed text in the results section to more closely align with what’s depicted on the figure. There was some aggregation present in the nuclear extracts but it was of different quantity and quality. We clarified this in the results section.

__Reviewer #2 (Significance (Required)): __ The manuscript by Kragelj et al. has the potential to become a valuable study demonstrating the role and power of modern solid-state NMR spectroscopy in investigating molecular assemblies that are otherwise inaccessible to other structural biology techniques.

In its current form, tthe manuscript has significant experimental concerns - particularly the lack of RNA purification and inadequate description of materials and methods. The data therefore cannot support the conclusions presented. I recommend extensive revision and repetition of the experiments using purified RNA material before further consideration for publication.

__Response: __We’ve addressed the concerns about RNA purification within the response to the first comment (Major concern).

__Reviewer #3 (Evidence, reproducibility and clarity (Required)): __ This is an interesting manuscript reporting evidence for formation of both hairpins and G-quadruplexes within RNA aggregates formed by ALS expansion repeats (GGGGCC)n. This is in line with literature but never directly confirmed. Given the novelty of the method (NMR magic angle) and of the data (NMR on aggregate), I believe this manuscript should be considered for publication. I also trust the methods are appropriately reported and reproducible.

Below are my main points:

Major points:

__Reviewer #3, Comment 1: __ 1) RNA aggregation of the GGGGCCn repeat has been reported for expansion as short as 6-8 repeats (see Raguseo et al. Nat Commun 2023), so the authors might not see aggregation under the conditions they use for these shorter repeats but this can happen under physiological conditions . The ionic strengths and the conditions used can vary heavily the phase diagram and the authors therefore should tone down significantly their conclusions. They characterise one aggregate that is likely to contain both secondary structures under the conditions used (in terms of ion and pHs). However, it has been shown in Raguseo et al that aggregates can arise by both intermolecular G4s and hairpins (or a mixture of them) depending on the ionic conditions used. This means that what the authors report might not be necessarily relevant in cells, which should be caveated in the manuscript.

__Response: __We toned down our statements regarding aggregation of shorter repeats in the introduction. We added the citation to Raguseo et al. Nat Commun 2023, which indeed provides useful insights about aggregation of GGGGCC repeats. In Supplementary Figure 1, we had data on gel formation with 8x and 24x repeats which showed these repeat lengths form gels to some extent. We oversimplified our conclusion and said there were no aggregates which needs correction, especially considering other studies reported in the literature have observed in vitro aggregation of these repeat lengths. We modified the results section to reflect this nuance.

__Reviewer #3, Comment 2: __ 2) It would be important to perform perturbation experiments that might promote/disrupt formation of the G4 or hairpin and see if this affect RNA aggregation, which has been already reported by Raguseo et al, and wether this can be appreciated spectroscopically in their assay. This can be done by taking advantage of some of the experiments reported in the manuscript mentioned above, such as: PDS treatment (favouring monomolecular G4s and preventing aggregation), Li vs K treatment (favouring hairpin over G4s), NMM photo-oxidation (disassembling G4s) or addition of ALS relevant RNA binding proteins (i.e. TDP-43). Not all of these controls need to be performed but it would be good to reconcile how the fraction of G4 vs hairpin reflect aggregates' properties, since the authors offer such a nice technique to measure this.

Response: We appreciate the reviewer’s suggestions and we would be eager to do the perturbation experiments in the future. However, these experiments would require additional optimization and waiting for approval and availability of measurement time on a high-field NMR spectrometer. Given that the primary goal of this manuscript is reporting on the methodological approach, we think the current data adequately demonstrate the technique’s utility.

__Reviewer #3, Comment 3: __ 3) I disagree with the speculation of the monomolecular G4 being formed within the condensates, as the authors have no evidence to support this. It has been shown that n=8 repeat forms multimolecular G4s that are responsible of aggregation, so the authors need to provide direct evidence to support this hypothesis if they want to keep it in the manuscript, as it would clash with previous reports (Raguseo et al Nat Commun 2023)

Response: We agree that multimolecular G4s contribute to aggregation in our 48xG4C2 gels. We also realized, after reading this comment, that the original presentation of data and schematics may have unintentionally suggested the presence of monomolecular G4 in our RNA gels. To address this, we have added a clarification to the results section, we modified Figure 2 and 3, and we included a new Supplementary Figure 4. For clarification, both multimolecular and monomolecular G4s in model oligonucleotides produce imino 1H and 15N chemical shifts in the same region and cannot be distinguished by the experiments used in our study. Based on the observations reported in the literature, we believe that G4s in 48xG4C2 form primarily intermolecularly, although direct experimental proof is not available with the present data.

Minor points:

__Reviewer #3, Comment 4: __ 4) An obvious omission in the literature is Raguseo et al Nat Commun 2023, extensively mentioned above. Given the relevance of the findings reported in this manuscript for this study, this should be appropriately referenced for clarity.

Response: We’ve added the citation to Raguseo et al Nat Commun 2023 to the introduction where in vitro aggregation is discussed.

__Reviewer #3, Comment 5: __ 5) The schematic in Figure 3 is somehow confusing and the structures reported and how they relate to aggregate formation is not clear. Given that in structural studies presentation and appearance is everything, I would strongly recommend to the authors to improve the clarity of the schematic for the benefit of the readers.

Response: We thank you for your comment. We’ve modified the figure, and we hope it is now clearer.

Providing that the authors can address the criticisms raised, I would be supportive of publication of this fine study.

Reviewer #3 (Significance (Required)):

The main strength of this paper is to provide direct evidence of DNA secondary structure formation within aggregates, which is something that has not been done before. This is important as it reconcile with the relevance of hairpin formation for the disease (reported by Disney and co-workers) and the relevance of G4-formation in the process of aggregation through multimolecular G4-formation (reported by Di Antonio and co-workers). Given the significance of the findings in this context and the novelty of the method applied to the study of RNA aggregation, this reviewer is supportive for publication of this manuscript and of its relevance to the field. I would be, however, more careful in the conclusions reported and would add additional controls to strengthen the conclusions.

Response: We thank the reviewer for the comment. In the conclusion section, we have added a statement highlighting the potential roles of both double-stranded and G4 structures in gel formation, in line with what has been reported in previous studies.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

This is an interesting manuscript reporting evidence for formation of both hairpins and G-quadruplexes within RNA aggregates formed by ALS expansion repeats (GGGGCC)n. This is in line with literature but never directly confirmed. Given the novelty of the method (NMR magic angle) and of the data (NMR on aggregate), I believe this manuscript should be considered for publication. I also trust the methods are appropriately reported and reproducible.

Below are my main points:

Major points:

1) RNA aggregation of the GGGGCCn repeat has been reported for expansion as short as 6-8 repeats (see Raguseo et al. Nat Commun 2023), so the authors might not see aggregation under the conditions they use for these shorter repeats but this can happen under physiological conditions . The ionic strengths and the conditions used can vary heavily the phase diagram and the authors therefore should tone down significantly their conclusions. They characterise one aggregate that is likely to contain both secondary structures under the conditions used (in terms of ion and pHs). However, it has been shown in Raguseo et al that aggregates can arise by both intermolecular G4s and hairpins (or a mixture of them) depending on the ionic conditions used. This means that what the authors report might not be necessarily relevant in cells, which should be caveated in the manuscript.

2) It would be important to perform perturbation experiments that might promote/disrupt formation of the G4 or hairpin and see if this affect RNA aggregation, which has been already reported by Raguseo et al, and wether this can be appreciated spectroscopically in their assay. This can be done by taking advantage of some of the experiments reported in the manuscript mentioned above, such as: PDS treatment (favouring monomolecular G4s and preventing aggregation), Li vs K treatment (favouring hairpin over G4s), NMM photo-oxidation (disassembling G4s) or addition of ALS relevant RNA binding proteins (i.e. TDP-43). Not all of these controls need to be performed but it would be good to reconcile how the fraction of G4 vs hairpin reflect aggregates' properties, since the authors offer such a nice technique to measure this.

3) I disagree with the speculation of the monomolecular G4 being formed within the condensates, as the authors have no evidence to support this. It has been shown that n=8 repeat forms multimolecular G4s that are responsible of aggregation, so the authors need to provide direct evidence to support this hypothesis if they want to keep it in the manuscript, as it would clash with previous reports (Raguseo et al Nat Commun 2023)

Minor points:

4) An obvious omission in the literature is Raguseo et al Nat Commun 2023, extensively mentioned above. Given the relevance of the findings reported in this manuscript for this study, this should be appropriately referenced for clarity.

5) The schematic in Figure 3 is somehow confusing and the structures reported and how they relate to aggregate formation is not clear. Given that in structural studies presentation and appearance is everything, I would strongly recommend to the authors to improve the clarity of the schematic for the benefit of the readers.

Providing that the authors can address the criticisms raised, I would be supportive of publication of this fine study.

Significance

The main strength of this paper is to provide direct evidence of DNA secondary structure formation within aggregates, which is something that has not been done before. This is important as it reconcile with the relevance of hairpin formation for the disease (reported by Disney and co-workers) and the relevance of G4-formation in the process of aggregation through multimolecular G4-formation (reported by Di Antonio and co-workers). Given the significance of the findings in this context and the novelty of the method applied to the study of RNA aggregation, this reviewer is supportive for publication of this manuscript and of its relevance to the field. I would be, however, more careful in the conclusions reported and would add additional controls to strengthen the conclusions.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

The manuscript by Kragelj et al. has the potential to become a valuable study demonstrating the role and power of modern solid-state NMR spectroscopy in investigating molecular assemblies that are otherwise inaccessible to other structural biology techniques. However, due to poor experimental execution and incomplete data interpretation, the manuscript requires substantial revision before it can be considered for publication in any journal.

Major Concern

Inspection of the analytical gels of the transcribed RNA clearly shows that the desired RNA product constitutes only about 10% of the total crude transcript. The RNA must therefore be purified, for example by preparative PAGE, before performing any NMR or other biophysical studies. As it stands, all spectra shown in the figures represent a combined signal of all products in the crude mixture rather than the intended 48× repeat RNA. Consequently, all analyses and conclusions currently refer to a heterogeneous mixture of transcripts rather than the specific target RNA.

Specific Comments

The statements: "We show that a technique called NMR spectroscopy under fast Magic Angle Spinning (fast MAS NMR) can be used to obtain structural information on GGGGCC repeat RNAs of physiological lengths. Fast MAS NMR can be used to obtain structural information on biomolecules regardless of their size." on page 1 are not entirely correct. Firstly, not only fast MAS NMR but MAS NMR in general can provide structural information on biomolecules regardless of their size. Fast MAS primarily allows for ¹H-detected experiments, improves spectral resolution, and reduces the required sample amount. Conventional ¹³C-detected solid-state MAS NMR can provide very similar structural information. A more thorough review of relevant literature could help address this issue. Secondly, MAS NMR has already been applied to systems of comparable complexity - for instance, the (CUG)₉₇ repeat studied by the Goerlach group as early as 2005. That work provided a comprehensive structural characterization of a similar molecular assembly. The authors are strongly encouraged to cite these studies (e.g., Riedel et al., J. Biomol. NMR, 2005; Riedel et al., Angew. Chem., 2006).

Experimental Description

The experimental details are poorly documented and need to be described in sufficient detail for reproducibility. Specifically:

1. What was the transcription scale? What was the yield (e.g., xx mg RNA per 1 mL transcription reaction)?
2. Why was the transcription product not purified? Dialysis only removes small molecules, while all macromolecular impurities above the cutoff remain. What was the dialysis cutoff used?
3. How much RNA was used for each precipitation experiment? Were the amounts normalized? For example, if 10 mg of pellet were obtained, what fraction of that mass corresponded to RNA? Was this ratio consistent across all samples?
4. Why is there a smaller amount of precipitate when nuclear extract (NE) or CaCl₂ is added?
5. The authors should describe NE addition in more detail: What is the composition of NE? What buffer was used (particularly Mg²⁺ and salt concentrations)? Was a control performed with NE buffer-type alone (without NE)?

6. How much pellet/RNA material was actually packed into each MAS rotor? Additional Clarifications P5. What is meant by "selective" in the phrase "We recorded a selective 1D-¹H MAS NMR spectrum of 48×G₄C₂ RNA gels"? There are also several contradictions between statements in the text and the corresponding figures. For example:

7. Page 4: The authors write that "The addition of at least 5 mM Mg²⁺ was required for significant 48×G₄C₂ aggregation." However, Figure 1E shows significant aggregation already at 3 mM MgCl₂ (NE−), and in samples containing NE, aggregation appears even at 1 mM MgCl₂. Was aggregation already present in the sample containing NE but without any added MgCl₂?

Significance

The manuscript by Kragelj et al. has the potential to become a valuable study demonstrating the role and power of modern solid-state NMR spectroscopy in investigating molecular assemblies that are otherwise inaccessible to other structural biology techniques.

In its current form, tthe manuscript has significant experimental concerns - particularly the lack of RNA purification and inadequate description of materials and methods. The data therefore cannot support the conclusions presented. I recommend extensive revision and repetition of the experiments using purified RNA material before further consideration for publication.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

In this manuscript, the authors employed fast MAS NMR spectroscopy to investigate the gel aggregation of longer repeat (48×) RNAs, revealing inherent folding structures and interactions (i.e., G-quadruplex and duplex).

The dynamic structure of the RNA gel was not resolved at high resolution, and only the structural features-namely, the coexistence of G-quadruplexes and duplexes-were inferred. The 1D and 2D NMR spectra were not assigned to specific atomic positions within the RNA, which makes it difficult to perform molecular dynamics (MD) modeling to elucidate the dynamic nature of the RNA gel. The following comments are provided for the authors' consideration:

1. Figure 2E and Figure 3A: The data suggest that Ca²⁺ promotes stronger G-quadruplex formation within the RNA gel compared with Mg²⁺. This observation is somewhat puzzling, as Mg²⁺ is generally known to stabilize G-quadruplex structures. The authors should clarify this discrepancy.
2. Figures 2 and 3: The authors use the chemical shift at δN 144.1 ppm to distinguish between G-quadruplex and duplex structures. How was the reliability of this assignment evaluated? Chemical shifts of RNA atoms can be influenced by various factors such as intermolecular interactions, conformational stress, and local chemical environment, not only by higher-order structures. This point should be substantiated by citing relevant references or by analyzing additional RNA structures exhibiting δN 144.1 ppm signals using NMR spectroscopy.
3. The authors state that "Our findings demonstrate that fast MAS NMR spectroscopy enables atomic-resolution monitoring of structural changes in GGGGCC repeat RNA of physiological lengths." This claim appears overstated, as no molecular model was constructed to define atomic coordinates based on NMR restraints.
4. Figure 3B: The experiment using nuclear extracts supplemented with Mg²⁺ to study RNA aggregation via 2D NMR may not accurately reflect intracellular conditions. It would be informative to perform a parallel experiment using nuclear extracts without additional Mg²⁺ to better simulate the native environment for RNA folding.

Significance

In this manuscript, the authors employed fast MAS NMR spectroscopy to investigate the gel aggregation of longer repeat (48×) RNAs, revealing inherent folding structures and interactions (i.e., G-quadruplex and duplex).

The dynamic structure of the RNA gel was not resolved at high resolution, and only the structural features-namely, the coexistence of G-quadruplexes and duplexes-were inferred. The 1D and 2D NMR spectra were not assigned to specific atomic positions within the RNA, which makes it difficult to perform molecular dynamics (MD) modeling to elucidate the dynamic nature of the RNA gel.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Reviewer #1 (Evidence, reproducibility and clarity (Required)): The authors map the ZFP36L1 protein interactome in human T cells using UltraID proximity labeling combined with quantitative mass spectrometry. They optimize labeling conditions in primary T cells, profile resting and activated cells, and include a time course at 2, 5, and 16 hours. They complement the interactome with co-immunoprecipitation in the presence or absence of RNase to assess RNA dependence. They then test selected candidates using CRISPR knockouts in primary T cells, focusing on UPF1 and GIGYF1/2, and report effects on global translation, stress, activation markers, and ZFP36L1 protein levels. The work argues that ZFP36L1 sits at the center of multiple post-transcriptional pathways in T cells (which in itself is not a novel finding) and that UPF1 supports ZFP36L1 expression at the mRNA and protein level. The main model system is primary human T cells, with some data in Jurkat cells.

The core datasets show thousands of identified proteins in total lysates and enriched biotinylated fractions. Known partners from CCR4-NOT, decapping, stress granules, and P-bodies appear, with additional candidates like GIGYF1/2, PATL1, DDX6, and UPF1. Time-resolved labeling suggests shifts in proximity during early activation. Co-IP with and without RNase suggests both RNA-dependent and RNA-independent contacts. CRISPR loss of UPF1 or GIGYF1/2 increases translation at rest and elevates activation markers, and UPF1 loss reduces ZFP36L1 protein and mRNA while MG132 does not rescue protein levels; UPF1 RIP enriches ZFP36L1 mRNA.

Among patterns worth noting are that the activation state drives the principal variance in both proteome and proximity datasets. Deadenylation, decapping, and granule proteins are consistently near ZFP36L1 across conditions, while some contacts dip at 2 hours and recover by 5 to 16 hours. Mitochondrial ribosomal proteins become more proximal later. UPF1 and GIGYF1 show time-linked behavior and RNase sensitivity that fits roles in mRNA surveillance and translational control. These observations support a dynamic hub model, though they remain proximity-based rather than direct binding maps.

We thank the reviewer for their careful reading and thoughtful summary. Please find our point-to point response below.

Major comments

1) The key conclusions are directionally convincing for a broad and dynamic ZFP36L1 neighborhood in human T cells. The data robustly recover established complexes and add plausible candidates. The time-course and RNase experiments strengthen the claim that interactions shift with activation state and RNA context. The functional tests around UPF1 and GIGYF1/2 point to biological relevance. That said, some statements could be qualified. The statement that ZFP36L1 "coordinates" multiple pathways implies mechanism and directionality that proximity data alone cannot prove. I suggest reframing as "positions ZFP36L1 within" or "supports a model where ZFP36L1 sits within" these networks.

We thank this reviewer for considering our data ‘directionally convincing, and robust, adding new plausible candidates as interactors with ZFP36L1’. We agree that the proposed wording is more appropriate and will change it accordingly.

2) UPF1, as an upstream regulator of ZFP36L1 expression, is a promising lead. The reduction of ZFP36L1 protein and mRNA in UPF1 knockout, the non-rescue by MG132, and the UPF1 RIP on ZFP36L1 mRNA together argue that UPF1 influences ZFP36L1 transcript output or processing. This claim would read stronger with one short rescue or perturbation that pins the mechanism. A compact test would be UPF1 re-expression in UPF1-deficient T cells with wild-type and helicase-dead alleles. This is realistic in primary T cells using mRNA electroporation or virus-based systems. Approximate time 2 to 3 weeks, including guide design check and expansion. Reagents and sequencing about 2 to 4k USD depending on donor numbers. This would help separate viability or stress effects from a direct role in ZFP36L1 mRNA handling.

We agree that a rescue experiment with wild-type and helicase-dead UPF1 in UPF1-deficient primary T cells would be interesting. Unfortunately, however, UPF1 knockout T cells are less viable and divide less (Supp Figure 6B), making further manipulations such as re-expression by viral transduction technically impossible. We will clarify this limitation in the Discussion and will more explicitly indicate that UPF1 promotes ZFP36L1 mRNA and protein expression, while acknowledging that the precise mechanistic contribution of UPF1 (e.g. to transcript processing, export, or surveillance) remain to be fully resolved.

3) The inference that ZFP36L1 proximity to decapping and deadenylation complexes reflects pathway engagement is reasonable and, frankly, expected. Still, where the manuscript moves from proximity to function, the narrative works best when supported by orthogonal validation. Two compact additions would raise confidence without opening new lines of work. First, a small set of reciprocal co-IPs for PATL1 or DDX6 at endogenous levels in activated T cells, run with and without RNase, would tie the RNase-class assignments to biochemistry. Second, a short-pulse proximity experiment using a reduced biotin dose and shorter labeling window in activated cells would address whether long incubations drive non-specific labeling. Both are feasible in 2 to 3 weeks with minimal extra cost for antibodies and MS runs if the facility is in-house.

We fully agree with the reviewer that orthogonal biochemical validation is valuable. Therefore, we already combined time-resolved proximity labeling (between 0-2h, 2-5h, and 5-16 hours) with time-resolved ZFP36L1 co-IPs ± RNase, to address the dynamic behavior and potential temporal broadening of the interactome.

As to running reciprocal co-IPs for PATL1 or DDX6: we had in fact already considered to follow up on PATL1. However, we failed to identified specific antibodies, revealing many unspecific bands (see below). As to DDX6, antibodies suitable for IP have been reported, and we can therefore offer such reciprocal IP as requested.

To further address the raised points, we will (i) clarify how we define and interpret RNase-sensitive versus RNase-resistant classes (ii) emphasize that some key factors (including PATL1) are already detected in shorter labeling conditions (2 h) in activated T cells (Fig 4C); and (iii) better highlight that the our data provide strong candidates and pathway hypotheses that warrant further mechanistic experimentation in follow-up studies, when moving from proximity to function.

As to the suggested lowering dose of biotin: As described in Figure S1, this appeared unsuccessful. We owe it to the reported dependence and use of biotin in primary T cells (Ref’s 31-33 of this manuscript). This also included that we could not culture T cells in biotin-free medium prior to labeling, as most protocols would do in cell lines.

The reviewer also suggested shorter labeling times. Please be advised that the labeling times chosen were based on the reported protein induction and activity on target mRNAs: 1) ZFP36L1 expression peaks at 2h of T cell activation (Zandhuis et al. 2025; 0.1002/eji.202451641, Petkau et al. 2024; 10.1002/eji.202350700), 3) shows the strongest effects on T cell function between 4-5h, and displays a late phase of activity at 5-16h (Popovic et al. Cell Reports 2023; 10.1016/j.celrep.2023.112419). We realize that additional explanation is warranted for this rationale, which we will provide.

4) Reproducibility is helped by donor pooling, repeated T-cell screens, Jurkat confirmation, and detailed methods including MaxQuant, LIMMA, and supervised patterning. Deposition of MS data is listed. The authors should consider adding a brief, stand-alone analysis notebook in SI or on GitHub with exact filtering thresholds and "shape" definitions, since the supervised profiles are central to claims. This would let others reproduce figures from raw tables with the same code and workflows.

We thank the reviewer for his or her suggestion and we have done as suggested. We will include the following link in the manuscript: https://github.com/ajhoogendijk/ZFP36L1_UltraID

5) Replication and statistics are mostly adequate for discovery proteomics. The thresholds are clear, and PCA and correlation frameworks are appropriate. For functional readouts in edited T cells, please make the number of donors and independent experiments explicit in figure legends, and indicate whether statistics are paired by donor. Where viability differs (UPF1), note any gating strategies used to avoid bias in puromycin or activation marker measurements. These clarifications are quick to add.

Please be advised that the current figure legends already contain the requested information at the bottom (which test used, donor number etc). To highlight this better, we will indicate this point more explicitly in the methods section.

Minor comments 6) The UltraID optimization in primary T cells is useful, but the long 16-hour labeling and high biotin should be framed as a compromise rather than a standard. A short statement about potential off-target labeling during extended incubations would set expectations and justify the RNase and time-course controls.

Please be advised that 1) high biotin was required because primary T cells depend on biotin and 2) increase biotin absorption a 2-7-fold upon activation (Ref 31-33 from the paper). For better time resolution, we included a labeling of 2h (from 0-2h of activation), 3h (from 2-5h) and 9h (from 5-16h) of T cell activation. Nevertheless, we agree that we cannot exclude the risk of off-target labeling, which in fact is inherent to any labeling and pulldown method. We will include such statement in the discussion.

7) The overlap across T-cell screens and with HEK293T APEX datasets is discussed, but a compact quantitative reconciliation would help. A table that lists shared versus cell-type-specific interactors with brief notes on known expression patterns would make this point concrete.

We thank the reviewer for this suggestion. We agree and we will include such table.

8) Figures are generally clear. Where proximity and total proteome PCA are shown, consider adding sample-wise annotations for donor pools and activation time to help readers link variance to biology. Ensure all volcano plots and heatmaps display the exact cutoffs used in text.

We agree that sample-wise annotations would be a nice addition. However, when testing this for e.g. FIgure 1D&E, such differentiation into individual donors becomes illegible due to the many different variables already present. We therefore decided against it.

9) Prior work on ZFP36 family roles in decay, deadenylation via CCR4-NOT, granules, and translational control is cited within the manuscript. In a few places, recent proximity and interactome papers could be more explicitly integrated when comparing overlap, especially where conclusions differ by cell type. A concise paragraph in Discussion that lays out what is truly new in primary T cells would help clarify the contribution of this work to the field.

We appreciate this suggestion and will revise the Discussion accordingly. As to what is new in primary T cells, we would also like to mention that adding H2O2 (required for APEX labeling) to T cells results in immediate cell death can therefore not be employed on T cells. This technical limitation further underscores the valuable contribution of the UltraID-based approach we present here.

Reviewer #1 (Significance (Required)):

Nature and type of advance. The study is a technical and contextual advance in mapping ZFP36L1 proximity partners directly in human primary T cells during activation. The combination of time-resolved labeling and RNase-class assignments is informative. The CRIS PR perturbations provide an initial functional bridge from proximity to phenotype, especially for UPF1.

Context in the literature. ZFP36 family proteins have long been linked to ARE-mediated decay, CCR4-NOT recruitment, and granule localization. The present work confirms those cores and extends them to include decapping and GIGYF1/2-4EHP scaffolds in primary T cells with temporal resolution. The UPF1 link to ZFP36L1 expression adds a plausible surveillance angle that merits follow-up. The cell-type specificity analysis versus HEK293T underscores that proximity networks vary with context.

Audience. Readers in RNA biology, T-cell biology, and proteomics will find the dataset valuable. Groups studying post-transcriptional regulation in immunity can use the resource to prioritize candidate nodes for mechanistic work.

Expertise and scope. I work on post-transcriptional regulation, RNA-protein complexes, and T-cell effector biology. I am comfortable evaluating the conceptual claims, experimental design, and statistical treatment. I am not a mass spectrometry specialist, so I rely on the presented parameters and deposited data for MS acquisition specifics.

To conclude, the manuscript delivers a substantive proximity map of ZFP36L1 in human T cells, with useful temporal and RNA-class information. The UPF1 observations are promising and would benefit from a compact rescue to secure causality. A few minor additions for biochemical validation and transparency in replication would further strengthen the paper.

We thank the reviewer for this comprehensive and constructive assessment. We agree that our study primarily provides a substantive and well-annotated proximity map of ZFP36L1 in human T cells, including temporal and RNA-class information, and that the UPF1 observations constitute a promising lead that merits more detailed mechanistic analysis in follow-up studies.

Reviewer #2 (Evidence, reproducibility and clarity (Required)): The manuscript by Wolkers and colleagues describes the protein interactome of the RNA-binding protein ZFP36L1 in primary human T-cells. There is inherent value in the use of primary cells of human origin, but there is also value in that the study is quite complete, as it is performed in a variety of conditions: T-cells that have been activated or not, at different time points after activation, and by two methods (co-IP and proximity labeling). One might imagine that this basically covers all what can be detected for this protein in T-cells. The authors report a large amount of new interactors involved at all steps in post-transcriptional regulation. In addition, the authors show that UPF1, a known interactor of ZFP36L1, actually binds to ZFP36L1 mRNA and enhances its levels. In sum, the work provides a valuable resource of ZFP36L1 interactors. Yet, how the data add to the mechanistic understanding of ZFP36L1 functions and/or regulation of ZFP36L1 remains unclear.

We thank the reviewer for this enthusiasm on our experimental setups, considering the use of primary T cells of inherent value and our study with the variety of conditions complete.

Major comments: 1) Fig 2: It is confusing that the Pearson correlation to define ZFP36L1 interactors is changed depending on figure panel. In panels A-C, a correlation {greater than or equal to} 0.6 is used, while panel D uses a correlation > 0.5, which changes the nº of interactors. Then, this is changed again in Fig 3A for some cell types but not for others. Why has this been done? It would be better to stick to the same thresholds throughout the manuscript.

Please be advised that different correlation thresholds arise from the composition of the individual datasets: they in depth, number of controls, and the overall dynamic range. The initial proximity labeling experiment (Figure 2A–C) had a higher depth and a larger number of suitable control samples, which allowed us to apply a stricter cutoff (r ≥ 0.6). The time-course experiment and some of the cross-cell-type comparisons have fewer controls and somewhat lower depth, which then required a more permissive threshold (e.g. r > 0.5) to retain known core interactors.

We fully agree that this rationale needs to be explicit. In the revised manuscript we (i) clearly state for each dataset which correlation cutoff is used (ii) emphasize that these thresholds are somewhat arbitrary and should not be directly compared across experiments, and (iii) highlight that our key biological conclusions do not depend on the exact boundary chosen but rather on the consistent enrichment of core complexes and pathways across .

2) Fig 3A: It would be nice to have the information of this Figure panel as a Table (protein name, molecular process(es), known or novel, previously detected in which cells) in addition to the figure.

We agree that this would increase the value of our work as a resource to the community, and we will include such table and merge it with the table Reviewer 1 asked about.

3) Fig 6: To what extent are the effects of UPF1 and GIGFYF1 knock-out on translation and T-cell hyper-activation mediated by ZFP36L1? If deletion of ZFP36L1 itself has no effect on these processes, it seems unlikely that it is involved. In this respect, I am not sure that Fig 6 contributes to the understanding of ZFP36L.

We appreciate this conceptual question. In our dataset, ZFP36L1 knockout affects T-cell activation markers, but does not recapitulate the increased global translation observed upon UPF1 or GIGYF1/2 deletion. We will discuss this finding more explicitly in the Results and Discussion. We discuss the possibility that other ZFP36 family members (e.g. ZFP36/TTP, ZFP36L2) may partially compensate for the absence of ZFP36L1 in some readouts1. Moreover, we will emphasize that at this point it is not clear whether ZFP36L1’s contribution to UPF1 and GIGYF1 protein levels is direct or indirect.

We nonetheless consider Fig. 6 an important component of the story, as it demonstrates that proximity partners emerging from the interactome (UPF1, GIGYF1/2) have measurable functional consequences on T cell activation and translational control, thereby illustrating how the resource can guide mechanistic hypotheses. We will now more carefully phrase this as “first indications of mechanism” and avoid implying that these phenotypes are mediated exclusively via ZFP36L1.

4) Fig 7E: Differences in ZFP36L1 mRNA expression are claimed as a consequence of UPF1 deletion, and indeed there is a clear tendency to reduction of ZFP36L1 mRNA levels upon UPF1 KO. Yet the difference is statistically non-significant. Please, repeat this experiment to increase statistical significance. In addition, a clear discussion on how UPF1 -generally associated to mRNA degradation- contributes to increase ZFP36L1 mRNA levels would be appreciated.

We would like to refrain from including repeats for increasing statistical power. We find similar trends with n=3 at 0h as with n=7 at 3h of activation (Fig. 7E). We rather would like to stress that despite the width overall expression levels which most probably stems from using primary human material, the overall levels of ZFP36L1 mRNA are lower in UPF1 KO T cells. We will include a point on how UPF1 possibly may contribute to the decreased ZFP36L1 mRNA levels, as suggested.

5) Fig 6A: The decrease in global translation by GIGFYF1 knock-out upon activation claimed by the authors is not clear in Fig 6A and is non-significant upon quantification. Please, modify narrative accordingly.

Indeed, this was not phrased well. We will correct our description to match the statistical analysis.

6) Page 6: The authors state 'This included the PAN2/3 complex proteins which trim poly(A) tails prior to mRNA degradation through the CCR4/NOT complex'. To the best of my knowledge, the CCR4/NOT complex does not degrade the body of the mRNA. Both PAN2/3 and CCR4/NOT are deadenylases that function independently.

We thank the reviewer for highlighting this inaccuracy. PAN2/3 and CCR4–NOT are indeed both deadenylase complexes that function independently rather than one acting strictly upstream of the other in degrading the mRNA body. We will correct this statement to that PAN2/3 and CCR4–NOT cooperate in poly(A) tail shortening and do not themselves degrade the mRNA body, which is instead handled by the downstream decay machinery.

7) Please, label all Table sheets. Right now one has to guess what is being shown in most of them. Furthermore, it would be convenient to join all Tables related to the same Figure in one unique Excel with several sheets, rather than having many Tables with only one sheet each.

We appreciate this suggestion. In the revised supplementary files all table sheets will be clearly labeled to indicate the corresponding figure and dataset, and combined into a single excel file when multiple tables relate to the same figure. We have already done so.

Minor comments: 8) Fig 1E: Shouldn't there be a better separation by biotinylation in the UltraID IP principal component analysis? In theory, only biotinylated proteins should be immunoprecipitated.

In theory this should indeed be the case. However, in practice, pull down experiments always suffer from background stickiness of proteins to tubes, beads etc. Combined, these known background issues highlight the critical addition of control samples, allowing for unequivocal call of proteins that are above background.

In addition, as we indicated in the manuscript, primary T cells depend on Biotin. This prohibited us to use biotin-free medium, even for a short culture period (it resulted in cell death). Such biotin-free culture steps are included in proximity labeling assays performed in cell lines. Owing to the continuous addition of biotin, some of the ‘background’ biotinylation signal may even be ‘real’. Nevertheless, the higher levels of biotin we added during the labeling results in increased signals, and statistical analysis with these controls identifies which of the proteins are above background, irrespective from the source. We will include a short note on this in the manuscript

9) Fig 3B-E: Is the labeling not swapped, top (always +) is Biotin and bottom (- or +) is aCD3/aCD28?

We thank the reviewer for catching this mistake- we have corrected it

10) Fig 7A data is from another paper, so I suggest to move this panel to Supplementary materials.

We respectfully disagree. Please be advised that we reanalysed data from published datasets, that resulted in this figure. Re-analysis is a widely accepted method and certainly used for main figure panels. Our re-analysis from Bestenhorn et al 2025; (10.1016/j.molcel.2025.01.001) confirms that ZFP36L1 interacts with UPF1 and GIGYF1/2 in the RAW 264.7 macrophage cell line, which we consider an important consolidation of our findings. To highlight that this table is a re-analysis of published data, we will include this information (including the reference) below the data. As ‘extracted from Bestenhorn et al'

11) Fig S1A: Why is there so much labeling in the UltraID only lane without biotin?

This is a phenomenon also reported by others (Kubitz et al. 2022; 10.1038/s42003-022-03604-5: Figure 5A). UltraID alone is a small protein of (19.7KD), comparable to TurboID or others (Kubitz et al. 2022; 10.1038/s42003-022-03604-5). If not tethered to a specific compartment, these proximity labeling moieties can diffuse through the cytoplasm, biotinylating any protein they ‘bump’ into. Please be advised that we included this control to show this effect, to substantiate why we use GFP-UltraID- as control, to limit such background effects. To highlight this point better, we will better articulate this reasoning in the results section.

12) Fig S1E: Please, explain better. What is WT?

We thank the reviewer for catching this inconsistency. We will explicitly define “WT” as wild-type primary T cells (non-edited, non-transduced) and clarify how this relates to the other conditions.

13) Fig S4B: Please, explain the labels on top of the shapes.

We will update the figure, explaining how the labels above each shape are chosen (e.g. indicating specific clusters, functional categories, or experimental conditions, as appropriate). This should make the reading more intuitive.

14) Page 3: A time-course of incubation with biotin is lacking in Fig S1B, and thereby it is confusing that the authors direct readers to this figure when an increased to 16h incubation is claimed to be better.

Please be advised that short labeling times yielded disappointing results in primary human T cells. Therefore all first analyses were performed with 16h biotinylation, as depicted in Figure S1B). Only after achieving good results (presented in Figure 1B), we performed time course experiments (presented in __Figure 4, __lowering incubation times to 2h, 3h and 9h). We realize that this is confusing and we will rephrase this point in page 3.

Reviewer #2 (Significance (Required)): Strengths: A thorough repository of ZFP36L1 interactors in primary human T-cells. A valuable resource for the community. Weaknesses: There is little mechanistic insight on ZFP36L1 function or regulation.

We would like to highlight that the purpose of our study was to provide a comprehensive interactome of ZFP36L1, and to study the dynamics of these interactions. In addition to known interactors, we identified novel putative interactors of ZFP36L1. We have indeed not followed up on all interactions, which we consider beyond the scope of this manuscript. Rather, we consider our study as a toolbox for the community, that helps in their studies.

Nevertheless, in Fig 6-7, we show first indications of mechanistic insights on ZFP36L1 interactors, exemplifying how the findings of this resource paper can be used by the community.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

The authors have analyzed the interactome of ZFP36L1 in primary human T cells using a biotin-based proximity labeling method. In addition to proteins that are known to interact with ZFP36L1, the authors defined a multitude of novel interactions involved in mRNA decapping, mRNA degradation pathways, translation repressors, stress granule/p-body formation, and other regulatory pathways. Time-lapse proximity labeling revealed that the ZFP36L1 interactome undergoes remodeling during T cell activation. Co-IP for ZFP36L1 executed in the presence/absence of RNA further revealed the interactome and possible regulators of ZFP36L1, including the helicase UPF1. In addition to interacting with ZFP36L1, UPF1 promotes the ZFP36L1 protein expression, seemingly by binding to the ZFP36L1 mRNA transcript, and in some way stabilizing it. This comprehensive interactome map highlights the widespread interactions of ZFP36L1 with proteins of many types, and its potential roles in diverse T cell processes. Although somewhat descriptive, rather than hypothesis-testing, this work represents an important contribution to understanding the potential roles of the ZFP36 family proteins, and sets up many future experiments which could test molecular details.

We thank the reviewer for these thoughtful points, and for recognizing our paper as an important contribution for the field as resource, that should support future experiments.

Major points: 1) Can the authors discuss the specificity of the antibody for ZFP36L1 used in the Co-IP experiments? The antibody listed in Appendix A is abcam catalog number ab42473, although the catalog number for this antibody (unlike the others major ones used) is not listed in the Methods section - please add this to the Methods to make it easier for readers to find this detail. Could this antibody also be immunoprecipitating ZFP36 or ZFP36L2? Other antibodies have had cross-reactivity for the different family members. It is also notable that this antibody has been discontinued by the manufacturer (https://www.abcam.com/en-us/products/unavailable/zfp36l1-antibody-ab42473). Have the authors tried the current abcam anti-ZFP36L1 antibody being sold, catalog number ab230507?

We appreciate the opportunity to clarify this important technical point. We have now added the catalog number (ab42473, Abcam) of the anti-ZFP36L1 antibody used for co-IP to the Methods section, in addition to Appendix A, to facilitate reproducibility. The antibody ab42473 has indeed been discontinued by the manufacturer. We have contacted the manufacturer on multiple occasions with no luck.

We have evaluated multiple alternative anti-ZFP36L1 antibodies, including the currently available Abcam antibody ab230507. In our hands, these alternatives showed weaker or less specific detection of ZFP36L1 compared to the original ZFP36L1 antibody. Only antibody 1A3 recognized ZFP36L1. We therefore used this antibody for the Co-IP. Importantly, even though the signal is lower than the original antibody we used, the migration patterns observed with ab42473 in our co-IP experiments match the expected molecular weight of ZFP36L1 and do not suggest substantial cross-reactivity with ZFP36 or ZFP36L2, which display distinct sizes (we will add the sizes to the WB in figures). We discuss this point briefly in the revised Methods/Results.

2) On this point, the authors report interactions between ZFP36L1 and its related proteins ZFP36 and ZFP36L2 in the Co-IP experiment (Supp 5C). Did these proteins interact in the proximity labeling? Ideally this could be discussed in the Discussion section.

ZFP36 and ZFP36L2 were indeed detected as co-precipitating with ZFP36L1 in the co-IP experiments but were not found as high-confidence interactors in the UltraID proximity labeling datasets. Also in the APEX proximity labeling of Bestehorn et al. In RAW macrophage cells, they did not find ZFP36 or ZFP36L1 to interact with ZFP36L1. * *We now explicitly mention this in the Results and discuss it in the Discussion.

3) Can the authors discuss more fully the limited overlap in identified interactors across the two proximity labeling screens performed in primary T cells (Fig 2C)? Likewise, can the authors comment on the very limited overlap between the screens in T cells and the published ZFP36L1-APEX proximity labelling experiment performed in the HEK293T cell line by Bestehorn et al. (ref 42)? Only 6.8% of proteins found in either T cell screen were found as interactors in this cell line. The authors comment that this may be because "...either expression of certain proteins is cell-type specific, or [because] ZFP36L1 has cell-type specific protein interactions, in addition to its core interactome". While I agree that cell-type specific interactions may be at play, I would think most of the interactors found in the T cell screens are widely expressed proteins necessary for central cell functions.

First, the apparent overlap percentage depends on depth and filtering. As noted above and now detailed in a new Supplementary table, a core set of decapping, deadenylation, and granule-associated factors is consistently recovered across our T-cell screens and the HEK293T APEX dataset. However, beyond this core protein, overlap is reduced, reflecting several factors: (i) differences in expression levels of many interactors between HEK293T cells and primary T cells; (ii) the activation-dependent nature of ZFP36L1 function in T cells, which cannot be fully mimicked in HEK293T; (iii) different proximity labeling enzymes and fusion constructs (APEX vs UltraID, different tags, expression levels); and (iv) distinct experimental designs and control strategies, which influence statistical filtering and the effective “depth” of each interactome.

In the revised Discussion and in the new comparative table, we now emphasize that while many of the ZFP36L1 proximity partners identified in T cells are indeed widely expressed, their effective labeling and enrichment are strongly context dependent. We therefore interpret the relatively limited overlap as highlighting both a robust core interactome and substantial context-specific remodeling, rather than as evidence of artifacts in one or the other dataset.

Minor comments: 4) In Figure 3D, the legend states that black circles indicate significantly enriched proteins in biotin samples, while grey circles indicate non-significant enrichment. However, some genes, including DCP1A, DDX6, YBX1, have black circles in the -biotin group and grey in the +biotin group, which creates confusion in interpretation.

We thank the reviewer for this comment. We have accidentally switched the labeling of biotin and activation as pointed out by reviewer 2. Once this is fixed, this comment will also be fixed.

5) Did the authors find any interactors whose expression is known to be specific to CD4 or CD8 T cells?

In our current dataset we did not identify interactors whose presence was clearly restricted to CD4 or CD8 T-cells. We agree that differential ZFP36L1 interactomes in defined T-cell subsets represent an interesting avenue for future targeted studies and will outline this is the discussion.

Reviewer #3 (Significance (Required)):

The authors present the first comprehensive analysis of the ZFP36L1 interactome in primary T cells. The use of biotin-based proximity labeling enables detection of physiologically relevant interactions in live cells. This approach revealed many novel interactors.

Strengths include the overall richness of the dataset, and the hypothesis-provoking experiments that could follow in the future. Limitations include somewhat limited overlap with a published proximity labeling dataset from performed in a different cell line, suggesting that there may be artifacts in one or both datasets.

The audience for this article would include those interested broadly in RNA binding proteins and those interested in post-transcriptional and translational regulation.

I have immunology expertise on T cell activation and differentiation and expertise on transcriptional and post-transcriptional regulation of gene expression in T cells.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The authors have analyzed the interactome of ZFP36L1 in primary human T cells using a biotin-based proximity labeling method. In addition to proteins that are known to interact with ZFP36L1, the authors defined a multitude of novel interactions involved in mRNA decapping, mRNA degradation pathways, translation repressors, stress granule/p-body formation, and other regulatory pathways. Time-lapse proximity labeling revealed that the ZFP36L1 interactome undergoes remodeling during T cell activation. Co-IP for ZFP36L1 executed in the presence/absence of RNA further revealed the interactome and possible regulators of ZFP36L1, including the helicase UPF1. In addition to interacting with ZFP36L1, UPF1 promotes the ZFP36L1 protein expression, seemingly by binding to the ZFP36L1 mRNA transcript, and in some way stabilizing it. This comprehensive interactome map highlights the widespread interactions of ZFP36L1 with proteins of many types, and its potential roles in diverse T cell processes. Although somewhat descriptive, rather than hypothesis-testing, this work represents an important contribution to understanding the potential roles of the ZFP36 family proteins, and sets up many future experiments which could test molecular details.

Major points:

1) Can the authors discuss the specificity of the antibody for ZFP36L1 used in the Co-IP experiments? The antibody listed in Appendix A is abcam catalog number ab42473, although the catalog number for this antibody (unlike the others major ones used) is not listed in the Methods section - please add this to the Methods to make it easier for readers to find this detail. Could this antibody also be immunoprecipitating ZFP36 or ZFP36L2? Other antibodies have had cross-reactivity for the different family members. It is also notable that this antibody has been discontinued by the manufacturer (https://www.abcam.com/en-us/products/unavailable/zfp36l1-antibody-ab42473). Have the authors tried the current abcam anti-ZFP36L1 antibody being sold, catalog number ab230507?

2) On this point, the authors report interactions between ZFP36L1 and its related proteins ZFP36 and ZFP36L2 in the Co-IP experiment (Supp 5C). Did these proteins interact in the proximity labeling? Ideally this could be discussed in the Discussion section.

3) Can the authors discuss more fully the limited overlap in identified interactors across the two proximity labeling screens performed in primary T cells (Fig 2C)? Likewise, can the authors comment on the very limited overlap between the screens in T cells and the published ZFP36L1-APEX proximity labelling experiment performed in the HEK293T cell line by Bestehorn et al. (ref 42)? Only 6.8% of proteins found in either T cell screen were found as interactors in this cell line. The authors comment that this may be because "...either expression of certain proteins is cell-type specific, or [because] ZFP36L1 has cell-type specific protein interactions, in addition to its core interactome". While I agree that cell-type specific interactions may be at play, I would think most of the interactors found in the T cell screens are widely expressed proteins necessary for central cell functions.

Minor comments:

4) In Figure 3D, the legend states that black circles indicate significantly enriched proteins in biotin samples, while grey circles indicate non-significant enrichment. However, some genes, including DCP1A, DDX6, YBX1, have black circles in the -biotin group and grey in the +biotin group, which creates confusion in interpretation.

5) Did the authors find any interactors whose expression is known to be specific to CD4 or CD8 T cells?

Significance

The authors present the first comprehensive analysis of the ZFP36L1 interactome in primary T cells. The use of biotin-based proximity labeling enables detection of physiologically relevant interactions in live cells. This approach revealed many novel interactors.

Strengths include the overall richness of the dataset, and the hypothesis-provoking experiments that could follow in the future. Limitations include somewhat limited overlap with a published proximity labeling dataset from performed in a different cell line, suggesting that there may be artifacts in one or both datasets.

The audience for this article would include those interested broadly in RNA binding proteins and those interested in post-transcriptional and translational regulation.

I have immunology expertise on T cell activation and differentiation and expertise on transcriptional and post-transcriptional regulation of gene expression in T cells.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

The manuscript by Wolkers and colleagues describes the protein interactome of the RNA-binding protein ZFP36L1 in primary human T-cells. There is inherent value in the use of primary cells of human origin, but there is also value in that the study is quite complete, as it is performed in a variety of conditions: T-cells that have been activated or not, at different time points after activation, and by two methods (co-IP and proximity labeling). One might imagine that this basically covers all what can be detected for this protein in T-cells. The authors report a large amount of new interactors involved at all steps in post-transcriptional regulation. In addition, the authors show that UPF1, a known interactor of ZFP36L1, actually binds to ZFP36L1 mRNA and enhances its levels. In sum, the work provides a valuable resource of ZFP36L1 interactors. Yet, how the data add to the mechanistic understanding of ZFP36L1 functions and/or regulation of ZFP36L1 remains unclear.

Major comments:

1) Fig 2: It is confusing that the Pearson correlation to define ZFP36L1 interactors is changed depending on figure panel. In panels A-C, a correlation {greater than or equal to} 0.6 is used, while panel D uses a correlation > 0.5, which changes the nº of interactors. Then, this is changed again in Fig 3A for some cell types but not for others. Why has this been done? It would be better to stick to the same thresholds throughout the manuscript.

2) Fig 3A: It would be nice to have the information of this Figure panel as a Table (protein name, molecular process(es), known or novel, previously detected in which cells) in addition to the figure.

3) Fig 6: To what extent are the effects of UPF1 and GIGFYF1 knock-out on translation and T-cell hyper-activation mediated by ZFP36L1? If deletion of ZFP36L1 itself has no effect on these processes, it seems unlikely that it is involved. In this respect, I am not sure that Fig 6 contributes to the understanding of ZFP36L.

4) Fig 7E: Differences in ZFP36L1 mRNA expression are claimed as a consequence of UPF1 deletion, and indeed there is a clear tendency to reduction of ZFP36L1 mRNA levels upon UPF1 KO. Yet the difference is statistically non-significant. Please, repeat this experiment to increase statistical significance. In addition, a clear discussion on how UPF1 -generally associated to mRNA degradation- contributes to increase ZFP36L1 mRNA levels would be appreciated.

5) Fig 6A: The decrease in global translation by GIGFYF1 knock-out upon activation claimed by the authors is not clear in Fig 6A and is non-significant upon quantification. Please, modify narrative accordingly.

6) Page 6: The authors state 'This included the PAN2/3 complex proteins which trim poly(A) tails prior to mRNA degradation through the CCR4/NOT complex'. To the best of my knowledge, the CCR4/NOT complex does not degrade the body of the mRNA. Both PAN2/3 and CCR4/NOT are deadenylases that function independently.

7) Please, label all Table sheets. Right now one has to guess what is being shown in most of them. Furthermore, it would be convenient to join all Tables related to the same Figure in one unique Excel with several sheets, rather than having many Tables with only one sheet each.

Minor comments:

8) Fig 1E: Shouldn't there be a better separation by biotinylation in the UltraID IP principal component analysis? In theory, only biotinylated proteins should be immunoprecipitated.

9) Fig 3B-E: Is the labeling not swapped, top (always +) is Biotin and bottom (- or +) is aCD3/aCD28?

10) Fig 7A data is from another paper, so I suggest to move this panel to Supplementary materials.

11) Fig S1A: Why is there so much labeling in the UltraID only lane without biotin?

12) Fig S1E: Please, explain better. What is WT?

13) Fig S4B: Please, explain the labels on top of the shapes.

14) Page 3: A time-course of incubation with biotin is lacking in Fig S1B, and thereby it is confusing that the authors direct readers to this figure when an increased to 16h incubation is claimed to be better.

Significance

Strengths: A thorough repository of ZFP36L1 interactors in primary human T-cells. A valuable resource for the community.

Weaknesses: There is little mechanistic insight on ZFP36L1 function or regulation.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

The authors map the ZFP36L1 protein interactome in human T cells using UltraID proximity labeling combined with quantitative mass spectrometry. They optimize labeling conditions in primary T cells, profile resting and activated cells, and include a time course at 2, 5, and 16 hours. They complement the interactome with co-immunoprecipitation in the presence or absence of RNase to assess RNA dependence. They then test selected candidates using CRISPR knockouts in primary T cells, focusing on UPF1 and GIGYF1/2, and report effects on global translation, stress, activation markers, and ZFP36L1 protein levels. The work argues that ZFP36L1 sits at the center of multiple post-transcriptional pathways in T cells (which in itself is not a novel finding) and that UPF1 supports ZFP36L1 expression at the mRNA and protein level. The main model system is primary human T cells, with some data in Jurkat cells.

The core datasets show thousands of identified proteins in total lysates and enriched biotinylated fractions. Known partners from CCR4-NOT, decapping, stress granules, and P-bodies appear, with additional candidates like GIGYF1/2, PATL1, DDX6, and UPF1. Time-resolved labeling suggests shifts in proximity during early activation. Co-IP with and without RNase suggests both RNA-dependent and RNA-independent contacts. CRISPR loss of UPF1 or GIGYF1/2 increases translation at rest and elevates activation markers, and UPF1 loss reduces ZFP36L1 protein and mRNA while MG132 does not rescue protein levels; UPF1 RIP enriches ZFP36L1 mRNA.

Among patterns worth noting are that the activation state drives the principal variance in both proteome and proximity datasets. Deadenylation, decapping, and granule proteins are consistently near ZFP36L1 across conditions, while some contacts dip at 2 hours and recover by 5 to 16 hours. Mitochondrial ribosomal proteins become more proximal later. UPF1 and GIGYF1 show time-linked behavior and RNase sensitivity that fits roles in mRNA surveillance and translational control. These observations support a dynamic hub model, though they remain proximity-based rather than direct binding maps.

Major comments

The key conclusions are directionally convincing for a broad and dynamic ZFP36L1 neighborhood in human T cells. The data robustly recover established complexes and add plausible candidates. The time-course and RNase experiments strengthen the claim that interactions shift with activation state and RNA context. The functional tests around UPF1 and GIGYF1/2 point to biological relevance. That said, some statements could be qualified. The statement that ZFP36L1 "coordinates" multiple pathways implies mechanism and directionality that proximity data alone cannot prove. I suggest reframing as "positions ZFP36L1 within" or "supports a model where ZFP36L1 sits within" these networks.

UPF1, as an upstream regulator of ZFP36L1 expression, is a promising lead. The reduction of ZFP36L1 protein and mRNA in UPF1 knockout, the non-rescue by MG132, and the UPF1 RIP on ZFP36L1 mRNA together argue that UPF1 influences ZFP36L1 transcript output or processing. This claim would read stronger with one short rescue or perturbation that pins the mechanism. A compact test would be UPF1 re-expression in UPF1-deficient T cells with wild-type and helicase-dead alleles. This is realistic in primary T cells using mRNA electroporation or virus-based systems. Approximate time 2 to 3 weeks, including guide design check and expansion. Reagents and sequencing about 2 to 4k USD depending on donor numbers. This would help separate viability or stress effects from a direct role in ZFP36L1 mRNA handling.

The inference that ZFP36L1 proximity to decapping and deadenylation complexes reflects pathway engagement is reasonable and, frankly, expected. Still, where the manuscript moves from proximity to function, the narrative works best when supported by orthogonal validation. Two compact additions would raise confidence without opening new lines of work. First, a small set of reciprocal co-IPs for PATL1 or DDX6 at endogenous levels in activated T cells, run with and without RNase, would tie the RNase-class assignments to biochemistry. Second, a short-pulse proximity experiment using a reduced biotin dose and shorter labeling window in activated cells would address whether long incubations drive non-specific labeling. Both are feasible in 2 to 3 weeks with minimal extra cost for antibodies and MS runs if the facility is in-house.

Reproducibility is helped by donor pooling, repeated T-cell screens, Jurkat confirmation, and detailed methods including MaxQuant, LIMMA, and supervised patterning. Deposition of MS data is listed. The authors should consider adding a brief, stand-alone analysis notebook in SI or on GitHub with exact filtering thresholds and "shape" definitions, since the supervised profiles are central to claims. This would let others reproduce figures from raw tables with the same code and workflows.

Replication and statistics are mostly adequate for discovery proteomics. The thresholds are clear, and PCA and correlation frameworks are appropriate. For functional readouts in edited T cells, please make the number of donors and independent experiments explicit in figure legends, and indicate whether statistics are paired by donor. Where viability differs (UPF1), note any gating strategies used to avoid bias in puromycin or activation marker measurements. These clarifications are quick to add.

Minor comments

The UltraID optimization in primary T cells is useful, but the long 16-hour labeling and high biotin should be framed as a compromise rather than a standard. A short statement about potential off-target labeling during extended incubations would set expectations and justify the RNase and time-course controls.

The overlap across T-cell screens and with HEK293T APEX datasets is discussed, but a compact quantitative reconciliation would help. A table that lists shared versus cell-type-specific interactors with brief notes on known expression patterns would make this point concrete.

Figures are generally clear. Where proximity and total proteome PCA are shown, consider adding sample-wise annotations for donor pools and activation time to help readers link variance to biology. Ensure all volcano plots and heatmaps display the exact cutoffs used in text.

Prior work on ZFP36 family roles in decay, deadenylation via CCR4-NOT, granules, and translational control is cited within the manuscript. In a few places, recent proximity and interactome papers could be more explicitly integrated when comparing overlap, especially where conclusions differ by cell type. A concise paragraph in Discussion that lays out what is truly new in primary T cells would help clarify the contribution of this work to the field.

Significance

Nature and type of advance. The study is a technical and contextual advance in mapping ZFP36L1 proximity partners directly in human primary T cells during activation. The combination of time-resolved labeling and RNase-class assignments is informative. The CRISPR perturbations provide an initial functional bridge from proximity to phenotype, especially for UPF1.

Context in the literature. ZFP36 family proteins have long been linked to ARE-mediated decay, CCR4-NOT recruitment, and granule localization. The present work confirms those cores and extends them to include decapping and GIGYF1/2-4EHP scaffolds in primary T cells with temporal resolution. The UPF1 link to ZFP36L1 expression adds a plausible surveillance angle that merits follow-up. The cell-type specificity analysis versus HEK293T underscores that proximity networks vary with context.

Audience. Readers in RNA biology, T-cell biology, and proteomics will find the dataset valuable. Groups studying post-transcriptional regulation in immunity can use the resource to prioritize candidate nodes for mechanistic work.

Expertise and scope. I work on post-transcriptional regulation, RNA-protein complexes, and T-cell effector biology. I am comfortable evaluating the conceptual claims, experimental design, and statistical treatment. I am not a mass spectrometry specialist, so I rely on the presented parameters and deposited data for MS acquisition specifics.

To conclude, the manuscript delivers a substantive proximity map of ZFP36L1 in human T cells, with useful temporal and RNA-class information. The UPF1 observations are promising and would benefit from a compact rescue to secure causality. A few minor additions for biochemical validation and transparency in replication would further strengthen the paper.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Manuscript number: RC -2025-03175

Corresponding author(s): Gernot Längst

[Please use this template only if the submitted manuscript should be considered by the affiliate journal as a full revision in response to the points raised by the reviewers.

• *

If you wish to submit a preliminary revision with a revision plan, please use our "Revision Plan" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

1. General Statements [optional]

This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

2. Point-by-point description of the revisions

This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *

We thank the reviewers for their efforts and detailed evaluation of our manuscript. We think that the comments of the reviewers allowed us to significantly improve the manuscript.

With best regards

The authors of the manuscript

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Summary: Holzinger et al. present a new automated pipeline, nucDetective, designed to provide accurate nucleosome positioning, fuzziness, and regularity from MNase-seq data. The pipeline is structured around two main workflows-Profiler and Inspector-and can also be applied to time-series datasets. To demonstrate its utility, the authors re-analyzed a Plasmodium falciparum MNase-seq time-series dataset (Kensche et al., 2016), aiming to show that nucDetective can reliably characterize nucleosomes in challenging AT-rich genomes. By integrating additional datasets (ATAC-seq, RNA-seq, ChIP-seq), they argue that the nucleosome positioning results from their pipeline have biological relevance.

Major Comments:

Despite being a useful pipeline, the authors draw conclusions directly from the pipeline's output without integrating necessary quality controls. Some claims either contradict existing literature or rely on misinterpretation or insufficient statistical support. In some instances, the pipeline output does not align with known aspects of Plasmodium biology. I outline below the key concerns and suggested improvements to strengthen the manuscript and validate the pipeline:

Clarification of +1 Nucleosome Positioning in P. falciparum The authors should acknowledge that +1 nucleosomes have been previously reported in P. falciparum. For example, Kensche et al. (2016) used MNase-seq to map ~2,278 TSSs (based on enriched 5′-end RNA data) and found that the +1 nucleosome is positioned directly over the TSS in most genes:

"Analysis of 2278 start sites uncovered positioning of a +1 nucleosome right over the TSS in almost all analysed regions" (Figure 3A).

They also described a nucleosome-depleted region (NDR) upstream of the TSS, which varies in size, while the +1 nucleosome frequently overlaps the TSS. The authors should nuance their claims accordingly. Nevertheless, I do agree that the +1 positioning in P. falciparum may be fuzzier as compared to yeast or mammals. Moreover, the correlation between +1 nucleosome occupancy and gene expression is often weak and that several genes show similar nucleosome profiles regardless of expression level. This raises my question: did the authors observe any of these patterns in their new data?

We appreciate the reviewer’s insightful comment and agree that +1 nucleosomes and nucleosome depleted promoter regions have been previously reported in P. falciparum, notably by the Bartfai and Le Roch groups, including Kensche et al. (PMID: 26578577). Our study advances this understanding by providing, for the first time, a comprehensive view of the entirety of a canonical eukaryotic promoter architecture in P. falciparum—encompassing the NDR, the well-positioned +1 nucleosome, and the downstream phased nucleosome array. This downstream nucleosome array structure has not been characterized before, as prior studies noted a “lack of downstream nucleosomal arrays” (PMID: 26578577) or “relatively random” nucleosome organization within gene bodies (PMID: 24885191). We have revised the manuscript to more clearly acknowledge previous work and highlight our contributions. The changes we applied in the manuscript are highlighted in yellow and shown as well below.

In the Abstract L26-L230: Contrary to the current view of irregular chromatin, we demonstrate for the first time regular phased nucleosome arrays downstream of TSSs, which, together with the established +1 nucleosome and upstream nucleosome-depleted region, reveal a complete canonical eukaryotic promoter architecture in Pf.

Introduction L156-L159: For example, we identify a phased nucleosome array downstream of the TSS. Together with a well-positioned +1 nucleosome and an upstream nucleosome-free region. These findings support a promoter architecture in Pf that resembles classical eukaryotic promoters (Bunnik et al. 2014, Kensche et al. 2016).

Results L181-L183: These new Pf nucleosome maps reveal a nucleosome organisation at transcription start sites (TSS) reminiscent of the general eukaryotic chromatin structure, featuring a reported well-positioned +1 nucleosome , an upstream nucleosome-free region (NFR, Bunnik et al. 2014, Kensche et al. 2016), and shown for the first time in Pf, a phased nucleosome array downstream of the TSS.

Discussion L414-L419: Previous analyses of Pf chromatin have identified +1 nucleosomes and NFRs (Bunnik et al 2014, Kensche et al. 2016). Here we extend this understanding by demonstrating phased nucleosome array structures throughout the genome. This finding provides evidence for a spatial regulation of nucleosome positioning in Pf, challenging the notion that nucleosome positioning is relatively random in gene bodies (Bunnik et al. 2014, Kensche et al. 2016). Consequently our results contribute to the understanding that Pf exhibits a typical eukaryotic chromatin structure, including well-defined nucleosome positioning at the TSS and regularly spaced nucleosome arrays (Schones et al. 2008; Yuan et al. 2005).

Regarding the reviewer’s question on +1 nucleosome dynamics. Our data agrees with the reviewer and other studies (e.g. PMID: 31694866), that the +1 nucleosome position is robust and does not correlate with gene expression strength. In the manuscript we show that dynamic nucleosomes are preferentially detected at the –1 nucleosome position (Figure 2C). In line with that we show that the +1 nucleosome position does not markedly change during transcription initiation of a subset of late transcribed genes (Figure 5A). However, we observe an opening of the NDR and within the gene body increased fuzziness and decreased nucleosome array regularity (Figure S4A). To illustrate the relationship between the +1 nucleosome positioning and expression strength, we have included a heatmap showing nucleosome occupancy at the TSS, ordered according to expression strength (NEW Figure S4C):

We included a sentence describing the relationship of +1 nucleosome position with gene expression in L257-L258: Furthermore, the +1 nucleosome positioning is unaffected by the strength of gene expression (Figure S2C).

__ Lack of Quality Control in the Pipeline __

The authors claim (lines 152-153) that QC is performed at every stage, but this is not supported by the implementation. On the GitHub page (GitHub - uschwartz/nucDetective), QC steps are only marked at the Profiler stage using standard tools (FastQC, MultiQC). The Inspector stage, which is crucial for validating nucleosome detection, lacks QC entirely. The authors should implement additional steps to assess the quality of nucleosome calls. For example, how are false positives managed? ROC curves should be used to evaluate true positive vs. false positive rates when defining dynamic nucleosomes. How sequencing biases are adressed?

The workflow overview chart on GitHub was not properly color coded. Therefore, we changed the graphics and highlighted the QC steps in the overview charts accordingly:

Based on our long standing expertise of analysing MNase-seq data (PMID: 38959309, PMID: 37641864, PMID: 30496478, PMID: 25608606), the best quality metrics to assess the performance of the challenging MNase experiment are the fragment size distributions revealing the typical nucleosomal DNA lengths and the TSS plots showing a positioned +1 nucleosome and regularly phased nucleosome arrays downstream of the +1 nucleosome. Additionally, visual inspection of the nucleosome profiles in a genome browser is advisable. We make those quality metrics easily available in the nucDetective Profiler workflow (Insertsize Histogram, TSS plot and provide nucleosome profile bigwig files). Furthermore, the PC and correlation analysis based on the nucleosome occupancy in the inspector workflow allows to evaluate replicate reproducibility or integrity of time series data, as shown for data evaluated in this manuscript.

The inspector workflow uses the well-established DANPOS toolkit to call nucleosome positions. Based on our experience, this step is particularly robust and well-established in the DANPOS toolkit (PMID: 23193179), so there is no need to reinvent it. Nevertheless, appropriate pre-processing of the data as done in the nucDetective pipeline is crucial to obtain highly resolved nucleosome positions. Using the final nucleosome profiles (bigwig) and the nucleosome reference positions (bed) as output of the Inspector workflow allows visual inspection of the called nucleosomes in a genome viewer. Furthermore, to avoid using false positive nucleosome positions for dynamic nucleosome analysis, we take only the 20% best positioned nucleosomes of each sample, as determined by the fuzziness score.

We understand the value of a gold standard of dynamic nucleosomes to test performance using ROC curves. However, we are not aware that such a gold standard exists in the nucleosome analysis field, especially not when using multi-sample settings, such as time series data. One alternative would be to use simulated data; however, this has several limitations:

• __Lack of biological complexity: __simulated data often fails to capture the full complexity of biological systems including the heterogeneity, variability, and subtle dependencies present in real-world data. Simplifications and omissions in simulation models can result in test datasets that are more tractable but less realistic, causing software to appear robust or accurate under idealized conditions, while underperforming on actual experimental data.
• __Risks of Overfitting: __Software may be tuned to perform well on simulated datasets leading to overfitting and falsely inflated performance metrics. This undermines the predictive or diagnostic value of the results for real biological data

• Poor Model Fidelity and Hidden Assumptions: The authenticity of simulated data is bounded by the fidelity of the underlying models. If those models are inaccurate or make untested assumptions, the generated data may not reflect real experimental or clinical scenarios. This can mask software shortcomings or bias validation toward specific, perhaps irrelevant, scenarios. Therefore, we decided to validate the performance of the pipeline in the biological context of the analyzed data:

• PCA analysis of the individual nucleosome features shows a cyclic structure as expected for the IDC (Fig. 1D-G).

• Nucleosome occupancy changes anti-correlate with chromatin accessibility (Fig. 3B) as expected.
• Dynamic nucleosome features correlate with expression changes (Fig. 5C) We are aware that MNase-seq experiments might have sequence bias caused by the enzyme's endonuclease sequence preference (PMID: 30496478). However, the main aim of the nucDetective pipeline is to identify dynamic nucleosome features genome wide. Therefore, we are comparing the nucleosome features across multiple samples to find the positions in the genome with the highest variability. Comparisons are performed between the same nucleosome positions at the same genomic sites across multiple conditions, so the sequence context is constant and does not confound the analysis. This is like the differential expression analysis of RNA-seq data, where the gene counts are not normalized by gene length. Introducing a sequence normalization step might distort and bias the results of dynamic nucleosomes.

We included a paragraph describing the limitations to the discussion (L447-457):

Depending on the degree of MNase digestion, preferentially nucleosomes from GC rich regions are revealed in MNase-seq experiments (Schwartz et al. 2019). However, no sequence or gDNA normalisation step was included in the nucDetective pipeline. To identify dynamic nucleosomes, comparisons are performed between the same nucleosome positions at the same genomic sites across multiple samples. Hence, the sequence context is constant and does not confound the analysis. Introducing a sequence normalization step might even distort and bias the results. Nevertheless, it is highly advisable to use low MNase concentrations in chromatin digestions to reduce the sequence bias in nucleosome extractions. This turned out to be a crucial condition to obtain a homogenous nucleosome distribution in the AT-rich intergenic regions of eukaryotic genomes and especially in the AT-rich genome of Pf (Schwartz et al. 2019, Kensche et al. 2016).

__ Use of Mono-nucleosomes Only __

The authors re-analyze the Kensche et al. (2016) dataset using only mono-nucleosomes and claim improved nucleosome profiles, including identification of tandem arrays previously unreported in P. falciparum. Two key issues arise: 1. Is the apparent improvement due simply to focusing on mono-nucleosomes (as implied in lines 342-346)?

The default setting in nucDetective is to use fragment sizes of 140 – 200 bp, which corresponds to the main mono-nucleosome fraction in standard MNase-seq experiments. However, the correct selection of fragment sizes may vary depending on the organism and the variations in MNase-seq protocols. Therefore, the pipeline offers the option of changing the cutoff parameter (--minLen; --maxLen), accordingly. Kensche et al thoroughly tested and established the best parameters for the data set. We agree with their selected parameters and used the same cutoffs (75-175 bp) in this manuscript. For this particular data set, the fragment size selection is not the reason why we obtain a better resolution. MNase-seq analysis is a multistep process which is optimized in the nucDetective pipeline. Differences in the analysis to Kensche et al are at the pre-processing stage and alignment step:

Kensche et al. : “Paired-end reads were clipped to 72 bp and all data was mapped with BWA sample (Version 0.6.2-r126)”

nucDetective:

• Trimming using TrimGalore --paired -q 10 --stringency 2
• Mapping using bowtie2 --very-sensitive –dovetail --no-discordant
• MAPQ >= 20 filtering of aligned read-pairs (samtools). The manuscript text L379 was changed to

This is achieved using MNase-seq optimized alignment settings, and proper selection of the fragment sizes corresponding to mono-nucleosomal DNA to obtain high resolution nucleosome profiles.

How does the pipeline perform with di- or tri-nucleosomes, which are also biologically relevant (Kensche et al., 2016 and others)? Furthermore, the limitation to mono-nucleosomes is only mentioned in the methods, not in the results or discussion, which could mislead readers.

The pipeline is optimized for mono-nucleosome analysis. However, the cutoffs for fragment size selection can be adjusted to analyse other fragment populations in MNase-seq data (--minLen; --maxLen). For example we know from previous studies that the settings in the pipeline could be used for sub-nucleosome analysis as well (PMID: 38959309). Di- or Tri-nucleosome analysis we have not explicitly tested. However, in a previous study (PMID: 30496478) we observed that the inherited MNase sequence bias is more pronounced in di-nucleosomes, which are preferentially isolated from GC-rich regions. This is in line with the depletion of di-nucleosomes in AT-rich intergenic regions in Pf, as was already described by Kensche et al.

Changes to the manuscript text: We included a paragraph describing the limitations to the discussion (L428-434):

The nucDetective pipeline has been optimized for the analysis of mono-nucleosomes. However, the selection of fragment sizes can be adjusted manually, enabling the pipeline to be used for other nucleosome categories. The pipeline is suitable to map and annotate sub-nucleosomal particles (

__ Reference Nucleosome Numbers __

The authors identify 49,999 reference nucleosome positions. How does this compare to previous analyses of similar datasets? This should be explicitly addressed.

We thank the reviewer for this suggestion. In order to put our results in perspective, it is important to distinguish between reference nucleosome positions (what we reported in the manuscript) and all detectable nucleosomes. The reference positions are our attempt to build a set of nucleosome positions with strong evidence, allowing confident further analysis across timepoints. The selection of a well positioned subset of nucleosomes for downstream analysis has been done previously (PMID: 26578577) and the merging algorithm we used across timepoints is also used by DANPOS to decide if a MNase-Seq peak is a new nucleosome position or belongs to an existing position (PMID: 23193179).

To be able to address the reviewer suggestion we prepared and added a table to the supplementary data, including the total number of all nucleosomes detected by our pipeline at each timepoint. We adjusted the results to the following (L223-226):

“The pipeline identified a total of 127370 ± 1151 (mean ± SD) nucleosomes at each timepoint (Supplementary Data X). To exclude false positive positions in our analysis, we conservatively selected 49,999 reference nucleosome positions, representing sites with a well-positioned nucleosome at least at one time point (see Methods). Among these 1192 nucleosomes exhibited […]”

Several groups reported nucleosome positioning data for P. falciparum (PMID: 20015349, PMID: 20054063, PMID: 24885191, PMID: 26578577), however only Ponts et al (2010) reported resolved numbers (~45000-90000 nucleosomes depending in development stage) and Bunnik et al reported ~ 75000 nucleosomes in a graph. Although we do not know the reason of why the other studies did not include specific numbers, we speculate that the data quality did not allow them to confidently report a number. In fact, nucleosomal reads are severely depleted in AT-rich intergenic regions in the Ponts and Bunnik datasets. In contrast, Kensche et al (and our analysis) shows that nucleosomes can be identified throughout the genome of Pf. Therefore, the nucleosome numbers reported by Ponts et al and Bunnik et al are very likely underestimated.

We included the following text in the discussion, addressing previously published datasets (L404 – 405):

“For example, our pipeline was able to identify a total of ~127,000 nucleosomes per timepoint (=5.4 per kb) in range with observed nucleosome densities in other eukaryotes (typically 5 to 6 per kb). From these, we extracted 49,999 reference nucleosome positions with strong positioning evidence across all timepoints, which we used to characterize nucleosome dynamics of Pf longitudinally. Previous studies of P. falciparum chromatin organization, did not report a total number of nucleosomes (Westenberger et al. 2009, Kensche et al. 2016), or estimated approximately ~45000-90000 nucleosomes across the genome at different developmental stages (Bunnik et al. 2014, Ponts et al. 2010). However, this value likely represents an underestimation due to the depletion of nucleosomal reads in AT-rich intergenic regions observed in their datasets.”

__ Figure 1B and Nucleosome Spacing __

The authors claim that Figure 1B shows developmental stage-specific variation in nucleosome spacing. However, only T35 shows a visible upstream change at position 0. In A4, A6, and A8 (Figure S4), no major change is apparent. Statistical tests are needed to validate whether the observed differences are significant and should be described in the figure legends and main text.

We would like to thank the reviewer for bringing this issue to our attention. We apologize for an error we made, wrongly labelling the figure numbers. The differences in nucleosome spacing across time are visible in Figure 1C. Figure 1B shows the precise array structure of the Pf nucleosomes, when centered on the +1 nucleosome, and is mentioned before. The mistake is now corrected.

In Figure 1C the mean NRL and 95% confidence interval are depicted, allowing a visual assessment of data significance (non-overlapping 95% CI-Intervals correspond to p Taken together we corrected this mistake and edited the text as follows (L194 – 199):

“With this +1 nucleosome annotation, regularly spaced nucleosome arrays downstream of the TSS were detected, revealing a precise nucleosome organization in Pf (Figure 1B). Due to the high resolution maps of nucleosomes we can now observe significantvariations in nucleosome spacing depending on the developmental stage (Figure 1C, ANOVA on bootstrapped values (3 per timepoint) F₇,₇₂ = 35.10, p

__ Genome-wide Occupancy Claims __

The claim that nucleosomes are "evenly distributed throughout the genome" (Figure S2A) is questionable. Chromosomes 3 and 11 show strong peaks mid-chromosome, and chromosome 14 shows little to no signal at the ends. This should be discussed. Subtelomeric regions, such as those containing var genes, are known to have unique chromatin features. For instance, Lopez-Rubio et al. (2009) show that subtelomeric regions are enriched for H3K9me3 and HP1, correlating with gene silencing. Should these regions not display different nucleosome distributions? Do you expect the Plasmodium genome (or any genome) to have uniform nucleosome distribution?

On global scale (> 10 kb) we would expect a homogenous distribution of nucleosomes genome wide, regardless of euchromatin or heterochromatin. We have shown this in a previous study for human cells (PMID: 30496478), which was later confirmed for drosophila melongaster (PMID: 31519205,PMID: 30496478) and yeast (PMID: 39587299).

However, Figure S2A shows the distribution of the dynamic nucleosome features during the IDC, called with our pipeline. We agree with the reviewer, that there are a few exceptions of the uniform distribution, which we address now in the manuscript.

Furthermore, we agree with the reviewer that the H3K9me3 / HP1 subtelomeric regions are special. Those regions are depleted of dynamic nucleosomes in the IDC as shown in Fig. 2D and now mentioned in L280 - L282.

We included an additional genome browser snapshot in Supplemental Figure S2B and changed the text accordingly (L245-249):

We observed a few exceptions to the even distribution of the nucleosomes in the center of chromosome 3, 11 and 12, where nucleosome occupancy changes accumulated at centromeric regions (Figure S2B). Furthermore, the ends of the chromosomes are rather depleted of dynamic nucleosome features.

Genome browser snapshot illustrating accumulation of nucleosome occupancy changes at a centromeric site. Centered nucleosome coverage tracks (T5-T40 colored coverage tracks), nucleosomes occupancy changes (yellow bar) and annotated centromers (grey bar) taken from (Hoeijmakers et al., 2012)

Dependence on DANPOS

The authors criticize the DANPOS pipeline for its limitations but use it extensively within nucDetective. This contradiction confuses the reader. Is nucDetective an original pipeline, or a wrapper built on existing tools?

One unique feature of the nucDetective pipeline is to identify dynamic nucleosomes (occupancy, fuzziness, regularity, shifts) in complex experimental designs, such as time series data (Inspector workflow). To our knowledge, there is no other tool for MNase-seq data which allows multi-condition/time-series comparisons (PMID: 35061087). For example, DANPOS allows only pair-wise comparisons, which cannot be used for time-series data. For the analysis of dynamic nucleosome features we require nucleosome profiles and positions at high resolution. For this purpose, several tools do already exist (PMID: 35061087). However, researchers without experience in MNase-seq analysis often find the plethora of available tools overwhelming, which makes it challenging to select the most appropriate ones. Here we share our experience and provide the user an automated workflow (Profiler), which builds on existing tools.

In summary the Profiler workflow is a wrapper built on existing tools and the Inspector workflow is partly a wrapper (uses DANPOS to normalize nucleosome profiles and call nucleosome positions) and implements our original algorithm to detect dynamic nucleosome features in multiple conditions / time-series data.

__ Control Data Usage __

The authors should clarify whether gDNA controls were used throughout the analysis, as done in Kensche et al. (2016). Currently, this is mentioned only in the figure legend for Figure 5, not in the methods or results.

We used the gDNA normalisation to optimize the visualization of the nucleosome depleted region upstream of the TSS in Fig 5A. Otherwise, we did not normalize the data by the gDNA control. The reason is the same as we did not include sequence normalization in the pipeline (see comment above)

We included a paragraph describing the limitations to the discussion (L447-457):

Depending on the degree of MNase digestion, preferentially nucleosomes from GC rich regions are revealed in MNase-seq experiments (Schwartz et al. 2019). However, no sequence or gDNA normalisation step was included in the nucDetective pipeline. To identify dynamic nucleosomes, comparisons are performed between the same nucleosome positions at the same genomic sites across multiple samples. Hence, the sequence context is constant and does not confound the analysis. Introducing a sequence normalization step might even distort and bias the results. Nevertheless, it is highly advisable to use low MNase concentrations in chromatin digestions to reduce the sequence bias in nucleosome extractions. This turned out to be a crucial condition to obtain a homogenous nucleosome distribution in the AT-rich intergenic regions of eukaryotic genomes and especially in the AT-rich genome of Pf (Schwartz et al. 2019, Kensche et al. 2016).

We added following statement to the methods part: Additionally, the TSS profile shown in Figure 5A was normalized by the gDNA control for better NDR visualization.

__ Lack of Statistical Power for Time-Series Analyses __

Although the pipeline is presented as suitable for time-series data, it lacks statistical tools to determine whether differences in nucleosome positioning or fuzziness are significant across conditions. Visual interpretation alone is insufficient. Statistical support is essential for any differential analysis.

We understand the value of statistical support in such an analysis. However, in biology we often face the limitations in terms of the appropriate sample sizes needed to accurately estimate the variance parameters required for statistical modeling. As MNase-seq experiments require a large amount of input material and high sequencing depth, the number of samples in most experiments is low, often with only two replicates (PMID: 23193179). Therefore, we decided that the nucDetective pipeline should be rather handled as a screening method to identify nucleosome features with high variance across all conditions. This prevents misuse of p-values. A common misinterpretation we observed is the use of non-significant p-values to conclude that no biological change exists, despite inadequate statistical power to detect such changes. We included a paragraph in the limitations section discussing the limitations of statistical analysis of MNase-Seq data.

Changes to the manuscript text: We included a paragraph describing the limitations to the discussion (L435-446).

As MNase-seq experiments require a large amount of input material and high sequencing depths, most published MNase-seq experiments do not provide the appropriate sample sizes required to accurately estimate the variance parameters necessary for statistical modelling (Chen et al. 2013). Therefore, dynamic nucleosomes are not identified through statistical testing but rather by ranking nucleosome features according to their variance across all samples and applying a variance threshold to distinguish them. This concept is well established to identify super-enhancers (Whyte et al. 2013). In this study we set the variance cutoff to a slope of 3, resulting in a high data confidence. However, other data sets might require further adjustment of the variance cutoff, depending on data quality or sequencing depth. The nucDetective identification of dynamic nucleosomes can be seen as a screening approach to provide a holistic overview of nucleosome dynamics in the system, which provides a basis for further research.

Reproducibility of Methods

The Methods section is not sufficient to reproduce the results. The GitHub repository lacks the necessary code to generate the paper's figures and focuses on an exemplary yeast dataset. The authors should either: o Update the repository with relevant scripts and examples, o Clearly state the repository's purpose, or o Remove the link entirely. Readers must understand that nucDetective is dedicated to assessing nucleosome fuzziness, occupancy, shift, and regularity dynamics-not downstream analyses presented in the paper.

We thank the reviewer for this helpful comment. In addition to the main nucDetective repository, a second GitHub link is provided in the Data Availability section, which contains the scripts used to generate the figures presented in the paper. This separation was intentional to distinguish the general-purpose nucDetective tool from the project-specific analyses performed for this study. We acknowledge that this may not have been sufficiently clear.

To have all resources available at a single citable permanent location we included a link to the corresponding Zenodo repository (https://doi.org/10.5281/zenodo.16779899) in the Data and materials availability statement.

The Zenodo repository contains:

Code (scripts.zip) and annotation of Plasmodium falciparum (Annotation.zip) to reproduce the nucDetective v1.1 (nucDetective-1.1.zip) analysis as done in the research manuscript entitled "Deciphering chromatin architecture and dynamics in Plasmodium falciparum using the nucDetective pipeline".

The folder "output_nucDetective" conains the complete output of the nucDetective analysis pipeline as generated by the "01_nucDetective_profiler.sh" and "02_nucDetective_inspector.sh" scripts.

Nucleosome coverage tracks, annotation of nucleosome positions and dynamic nucleosomes are deposited additonally in the folder "Pf_nucleosome_annotation_of_nucDetective".

To make this clearer we added following text to Material and Methods in ”The nucDetective pipeline” section:

Changes in the manuscript text (L518-519):

The code, software and annotations used to run the nucDetective pipeline along with the output have been deposited on Zenodo (https://doi.org/10.5281/zenodo.16779899).

__ Supplementary Tables __

Including supplementary tables showing pipeline outputs (e.g., nucleosome scores, heatmaps, TSS extraction) would help readers understand the input-output structure and support figure interpretations.

See comments above.

We included a link to the corresponding Zenodo repository (https://doi.org/10.5281/zenodo.16779899) in the Data and materials availability statement.

The repository contains:

Code (scripts.zip) and annotation of Plasmodium falciparum (Annotation.zip) to reproduce the nucDetective v1.1 (nucDetective-1.1.zip) analysis as done in the research manuscript entitled "Deciphering chromatin architecture and dynamics in Plasmodium falciparum using the nucDetective pipeline".

The folder "output_nucDetective" conains the complete output of the nucDetective analysis pipeline as generated by the "01_nucDetective_profiler.sh" and "02_nucDetective_inspector.sh" scripts.

Minor Comments:

The authors should moderate claims such as "no studies have reported a well-positioned +1 nucleosome" in P. falciparum, as this contradicts existing literature. Similarly, avoid statements like "poorly understood chromatin architecture of Pf," which undervalue extensive prior work (e.g., discovery of histone lactylation in Plasmodium, Merrick et al., 2023).

We would like to clarify that we neither wrote that ““no studies have reported a well-positioned +1 nucleosome”” in P. falciparum nor did we intend to imply such thing. However, we acknowledge that our original wording may have been unclear. To address this, we have revised the manuscript to explicitly acknowledge prior studies on chromatin organization and highlight our contribution.

In the Abstract L26-L30: Contrary to the current view of irregular chromatin, we demonstrate for the first time regular phased nucleosome arrays downstream of TSSs, which, together with the established +1 nucleosome and upstream nucleosome-depleted region, reveal a complete canonical eukaryotic promoter architecture in Pf.

Introduction L156-L159: For example, we identify a phased nucleosome array downstream of the TSS. Together with a well-positioned +1 nucleosome and an upstream nucleosome-free region. These findings support a promoter architecture in Pf that resembles classical eukaryotic promoters (Bunnik et al. 2014, Kensche et al. 2016).

Results L180-L183: These new Pf nucleosome maps reveal a nucleosome organisation at transcription start sites (TSS) reminiscent of the general eukaryotic chromatin structure, featuring a reported well-positioned +1 nucleosome , an upstream nucleosome-free region (NFR, Bunnik et al. 2014, Kensche et al. 2016), and shown for the first time in Pf, a phased nucleosome array downstream of the TSS.

Discussion L412-L421: Previous analyses of Pf chromatin have identified +1 nucleosomes and NFRs (Bunnik et al 2014, Kensche et al. 2016). Here we extend this understanding by demonstrating phased nucleosome array structures throughout the genome. This finding provides evidence for a spatial regulation of nucleosome positioning in Pf, challenging the notion that nucleosome positioning is relatively random in gene bodies (Bunnik et al. 2014, Kensche et al. 2016). Consequently our results contribute to the understanding that Pf exhibits a typical eukaryotic chromatin structure, including well-defined nucleosome positioning at the TSS and regularly spaced nucleosome arrays (Schones et al. 2008; Yuan et al. 2005).

The phrase “poorly understood chromatin architecture” has been modified to “underexplored chromatin architecture” in order to more accurately reflect the potential for further analyses and contributions to the field, while avoiding any potential misinterpretation of an attempt to undervalue previous work.

Track labels in figures (e.g., Figure 5B) are too small to be legible.

We made the labels bigger.

Several figures (e.g., Figure 5B, S4B) lack statistical significance tests. Are the differences marked with stars statistically significant or just visually different?

We added statistics to S4B.

Differences in 5B were identified by visual inspection. To clarify this, we exchanged the asterisks to arrows in Fig.5B and changed the text in the legend:

Arrows mark descriptive visual differences in nucleosome occupancy.

Figure S3 includes a small black line on top of the table. Is this an accidental crop?

We checked the figure carefully; however, the black line does not appear in our PDF viewer or on the printed paper

The authors should state the weaknesses and limitations of this pipeline.

We added a limitation section in discussion, see comments above

Reviewer #1 (Significance (Required)):

The proposed pipeline is useful and timely. It can benefit research groups willing to analyse MNase-Seq data of complex genomes such as P. falciparum. The tool requires users to have extensive experience in coding as the authors didn't include any clear and explicit codes on how to start processing the data from raw files. Nevertheless, there are multiple tool that can detect nucleosome occupancy and that are not cited by the authors not mention. I have included for the authors a link where a large list of tools for analysis of nucleosome positioning experiments tools/pipelines were developed for (Software to analyse nucleosome positioning experiments - Gene Regulation - Teif Lab). I think it would be useful for the authors to direct the reference this.

We appreciate the reviewer’s valuable suggestion. We included a citation to the comprehensive database of nucleosome analysis tools curated by the Teif lab (Shtumpf et al., 2022). We chose to reference only selected tools in addition to this resource rather than listing all individual tools to maintain clarity and avoid overloading the manuscript with numerous citations.

Despite valid, I still believe that controlling their pipeline by filtering out false positives and including more QC steps at the Inspector stage is strongly needed. That would boost the significance of this pipeline.

We thank the reviewer for the assessment of our study and for recognizing that our MNase-seq analysis pipeline nucDetective can be a useful tool for the chromatin community utilizing MNase-Seq in complex settings.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

In this manuscript, Holzinger and colleagues have developed a new pipeline to assess chromatin organization in linear space and time. They used this pipeline to reevaluate nucleosome organization in the malaria parasite, P. falciparum. Their analysis revealed typical arrangement of nucleosomes around the transcriptional start site. Furthermore, it further strengthened and refined the connection between specific nucleosome dynamics and epigenetic marks, transcription factor binding sites or transcriptional activity.

Major comments

• I am wondering what is the main selling point of this manuscript is. If it is the development of the nucDetective pipeline, perhaps it would be best to first benchmark it and directly compare it to existing tools on a dataset where nucleosome fussiness, shifting and regularity has been analyzed before. If on the other hand, new insights into Plasmodium chromatin biology is the primary target validation of some of the novel findings would be advantageous (e.g. refinement of TSS positions, relevance of novel motifs, etc).

NucDetective presents a novel pipeline to identify dynamic nucleosome properties within different datasets, like time series or developmental stages, as analysed for the erythrocytic cycle in this manuscript. As such kind of a pipeline, allowing direct comparisons, does not exist for MNase-Seq data, we used the existing analysis and high quality dataset of Kensche et al., to visualize the strong improvements of this kind of analysis. Accordingly, we combined the pipeline development and the reasearch of chromatin structure analysis, being able to showcase the utility of this new pipeline.

• The authors identify a strong positioning of +1 nucleosome by searching for a positioned nucleosomes in the vicinity of the assigned TSS. Given the ill-defined nature of TSSs, this approach sounds logic at first glance. However, given the rather broad search space from -100 till +300bp, I am wondering whether it is a sort of "self-fulfilling prophecy". Conversely, it would be good to validate that this approach indeed helps to refine TSS positions.

We thank the reviewer for raising this important point. We would like to clarify that we do not claim to redefine or precisely determine TSS positions in our study. Instead, we use annotated TSS coordinates as a reference to identify nucleosomes that correspond to the +1 nucleosome, based on their proximity to the TSS.

We selected the search window from -100 to +300 bp to account for known variability in Pf TSS annotation. For example, dominant transcription start sites identified by 5'UTR-seq tag clusters can differ by several hundred base pairs within a single time point (Chappell et al., 2020). The broad window thus allows us to capture the principal nucleosome positions near a TSS, even when the TSS itself is imprecise or heterogeneous. Based on the TSS centered plots (Figure 2C and Figure S1B), we reasoned that a window of -100 to +300 is sufficient to capture the majority of the +1 nucleosomes, which would have been missed by using smaller window sizes. This strategy aligns with well-established conventions in yeast chromatin biology, where the +1 nucleosome is defined relative to the TSS (Jiang and Pugh, 2009; Zhang et al. 2011) and commonly used as an anchor point to visualize downstream phased nucleosome arrays and upstream nucleosome-depleted regions (Rossi et al., 2021; Oberbeckmann et al., 2019; Krietenstein et al., 2016 and many more). Accordingly, our approach leverages these accepted standards to interpret nucleosome positioning without re-defining TSS annotations.

• Figure 1C: I am wondering how should the reader interpret the changes in nucleosomal repeat length changes throughout the cycle. Is linker DNA on average 10 nucleotides shorter at T30 compared to T5 timepoint? If so how could such "dramatic reorganization" be achieved at the molecular level in absence of a known linker DNA-binding protein. More importantly is this observation supported by additional evidence (e.g. dinucleosomal fragment length) or could it be due to slightly different digestion of the chromatin at the different stages or other technical variables?

We thank the reviewer for this insightful question regarding the interpretation of NRL changes across the cell cycle. The reviewer is right in her or his interpretation – linker DNA is on average ~10 bp shorter at T30 than at T5.

To address concerns about additional evidence and potential MNase digestion variability, we now analyzed MNase-seq fragment sizes by shifting mononucleosome peaks of each time point to the canonical 147 bp length, to correct for MNase digestion differences. After this normalisation, dinucleosome fragment length distributions revealed the shortest linker lengths at T30 and T35, whereas T5 and T10 showed longer DNA linkers. These results confirm our previous NRL measurements based on mononucleosomal read distances while controlling for MNase digestion bias.

The molecular basis of this reorganization, is still unclear. While linker histone H1 is considered absent in Plasmodium falciparum, presence of an uncharacterized linker DNA–binding protein or alternative factors fulfilling a similar role can not be excluded (Gill et al. 2010). However, H1 absence across all developmental stages, fails to explain stage-specific chromatin changes. We hypothesize that Apicomplexans evolved specialized chromatin remodelers to compensate for the missing H1, which may also drive the dynamic NRL changes observed. The low NRL coincides with high transcriptional activity in Pf during trophozoite stage is consistent with previous reports linking elevated transcription to reduced NRL in other eukaryotes (Baldi et al. 2018). In addition, the schizont stage involves multiple rounds of DNA replication requiring large histone supplies being produced during that time. It may well be that a high level of histone synthesis and DNA amplification, results in a short time period with increased nucleosome density and shorter NRL, until the system reaches again equilibrium (Beshnova et al. 2014). Although speculative we suggest a model wherein increased transcription promotes elevated nucleosome turnover and re-assembly by specialized remodeling enzymes, combined with high abundance of histones, resulting in higher nucleosome density and decreased NRL. Unfortunately, absolute quantification of nucleosome levels from this MNase-seq dataset is not possible without spike-in controls, which makes it infeasible to test the hypothesis with the available data set (Chen et al. 2016).

Minor comments

• I am wondering whether fuzziness and occupancy changes are truly independent categories. I am asking as both could lead to reduction of the signal at the nucleosome dyad and because they show markedly similar distribution in relation to the TSS and associate with identical epigenetic features (Figure 2B-D). Figure 2A indicates minimal overlap between them, but this could be due to the fact that the criteria to define these subtypes is defined such to place nucleosomes to one or the other category, but at the end they represent two flavors of the same thing.

Indeed, changes in occupancy and fuzziness can appear related because both features may reduce signal intensity at the nucleosome dyad and both are connected to “poor nucleosome positioning”. However, their definitions and measurements are clearly distinct and technically independent. Occupancy reflects the peak height at the nucleosome dyad, while fuzziness quantifies the spread of reads around the peak, measured as the standard deviation of read positions within each nucleosome peak (Jiang and Pugh, 2009; Chen et al., 2013). Although a reduction in occupancy can contribute to increased fuzziness by diminishing the dyad axis signal, fuzziness primarily arises from increased variability in the flanking regions around the nucleosome position center. While this distinction is established in the field, it is also often confused by the concept of well (high occupancy, low fuzziness) and poorly (high fuzziness, low occupancy) positioned nucleosomes, where both of these features are considered.

• Do the authors detect spatial relationship between fuzzy and repositioned/evicted nucleosomes at the level of individual nucleosomes pairs. With other words, can fuzziness be the consequence of repositioning/eviction of the neighboring nucleosome?

In Figure 2A we analyse the spatial overlap of all features to each other. The analysis clearly shows that fuzziness, occupancy changes and position changes occur mostly at distinct spatial sites (overlaps between 3 and 10%, Fig. 2A). Therefore, we suggest that the features correspond to independent processes. Likewise, we do observe an overlap between occupancy and ATAC-seq peaks, but not nucleosome positioning shifts, clearly discriminating different processes.

• Figure 4: enrichment values and measure of statistical significance for the different motifs are missing. Also have there been any other motifs identified.

This information is present in Supplemental Figure S3. Here we show the top 3 hits in each cluster. In the figure legend of Figure 4 we reference to Fig. S3:

L1054 –1055:

“Additional enriched motifs along with the significance of motif enrichment and the fraction of motifs at the respective nucleosome positions are shown in Figure S3”

• The M&M would benefit from some more details, e.g. settings in the piepline, or which fragment sizes were used to map the MNase-seq data?

We included a link to the corresponding Zenodo repository (https://doi.org/10.5281/zenodo.16779899) in the Data and materials availability statement.

The repository contains:

Code (scripts.zip) and annotation of Plasmodium falciparum (Annotation.zip) to reproduce the nucDetective v1.1 (nucDetective-1.1.zip) analysis as done in the research manuscript entitled "Deciphering chromatin architecture and dynamics in Plasmodium falciparum using the nucDetective pipeline".

The folder "output_nucDetective" conains the complete output of the nucDetective analysis pipeline as generated by the "01_nucDetective_profiler.sh" and "02_nucDetective_inspector.sh" scripts.

Nucleosome coverage tracks, annotation of nucleosome positions and dynamic nucleosomes are deposited additonally in the folder "Pf_nucleosome_annotation_of_nucDetective".

To make this clearer we added following text to Material and Methods in ”The nucDetective pipeline” section:

Changes in the manuscript (L518-519):

The code, software and annotations used to run the nucDetective pipeline along with the output have been deposited on Zenodo (https://doi.org/10.5281/zenodo.16779899).

which fragment sizes were used to map the MNase-seq data?

The default setting in nucDetective is to use fragment sizes of 140 – 200 bp, which corresponds to the main mono-nucleosome fraction in standard MNase-seq experiments. However, the correct selection of fragment sizes may vary depending on the organism and the variations in MNase-seq protocols. Therefore, the pipeline offers the option of changing the cutoff parameter (--minLen; --maxLen), accordingly. Kensche et al thoroughly tested the best selection of the fragment sizes for the data set, which is used in this manuscript. We agree with their selection and used the same cutoffs (75-175 bp).

This is stated in line 535-536:

The fragments are further filtered to mono-nucleosome sized fragments (here we used 75 – 175 bp)

We changed the text:

The fragments are further filtered to mono-nucleosome sized fragments (default setting 140-200 bp; changed in this study to 75 – 175 bp)

We highlighted other parameters used in this study in the material and methods part.

Reviewer #2 (Significance (Required)):

Overall, the manuscript is well written and findings are clearly and elegantly presented. The manuscript describes a new pipeline to map and analyze MNase-seq data across different stages or conditions, though the broader applicability of the pipeline and advancements over existing tools could be better demonstrated. Importantly, the manuscript make use of this pipeline to provide a refined and likely more accurate view on (the dynamics of) nucleosome positioning over the AT-rich genome of P. falciparum. While these observations make sense they remain rather descriptive/associative and lack further experimental validation. Overall, this manuscript could be interest to both researchers working on chromatin biology and Plasmodium gene-regulation.

We thank the reviewer for the assessment of our study and for recognizing that the results of our MNase-seq analysis pipeline nucDetective contribute to a better understanding of Pf chromatin biology.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

The manuscript "Deciphering chromatin architecture and dynamics in Plasmodium 2 falciparum using the nucDetective pipeline" describes computational analysis of previously published data of P falciparum chromatin. This work corrects the prevailing view that this parasitic organism has an unusually disorganized chromatin organization, which had been attributed to its high genomic AT content, lack of histone H1, and ancient derivation. The authors show that instead P falciparum has a very typical chromatin organization. Part of the refinement is due to aligning data on +1 nucleosome positions instead of TSSs, which have been poorly mapped. The computational tools corral some useful features, for querying epigenomic structure that make visualization straightforward, especially for fuzzy nucleosomes.

Reviewer #3 (Significance (Required)):

As a computational package this is a nice presentation of fairly central questions. The assessment and display of fuzzy nucleosomes is a nice feature.

We thank the reviewer for the assessment of our study and are pleased that the reviewer acknowledges the value and usability of our pipeline.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The manuscript "Deciphering chromatin architecture and dynamics in Plasmodium 2 falciparum using the nucDetective pipeline" describes computational analysis of previously published data of P falciparum chromatin. This work corrects the prevailing view that this parasitic organism has an unusually disorganized chromatin organization, which had been attributed to its high genomic AT content, lack of histone H1, and ancient derivation. The authors show that instead P falciparum has a very typical chromatin organization. Part of the refinement is due to aligning data on +1 nucleosome positions instead of TSSs, which have been poorly mapped. The computational tools corral some useful features, for querying epigenomic structure that make visualization straightforward, especially for fuzzy nucleosomes.

Significance

As a computational package this is a nice presentation of fairly central questions. The assessment and display of fuzzy nucleosomes is a nice feature.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

In this manuscript, Holzinger and colleagues have developed a new pipeline to assess chromatin organization in linear space and time. They used this pipeline to reevaluate nucleosome organization in the malaria parasite, P. falciparum. Their analysis revealed typical arrangement of nucleosomes around the transcriptional start site. Furthermore, it further strengthened and refined the connection between specific nucleosome dynamics and epigenetic marks, transcription factor binding sites or transcriptional activity.

Major comments

• I am wondering what is the main selling point of this manuscript is. If it is the development of the nucDetective pipeline, perhaps it would be best to first benchmark it and directly compare it to existing tools on a dataset where nucleosome fussiness, shifting and regularity has been analyzed before. If on the other hand, new insights into Plasmodium chromatin biology is the primary target validation of some of the novel findings would be advantageous (e.g. refinement of TSS positions, relevance of novel motifs, etc).
• The authors identify a strong positioning of +1 nucleosome by searching for a positioned nucleosomes in the vicinity of the assigned TSS. Given the ill-defined nature of TSSs, this approach sounds logic at first glance. However, given the rather broad search space from -100 till +300bp, I am wondering whether it is a sort of "self-fulfilling prophecy". Conversely, it would be good to validate that this approach indeed helps to refine TSS positions.
• Figure 1C: I am wondering how should the reader interpret the changes in nucleosomal repeat length changes throughout the cycle. Is linker DNA on average 10 nucleotides shorter at T30 compared to T5 timepoint? If so how could such "dramatic reorganization" be achieved at the molecular level in absence of a known linker DNA-binding protein. More importantly is this observation supported by additional evidence (e.g. dinucleosomal fragment length) or could it be due to slightly different digestion of the chromatin at the different stages or other technical variables?

Minor comments

• I am wondering whether fuzziness and occupancy changes are truly independent categories. I am asking as both could lead to reduction of the signal at the nucleosome dyad and because they show markedly similar distribution in relation to the TSS and associate with identical epigenetic features (Figure 2B-D). Figure 2A indicates minimal overlap between them, but this could be due to the fact that the criteria to define these subtypes is defined such to place nucleosomes to one or the other category, but at the end they represent two flavors of the same thing.
• Do the authors detect spatial relationship between fuzzy and repositioned/evicted nucleosomes at the level of individual nucleosomes pairs. With other words, can fuzziness be the consequence of repositioning/eviction of the neighboring nucleosome?
• Figure 4: enrichment values and measure of statistical significance for the different motifs are missing. Also have there been any other motifs identified.
• The M&M would benefit from some more details, e.g. settings in the piepline, or which fragment sizes were used to map the MNase-seq data?

Significance

Overall, the manuscript is well written and findings are clearly and elegantly presented. The manuscript describes a new pipeline to map and analyze MNase-seq data across different stages or conditions, though the broader applicability of the pipeline and advancements over existing tools could be better demonstrated. Importantly, the manuscript make use of this pipeline to provide a refined and likely more accurate view on (the dynamics of) nucleosome positioning over the AT-rich genome of P. falciparum. While these observations make sense they remain rather descriptive/associative and lack further experimental validation. Overall, this manuscript could be interest to both researchers working on chromatin biology and Plasmodium gene-regulation.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary:

Holzinger et al. present a new automated pipeline, nucDetective, designed to provide accurate nucleosome positioning, fuzziness, and regularity from MNase-seq data. The pipeline is structured around two main workflows-Profiler and Inspector-and can also be applied to time-series datasets. To demonstrate its utility, the authors re-analyzed a Plasmodium falciparum MNase-seq time-series dataset (Kensche et al., 2016), aiming to show that nucDetective can reliably characterize nucleosomes in challenging AT-rich genomes. By integrating additional datasets (ATAC-seq, RNA-seq, ChIP-seq), they argue that the nucleosome positioning results from their pipeline have biological relevance.

Major Comments:

Despite being a useful pipeline, the authors draw conclusions directly from the pipeline's output without integrating necessary quality controls. Some claims either contradict existing literature or rely on misinterpretation or insufficient statistical support. In some instances, the pipeline output does not align with known aspects of Plasmodium biology. I outline below the key concerns and suggested improvements to strengthen the manuscript and validate the pipeline:

• Clarification of +1 Nucleosome Positioning in P. falciparum The authors should acknowledge that +1 nucleosomes have been previously reported in P. falciparum. For example, Kensche et al. (2016) used MNase-seq to map ~2,278 TSSs (based on enriched 5′-end RNA data) and found that the +1 nucleosome is positioned directly over the TSS in most genes: "Analysis of 2278 start sites uncovered positioning of a +1 nucleosome right over the TSS in almost all analysed regions" (Figure 3A). They also described a nucleosome-depleted region (NDR) upstream of the TSS, which varies in size, while the +1 nucleosome frequently overlaps the TSS. The authors should nuance their claims accordingly. Nevertheless, I do agree that the +1 positioning in P. falciparum may be fuzzier as compared to yeast or mammals. Moreover, the correlation between +1 nucleosome occupancy and gene expression is often weak and that several genes show similar nucleosome profiles regardless of expression level. This raises my question: did the authors observe any of these patterns in their new data?
• Lack of Quality Control in the Pipeline The authors claim (lines 152-153) that QC is performed at every stage, but this is not supported by the implementation. On the GitHub page (GitHub - uschwartz/nucDetective), QC steps are only marked at the Profiler stage using standard tools (FastQC, MultiQC). The Inspector stage, which is crucial for validating nucleosome detection, lacks QC entirely. The authors should implement additional steps to assess the quality of nucleosome calls. For example, how are false positives managed? ROC curves should be used to evaluate true positive vs. false positive rates when defining dynamic nucleosomes. How sequencing biases are addressed?
• Use of Mono-nucleosomes Only The authors re-analyze the Kensche et al. (2016) dataset using only mono-nucleosomes and claim improved nucleosome profiles, including identification of tandem arrays previously unreported in P. falciparum. Two key issues arise:
• Is the apparent improvement due simply to focusing on mono-nucleosomes (as implied in lines 342-346)?
• How does the pipeline perform with di- or tri-nucleosomes, which are also biologically relevant (Kensche et al., 2016 and others)? Furthermore, the limitation to mono-nucleosomes is only mentioned in the methods, not in the results or discussion, which could mislead readers.
• Reference Nucleosome Numbers The authors identify 49,999 reference nucleosome positions. How does this compare to previous analyses of similar datasets? This should be explicitly addressed.
• Figure 1B and Nucleosome Spacing The authors claim that Figure 1B shows developmental stage-specific variation in nucleosome spacing. However, only T35 shows a visible upstream change at position 0. In A4, A6, and A8 (Figure S4), no major change is apparent. Statistical tests are needed to validate whether the observed differences are significant and should be described in the figure legends and main text.
• Genome-wide Occupancy Claims The claim that nucleosomes are "evenly distributed throughout the genome" (Figure S2A) is questionable. Chromosomes 3 and 11 show strong peaks mid-chromosome, and chromosome 14 shows little to no signal at the ends. This should be discussed. Subtelomeric regions, such as those containing var genes, are known to have unique chromatin features. For instance, Lopez-Rubio et al. (2009) show that subtelomeric regions are enriched for H3K9me3 and HP1, correlating with gene silencing. Should these regions not display different nucleosome distributions? Do you expect the Plasmodium genome (or any genome) to have uniform nucleosome distribution?
• Dependence on DANPOS The authors criticize the DANPOS pipeline for its limitations but use it extensively within nucDetective. This contradiction confuses the reader. Is nucDetective an original pipeline, or a wrapper built on existing tools?
• Control Data Usage The authors should clarify whether gDNA controls were used throughout the analysis, as done in Kensche et al. (2016). Currently, this is mentioned only in the figure legend for Figure 5, not in the methods or results.
• Lack of Statistical Power for Time-Series Analyses Although the pipeline is presented as suitable for time-series data, it lacks statistical tools to determine whether differences in nucleosome positioning or fuzziness are significant across conditions. Visual interpretation alone is insufficient. Statistical support is essential for any differential analysis.
• Reproducibility of Methods The Methods section is not sufficient to reproduce the results. The GitHub repository lacks the necessary code to generate the paper's figures and focuses on an exemplary yeast dataset. The authors should either:
  • Update the repository with relevant scripts and examples,
  • Clearly state the repository's purpose, or
  • Remove the link entirely. Readers must understand that nucDetective is dedicated to assessing nucleosome fuzziness, occupancy, shift, and regularity dynamics-not downstream analyses presented in the paper.
• Supplementary Tables Including supplementary tables showing pipeline outputs (e.g., nucleosome scores, heatmaps, TSS extraction) would help readers understand the input-output structure and support figure interpretations.

Minor Comments:

• The authors should moderate claims such as "no studies have reported a well-positioned +1 nucleosome" in P. falciparum, as this contradicts existing literature. Similarly, avoid statements like "poorly understood chromatin architecture of Pf," which undervalue extensive prior work (e.g., discovery of histone lactylation in Plasmodium, Merrick et al., 2023).
• Track labels in figures (e.g., Figure 5B) are too small to be legible.
• Several figures (e.g., Figure 5B, S4B) lack statistical significance tests. Are the differences marked with stars statistically significant or just visually different?
• Figure S3 includes a small black line on top of the table. Is this an accidental crop?
• The authors should state the weaknesses and limitations of this pipeline.

Significance

• The proposed pipeline is useful and timely. It can benefit research groups willing to analyse MNase-Seq data of complex genomes such as P. falciparum. The tool requires users to have extensive experience in coding as the authors didn't include any clear and explicit codes on how to start processing the data from raw files. Nevertheless, there are multiple tool that can detect nucleosome occupancy and that are not cited by the authors not mention. I have included for the authors a link where a large list of tools for analysis of nucleosome positioning experiments tools/pipelines were developed for (Software to analyse nucleosome positioning experiments - Gene Regulation - Teif Lab). I think it would be useful for the authors to direct the reference this.
• Despite valid, I still believe that controlling their pipeline by filtering out false positives and including more QC steps at the Inspector stage is strongly needed. That would boost the significance of this pipeline.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

The authors do not wish to provide a response at this time.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The study has carefully controlled and rigorous data. For the most part, the results are consistent with their claims. Except for a few modifications, it should be published. My suggestions are:

1. Fig 2A. I cannot see the red line in the plot that is mentioned in the legend. Please add it.
2. Fig 2A. The Manhattan plot shows a number of loci in the genome that have peaks of significant SNPs, not just the locus encompassing Malt-A. It might be worth highlighting the loci or peaks better in the plot. It is pretty minimalist as is.
3. Linkage disequilibrium is a problem in Drosophila. Many SNPs are hitchikers riding along with a single causative SNP due to infrequent recombination between hitchiker and causative SNPs. How many SNPs are significant and please list the SNPs or intervals considered significant in the GWAS. The text is vague and brief. The plot in Fig 2A is problematic by being overly minimal.
4. Regarding the GWAS loci they found. It would be worth comparing these regions of the genome with significant GWAS scores to those regions identified in an earlier study. In 2013, Cassidy et al performed artificial selection on Drosophila populations using the same trait (scutellar bristle number) as this study. They did whole genome sequencing of the population before and after selection, and found loci in the genome that exhibited signs of selection through having altered allele frequencies at some loci. Are some of the loci identified in that study the same as in this GWAS study? Are some of the genes implicated in that study the same? The old data is publicly available and so could be easily mined.
5. Tables 1 is cut apart in its format. Please format properly.
6. Across the work, there is a lack of statistical testing of significance in bristle number between treated groups. These phenotypes need testing. The number of animals assayed in each experiment are listed but no tests for statistical significance are presented. A chi square or better yet, a fishers exact test would be appropriate. Some of the sample numbers seem low for the claims made, i.e. 8 animals scored for UAS-MalA1 control group.. This testing should be done for all data in Table 1, Fig 2C, Supp Fig 2 A, Fig 4E and any others I might have missed.
7. Fig 3A, are the individual datapoints single replicates of metabolomic samples? The description of what PCA was done is minimal and needs more description. I assume they performed PCA using metabolites as variables. They did not say. Nor did they explain how PCA was performed except for the software. They "normalized" the data to the median. Did they center the matrix of variable values to the median before doing PCA - is that what they mean? Why not center to the mean values? Typically one calculates the mean value for a given variable, ie a single metabolite, across all samples, and then calculates the difference between the measured value from one sample and the mean value for that variable. That needs to be done. It is not standard to center to the median. They should also normalize the data to eliminate biasing in the PCA results because of variance due to very abundant metabolites, The variables with large values (ie abundant metabolites) overly contribute to the explanatory variance in a PCA analysis unless one normalizes. This normalization is typically done by taking the difference between measured and mean values (as described above), and dividing that difference by the standard deviation of the variable's measurements. Think of it as a Z-score. The matrix data then is centered around zero for each variable, and each variable's values range from -5 to +5. Then perform PCA. Otherwise highly abundant metabolites bias the analysis. Again, this type of normalization is standard for PCA.
8. How many metabolites were measured? What were they, ie the list. Provide please
9. Results described in Fig 5A are the weakest in the manuscript and really could be supplemental. It is weakly circumstantal evidence for the claim being made. Temperature affects so many things, it could be coincidence that dilp levels change and this change correlates with bristle number. Many things change with temperature. Definitely they should not end the results section with such weak data,
10. Carthew and colleagues showed that IPC ablation suppressed the scutellar bristle phenotypes of miR9a and scute mutants. Does Mal-A1 knockdown have similar effects on these mutants? One would predict yes.
11. The authors mention the 2019 paper by Cassidy et al and some of the results therein regarding inhibiting carbohydrate metabolism and phenotype suppression (robustness). But not only miR-9a and scutellar bristles were tested in that paper but a wide variety of mutations in TFs, signaling proteins and other miRNAs. All their results were consistent with the findings of the current ms. The authors could discuss this more in depth. Also, Cassidy et al put forth a quantitative model that explained how limiting glucose metabolsm could provide robustness for a wide variety of developmental decisions. It might be worth discussing this model in light of their results.

Significance

This manuscript describes an interesting study of developmental robustness and its intersection with organismal metabolism. It builds upon prior papers that have addressed the link between metabolism and development. It describes an ingenious approach to the problem and uncovers maltose metabolism in Drosophila as one such connection to sensory organ development and patterning. The important take home message for me is that they found natural genetic variants from the wild that confer greater robustness to the fly's morphological development, and these genetic variants are found in an enzyme that broadly metabolizes maltose, a simple sugar. Whereas previous studies used genetic manipulation to impact metabolism, this study shows that genetic variants in the wild exhibit effects on robustness. It suggests there might be a tradeoff between more vigorous carbohydrate metabolism and fidelity in morphological development.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

In this study, the authors performed GWAS to identify associations between the mean bristle number in Drosophila melanogaster adults and different SNPs present in 95 lines of the DGRP panel rear at 18C. They selected genes harboring those SNPs linked to bristle number that also had a moderate or high expression at the third insta larva stage to perform an RNAi screen. This RNAi screen, which included 43 genes, identified Maltase-A1 (Mal-A1) as a contributor to bristle number. Therefore, the authors then focus on investigating possible metabolic and transcriptional changes underlying the effect of Mal-A1 knockdown on bristle number. After whole-body knockdown using the da-gal4 driver, the authors identified decreased glucose in whole body and hemolymph, and decreased dilp3 mRNA expression in whole body, intestine, and insulin producing cells (IPC) in the larva brain. Similar to a whole-body Mal-A1 knockdown, a gut epithelial cell-specific gal4 driver (NP1) also decreased dilp3 mRNA expression in the whole body and larva brain. The authors suggest that Mal-A1 activity in the intestine may affect bristle number through lowering available glucose in the intestine, which decreases circulating glucose levels in the hemolymph, and in turn decreases dilp3 mRNA expression in the larva brain, leading to decreased bristle number. Finally, to validate the influence of bristle number via dilp3-mediated insulin signaling in the brain, the authors reared larvae at 18C, which they showed increased bristle number. Supporting their proposed model, rearing larvae at 18C increased dilp3 mRNA expression in the brain, which correlated with increased bristle number.

Major comments:

1. The main finding of this paper is the identification of Mal-A1 gene as a regulator of bristle number in Drosophila adults. However, the authors do not to show clear phenotypes which could stem from a lack of experimental rigor. As an example in Fig. 2C (source data not provided) the UAS-Mal-A1-RNAi line V15789 in the absence of GAL4 shows 5% abnormal bristle number compared with 2% upon knockdown. If I'm understanding the data provided, this means that abnormal bristle number was observed in 2 flies (out of 40) in the UAS-line alone compared with ~2 flies (out of 111) in the presence of GAL4. For line V106220, 2% (n=56) showed abnormal bristles compared with 0% (n=37) upon in the presence of GAL4. In absolute numbers this would mean that abnormal bristle number was observed in ~1 fly (out of 56) in the UAS-line alone compared with 0 flies (out of 37) upon knockdown. All of these experiments do not use sufficient n, which according to the reviewers calculations (to show a 3% increase, with 80% confidence the n should be around 750-800). In addition no information on statistical tests or whether biological replicates were performed is included. Due to the main finding heavily relying on this phenotype of abnormal bristle number, this reviewer is not confident that the conclusions of the manuscript are supported. This problem also applies to other experiments presented in the manuscript, which suffer from low n, significantly decreasing the enthusiasm for the presented results.
2. The authors do not to show that Drosophila insulin- like peptide 3 (dilp3) level affects the SOPs in a nonautonomous manner. The only experiments included are showing indirect effects.
3. There are important statistical details missing in some of the figures (see comments below)
4. Important details are missing from the methods for results or analysis to be reproduced. For example, the method section for GWAS analysis is lacking details, a script should be provided as supplemental information, as well as a table similar to the one provided for the RNAi screen.

Minor comments

• There are some typos like referring to 'using w118 male mice' in the 'Phenotypic Analysis of Maltase Knockdown; (1) Bristle number count'
• Details in methods. For GWAS experiments, could the authors define what their cutoffs were for selecting genes harboring SNPs linked to bristle number? How many base pairs from a gene? or enhancer? They selected only those gene with moderate or high expression, but what does it mean?
• In Fig. 2A, could the authors provide all significant SNPs identified by their GWAS analysis as supplemental material?
• In Fig. 2A, it is stated in the legend " and the red line represents the significance threshold calculated using Bonferroni correction...". This might be a problem with the pdf document but I did not find the red line in the Manhattan plot that the authors refer to.
• In Fig. 4E, could the authors provide the n number as in other figures?
• Check citations. Some references have missing parts. For example; Ref 5 is missing the last 2 words of the title. In Manuscript it reads: "Trehalose metabolism confers developmental robustness and stability in Drosophila by regulating.". It should be "Trehalose metabolism confers developmental robustness and stability in Drosophila by regulating glucose homeostasis."

Significance

While the significance of identifying a novel regulatory mechanism for developmental robustness in Drosophila melanogaster is high and would be interesting for a broad audience, the authors do not present convincing experimental evidence to support their hypothesis. This is due to the insufficient number of replicates as well as the lack of experiments showing a direct role of insulin signaling.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

In this article, the authors identified a gut-expressed enzyme, maltase-A1, which regulates the developmental robustness of SSO. Through a GWAS analysis of bristle phenotypes using the DGRP lines, maltase-A1 was revealed as a significant regulator of bristle number. Knockdown of maltase-A1 suppressed the increase in bristle count. Metabolite profiling of key carbohydrates showed a reduction in several sugar levels, potentially leading to decreased ilp3 release from the CNS. Furthermore, the authors demonstrated that cold temperature induces higher expression of both ilp2 and ilp3, which may contribute to the observed increase in bristle number.

The findings of this study offer valuable insights into how nutrient metabolism may influence developmental robustness. However, a key limitation lies in the correlative nature of the observations. Further experimental validation is needed to establish a direct causal relationship. 1. To further support the hypothesis that Maltase-A1 mutation reduces bristle variance by lowering hemolymph glucose levels and consequently decreasing insulin secretion, it would be essential to test whether providing a higher concentration of dietary glucose to Maltase-A1 mutant larvae can rescue the mutant phenotype. 2. To further substantiate the claim that ilp3 acts as a downstream effector in the Maltase-A1 regulatory pathway, it would be important to perform ilp3 knockdown and overexpression experiments in both wild-type and Maltase-A1 mutant backgrounds. This approach could help determine whether altered ilp3 expression levels directly contribute to the bristle phenotype associated with Maltase-A1 dysfunction.

Significance

How nutrients regulate developmental processes is an intriguing question in developmental biology. This study employs GWAS to identify an unexpected regulator of bristle development, offering new insights into how nutrient metabolism may influence developmental robustness. I believe this article will be of great interest to audiences in developmental biology.

Transparent Peer Review

Download the complete Review Process [PDF] including:

• reviews
• authors' reply
• editorial decisions

</br>

Transparent Peer Review

Download the complete Review Process [PDF] including:

• reviews
• authors' reply
• editorial decisions

</br>

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

These authors have developed a method to induce MI or MII arrest. While this was previously possible in MI, the advantage of the method presented here is it works for MII, and chemically inducible because it is based on a system that is sensitive to the addition of ABA. Depending on when the ABA is added, they achieve a MI or MII delay. The ABA promotes dimerizing fragments of Mps1 and Spc105 that can't bind their chromosomal sites. The evidence that the MI arrest is weaker than the MII arrest is convincing and consistent with published data and indicating the SAC in MI is less robust than MII or mitosis. The authors use this system to find evidence that the weak MI arrest is associated with PP1 binding to Spc105. This is a nice use of the system.

The remainder of the paper uses the SynSAC system to isolate populations enriched for MI or MII stages and conduct proteomics. This shows a powerful use of the system but more work is needed to validate these results, particularly in normal cells.

Overall the most significant aspect of this paper is the technical achievement, which is validated by the other experiments. They have developed a system and generated some proteomics data that maybe useful to others when analyzing kinetochore composition at each division. Overall, I have only a few minor suggestions.

We appreciate the reviewers’ support of our study.

1) In wild-type - Pds1 levels are high during M1 and A1, but low in MII. Can the authors comment on this? In line 217, what is meant by "slightly attenuated? Can the authors comment on how anaphase occurs in presence of high Pds1? There is even a low but significant level in MII.

The higher levels of Pds1 in meiosis I compared to meiosis II has been observed previously using immunofluorescence and live imaging1–3. Although the reasons are not completely clear, we speculate that there is insufficient time between the two divisions to re-accumulate Pds1 prior to separase re-activation.

We agree “slightly attenuated” was confusing and we have re-worded this sentence to read “Addition ABA at the time of prophase release resulted in Pds1securin stabilisation throughout the time course, consistent with delays in both metaphase I and II”.

We do not believe that either anaphase I or II occur in the presence of high Pds1. Western blotting represents the amount of Pds1 in the population of cells at a given time point. The time between meiosis I and II is very short even when treated with ABA. For example, in Figure 2B, spindle morphology counts show that the anaphase I peak is around 40% at its maxima (105 min) and around 40% of cells are in either metaphase I or metaphase II, and will be Pds1 positive. In contrast, due to the better efficiency of meiosis II, anaphase II hardly occurs at all in these conditions, since anaphase II spindles (and the second nuclear division) are observed at very low frequency (maximum 10%) from 165 minutes onwards. Instead, metaphase II spindles partially or fully breakdown, without undergoing anaphase extension. Taking Pds1 levels from the western blot and the spindle data together leads to the conclusion that at the end of the time-course, these cells are biochemically in metaphase II, but unable to maintain a robust spindle. Spindle collapse is also observed in other situations where meiotic exit fails, and potentially reflects an uncoupling of the cell cycle from the programme governing gamete differentiation3–5. We will explain this point in a revised version while referring to representative images that from evidence for this, as also requested by the reviewer below.

2) The figures with data characterizing the system are mostly graphs showing time course of MI and MII. There is no cytology, which is a little surprising since the stage is determined by spindle morphology. It would help to see sample sizes (ie. In the Figure legends) and also representative images. It would also be nice to see images comparing the same stage in the SynSAC cells versus normal cells. Are there any differences in the morphology of the spindles or chromosomes when in the SynSAC system?

This is an excellent suggestion and will also help clarify the point above. We will provide images of cells at the different stages. For each timepoint, 100 cells were scored. We have already included this information in the figure legends

3) A possible criticism of this system could be that the SAC signal promoting arrest is not coming from the kinetochore. Are there any possible consequences of this? In vertebrate cells, the RZZ complex streams off the kinetochore. Yeast don't have RZZ but this is an example of something that is SAC dependent and happens at the kinetochore. Can the authors discuss possible limitations such as this? Does the inhibition of the APC effect the native kinetochores? This could be good or bad. A bad possibility is that the cell is behaving as if it is in MII, but the kinetochores have made their microtubule attachments and behave as if in anaphase.

In our view, the fact that SynSAC does not come from kinetochores is a major advantage as this allows the study of the kinetochore in an unperturbed state. It is also important to note that the canonical checkpoint components are all still present in the SynSAC strains, and perturbations in kinetochore-microtubule interactions would be expected to mount a kinetochore-driven checkpoint response as normal. Indeed, it would be interesting in future work to understand how disrupting kinetochore-microtubule attachments alters kinetochore composition (presumably checkpoint proteins will be recruited) and phosphorylation but this is beyond the scope of this work. In terms of the state at which we are arresting cells – this is a true metaphase because cohesion has not been lost but kinetochore-microtubule attachments have been established. This is evident from the enrichment of microtubule regulators but not checkpoint proteins in the kinetochore purifications from metaphase I and II. While this state is expected to occur only transiently in yeast, since the establishment of proper kinetochore-microtubule attachments triggers anaphase onset, the ability to capture this properly bioriented state will be extremely informative for future studies. We appreciate the reviewers’ insight in highlighting these interesting discussion points which we will include in a revised version.

Reviewer #1 (Significance (Required)):

These authors have developed a method to induce MI or MII arrest. While this was previously possible in MI, the advantage of the method presented here is it works for MII, and chemically inducible because it is based on a system that is sensitive to the addition of ABA. Depending on when the ABA is added, they achieve a MI or MII delay. The ABA promotes dimerizing fragments of Mps1 and Spc105 that can't bind their chromosomal sites. The evidence that the MI arrest is weaker than the MII arrest is convincing and consistent with published data and indicating the SAC in MI is less robust than MII or mitosis. The authors use this system to find evidence that the weak MI arrest is associated with PP1 binding to Spc105. This is a nice use of the system.

The remainder of the paper uses the SynSAC system to isolate populations enriched for MI or MII stages and conduct proteomics. This shows a powerful use of the system but more work is needed to validate these results, particularly in normal cells.

Overall the most significant aspect of this paper is the technical achievement, which is validated by the other experiments. They have developed a system and generated some proteomics data that maybe useful to others when analyzing kinetochore composition at each division.

We appreciate the reviewer’s enthusiasm for our work.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

The manuscript submitted by Koch et al. describes a novel approach to collect budding yeast cells in metaphase I or metaphase II by synthetically activating the spinde checkpoint (SAC). The arrest is transient and reversible. This synchronization strategy will be extremely useful for studying meiosis I and meiosis II, and compare the two divisions. The authors characterized this so-named syncSACapproach and could confirm previous observations that the SAC arrest is less efficient in meiosis I than in meiosis II. They found that downregulation of the SAC response through PP1 phosphatase is stronger in meiosis I than in meiosis II. The authors then went on to purify kinetochore-associated proteins from metaphase I and II extracts for proteome and phosphoproteome analysis. Their data will be of significant interest to the cell cycle community (they compared their datasets also to kinetochores purified from cells arrested in prophase I and -with SynSAC in mitosis).

I have only a couple of minor comments:

1) I would add the Suppl Figure 1A to main Figure 1A. What is really exciting here is the arrest in metaphase II, so I don't understand why the authors characterize metaphase I in the main figure, but not metaphase II. But this is only a suggestion.

This is a good suggestion, we will do this in our full revision.

2) Line 197, the authors state: ...SyncSACinduced a more pronounced delay in metaphase II than in metaphase I. However, line 229 and 240 the auhtors talk about a "longer delay in metaphase Thank you for pointing this out, this is indeed a typo and we have corrected it.

3) The authors describe striking differences for both protein abundance and phosphorylation for key kinetochore associated proteins. I found one very interesting protein that seems to be very abundant and phosphorylated in metaphase I but not metaphase II, namely Sgo1. Do the authors think that Sgo1 is not required in metaphase II anymore? (Top hit in suppl Fig 8D).

This is indeed an interesting observation, which we plan to investigate as part of another study in the future. Indeed, data from mouse indicates that shugoshin-dependent cohesin deprotection is already absent in meiosis II in mouse oocytes6, though whether this is also true in yeast is not known. Furthermore, this does not rule out other functions of Sgo1 in meiosis II (for example promoting biorientation). We will include this point in the discussion.

Reviewer #2 (Significance (Required)):

The technique described here will be of great interest to the cell cycle community. Furthermore, the authors provide data sets on purified kinetochores of different meiotic stages and compare them to mitosis. This paper will thus be highly cited, for the technique, and also for the application of the technique.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

In their manuscript, Koch et al. describe a novel strategy to synchronize cells of the budding yeast Saccharomyces cerevisiae in metaphase I and metaphase II, thereby facilitating comparative analyses between these meiotic stages. This approach, termed SynSAC, adapts a method previously developed in fission yeast and human cells that enables the ectopic induction of a synthetic spindle assembly checkpoint (SAC) arrest by conditionally forcing the heterodimerization of two SAC components upon addition of the plant hormone abscisic acid (ABA). This is a valuable tool, which has the advantage that induces SAC-dependent inhibition of the anaphase promoting complex without perturbing kinetochores. Furthermore, since the same strategy and yeast strain can be also used to induce a metaphase arrest during mitosis, the methodology developed by Koch et al. enables comparative analyses between mitotic and meiotic cell divisions. To validate their strategy, the authors purified kinetochores from meiotic metaphase I and metaphase II, as well as from mitotic metaphase, and compared their protein composition and phosphorylation profiles. The results are presented clearly and in an organized manner.

We are grateful to the reviewer for their support.

Despite the relevance of both the methodology and the comparative analyses, several main issues should be addressed: 1.- In contrast to the strong metaphase arrest induced by ABA addition in mitosis (Supp. Fig. 2), the SynSAC strategy only promotes a delay in metaphase I and metaphase II as cells progress through meiosis. This delay extends the duration of both meiotic stages, but does not markedly increase the percentage of metaphase I or II cells in the population at a given timepoint of the meiotic time course (Fig. 1C). Therefore, although SynSAC broadens the time window for sample collection, it does not substantially improve differential analyses between stages compared with a standard NDT80 prophase block synchronization experiment. Could a higher ABA concentration or repeated hormone addition improve the tightness of the meiotic metaphase arrest?

For many purposes the enrichment and extended time for sample collection is sufficient, as we demonstrate here. However, as pointed out by the reviewer below, the system can be improved by use of the 4A-RASA mutations to provide a stronger arrest (see our response below). We did not experiment with higher ABA concentrations or repeated addition since the very robust arrest achieved with the 4A-RASA mutant deemed this unnecessary.

2.- Unlike the standard SynSAC strategy, introducing mutations that prevent PP1 binding to the SynSAC construct considerably extended the duration of the meiotic metaphase arrests. In particular, mutating PP1 binding sites in both the RVxF (RASA) and the SILK (4A) motifs of the Spc105(1-455)-PYL construct caused a strong metaphase I arrest that persisted until the end of the meiotic time course (Fig. 3A). This stronger and more prolonged 4A-RASA SynSAC arrest would directly address the issue raised above. It is unclear why the authors did not emphasize more this improved system. Indeed, the 4A-RASA SynSAC approach could be presented as the optimal strategy to induce a conditional metaphase arrest in budding yeast meiosis, since it not only adapts but also improves the original methods designed for fission yeast and human cells. Along the same lines, it is surprising that the authors did not exploit the stronger arrest achieved with the 4A-RASA mutant to compare kinetochore composition at meiotic metaphase I and II.

We agree that the 4A-RASA mutant is the best tool to use for the arrest and going forward this will be our approach. We collected the proteomics data and the data on the SynSAC mutant variants concurrently, so we did not know about the improved arrest at the time the proteomics experiment was done. Because very good arrest was already achieved with the unmutated SynSAC construct, we could not justify repeating the proteomics experiment which is a large amount of work using significant resources. However, we will highlight the potential of the 4A-RASA mutant more prominently in our full revision.

3.- The results shown in Supp. Fig. 4C are intriguing and merit further discussion. Mitotic growth in ABA suggest that the RASA mutation silences the SynSAC effect, yet this was not observed for the 4A or the double 4A-RASA mutants. Notably, in contrast to mitosis, the SynSAC 4A-RASA mutation leads to a more pronounced metaphase I meiotic delay (Fig. 3A). It is also noteworthy that the RVAF mutation partially restores mitotic growth in ABA. This observation supports, as previously demonstrated in human cells, that Aurora B-mediated phosphorylation of S77 within the RVSF motif is important to prevent PP1 binding to Spc105 in budding yeast as well.

We agree these are intriguing findings that highlight key differences as to the wiring of the spindle checkpoint in meiosis and mitosis and potential for future studies, however, currently we can only speculate as to the underlying cause. The effect of the RASA mutation in mitosis is unexpected and unexplained. However, the fact that the 4A-RASA mutation causes a stronger delay in meiosis I compared to mitosis can be explained by a greater prominence of PP1 phosphatase in meiosis. Indeed, our data (Figure 4A) show that the PP1 phosphatase Glc7 and its regulatory subunit Fin1 are highly enriched on kinetochores at all meiotic stages compared to mitosis.

We agree that the improved growth of the RVAF mutant is intriguing and points to a role of Aurora B-mediated phosphorylation, though previous work has not supported such a role 7.

We will include a discussion of these important points in a revised version.

4.- To demonstrate the applicability of the SynSAC approach, the authors immunoprecipitated the kinetochore protein Dsn1 from cells arrested at different meiotic or mitotic stages, and compared kinetochore composition using data independent acquisition (DIA) mass spectrometry. Quantification and comparative analyses of total and kinetochore protein levels were conducted in parallel for cells expressing either FLAG-tagged or untagged Dsn1 (Supp. Fig. 7A-B). To better detect potential changes, protein abundances were next scaled to Dsn1 levels in each sample (Supp. Fig. 7C-D). However, it is not clear why the authors did not normalize protein abundance in the immunoprecipitations from tagged samples at each stage to the corresponding untagged control, instead of performing a separate analysis. This would be particularly relevant given the high sensitivity of DIA mass spectrometry, which enabled quantification of thousands of proteins. Furthermore, the authors compared protein abundances in tagged-samples from mitotic metaphase and meiotic prophase, metaphase I and metaphase II (Supp. Fig. 7E-F). If protein amounts in each case were not normalized to the untagged controls, as inferred from the text (lines 333 to 338), the observed differences could simply reflect global changes in protein expression at different stages rather than specific differences in protein association to kinetochores.

While we agree with the reviewer that at first glance, normalising to no tag makes the most sense, in practice there is very low background signal in the no tag sample which means that any random fluctuations have a big impact on the final fold change. This approach therefore introduces artefacts into the data rather than improving normalisation.

To provide reassurance that our kinetochore immunoprecipitations are specific, and that the background (no tag) signal is indeed very low, we will provide a new supplemental figure showing the volcanos comparing kinetochore purifications at each stage with their corresponding no tag control. These volcano plots show very clearly that the major enriched proteins are kinetochore proteins and associated factors, in all cases.

It is also important to note that our experiment looks at relative changes of the same protein over time, which we expect to be relatively small in the whole cell lysate. We previously documented proteins that change in abundance in whole cell lysates throughout meiosis8. In this study, we found that relatively few proteins significantly change in abundance, supporting this view.

Our aim in the current study was to understand how the relative composition of the kinetochore changes and for this, we believe that a direct comparison to Dsn1, a central kinetochore protein which we immunoprecipitated is the most appropriate normalisation.

5.- Despite the large amount of potentially valuable data generated, the manuscript focuses mainly on results that reinforce previously established observations (e.g., premature SAC silencing in meiosis I by PP1, changes in kinetochore composition, etc.). The discussion would benefit from a deeper analysis of novel findings that underscore the broader significance of this study.

We strongly agree with this point and we will re-frame the discussion to focus on the novel findings, as also raised by the other reviewers.

Finally, minor concerns are: 1.- Meiotic progression in SynSAC strains lacking Mad1, Mad2 or Mad3 is severely affected (Fig. 1D and Supp. Fig. 1), making it difficult to assess whether, as the authors state, the metaphase delays depend on the canonical SAC cascade. In addition, as a general note, graphs displaying meiotic time courses could be improved for clarity (e.g., thinner data lines, addition of axis gridlines and external tick marks, etc.).

We will generate the data to include a checkpoint mutant +/- ABA for direct comparison. We will take steps to improve the clarity of presentation of the meiotic timecourse graphs, though our experience is that uncluttered graphs make it easier to compare trends.

2.- Spore viability following SynSAC induction in meiosis was used as an indicator that this experimental approach does not disrupt kinetochore function and chromosome segregation. However, this is an indirect measure. Direct monitoring of genome distribution using GFP-tagged chromosomes would have provided more robust evidence. Notably, the SynSAC mad3Δ mutant shows a slight viability defect, which might reflect chromosome segregation defects that are more pronounced in the absence of a functional SAC.

Spore viability is a much more sensitive way of analysing segregation defects that GFP-labelled chromosomes. This is because GFP labelling allows only a single chromosome to be followed. On the other hand, if any of the 16 chromosomes mis-segregate in a given meiosis this would result in one or more aneuploid spores in the tetrad, which are typically inviable. The fact that spore viability is not significantly different from wild type in this analysis indicates that there are no major chromosome segregation defects in these strains, and we therefore do not plan to do this experiment.

3.- It is surprising that, although SAC activity is proposed to be weaker in metaphase I, the levels of CPC/SAC proteins seem to be higher at this stage of meiosis than in metaphase II or mitotic metaphase (Fig. 4A-B).

We agree, this is surprising and we will point this out in the revised discussion. We speculate that the challenge in biorienting homologs which are held together by chiasmata, rather than back-to-back kinetochores results in a greater requirement for error correction in meiosis I. Interestingly, the data with the RASA mutant also point to increased PP1 activity in meiosis I, and we additionally observed increased levels of PP1 (Glc7 and Fin1) on meiotic kinetochores, consistent with the idea that cycles of error correction and silencing are elevated in meiosis I.

4.- Although a more detailed exploration of kinetochore composition or phosphorylation changes is beyond the scope of the manuscript, some key observations could have been validated experimentally (e.g., enrichment of proteins at kinetochores, phosphorylation events that were identified as specific or enriched at a certain meiotic stage, etc.).

We agree that this is beyond the scope of the current study but will form the start of future projects from our group, and hopefully others.

5.- Several typographical errors should be corrected (e.g., "Knetochores" in Fig. 4 legend, "250uM ABA" in Supp. Fig. 1 legend, etc.)

Thank you for pointing these out, they have been corrected.

Reviewer #3 (Significance (Required)):

Koch et al. describe a novel methodology, SynSAC, to synchronize budding yeast cells in metaphase I or metaphase II during meiosis, as well and in mitotic metaphase, thereby enabling differential analyses among these cell division stages. Their approach builds on prior strategies originally developed in fission yeast and human cells models to induce a synthetic spindle assembly checkpoint (SAC) arrest by conditionally forcing the heterodimerization of two SAC proteins upon addition of abscisic acid (ABA). The results from this manuscript are of special relevance for researchers studying meiosis and using Saccharomyces cerevisiae as a model. Moreover, the differential analysis of the composition and phosphorylation of kinetochores from meiotic metaphase I and metaphase II adds interest for the broader meiosis research community. Finally, regarding my expertise, I am a researcher specialized in the regulation of cell division.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

In their manuscript, Koch et al. describe a novel strategy to synchronize cells of the budding yeast Saccharomyces cerevisiae in metaphase I and metaphase II, thereby facilitating comparative analyses between these meiotic stages. This approach, termed SynSAC, adapts a method previously developed in fission yeast and human cells that enables the ectopic induction of a synthetic spindle assembly checkpoint (SAC) arrest by conditionally forcing the heterodimerization of two SAC components upon addition of the plant hormone abscisic acid (ABA). This is a valuable tool, which has the advantage that induces SAC-dependent inhibition of the anaphase promoting complex without perturbing kinetochores. Furthermore, since the same strategy and yeast strain can be also used to induce a metaphase arrest during mitosis, the methodology developed by Koch et al. enables comparative analyses between mitotic and meiotic cell divisions. To validate their strategy, the authors purified kinetochores from meiotic metaphase I and metaphase II, as well as from mitotic metaphase, and compared their protein composition and phosphorylation profiles. The results are presented clearly and in an organized manner. Despite the relevance of both the methodology and the comparative analyses, several main issues should be addressed:

1.- In contrast to the strong metaphase arrest induced by ABA addition in mitosis (Supp. Fig. 2), the SynSAC strategy only promotes a delay in metaphase I and metaphase II as cells progress through meiosis. This delay extends the duration of both meiotic stages, but does not markedly increase the percentage of metaphase I or II cells in the population at a given timepoint of the meiotic time course (Fig. 1C). Therefore, although SynSAC broadens the time window for sample collection, it does not substantially improve differential analyses between stages compared with a standard NDT80 prophase block synchronization experiment. Could a higher ABA concentration or repeated hormone addition improve the tightness of the meiotic metaphase arrest? 2.- Unlike the standard SynSAC strategy, introducing mutations that prevent PP1 binding to the SynSAC construct considerably extended the duration of the meiotic metaphase arrests. In particular, mutating PP1 binding sites in both the RVxF (RASA) and the SILK (4A) motifs of the Spc105(1-455)-PYL construct caused a strong metaphase I arrest that persisted until the end of the meiotic time course (Fig. 3A). This stronger and more prolonged 4A-RASA SynSAC arrest would directly address the issue raised above. It is unclear why the authors did not emphasize more this improved system. Indeed, the 4A-RASA SynSAC approach could be presented as the optimal strategy to induce a conditional metaphase arrest in budding yeast meiosis, since it not only adapts but also improves the original methods designed for fission yeast and human cells. Along the same lines, it is surprising that the authors did not exploit the stronger arrest achieved with the 4A-RASA mutant to compare kinetochore composition at meiotic metaphase I and II. 3.- The results shown in Supp. Fig. 4C are intriguing and merit further discussion. Mitotic growth in ABA suggest that the RASA mutation silences the SynSAC effect, yet this was not observed for the 4A or the double 4A-RASA mutants. Notably, in contrast to mitosis, the SynSAC 4A-RASA mutation leads to a more pronounced metaphase I meiotic delay (Fig. 3A). It is also noteworthy that the RVAF mutation partially restores mitotic growth in ABA. This observation supports, as previously demonstrated in human cells, that Aurora B-mediated phosphorylation of S77 within the RVSF motif is important to prevent PP1 binding to Spc105 in budding yeast as well. 4.- To demonstrate the applicability of the SynSAC approach, the authors immunoprecipitated the kinetochore protein Dsn1 from cells arrested at different meiotic or mitotic stages, and compared kinetochore composition using data independent acquisition (DIA) mass spectrometry. Quantification and comparative analyses of total and kinetochore protein levels were conducted in parallel for cells expressing either FLAG-tagged or untagged Dsn1 (Supp. Fig. 7A-B). To better detect potential changes, protein abundances were next scaled to Dsn1 levels in each sample (Supp. Fig. 7C-D). However, it is not clear why the authors did not normalize protein abundance in the immunoprecipitations from tagged samples at each stage to the corresponding untagged control, instead of performing a separate analysis. This would be particularly relevant given the high sensitivity of DIA mass spectrometry, which enabled quantification of thousands of proteins. Furthermore, the authors compared protein abundances in tagged-samples from mitotic metaphase and meiotic prophase, metaphase I and metaphase II (Supp. Fig. 7E-F). If protein amounts in each case were not normalized to the untagged controls, as inferred from the text (lines 333 to 338), the observed differences could simply reflect global changes in protein expression at different stages rather than specific differences in protein association to kinetochores. 5.- Despite the large amount of potentially valuable data generated, the manuscript focuses mainly on results that reinforce previously established observations (e.g., premature SAC silencing in meiosis I by PP1, changes in kinetochore composition, etc.). The discussion would benefit from a deeper analysis of novel findings that underscore the broader significance of this study.

Finally, minor concerns are:

1.- Meiotic progression in SynSAC strains lacking Mad1, Mad2 or Mad3 is severely affected (Fig. 1D and Supp. Fig. 1), making it difficult to assess whether, as the authors state, the metaphase delays depend on the canonical SAC cascade. In addition, as a general note, graphs displaying meiotic time courses could be improved for clarity (e.g., thinner data lines, addition of axis gridlines and external tick marks, etc.). 2.- Spore viability following SynSAC induction in meiosis was used as an indicator that this experimental approach does not disrupt kinetochore function and chromosome segregation. However, this is an indirect measure. Direct monitoring of genome distribution using GFP-tagged chromosomes would have provided more robust evidence. Notably, the SynSAC mad3Δ mutant shows a slight viability defect, which might reflect chromosome segregation defects that are more pronounced in the absence of a functional SAC. 3.- It is surprising that, although SAC activity is proposed to be weaker in metaphase I, the levels of CPC/SAC proteins seem to be higher at this stage of meiosis than in metaphase II or mitotic metaphase (Fig. 4A-B). 4.- Although a more detailed exploration of kinetochore composition or phosphorylation changes is beyond the scope of the manuscript, some key observations could have been validated experimentally (e.g., enrichment of proteins at kinetochores, phosphorylation events that were identified as specific or enriched at a certain meiotic stage, etc.). 5.- Several typographical errors should be corrected (e.g., "Knetochores" in Fig. 4 legend, "250uM ABA" in Supp. Fig. 1 legend, etc.)

Significance

Koch et al. describe a novel methodology, SynSAC, to synchronize budding yeast cells in metaphase I or metaphase II during meiosis, as well and in mitotic metaphase, thereby enabling differential analyses among these cell division stages. Their approach builds on prior strategies originally developed in fission yeast and human cells models to induce a synthetic spindle assembly checkpoint (SAC) arrest by conditionally forcing the heterodimerization of two SAC proteins upon addition of abscisic acid (ABA). The results from this manuscript are of special relevance for researchers studying meiosis and using Saccharomyces cerevisiae as a model. Moreover, the differential analysis of the composition and phosphorylation of kinetochores from meiotic metaphase I and metaphase II adds interest for the broader meiosis research community. Finally, regarding my expertise, I am a researcher specialized in the regulation of cell division.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

The manuscript submitted by Koch et al. describes a novel approach to collect budding yeast cells in metaphase I or metaphase II by synthetically activating the spinde checkpoint (SAC). The arrest is transient and reversible. This synchronization strategy will be extremely useful for studying meiosis I and meiosis II, and compare the two divisions. The authors characterized this so-named syncSACapproach and could confirm previous observations that the SAC arrest is less efficient in meiosis I than in meiosis II. They found that downregulation of the SAC response through PP1 phosphatase is stronger in meiosis I than in meiosis II. The authors then went on to purify kinetochore-associated proteins from metaphase I and II extracts for proteome and phosphoproteome analysis. Their data will be of significant interest to the cell cycle community (they compared their datasets also to kinetochores purified from cells arrested in prophase I and -with SynSAC in mitosis).

I have only a couple of minor comments:

1) I would add the Suppl Figure 1A to main Figure 1A. What is really exciting here is the arrest in metaphase II, so I don't understand why the authors characterize metaphase I in the main figure, but not metaphase II. But this is only a suggestion.

2) Line 197, the authors state: ...SyncSACinduced a more pronounced delay in metaphase II than in metaphase I. However, line 229 and 240 the auhtors talk about a "longer delay in metaphase <i compared to metaphase II"... this seems to be a mix-up.

3) The authors describe striking differences for both protein abundance and phosphorylation for key kinetochore associated proteins. I found one very interesting protein that seems to be very abundant and phosphorylated in metaphase I but not metaphase II, namely Sgo1. Do the authors think that Sgo1 is not required in metaphase II anymore? (Top hit in suppl Fig 8D).

Significance

The technique described here will be of great interest to the cell cycle community. Furthermore, the authors provide data sets on purified kinetochores of different meiotic stages and compare them to mitosis. This paper will thus be highly cited, for the technique, and also for the application of the technique.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

These authors have developed a method to induce MI or MII arrest. While this was previously possible in MI, the advantage of the method presented here is it works for MII, and chemically inducible because it is based on a system that is sensitive to the addition of ABA. Depending on when the ABA is added, they achieve a MI or MII delay. The ABA promotes dimerizing fragments of Mps1 and Spc105 that can't bind their chromosomal sites. The evidence that the MI arrest is weaker than the MII arrest is convincing and consistent with published data and indicating the SAC in MI is less robust than MII or mitosis. The authors use this system to find evidence that the weak MI arrest is associated with PP1 binding to Spc105. This is a nice use of the system.

The remainder of the paper uses the SynSAC system to isolate populations enriched for MI or MII stages and conduct proteomics. This shows a powerful use of the system but more work is needed to validate these results, particularly in normal cells.

Overall the most significant aspect of this paper is the technical achievement, which is validated by the other experiments. They have developed a system and generated some proteomics data that maybe useful to others when analyzing kinetochore composition at each division. Overall, I have only a few minor suggestions.

1) In wild-type - Pds1 levels are high during M1 and A1, but low in MII. Can the authors comment on this? In line 217, what is meant by "slightly attenuated? Can the authors comment on how anaphase occurs in presence of high Pds1? There is even a low but significant level in MII.

2) The figures with data characterizing the system are mostly graphs showing time course of MI and MII. There is no cytology, which is a little surprising since the stage is determined by spindle morphology. It would help to see sample sizes (ie. In the Figure legends) and also representative images. It would also be nice to see images comparing the same stage in the SynSAC cells versus normal cells. Are there any differences in the morphology of the spindles or chromosomes when in the SynSAC system?

3) A possible criticism of this system could be that the SAC signal promoting arrest is not coming from the kinetochore. Are there any possible consequences of this? In vertebrate cells, the RZZ complex streams off the kinetochore. Yeast don't have RZZ but this is an example of something that is SAC dependent and happens at the kinetochore. Can the authors discuss possible limitations such as this? Does the inhibition of the APC effect the native kinetochores? This could be good or bad. A bad possibility is that the cell is behaving as if it is in MII, but the kinetochores have made their microtubule attachments and behave as if in anaphase.

Significance

These authors have developed a method to induce MI or MII arrest. While this was previously possible in MI, the advantage of the method presented here is it works for MII, and chemically inducible because it is based on a system that is sensitive to the addition of ABA. Depending on when the ABA is added, they achieve a MI or MII delay. The ABA promotes dimerizing fragments of Mps1 and Spc105 that can't bind their chromosomal sites. The evidence that the MI arrest is weaker than the MII arrest is convincing and consistent with published data and indicating the SAC in MI is less robust than MII or mitosis. The authors use this system to find evidence that the weak MI arrest is associated with PP1 binding to Spc105. This is a nice use of the system.

The remainder of the paper uses the SynSAC system to isolate populations enriched for MI or MII stages and conduct proteomics. This shows a powerful use of the system but more work is needed to validate these results, particularly in normal cells.

Overall the most significant aspect of this paper is the technical achievement, which is validated by the other experiments. They have developed a system and generated some proteomics data that maybe useful to others when analyzing kinetochore composition at each division.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Manuscript number: RC-2025-03160

Corresponding author(s) Padinjat, Raghu

[The “revision plan” should delineate the revisions that authors intend to carry out in response to the points raised by the referees. It also provides the authors with the opportunity to explain their view of the paper and of the referee reports.

• *

The document is important for the editors of affiliate journals when they make a first decision on the transferred manuscript. It will also be useful to readers of the reprint and help them to obtain a balanced view of the paper.

• *

If you wish to submit a full revision, please use our "Full Revision" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

1. General Statements [optional]

We thank all three reviewers for appreciating the novelty of our analysis of CERT function in a physiological context in vivo. While many studies have been published on the biochemistry and function of CERT in cultured cells, there are limited studies, if any, relating the impact of CRT function at the biochemical level to its function on a physiological process, in our case the electrical response to light.

We also that all reviewers for commenting on the importance of our rescue of dcert mutants with hCERT and the scientific insights raised by this experiment. All reviewers have also noted the importance of strengthening our observation that hCERT, in these cells, is localized at ER-PM MCS rather that the more widely reported localization at the Golgi. We highlight that many excellent studies which have localized CERT at the Golgi are performed in cultured, immortalized, mammalian cells. There are limited studies on the localization of this protein in primary cells, neurons or in polarized cells. With the additional experiments we have proposed in the revision for this aspect of the manuscript, we believe the findings will be of great novelty and widespread interest.

We believe we can address almost all points raised by reviewers thereby strengthening this exciting manuscript.

2. Description of the planned revisions

Insert here a point-by-point reply that explains what revisions, additional experimentations and analyses are planned to address the points raised by the referees.

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

This manuscript dissects the physiological function of ceramide transfer protein (CERT) by studying the phenotype of CERT null Drosophila.

dCERT null animals have a reduced electrical response to light in their photoreceptors, reduced baseline PIP2 accumulation in the cells and delayed re-synthesis of PIP2 and its precursor, PI4P after light stimulation. There are also reduced ER:PM contact sites at the rhabdomere and a corresponding reduction in the localization of PI/PA exchange protein, RDGB at this site. Therefore, the animals seem to have an impaired ability for sustaining phototransduction, which is nonetheless milder than that seen after loss of RDGB, for example. In terms of biochemical function, there is no overall change in ceramides, with some minor increases in specific short chain pools. There is however a large decrease in PE-ceramide species, again selective for a few molecular species. Curiously, decreasing ceramides with a mutant in ceramide synthesis is able to partially rescue both the electrical response and RDGB localization in dCERT flies, implying the increased ceramide species contribute to the phenotype. In addition, a mutation in PE-ceramide synthase largely phenocopies the dCERT null, exhiniting both increases ceramides and decreased PE-ceramide.

In addition, dCERT flies were shown to have reduced localization of some plasma membrane proteins to detergent-resistant membrane fractions, as well as up regulation of the IRE1 and PERK stress-response pathways. Finally, dCERT nulls could be rescued with the human CERT protein, demonstrating conservation of core physiological function between these animals. Surprisingly, CERT is reported to localize to the ER:PM junctions at rhabdomeres, as opposed to the expected ER:Golgi contact sites. Specific areas where the manuscript could be strengthened include:

Figure 2 studies the phototransduction system. Although clear changes in PI4P and PIP2 are seen, it would be interesting to see if changed PA accumulation occur in the dCERT animals, since RDGB localization is disrupted: this is expected to cause PM PA accumulation along with reduced PIP2 synthesis.

It is an important question raised by the reviewer to check PA levels. In the present study we have noticed that localization of RDGB at the base of the rhabdomere in dcert1 is reduced but not completely removed. Consequently, one may consider the situation on dcert1 as a partial loss of function of RDGB and consistent with this, the delay in PI4P and PI(4,5)P2 resynthesis is not as severe as in rdgB9 which is a strong hypomorph (PMID: 26203165).

rdgB9 mutants also show an elevation in PA levels and the reviewer is right that one might expect changes in PA levels too as RDGB is a PI/PA transfer protein. We expect that if measured, there will be a modest elevation in PA levels. However, previous work has shown that elevation of PA levels at the or close to the rhabdomere lead to retinal degeneration Specifically, elevated PA levels by dPLD overexpression disrupts rhabdomere biogenesis and leads to retinal degeneration (PMID: 19349583). Similarly, loss of the lipid transfer protein RDGB leads to photoreceptor degeneration (PMID: 26203165). In this study, we report that retinal degeneration is not a phenotype of dcert1. Thus measurements of PA levels though interesting may not be that informative in the context of the present study. However, if necessary, we can measure PA levels in dcert1.

Lines 228-230 state: "These findings suggest an important contribution for reduced PE - Cer levels in the eye phenotypes of dcert". Does it not also suggest a contribution of the elevated ceramide species, since these are also observed in the CPES animals?

We agree with the reviewer that not only reduced PE-Ceramide but also elevated ceramide levels in GMR>CPESi could contribute to the eye phenotype. This statement will be revised to reflect this conclusion.

Figure 6D is a key finding that human CERT localized to the rhabdomere at ER:PM contact sites, though the reviewer was not convinced by these images. Is the protein truly localized to the contact sites, or simply have a pool of over-expressed protein localized to the surrounding cytoplasm? It also does not rule out localization (and therefore function) at ER:PM contact sites.

Since hCERT completely rescued eye phenotype of dcert1 the localization we observe for hCERT must be at least partly relevant. We will perform additional IHC experiments to

• Co-localize hCERT with an ER-PM MCS marker, e.g RDGB in wild type flies
• Co-localize hCERT with VAP-A that is enriched at the ER-PM MCS. This should help to determine if there are MCS and non-MCS pools of hCERT in these cells. marker, e.g RDGB in wild type flies
• Test if there is a pool of hCERT, in these cells that also localizes (or not) with the Golgi marker Golgin 84. These will be included in the revision to strengthen this important point.

Statistics: There are a large number of t-tests employed that do not correct for multiple comparisons, for example in figures 3B, 3D, 3H, 4C, 6C, S2A, S2B, S3B and S3C.

We will performed multiple comparisons with mentioned data and incorporate in the revised manuscript.

There are two Western blotting sections in the methods.

The first Western blotting methods is for general blots in the paper. The second western blotting section is related to the samples from detergent resistant membrane (DRM) fractions. We will clearly explain this information in the methods section of the manuscript.

Reviewer #1 (Significance (Required)):

Overall, the manuscript is clearly and succinctly written, with the data well presented and mostly convincing. The paper demonstrates clear phenotypes associated with loss of dCERT function, with surprising consequences for the function of a signaling system localized to ER:PM contact sites. To this reviewer, there seem to be three cogent observations of the paper: (i) loss of dCERT leads to accumulation of ceramides and loss of PE-ceramide, which together drive the phenotype. (ii) this ceramide alteration disrupts ER:PM contact sites and thus impairs phototransduction and (iii) rescue by human CERT and its apparent localization to ER:PM contact sites implies a potential novel site of action. Although surprising and novel, the significance of these observations are a little unclear: there is no obvious mechanism by which the elevated ceramide species and decreased PE-ceramide causes the specific failure in phototrasnduction, and the evidence for a novel site of action of CERT at the ER:PM contact sites is not compelling. Therefore, although an interesting and novel set of observations, the manuscript does not reveal a clear mechanistic basis for CERT physiological function.

We thank reviewer for appreciating the quality of our manuscript while also highlighting points through which its impact can be enhanced. To our knowledge this is one of the first studies to tackle the challenging problem of a role for CERT in physiological function. We would like to highlight two points raised:

• We do understand that the localisation of hCERT at ER-PM MCS is unusual compared to the traditional reported localization to ER-Golgi sites. This is important for the overall interpretation of the results in the paper on how dCERT regulates phototransduction. As indicated in response to an earlier comment by the reviewer we will perform additional experiments to strengthen our conclusion of the localization of hCERT.
• With regard to how loss of dCERT affects phototransduction, we feel to likely mechanisms contribute. If the localization of hCERT to ER-PM MCS is verified through additional experiments (see proposal above) then it is important to note that ER-PM MCS in these cells includes the SMC (smooth endoplasmic reticulum) the major site of lipid synthesis. It is possible that loss of dCERT leads to ceramide accumulation in the smooth ER and disruption of ER-PM contacts. That may explain why reducing the levels of ceramide at this site partially rescues the eye phenotype.

The multi-protein INAD-TRP-NORPA complex, central to phototransduction have previously been shown to localise to DRMs in photoreceptors. PE-Ceramides are important contributors to the formation of plasma membrane DRMs and we have presented biochemical evidence that the formation of these DRMs are reduced in the dcert1. This may be a mechanism contributing to reduced phototransduction. This latter mechanism has been proposed as a physiological function of DRMs but we think our data may be the first to show it in a physiological model.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Summary Non-vesicular lipid transfer by lipid transfer proteins regulates organelle lipid compositions and functions. CERT transfers ceramide from the ER to Golgi to produce sphingomyelin, although CERT function in animal development and physiology is less clear. Using dcert1 (a protein-null allele), this paper shows a disruption of the sole Drosophila CERT gene causes reduced ERG amplitude in photoreceptors. While the level and localization of phototransduction machinery appears unaffected, the level of PIP2 and the localization of RDGB are perturbed. Collectively, these observations establish a novel link between CERT and phospholipase signaling in phototransduction. To understand the molecular mechanism further, the authors performed lipid chromatography and mass spec to characterize ceramide species in dcert1. This analysis reveals that whereas the total ceramide remains unaffected, most PE-ceramide species are reduced. The authors use lace mutant (serine palmitoyl transferase) and CPES (ceramide phosphoethanolamine synthase) RNAi to distinguish whether it is the accumulation of ceramide in the ER or the reduction of sphingolipid derivates in the Golgi that is the cause for the reduced ERG amplitude. Mutating one copy of lace reduces ceramide level by 50% and partially rescues the ERG defect, suggesting that the accumulation of ceramide in the ER is a cause. CPES RNAi phenocopies the reduced ERG amplitude, suggesting the production of certain sphingolipid is also relevant.

Major comments: 1. By showing the reduced PIP2 level, the decreased SMC sites at the base of rhabdomeres, and the diffused RDGB localization in dcert1, the authors favor the model, in which the disruption of ceramide metabolism affects PIP transport. However, it is unclear if the reduced PIP2 level (i.e., reduced PH-PLCd::GFP staining) is specific to the rhabdomeres. It should be possible to compare PH-PLCd::GFP signals in different plasma membranes between wildtype and dcert1. If PH-PLCd::GFP signal is specifically reduced at the rhabdomeres, this conclusion will be greatly strengthened. In addition, the photoreceptor apical plasma membrane includes rhabdomere and stalk membrane. Is the PH-PLCd::GFP signal at the stalk membrane also affected?

Due to the physical organization of optics in the fly eye, the pseudopupil imaging method used in this study collects the signal for the PIP2 probe (PH-PLCd::GFP) mainly from the apical rhabdomere membrane of photoreceptors in live imaging experimental mode. Therefore, the PIP2 signal from these experiments cannot be used to interpret the level of PIP2 either at the stalk membrane or indeed the basolateral membrane.

The point raised by the reviewer, i.e whether CERT selectively controls PIP2 levels at the rhabdomere membrane or not, is an interesting one. To do this, we will need to fix fly photoreceptors and determine the PH-PLCd::GFP signal using single slice confocal imaging. When combined with a stalk marker such as CRUMBS, it should be possible to address the question of which are the membrane domains at which dCERT controls PIP2 levels. If the sole mechanism of action of dCERT is via disruption of ER-PM MCS then only the apical rhabdomere membrane PIP2 should be affected leaving the stalk membrane and basolateral membrane unaffected.

Thank you very much for raising this specific point.

The analysis of RDGB localization should be done in mosaic dcert1 retinas, which will be more convincing with internal control for each comparison. In addition, the phalloidin staining in Figure 2J shows distinct patterns of adherens junctions, indicating that the wildtype and dcert1 were imaged at different focal planes.

We understand that having mosaics is an alternative an elegant way to perform a a side by side analysis of control and mutant. However this would require significant investment of time and effort, perhaps beyond the scope of this study. If we were to perform a mosaic analysis, this would compromise our ERG analysis since ERG is an extracellular recording We feel that this is beyond the scope of this study and perhaps may not be necessary as such (see below).

In the revision we will present equivalent sections of control and dcert1 taken from the nuclear plane of the photoreceptor. This should resolve the reviewer’s concerns.

The significance of ceramide species levels in dcert1 and GMR>CPESRNAi needs to be explained better. Do certain alterations represent accumulation of ceramides in the ER?

Species level analysis of changes in ceramides reveal that elevations in dcert1 are seen mainly in the short chain ceramides (14 and 16 carbon chains). These most likely represent the short chain ceramides synthesised in the ER and accumulating due to the block in further metabolism to PE-Cer due to depletion in CPES.

Species level analysis of changes in ceramides reveal that in dcert1 there is a ceramide transport related defect leading to elevation, primarily, in the short chain ceramides (14 and 16 carbon chains), and this selective supply defect leads to a reduction in PE-Cer levels, with a maximum change in the ratio of short-chain Cer:PE Cer (Figure 3A-D). Though there is no apparent change in the total ceramide level the species specific elevation in the ceramides disturb the fine -balance between the short-chain ceramides and the long and very-long chain ceramides. As the function of long and very-long chain ceramides are implicated in dendrite development and neuronal morphology (doi: 10.1371/journal.pgen.1011880), therefore this alteration in the fine balance between different ceramide species probably impacts the integrity and fluidity of the membrane environment. On the other hand it leads to a possibility of a defined function of the short-chain ceramides in electrical responses to light signalling in the eye, especially with respect to the PE-ceramides that are reduced by around 50%.

In contrast the GMR>CPESRNAi leads to more of a substrate accumulation showing ceramide increase (14, 16, 18, 20 carbon chains) and decrease in PE-Cer levels (Figure 4D, E). In this case Cer accumulation is due to the block in further metabolism to PE-Cer arising from depletion in CPES.

We will include this in the discussion of a revised version.

The suppression by lace is interpreted as evidence that the reduced ERG amplitude in dcert1 is caused by ceramide accumulation in the ER. This interpretation seems preliminary as lace may interact with dcert genetically by other mechanisms.

The dcert1 mutant exhibits increased levels of short-chain ceramides (Fig 3B), whereas the lace heterozygous mutant (laceK05305/+) displays reduced short-chain ceramide levels (Supp Fig 2B). In the laceK05305/+; dcert1 double mutant, ceramide levels are lower than those observed in the dcert1 mutant alone (Supp Fig 2B), indicating a partial genetic rescue of the elevated ceramide phenotype.

Furthermore, through multiple independent genetic manipulations that modulate ceramide metabolism (alterations of dcert, cpes and lace), we consistently observe that increased ceramide levels correlate with a reduction in ERG amplitude, suggesting that ceramide accumulation negatively impacts photoreceptor function. Taken together, these observations indicate that the reduction in ceramide levels in the laceK05305/+; dcert1 double mutant likely contributes to the suppression of the ERG defect observed in the dcert1 mutant.

The authors show that ERG amplitude is reduced in GMR>CPESRNAi. While this phenocopying is consistent with the reduced ERG amplitude in dcert1 being caused by reduced production of PE-ceramide, GMR>CPESRNAi also shows an increase in total ceramide level. Could this support the hypothesis that reduced ERG amplitude is caused by an accumulation of ceramide elsewhere? In addition, is the ERG amplitude reduction in GMR>CPESRNAi sensitive to lace?

We agree that in addition to reduced PE-Ceramide, the elevated ceramide levels in GMR>CPESi could contribute to the eye phenotype. We will introduce lace heterozygous mutant in the GMR>CPESi background to test the contribution of elevated ceramide levels in the *GMR>CPESi * background and incorporate the data in the revision. Thank you for this suggestion.

Along the same line, while the total ceramide level is significantly reduced in lace heterozygotes, is the PE-ceramide level also reduced? If yes, wouldn't this be contradictory to PE-ceramide production being important for ERG amplitude?

Mass spec measurements show that levels of PE-Cer were not reduced in lacek05305/+ compared to wild type. This data will be included in the revised manuscript. However, the ERG amplitude of these flies and also in those with lace depletion using two independent RNAi lines were not reduced.

What is the explanation and significance for the age-dependent deterioration of ERG amplitude in dcert1? Likewise, the significance of no retinal degeneration is not clearly presented.

There could be multiple reasons for the age dependent deterioration of the ERG amplitude, in the absence of retinal degeneration. Drosophila phototransduction cascade depends heavily on ATP production. The age dependent reduction in ATP synthesis could lead to deterioration in the ERG amplitude. These may include instability of the DRMs due to reduced PE-Cer, lower ATP levels due to mitochondrial dysfunction, an perhaps others. A previous study has shown that ATP production is highly reduced along with oxidative stress and metabolic dysfunction in dcert1 flies aged to 10 days and beyond (PMID: 17592126). The same study has also found no neuronal degeneration in dcert1 that phenocopies absence of photoreceptor degeneration in the present study. We will attempt a few experiments to rule in or rule out the these and revise the discussion accordingly.

The rescue of dcert1 phenotype by the expression of human CERT is a nice result. In addition to demonstrating a functional conservation, it allows a determination of CERT protein localization. However, the quality of images in Figure 6D should be improved. The phalloidin staining was rather poor, and the CNX99A in the lower panel was over-exposed, generating bleed-through signals at the rhabdomeres. In addition, the localization of hCERT should be explored further. For instance, does hCERT colocalize with RDGB? Is the hCERT localization altered in lace or GMR>CPESRNAi background?

As indicated in response to reviewer 1:

We will perform additional IHC experiments to

• Co-localize hCERT with an ER-PM MCS marker, e.g RDGB in wild type flies
• Co-localize hCERT with VAP-A that is enriched at the ER-PM MCS. This should help to determine if there are MCS and non-MCS pools of hCERT in these cells. marker, e.g RDGB in wild type flies
• Test if there is a pool of hCERT, in these cells that also localizes (or not) with the Golgi marker Golgin 84. These will be included in the revision to strengthen this important point.

We will also attempt to perform hCERT localization in lace or GMR>CPESRNAi background

Minor comments: 1. In Line 128, Df(732) should be Df(3L)BSC732.

Changes will be incorporated in the main manuscript.

GMR-SMSrRNAi shows an increase in ERG peak amplitude. Is there an explanation for this?

GMR-SMSrRNAi did show slight increase in ERG peak amplitude but was not statistically significant.

Reviewer #2 (Significance (Required)):

Significance As CERT mutations are implicated in human learning disability, a better understanding of CERT function in neuronal cells is certainly of interest. While the link between ceramide transport and phospholipase signaling is novel and interesting, this paper does not clearly explain the mechanism. In addition, as the ERG were measured long after the retinal cells were deficient in CERT or CPES, it is difficult to assess whether the observed phenotype is a primary defect. Furthermore, the quality of some images needs to be improved. Thus, I feel the manuscript in its current form is too preliminary.

We thank reviewer for highlighting the importance and significance of our work in the light of recent studies of CERT function in ID. As with all genetic studies it is difficult to completely disentangle the role of a gene during development from a role only in the adult. However, we will attempt to perhaps use the GAL80ts system to uncouple these two potential components of CERT function in photoreceptors. The goal will be to determine if CERT has a specific role only in adult photoreceptors or if this is coupled to a developmental role. Since ID is as a neurodevelopmental disorder, a developmental role for CERT would be equally interesting.

As previously indicated images will be improved bearing in mind the reviewer comments.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Summary: Lipid transfer proteins (LTPs) shuttle lipids between organelle membranes at membrane contact sites (MCSs). While extensive biochemical and cell culture studies have elucidated many aspects of LTP function, their in vivo physiological roles are only beginning to be understood. In this manuscript, the authors investigate the physiological role of the ceramide transfer protein (CERT) in Drosophila adult photoreceptors-a model previously employed by this group to study LTP function at ER-PM contact sites under physiological conditions. Using a combination of genetic, biochemical, and physiological approaches, they analyze a protein-null mutant of dcert. They show that loss of dcert causes a reduction in electrical response to light with progressive decrease in electroretinogram (ERG) amplitude with age but no retinal degeneration. Lipidomic analysis shows that while the total levels of ceramides are not changed in dcert mutants, they do observe significant change in certain species of ceramides and depletion of downstream metabolite phosphoethanolamine ceramide (PE-Cer). Using fluorescent biosensors, the authors demonstrate reduced PIP2 levels at the plasma membrane, unchanged basal PI4P levels and slower resynthesis kinetics of both lipids following depletion. Electron microscopy and immunolabeling further reveal a reduced density of ER-PM MCSs and mislocalization of the MCS-resident lipid transfer protein RDGB. Genetic interaction studies with lace and RNAi-mediated knockdown of CPES support the conclusion that both ER ceramide accumulation and PM PE-Cer depletion contribute to the observed defects in dcert mutants. In addition, detergent-resistant membrane fractionation indicates altered plasma membrane organization in the absence of dcert. The study also reports upregulation of unfolded protein response transcripts, including IRE1 and PERK, suggesting increased ER stress. Finally, expression of human CERT rescues the reduced electrical response, demonstrating functional conservation across species. Overall the manuscript is well written that builds on established work and experiments are technically rigorous. The results are clearly presented and provide valuable insights into the physiological role of CERT.

Major comments: 1.The reduced ERG amplitude appears to be the central phenotype associated with the loss of dcert, and most of the experiments in this manuscript effectively build a mechanistic framework to explain this observation. However, the experiments addressing detergent-resistant membrane domains (DRMs) and the unfolded protein response (UPR) seem somewhat disconnected from the main focus of the study. The DRM and UPR data feel peripheral and could benefit from few experiments for functional linkage to the ERG defect or should be moved to supplementary.

We agree with the reviewer that further experiments are needed to link the DRM data to the ERG defects. That would need specific biochemical alteration at the PM to modulate PE-Cer species and their effect on scaffolding proteins required for phototransduction (that is beyond the scope of the present study). We will consider moving these to the supplementary section as suggested by the reviewer.

2.The changes in ceramide species and reduction in PE-Cer are key findings of the study. These results should be further validated by performing a genetic rescue using the BAC or hCERT fly line to confirm that the lipidomic changes are specifically due to loss of CERT function.

Thank you for this comment. We will include this in the revised manuscript.

3.Figure 2B-C and 2E-F: Representative images corresponding to the quantified data should be included to illustrate the changes in PIP2 and PI4P reporters. Given that the fluorescence intensity of the PIP2 reporter at the PM is reduced in the dcert mutant relative to control, the authors should also verify that the reporter is expressed at comparable levels across genotypes.

• As mentioned by the reviewer we will include representative images alongside our quantified data both of the basal ones and that of the kinetic study.

• Western blot of reporters (PH-PLCd::GFP and P4M::GFP) across genotypes will be added to the revised manuscript. 4.Figure 2J-K: The partial mislocalization of RDGB represents an important observation that could mechanistically explain the reduced resynthesis of PI4P and PIP2 and consequently, the decreased ERG amplitude in dcert mutants. However, this result requires further validation. First, the authors should confirm whether this mislocalization is specific to RDGB by performing co-staining with another ER-PM MCS marker, such as VAP-A, to assess whether overall MCS organization is disrupted. Second, the quantification of RDGB enrichment at ER-PM MCSs should be refined. From the representative images, RDGB appears redistributed toward the photoreceptor cell body, but the presented quantification does not clearly reflect this shift. The authors should therefore include an analysis comparing RDGB levels in the cell body versus the submicrovillar region across genotypes. This analysis should be repeated for similar experiments across the study. Additionally, the total RDGB protein level should be quantified and reported. Finally, since RDGB mislocalization could directly contribute to the decreased ERG amplitude, it would be valuable to test whether overexpression of RDGB in dcert mutants can rescue the ERG phenotype.

• In our ultrastructural studies (Fig. 2H, 2I and Sup. Fig. 1A, 1B) we did see reduction in PM-SMC MCS that was corroborated with RDGB staining.

• Comparative ratio analysis of RDGB localisation at ER-PM MCS vs cell body will be included in the manuscript for all RDGB staining.
• We have done western analysis for total RDGB protein level in ROR and dcert1. This data will be included in the revised manuscript.
• This is a very interesting suggestion and we will test if RDGB overexpression can rescue ERG phenotype in dcert1.

5.Figure 3F and I-J: Inclusion of appropriate WT and laceK05205/+ controls is necessary to allow proper interpretation of the results. These controls would strengthen the conclusions regarding the functional relationship between dcert and lace.

Changes will be incorporated as per the suggestion.

6.Figure 5C: The representative images shown here appear to contradict the findings described in Figure 2A. In Figure 5C, Rhodopsin 1 levels seem markedly reduced in the dcert mutants, whereas the text states that Rh1 levels are comparable between control and mutant photoreceptors. The authors should replace or reverify the representative images to ensure that they accurately reflect the conclusions presented in the text.

We will reverify the representative images and changes will be accordingly incorporated.

7.Figure 6D: The reported localization of hCERT to ER-PM MCSs is a key and potentially insightful observation, as it suggests the subcellular site of dcert activity in photoreceptors. However, the representative images provided are not sufficiently conclusive to support this claim. The authors should validate hCERT localization by co-staining with established markers like RDGB for ER-PM CNX99A for the ER and a Golgi marker since mammalian CERT is classically localized to ER-Golgi interfaces. Optionally, the authors could also quantify the relative distribution of hCERT among these compartments to provide a clearer assessment of its subcellular localization.

As indicated in response to reviewer 1:

We will perform additional IHC experiments to

• Co-localize hCERT with an ER-PM MCS marker, e.g RDGB in wild type flies
• Co-localize hCERT with VAP-A that is enriched at the ER-PM MCS. This should help to determine if there are MCS and non-MCS pools of hCERT in these cells. marker, e.g RDGB in wild type flies
• Test if there is a pool of hCERT, in these cells that also localizes (or not) with the Golgi marker Golgin 84. These will be included in the revision to strengthen this important point.

Minor comments: 1.In the first paragraph of introduction, authors should consider citing few of the key MCS literature.

Additional literature will be included as per the suggestion.

2.Line 132: data not shown is not acceptable. Authors should consider presenting the findings in the supplemental figure.

Data will be added in supplement as per the suggestion.

3.The authors should include a comprehensive table or Excel sheet summarizing all statistical analyses. This should include the sample size, type of statistical test used and exact p-values. Providing this information will improve the transparency, reproducibility and overall rigor of the study.

We will provide all the statistical analyses in mentioned format as per the suggestion.

4.The materials and methods section can be reorganized to include citation for flystocks which do not have stock number or RRIDs if the stocks were previously described but are not available from public repositories. They should expand on the details of various quantification methods used in the study. Finally including a section of Statistical analyses would further enhance transparency and reproducibility

• Stock details will be added wherever missing as per the suggestion.
• Statistical analyses section will be included in the material and methods. **Referee cross-commenting**

1.I concur with Reviewer 1 regarding the need for more detailed reporting of statistical analyses.

We will perform multiple comparisons with mentioned data and incorporate in the revised manuscript.

2.I also agree with Reviewer 3 that the discussion should be expanded to address the age-dependent deterioration of ERG amplitude observed in the dcert mutants. This progressive decline could provide valuable insight into the long-term requirement of CERT function and signaling capacity at the photoreceptor membrane.

Expanded discussion on the age dependent ERG amplitude decline will be incorporated in the discussion as per the suggestion.

Reviewer #3 (Significance (Required)):

This study explores the physiological function of CERT, a LTP localized at MCSs in Drosophila photoreceptors and uncovers a novel role in regulating plasma membrane PE-Cer levels and GPCR-mediated signaling. These findings significantly advances our understanding of how CERT-mediated lipid transport regulates G-protein coupled phospholipase C signaling in vivo. This work also highlights Drosophila photoreceptors as a powerful system to analyze the physiological significance of lipid-dependent signaling processes. This work will be of interest to researchers in neuronal cell biology, membrane dynamics and lipid signaling community. This review is based on my expertise in neuronal cell biology.

We thank the reviewer for appreciating the significance of our work from a neuroscience perspective.

• *

3. Description of the revisions that have already been incorporated in the transferred manuscript

Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. If no revisions have been carried out yet, please leave this section empty.

• *

4. Description of analyses that authors prefer not to carry out

Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

• *

We can address all reviewer points in the revision. However, we will not be able to perform a mosaic analysis of the impact of dcert1 mutant in the retina. We feel this is beyond the scope of this revision. In our response, we have highlighted how controls included in the revision offset the need for a mosaic analysis at this stage.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Summary:

Lipid transfer proteins (LTPs) shuttle lipids between organelle membranes at membrane contact sites (MCSs). While extensive biochemical and cell culture studies have elucidated many aspects of LTP function, their in vivo physiological roles are only beginning to be understood. In this manuscript, the authors investigate the physiological role of the ceramide transfer protein (CERT) in Drosophila adult photoreceptors-a model previously employed by this group to study LTP function at ER-PM contact sites under physiological conditions. Using a combination of genetic, biochemical, and physiological approaches, they analyze a protein-null mutant of dcert. They show that loss of dcert causes a reduction in electrical response to light with progressive decrease in electroretinogram (ERG) amplitude with age but no retinal degeneration. Lipidomic analysis shows that while the total levels of ceramides are not changed in dcert mutants, they do observe significant change in certain species of ceramides and depletion of downstream metabolite phosphoethanolamine ceramide (PE-Cer). Using fluorescent biosensors, the authors demonstrate reduced PIP2 levels at the plasma membrane, unchanged basal PI4P levels and slower resynthesis kinetics of both lipids following depletion. Electron microscopy and immunolabeling further reveal a reduced density of ER-PM MCSs and mislocalization of the MCS-resident lipid transfer protein RDGB. Genetic interaction studies with lace and RNAi-mediated knockdown of CPES support the conclusion that both ER ceramide accumulation and PM PE-Cer depletion contribute to the observed defects in dcert mutants. In addition, detergent-resistant membrane fractionation indicates altered plasma membrane organization in the absence of dcert. The study also reports upregulation of unfolded protein response transcripts, including IRE1 and PERK, suggesting increased ER stress. Finally, expression of human CERT rescues the reduced electrical response, demonstrating functional conservation across species.Overall the manuscript is well written that builds on established work and experiments are technically rigorous. The results are clearly presented and provide valuable insights into the physiological role of CERT.

Major comments:

1.The reduced ERG amplitude appears to be the central phenotype associated with the loss of dcert, and most of the experiments in this manuscript effectively build a mechanistic framework to explain this observation. However, the experiments addressing detergent-resistant membrane domains (DRMs) and the unfolded protein response (UPR) seem somewhat disconnected from the main focus of the study. The DRM and UPR data feel peripheral and could benefit from few experiments for functional linkage to the ERG defect or should be moved to supplementary. 2.The changes in ceramide species and reduction in PE-Cer are key findings of the study. These results should be further validated by performing a genetic rescue using the BAC or hCERT fly line to confirm that the lipidomic changes are specifically due to loss of CERT function. 3.Figure 2B-C and 2E-F: Representative images corresponding to the quantified data should be included to illustrate the changes in PIP2 and PI4P reporters. Given that the fluorescence intensity of the PIP2 reporter at the PM is reduced in the dcert mutant relative to control, the authors should also verify that the reporter is expressed at comparable levels across genotypes. 4.Figure 2J-K: The partial mislocalization of RDGB represents an important observation that could mechanistically explain the reduced resynthesis of PI4P and PIP2 and consequently, the decreased ERG amplitude in dcert mutants. However, this result requires further validation. First, the authors should confirm whether this mislocalization is specific to RDGB by performing co-staining with another ER-PM MCS marker, such as VAP-A, to assess whether overall MCS organization is disrupted. Second, the quantification of RDGB enrichment at ER-PM MCSs should be refined. From the representative images, RDGB appears redistributed toward the photoreceptor cell body, but the presented quantification does not clearly reflect this shift. The authors should therefore include an analysis comparing RDGB levels in the cell body versus the submicrovillar region across genotypes. This analysis should be repeated for similar experiments across the study. Additionally, the total RDGB protein level should be quantified and reported. Finally, since RDGB mislocalization could directly contribute to the decreased ERG amplitude, it would be valuable to test whether overexpression of RDGB in dcert mutants can rescue the ERG phenotype. 5.Figure 3F and I-J: Inclusion of appropriate WT and laceK05205/+ controls is necessary to allow proper interpretation of the results. These controls would strengthen the conclusions regarding the functional relationship between dcert and lace. 6.Figure 5C: The representative images shown here appear to contradict the findings described in Figure 2A. In Figure 5C, Rhodopsin 1 levels seem markedly reduced in the dcert mutants, whereas the text states that Rh1 levels are comparable between control and mutant photoreceptors. The authors should replace or reverify the representative images to ensure that they accurately reflect the conclusions presented in the text. 7.Figure 6D: The reported localization of hCERT to ER-PM MCSs is a key and potentially insightful observation, as it suggests the subcellular site of dcert activity in photoreceptors. However, the representative images provided are not sufficiently conclusive to support this claim. The authors should validate hCERT localization by co-staining with established markers like RDGB for ER-PM CNX99A for the ER and a Golgi marker since mammalian CERT is classically localized to ER-Golgi interfaces. Optionally, the authors could also quantify the relative distribution of hCERT among these compartments to provide a clearer assessment of its subcellular localization.

Minor comments:

1.In the first paragraph of introduction, authors should consider citing few of the key MCS literature. 2.Line 132: data not shown is not acceptable. Authors should consider presenting the findings in the supplemental figure. 3.The authors should include a comprehensive table or Excel sheet summarizing all statistical analyses. This should include the sample size, type of statistical test used and exact p-values. Providing this information will improve the transparency, reproducibility and overall rigor of the study. 4.The materials and methods section can be reorganized to include citation for flystocks which do not have stock number or RRIDs if the stocks were previously described but are not available from public repositories. They should expand on the details of various quantification methods used in the study. Finally including a section of Statistical analyses would further enhance transparency and reproducibility

Referee cross-commenting

1.I concur with Reviewer 1 regarding the need for more detailed reporting of statistical analyses. 2.I also agree with Reviewer 3 that the discussion should be expanded to address the age-dependent deterioration of ERG amplitude observed in the dcert mutants. This progressive decline could provide valuable insight into the long-term requirement of CERT function and signaling capacity at the photoreceptor membrane.

Significance

This study explores the physiological function of CERT, a LTP localized at MCSs in Drosophila photoreceptors and uncovers a novel role in regulating plasma membrane PE-Cer levels and GPCR-mediated signaling. These findings significantly advances our understanding of how CERT-mediated lipid transport regulates G-protein coupled phospholipase C signaling in vivo. This work also highlights Drosophila photoreceptors as a powerful system to analyze the physiological significance of lipid-dependent signaling processes. This work will be of interest to researchers in neuronal cell biology, membrane dynamics and lipid signaling community. This review is based on my expertise in neuronal cell biology.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary

Non-vesicular lipid transfer by lipid transfer proteins regulates organelle lipid compositions and functions. CERT transfers ceramide from the ER to Golgi to produce sphingomyelin, although CERT function in animal development and physiology is less clear. Using dcert1 (a protein-null allele), this paper shows a disruption of the sole Drosophila CERT gene causes reduced ERG amplitude in photoreceptors. While the level and localization of phototransduction machinery appears unaffected, the level of PIP2 and the localization of RDGB are perturbed. Collectively, these observations establish a novel link between CERT and phospholipase signaling in phototransduction. To understand the molecular mechanism further, the authors performed lipid chromatography and mass spec to characterize ceramide species in dcert1. This analysis reveals that whereas the total ceramide remains unaffected, most PE-ceramide species are reduced. The authors use lace mutant (serine palmitoyl transferase) and CPES (ceramide phosphoethanolamine synthase) RNAi to distinguish whether it is the accumulation of ceramide in the ER or the reduction of sphingolipid derivates in the Golgi that is the cause for the reduced ERG amplitude. Mutating one copy of lace reduces ceramide level by 50% and partially rescues the ERG defect, suggesting that the accumulation of ceramide in the ER is a cause. CPES RNAi phenocopies the reduced ERG amplitude, suggesting the production of certain sphingolipid is also relevant.

Major comments:

1. By showing the reduced PIP2 level, the decreased SMC sites at the base of rhabdomeres, and the diffused RDGB localization in dcert1, the authors favor the model, in which the disruption of ceramide metabolism affects PIP transport. However, it is unclear if the reduced PIP2 level (i.e., reduced PH-PLC::GFP staining) is specific to the rhabdomeres. It should be possible to compare PH-PLC::GFP signals in different plasma membranes between wildtype and dcert1. If PH-PLC::GFP signal is specifically reduced at the rhabdomeres, this conclusion will be greatly strengthened. In addition, the photoreceptor apical plasma membrane includes rhabdomere and stalk membrane. Is the PH-PLC::GFP signal at the stalk membrane also affected?
2. The analysis of RDGB localization should be done in mosaic dcert1 retinas, which will be more convincing with internal control for each comparison. In addition, the phalloidin staining in Figure 2J shows distinct patterns of adherens junctions, indicating that the wildtype and dcert1 were imaged at different focal planes.
3. The significance of ceramide species levels in dcert1 and GMR>CPESRNAi needs to be explained better. Do certain alterations represent accumulation of ceramides in the ER?
4. The suppression by lace is interpreted as evidence that the reduced ERG amplitude in dcert1 is caused by ceramide accumulation in the ER. This interpretation seems preliminary as lace may interact with dcert genetically by other mechanisms.
5. The authors show that ERG amplitude is reduced in GMR>CPESRNAi. While this phenocopying is consistent with the reduced ERG amplitude in dcert1 being caused by reduced production of PE-ceramide, GMR>CPESRNAi also shows an increase in total ceramide level. Could this support the hypothesis that reduced ERG amplitude is caused by an accumulation of ceramide elsewhere? In addition, is the ERG amplitude reduction in GMR>CPESRNAi sensitive to lace?
6. Along the same line, while the total ceramide level is significantly reduced in lace heterozygotes, is the PE-ceramide level also reduced? If yes, wouldn't this be contradictory to PE-ceramide production being important for ERG amplitude?
7. What is the explanation and significance for the age-dependent deterioration of ERG amplitude in dcert1? Likewise, the significance of no retinal degeneration is not clearly presented.
8. The rescue of dcert1 phenotype by the expression of human CERT is a nice result. In addition to demonstrating a functional conservation, it allows a determination of CERT protein localization. However, the quality of images in Figure 6D should be improved. The phalloidin staining was rather poor, and the CNX99A in the lower panel was over-exposed, generating bleed-through signals at the rhabdomeres. In addition, the localization of hCERT should be explored further. For instance, does hCERT colocalize with RDGB? Is the hCERT localization altered in lace or GMR>CPESRNAi background?

Minor comments:

1. In Line 128, Df(732) should be Df(3L)BSC732.
2. GMR-SMSrRNAi shows an increase in ERG peak amplitude. Is there an explanation for this?

Significance

As CERT mutations are implicated in human learning disability, a better understanding of CERT function in neuronal cells is certainly of interest. While the link between ceramide transport and phospholipase signaling is novel and interesting, this paper does not clearly explain the mechanism. In addition, as the ERG were measured long after the retinal cells were deficient in CERT or CPES, it is difficult to assess whether the observed phenotype is a primary defect. Furthermore, the quality of some images needs to be improved. Thus, I feel the manuscript in its current form is too preliminary.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

This manuscript dissects the physiological function of ceramide transfer protein (CERT) by studying the phenotype of CERT null Drosophila.

dCERT null animals have a reduced electrical response to light in their photoreceptors, reduced baseline PIP2 accumulation in the cells and delayed re-synthesis of PIP2 and its precursor, PI4P after light stimulation. There are also reduced ER:PM contact sites at the rhabdomere and a corresponding reduction in the localization of PI/PA exchange protein, RDGB at this site. Therefore, the animals seem to have an impaired ability for sustaining phototransduction, which is nonetheless milder than that seen after loss of RDGB, for example. In terms of biochemical function, there is no overall change in ceramides, with some minor increases in specific short chain pools. There is however a large decrease in PE-ceramide species, again selective for a few molecular species. Curiously, decreasing ceramides with a mutant in ceramide synthesis is able to partially rescue both the electrical response and RDGB localization in dCERT flies, implying the increased ceramide species contribute to the phenotype. In addition, a mutation in PE-ceramide synthase largely phenocopies the dCERT null, exhiniting both increases ceramides and decreased PE-ceramide.

In addition, dCERT flies were shown to have reduced localization of some plasma membrane proteins to detergent-resistant membrane fractions, as well as up regulation of the IRE1 and PERK stress-response pathways. Finally, dCERT nulls could be rescued with the human CERT protein, demonstrating conservation of core physiological function between these animals. Surprisingly, CERT is reported to localize to the ER:PM junctions at rhabdomeres, as opposed to the expected ER:Golgi contact sites.

Specific areas where the manuscript could be strengthened include:

Figure 2 studies the phototransduction system. Although clear changes in PI4P and PIP2 are seen, it would be interesting to see if changed PA accumulation occur in the dCERT animals, since RDGB localization is disrupted: this is expected to cause PM PA accumulation along with reduced PIP2 synthesis.

Lines 228-230 state: "These findings suggest an important contribution for reduced PE - Cer levels in the eye phenotypes of dcert". Does it not also suggest a contribution of the elevated ceramide species, since these are also observed in the CPES animals?

Figure 6D is a key finding that human CERT localized to the rhabdomere at ER:PM contact sites, though the reviewer was not convinced by these images. Is the protein truly localized to the contact sites, or simply have a pool of over-expressed protein localized to the surrounding cytoplasm? It also does not rule out localization (and therefore function) at ER:PM contact sites.

Statistics: There are a large number of t-tests employed that do not correct for multiple comparisons, for example in figures 3B, 3D, 3H, 4C, 6C, S2A, S2B, S3B and S3C.

There are two Western blotting sections in the methods.

Significance

Overall, the manuscript is clearly and succinctly written, with the data well presented and mostly convincing. The paper demonstrates clear phenotypes associated with loss of dCERT function, with surprising consequences for the function of a signaling system localized to ER:PM contact sites. To this reviewer, there seem to be three cogent observations of the paper: (i) loss of dCERT leads to accumulation of ceramides and loss of PE-ceramide, which together drive the phenotype. (ii) this ceramide alteration disrupts ER:PM contact sites and thus impairs phototransduction and (iii) rescue by human CERT and its apparent localization to ER:PM contact sites implies a potential novel site of action. Although surprising and novel, the significance of these observations are a little unclear: there is no obvious mechanism by which the elevated ceramide species and decreased PE-ceramide causes the specific failure in phototrasnduction, and the evidence for a novel site of action of CERT at the ER:PM contact sites is not compelling. Therefore, although an interesting and novel set of observations, the manuscript does not reveal a clear mechanistic basis for CERT physiological function.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Reviewer #1

Evidence, reproducibility and clarity

This paper addresses a very interesting problem of non-centrosomal microtubule organization in developing Drosophila oocytes. Using genetics and imaging experiments, the authors reveal an interplay between the activity of kinesin-1, together with its essential cofactor Ensconsin, and microtubule organization at the cell cortex by the spectraplakin Shot, minus-end binding protein Patronin and Ninein, a protein implicated in microtubule minus end anchoring. The authors demonstrate that the loss of Ensconsin affects the cortical accumulation non-centrosomal microtubule organizing center (ncMTOC) proteins, microtubule length and vesicle motility in the oocyte, and show that this phenotype can be rescued by constitutively active kinesin-1 mutant, but not by Ensconsin mutants deficient in microtubule or kinesin binding. The functional connection between Ensconsin, kinesin-1 and ncMTOCs is further supported by a rescue experiment with Shot overexpression. Genetics and imaging experiments further implicate Ninein in the same pathway. These data are a clear strength of the paper; they represent a very interesting and useful addition to the field.

The weaknesses of the study are two-fold. First, the paper seems to lack a clear molecular model, uniting the observed phenomenology with the molecular functions of the studied proteins. Most importantly, it is not clear how kinesin-based plus-end directed transport contributes to cortical localization of ncMTOCs and regulation of microtubule length.

Second, not all conclusions and interpretations in the paper are supported by the presented data.

We thank the reviewer for recognizing the impact of this work. In response to the insightful suggestions, we performed extensive new experiments that establish a well-supported cellular and molecular model (Figure 7). The discussion has been restructured to directly link each conclusion to its corresponding experimental evidence, significantly strengthening the manuscript.

Below is a list of specific comments, outlining the concerns, in the order of appearance in the paper/figures.

Figure 1. The statement: "Ens loading on MTs in NCs and their subsequent transport by Dynein toward ring canals promotes the spatial enrichment of the Khc activator Ens in the oocyte" is not supported by data. The authors do not demonstrate that Ens is actually transported from the nurse cells to the oocyte while being attached to microtubules. They do show that the intensity of Ensconsin correlates with the intensity of microtubules, that the distribution of Ensconsin depends on its affinity to microtubules and that an Ensconsin pool locally photoactivated in a nurse cell can redistribute to the oocyte (and throughout the nurse cell) by what seems to be diffusion. The provided images suggest that Ensconsin passively diffuses into the oocyte and accumulates there because of higher microtubule density, which depends on dynein. To prove that Ensconsin is indeed transported by dynein in the microtubule-bound form, one would need to measure the residence time of Ensconsin on microtubules and demonstrate that it is longer than the time needed to transport microtubules by dynein into the oocyte; ideally, one would like to see movement of individual microtubules labelled with photoconverted Ensconsin from a nurse cell into the oocyte. Since microtubules are not enriched in the oocyte of the dynein mutant, analysis of Ensconsin intensity in this mutant is not informative and does not reveal the mechanism of Ensconsin accumulation.

As noted by Reviewer 3, the directional movement of microtubules traveling at ~140 nm/s from nurse cells toward the oocyte through Ring Canals was previously reported using a tagged Ens-MT binding domain reporter line by Lu et al. (2022). We have therefore added the citation of this crucial work in the novel version of the manuscript (lane 155-157) and removed the photo-conversion panel.

Critically, however, our study provides mechanistic insight that was missing from this earlier work: this mechanism is also crucial to enrich MAPs in the oocyte. The fact that Dynein mutants fail to enrich Ensconsin is a crucial piece of evidence: it supports a model of Ensconsin-loaded MT transport (Figure 1D-1F).

Figure 2. According to the abstract, this figure shows that Ensconsin is "maintained at the oocyte cortex by Ninein". However, the figure doesn't seem to prove it - it shows that oocyte enrichment of Ensonsin is partially dependent on Ninein, but this applies to the whole cell and not just to the cell cortex. Furthermore, it is not clear whether Ninein mutation affects microtubule density, which in turn would affect Ensconsin enrichment, and therefore, it is not clear whether the effect of Ninein loss on Ensconsin distribution is direct or indirect.

Ninein plays a critical role in Ensconsin enrichment and microtubule organization in the oocyte (new Figure 2, Figure 3, Figure S3). Quantification of total Tubulin signal shows no difference between control and Nin mutant oocytes (new Figure S3 panels A, B). We found decreased Ens enrichment in the oocyte, and Ens localization on MTs and to the cell cortex (Figure 2E, 2F, and Figure S3C and S3D).

Novel quantitative analyses of microtubule orientation at the anterior cortex, where MTs are normally preferentially oriented toward the posterior pole (Parton et al. 2011), demonstrate that Nin mutants exhibit randomized MT orientation compared to wild-type oocytes (new Figure 3C-3E).These findings establish that Ninein (although not essential) favors Ensconsin localization on MTs, Ens enrichment in the oocyte, ncMTOC cortical localization, and more robust MT orientation toward the posterior cortex. It also suggests that Ens levels in the oocyte acts as a rheostat to control Khc activation.

The observation that the aggregates formed by overexpressed Ninein accumulate other proteins, including Ensconsin, supports, though does not prove their interactions. Furthermore, there is absolutely no proof that Ninein aggregates are "ncMTOCs". Unless the authors demonstrate that these aggregates nucleate or anchor microtubules (for example, by detailed imaging of microtubules and EB1 comets), the text and labels in the figure would need to be altered.

We have modified the manuscript, we now refer to an accumulation of these components in large puncta, rather than aggregates, consistent with previous observations (Rosen et al., 2000). We acknowledge in the revised version that these puncta recruit Shot, Patronin and Ens without mentioning direct interaction (lane 218).

Importantly, we conducted a more detailed characterization of these Ninein/Shot/Patronin/Ens-containing puncta in a novel Figure S4. To rigorously assess their nucleation capacity, we analyzed Eb1-GFP-labeled MT comets, a robust readout of MT nucleation (Parton et al., 2011, Nashchekin et al., 2016). While few Eb1-positive comets occasionally emanate from these structures, confirming their identity as putative ncMTOCs, these puncta function as surprisingly weak nucleation centers (new Figure S4 E, Video S1) and, their presence does not alter overall MT architecture (new Figure S4 F). Moreover, these puncta disappear over time, are barely visible at stage 10B, they do not impair oocyte development or fertility (Figure S4 G and Table 1).

Minor comment: Note that a "ratio" (Figure 2C) is just a ratio, and should not be expressed in arbitrary units.

We have amended this point in all the figures.

Figure 3B: immunoprecipitation results cannot be interpreted because the immunoprecipitated proteins (GFP, Ens-GFP, Shot-YFP) are not shown. It is also not clear that this biochemical experiment is useful. If the authors would like to suggest that Ensconsin directly binds to Patronin, the interaction would need to be properly mapped at the protein domain level.

This is a good point: the GFP and Ens-GFP immunoprecipitated proteins are now much clearly identified on the blots and in the figure legend (new Figure 4G). Shot-YFP IP, was used as a positive control but is difficult to be detected by Western blot due to its large size (>106 Da) using conventional acrylamide gels (Nashchekin et al., 2016).

We now explicitly state that immunoprecipitations were performed at 4°C, where microtubules are fully depolymerized, thereby excluding undirect microtubule-mediated interactions. We agree with this reviewer: we cannot formally rule out interactions through bridging by other protein components. This is stated in the revised manuscript (lane 238-239).

One of the major phenotypes observed by the authors in Ens mutant is the loss of long microtubules. The authors make strong conclusions about the independence of this phenotype from the parameters of microtubule plus-end growth, but in fact, the quality of their data does not allow to make such a conclusion, because they only measured the number of EB1 comets and their growth rate but not the catastrophe, rescue or pausing frequency."Note that kinesin-1 has been implicated in promoting microtubule damage and rescue (doi: 10.1016/j.devcel.2021).In the absence of such measurements, one cannot conclude whether short microtubules arise through defects in the minus-end, plus-end or microtubule shaft regulation pathways.

We thank the reviewer for raising this important point. Our data demonstrate that microtubule (MT) nucleation and polymerization rates remain unaffected under Khc RNAi and ens mutant conditions, indicating that MT dynamics alterations must arise through alternative mechanisms.

As the reviewer suggested, recent studies on Kinesin activity and MT network regulation are indeed highly relevant. Two key studies from the Verhey and Aumeier laboratories examined Kinesin-1 gain-of-function conditions and revealed that constitutively active Kinesin-1 induces MT lattice damage (Budaitis et al., 2022). While damaged MTs can undergo self-repair, Aumeier and colleagues demonstrated that GTP-tubulin incorporation generates "rescue shafts" that promote MT rescue events (Andreu-Carbo et al., 2022). Extrapolating from these findings, loss of Kinesin-1 activity could plausibly reduce rescue shaft formation, thereby decreasing MT rescue frequency and stability. Although this hypothesis is challenging to test directly in our system, it provides a mechanistic framework for the observed reduction in MT number and stability.

Additionally, the reviewer highlighted the role of Khc in transporting the dynactin complex, an anti-catastrophe factor, to MT plus ends (Nieuwburg et al., 2017), which could further contribute to MT stabilization. This crucial reference is now incorporated into the revised Discussion.

Importantly, our work also demonstrates the contribution of Ens/Khc to ncMTOC targeting to the cell cortex. Our new quantitative analyses of MT organization (new Figure 5 B) reveal a defective anteroposterior orientation of cortical MTs in mutant conditions, pointing to a critical role for cortical ncMTOCs in organizing the MT network.

Taken together, we propose that the observed MT reduction and disorganization result from multiple interconnected mechanisms: (1) reduced rescue shaft formation affecting MT stability; (2) impaired transport of anti-catastrophe factors to MT plus ends; and (3) loss of cortical ncMTOCs, which are essential for minus-end MT stabilization and network organization. The Discussion has been revised to reflect this integrated model in a dedicated paragraph (“A possible regulation of MT dynamics in the oocyte at both plus end minus MT ends by Ens and Khc” lane 415-432).

It is important to note in that a spectraplakin, like Shot, can potentially affect different pathways, particularly when overexpressed.

We agree that Shot harbors multiple functional domains and acts as a key organizer of both actin and microtubule cytoskeletons. Overexpression of such a cytoskeletal cross-linker could indeed perturb both networks, making interpretation of Ens phenotype rescue challenging due to potential indirect effects.

To address this concern, we selected an appropriate Shot isoform for our rescue experiments that displayed similar localization to “endogenous” Shot-YFP (a genomic construct harboring shot regulatory sequences) and importantly that was not overexpressed.

Elevated expression of the Shot.L(A) isoform (see Western Blot Figure S8 A), considered as the wild-type form with two CH1 and CH2 actin-binding motifs (Lee and Kolodziej, 2002), showed abnormal localization such as strong binding to the microtubules in nurse cells and oocyte confirming the risk of gain-of-function artifacts and inappropriate conclusions (Figure S8 B, arrows).

By contrast, our rescue experiments using the Shot.L(C) isoform (that only harbors the CH2 motif) provide strong evidence against such artifacts for three reasons. First, Shot-L(C) is expressed at slightly lower levels than a Shot-YFP genomic construct (not overexpressed), and at much lower levels than Shot-L(A), despite using the same driver (Figure S8 A). Second, Shot-L(C) localization in the oocyte is similar to that of endogenous Shot-YFP, concentrating at the cell cortex (Figure S8 B, compare lower and top panels). Taken together, these controls rather suggest our rescue with the Shot-L(C) is specific.

Note that this Shot-L(C) isoform is sufficient to complement the absence of the shot gene in other cell contexts (Lee and Kolodziej, 2002).

Unjustified conclusions should be removed: the authors do not provide sufficient data to conclude that "ens and Khc oocytes MT organizational defects are caused by decreased ncMTOC cortical anchoring", because the actual cortical microtubule anchoring was not measured.

This is a valid point. We acknowledge that we did not directly measure microtubule anchoring in this study. In response, we have revised the discussion to more accurately reflect our observations. Throughout the manuscript, we now refer to "cortical microtubule organization" rather than "cortical microtubule anchoring," which better aligns with the data presented.

Minor comment: Microtubule growth velocity must be expressed in units of length per time, to enable evaluating the quality of the data, and not as a normalized value.

This is now amended in the revised version (modified Figure S7).

A significant part of the Discussion is dedicated to the potential role of Ensconsin in cortical microtubule anchoring and potential transport of ncMTOCs by kinesin. It is obviously fine that the authors discuss different theories, but it would be very helpful if the authors would first state what has been directly measured and established by their data, and what are the putative, currently speculative explanations of these data.

We have carefully considered the reviewer's constructive comments and are confident that this revised version fully addresses their concerns.

First, we have substantially strengthened the connection between the Results and Discussion sections, ensuring that our interpretations are more directly anchored in the experimental data. This restructuring significantly improves the overall clarity and logical flow of the manuscript.

Second, we have added a new comprehensive figure presenting a molecular-scale model of Kinesin-1 activation upon release of autoinhibition by Ensconsin (new Figure 7D). Critically, this figure also illustrates our proposed positive feedback loop mechanism: Khc-dependent cytoplasmic advection promotes cortical recruitment of additional ncMTOCs, which generates new cortical microtubules and further accelerates cytoplasmic transport (Figure 7 A-C). This self-amplifying cycle provides a mechanistic framework consistent with emerging evidence that cytoplasmic flows are essential for efficient intracellular transport in both insect and mammalian oocytes.

Minor comment: The writing and particularly the grammar need to be significantly improved throughout, which should be very easy with current language tools. Examples: "ncMTOCs recruitment" should be "ncMTOC recruitment"; "Vesicles speed" should be "Vesicle speed", "Nin oocytes harbored a WT growth,"- unclear what this means, etc. Many paragraphs are very long and difficult to read. Making shorter paragraphs would make the authors' line of thought more accessible to the reader.

We have amended and shortened the manuscript according to this reviewer feed-back. We have specifically built more focused paragraphs to facilitates the reading.

Significance

This paper represents significant advance in understanding non-centrosomal microtubule organization in general and in developing Drosophila oocytes in particular by connecting the microtubule minus-end regulation pathway to the Kinesin-1 and Ensconsin/MAP7-dependent transport. The genetics and imaging data are of good quality, are appropriately presented and quantified. These are clear strengths of the study which will make it interesting to researchers studying the cytoskeleton, microtubule-associated proteins and motors, and fly development.

The weaknesses of this study are due to the lack of clarity of the overall molecular model, which would limit the impact of the study on the field. Some interpretations are not sufficiently supported by data, but this can be solved by more precise and careful writing, without extensive additional experimentation.

We thank the reviewer for raising these important concerns regarding clarity and data interpretation. We have thoroughly revised the manuscript to address these issues on multiple fronts. First, we have substantially rewritten key sections to ensure that our conclusions are clearly articulated and directly supported by the data. Second, we have performed several new experiments that now allow us to propose a robust mechanistic model, presented in new figures. These additions significantly strengthen the manuscript and directly address the reviewer's concerns.

My expertise is cell biology and biochemistry of the microtubule cytoskeleton, including both microtubule-associated proteins and microtubule motors.

Reviewer #2

Evidence, reproducibility and clarity

In this manuscript, Berisha et al. investigate how microtubule (MT) organization is spatially regulated during Drosophila oogenesis. The authors identify a mechanism in which the Kinesin-1 activator Ensconsin/MAP7 is transported by dynein and anchored at the oocyte cortex via Ninein, enabling localized activation of Kinesin-1. Disruption of this pathway impairs ncMTOC recruitment and MT anchoring at the cortex. The authors combine genetic manipulation with high-resolution microscopy and use three key readouts to assess MT organization during mid-to-late oogenesis: cortical MT formation, localization of posterior determinants, and ooplasmic streaming. Notably, Kinesin-1, in concert with its activator Ens/MAP7, contributes to organizing the microtubule network it travels along. Overall, the study presents interesting findings, though we have several concerns we would like the authors to address. Ensconsin enrichment in the oocyte 1. Enrichment in the oocyte • Ensconsin is a MAP that binds MTs. Given that microtubule density in the oocyte significantly exceeds that in the nurse cells, its enrichment may passively reflect this difference. To assess whether the enrichment is specific, could the authors express a non-Drosophila MAP (e.g., mammalian MAP1B) to determine whether it also preferentially localizes to the oocyte?

To address this point, we performed a new series of experiments analyzing the enrichment of other Drosophila and non-Drosophila MAPs, including Jupiter-GFP, Eb1-GFP, and bovine Tau-GFP, all widely used markers of the microtubule cytoskeleton in flies (see new Figure S2). Our results reveal that Jupiter-GFP, Eb1-GFP, and bovine Tau-GFP all exhibit significantly weaker enrichment in the oocyte compared to Ens-GFP. Khc-GFP also shows lower enrichment. These findings indicate that MAP enrichment in the oocyte is MAP-dependent, rather than solely reflecting microtubule density or organization. Of note, we cannot exclude that microtubule post-translational modifications contribute to differential MAP binding between nurse cells and the oocyte, but this remains a question for future investigation.

The ability of ens-wt and ens-LowMT to induce tubulin polymerization according to the light scattering data (Fig. S1J) is minimal and does not reflect dramatic differences in localization. The authors should verify that, in all cases, the polymerization product in their in vitro assays is microtubules rather than other light-scattering aggregates. What is the control in these experiments? If it is just purified tubulin, it should not form polymers at physiological concentrations.

The critical concentration Cr for microtubule self-assembly in classical BRB80 buffer found by us and others is around 20 µM (see Fig. 2c in Weiss et al., 2010). Here, microtubules were assembled at 40 µM tubulin concentration, i.e., largely above the Cr. As stated in the materials and methods section, we systematically induced cooling at 4°C after assembly to assess the presence of aggregates, since those do not fall apart upon cooling. The decrease in optical density upon cooling is a direct control that the initial increase in DO is due to the formation of microtubules. Finally, aggregation and polymerization curves are widely different, the former displaying an exponential shape and the latter a sigmoid assembly phase (see Fig. 3A and 3B in Weiss et al., 2010).

Photoconversion caveatsMAPs are known to dynamically associate and dissociate from microtubules. Therefore, interpretation of the Ens photoconversion data should be made with caution. The expanding red signal from the nurse cells to the oocyte may reflect a any combination of dynein-mediated MT transport and passive diffusion of unbound Ensconsin. Notably, photoconversion of a soluble protein in the nurse cells would also result in a gradual increase in red signal in the oocyte, independent of active transport. We encourage the authors to more thoroughly discuss these caveats. It may also help to present the green and red channels side by side rather than as merged images, to allow readers to assess signal movement and spatial patterns better.

This is a valid point that mirrors the comment of Reviewers 1 and 3. The directional movement of microtubules traveling at ~140 nm/s from nurse cells toward the oocyte via the ring canals was previously reported by Lu et al. (2022) with excellent spatial resolution. Notably, this MT transport was measured using a fusion protein containing the Ens MT-binding domain. We now cite this relevant study in our revised manuscript and have removed this redundant panel in Figure 1.

Reduction of Shot at the anterior cortex• Shot is known to bind strongly to F-actin, and in the Drosophila ovary, its localization typically correlates more closely with F-actin structures than with microtubules, despite being an MT-actin crosslinker. Therefore, the observed reduction of cortical Shot in ens, nin mutants, and Khc-RNAi oocytes is unexpected. It would be important to determine whether cortical F-actin is also disrupted in these conditions, which should be straightforward to assess via phalloidin staining.

As requested by the reviewer, we performed actin staining experiments, which are now presented in a new Figure S5. These data demonstrate that the cortical actin network remains intact in all mutant backgrounds analyzed, ruling out any indirect effect of actin cytoskeleton disruption on the observed phenotypes.

MTs are barely visible in Fig. 3A, which is meant to demonstrate Ens-GFP colocalization with tubulin. Higher-quality images are needed.

The revised version now provides significantly improved images to show the different components examined. Our data show that Ens and Ninein localize at the cell cortex where they co-localize with Shot and Patronin (Figure 2 A-C). In addition, novel images show that Ens extends along microtubules (new Figure 4 A).

MT gradient in stage 9 oocytesIn ens-/-, nin-/-, and Khc-RNAi oocytes, is there any global defect in the stage 9 microtubule gradient? This information would help clarify the extent to which cortical localization defects reflect broader disruptions in microtubule polarity.

We now provide quantitative analysis of microtubule (MT) array organization in novel figures (Figure 3D and Figure 5B). Our data reveal that both Khc RNAi and ens mutant oocytes exhibit severe disruption of MT orientation toward the posterior (new Figure 5B). Importantly, this defect is significantly less pronounced in Nin-/- oocytes, which retain residual ncMTOCs at the cortex (new Figure 3D). This differential phenotype supports our model that cortical ncMTOCs are critical for maintaining proper MT orientation toward the posterior side of the oocyte.

Role of Ninein in cortical anchoringThe requirement for Ninein in cortical anchorage is the least convincing aspect of the manuscript and somewhat disrupts the narrative flow. First, it is unclear whether Ninein exhibits the same oocyte-enriched localization pattern as Ensconsin. Is Ninein detectable in nurse cells? Second, the Ninein antibody signal appears concentrated in a small area of the anterior-lateral oocyte cortex (Fig. 2A), yet Ninein loss leads to reduced Shot signal along a much larger portion of the anterior cortex (Fig. 2F)-a spatial mismatch that weakens the proposed functional relationship. Third, Ninein overexpression results in cortical aggregates that co-localize with Shot, Patronin, and Ensconsin. Are these aggregates functional ncMTOCs? Do microtubules emanate from these foci?

We now provide a more comprehensive analysis of Ninein localization. Similar to Ensconsin (Ens), endogenous Ninein is enriched in the oocyte during the early stages of oocyte development but is also detected in NCs (see modified Figure 2 A and Lasko et al., 2016). Improved imaging of Ninein further shows that the protein partially co-localizes with Ens, and ncMTOCs at the anterior cortex and with Ens-bound MTs (Figure 2B, 2C).

Importantly, loss of Ninein (Nin) only partially reduces the enrichment of Ens in the oocyte (Figure 2E). Both Ens and Kinesin heavy chain (Khc) remain partially functional and continue to target non-centrosomal microtubule-organizing centers (ncMTOCs) to the cortex (Figure 3A). In Nin-/- mutants, a subset of long cortical microtubules (MTs) is present, thereby generating cytoplasmic streaming, although less efficiently than under wild-type (WT) conditions (Figure 3F and 3G). As a non-essential gene, we envisage Ninein as a facilitator of MT organization during oocyte development.

Finally, our new analyses demonstrate that large puncta containing Ninein, Shot, Patronin, and despite their size, appear to be relatively weak nucleation centers (revised Figure S4 E and Video 1). In addition, their presence does not bias overall MT architecture (Figure S4 F) nor impair oocyte development and fertility (Figure S4 G and Table 1).

Inconsistency of Khc^MutEns rescueThe Khc^MutEns variant partially rescues cortical MT formation and restores a slow but measurable cytoplasmic flow yet it fails to rescue Staufen localization (Fig. 5). This raises questions about the consistency and completeness of the rescue. Could the authors clarify this discrepancy or propose a mechanistic rationale?

This is a good point. The cytoplasmic flows (the consequence of cargo transport by Khc on MTs) generated by a constitutively active KhcMutEns in an ens mutant condition, are less efficient than those driven by Khc activated by Ens in a control condition (Figure 6C). The rescued flow is probably not efficient enough to completely rescue the Staufen localization at stage 10.

Additionally, this KhcMutEns variant rescues the viability of embryos from Khc27 mutant germline clones oocytes but not from ens mutants (Table1). One hypothesis is that Ens harbors additional functions beyond Khc activation.

This incomplete rescue of Ens by an active Khc variant could also be the consequence of the “paradox of co-dependence”: Kinesin-1 also transport the antagonizing motor Dynein that promotes cargo transport in opposite directions (Hancock et al., 2016). The phenotype of a gain of function variant is therefore complex to interpret. Consistent with this, both KhcMutEns-GFP and KhcDhinge2 two active Khc only rescues partially centrosome transport in ens mutant Neural Stem Cells (Figure S10).

Minor points: 1. The pUbi-attB-Khc-GFP vector was used to generate the Khc^MutEns transgenic line, presumably under control of the ubiquitous ubi promoter. Could the authors specify which attP landing site was used? Additionally, are the transgenic flies viable and fertile, given that Kinesin-1 is hyperactive in this construct?

All transgenic constructs were integrated at defined genomic landing sites to ensure controlled expression levels. Specifically, both GFP-tagged KhcWT and KhcMutEns were inserted at the VK05 (attP9A) site using PhiC31-mediated integration. Full details of the landing sites are provided in the Materials and Methods section. Both transgenic flies are homozygous lethal and the transgenes are maintained over TM6B balancers.

On page 11 (Discussion, section titled "A dual Ensconsin oocyte enrichment mechanism achieves spatial relief of Khc inhibition"), the statement "many mutations in Kif5A are causal of human diseases" would benefit from a brief clarification. Since not all readers may be familiar with kinesin gene nomenclature, please indicate that KIF5A is one of the three human homologs of Kinesin heavy chain.

We clarified this point in the revised version (lane 465-466).

On page 16 (Materials and Methods, "Immunofluorescence in fly ovaries"), the sentence "Ovaries were mounted on a slide with ProlonGold medium with DAPI (Invitrogen)" should be corrected to "ProLong Gold."

This is corrected.

Significance

This study shows that enrichment of MAP7/ensconsin in the oocyte is the mechanism of kinesin-1 activation there and is important for cytoplasmic streaming and localization non-centrosomal microtubule-organizing centers to the oocyte cortex

We thank the reviewers for the accurate review of our manuscript and their positive feed-back.

Reviewer #3

Evidence, reproducibility and clarity

The manuscript of Berisha et al., investigates the role of Ensconsin (Ens), Kinesin-1 and Ninein in organisation of microtubules (MT) in Drosophila oocyte. At stage 9 oocytes Kinesin-1 transports oskar mRNA, a posterior determinant, along MT that are organised by ncMTOCs. At stage 10b, Kinesin-1 induces cytoplasmic advection to mix the contents of the oocyte. Ensconsin/Map7 is a MT associated protein (MAP) that uses its MT-binding domain (MBD) and kinesin binding domain (KBD) to recruit Kinesin-1 to the microtubules and to stimulate the motility of MT-bound Kinesin-1. Using various new Ens transgenes, the authors demonstrate the requirement of Ens MBD and Ninein in Ens localisation to the oocyte where Ens activates Kinesin-1 using its KBD. The authors also claim that Ens, Kinesin-1 and Ninein are required for the accumulation of ncMTOCs at the oocyte cortex and argue that the detachment of the ncMTOCs from the cortex accounts for the reduced localisation of oskar mRNA at stage 9 and the lack of cytoplasmic streaming at stage 10b. Although the manuscript contains several interesting observations, the authors' conclusions are not sufficiently supported by their data. The structure function analysis of Ensconsin (Ens) is potentially publishable, but the conclusions on ncMTOC anchoring and cytoplasmic streaming not convincing.

We are grateful that the regulation of Khc activity by MAP7 was well received by all reviewers. While our study focuses on Drosophila oogenesis, we believe this mechanism may have broader implications for understanding kinesin regulation across biological systems.

For the novel function of the MAP7/Khc complex in organizing its own microtubule networks through ncMTOC recruitment, we have carefully considered the reviewers' constructive recommendations. We now provide additional experimental evidence supporting a model of flux self-amplification in which ncMTOC recruitment plays a key role. It is well established that cytoplasmic flows are essential for posterior localization of cell fate determinants at stage 10B. Slow flows have also been described at earlier oogenesis stages by the groups of Saxton and St Johnston. Building on these early publications and our new experiments, we propose that these flows are essential to promote a positive feedback loop that reinforces ncMTOC recruitment and MT organization (Figure 7).

1) The main conclusion of the manuscript is that "MT advection failure in Khc and ens in late oogenesis stems from defective cortical ncMTOCs recruitment". This completely overlooks the abundant evidence that Kinesin-1 directly drives cytoplasmic streaming by transporting vesicles and microtubules along microtubules, which then move the cytoplasm by advection (Palacios et al., 2002; Serbus et al, 2005; Lu et al, 2016). Since Kinesin-1 generates the flows, one cannot conclude that the effect of khc and ens mutants on cortical ncMTOC positioning has any direct effect on these flows, which do not occur in these mutants.

We regret the lack of clarity of the first version of the manuscript and some missing references. We propose a model in which the Kinesin-1- dependent slow flows (described by Serbus/Saxton and Palacios/StJohnston) play a central role in amplifying ncMTOC anchoring and cortical MT network formation (see model in the new Figure 7).

2) The authors claim that streaming phenotypes of ens and khs mutants are due to a decrease in microtubule length caused by the defective localisation of ncMTOCs. In addition to the problem raised above, However, I am not convinced that they can make accurate measurements of microtubule length from confocal images like those shown in Figure 4. Firstly, they are measuring the length of bundles of microtubules and cannot resolve individual microtubules. This problem is compounded by the fact that the microtubules do not align into parallel bundles in the mutants. This will make the "microtubules" appear shorter in the mutants. In addition, the alignment of the microtubules in wild-type allows one to choose images in which the microtubule lie in the imaging plane, whereas the more disorganized arrangement of the microtubules in the mutants means that most microtubules will cross the imaging plane, which precludes accurate measurements of their length.

As mentioned by Reviewer 4, we have been transparent with the methodology, and the limitations that were fully described in the material and methods section.

Cortical microtubules in oocytes are highly dynamic and move rapidly, making it technically impossible to capture their entire length using standard Z-stack acquisitions. We therefore adopted a compromise approach: measuring microtubules within a single focal plane positioned just below the oocyte cortex. This strategy is consistent with established methods in the field, such as those used by Parton et al. (2011) to track microtubule plus-end directionality. To avoid overinterpretation, we explicitly refer to these measurements as "minimum detectable MT length," acknowledging that microtubules may extend beyond the focal plane, particularly at stage 10, where long, tortuous bundles frequently exit the plane of focus. These methodological considerations and potential biases are clearly described in the Materials and Methods section and the text now mentions the possible disorganization of the MT network in the mutant conditions (lane 272-273).

In this revised version, we now provide complementary analyses of MT network organization.Beyond length measurements (and the mentioned limitations), we also quantified microtubule network orientation at stage 9, assessing whether cortical microtubules are preferentially oriented toward the posterior axis as observed in controls (revised Figure 3D and Figure 5B). While this analysis is also subject to the same technical limitations, it reveals a clear biological difference: microtubules exhibit posterior-biased orientation in control oocytes similar to a previous study (Parton et al., 2011) but adopt a randomized orientation in Nin-/-, ens, and Khc RNAi-depleted oocytes (revised Figure 3D and Figure 5B).

Taken together, these complementary approaches, despite their technical constraints, provide convergent evidence for the role of the Khc/Ens complex in organizing cortical microtubule networks during oogenesis.

3) "To investigate whether the presence of these short microtubules in ens and Khc RNAi oocytes is due to defects in microtubule anchoring or is also associated with a decrease in microtubule polymerization at their plus ends, we quantified the velocity and number of EB1comets, which label growing microtubule plus ends (Figure S3)." I do not understand how the anchoring or not of microtubule minus ends to the cortex determines how far their plus ends grow, and these measurements fall short of showing that plus end growth is unaffected. It has already been shown that the Kinesin-1-dependent transport of Dynactin to growing microtubule plus ends increases the length of microtubules in the oocyte because Dynactin acts as an anti-catastrophe factor at the plus ends. Thus, khc mutants should have shorter microtubules independently of any effects on ncMTOC anchoring. The measurements of EB1 comet speed and frequency in FigS2 will not detect this change and are not relevant for their claims about microtubule length. Furthermore, the authors measured EB1 comets at stage 9 (where they did not observe short MT) rather than at stage 10b. The authors' argument would be better supported if they performed the measurements at stage 10b.

We thank the reviewer for raising this important point. The short microtubule (MT) length observed at stage 10B could indeed result from limited plus-end growth. Unfortunately, we were unable to test this hypothesis directly: strong endogenous yolk autofluorescence at this stage prevented reliable detection of Eb1-GFP comets, precluding velocity measurements.

At least during stage 9, our data demonstrate that MT nucleation and polymerization rates are not reduced in both KhcRNAi and ens mutant conditions, indicating that the observed MT alterations must arise through alternative mechanisms.

In the discussion, we propose the following interconnected explanations, supported by recent literature and the reviewers’ suggestions:

1- Reduced MT rescue events. Two seminal studies from the Verhey and Aumeier laboratories have shown that constitutively active Kinesin-1 induces MT lattice damage (Budaitis et al., 2022), which can be repaired through GTP-tubulin incorporation into "rescue shafts" that promote MT rescue (Andreu-Carbo et al., 2022). Extrapolating from these findings, loss of Kinesin-1 activity could plausibly reduce rescue shaft formation, thereby decreasing MT stability. While challenging to test directly in our system, this mechanism provides a plausible framework for the observed phenotype.

2- Impaired transport of stabilizing factors. As that reviewer astutely points out, Khc transports the dynactin complex, an anti-catastrophe factor, to MT plus ends (Nieuwburg et al., 2017). Loss of this transport could further compromise MT plus end stability. We now discuss this important mechanism in the revised manuscript.

3- Loss of cortical ncMTOCs. Critically, our new quantitative analyses (revised Figure 3 and Figure 5) also reveal defective anteroposterior orientation of cortical MTs in mutant conditions. These experiments suggest that Ens/Khc-mediated localization of ncMTOCs to the cortex is essential for proper MT network organization, and possibly minus-end stabilization as suggested in several studies (Feng et al., 2019, Goodwin and Vale, 2011, Nashchekin et al., 2016).

Altogether, we now propose an integrated model in which MT reduction and disorganization may result from multiple complementary mechanisms operating downstream of Kinesin-1/Ensconsin loss. While some aspects remain difficult to test directly in our in vivo system, the convergence of our data with recent mechanistic studies provides an interesting conceptual framework. The Discussion has been revised to reflect this comprehensive view in a dedicated paragraph (“A possible regulation of MT dynamics in the oocyte at both plus end minus MT ends by Ens and Khc” lane 415-432).

4) The Shot overexpression experiments presented in Fig.3 E-F, Fig.4D and TableS1 are very confusing. Originally , the authors used Shot-GFP overexpression at stage 9 to show that there is a decrease of ncMTOCs at the cortex in ens mutants (Fig.3 E-F) and speculated that this caused the defects in MT length and cytoplasmic advection at stage 10B. However the authors later state on page 8 that : "Shot overexpression (Shot OE) was sufficient to rescue the presence of long cortical MTs and ooplasmic advection in most ens oocytes (9/14), resembling the patterns observed in controls (Figures 4B right panel and 4D). Moreover, while ens females were fully sterile, overexpression of Shot was sufficient to restore that loss of fertility (Table S1)". Is this the same UAS Shot-GFP and VP16 Gal4 used in both experiments? If so, this contradictions puts the authors conclusions in question.

This is an important point that requires clarification regarding our experimental design.

The Shot-YFP construct is a genomic insertion on chromosome 3. The ens mutation is also located on chromosome 3 and we were unable to recombine this transgene with the ens mutant for live quantification of cortical Shot. To circumvent this technical limitation, we used a UAS-Shot.L(C)-GFP transgenic construct driven by a maternal driver, expressed in both wild-type (control) and ens mutant oocytes. We validated that the expression level and subcellular localization of UAS-Shot.L(C)-GFP were comparable to those of the genomic Shot-YFP (new Figure S8 A and B).

From these experiments, we drew two key conclusions. First, cortical Shot.L(C)-GFP is less abundant in ens mutant oocytes compared to wild-type (the quantification has been removed from this version). Second, despite this reduced cortical accumulation, Shot.L(C)-GFP expression partially rescues ooplasmic flows and microtubule streaming in stage 10B ens mutant oocytes, and restores fertility to ens mutant females.

5) The authors based they conclusions about the involvement of Ens, Kinesin-1 and Ninein in ncMTOC anchoring on the decrease in cortical fluorescence intensity of Shot-YFP and Patronin-YFP in the corresponding mutant backgrounds. However, there is a large variation in average Shot-YFP intensity between control oocytes in different experiments. In Fig. 2F-G the average level of Shot-YFP in the control sis 130 AU while in Fig.3 G-H it is only 55 AU. This makes me worry about reliability of such measurements and the conclusions drawn from them.

To clarify this point, we have harmonized the method used to quantify the Shot-YFP signals in Figure 4E with the methodology used in Figure 3B, based on the original images. The levels are not strictly identical (Control Figure 2 B: 132.7+/-36.2 versus Control Figure 4 E: 164.0+/- 37.7). These differences are usual when experiments are performed at several-month intervals and by different users.

6) The decrease in the intensity of Shot-YFP and Patronin-YFP cortical fluorescence in ens mutant oocytes could be because of problems with ncMTOC anchoring or with ncMTOCs formation. The authors should find a way to distinguish between these two possibilities. The authors could express Ens-Mut (described in Sung et al 2008), which localises at the oocyte posterior and test whether it recruits Shot/Patronin ncMTOCs to the posterior.

We tried to obtain the fly stocks described in the 2008 paper by contacting former members of Pernille Rørth's laboratory. Unfortunately, we learned that the lab no longer exists and that all reagents, including the requested stocks, were either discarded or lost over time. To our knowledge, these materials are no longer available from any source. We regret that this limitation prevented us from performing the straightforward experiments suggested by the reviewer using these specific tools.

7) According to the Materials and Methods, the Shot-GFP used in Fig.3 E-F and Fig.4 was the BDSC line 29042. This is Shot L(C), a full-length version of Shot missing the CH1 actin-binding domain that is crucial for Shot anchoring to the cortex. If the authors indeed used this version of Shot-GFP, the interpretation of the above experiments is very difficult.

The Shot.L(C) isoform lacks the CH1 domain but retains the CH2 actin-binding motif. Truncated proteins with this domain and fused to GST retains a weak ability to bind actin in vitro. Importantly, the function of this isoform is context-dependent: it cannot rescue shot loss-of-function in neuron morphogenesis but fully restores Shot-dependent tracheal cell remodeling (Lee and Kolodziej, 2002).

In our experiments, when the Shot.L(C) isoform was expressed under the control of a maternal driver, its localization to the oocyte cortex was comparable to that of the genomic Shot-YFP construct (new Figure S8). This demonstrates unambiguously that the CH1 domain is dispensable for Shot cortical localization in oocytes, and that CH2-mediated actin binding is sufficient for this localization. Of note, a recent study showed that actin network are not equivalent highlighting the need for specific Shot isoforms harboring specialized actin-binding domain (Nashchekin et al., 2024).

We note that the expression level of Shot.L(C)-GFP in the oocyte appeared slightly lower than that of Shot-YFP (expressed under endogenous Shot regulatory sequences), as assessed by Western blot (Figure S8 A).

Critically, Shot.L(C)-GFP expression was substantially lower than that of Shot.L(A)-GFP (that harbored both the CH1 and CH2 domain). Shot.L(A)-GFP was overexpressed (Figure 8 A) and ectopically localized on MTs in both nurse cells and the ooplasm (Figure S8 B middle panel and arrow). These observations are in agreement that the Shot.L(C)-GFP rescue experiment was performed at near-physiological expression levels, strengthening the validity of our conclusions.

8) Page 6 "converted in NCs, in a region adjacent to the ring canals, Dendra-Ens-labeled MTs were found in the oocyte compartment indicating they are able to travel from NC toward the oocyte through ring canals". I have difficulty seeing the translocation of MT through the ring canals. Perhaps it would be more obvious with a movie/picture showing only one channel. Considering that f Dendra-Ens appears in the oocyte much faster than MT transport through ring canals (140nm/s, Lu et al 2022), the authors are most probably observing the translocation of free Ens rather than Ens bound to MT. The authors should also mention that Ens movement from the NC to the oocyte has been shown before with Ens MBD in Lu et al 2022 with better resolution.

We fully agree on the caveat mentioned by this reviewer: we may observe the translocation of free Dendra-Ensconsin. The experiment, was removed and replaced by referring to the work of the Gelfand lab. The movement of MTs that travel at ~140 nm/s between nurse cells toward the oocyte through the Ring Canals was reported before by Lu et al. (2022) with a very good resolution. Notably, this directional directed movement of MTs was measured using a fusion protein encompassing Ens MT-binding domain. We decided to remove this inclusive experiment and rather refer to this relevant study.

9) Page 6: The co-localization of Ninein with Ens and Shot at the oocyte cortex (Figure 2A). I have difficulty seeing this co-localisation. Perhaps it would be more obvious in merged images of only two channels and with higher resolution images

10) "a pool of the Ens-GFP co-localized with Ch-Patronin at cortical ncMTOCs at the anterior cortex (Figure 3A)". I also have difficulty seeing this.

We have performed new high-resolution acquisitions that provide clearer and more convincing evidence for the localization cortical distribution of these proteins (revised Figure 2A-2C and Figure 4A). These improved images demonstrate that Ens, Ninein, Shot, and Patronin partially colocalize at cortical ncMTOCs, as initially proposed. Importantly, the new data also reveal a spatial distinction: while Ens localizes along microtubules extending from these cortical sites, Ninein appears confined to small cytoplasmic puncta adjacent but also present on cortical microtubules.

11) "Ninein co-localizes with Ens at the oocyte cortex and partially along cortical microtubules, contributing to the maintenance of high Ens protein levels in the oocyte and its proper cortical targeting". I could not find any data showing the involvement of Ninein in the cortical targeting of Ens.

We found decreased Ens localization to MTs and to the cell cortex region (new Figure S3 A-B).

12) "our MT network analyses reveal the presence of numerous short MTs cytoplasmic clustered in an anterior pattern." "This low cortical recruitment of ncMTOCs is consistent with poor MT anchoring and their cytoplasmic accumulation." I could not find any data showing that short cortical MT observed at stage 10b in ens mutant and Khc RNAi were cytoplasmic and poorly anchored.

The sentence was removed from the revised manuscript.

13) "The egg chamber consists of interconnected cells where Dynein and Khc activities are spatially separated. Dynein facilitates transport from NCs to the oocyte, while Khc mediates both transport and advection within the oocyte." Dynein is involved in various activities in the oocyte. It anchors the oocyte nucleus and transports bcd and grk mRNA to mention a few.

The text was amended to reflect Dynein involvement in transport activities in the oocyte, with the appropriate references (lane 105-107).

14) The cartoons in Fig.2H and 3I exaggerate the effect of Ninein and Ens on cortical ncMTOCs. According to the corresponding graphs, there is a 20 and 50% decrease in each case.

New cartoons (now revised Figure 3E and 4F), are amended to reflect the ncMTOC values but also MT orientation (Figure 3E).

Significance

Given the important concerns raised, the significance of the findings is difficult to assess at this stage.

We sincerely thank the reviewer for their thorough evaluation of our manuscript. We have carefully addressed their concerns through substantial new experiments and analyses. We hope that the revised manuscript, in its current form, now provides the clarifications and additional evidence requested, and that our responses demonstrate the significance of our findings.

Reviewer #4 (Evidence, reproducibility and clarity (Required)):

Summary: This manuscript presents an investigation into the molecular mechanisms governing spatial activation of Kinesin-1 motor protein during Drosophila oogenesis, revealing a regulatory network that controls microtubule organization and cytoplasmic transport. The authors demonstrate that Ensconsin, a MAP7 family protein and Kinesin-1 activator, is spatially enriched in the oocyte through a dual mechanism involving Dynein-mediated transport from nurse cells and cortical maintenance by Ninein. This spatial enrichment of Ens is crucial for locally relieving Kinesin-1 auto-inhibition. The Ens/Khc complex promotes cortical recruitment of non-centrosomal microtubule organizing centers (ncMTOCs), which are essential for anchoring microtubules at the cortex, enabling the formation of long, parallel microtubule streams or "twisters" that drive cytoplasmic advection during late oogenesis. This work establishes a paradigm where motor protein activation is spatially controlled through targeted localization of regulatory cofactors, with the activated motor then participating in building its own transport infrastructure through ncMTOC recruitment and microtubule network organization.

There's a lot to like about this paper! The data are generally lovely and nicely presented. The authors also use a combination of experimental approaches, combining genetics, live and fixed imaging, and protein biochemistry.

We thank the reviewer for this enthusiastic and supportive review, which helped us further strengthen the manuscript.

Concerns: Page 6: "to assay if elevation of Ninein levels was able to mis-regulate Ens localization, we overexpressed a tagged Ninein-RFP protein in the oocyte. At stage 9 the overexpressed Ninein accumulated at the anterior cortex of the oocyte and also generated large cortical aggregates able to recruit high levels of Ens (Figures 2D and 2H)... The examination of Ninein/Ens cortical aggregates obtained after Ninein overexpression showed that these aggregates were also able to recruit high levels of Patronin and Shot (Figures 2E and 2H)." Firstly, I'm not crazy about the use of "overexpressed" here, since there isn't normally any Ninein-RFP in the oocyte. In these experiments it has been therefore expressed, not overexpressed. Secondly, I don't understand what the reader is supposed to make of these data. Expression of a protein carrying a large fluorescent tag leads to large aggregates (they don't look cortical to me) that include multiple proteins - in fact, all the proteins examined. I don't understand this to be evidence of anything in particular, except that Ninein-RFP causes the accumulation of big multi-protein aggregates. While I can understand what the authors were trying to do here, I think that these data are inconclusive and should be de-emphasized.

We have revised the manuscript by replacing overexpressed with expressed (lanes 211 and 212). In addition, we now provide new localization data in both cortical (new Figure S4 A, top) and medial focal planes (new Figure S4 A, bottom), demonstrating that Ninein puncta (the word used in Rosen et al, 2019), rather than aggregates are located cortically. We also show that live IRP-labelled MTs do not colocalize with Ninein-RFP puncta. In light of the new experiments and the comments from the other reviewers, the corresponding text has been revised and de-emphasized accordingly.

Page 7: "Co-immunoprecipitations experiments revealed that Patronin was associated with Shot-YFP, as shown previously (Nashchekin et al., 2016), but also with EnsWT-GFP, indicating that Ens, Shot and Patronin are present in the same complex (Figure 3B)." I do not agree that association between Ens-GFP and Patronin indicates that Ens is in the same complex as Shot and Patronin. It is also very possible that there are two (or more) distinct protein complexes. This conclusion could therefore be softened. Instead of "indicating" I suggest "suggesting the possibility."

We have toned down this conclusion and indicated “suggesting the possibility” (lane 238-239).

Page 7: "During stage 9, the average subcortical MT length, taken at one focal plane in live oocytes (see methods)..." I appreciate that the authors have been careful to describe how they measured MT length, as this is a major point for interpretation. I think the reader would benefit from an explanation of why they decided to measure in only one focal plane and how that decision could impact the results.

We appreciate this helpful suggestion. Cortical microtubules are indeed highly dynamic and extend in multiple directions, including along the Z-axis. Moreover, their diameter is extremely small (approximately 25 nm), making it technically challenging to accurately measure their full length with high resolution using our Zeiss Airyscan confocal microscope (over several, microns): the acquisition of Z-stacks is relatively slow and therefore not well suited to capturing the rapid dynamics of these microtubules. Consequently, our length measurements represent a compromise and most likely underestimate the actual lengths of microtubules growing outside the focal plane. We note that other groups have encountered similar technical limitations (Parton et al., 2011).

Page 7: "... the MTs exhibited an orthogonal orientation relative to the anterior cortex (Figures 4A left panels, 4C and 4E)." This phenotype might not be obvious to readers. Can it be quantified?

We have now analyzed the orientation of microtubules (MTs) along the dorso-ventral axis. Our analysis shows that ens, Khc RNAi oocytes (new Figure 5B), and, to a lesser extent, Nin mutant oocytes (new Figure 3D), display a more random MT orientation compared to wild-type (WT) oocytes. In WT oocytes, MTs are predominantly oriented toward the posterior pole, consistent with previous findings (Parton et al., 2011).

Page 8: "Altogether, the analyses of Ens and Khc defective oocytes suggested that MT organization defects during late oogenesis (stage 10B) were caused by an initial failure of ncMTOCs to reach the cell cortex. Therefore, we hypothesized that overexpression of the ncMTOC component Shot could restore certain aspects of microtubule cortical organization in ens-deficient oocytes. Indeed, Shot overexpression (Shot OE) was sufficient to rescue the presence of long cortical MTs and ooplasmic advection in most ens oocytes (9/14)..." The data are clear, but the explanation is not. Can the authors please explain why adding in more of an ncMTOC component (Shot) rescues a defect of ncMTOC cortical localization?

We propose that cytoplasmic ncMTOCs can bind the cell cortex via the Shot subunit that is so far the only component that harbors actin-binding motifs. Therefore, we propose that elevating cytoplasmic Shot increase the possibility of Shot to encounter the cortex by diffusion when flows are absent. This is now explained lane 282-285.

I'm grateful to the authors for their inclusion of helpful diagrams, as in Figures 1G and 2H. I think the manuscript might benefit from one more of these at the end, illustrating the ultimate model.

We have carefully considered and followed the reviewer’s suggestions. In response, we have included a new figure illustrating our proposed model: the recruitment of ncMTOCs to the cell cortex through low Khc-mediated flows at stage 9 enhances cortical microtubule density, which in turn promotes self-amplifying flows (new Figure 7, panels A to C). Note that this Figure also depicts activation of Khc by loss of auto-inhibition (Figure 7, panel D).

I'm sorry to say that the language could use quite a bit of polishing. There are missing and extraneous commas. There is also regular confusion between the use of plural and singular nouns. Some early instances include:

1. Page 3: thought instead of "thoughted."
2. Page 5: "A previous studies have revealed"
3. Page 5: "A significantly loss"
4. Page 6: "troughs ring canals" should be "through ring canals"
5. Page 7: lives stage 9 oocytes
6. Page 7: As ens and Khc RNAi oocytes exhibits
7. Page 7: we examined in details
8. Page 7: This average MT length was similar in Khc RNAi and ens mutant oocyte..

We apologize for errors. We made the appropriate corrections of the manuscript.

Reviewer #4 (Significance (Required)):

This work makes a nice conceptual advance by showing that motor activation controls its own transport infrastructure, a paradigm that could extend to other systems requiring spatially regulated transport.

We thank the reviewers for their evaluation of the manuscript and helpful comments.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #4

Evidence, reproducibility and clarity

Summary: This manuscript presents an investigation into the molecular mechanisms governing spatial activation of Kinesin-1 motor protein during Drosophila oogenesis, revealing a regulatory network that controls microtubule organization and cytoplasmic transport. The authors demonstrate that Ensconsin, a MAP7 family protein and Kinesin-1 activator, is spatially enriched in the oocyte through a dual mechanism involving Dynein-mediated transport from nurse cells and cortical maintenance by Ninein. This spatial enrichment of Ens is crucial for locally relieving Kinesin-1 auto-inhibition. The Ens/Khc complex promotes cortical recruitment of non-centrosomal microtubule organizing centers (ncMTOCs), which are essential for anchoring microtubules at the cortex, enabling the formation of long, parallel microtubule streams or "twisters" that drive cytoplasmic advection during late oogenesis. This work establishes a paradigm where motor protein activation is spatially controlled through targeted localization of regulatory cofactors, with the activated motor then participating in building its own transport infrastructure through ncMTOC recruitment and microtubule network organization.

There's a lot to like about this paper! The data are generally lovely and nicely presented. The authors also use a combination of experimental approaches, combining genetics, live and fixed imaging, and protein biochemistry.

Concerns:

Page 6: "to assay if elevation of Ninein levels was able to mis-regulate Ens localization, we overexpressed a tagged Ninein-RFP protein in the oocyte. At stage 9 the overexpressed Ninein accumulated at the anterior cortex of the oocyte and also generated large cortical aggregates able to recruit high levels of Ens (Figures 2D and 2H)... The examination of Ninein/Ens cortical aggregates obtained after Ninein overexpression showed that these aggregates were also able to recruit high levels of Patronin and Shot (Figures 2E and 2H)." Firstly, I'm not crazy about the use of "overexpressed" here, since there isn't normally any Ninein-RFP in the oocyte. In these experiments it has been therefore expressed, not overexpressed. Secondly, I don't understand what the reader is supposed to make of these data. Expression of a protein carrying a large fluorescent tag leads to large aggregates (they don't look cortical to me) that include multiple proteins - in fact, all the proteins examined. I don't understand this to be evidence of anything in particular, except that Ninein-RFP causes the accumulation of big multi-protein aggregates. While I can understand what the authors were trying to do here, I think that these data are inconclusive and should be de-emphasized.

Page 7: "Co-immunoprecipitations experiments revealed that Patronin was associated with Shot-YFP, as shown previously (Nashchekin et al., 2016), but also with EnsWT-GFP, indicating that Ens, Shot and Patronin are present in the same complex (Figure 3B)." I do not agree that association between Ens-GFP and Patronin indicates that Ens is in the same complex as Shot and Patronin. It is also very possible that there are two (or more) distinct protein complexes. This conclusion could therefore be softened. Instead of "indicating" I suggest "suggesting the possibility."

Page 7: "During stage 9, the average subcortical MT length, taken at one focal plane in live oocytes (see methods)..." I appreciate that the authors have been careful to describe how they measured MT length, as this is a major point for interpretation. I think the reader would benefit from an explanation of why they decided to measure in only one focal plane and how that decision could impact the results.

Page 7: "... the MTs exhibited an orthogonal orientation relative to the anterior cortex (Figures 4A left panels, 4C and 4E)." This phenotype might not be obvious to readers. Can it be quantified?

Page 8: "Altogether, the analyses of Ens and Khc defective oocytes suggested that MT organization defects during late oogenesis (stage 10B) were caused by an initial failure of ncMTOCs to reach the cell cortex. Therefore, we hypothesized that overexpression of the ncMTOC component Shot could restore certain aspects of microtubule cortical organization in ens-deficient oocytes. Indeed, Shot overexpression (Shot OE) was sufficient to rescue the presence of long cortical MTs and ooplasmic advection in most ens oocytes (9/14)..." The data are clear, but the explanation is not. Can the authors please explain why adding in more of an ncMTOC component (Shot) rescues a defect of ncMTOC cortical localization?

I'm grateful to the authors for their inclusion of helpful diagrams, as in Figures 1G and 2H. I think the manuscript might benefit from one more of these at the end, illustrating the ultimate model.

I'm sorry to say that the language could use quite a bit of polishing. There are missing and extraneous commas. There is also regular confusion between the use of plural and singular nouns. Some early instances include:

1. Page 3: thought instead of "thoughted."
2. Page 5: "A previous studies have revealed"
3. Page 5: "A significantly loss"
4. Page 6: "troughs ring canals" should be "through ring canals"
5. Page 7: lives stage 9 oocytes
6. Page 7: As ens and Khc RNAi oocytes exhibits
7. Page 7: we examined in details
8. Page 7: This average MT length was similar in Khc RNAi and ens mutant oocyte..

Significance

This work makes a nice conceptual advance by showing that motor activation controls its own transport infrastructure, a paradigm that could extend to other systems requiring spatially regulated transport.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The manuscript of Berisha et al., investigates the role of Esconsin (Ens), Kinesin-1 and Ninein in organisation of microtubules (MT) in Drosophila oocyte. At stage 9 oocytes Kinesin-1 transports oskar mRNA, a posterior determinant, along MT that are organised by ncMTOCs. At stage 10b, Kinesin-1 induces cytoplasmic advection to mix the contents of the oocyte. Ensconsin/Map7 is a MT associated protein (MAP) that uses its MT-binding domain (MBD) and kinesin binding domain (KBD) to recruit Kinesin-1 to the microtubules and to stimulate the motility of MT-bound Kinesin-1. Using various new Ens transgenes, the authors demonstrate the requirement of Ens MBD and Ninein in Ens localisation to the oocyte where Ens activates Kinesin-1 using its KBD. The authors also claim that Ens, Kinesin-1 and Ninein are required for the accumulation of ncMTOCs at the oocyte cortex and argue that the detachment of the ncMTOCs from the cortex accounts for the reduced localisation of oskar mRNA at stage 9 and the lack of cytoplasmic streaming at stage 10b.

Although the manuscript contains several interesting observations, the authors' conclusions are not sufficiently supported by their data. The structure function analysis of Ensconsin (Ens) is potentially publishable, but the conclusions on ncMTOC anchoring and cytoplasmic streaming not convincing

1. The main conclusion of the manuscript is that "MT advection failure in Khc and ens in late oogenesis stems from defective cortical ncMTOCs recruitment". This completely overlooks the abundant evidence that Kinesin-1 directly drives cytoplasmic streaming by transporting vesicles and microtubules along microtubules, which then move the cytoplasm by advection (Palacios et al., 2002; Serbus et al, 2005; Lu et al, 2016). Since Kinesin-1 generates the flows, one cannot conclude that the effect of khc and ens mutants on cortical ncMTOC positioning has any direct effect on these flows, which do not occur in these mutants.
2. The authors claim that streaming phenotypes of ens and khs mutants are due to a decrease in microtubule length caused by the defective localisation of ncMTOCs. In addition to the problem raised above, However, I am not convinced that they can make accurate measurements of microtubule length from confocal images like those shown in Figure 4. Firstly, they are measuring the length of bundles of microtubules and cannot resolve individual microtubules. This problem is compounded by the fact that the microtubules do not align into parallel bundles in the mutants. This will make the "microtubules" appear shorter in the mutants. In addition, the alignment of the microtubules in wild-type allows one to choose images in which the microtubule lie in the imaging plane, whereas the more disorganised arrangement of the microtubules in the mutants means that most microtubules will cross the imaging plane, which precludes accurate measurements of their length.
3. "To investigate whether the presence of these short microtubules in ens and Khc RNAi oocytes is due to defects in microtubule anchoring or is also associated with a decrease in microtubule polymerization at their plus ends, we quantified the velocity and number of EB1comets, which label growing microtubule plus ends (Figure S3)." I do not understand how the anchoring or not of microtubule minus ends to the cortex determines how far their plus ends grow, and these measurements fall short of showing that plus end growth is unaffected. It has already been shown that the Kinesin-1-dependent transport of Dynactin to growing microtubule plus ends increases the length of microtubules in the oocyte because Dynactin acts as an anti-catastrophe factor at the plus ends. Thus, khc mutants should have shorter microtubules independently of any effects on ncMTOC anchoring. The measurements of EB1 comet speed and frequency in FigS2 will not detect this change and are not relevant for their claims about microtubule length. Furthermore, the authors measured EB1 comets at stage 9 (where they did not observe short MT) rather than at stage 10b. The authors' argument would be better supported if they performed the measurements at stage 10b.
4. The Shot overexpression experiments presented in Fig.3 E-F, Fig.4D and TableS1 are very confusing. Originally , the authors used Shot-GFP overexpression at stage 9 to show that there is a decrease of ncMTOCs at the cortex in ens mutants (Fig.3 E-F) and speculated that this caused the defects in MT length and cytoplasmic advection at stage 10B. However the authors later state on page 8 that : "Shot overexpression (Shot OE) was sufficient to rescue the presence of long cortical MTs and ooplasmic advection in most ens oocytes (9/14), resembling the patterns observed in controls (Figures 4B right panel and 4D). Moreover, while ens females were fully sterile, overexpression of Shot was sufficient to restore that loss of fertility (Table S1)". Is this the same UAS Shot-GFP and VP16 Gal4 used in both experiments? If so, this contradictions puts the authors conclusions in question.
5. The authors based they conclusions about the involvement of Ens, Kinesin-1 and Ninein in ncMTOC anchoring on the decrease in cortical fluorescence intensity of Shot-YFP and Patronin-YFP in the corresponding mutant backgrounds. However, there is a large variation in average Shot-YFP intensity between control oocytes in different experiments. In Fig. 2F-G the average level of Shot-YFP in the control sis 130 AU while in Fig.3 G-H it is only 55 AU. This makes me worry about reliability of such measurements and the conclusions drawn from them.
6. The decrease in the intensity of Shot-YFP and Patronin-YFP cortical fluorescence in ens mutant oocytes could be because of problems with ncMTOC anchoring or with ncMTOCsformation. The authors should find a way to distinguish between these two possibilities. The authors could express Ens-Mut (described in Sung et al 2008), which localises at the oocyte posterior and test whether it recruits Shot/Patronin ncMTOCs to the posterior.
7. According to the Materials and Methods, the Shot-GFP used in Fig.3 E-F and Fig.4 was the BDSC line 29042. This is Shot L(C), a full-length version of Shot missing the CH1 actin-binding domain that is crucial for Shot anchoring to the cortex. If the authors indeed used this version of Shot-GFP, the interpretation of the above experiments is very difficult.
8. Page 6 "converted in NCs, in a region adjacent to the ring canals, Dendra-Ens-labeled MTs were found in the oocyte compartment indicating they are able to travel from NC toward the oocyte trough ring canals". I have difficulty seeing the translocation of MT through the ring canals. Perhaps it would be more obvious with a movie/picture showing only one channel. Considering that f Dendra-Ens appears in the oocyte much faster than MT transport through ring canals (140nm/s, Lu et al 2022) , the authors are most probably observing the translocation of free Ens rather than Ens bound to MT. The authors should also mention that Ens movement from the NC to the oocyte has been shown before with Ens MBD in Lu et al 2022 with better resolution.
9. Page 6: The co-localization of Ninein with Ens and Shot at the oocyte cortex (Figure 2A). I have difficulty seeing this co-localisation. Perhaps it would be more obvious in merged images of only two channels and with higher resolution images
10. "a pool of the Ens-GFP co-localized with Ch-Patronin at cortical ncMTOCs at the anterior cortex (Figure 3A)". I also have difficulty seeing this.
11. "Ninein co-localizes with Ens at the oocyte cortex and partially along cortical microtubules, contributing to the maintenance of high Ens protein levels in the oocyte and its proper cortical targeting". I could not find any data showing the involvement of Ninein in the cortical targeting of Ens.
12. "our MT network analyses reveal the presence of numerous short MTs cytoplasmic clustered in an anterior pattern." "This low cortical recruitment of ncMTOCs is consistent with poor MT anchoring and their cytoplasmic accumulation." I could not find any data showing that short cortical MT observed at stage 10b in ens mutant and Khc RNAi were cytoplasmic and poorly anchored.
13. "The egg chamber consists of interconnected cells where Dynein and Khc activities are spatially separated. Dynein facilitates transport from NCs to the oocyte, while Khc mediates both transport and advection within the oocyte." Dynein is involved in various activities in the oocyte. It anchors the oocyte nucleus and transports bcd and grk mRNA to mention a few.
14. The cartoons in Fig.2H and 3I exaggerate the effect of Ninein and Ens on cortical ncMTOCs. According to the corresponding graphs, there is a 20 and 50% decrease in each case.

Significance

Given the important concerns raised, the significance of the findings is difficult to assess at this stage.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

In this manuscript, Berisha et al. investigate how microtubule (MT) organization is spatially regulated during Drosophila oogenesis. The authors identify a mechanism in which the Kinesin-1 activator Ensconsin/MAP7 is transported by dynein and anchored at the oocyte cortex via Ninein, enabling localized activation of Kinesin-1. Disruption of this pathway impairs ncMTOC recruitment and MT anchoring at the cortex. The authors combine genetic manipulation with high-resolution microscopy and use three key readouts to assess MT organization during mid-to-late oogenesis: cortical MT formation, localization of posterior determinants, and ooplasmic streaming. Notably, Kinesin-1, in concert with its activator Ens/MAP7, contributes to organizing the microtubule network it travels along. Overall, the study presents interesting findings, though we have several concerns we would like the authors to address.

Ensconsin enrichment in the oocyte

1. Enrichment in the oocyte
   • Ensconsin is a MAP that binds MTs. Given that microtubule density in the oocyte significantly exceeds that in the nurse cells, its enrichment may passively reflect this difference. To assess whether the enrichment is specific, could the authors express a non-Drosophila MAP (e.g., mammalian MAP1B) to determine whether it also preferentially localizes to the oocyte?
   • The ability of ens-wt and ens-LowMT to induce tubulin polymerization according to the light scattering data (Fig. S1J) is minimal and does not reflect dramatic differences in localization. The authors should verify that, in all cases, the polymerization product in their in vitro assays is microtubules rather than other light-scattering aggregates. What is the control in these experiments? If it is just purified tubulin, it should not form polymers at physiological concentrations.
2. Photoconversion caveats MAPs are known to dynamically associate and dissociate from microtubules. Therefore, interpretation of the Ens photoconversion data should be made with caution. The expanding red signal from the nurse cells to the oocyte may reflect a any combination of dynein-mediated MT transport and passive diffusion of unbound Ensconsin. Notably, photoconversion of a soluble protein in the nurse cells would also result in a gradual increase in red signal in the oocyte, independent of active transport. We encourage the authors to more thoroughly discuss these caveats. It may also help to present the green and red channels side by side rather than as merged images, to allow readers to assess signal movement and spatial patterns better.
3. Reduction of Shot at the anterior cortex
   • Shot is known to bind strongly to F-actin, and in the Drosophila ovary, its localization typically correlates more closely with F-actin structures than with microtubules, despite being an MT-actin crosslinker. Therefore, the observed reduction of cortical Shot in ens, nin mutants, and Khc-RNAi oocytes is unexpected. It would be important to determine whether cortical F-actin is also disrupted in these conditions, which should be straightforward to assess via phalloidin staining.
   • MTs are barely visible in Fig. 3A, which is meant to demonstrate Ens-GFP colocalization with tubulin. Higher-quality images are needed.
4. MT gradient in stage 9 oocytes In ens-/-, nin-/-, and Khc-RNAi oocytes, is there any global defect in the stage 9 microtubule gradient? This information would help clarify the extent to which cortical localization defects reflect broader disruptions in microtubule polarity.
5. Role of Ninein in cortical anchoring The requirement for Ninein in cortical anchorage is the least convincing aspect of the manuscript and somewhat disrupts the narrative flow. First, it is unclear whether Ninein exhibits the same oocyte-enriched localization pattern as Ensconsin. Is Ninein detectable in nurse cells? Second, the Ninein antibody signal appears concentrated in a small area of the anterior-lateral oocyte cortex (Fig. 2A), yet Ninein loss leads to reduced Shot signal along a much larger portion of the anterior cortex (Fig. 2F)-a spatial mismatch that weakens the proposed functional relationship. Third, Ninein overexpression results in cortical aggregates that co-localize with Shot, Patronin, and Ensconsin. Are these aggregates functional ncMTOCs? Do microtubules emanate from these foci?
6. Inconsistency of Khc^MutEns rescue The Khc^MutEns variant partially rescues cortical MT formation and restores a slow but measurable cytoplasmic flow yet it fails to rescue Staufen localization (Fig. 5). This raises questions about the consistency and completeness of the rescue. Could the authors clarify this discrepancy or propose a mechanistic rationale?

Minor points:

1. The pUbi-attB-Khc-GFP vector was used to generate the Khc^MutEns transgenic line, presumably under control of the ubiquitous ubi promoter. Could the authors specify which attP landing site was used? Additionally, are the transgenic flies viable and fertile, given that Kinesin-1 is hyperactive in this construct?
2. On page 11 (Discussion, section titled "A dual Ensconsin oocyte enrichment mechanism achieves spatial relief of Khc inhibition"), the statement "many mutations in Kif5A are causal of human diseases" would benefit from a brief clarification. Since not all readers may be familiar with kinesin gene nomenclature, please indicate that KIF5A is one of the three human homologs of Kinesin heavy chain.
3. On page 16 (Materials and Methods, "Immunofluorescence in fly ovaries"), the sentence "Ovaries were mounted on a slide with ProlonGold medium with DAPI (Invitrogen)" should be corrected to "ProLong Gold."

Significance

This study shows that enrichment of MAP7/ensconsin in the oocyte is the mechanism of kinesin-1 activation there and is important for cytoplasmic streaming and localization non-centrosomal microtubule-organizing centers to the oocyte cortex

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

This paper addresses a very interesting problem of non-centrosomal microtubule organization in developing Drosophila oocytes. Using genetics and imaging experiments, the authors reveal an interplay between the activity of kinesin-1, together with its essential cofactor Ensconsin, and microtubule organization at the cell cortex by the spectraplakin Shot, minus-end binding protein Patronin and Ninein, a protein implicated in microtubule minus end anchoring. The authors demonstrate that the loss of Ensconsin affects the cortical accumulation non-centrosomal microtubule organizing center (ncMTOC) proteins, microtubule length and vesicle motility in the oocyte, and show that this phenotype can be rescued by constitutively active kinesin-1 mutant, but not by Ensconsin mutants deficient in microtubule or kinesin binding. The functional connection between Ensconsin, kinesin-1 and ncMTOCs is further supported by a rescue experiment with Shot overexpression. Genetics and imaging experiments further implicate Ninein in the same pathway. These data are a clear strength of the paper; they represent a very interesting and useful addition to the field.

The weaknesses of the study are two-fold. First, the paper seems to lack a clear molecular model, uniting the observed phenomenology with the molecular functions of the studied proteins. Most importantly, it is not clear how kinesin-based plus-end directed transport contributes to cortical localization of ncMTOCs and regulation of microtubule length.

Second, not all conclusions and interpretations in the paper are supported by the presented data. Below is a list of specific comments, outlining the concerns, in the order of appearance in the paper/figures.

1. Figure 1. The statement: "Ens loading on MTs in NCs and their subsequent transport by Dynein toward ring canals promotes the spatial enrichment of the Khc activator Ens in the oocyte" is not supported by data. The authors do not demonstrate that Ens is actually transported from the nurse cells to the oocyte while being attached to microtubules. They do show that the intensity of Ensconsin correlates with the intensity of microtubules, that the distribution of Ensconsin depends on its affinity to microtubules and that an Ensconsin pool locally photoactivated in a nurse cell can redistribute to the oocyte (and throughout the nurse cell) by what seems to be diffusion. The provided images suggest that Ensconsin passively diffuses into the oocyte and accumulates there because of higher microtubule density, which depends on dynein. To prove that Ensconsin is indeed transported by dynein in the microtubule-bound form, one would need to measure the residence time of Ensconsin on microtubules and demonstrate that it is longer than the time needed to transport microtubules by dynein into the oocyte; ideally, one would like to see movement of individual microtubules labelled with photoconverted Ensconsin from a nurse cell into the oocyte. Since microtubules are not enriched in the oocyte of the dynein mutant, analysis of Ensconsin intensity in this mutant is not informative and does not reveal the mechanism of Ensconsin accumulation.
2. Figure 2. According to the abstract, this figure shows that Ensconsin is "maintained at the oocyte cortex by Ninein". However, the figure doesn't seem to prove it - it shows that oocyte enrichment of Ensonsin is partially dependent on Ninein, but this applies to the whole cell and not just to the cell cortex. Furthermore, it is not clear whether Ninein mutation affects microtubule density, which in turn would affect Ensconsin enrichment, and therefore, it is not clear whether the effect of Ninein loss on Ensconsin distribution is direct or indirect. The observation that the aggregates formed by overexpressed Ninein accumulate other proteins, including Ensconsin, supports, though does not prove their interactions. Furthermore, there is absolutely no proof that Ninein aggregates are "ncMTOCs". Unless the authors demonstrate that these aggregates nucleate or anchor microtubules (for example, by detailed imaging of microtubules and EB1 comets), the text and labels in the figure would need to be altered.

Minor comment: Note that a "ratio" (Figure 2C) is just a ratio, and should not be expressed in arbitrary units. 3. Figure 3B: immunoprecipitation results cannot be interpreted because the immunoprecipitated proteins (GFP, Ens-GFP, Shot-YFP) are not shown. It is also not clear that this biochemical experiment is useful. If the authors would like to suggest that Ensconsin directly binds to Patronin, the interaction would need to be properly mapped at the protein domain level. 4. One of the major phenotypes observed by the authors in Ens mutant is the loss of long microtubules. The authors make strong conclusions about the independence of this phenotype from the parameters of microtubule plus-end growth, but in fact, the quality of their data does not allow to make such a conclusion, because they only measured the number of EB1 comets and their growth rate but not the catastrophe, rescue or pausing frequency. Note that kinesin-1 has been implicated in promoting microtubule damage and rescue (doi: 10.1016/j.devcel.2021). In the absence of such measurements, one cannot conclude whether short microtubules arise through defects in the minus-end, plus-end or microtubule shaft regulation pathways. It is important to note in that a spectraplakin, like Shot, can potentially affect different pathways, particularly when overexpressed. Unjustified conclusions should be removed: the authors do not provide sufficient data to conclude that "ens and Khc oocytes MT organizational defects are caused by decreased ncMTOC cortical anchoring", because the actual cortical microtubule anchoring was not measured.

Minor comment: Microtubule growth velocity must be expressed in units of length per time, to enable evaluating the quality of the data, and not as a normalized value. 5. A significant part of the Discussion is dedicated to the potential role of Ensconsin in cortical microtubule anchoring and potential transport of ncMTOCs by kinesin. It is obviously fine that the authors discuss different theories, but it would be very helpful if the authors would first state what has been directly measured and established by their data, and what are the putative, currently speculative explanations of these data.

Minor comment: The writing and particularly the grammar need to be significantly improved throughout, which should be very easy with current language tools. Examples: "ncMTOCs recruitment" should be "ncMTOC recruitment"; "Vesicles speed" should be "Vesicle speed", "Nin oocytes harbored a WT growth,"- unclear what this means, etc. Many paragraphs are very long and difficult to read. Making shorter paragraphs would make the authors' line of thought more accessible to the reader.

Significance

This paper represents significant advance in understanding non-centrosomal microtubule organization in general and in developing Drosophila oocytes in particular by connecting the microtubule minus-end regulation pathway to the Kinesin-1 and Ensconsin/MAP7-dependent transport. The genetics and imaging data are of good quality, are appropriately presented and quantified. These are clear strengths of the study which will make it interesting to researchers studying the cytoskeleton, microtubule-associated proteins and motors, and fly development.

The weaknesses of this study are due to the lack of clarity of the overall molecular model, which would limit the impact of the study on the field. Some interpretations are not sufficiently supported by data, but this can be solved by more precise and careful writing, without extensive additional experimentation.

My expertise is cell biology and biochemistry of the microtubule cytoskeleton, including both microtubule-associated proteins and microtubule motors.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Revision Plan

Manuscript number: RC-2025-03208

Corresponding author(s): Jared Nordman

[The "revision plan" should delineate the revisions that authors intend to carry out in response to the points raised by the referees. It also provides the authors with the opportunity to explain their view of the paper and of the referee reports.

• *

The document is important for the editors of affiliate journals when they make a first decision on the transferred manuscript. It will also be useful to readers of the reprint and help them to obtain a balanced view of the paper.

• *

If you wish to submit a full revision, please use our "Full Revision" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

1. General Statements [optional]

All three reviewers of our manuscript were very positive about our work. The reviewers noted that our work represents a necessary advance that is timely, addresses important issues in the chromatin field, and will of broad interest to this community. Given the nature of our work and the positive reviews, we feel that this manuscript would best be suited for the Journal of Cell Biology.

2. Description of the planned revisions

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Summary:

The authors investigate the function of the H3 chaperone NASP, which is known to bind directly to H3 and prevent degradation of soluble H3. What is unclear is where NASP functions in the cell (nucleus or cytoplasm), how NASP protects H3 from degradation (direct or indirect), and if NASP affects H3 dynamics (nuclear import or export). They use the powerful model system of Drosophila embryos because the soluble H3 pool is high due to maternal deposition and they make use of photoconvertable Dendra-tagged proteins, since these are maternally deposited and can be used to measure nuclear import/export rates.

Using these systems and tools, they conclude that NASP affects nuclear import, but only indirectly, because embryos from NASP mutant mothers start out with 50% of the maternally deposited H3. Because of the depleted H3 and reduced import rates, NASP deficient embryos also have reduced nucleoplasmic and chromatin-associated H3. Using a new Dendra-tagged NASP allele, the authors show that NASP and H3 have different nuclear import rates, indicating that NASP is not a chaperone that shuttles H3 into the nucleus. They test H3 levels in embryos that have no nuclei and conclude that NASP functions in the cytoplasm, and through protein aggregation assays they conclude that NASP prevents H3 aggregation.

Major comments:

The text was easy to read and logical. The data are well presented, methods are complete, and statistics are robust. The conclusions are largely reasonable. However, I am having trouble connecting the conclusions in text to the data presented in Figure 4.

First, I'm confused why the conclusion from Figure 4A is that NASP functions in the cytoplasm of the egg. Couldn't NASP be required in the ovary (in, say, nurse cell nuclei) to stimulate H3 expression and deposition into the egg? The results in 4A would look the same if the mothers deposit 50% of the normal H3 into the egg. Why is NASP functioning specifically in the cytoplasm when it is also so clearly imported into the nucleus? Maybe NASP functions wherever it is, and by preventing nuclear import, you force it to function in the cytoplasm. I do not have additional suggestions for experiments, but I think the authors need to be very clear about the different interpretations of these data and to discuss WHY they believe their conclusion is strongest.

The concern raised by the reviewer regarding NASP function during oogenesis has been addressed in a previous work published from our lab. Unfortunately, we did not do a good job conveying this work in the original version of this manuscript. We demonstrated that total H3 levels are unaffected when comparing WT and NASP mutant stage 14 egg chambers. This means that the amount of H3 deposited into the eggs does not change in the absence of NASP. To address the reviewer's comment, we will change the text to make the link to our previous work clear.

Second, an alternate conclusion from Figure 4D/E is that mothers are depositing less H3 protein into the egg, but the same total amount is being aggregated. This amount of aggregated protein remains constant in activated eggs, but additional H3 translation leads to more total H3? The authors mention that additional translation can compensate for reduced histone pools (line 416).

Similar to our response above, the total amount of H3 in wild type and NASP mutant stage 14 egg chambers is the same. Therefore, mothers are depositing equal amounts of H3 into the egg. We will make the necessary changes in the text to make this point clear.

As the function of NASP in the cytoplasm (when it clearly imports into the nucleus) and role in H3 aggregation are major conclusions of the work, the authors need to present alternative conclusions in the text or complete additional experiments to support the claims. Again, I do not have additional suggestions for experiments, but I think the authors need to be very clear about the different interpretations of these data and to discuss WHY they believe their conclusion is strongest.

A common issue raised by all three reviewers was to more convincingly demonstrate that assay that we have used to isolate protein aggregates does, in fact, isolate protein aggregates. To verify this, we will be performing the aggregate isolation assay using controls that are known to induce more protein aggregation. We will perform the aggregation assay with egg chambers or extracts that are exposed to heat shock or the aggregation-inducing chemicals Canavanine and Azetidine-2-carboxylic acid. The chemical treatment was a welcome suggestion from reviewer #3. These experiments will significantly strengthen any claims based on the outcome of the aggregation assay.

We will also make changes to the text and include other interpretations of our work as the reviewer has suggested.

Data presentation:

Overall, I suggest moving some of the supplemental figures to the main text, adding representative movie stills to show where the quantitative data originated, and moving the H3.3 data to the supplement. Not because it's not interesting, but because H3.3 and H3.2 are behaving the same.

Where possible, we will make changes to the figure display to improve the logic and flow of the manuscript

Fig 1:

It would strengthen the figure to include representative still images that led to the quantitative data, mostly so readers understand how the data were collected.

We will add representative stills to Figure 1 to help readers understand how the data is collected. We will also a representative H3-Dendra movie similar to the NASP supplemental movie.

The inclusion of a "simulated 50% H3" in panel C is confusing. Why?

We used a 50% reduction in H3 levels because that is reduction in H3 we measure in embryos laid by NASP-mutant mothers in our previous work. A reduction in H3 levels alone would be predicted to change the nuclear import rate of H3. Thus, having a quantitative model of H3 import kinetics was key in our understanding of NASP function in vivo. We will revise the text to make this clear.

I would also consider normalizing the data between A and B (and C and D) by dividing NASP/WT. This could be included in the supplement (OPTIONAL)

We can normalize the values and include the data in a supplemental figure.

Fig S1:

The data simulation S1G should be moved to the main text, since it is the primary reason the authors reject the hypothesis that NASP influences H3 import rates.

This is a good point. We will move S1G into the Figure 1.

Fig 2:

Once again, I think it would help to include a few representative images of the photoconverted Dendra2 in the main text.

We will add representative images of the photoconversion in Figure 2.

I struggled with A/B, I think due to not knowing how the data were normalized. When I realized that the WT and NASP data are not normalized to each other, but that the NASP values are likely starting less than the WT values, it made way more sense. I suggest switching the order of data presentation so that C-F are presented first to establish that there is less chromatin-bound H3 in the first place, and then present A/B to show no change in nuclear export of the H3 that is present, allowing the conclusion of both less soluble AND chromatin-bound H3.

The order of the presentation of the data was to test if NASP was acting as a nuclear receptor. Since Figure 1 compares the nuclear import, we wanted to address the nuclear export and provide a comprehensive analysis of the role of NASP in H3 nuclear dynamics before advancing on to other consequences of NASP depletion. We can add the graphs with the un-normalized values in the Supplemental Figure to show the actual difference in total intensity values.

Fig S2:

If M1-M3 indicate males, why are the ovaries also derived from males? I think this is just confusing labeling.

We will change the labelling.

Supplemental Movie S1:

Beautiful. Would help to add a time stamp (OPTIONAL).

Thank you! We will add the time stamp to the movie

Fig 3:

Panel C is the same as Fig S1A (not Fig 1A, as is said in the legend), though I appreciate the authors pointing it out in the legend. Also see line 276.

We appreciate the reviewer for pointing this out. We will make the change in the text to correct this.

Panel D is a little confusing, because presumably the "% decrease in import rate" cannot be positive (Y axis). This could be displayed as a scatter (not bar) as in Panels B/C (right) where the top of the Y axis is set to 0.

We understand the reviewer's concern that the decrease value cannot be positive. We can adjust the y-axis so that it caps off at 0.

Fig S3:

A: What do the different panels represent? I originally thought developmental time, but now I think just different representative images? Are these age-matched from time at egg lay?

The different panels show representative images. We can clarify that in the figure legend.

C: What does "embryos" mean? Same question for Fig 4A.

In this figure, embryos mean the exact number of embryos used to form the lysate for the western blot. We will clarify this in the figure legend.

Fig 4:

A: What does "embryos" mean? Number of embryos? Age in hours?

In this figure, embryos mean the exact number of embryos used to form the lysate for the western blot. We will clarify this in the figure legend.

C: Not sure the workflow figure panel is necessary, as I can't tell what each step does. This is better explained in methods. However I appreciated the short explanation in the text (lines 314-5).

The workflow panel helps to identify the samples labelled as input and aggregate for the western blot analysis. Since our input in the western blots does not refer to the total protein lysate, we feel it is helpful to point out exactly what stage at the protocol we are utilizing the sample for our analysis.

Minor comments:

The authors should describe the nature of the NASP alleles in the main text and present evidence of robust NASP depletion, potentially both in ovaries and in embryos. The antibody works well for westerns (Fig S2B). This is sort of demonstrated later in Figure 4A, but only in NAAP x twine activated eggs.

We appreciate the reviewer's comments about the NASP mutant allele. In our previous publication, we characterized the NASP mutant fly line and its effect on both stage 14 egg chambers and the embryos. We will emphasize the reference to our previous work in the text.

Lines 163, 251, 339: minor typos

Line 184: It would help to clarify- I'm assuming cytoplasmic concentration (or overall) rather than nuclear concentration. If nuclear, I'd expect the opposite relationship. This occurs again when discussing NASP (line 267). I suspect it's also not absolute concentration, but relative concentration difference between cytoplasm and nucleus. It would help clarify if the authors were more precise.

We appreciate the reviewer's point and will add the clarification in the text.

Line 189: Given that the "established integrative model" helps to reject the hypothesis that NASP is involved in H3 import, I think it's important to describe the model a little more, even though it's previously published.

We will add few sentences giving a brief description of the model to the text.

Line 203: "The measured rate of H3.2 export from the nucleus is negligible" clarify this is in WT situations and not a conclusion from this study.

We will add the clarification of this statement in the text.

Line 211: How can the authors be so sure that the decrease in WT is due to "the loss of non-chromatin bound nucleoplasmic H3.2-Dendra2?"

From the live imaging experiments, the H3.2-Dendra2 intensity in the nucleus reduces dramatically upon nuclear envelope breakdown with the only H3.2-Dendra2 intensity remaining being the chromatin bound H3.2. Excess H3.2 is imported into the nucleus and not all of it is incorporated into the chromatin. This is a unique feature of the embryo system that has been observed previously. We mention that the intensity reduction is due to the loss of non-chromatin bound nucleoplasmic H3.2.

Line 217: In the conclusion, the authors indicate that NASP indirectly affects soluble supply of H3 in the nucleoplasm. I do believe they've shown that the import rate effect is indirect, but I don't know why they conclude that the effect of NASP on the soluble nucleoplasmic H3 supply is indirect. Similarly, the conclusion is indirect on line 239. Yet, the authors have not shown it's not direct, just assumed since NASP results in 50% decrease to deposited maternal histones.

We appreciate the feedback on the conclusions of Figure 2 from the reviewer. Our conclusions are primarily based on the effect of H3 levels in the absence of NASP in the early embryos. To establish direct causal effects, it would be important to recover the phenotypes by complementation experiments and providing molecular interactions to cause the effects. In this study we have not established those specific details to make conclusions of direct effects. We will change the text to make this more clear.

Line 292: What is the nature of the NASP "mutant?" Is it a null? Similarly, what kind of "mutant" is the twine allele? Line 295.

We will include descriptions of the NASP and twine mutants in the text.

Line 316: Why did the authors use stage 14 egg chambers here when they previously used embryos? This becomes more clear later shortly, when the authors examine activated eggs, but it's confusing in text.

The reason to use stage 14 egg chambers was to establish NASP function during oogenesis. We will modify the text to emphasize the reason behind using stage 14 egg chambers.

Lines 343-348: It's unclear if the authors are drawing extended conclusions here or if they are drawing from prior literature (if so, citations would be required). For example, why during oogenesis/embryogenesis are aggregation and degradation developmentally separated?

This conclusion is based primarily based on the findings from this study (Figure 4) and out previous published work. We will modify the text for more clarity.

Lines 386-7: I do not understand why the authors conclude that H3 aggregation and degradation are "developmentally uncoupled" and why, in the absence of NASP, "H3 aggregation precedes degradation."

This is based data in Figure 4 combined with our previous working showing that the total level of H3 in not changed in NASP-mutant stage 14 egg chambers. Aggregates seem to be more persistent in the stage 14 egg chambers (oogenesis) and they get cleared out upon egg activation (entry into embryogenesis). This provides evidence for aggregation occurring prior to degradation and these two events occurring in different developmental stages. We will change the text to make this more clear.

Line 395: Why suddenly propose that NASP also functions in the nucleus to prevent aggregation, when earlier the authors suggest it functions only in the cytoplasm?

We will make the necessary edits to ensure that the results don't suggest a role of NASP exclusive to the cytoplasm. Our findings highlight a cytoplasmic function of NASP, however, we do not want to rule out that this same function couldn't occur in the nucleus.

Lines 409-413: The authors claim that histone deficiency likely does not cause the embryonic arrest seen in embryos from NASP mutant mothers. This is because H3 is reduced by 50% yet some embryos arrest long before they've depleted this supply. However, the authors also showed that H3 import rates are affected in these embryos due to lower H3 concentration. Since the early embryo cycles are so rapid, reduced H3 import rates could lead to early arrest, even though available H3 remains in the cytoplasm.

We thank the reviewer for their suggestion. This conclusion is based on the findings from the previous study from our lab which showed that the majority of the embryos laid by NASP mutant females get arrested in the very early nuclear cycles (Reviewer #1 (Significance (Required)):

The significance of the work is conceptual, as NASP is known to function in H3 availability but the precise mechanism is elusive. This work represents a necessary advance, especially to show that NASP does not affect H3 import rates, nor does it chaperone H3 into the nucleus. However, the authors acknowledge that many questions remain. Foremost, why is NASP imported into the nucleus and what is its role there?

I believe this work will be of interest to those who focus on early animal development, but NASP may also represent a tool, as the authors conclude in their discussion, to reduce histone levels during development and examine nucleosome positioning. This may be of interest to those who work on chromatin accessibility and zygotic genome activation.

I am a genetics expert who works in Drosophila embryogenesis. I do not have the expertise to evaluate the aggregate methods presented in Figure 4.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Summary:

This manuscript focuses on the role of the histone chaperone NASP in Drosophila. NASP is a chaperone specific to histone H3 that is conserved in mammals. Many aspects of the molecular mechanisms by which NASP selectively binds histone H3 have been revealed through biochemical studies. However, key aspects of NASP's in vivo roles remain unclear, including where in the cell NASP functions, and how it prevents H3 degradation. Through live imaging in the early Drosophila embryo, which possesses large amounts of soluble H3 protein, Das et al determine that NASP does not control nuclear import or export of H3.2 or H3.3. Instead, they find through differential centrifugation analysis that NASP functions in the cytoplasm to prevent H3 aggregation and hence its subsequent degradation.

Major Comments:

The protein aggregation assays raise several questions. From a technical standpoint, it would be helpful to have a positive control to demonstrate that the assay is effective at detecting protein aggregates. Ie. a genotype that exhibits increased protein aggregation; this could be for a protein besides H3. A common issue raised by all three reviewers was to more convincingly demonstrate that assay that we have used to isolate protein aggregates does, in fact, isolate protein aggregates. To verify this, we will be performing the aggregate isolation assay using controls that are known to induce more protein aggregation. We will perform the aggregation assay with egg chambers or extracts that are exposed to heat shock or the aggregation-inducing chemicals Canavanine and Azetidine-2-carboxylic acid. The chemical treatment was a welcome suggestion from reviewer #3. These experiments will significantly strengthen any claims based on the outcome of the aggregation assay.

If NASP is not required to prevent H3 degradation in egg chambers, then why are H3 levels much lower in NASP input lanes relative to wild-type egg chambers in Fig 4D? We appreciate the reviewer's inputs regarding the reduced H3 levels in the NASP mutant egg chambers. We observe this reduction in H3 levels in the input because of the altered solubility of H3 which leads to the loss of H3 protein at different steps of the aggregate isolation assay. We will add a supplement figure showing H3 levels at different steps of the aggregate isolation assay. We do want to stress, however, that the total levels of H3 in stage 14 egg chambers does not change between WT and the NASP mutant.

A corollary to this is that the increased fraction of H3 in aggregates in NASP mutants seems to be entirely due to the reduction in total H3 levels rather than an increase in aggregated H3. If NASP's role is to prevent aggregation in the cytoplasm, and degradation has not yet begun in egg chambers, then why are aggregated H3 levels not increased in NASP mutants relative to wild-type egg chambers? If the same number of egg chambers were used, shouldn't the total amount of histone be the same in the absence of degradation?

In previously published work, we demonstrated that total H3 levels are unaffected when comparing WT and NASPmutant stage 14 egg chambers. This means that the amount of H3 deposited into the eggs does not change in the absence of NASP. To address the reviewer's comment, we will change the text to make the link to our previous work clear. As stated above, we will add a supplement figure showing H3 levels at different steps of the aggregate isolation assay.

The live imaging studies are well designed, executed, and quantified. They use an established genotype (H3.2-Dendra2) in wild-type and NASP maternal mutants to demonstrate that NASP is not directly involved in nuclear import of H3.2. Decreased import is likely due to reduced H3.2 levels in NASP mutants rather than reduced import rates per se. The same methodology was used to determine that loss of NASP did not affect H3.2 nuclear export. These findings eliminate H3.2 nuclear import/export regulation as possible roles for NASP, which had been previously proposed.

Thank you.

Live imaging also conclusively demonstrates that the levels of H3.2 in the nucleoplasm and in mitotic chromatin are significantly lower in NASP mutants than wild-type nuclei. Despite these lower histone levels, the nuclear cycle duration is only modestly lengthened. The live imagining of NASP-Dendra2 nuclear import conclusively demonstrate that NASP and H3.2 are unlikely to be imported into the nucleus as one complex.

Thank you.

Minor Comments:

Additional details on how the NASP-Dendra2 CRISPR allele was generated should be provided. In addition, additional details on how it was determined that this allele is functional should be provided (e.g. quantitative assays for fertility/embryo viability of NASP-Dendra2 females) We will make these additions to the text.

If statistical tests are used to determine significance, the type of test used should be reported in the figure legends throughout.

We will make the addition of the statistical tests to the figure legends.

The western blot shown in Figure 4A looks more like a 4-fold reduction in H3 levels in NASP mutants relative to wild-type embryos, rather than the quantified 2-fold reduction. Perhaps a more representative blot can be shown.

We have additional blots in the supplemental figure S3C. The quantification was performed after normalization to the total protein levels and we can highlight that in the figure legend.

Reviewer #2 (Significance (Required)):

As a fly chromatin biologist with colleagues that utilize mammalian experimental systems, I feel this manuscript will be of broad interest to the chromatin research community. Packaging of the genome into chromatin affects nearly every DNA-templated process, making the mechanisms by which histone proteins are expressed, chaperoned, and deposited into chromatin of high importance to the field. The study has multiple strengths, including high-quality quantitative imaging, use of a terrific experimental system (storage and deposition of soluble histones in early fly embryos). The study also answers outstanding questions in the field, specifically that NASP does not control nuclear import/export of histone H3. Instead, the authors propose that NASP functions to prevent protein aggregation. If this could be conclusively demonstrated, it would be valuable to the field. However, the protein aggregation studies need improvement. Technical demonstration that their differential centrifugation assay accurately detects aggregated proteins is needed. Further, NASP mutants do not exhibit increased H3 protein aggregation in the data presented. Instead, the increased fraction of aggregated H3 in NASP mutants seems to be due to a reduction in the overall levels of H3 protein, which is contrary to the model presented in this paper.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

This manuscript by Das et al. entitled "NASP functions in the cytoplasm to prevent histone H3 aggregation during early embryogenesis", explores the role of the histone chaperone NASP in regulating histone H3 dynamics during early Drosophila embryogenesis. Using primarily live imaging approaches, the authors found that NASP is not directly involved in the import or export of H3. Moreover, the authors claimed that NASP prevents H3 aggregation rather than protects against degradation.

Major Comments:

Figure 1A-B: The plotted data appear to have substantial dispersion. Could the authors include individual data points or provide representative images to help the reader assess variability?

We chose to show unnormalized data in Figure 1 so readers could better compare the actual import values of H3 in the presence and absence of NASP. We felt it was a better representation of the true biological difference although raw data is more dispersive. We did also include normalized data in the supplement. Regardless, we will add representative stills to Figure 1 and include a H3-Dendra2 movie in the supplement to show the representative data.

Given that the authors conclude that the reduced nuclear import is due to lowered H3 levels in NASP-deficient embryos, would overexpression of H3 rescue this phenotype? This would directly test whether H3 levels, rather than import machinery per se, drive the effect.

We thank the reviewer for their valuable suggestion. We and others have tried to overexpress histones in the Drosophila early embryo without success. There must be an undefined feedback mechanism preventing histone overexpression in the germline. In fact, a recent paper has been deposited on bioRxiv (https://doi.org/10.1101/2024.12.23.630206) that suggest H4 protein could provide a feedback mechanism to prevent histone overexpression. While we would love to do this experiment, it is not technically feasible at this time.

Figure 2A-B: The authors present the Relative Intensity of H3-Dendra2, but this metric obscures absolute differences between Control and NASP knockout embryos. Please include Total Intensity plots to show the actual reduction in H3 levels.

We will add the total H3-Dendra2 intensity plots to the supplemental figure for the export curves.

Additionally, Western blot analysis of nucleoplasmic H3 from wild-type vs. NASP-deficient embryos would provide essential biochemical confirmation of H3 level reductions.

We will measure nuclear H3 levels by western from 0-2 hr embryos laid by WT and NASP mutant flies.

Figure 4: To support the conclusion that NASP prevents H3 aggregation, I recommend performing aggregation assays by adding compounds that induce unfolding (amino acid analogues that induce unfolding, like canavanine or Azetidine-2-carboxylic acid) or using aggregation-prone H3 mutants.

This is a very helpful suggestion! It is difficult to get chemicals into Drosophila eggs, but we will treat extracts directly with these chemicals. Additionally, we will use heat shocked eggs and extracts as an additional control.

Inclusion of CMA and proteasome inhibition experiments could also clarify whether degradation pathways are secondarily involved or compensatory in the absence of NASP.

The degradation pathway for H3 in the absence of NASP is unknown and a major focus of our future work is to define this pathway. Drosophila does not have a CMA pathway and therefore, we don't know how H3 aggregates are being sensed.

Minor Comments:

(1) The Introduction would benefit from mentioning the two NASP isoforms that exist in mammals (sNASP and tNASP), as this evolutionary context may inform interpretation of the Drosophila results.

We will make the edits in the text to include that Drosophila NASP is the sole homolog of sNASP and that tNASP ortholog is not found in Drosophila.

(2) Could the authors comment on the status of histone H4 in their experimental system? Given the observed cytoplasmic pool of H3, is it likely to exist as a monomer? If this H3 pool is monomeric, does that suggest an early failure in H3-H4 dimerization, and could this contribute to its aggregation propensity?

In our previous work we noted that NASP binds more preferentially to H3 and the levels of H3 we much more reduced upon NASP depletion than H4. We pointed out in this publication that our data was consistent with H3 stores being monomeric in the Drosophila embryo. We don't' have a H4-Dendra2 line to test. In the future, however, this is something we are very keen to look at.

Reviewer #3 (Significance (Required)):

This work addresses a timely and important question in the field of chromatin biology and developmental epigenetics. The focus on histone homeostasis during embryogenesis and the cytoplasmic role of NASP adds a novel perspective. The live imaging experiments are a clear strength, providing valuable spatiotemporal insights. However, I believe that the manuscript would benefit significantly from additional biochemical validation to support and clarify some of the mechanistic claims.

3. Description of the revisions that have already been incorporated in the transferred manuscript

• *

4. Description of analyses that authors prefer not to carry out

Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

This manuscript by Das et al. entitled "NASP functions in the cytoplasm to prevent histone H3 aggregation during early embryogenesis", explores the role of the histone chaperone NASP in regulating histone H3 dynamics during early Drosophila embryogenesis. Using primarily live imaging approaches, the authors found that NASP is not directly involved in the import or export of H3. Moreover, the authors claimed that NASP prevents H3 aggregation rather than protects against degradation.

Major Comments:

Figure 1A-B: The plotted data appear to have substantial dispersion. Could the authors include individual data points or provide representative images to help the reader assess variability? Given that the authors conclude that the reduced nuclear import is due to lowered H3 levels in NASP-deficient embryos, would overexpression of H3 rescue this phenotype? This would directly test whether H3 levels, rather than import machinery per se, drive the effect.

Figure 2A-B: The authors present the Relative Intensity of H3-Dendra2, but this metric obscures absolute differences between Control and NASP knockout embryos. Please include Total Intensity plots to show the actual reduction in H3 levels. Additionally, Western blot analysis of nucleoplasmic H3 from wild-type vs. NASP-deficient embryos would provide essential biochemical confirmation of H3 level reductions.

Figure 4: To support the conclusion that NASP prevents H3 aggregation, I recommend performing aggregation assays by adding compounds that induce unfolding (amino acid analogues that induce unfolding, like canavanine or Azetidine-2-carboxylic acid) or using aggregation-prone H3 mutants. Inclusion of CMA and proteasome inhibition experiments could also clarify whether degradation pathways are secondarily involved or compensatory in the absence of NASP.

Minor Comments:

(1) The Introduction would benefit from mentioning the two NASP isoforms that exist in mammals (sNASP and tNASP), as this evolutionary context may inform interpretation of the Drosophila results.

(2) Could the authors comment on the status of histone H4 in their experimental system? Given the observed cytoplasmic pool of H3, is it likely to exist as a monomer? If this H3 pool is monomeric, does that suggest an early failure in H3-H4 dimerization, and could this contribute to its aggregation propensity?

Significance

This work addresses a timely and important question in the field of chromatin biology and developmental epigenetics. The focus on histone homeostasis during embryogenesis and the cytoplasmic role of NASP adds a novel perspective. The live imaging experiments are a clear strength, providing valuable spatiotemporal insights. However, I believe that the manuscript would benefit significantly from additional biochemical validation to support and clarify some of the mechanistic claims.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

This manuscript focuses on the role of the histone chaperone NASP in Drosophila. NASP is a chaperone specific to histone H3 that is conserved in mammals. Many aspects of the molecular mechanisms by which NASP selectively binds histone H3 have been revealed through biochemical studies. However, key aspects of NASP's in vivo roles remain unclear, including where in the cell NASP functions, and how it prevents H3 degradation. Through live imaging in the early Drosophila embryo, which possesses large amounts of soluble H3 protein, Das et al determine that NASP does not control nuclear import or export of H3.2 or H3.3. Instead, they find through differential centrifugation analysis that NASP functions in the cytoplasm to prevent H3 aggregation and hence its subsequent degradation.

Major Comments:

1. The protein aggregation assays raise several questions.

a. From a technical standpoint, it would be helpful to have a positive control to demonstrate that the assay is effective at detecting protein aggregates. Ie. a genotype that exhibits increased protein aggregation; this could be for a protein besides H3.

b. If NASP is not required to prevent H3 degradation in egg chambers, then why are H3 levels much lower in NASP input lanes relative to wild-type egg chambers in Fig 4D?

c. A corollary to this is that the increased fraction of H3 in aggregates in NASP mutants seems to be entirely due to the reduction in total H3 levels rather than an increase in aggregated H3. If NASP's role is to prevent aggregation in the cytoplasm, and degradation has not yet begun in egg chambers, then why are aggregated H3 levels not increased in NASP mutants relative to wild-type egg chambers? If the same number of egg chambers were used, shouldn't the total amount of histone be the same in the absence of degradation? 2. The live imaging studies are well designed, executed, and quantified. They use an established genotype (H3.2-Dendra2) in wild-type and NASP maternal mutants to demonstrate that NASP is not directly involved in nuclear import of H3.2. Decreased import is likely due to reduced H3.2 levels in NASP mutants rather than reduced import rates per se. The same methodology was used to determine that loss of NASP did not affect H3.2 nuclear export. These findings eliminate H3.2 nuclear import/export regulation as possible roles for NASP, which had been previously proposed. 3. Live imaging also conclusively demonstrates that the levels of H3.2 in the nucleoplasm and in mitotic chromatin are significantly lower in NASP mutants than wild-type nuclei. Despite these lower histone levels, the nuclear cycle duration is only modestly lengthened. 4. The live imagining of NASP-Dendra2 nuclear import conclusively demonstrate that NASP and H3.2 are unlikely to be imported into the nucleus as one complex.

Minor Comments:

1. Additional details on how the NASP-Dendra2 CRISPR allele was generated should be provided. In addition, additional details on how it was determined that this allele is functional should be provided (e.g. quantitative assays for fertility/embryo viability of NASP-Dendra2 females)
2. If statistical tests are used to determine significance, the type of test used should be reported in the figure legends throughout.
3. The western blot shown in Figure 4A looks more like a 4-fold reduction in H3 levels in NASP mutants relative to wild-type embryos, rather than the quantified 2-fold reduction. Perhaps a more representative blot can be shown.

Significance

As a fly chromatin biologist with colleagues that utilize mammalian experimental systems, I feel this manuscript will be of broad interest to the chromatin research community. Packaging of the genome into chromatin affects nearly every DNA-templated process, making the mechanisms by which histone proteins are expressed, chaperoned, and deposited into chromatin of high importance to the field. The study has multiple strengths, including high-quality quantitative imaging, use of a terrific experimental system (storage and deposition of soluble histones in early fly embryos). The study also answers outstanding questions in the field, specifically that NASP does not control nuclear import/export of histone H3. Instead, the authors propose that NASP functions to prevent protein aggregation. If this could be conclusively demonstrated, it would be valuable to the field. However, the protein aggregation studies need improvement. Technical demonstration that their differential centrifugation assay accurately detects aggregated proteins is needed. Further, NASP mutants do not exhibit increased H3 protein aggregation in the data presented. Instead, the increased fraction of aggregated H3 in NASP mutants seems to be due to a reduction in the overall levels of H3 protein, which is contrary to the model presented in this paper.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary:

The authors investigate the function of the H3 chaperone NASP, which is known to bind directly to H3 and prevent degradation of soluble H3. What is unclear is where NASP functions in the cell (nucleus or cytoplasm), how NASP protects H3 from degradation (direct or indirect), and if NASP affects H3 dynamics (nuclear import or export). They use the powerful model system of Drosophila embryos because the soluble H3 pool is high due to maternal deposition and they make use of photoconvertable Dendra-tagged proteins, since these are maternally deposited and can be used to measure nuclear import/export rates.

Using these systems and tools, they conclude that NASP affects nuclear import, but only indirectly, because embryos from NASP mutant mothers start out with 50% of the maternally deposited H3. Because of the depleted H3 and reduced import rates, NASP deficient embryos also have reduced nucleoplasmic and chromatin-associated H3. Using a new Dendra-tagged NASP allele, the authors show that NASP and H3 have different nuclear import rates, indicating that NASP is not a chaperone that shuttles H3 into the nucleus. They test H3 levels in embryos that have no nuclei and conclude that NASP functions in the cytoplasm, and through protein aggregation assays they conclude that NASP prevents H3 aggregation.

Major comments:

The text was easy to read and logical. The data are well presented, methods are complete, and statistics are robust. The conclusions are largely reasonable. However, I am having trouble connecting the conclusions in text to the data presented in Figure 4.

First, I'm confused why the conclusion from Figure 4A is that NASP functions in the cytoplasm of the egg. Couldn't NASP be required in the ovary (in, say, nurse cell nuclei) to stimulate H3 expression and deposition into the egg? The results in 4A would look the same if the mothers deposit 50% of the normal H3 into the egg. Why is NASP functioning specifically in the cytoplasm when it is also so clearly imported into the nucleus? Maybe NASP functions wherever it is, and by preventing nuclear import, you force it to function in the cytoplasm. I do not have additional suggestions for experiments, but I think the authors need to be very clear about the different interpretations of these data and to discuss WHY they believe their conclusion is strongest.

Second, an alternate conclusion from Figure 4D/E is that mothers are depositing less H3 protein into the egg, but the same total amount is being aggregated. This amount of aggregated protein remains constant in activated eggs, but additional H3 translation leads to more total H3? The authors mention that additional translation can compensate for reduced histone pools (line 416).

As the function of NASP in the cytoplasm (when it clearly imports into the nucleus) and role in H3 aggregation are major conclusions of the work, the authors need to present alternative conclusions in the text or complete additional experiments to support the claims. Again, I do not have additional suggestions for experiments, but I think the authors need to be very clear about the different interpretations of these data and to discuss WHY they believe their conclusion is strongest.

Data presentation:

Overall, I suggest moving some of the supplemental figures to the main text, adding representative movie stills to show where the quantitative data originated, and moving the H3.3 data to the supplement. Not because it's not interesting, but because H3.3 and H3.2 are behaving the same.

Fig 1:

It would strengthen the figure to include representative still images that led to the quantitative data, mostly so readers understand how the data were collected. The inclusion of a "simulated 50% H3" in panel C is confusing. Why? I would also consider normalizing the data between A and B (and C and D) by dividing NASP/WT. This could be included in the supplement (OPTIONAL)

Fig S1:

The data simulation S1G should be moved to the main text, since it is the primary reason the authors reject the hypothesis that NASP influences H3 import rates.

Fig 2:

Once again, I think it would help to include a few representative images of the photoconverted Dendra2 in the main text. I struggled with A/B, I think due to not knowing how the data were normalized. When I realized that the WT and NASP data are not normalized to each other, but that the NASP values are likely starting less than the WT values, it made way more sense. I suggest switching the order of data presentation so that C-F are presented first to establish that there is less chromatin-bound H3 in the first place, and then present A/B to show no change in nuclear export of the H3 that is present, allowing the conclusion of both less soluble AND chromatin-bound H3.

Fig S2:

If M1-M3 indicate males, why are the ovaries also derived from males? I think this is just confusing labeling. Supplemental Movie S1: Beautiful. Would help to add a time stamp (OPTIONAL).

Fig 3:

Panel C is the same as Fig S1A (not Fig 1A, as is said in the legend), though I appreciate the authors pointing it out in the legend. Also see line 276. Panel D is a little confusing, because presumably the "% decrease in import rate" cannot be positive (Y axis). This could be displayed as a scatter (not bar) as in Panels B/C (right) where the top of the Y axis is set to 0.

Fig S3:

A: What do the different panels represent? I originally thought developmental time, but now I think just different representative images? Are these age-matched from time at egg lay? C: What does "embryos" mean? Same question for Fig 4A. Fig 4: A: What does "embryos" mean? Number of embryos? Age in hours? C: Not sure the workflow figure panel is necessary, as I can't tell what each step does. This is better explained in methods. However I appreciated the short explanation in the text (lines 314-5).

Minor comments:

The authors should describe the nature of the NASP alleles in the main text and present evidence of robust NASP depletion, potentially both in ovaries and in embryos. The antibody works well for westerns (Fig S2B). This is sort of demonstrated later in Figure 4A, but only in NAAP x twine activated eggs.

Lines 163, 251, 339: minor typos Line 184: It would help to clarify- I'm assuming cytoplasmic concentration (or overall) rather than nuclear concentration. If nuclear, I'd expect the opposite relationship. This occurs again when discussing NASP (line 267). I suspect it's also not absolute concentration, but relative concentration difference between cytoplasm and nucleus. It would help clarify if the authors were more precise. Line 189: Given that the "established integrative model" helps to reject the hypothesis that NASP is involved in H3 import, I think it's important to describe the model a little more, even though it's previously published. Line 203: "The measured rate of H3.2 export from the nucleus is negligible" clarify this is in WT situations and not a conclusion from this study. Line 201: How can the authors be so sure that the decrease in WT is due to "the loss of non-chromatin bound nucleoplasmid H3.2-Dendra2?" Line 217: In the conclusion, the authors indicate that NASP indirectly affects soluble supply of H3 in the nucleoplasm. I do believe they've shown that the import rate effect is indirect, but I don't know why they conclude that the effect of NASP on the soluble nucleoplasmic H3 supply is indirect. Similarly, the conclusion is indirect on line 239. Yet, the authors have not shown it's not direct, just assumed since NASP results in 50% decrease to deposited maternal histones. Line 292: What is the nature of the NASP "mutant?" Is it a null? Similarly, what kind of "mutant" is the twine allele? Line 295. Line 316: Why did the authors use stage 14 egg chambers here when they previously used embryos? This becomes more clear later shortly, when the authors examine activated eggs, but it's confusing in text. Lines 343-348: It's unclear if the authors are drawing extended conclusions here or if they are drawing from prior literature (if so, citations would be required). For example, why during oogenesis/embryogenesis are aggregation and degradation developmentally separated? Lines 386-7: I do not understand why the authors conclude that H3 aggregation and degradation are "developmentally uncoupled" and why, in the absence of NASP, "H3 aggregation precedes degradation." Line 395: Why suddenly propose that NASP also functions in the nucleus to prevent aggregation, when earlier the authors suggest it functions only in the cytoplasm? Lines 409-413: The authors claim that histone deficiency likely does not cause the embryonic arrest seen in embryos from NASP mutant mothers. This is because H3 is reduced by 50% yet some embryos arrest long before they've depleted this supply. However, the authors also showed that H3 import rates are affected in these embryos due to lower H3 concentration. Since the early embryo cycles are so rapid, reduced H3 import rates could lead to early arrest, even though available H3 remains in the cytoplasm.

Significance

The significance of the work is conceptual, as NASP is known to function in H3 availability but the precise mechanism is elusive. This work represents a necessary advance, especially to show that NASP does not affect H3 import rates, nor does it chaperone H3 into the nucleus. However, the authors acknowledge that many questions remain. Foremost, why is NASP imported into the nucleus and what is its role there?

I believe this work will be of interest to those who focus on early animal development, but NASP may also represent a tool, as the authors conclude in their discussion, to reduce histone levels during development and examine nucleosome positioning. This may be of interest to those who work on chromatin accessibility and zygotic genome activation.

I am a genetics expert who works in Drosophila embryogenesis. I do not have the expertise to evaluate the aggregate methods presented in Figure 4.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Review report for 'Sterols regulate ciliary membrane dynamics and hedgehog signaling in health and disease', Lamazière et al.

Reviewer #1

In this manuscript, Lamazière et al. address an important understudied aspect of primary cilium biology, namely the sterol composition in the ciliary membrane. It is known that sterols especially play an important role in signal transduction between PTCH1 and SMO, two upstream components of the Hedgehog pathway, at the primary cilium. Moreover, several syndromes linked to cholesterol biosynthesis defects present clinical phenotypes indicative of altered Hh signal transduction. To understand the link between ciliary membrane sterol composition and Hh signal transduction in health and disease, the authors developed a method to isolate primary cilia from MDCK cells and coupled this to quantitative metabolomics. The results were validated using biophysical methods and cellular Hh signaling assays. While this is an interesting study, it is not clear from the presented data how general the findings are: can cilia be isolated from different mammalian cell types using this protocol? Is the sterol composition of MDCK cells expected to the be the same in fibroblasts or other cell types? Without this information, it is difficult to judge whether the conclusions reached in fibroblasts are indeed directly related to the sterol composition detected in MDCK cells. Below is a detailed breakdown of suggested textual changes and experimental validations to strengthen the conclusions of the manuscript.

We would like to thank the reviewer for their helpful comments

Major comments:

• It appears that the comparison has been made between ciliary membranes and the rest of the cell's membranes, which includes many other membranes besides the plasma membrane. This significantly weakens the conclusions on the sterol content specific to the cilium, as it may in fact be highly similar to the rest of the plasma membrane. It is for example known that lathosterol is biosynthesized in the ER, and therefore the non-presence in the cilium may reflect a high abundance in the ER but not necessarily in the plasma membrane.

The reviewer is correct that we compared the sterol composition of the primary ciliary membrane to the average of the remaining cellular membranes. We agree that this broader reference fraction contains multiple intracellular membranes, including ER- and Golgi-derived compartments, and therefore does not isolate the plasma membrane specifically. We would like to emphasize that our study did not aim to compare the cilium directly to the plasma membrane, nor did we claim that the comparison was in any way related to the plasma membrane. It is also worth noting that previous studies in other ciliated organisms have reported a higher cholesterol content in cilia compared to the plasma membrane, suggesting that the two membranes may not be compositionally identical despite their continuity. However, we concur that determining the sterol composition of the MDCK plasma membrane would provide valuable context and enable a comparison with the membrane continuous with the ciliary membrane. Hence, we are willing to try isolating plasma membrane in the same cellular contexts.

• While the protocol to isolate primary cilium from MDCK cells is a valuable addition to the methods available, it would be good to at least include a discussion on its general applicability. Have the authors tried to use this protocol on fibroblasts for example?

Thank you for the reviewer's positive comment on the value of the ciliary isolation protocol. Indeed, we have attempted to apply the same approach to other ciliated cell types, namely IMCD3 and MEF cells. In the case of IMCD3 cells, we were able to isolate primary cilia using the same general strategy; however, we are still refining the preparation, as the overall yield is lower than in MDCK cells and the amount of material obtained is currently insufficient for comprehensive biochemical analyses. With MEF (fibroblast) cells, the procedure proved even more challenging, as the yield of isolated cilia was extremely low. This difficulty is likely due to the shorter length of fibroblast cilia and to their positioning beneath the cell body, which probably makes them more resistant to detachment. Overall, these observations suggest that while the protocol can be adapted to other cell types, its efficiency depends on cellular architecture. We have added a discussion of these aspects in the revised manuscript to clarify the method's current scope and limitations (lines 492-502).

• Some of the conclusions in the introduction (lines 75-80) seem to be incorrectly phrased based on the data: in basal conditions, ciliary membranes are already enriched in cholesterol and desmosterol, and the treatment lowers this in all membranes.

We agree, this was modified in the revised manuscript (lines 75-80).

• There seems to be little effect of simvastatin on overall cholesterol levels. Can the authors comment on this result? How would the membrane fluidity be altered when mimicking simvastatin-induced composition? Since the effect on Hh signaling appears to be the biggest (Figure 5B) under simvastatin treatment, it would be interesting to compare this against that found for AY9944 treatment. Also, the authors conclude that the effects of simvastatin treatment on ciliary membrane sterol composition are the mildest, however, one could argue that they are the strongest as there is a complete lack of desmosterol.

We thank the reviewer for these insightful comments. Regarding the modest overall effect of simvastatin on cholesterol levels, we would like to note that MDCK cells are an immortalized epithelial cell line with high metabolic plasticity. Such cancer-like cell types are known to exhibit enhanced de novo lipogenesis, particularly under culture conditions with ample glucose availability. This compensatory lipid biosynthesis can partially counterbalance pharmacological inhibition of the cholesterol biosynthetic pathway. Because simvastatin acts upstream in the pathway (at HMG-CoA reductase), its inhibition primarily reduces early intermediates rather than fully depleting end-product cholesterol, explaining the relatively mild changes observed in total cholesterol content.

Concerning desmosterol, we agree with the reviewer that its complete loss under simvastatin treatment is a striking finding that deserves further discussion. Interestingly, our data show that simvastatin treatment produces the strongest inhibition of pathway activation (as measured by SMO activation), but the weakest effect on signal transduction downstream of constitutively active SMOM2. This dichotomy suggests that the absence of desmosterol may preferentially affect the activation step of Hedgehog signaling at the ciliary membrane, without equally impacting downstream propagation. We have expanded the Result section to highlight this potential role of desmosterol in the activation phase of Hedgehog signaling and to contrast it with the effects observed under AY9944 treatment (lines 463-469).

It is not clear to me why the authors have chosen to use SAG to activate the Hh pathway, as this is a downstream mode of activation and bypasses PTCH1 (and therefore a potentially sterol-mediated interaction between the two proteins). It would be very informative to compare the effect of sterol modulation on the ability of ShhN vs SAG to activate the pathway.

Our study aims to demonstrate that the sterol composition of the ciliary membrane plays an essential role in the proper functioning of the Hedgehog (Hh) signaling pathway, comparable in importance to that of oxysterols and free cholesterol. Because ShhN itself is covalently modified by cholesterol, and Smoothened (SMO) can be directly activated by both oxysterols and cholesterol, we reasoned that using a non-native SMO agonist such as SAG would allow us to specifically assess defects arising from alterations in membrane-bound sterols. In this way, pathway activation by SAG provides a more direct readout of the functional contribution of ciliary membrane sterols to SMO activity, independent of potential confounding effects related to ShhN processing, secretion, or PTCH1-mediated regulation.

• The conclusions about the effect of tamoxifen on SMO trafficking in MEFs should be validated in human patient cells before being able to conclude that there is a potential off-target effect (line 438). Also, if that is the case, the experiment of tamoxifen treatment of EBP KO cells should give an additional effect on SMO trafficking. Also, could the CDPX2 phenotypes in patients be the result of different cell types being affected than the fibroblast used in this study?

We agree that carrying the proposed experiment would be a good way to assess a potential off-target effect. However, such validation is beyond the scope of the present study, as this comment on off-target effect was aimed primarily to propose a mechanistic hypothesis to explain the differences observed in Hedgehog pathway activation between patient-derived fibroblasts and tamoxifen-treated MEFs. We leaned towards this hypothesis because drug treatments are known for their overall variable specificity, but we agree other hypotheses are possible, and among them the difference in cell type, as both are fibroblasts but from different origin. We rephrased this passage in the revised manuscript (lines 447-448 ).

Regarding the reviewer's third point, we fully agree that the CDPX2 phenotype in patients is unlikely to arise solely from fibroblast dysfunction. Nevertheless, fibroblasts are the only patient-derived cells currently available to us, and they provide a useful model for assessing ciliary signaling. It is reasonable to expect that similar defects could occur in other, more physiologically relevant cell types.

• For the experiments with the SMO-M2 mutant, it would be useful to show the extent of pathway activation by the mutant compared to SAG or ShhN treatment of non-transfected cells. Moreover, it will be necessary to exclude any direct effects of the compound treatment on the ability of this mutant to traffic to the primary cilium, which can easily be done using fluorescence microscopy as the mutant is tagged with mCherry.

The SmoM2 mutant is indeed a well-characterized constitutively active form of Smoothened that has been extensively studied by us and others. It is well established that this mutant correctly localizes to the primary cilium and robustly activates the Hedgehog pathway in MEFs (see Eguether et al., Dev. Cell, 2014 or Eguether et al, mol.biol.cell, 2018). In our study, we have already included supporting evidence for pathway activation in Supplementary Figure S1b, showing Gli1 expression levels in untreated MEFs transfected with SmoM2, which illustrates the extent of its activation compared to ligand-induced conditions.

In line with the reviewer's recommendation, we will additionally include microscopy data showing SmoM2 localization in MEFs treated with the different sterol modulators. These data should confirm that the observed effects are not due to altered ciliary trafficking of the mutant protein but instead reflect changes in downstream signaling or membrane composition.

Minor comments:

Line 74: 'in patients', should be rephrased to 'patient-derived cells'

This was modified in the revised manuscript

Figure 2A: What do the '+/-' indicate? They seem to be erroneously placed.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Figure 2B: no label present for which bar represents cilia/other membranes

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Figure 2C: this representation is slightly deceptive, since the difference between cells and cilia for lanosterol is not significantly different as shown in figure 2A.

This representation has been removed in the revised figures.

Figure 3A: it would be useful to also show where 8-DHC is in the biosynthetic pathway.

This has been modified in the revised figures.

Line 373: the title should be rephrased as it infers that DHCR7 was blocked in model membranes, which is not the case.

This has been modified in the revised manuscript.

Lines 377-384: this paragraph seems to be a mix of methods and some explanation, but should be rephrased for clarity.

We believe the technical information within this paragraph are useful for the understanding of the reader. We would rather leave as is unless recommended by other reviewers or editorial staff.

Line 403: 'which could explain the resulting defects in Hedgehog signaling': how and what defects? At this point in the study no defects in Hh signaling have been shown.

This has been modified in the revised manuscript.

Figure 4D: 'd' is missing

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Line 408: SAG treatment resulted in slightly shorter cilia: this is not the case for just SAG treated cilia, but only for the combination of SAG + AY9944. However, in that condition there appears to be a subpopulation of very short cilia, are those real?

This is correct, this is not the case for untreated cilia, but the short population is real, not only in AY9944 but also in Tamoxifen and Simvastatin. Again, the relevance and significance of minor cilia length change is unclear and we are not trying to draw any other conclusion from this than saying that the ciliary compartment is modified.

Figure 5b: it would be good to add that all conditions contained SAG.

This has been modified in the revised figures.

Figure 5D: Since it is shown in Fig 5C that there are no positive cilia -SAG, there is no point to have empty graphs in Fig 5D on the left side, nor can any statistics be done. Similarly for 5K.

We think this is still worth having in the figure. As the reviewer noted in one of his next comment, there are cases where Smoothened or Patched can be abnormally distributed (see also Eguether et al, mol biol cell, 2018). This shows that we checked all conditions for presence or absence of Smo and that there is no signal to be found. We would rather leave it as is unless asked otherwise by editorial staff.

Figure 5E: it is not clearly indicated what is visualized in the inserts, sometimes it's a box, sometimes a line and they seem randomly integrated into the images.

We apologize for the oversight - the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Figure 5H: is this the intensity in just SMO positive cilia? If yes, this should be indicated, and the line at '0' for WT-SAG should be removed. I am also surprised there is then ns found for WT vs SLO, since in WT there are no positive cilia, but in SLO there are a few, so it appears to be more of a black-white situation. Perhaps it would be useful to split the data from different experiments to see if it consistently the case that there is a low percentage of SMO positive cilia in SLO cells.

Yes, as in the rest of figure 5, the fluorescence intensity of Smo is only taken into account in SMO positive cells. This is now indicated in figure legend (lines 890, 898, 903 ). As for Smo positive, this is a good suggestion. We checked and for cilia in non-activated SLO patients, there are 8 positive cilia over a total of 240 counted cilia, mainly from one of the experiments. We could remove the data or leave as is given that the result is not significant.

Fig S1: panels are inverted compared to mentioning in the text.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Methods-pharmacological treatments: there appear to be large differences in concentrations chosen to treat MDCK versus MEF cells - can the authors comment on these choices and show that the enzymes are indeed inhibited at the indicated concentrations?

We thank the reviewer for this important comment. The concentrations of the pharmacological treatments were optimized separately for MDCK and MEF cells based on cell-type-specific tolerance. For each compound, we used the highest concentration that produced no detectable cytotoxicity or morphological changes. These conditions ensured that the treatments were effective (as seen by changes in sterol composition in MDCK cilia and Hh pathway phenotypes in treated MEFs) and compatible with cell viability and ciliation. Although we did not directly assay enzymatic inhibition in each case, the selected concentrations are consistent with those previously reported to inhibit the targeted enzymes in similar cellular contexts.

Compound

Typical Concentration Range in Mammalian Cell Culture

Typical Exposure Duration

Example Cell Types

Representative Peer-Reviewed References

AY9944 (DHCR7 inhibitor)

1-10 µM widely used; 1 µM for minimal on-target effects; 2.5-10 µM for robust sterol shifts

24-72 h; some sterol studies up to several days

HEK293, fibroblasts, neuronal cells, macrophages

Kim et al., J Biol Chem, 2001 - used 1 µM in dose-response experiments.; Haas et al., Hum Mol Genet, 2007 - 1 µM in cell-based assays.; Recent macrophage sterol study - 2.5-10 µM to induce 7-DHC accumulation.

Simvastatin (HMG-CoA reductase inhibitor)

0.1-10 µM common; 1-10 µM most widely used for robust pathway inhibition

24-72 h

Diverse mammalian lines, including liver, fibroblasts, epithelial cells

Bytautaite et al., Cells (2020) - discusses common in-vitro ranges (1-10 µM).; Mullen et al., 2011 - used 10 µM simvastatin, noting it is a standard in-vitro concentration.

Tamoxifen (modulator of sterol metabolism)

1-20 µM; 1-5 µM for mild/longer treatments; 10-20 µM in cancer/cilia signaling studies

24-72 h (longer treatments often at 1-5 µM)

MDCK, MEFs, MCF-7, diverse epithelial lines

Schlottmann et al., Cells (2022) - used 5-25 µM in sterol-related cell studies.; MCF-7 literature - 0.1-1 µM for estrogenic signaling, higher (5-10 µM) for metabolic/sterol pathway effects.; Additional cancer cell work indicating similar ranges.

This information has been clarified in the revised Methods section (lines 222-224).

(optional): it would be interesting to include a gamma-tubulin staining on the cilium prep to see if there is indeed a presence of the basal body as suggested by the proteomics data.

Thank you, we will try this.

There are many spelling mistakes and inconsistencies throughout the manuscript and its figures (mix of French and English for example) so careful proofreading would be warranted. Moreover, there are many mentionings of 'Hedgehog defects' or 'Hedgehog-linked', where in fact it is a defect in or link to the Hedgehog pathway, not the protein itself. This should be corrected.

We thank the reviewer for noting these issues. We apologize for the inconsistencies observed in the initial submission, as mentioned previously, some of the figures inadvertently included earlier versions, which may have contributed to the errors identified. All figures have now been carefully revised and updated in the resubmitted manuscript.

Regarding the text, we are surprised to hear about the spelling inconsistencies, as the manuscript was professionally proofread prior to submission (documentation can be provided upon request). Nevertheless, we have conducted an additional round of thorough proofreading to ensure consistency throughout the text and figures.

Finally, we have corrected all instances of "Hedgehog defects" or "Hedgehog-linked" to the more accurate phrasing "Hedgehog pathway defect" or "Hedgehog pathway-linked," as suggested by the reviewer throughout the manuscript.

Reviewer #1 (Significance (Required)):

The study of ciliary membrane composition is highly relevant to understand signal transduction in health and disease. As such, the topic of this manuscript is significant and timely. However, as indicated above, there are limitations to this study, most notably the comparison of ciliary membrane versus all cellular membranes (rather than the plasma membrane), which weakens the conclusions that can be drawn. Moreover, cell-type dependency should be more thoroughly addressed. There certainly is a methodological advance in the form of cilia isolation from MDCK cells, however, it is unclear how broadly applicable this is to other mammalian cell types.

We would like to thank the reviewer for their helpful comments and we appreciate the reviewer's recognition of the relevance and timeliness of studying ciliary membrane composition in the context of signaling regulation. We fully acknowledge that our comparison was made between the primary ciliary membrane and the total cellular membrane fraction, which encompasses multiple intracellular membranes. Our intent, however, was to obtain a global overview of how the ciliary membrane differs from the average membrane environment within the cell, thereby highlighting features that are unique to the cilium as a signaling organelle. This approach provides valuable baseline information that complements, rather than replaces, future targeted comparisons with the plasma membrane. As mentioned in this reply, we aim at carrying out these experiments before publication. Regarding cell-type dependency, we concur that ciliary lipid composition may vary between cell types, reflecting differences in their functional specialization. Our method was intentionally established in MDCK cells, which are epithelial and highly ciliated, to ensure sufficient yield and reproducibility. We have initiated trials with other mammalian cell types, including IMCD3 and MEF cells, and while yields remain limited, preliminary results indicate that the approach is adaptable with further optimization. Thus, our current work establishes a robust and reproducible proof of concept in a mammalian model, providing the first detailed sterol fingerprint of a mammalian primary cilium.

We believe this constitutes a significant methodological and conceptual advance, as it opens the way for systematic exploration of ciliary lipid composition across diverse mammalian systems and pathological contexts.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Overview Accumulating evidence suggests that sterols play critical roles in signal transduction within the primary cilium, perhaps most notably in the Hedgehog cascade. However, the precise sterol composition of the primary cilium, and how it may change under distinct biological conditions, remains unknown, in part because of the lack of reproducible, widely accepted procedures to purify primary cilia from mammalian cultured cells. In the present study, the authors have designed a method to isolate the cilium from the MDCK cells efficiently and then utilized this procedure in conjunction with mass spectrometry to systematically analyze the sterol composition of the ciliary membrane, which they then compare to the sterol composition of the cell body. By analyzing this sterol profiling. the authors claim that the cilium has a distinct sterol composition from the cell body, including higher levels of cholesterol and desmosterol but lower levels of 8-DHC and & Lathosterol. This manuscript further demonstrates that alteration of sterol composition within cilia modulates Hedgehog signaling. These results strengthen the link between dysregulated Hedgehog signaling and defects in cholesterol biosynthesis pathways, as observed in SLOS and CDPX2.

While the ability to isolate primary cilia from cultured MDCK cells represents an important technical achievement, the central claim of the manuscript - that cilia have a different sterol composition from the cell body - is not adequately supported by the data, and more rigorous comparisons between the ciliary membrane and key organellar membranes (such as plasma membrane) are required to make this claim. Moreover, although the authors have repeatedly mention that the ciliary sterol composition is "tightly regulated" there is no evidence provided to support such claim. At best, the data suggest that the cilium and cell body may differ in sterol composition (though even that remains uncertain), but no underlying regulatory mechanisms are demonstrated. In addition, much of the 2nd half of the paper represents a rehash of experiments with sterol biosynthesis inhibitors that have already been published in the literature, making the conceptual advance modest at best. Lastly, the link between CDPX2 and defective Hedgehog signaling is tenuous.

We would like to thank the reviewer for their helpful comments

Major comments

Figure 1. C) Although the isolation of cilium from the MDCK cells using dibucaine treatment seems to be very efficient, the quality control of their fractionation procedure to monitor the isolation is limited to a single western blot of the purified cilia vs. cell body samples, with no representative data shown from the sucrose gradient fractionation steps. Given that prior studies (including those from the Marshall lab cited in this manuscript) found that 1) sucrose gradient fractionation was essential to obtain relatively pure ciliary fractions, and 2) the ciliary fractions appear to spread over many sucrose concentrations in those prior studies , the authors should have included the comparison of the fractionation profile from the sucrose gradient while isolating the primary cilium. This additional information would have further clarified and supported the efficiency of their proposed method.

We thank the reviewer for their insightful comments regarding the quality control of our ciliary fractionation. We would like to clarify several important methodological aspects that distinguish our approach from those used in the studies cited (including those from the Marshall lab). In the cited work, the authors used a continuous sucrose gradient ranging from 30 % to 45 %, which allowed visualization of the distribution of ciliary proteins across the gradient. In contrast, we employed a discontinuous sucrose gradient (25 % / 50 %) optimized for higher recovery and reproducibility in our hands. In our preparation, the primary cilia consistently localize at the interface between the 25 % and 50 % layers. We systematically collect five 1 mL fractions from this interface and use fractions 1-3 for downstream analyses, as fractions 4-5 are typically already depleted of ciliary material. This targeted collection ensures good enrichment and low contamination, while avoiding unnecessary dilution of the limited ciliary sample. We also note that the prior studies the reviewer refers to were optimized for proteomic analyses, and therefore used actin as a marker of contamination from the cell body. In our case, the downstream application is lipidomic profiling, for which such protein-based contamination markers are not directly informative, since no reliable lipid marker exists to differentiate between organelle membranes. For this reason, we limited the protein-level validation to a semi-quantitative assessment of ciliary enrichment using ARL13B Western blotting, which robustly reports the presence and enrichment of ciliary membranes. Finally, to complement this targeted validation, we performed proteomic analysis followed by Gene Ontology (GO) Enrichment Analysis using the PANTHER database. This analysis evaluates the overrepresentation of proteins associated with ciliary structures and functions relative to the background frequency in the Canis lupus familiaris proteome. The resulting enrichment profile confirms that the isolated material is highly enriched in ciliary components and somewhat depleted of non-ciliary contaminants, thereby serving as an unbiased and global assessment of sample specificity and purity. We believe that, together, these methodological choices provide a rigorous and quantitative validation of our fractionation efficiency and support the robustness of the cilia isolation protocol used in this study.

1. D) The authors presented proteomic data for the peptides analyzed from the isolated cilia in the form of GO term analysis; however, they did not provide examples of different proteins enriched within their fractionation procedure, aside from Arl13b shown in the blot. Including a summary table with representative proteins identified in the isolated ciliary fraction, along with the relative abundance or percentage distribution of these proteins, would make the data more informative.

We thank the reviewer for this valuable suggestion. As mentioned in the manuscript, our proteomic dataset includes numerous hallmark components of the cilium, such as 18 IFT proteins, 4 BBS proteins, and several Hedgehog pathway components (including SuFu and Arl13b), as well as axonemal (Tubulin, Kinesin, Dynein) and centrosomal proteins (Centrin, CEPs, γ-Tubulin, and associated factors). This composition demonstrates that the isolated fraction is highly enriched in bona fide ciliary components while retaining a small proportion of basal body proteins, which is expected given their physical continuity. Importantly, our dataset shows a 70% overlap with the ciliary proteome published by Ishikawa et al. and a 41% overlap with the CysCilia consortium's list of potential ciliary proteins, which supports both the specificity and reliability of our isolation procedure. Regarding the suggestion to present relative protein abundances, we would like to clarify that defining "relative to what" is challenging in this context. The stoichiometry of ciliary proteins is largely unknown, and relative abundance normalized to total protein content can be misleading, as ciliary structural and signaling components differ greatly in copy number and membrane association. For this reason, we chose to highlight in the text proteins such as BBS and IFTs, which are known to be of low abundance within the cilium; their detection supports the depth and specificity of our proteomic coverage. In addition, we performed an unbiased Gene Ontology (GO) Enrichment Analysis using the PANTHER database, which provides a systematic and quantitative overview of the biological processes and cellular components overrepresented in our dataset relative to the canine proteome. This analysis with regard to purity wa already discussed in the submitted manuscript discussion. To further address the reviewer's comment, we will include as a supplemental table in the revised manuscript, a summary table listing representative ciliary proteins identified in our fraction, including those overlapping with the CysCilia (Gold ans potential lists), CiliaCarta and Ishikawa/Marshall proteomes. This addition should make the dataset more transparent and informative while preserving scientific rigor.

Figure 2.

The authors represented the comparison of sterol content within the cilia versus whole cell (as cell membranes). Since different organelles have a very diverse degree of cholesterol contents within them, for instance plasma membrane itself is around 50 mol% cholesterol levels while organelles like ER have barely any cholesterol. Thus, comparing these two samples and claiming a 2.5-fold increase in cholesterol levels is misleading. A more appropriate comparison would be between isolated primary cilia and isolated plasma membranes (procedures to isolate plasma membranes have been described previously, e.g., Naito et al., eLife 2019; Das et al, PNAS 2013. The absence of such controls makes it difficult to fully validate the reported magnitude of sterols enrichment in cilia relative to the cell surface.

As already discussed above for reviewer 1, we would like to emphasize that our study did not aim to compare the cilium directly to the plasma membrane, nor did we claim that the comparison was in any way related to the plasma membrane. Our intent, was to obtain a global overview of how the ciliary membrane differs from the average membrane environment within the cell, thereby highlighting features that are unique to the cilium as a signaling organelle. This approach provides valuable baseline information that complements, rather than replaces, future targeted comparisons with the plasma membrane. However, we concur that determining the sterol composition of the MDCK plasma membrane would provide valuable context and enable a comparison with the membrane continuous with the ciliary membrane. Hence, we are willing to try isolating plasma membrane in the same cellular contexts, and we thank the reviewer for the proposed literature.

Also, because dibucaine was used here to isolate MDCK cilia, a control experiment to exclude possible effects of the dibucaine treatment on sterol biosynthesis would be helpful.

Thank you for this comment, we will verify this point by quantifying by GC-MS the sterol content of whole MDCK cells with and without 15 minutes-dibucaine treatments.

Figure 3.

Tamoxifen is a potent drug for nuclear hormone receptor activity and thus can independently influence various cellular processes. As several experiments in the later sections of the manuscript rely on tamoxifen treatment of cells, it is important that the authors include appropriate controls for tamoxifen treatment, to confirm that the observed effects do not stem from effects on nuclear hormone receptor activity. This would ensure that the observed effects can be confidently attributed to the experimental manipulation rather than to the intrinsic effects of tamoxifen.

The reviewer is right, tamoxifen, like many drugs, has pleiotropic effects in different cell processes. Aware of this possible issue, we turned to a genetic model creating a CRISPR-CAS9 mediated knock down of EBP, the enzyme targeted by tamoxifen. We showed in figure 5 that the results between tamoxifen treated cells and CRIPSR EBP cells were in accordance with one another, showing that, for hedgehog signaling, the effect of tamoxifen recapitulates the effect of the enzyme KO.

Figure4. The authors present the results of spectroscopy studies to analyze generalized polarization (GP) of liposomes in vitro , but only processed data are shown, and the raw spectra are not provided. The authors need to present representative spectra to enable the readers to interact the raw data from the experiments.

This has been added to new supplemental figure 1 and corresponding figure legend (lines 898-904)

Figure5. B) The experiment shown Gli1 mRNA levels following treatment with inhibitors of cholesterol biosynthesis, but similar findings have already been reported previously (e.g., Cooper et al, Nature Genetics 2003; Blassberg et al, Hum Mol Genet 2016), and the present results do not provide a significant conceptual advance over those earlier studies.

We thank the reviewer for this comment and for highlighting the importance of earlier studies on Hedgehog (Hh) signaling and cholesterol metabolism. While we fully agree that confirming and extending established findings has intrinsic scientific value, we respectfully disagree with the assertion that our work does not provide conceptual novelty.

The seminal work by Cooper et al. (Nature Genetics, 2003) indeed laid the foundation for linking sterol metabolism to Hedgehog signaling, and we cite it as such. However, that study was conducted in chick embryos, a model that is relatively distant from mammalian systems and human pathophysiology. Moreover, their approach relied heavily on cyclodextrin-mediated cholesterol depletion, which is non-specific and extracts multiple sterols from membranes (discussed in this article lines 512-516). In contrast, our study employs pharmacological inhibitors targeting specific enzymes in the sterol biosynthetic pathway, thereby allowing us to modulate distinct steps and intermediates in a controlled and mechanistically informative manner. We also extend these analyses to patient-derived fibroblasts and CRISPR-engineered cells, providing direct human and genetic validation of the observed effects. Importantly, we complement these cellular studies with biochemical characterization of isolated ciliary membranes from MDCK cells, enabling a direct assessment of how specific sterol alterations affect ciliary composition and Hh pathway function - an angle not addressed in prior work.

Regarding Blassberg et al. (Hum. Mol. Genet., 2016), we agree that part of our findings recapitulates their observations on SMO-related signaling defects, which we view as an important confirmation of reproducibility. However, their study primarily sought to distinguish whether Hh pathway impairment in SLOS results from 7-DHC accumulation or cholesterol depletion, concluding that cholesterol deficiency was the main cause. Our results expand on this by demonstrating that perturbations extend beyond these two sterols, and that additional intermediates in the biosynthetic pathway also impact ciliary membrane composition and signaling competence. Furthermore, our experiments using the constitutively active SmoM2 mutant show that Hh signaling defects are not restricted to SMO activation per se, revealing a broader disruption of the signaling machinery within the cilium.

Finally, neither of the above studies examined CDPX2 patient-derived cells or the consequences of EBP enzyme deficiency on Hh signaling. Our finding that this pathway is altered in this genetic context represents, to our knowledge, a novel link between CDPX2 and Hedgehog pathway dysfunction.

Taken together, our work builds upon and extends previous findings by integrating cell-type-specific, biochemical, and patient-based analyses to provide a more comprehensive and mechanistically detailed view of how sterol composition of the ciliary membrane regulates Hedgehog signaling.

In addition, the authors analyze the effect of these inhibitors on SAG stimulation, but the experiment lacks the control for Gli mRNA levels in the absence of SAG treatment. Without this control, it is impossible to know where the baseline in the experiment is and how large the effects in question really are.

Below, we provide the data expressed using the ΔΔCt method (NT + SAG normalized to NT - SAG), which more clearly illustrates the magnitude of the effect in question. As similar qPCR-based Hedgehog pathway activation assays in MEFs have been published previously (see Eguether et al., Dev. Cell 2014; Eguether et al., Mol. Biol. Cell 2018), our goal here was not to re-establish the assay itself but to highlight the comparative effects across experimental conditions. In addition, one of the datasets was obtained using a new batch of SAG, which exhibited stronger pathway activation across all conditions (visible as higher overall expression levels). To ensure valid statistical comparisons across experiments and to focus on relative rather than absolute activation, we therefore chose to present the data as fold change values, which provides a more robust and statistically consistent measure for cross-condition analysis.

J-K) The data represented in these panels for SAG treatment as fraction of Smo and its fluorescence intensity for the same sample appears to be inconsistent between the two graphs. Under SAG treatment for EBP mutants shows higher Smo fluorescence intensity while Smo positive cilia seems to be less than the wild type control cells. If the number of Smo+ cilia (quantified by eye) differs between conditions, shouldn't the quantification of Smo intensity within cilia show a similar difference?

We thank the reviewer for this careful observation. The apparent discrepancy arises because the two panels quantify different parameters. In panel (j), we counted the percentage of cilia positive for SMO (i.e., cilia in which SMO was detected above background). In contrast, panel (k) reports the fluorescence intensity of SMO, but this measurement was performed only within the SMO-positive cilia identified in panel (j). This distinction has now been explicitly clarified in the figure legend, as also suggested by Reviewer 1.

Taken together, these two analyses indicate that although fewer cilia display detectable SMO accumulation in the EBP mutant cells, the amount of SMO present within those cilia that do recruit it is comparable to wild-type levels (as reflected by the non-significant difference in fluorescence intensity). This interpretation helps explain the partial functional preservation of Hedgehog signaling in this condition and contrasts with cases such as AY9944 treatment, where both the number of SMO-positive cilia and the SMO intensity are reduced.

1. I) The rationale for using SmoM2 in the analysis of cholesterol metabolism-related diseases such as SLOS and CDPX2 is unclear. The SmoM2 variant is primarily associated with cancer rather than cholesterol biosynthesis defects and its relevance either of these disorders is not immediately apparent.

We thank the reviewer for this pertinent observation. We fully agree that SmoM2 was originally identified as an oncogenic mutation and is not directly associated with cholesterol biosynthesis disorders. However, our rationale for using this mutant was mechanistic rather than pathological. SmoM2 is a constitutively active form of SMO that triggers pathway activation independently of upstream components such as PTCH1 or ligand-mediated regulation.

By using SmoM2, we aimed to determine whether the signaling defects observed under conditions that alter sterol metabolism (e.g., treatment with AY9944 or tamoxifen) occur upstream or downstream of SMO activation. The results demonstrate that, even when SMO is constitutively active, the Hedgehog pathway remains impaired under AY9944 treatment-and to a lesser extent with tamoxifen-indicating that these sterol perturbations disrupt the pathway beyond the level of SMO activation itself. In contrast, cells treated with simvastatin maintain normal pathway responsiveness, reinforcing the specificity of this effect.

This experiment is therefore central to our study, as it reveals that sterol imbalance can hinder Hedgehog signaling even in the presence of an active SMO, providing new insight into how membrane composition influences downstream signaling competence.

Minor corrections

1. Line 385 seems to be a bit confusing which mentions cilia were treated with AY9944 - do the authors mean that cells were been treated with the drugs before isolation of cilia, or were the purified cilia actually treated with the drugs?

Thank you, this has been modified in the revised manuscript

The authors should add proper label in Figure 2 panel b for the bars representing the cilia and cell membranes.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Panels in Figure S1 should be re-arranged according to the figure legend and figure reference in line 450.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Legend for the Figure S1b should be corrected as data sets in graph represents 7 points while technical replicates in legend shows 6 experimental values.

Thank you, this has been modified in the revised manuscript

The labels for drug in Figure 3 and 5 should be corrected from tamoxifene to tamoxifen and simvastatine to simvastatin.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

Reviewer #2 (Significance (Required)):

In the present study, the authors have designed a method to isolate the cilium from the MDCK cells efficiently and then utilized this procedure in conjunction with mass spectrometry to systematically analyze the sterol composition of the ciliary membrane, which they then compare to the sterol composition of the cell body. By analyzing this sterol profiling. the authors claim that the cilium has a distinct sterol composition from the cell body, including higher levels of cholesterol and desmosterol but lower levels of 8-DHC and & Lathosterol. This manuscript further demonstrates that alteration of sterol composition within cilia modulates Hedgehog signaling. These results strengthen the link between dysregulated Hedgehog signaling and defects in cholesterol biosynthesis pathways, as observed in SLOS and CDPX2.

While the ability to isolate primary cilia from cultured MDCK cells represents an important technical achievement, the central claim of the manuscript - that cilia have a different sterol composition from the cell body - is not adequately supported by the data, and more rigorous comparisons between the ciliary membrane and key organellar membranes (such as plasma membrane) are required to make this claim. Moreover, although the authors have repeatedly mention that the ciliary sterol composition is "tightly regulated" there is no evidence provided to support such claim. At best, the data suggest that the cilium and cell body may differ in sterol composition (though even that remains uncertain), but no underlying regulatory mechanisms are demonstrated. In addition, much of the 2nd half of the paper represents a rehash of experiments with sterol biosynthesis inhibitors that have already been published in the literature, making the conceptual advance modest at best. Lastly, the link between CDPX2 and defective Hedgehog signaling is tenuous.

We thank the reviewer for this detailed summary and for acknowledging the technical advance represented by our method for isolating primary cilia from MDCK cells. However, we respectfully disagree with several aspects of the reviewer's assessment of our work.

As we elaborated in our responses to earlier comments, particularly regarding Figure 5, we disagree with the characterization of part of our study as a "rehash", a somewhat derogatory word, of previously published experiments. Our approach differs from earlier studies by relying on specific pharmacological modulation of defined enzymes in the sterol biosynthesis pathway, rather than using non-specific agents such as cyclodextrins, and by linking these manipulations to direct biochemical measurements of ciliary sterol composition. This strategy allows, for the first time, a targeted and physiologically relevant examination of how specific sterol perturbations affect Hedgehog signaling.

Regarding our statement that ciliary sterol composition is "tightly regulated," we acknowledge that we have not yet explored the underlying molecular mechanisms of this regulation. Nevertheless, the experimental evidence supporting this statement lies in the variation of ciliary sterol composition across multiple treatments that strongly perturb cellular sterols. Despite broad cellular changes, the ciliary sterol profile remains very resilient for some parameters, an observation that, in our view, strongly supports the idea of a selective or regulated process maintaining ciliary sterol identity. This conclusion does not depend on comparison with other membrane compartments.

We also respectfully disagree that the observed differences between cilia and the cell body (which doesn't equal to plasma membrane) are "uncertain." The consistent enrichment in cholesterol and desmosterol, combined with the relative depletion in 8-DHC and lathosterol, were detected across independent replicates using robust lipidomic profiling and are statistically supported. These findings are, to our knowledge, the first quantitative demonstration of a sterol fingerprint specific to a mammalian cilium.

Finally, while we agree that the mechanistic link between CDPX2 and defective Hedgehog signaling warrants further exploration, the data we present, combining pharmacological inhibition (tamoxifen), CRISPR-mediated EBP knockout, and SMOM2 activation assays, all consistently indicate a functional impairment of the Hedgehog pathway under EBP deficiency. This is further reinforced by clinical reports describing Hedgehog-related phenotypes in CDPX2 patients. We therefore believe that our work provides a solid experimental and conceptual basis for connecting EBP dysfunction to Hedgehog signaling defects.

In summary, our study introduces a validated and reproducible method for mammalian cilia isolation, provides the first detailed sterol composition profile of primary cilia, and establishes a functional link between ciliary sterol imbalance and Hedgehog pathway modulation. We believe these findings represent a meaningful conceptual advance and a valuable resource for the field

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Lamaziere et al. describe an improved protocol for isolating primary cilia from MDCK cells for downstream lipidomics analysis. Using this protocol, they characterize sterol profile of MDCK cilia membrane under standard growth conditions and following pharmacological perturbations that are meant to mimic SLOS and CDPX2 disorders in humans. The authors then assess the impact of the same pharmacological manipulations on Shh pathway activity and validate their findings from these experiments using orthogonal genetic approaches. Major and minor concerns that require attention prior to publication are outlined below.

We would like to thank the reviewer for their comments

Major 1.Since the extent of contamination of the cilia preps with non-cilia membranes is unclear, and variability between replicates is not reported, it makes interpretation of changes in cilia membrane sterol composition in response to pharmacological manipulations somewhat difficult to interpret. Discussing reproducibility of cilia sterol composition between replicates (and including corresponding data) could alleviate these concerns to some extent.

We thank the reviewer for this comment. We would like to clarify that variability between replicates is indeed reported throughout the manuscript. In Figures 2 and 3, all data are presented as mean {plus minus} SEM, as indicated in the figure legends. Specifically, the data in Figure 2 are derived from six independent experiments, reflecting the central dataset used for comparative analyses, while the data in Figure 3 are based on three independent experiments.

We also note that the overall variability between replicates is low, further supporting the reproducibility of our ciliary sterol composition measurements. This consistency across independent biological replicates provides confidence that the differences observed between cilia and the cell body are robust and not due to stochastic contamination or technical variation.

2.An abundant non-ciliary membrane protein (rather than GAPDH) may be a more appropriate loading control in Fig. 1C.

This is a valuable comment and we will find a non-ciliary membrane protein to complement this experiment.

3.Fig. 2b - which bar corresponds to cells and which one to cilia? What do numbers inside bars represent? Please label accordingly.

We apologize for the oversight, the figures initially submitted with the manuscript inadvertently included some earlier versions, which explains several of the discrepancies noted by the reviewers. This issue has been corrected in the revised submission, and all figures have now been updated to reflect the finalized data.

4.Fig. 3b-d, right panels - please define what numbers inside bars represent

Thank you, this was done in the revised manuscript. The numbers are reports of absolute quantification.

5.The font in Figs 2, 3, and 4 is very small and difficult to read. Please make the font and/or panels bigger to improve readability.

We did our best to enlarge font despite space limitations, but we are willing to work with editorial staff to improve readability as suggested.

6.It would help to have a diagram of the key steps in the cholesterol synthesis pathway for reference early in the paper rather than in figure 3.

We thank the reviewer for his comment, but we don't understand why this would be helpful as we only use sterol modulators involving the pathway's enzyme in fig3. We are open to discussion with editorial staff about moving it up to fig2. If they feel this is needed

7.The authors need to discuss why/how global inhibition of enzymes (e.g. via AY9944 treatment) in a cell could cause reduction in cholesterol levels only in the cilium and not in other cell membranes (see also point 1). Yet, tamoxifen treatment lowers cholesterol across the board.

We thank the reviewer for these insightful comments. Regarding the modest overall effect of simvastatin on cholesterol levels, we would like to note that MDCK cells are an immortalized epithelial cell line with high metabolic plasticity. Such cancer-like cell types are known to exhibit enhanced de novo lipogenesis, particularly under culture conditions with ample glucose availability. This compensatory lipid biosynthesis can partially counterbalance pharmacological inhibition of the cholesterol biosynthetic pathway. Because simvastatin acts upstream in the pathway (at HMG-CoA reductase), its inhibition primarily reduces early intermediates rather than fully depleting end-product cholesterol, explaining the relatively mild changes observed in total cholesterol content. . This has been added in a new paragraph in the revised manuscript (lines 371-378).

8.Fig. 5c, g, and j - statistical analyses are missing and need to be added in support of conclusions drawn in the text of the manuscript.

Thank you, this has been done in the revised manuscript

9.The decrease in the fraction of Smo+ cilia observed in EBP KO cells is mild (panel j, no statistics), and there is possibly a clone-specific effect here as well (statistical analysis is needed to determine if EBP139 is indeed different from WT and whether EBP139 and 141 are different from each other). Similarly, Smo fluorescence intensity after SAG treatment (panel k) is the same in WT and EBP KO cells, while there is a marked difference in intraciliary Smo intensity after tamoxifen treatment. The author's conclusion "...we were able to show that results with human cells aligned with our tamoxifen experiments" (line 436) should be modified to more accurately reflect the presented data. Ditto conclusions on lines 440-442, 530-531. In fact, it is the lack of Hh phenotypes in CDPX2 patients that is consistent with the EBP KO data presented in the paper.

We thank the reviewer for this detailed comment. We have now performed the requested statistical analyses and incorporated them into the revised manuscript.

The new analyses confirm that both EBP139 and EBP141 CRISPR KO clones show a statistically significant reduction in the fraction of Smo⁺ cilia compared to WT cells. They also reveal that the two clones differ significantly from each other, consistent with the expected clonal variability inherent to independently derived CRISPR lines.

Despite this variability, several lines of evidence support our conclusion that the EBP KO phenotypes align with the effects observed after tamoxifen treatment:

1- Directionally consistent reduction in Smo⁺ cilia:

Although the magnitude of the decrease differs between clones, both clones display a significant reduction compared to WT, paralleling the reduction observed in tamoxifen-treated cells. This directional consistency is the key point for comparing pharmacological and genetic perturbations.

2-Converging evidence from SmoM2 experiments:

Tamoxifen treatment also reduces pathway output in the context of SmoM2 overexpression. This supports the interpretation that both EBP inhibition (tamoxifen) and EBP loss (CRISPR KO) impair Hedgehog signaling at the level of ciliary function, albeit more mildly than AY9944/SLOS-like perturbations.

3-Interpretation of Smo intensity (panel k):

As clarified in the revised text, the fluorescence intensities in panel K correspond only to cilia that are Smo-positive. The absence of a difference in intensity therefore does not contradict the observed reduction in the number of Smo⁺ cilia. Rather, it explains why the phenotype is milder than that observed for SLOS/AY9944: when Smo is able to enter the cilium, its enrichment level is comparable to WT.

4- Clinical relevance for CDPX2:

While Hedgehog-related phenotypes in CDPX2 patients may be milder or under-reported, several documented features, such as polydactyly (10% of cases), as well as syndactyly and clubfoot, are classically associated with ciliary/Hedgehog signaling defects. This clinical pattern is consistent with the milder yet detectable defects we observe in EBP KO cells.

Minor •Line 310: 'intraflagellar' rather than 'intraciliary' transport particle B is a more conventional term

We agree that intraflagellar is more conventional than intraciliary, but in this case, this is how the GO term is labeled in the database. In our opinion, it should stay as is.

• Fig. 2c - typos in the color key, is grey meant to be "cells" and blue "cilia"? Individual panels are not referenced in the text

This panel has been removed thanks to comment from reviewer 1 and 3 finding it misleading.

• Lines 357-358: "Notably, AY9944 treatment led to a greater reduction in cholesterol content as well as a greater increase in 7-DHC and 8-DHC in cilia than in the other cell membranes" - the authors need to support this statement with appropriate statistical analysis

We respectfully believe there may be a misunderstanding in the reviewer's concern. In all cases, our comparisons are made between treated vs. untreated conditions within each compartment (cell bulk vs. ciliary membrane), and the statistical significance of these differences is already reported as determined by a Mann-Whitney test. In every case, the changes observed are greater in cilia than in the cell body. The statement in the manuscript simply summarizes this quantitative observation. However, if the reviewer feels that an additional statistical test directly comparing the magnitude of the two compartment-specific changes would strengthen the claim, we are willing to include this analysis. Alternatively, if preferred, we can remove the sentence entirely, as the comparison is already clearly visible in Figure 3b.

• Line 473 - unclear what is meant by "olfactory cilia are mainly sensory and not primary". Primary cilia are sensory.

We agree, primary cilia are sensory, but still different from cilia belonging to sensory epithelia like retina photoreceptors or olfactory cilia. Nevertheless, this statement was modified in revised manuscript

• Line 551: 'data not shown'. Please include the data that you would like to discuss or remove discussion of these data from the manuscript.

The data is not shown because there is nothing to show, as we discussed in that sentence, use of cholesterol probe resulted in the disappearance of primary cilia altogether. We are willing to work with editorial staff to find a better way of expressing this idea.

Reviewer #3 (Significance (Required)):

Overall, the manuscript expands our knowledge of cilia membrane composition and reports an interesting link between SLOS and Shh signaling defects, which could at least in part explain SLOS patients' symptoms. The findings reported in the manuscript could be of interest to a broad audience of cell biologists and geneticists.

We would like to thank the reviewer for his recognition of the importance of this work

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Lamaziere et al. describe an improved protocol for isolating primary cilia from MDCK cells for downstream lipidomics analysis. Using this protocol, they characterize sterol profile of MDCK cilia membrane under standard growth conditions and following pharmacological perturbations that are meant to mimic SLOS and CDPX2 disorders in humans. The authors then assess the impact of the same pharmacological manipulations on Shh pathway activity and validate their findings from these experiments using orthogonal genetic approaches. Major and minor concerns that require attention prior to publication are outlined below.

Major

1. Since the extent of contamination of the cilia preps with non-cilia membranes is unclear, and variability between replicates is not reported, it makes interpretation of changes in cilia membrane sterol composition in response to pharmacological manipulations somewhat difficult to interpret. Discussing reproducibility of cilia sterol composition between replicates (and including corresponding data) could alleviate these concerns to some extent.
2. An abundant non-ciliary membrane protein (rather than GAPDH) may be a more appropriate loading control in Fig. 1C.
3. Fig. 2b - which bar corresponds to cells and which one to cilia? What do numbers inside bars represent? Please label accordingly.
4. Fig. 3b-d, right panels - please define what numbers inside bars represent
5. The font in Figs 2, 3, and 4 is very small and difficult to read. Please make the font and/or panels bigger to improve readability.
6. It would help to have a diagram of the key steps in the cholesterol synthesis pathway for reference early in the paper rather than in figure 3.
7. The authors need to discuss why/how global inhibition of enzymes (e.g. via AY9944 treatment) in a cell could cause reduction in cholesterol levels only in the cilium and not in other cell membranes (see also point 1). Yet, tamoxifen treatment lowers cholesterol across the board.
8. Fig. 5c, g, and j - statistical analyses are missing and need to be added in support of conclusions drawn in the text of the manuscript.
9. The decrease in the fraction of Smo+ cilia observed in EBP KO cells is mild (panel j, no statistics), and there is possibly a clone-specific effect here as well (statistical analysis is needed to determine if EBP139 is indeed different from WT and whether EBP139 and 141 are different from each other). Similarly, Smo fluorescence intensity after SAG treatment (panel k) is the same in WT and EBP KO cells, while there is a marked difference in intraciliary Smo intensity after tamoxifen treatment. The author's conclusion "...we were able to show that results with human cells aligned with our tamoxifen experiments" (line 436) should be modified to more accurately reflect the presented data. Ditto conclusions on lines 440-442, 530-531. In fact, it is the lack of Hh phenotypes in CDPX2 patients that is consistent with the EBP KO data presented in the paper.

Minor

• Line 310: 'intraflagellar' rather than 'intraciliary' transport particle B is a more conventional term
• Fig. 2c - typos in the color key, is grey meant to be "cells" and blue "cilia"? Individual panels are not referenced in the text
• Lines 357-358: "Notably, AY9944 treatment led to a greater reduction in cholesterol content as well as a greater increase in 7-DHC and 8-DHC in cilia than in the other cell membranes" - the authors need to support this statement with appropriate statistical analysis
• Line 473 - unclear what is meant by "olfactory cilia are mainly sensory and not primary". Primary cilia are sensory.
• Line 551: 'data not shown'. Please include the data that you would like to discuss or remove discussion of these data from the manuscript.

Significance

Overall, the manuscript expands our knowledge of cilia membrane composition and reports an interesting link between SLOS and Shh signaling defects, which could at least in part explain SLOS patients' symptoms. The findings reported in the manuscript could be of interest to a broad audience of cell biologists and geneticists.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Overview

Accumulating evidence suggests that sterols play critical roles in signal transduction within the primary cilium, perhaps most notably in the Hedgehog cascade. However, the precise sterol composition of the primary cilium, and how it may change under distinct biological conditions, remains unknown, in part because of the lack of reproducible, widely accepted procedures to purify primary cilia from mammalian cultured cells. In the present study, the authors have designed a method to isolate the cilium from the MDCK cells efficiently and then utilized this procedure in conjunction with mass spectrometry to systematically analyze the sterol composition of the ciliary membrane, which they then compare to the sterol composition of the cell body. By analyzing this sterol profiling. the authors claim that the cilium has a distinct sterol composition from the cell body, including higher levels of cholesterol and desmosterol but lower levels of 8-DHC and & Lathosterol. This manuscript further demonstrates that alteration of sterol composition within cilia modulates Hedgehog signaling. These results strengthen the link between dysregulated Hedgehog signaling and defects in cholesterol biosynthesis pathways, as observed in SLOS and CDPX2.

While the ability to isolate primary cilia from cultured MDCK cells represents an important technical achievement, the central claim of the manuscript - that cilia have a different sterol composition from the cell body - is not adequately supported by the data, and more rigorous comparisons between the ciliary membrane and key organellar membranes (such as plasma membrane) are required to make this claim. Moreover, although the authors have repeatedly mention that the ciliary sterol composition is "tightly regulated" there is no evidence provided to support such claim. At best, the data suggest that the cilium and cell body may differ in sterol composition (though even that remains uncertain), but no underlying regulatory mechanisms are demonstrated. In addition, much of the 2nd half of the paper represents a rehash of experiments with sterol biosynthesis inhibitors that have already been published in the literature, making the conceptual advance modest at best. Lastly, the link between CDPX2 and defective Hedgehog signaling is tenuous.

Major comments

Figure 1.

C) Although the isolation of cilium from the MDCK cells using dibucaine treatment seems to be very efficient, the quality control of their fractionation procedure to monitor the isolation is limited to a single western blot of the purified cilia vs. cell body samples, with no representative data shown from the sucrose gradient fractionation steps. Given that prior studies (including those from the Marshall lab cited in this manuscript) found that 1) sucrose gradient fractionation was essential to obtain relatively pure ciliary fractions, and 2) the ciliary fractions appear to spread over many sucrose concentrations in those prior studies , the authors should have included the comparison of the fractionation profile from the sucrose gradient while isolating the primary cilium. This additional information would have further clarified and supported the efficiency of their proposed method. D) The authors presented proteomic data for the peptides analyzed from the isolated cilia in the form of GO term analysis; however, they did not provide examples of different proteins enriched within their fractionation procedure, aside from Arl13b shown in the blot. Including a summary table with representative proteins identified in the isolated ciliary fraction, along with the relative abundance or percentage distribution of these proteins, would make the data more informative.

Figure 2.

The authors represented the comparison of sterol content within the cilia versus whole cell (as cell membranes). Since different organelles have a very diverse degree of cholesterol contents within them, for instance plasma membrane itself is around 50 mol% cholesterol levels while organelles like ER have barely any cholesterol. Thus, comparing these two samples and claiming a 2.5-fold increase in cholesterol levels is misleading. A more appropriate comparison would be between isolated primary cilia and isolated plasma membranes (procedures to isolate plasma membranes have been described previously, e.g., Naito et al., eLife 2019; Das et al, PNAS 2013. The absence of such controls makes it difficult to fully validate the reported magnitude of sterols enrichment in cilia relative to the cell surface. Also, because dibucaine was used here to isolate MDCK cilia, a control experiment to exclude possible effects of the dibucaine treatment on sterol biosynthesis would be helpful.

Figure 3.

Tamoxifen is a potent drug for nuclear hormone receptor activity and thus can independently influence various cellular processes. As several experiments in the later sections of the manuscript rely on tamoxifen treatment of cells, it is important that the authors include appropriate controls for tamoxifen treatment, to confirm that the observed effects do not stem from effects on nuclear hormone receptor activity. This would ensure that the observed effects can be confidently attributed to the experimental manipulation rather than to the intrinsic effects of tamoxifen.

Figure4.

The authors present the results of spectroscopy studies to analyze generalized polarization (GP) of liposomes in vitro , but only processed data are shown, and the raw spectra are not provided. The authors need to present representative spectra to enable the readers to interact the raw data from the experiments.

Figure5.

B) The experiment shown Gli1 mRNA levels following treatment with inhibitors of cholesterol biosynthesis, but similar findings have already been reported previously (e.g., Cooper et al, Nature Genetics 2003; Blassberg et al, Hum Mol Genet 2016), and the present results do not provide a significant conceptual advance over those earlier studies. In addition, the authors analyze the effect of these inhibitors on SAG stimulation, but the experiment lacks the control for Gli mRNA levels in the absence of SAG treatment. Without this control, it is impossible to know where the baseline in the experiment is and how large the effects in question really are. J-K) The data represented in these panels for SAG treatment as fraction of Smo and its fluorescence intensity for the same sample appears to be inconsistent between the two graphs. Under SAG treatment for EBP mutants shows higher Smo fluorescence intensity while Smo positive cilia seems to be less than the wild type control cells. If the number of Smo+ cilia (quantified by eye) differs between conditions, shouldn't the quantification of Smo intensity within cilia show a similar difference? I) The rationale for using SmoM2 in the analysis of cholesterol metabolism-related diseases such as SLOS and CDPX2 is unclear. The SmoM2 variant is primarily associated with cancer rather than cholesterol biosynthesis defects and its relevance either of these disorders is not immediately apparent.

Minor corrections

1. Line 385 seems to be a bit confusing which mentions cilia were treated with AY9944 - do the authors mean that cells were been treated with the drugs before isolation of cilia, or were the purified cilia actually treated with the drugs?
2. The authors should add proper label in Figure 2 panel b for the bars representing the cilia and cell membranes.
3. Panels in Figure S1 should be re-arranged according to the figure legend and figure reference in line 450.
4. Legend for the Figure S1b should be corrected as data sets in graph represents 7 points while technical replicates in legend shows 6 experimental values.
5. The labels for drug in Figure 3 and 5 should be corrected from tamoxifene to tamoxifen and simvastatine to simvastatin.

Significance

In the present study, the authors have designed a method to isolate the cilium from the MDCK cells efficiently and then utilized this procedure in conjunction with mass spectrometry to systematically analyze the sterol composition of the ciliary membrane, which they then compare to the sterol composition of the cell body. By analyzing this sterol profiling. the authors claim that the cilium has a distinct sterol composition from the cell body, including higher levels of cholesterol and desmosterol but lower levels of 8-DHC and & Lathosterol. This manuscript further demonstrates that alteration of sterol composition within cilia modulates Hedgehog signaling. These results strengthen the link between dysregulated Hedgehog signaling and defects in cholesterol biosynthesis pathways, as observed in SLOS and CDPX2.

While the ability to isolate primary cilia from cultured MDCK cells represents an important technical achievement, the central claim of the manuscript - that cilia have a different sterol composition from the cell body - is not adequately supported by the data, and more rigorous comparisons between the ciliary membrane and key organellar membranes (such as plasma membrane) are required to make this claim. Moreover, although the authors have repeatedly mention that the ciliary sterol composition is "tightly regulated" there is no evidence provided to support such claim. At best, the data suggest that the cilium and cell body may differ in sterol composition (though even that remains uncertain), but no underlying regulatory mechanisms are demonstrated. In addition, much of the 2nd half of the paper represents a rehash of experiments with sterol biosynthesis inhibitors that have already been published in the literature, making the conceptual advance modest at best. Lastly, the link between CDPX2 and defective Hedgehog signaling is tenuous.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Review report for 'Sterols regulate ciliary membrane dynamics and hedgehog signaling in health and disease', Lamazière et al.

In this manuscript, Lamazière et al. address an important understudied aspect of primary cilium biology, namely the sterol composition in the ciliary membrane. It is known that sterols especially play an important role in signal transduction between PTCH1 and SMO, two upstream components of the Hedgehog pathway, at the primary cilium. Moreover, several syndromes linked to cholesterol biosynthesis defects present clinical phenotypes indicative of altered Hh signal transduction. To understand the link between ciliary membrane sterol composition and Hh signal transduction in health and disease, the authors developed a method to isolate primary cilia from MDCK cells and coupled this to quantitative metabolomics. The results were validated using biophysical methods and cellular Hh signaling assays. While this is an interesting study, it is not clear from the presented data how general the findings are: can cilia be isolated from different mammalian cell types using this protocol? Is the sterol composition of MDCK cells expected to the be the same in fibroblasts or other cell types? Without this information, it is difficult to judge whether the conclusions reached in fibroblasts are indeed directly related to the sterol composition detected in MDCK cells. Below is a detailed breakdown of suggested textual changes and experimental validations to strengthen the conclusions of the manuscript.

Major comments:

• It appears that the comparison has been made between ciliary membranes and the rest of the cell's membranes, which includes many other membranes besides the plasma membrane. This significantly weakens the conclusions on the sterol content specific to the cilium, as it may in fact be highly similar to the rest of the plasma membrane. It is for example known that lathosterol is biosynthesized in the ER, and therefore the non-presence in the cilium may reflect a high abundance in the ER but not necessarily in the plasma membrane.
• While the protocol to isolate primary cilium from MDCK cells is a valuable addition to the methods available, it would be good to at least include a discussion on its general applicability. Have the authors tried to use this protocol on fibroblasts for example?
• Some of the conclusions in the introduction (lines 75-80) seem to be incorrectly phrased based on the data: in basal conditions, ciliary membranes are already enriched in cholesterol and desmosterol, and the treatment lowers this in all membranes.
• There seems to be little effect of simvastatin on overall cholesterol levels. Can the authors comment on this result? How would the membrane fluidity be altered when mimicking simvastatin-induced composition? Since the effect on Hh signaling appears to be the biggest (Figure 5B) under simvastatin treatment, it would be interesting to compare this against that found for AY9944 treatment. Also, the authors conclude that the effects of simvastatin treatment on ciliary membrane sterol composition are the mildest, however, one could argue that they are the strongest as there is a complete lack of desmosterol.
• It is not clear to me why the authors have chosen to use SAG to activate the Hh pathway, as this is a downstream mode of activation and bypasses PTCH1 (and therefore a potentially sterol-mediated interaction between the two proteins). It would be very informative to compare the effect of sterol modulation on the ability of ShhN vs SAG to activate the pathway.
• The conclusions about the effect of tamoxifen on SMO trafficking in MEFs should be validated in human patient cells before being able to conclude that there is a potential off-target effect (line 438). Also, if that is the case, the experiment of tamoxifen treatment of EBP KO cells should give an additional effect on SMO trafficking. Also, could the CDPX2 phenotypes in patients be the result of different cell types being affected than the fibroblast used in this study?
• For the experiments with the SMO-M2 mutant, it would be useful to show the extent of pathway activation by the mutant compared to SAG or ShhN treatment of non-transfected cells. Moreover, it will be necessary to exclude any direct effects of the compound treatment on the ability of this mutant to traffic to the primary cilium, which can easily be done using fluorescence microscopy as the mutant is tagged with mCherry.

Minor comments:

Line 74: 'in patients', should be rephrased to 'patient-derived cells'

Figure 2A: What do the '+/-' indicate? They seem to be erroneously placed.

Figure 2B: no label present for which bar represents cilia/other membranes

Figure 2C: this representation is slightly deceptive, since the difference between cells and cilia for lanosterol is not significantly different as shown in figure 2A.

Figure 3A: it would be useful to also show where 8-DHC is in the biosynthetic pathway.

Line 373: the title should be rephrased as it infers that DHCR7 was blocked in model membranes, which is not the case.

Lines 377-384: this paragraph seems to be a mix of methods and some explanation, but should be rephrased for clarity.

Line 403: 'which could explain the resulting defects in Hedgehog signaling': how and what defects? At this point in the study no defects in Hh signaling have been shown.

Figure 4D: 'd' is missing

Line 408: SAG treatment resulted in slightly shorter cilia: this is not the case for just SAG treated cilia, but only for the combination of SAG + AY9944. However, in that condition there appears to be a subpopulation of very short cilia, are those real?

Figure 5b: it would be good to add that all conditions contained SAG.

Figure 5D: Since it is shown in Fig 5C that there are no positive cilia -SAG, there is no point to have empty graphs in Fig 5D on the left side, nor can any statistics be done. Similarly for 5K.

Figure 5E: it is not clearly indicated what is visualized in the inserts, sometimes it's a box, sometimes a line and they seem randomly integrated into the images.

Figure 5H: is this the intensity in just SMO positive cilia? If yes, this should be indicated, and the line at '0' for WT-SAG should be removed. I am also surprised there is then ns found for WT vs SLO, since in WT there are no positive cilia, but in SLO there are a few, so it appears to be more of a black-white situation. Perhaps it would be useful to split the data from different experiments to see if it consistently the case that there is a low percentage of SMO positive cilia in SLO cells. Fig S1: panels are inverted compared to mentioning in the text.

Methods-pharmacological treatments: there appear to be large differences in concentrations chosen to treat MDCK versus MEF cells - can the authors comment on these choices and show that the enzymes are indeed inhibited at the indicated concentrations?

(optional): it would be interesting to include a gamma-tubulin staining on the cilium prep to see if there is indeed a presence of the basal body as suggested by the proteomics data.

There are many spelling mistakes and inconsistencies throughout the manuscript and its figures (mix of French and English for example) so careful proofreading would be warranted. Moreover, there are many mentionings of 'Hedgehog defects' or 'Hedgehog-linked', where in fact it is a defect in or link to the Hedgehog pathway, not the protein itself. This should be corrected.

Significance

The study of ciliary membrane composition is highly relevant to understand signal transduction in health and disease. As such, the topic of this manuscript is significant and timely. However, as indicated above, there are limitations to this study, most notably the comparison of ciliary membrane versus all cellular membranes (rather than the plasma membrane), which weakens the conclusions that can be drawn. Moreover, cell-type dependency should be more thoroughly addressed. There certainly is a methodological advance in the form of cilia isolation from MDCK cells, however, it is unclear how broadly applicable this is to other mammalian cell types.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

The authors do not wish to provide a response at this time.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

This manuscript investigates the role of DOT1L and its H3K79 methyltransferase activity in dendritic cell (DC) differentiation. The authors employ a combination of in vitro FLT3L/SCF bone marrow culture systems, in vivo inducible knockout models, and genome-wide H3K79me2 ChIP-seq and RNA-seq analyses to demonstrate that DOT1L influences the balance between pDC and cDC2 differentiation, while leaving cDC1 development largely unaffected. The study further identifies transcriptional and epigenetic programs associated with these changes, linking DOT1L deficiency to altered antigen presentation pathways and loss of pDC-associated transcription factors. The paper provides valuable insights into DC biology. However, some of the key conclusions rely heavily on in vitro systems and short-term tamoxifen deletion models, which limit the interpretation of the in vivo data. Strengthening or clearly defining these limitations would substantially improve the paper's impact and clarity.

Major Comments

1. To strengthen the paper, the authors could follow one of two alternative strategies:

(1) Validate their in vitro observations through in vivo experiments, or

(2) Focus on deepening and refining their in vitro findings, moving the limited in vivo data to the supplementary material and explicitly acknowledging the limitations of the tamoxifen-inducible system.

Strategy 1 - Strengthen in vivo validation

-   The experiments presented in Figures 3 and 5 could be repeated in a competitive bone marrow chimera setting (e.g. CD45.1/CD45.2 irradiated hosts reconstituted with a 1:1 mix of WT CD45.1⁺ and Dot1l-KO CD45.2⁺ cells).
-   This design would allow dissection of direct (cell-intrinsic) versus indirect effects of DOT1L deficiency and could mitigate confounding effects of incomplete or asynchronous deletion.
-   After reconstitution, mice could be maintained on tamoxifen-supplemented chow for a longer period to ensure efficient recombination and adequate time for observing phenotypic consequences.
-   Flow cytometric analysis of spleen and bone marrow should use more refined panels to explore DC precursor and subset deficiencies. Suggested reference panels: Rodrigues et al., Immunity 2024; Minutti et al., Nat. Immunol. 2024; Zhu et al., Nat. Immunol. 2015.

Strategy 2 - Refine in vitro system and reposition in vivo data - The authors could replicate their differentiation assays under conditions that emulate the chimera approach by co-culturing WT (CD45.1⁺) and Dot1l-KO (CD45.2⁺) bone marrow cells. - This would reveal potential competition or cross-talk between WT and mutant cells and provide clearer mechanistic insight into cell-intrinsic versus extrinsic effects. - The authors should examine how tamoxifen itself affects differentiation and measure the kinetics of deletion and H3K79me loss to better contextualize the dynamic response. - It would also be valuable to assess which cDC2 subtypes (A vs. B) are preferentially affected by Dot1l deficiency, again using more sophisticated flow cytometry panels (see references above). If this in vitro-focused strategy is adopted, the in vivo data could be moved to the supplementary material, with explicit acknowledgment that the inducible deletion model and the gradual nature of H3K79me dilution limit the interpretation of the in vivo findings. 2. In Figures 2 and 3, the efficiency of H3K79me2 depletion following Dot1l excision should be assessed directly. Although DOT1L is the sole H3K79 methyltransferase, the dilution kinetics of H3K79me2 can vary depending on the proliferation rate. Quantifying the H3K79me2 signal in bone marrow-derived cell culture samples would clarify whether the deletion window allowed complete loss of the methylation mark. 3. Several observations are not discussed in sufficient depth: - The finding that Dot1l deletion increases antigen-presentation signatures might reflect stress or activation rather than lineage fate change. - The authors could also acknowledge that DOT1L's effect might be indirect, acting through cytokine feedback loops or altered progenitor proliferation, especially given the co-expression of Kit, Flt3, and Irf8 in early DC progenitors. - Moreover, because H3K79 methylation is primarily associated with transcriptional elongation rather than initiation, the observed transcriptional changes could result from broader alterations in chromatin accessibility or polymerase processivity, rather than direct promoter regulation. Discussing this mechanistic aspect would help clarify whether DOT1L's role in DC differentiation reflects a direct control of lineage-defining gene expression or a secondary consequence of disrupted transcriptional elongation dynamics.

Minor Comments

1. Terminology: The manuscript repeatedly refers to "mature" DCs-please clarify whether this means activated or fully differentiated cells.
2. Ontogeny statements: <br /> The assertion that DCs of lymphoid origin are well established should be softened; the lymphoid contribution to some DC lineages remains under discussion.
3. Transitional DCs (tDCs): <br /> The equivalence between tDCs and pre-cDC2As remains controversial. This should be acknowledged.
4. Cytokine supplementation: <br /> The inclusion of SCF in the FLT3L-based differentiation assays should be justified, it is not a standard procedure.
5. Macrophage contamination: <br /> The presence of C1qa, C1qb, and C1qc transcripts in some datasets suggests possible macrophage contamination. Please discuss how this was controlled for or how it might affect interpretation.

Significance

This study provides important insights into the epigenetic regulation of DC differentiation by DOT1L. The conclusions would be more compelling if supported by in vivo validation or, alternatively, if the limitations of the current in vivo data were transparently acknowledged and the focus shifted toward mechanistic in vitro depth.

With these revisions, the manuscript would represent a valuable contribution to understanding how chromatin modification integrates with transcriptional control in shaping dendritic cell fate.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Bouma et al. present a comprehensive analysis of DOT1L-mediated histone H3K79 methylation across canonical DC subsets. By mapping the methylation landscape, the authors demonstrate that DOT1L regulates both shared and subset-specific gene programs. They show that in vitro or in vivo deletion of Dot1l, followed by in vitro differentiation, results in reduced myeloid progenitors and pDCs alongside an increase in cDC2s, while cDC1 numbers remain largely unaffected. Functionally, Dot1l-deficient DCs fail to produce IFNα upon stimulation. Transcriptomic profiling reveals enrichment of antigen presentation pathways in Dot1l-KO subsets, with upregulated MHC class II surface expression in pDCs. Mechanistically, pharmacological inhibition of DOT1L links these effects to its methyltransferase activity. Collectively, the data suggest that DOT1L differentially regulates canonical DC subset development and represses antigen presentation pathways.

The manuscript is well-written and technically sound. However, several conclusions would benefit from deeper discussion or additional experimental validation.

Major Comments

1. Interpretation of DC balance changes and cell-cycle effects

The authors propose that DOT1L loss skews DC differentiation toward a pDC-like phenotype. However, DOT1L deletion or inhibition, and the consequent global loss of H3K79 methylation, is well known to downregulate key cell-cycle genes (e.g., Cyclin D1, Cyclin E, CDK4/6, MCM family) while upregulating cell-cycle inhibitors (e.g., Cdkn1a and b). These transcriptional changes are associated with slower proliferation, G1 arrest or delayed S-phase entry, and reduced DNA replication fork progression. Importantly, blocking DNA synthesis (e.g., with aphidicolin or mitomycin C) during early culture inhibits DC emergence, underscoring that proliferation is essential for differentiation. The authors should discuss how their findings align with this established literature. Could the observed DC subset shifts result from impaired cell-cycle progression rather than lineage-specific transcriptional reprogramming? A more detailed consideration of this point is needed. 2. Discrepancy between in vitro and in vivo pDC phenotypes

The in vitro data show a marked reduction in pDCs, yet in vivo pDC numbers appear unchanged. Although the discussion briefly mentions proliferation differences, this discrepancy deserves a clearer explanation or experimental follow-up.

Minor Comments

• Clarify statistical methods, specify biological replicate numbers, and indicate whether corrections for multiple comparisons were applied to transcriptomic analyses.
• The introduction is somewhat lengthy and repetitive; condensing it would improve focus.
• In the discussion sometimes it is not clear the distinction between findings and speculation.
• Ensure consistent gene name formatting throughout (e.g., Dot1l, Dot1L).

Significance

The current manuscript fills a gap in knowledge, and this is its major strength. Other strengths are clarity and technical appropriateness.

The major weakness is that the work is mainly descriptive. Mechanistic insights into DOT1L-dependent transcriptional regulation are still weak. The proposed mechanism -that DOT1L maintains pDC identity through H3K79 methylation at key transcription factors (Tcf4, SpiB, Irf8)- is intriguing but currently lacks functional evidence. The authors should consider validating this model experimentally, by modulating the expression of these genes without affecting DOT1L activity. Also the model suggesting that DOT1L indirectly represses antigen presentation via the Fbxo11-Ciita pathway is interesting but remains speculative. Additional mechanistic data would help support this claim.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary:

In this study, Bouma et al. investigate the epigenetic mechanisms involved in dendritic cell (DC) development, focusing on the role of the lysine methyltransferase DOT1L, which mediates histone H3 lysine 79 (H3K79) methylation. The authors first show that Dot1l is expressed across most DC subsets and their progenitors. Consistently, DOT1L activity was detected in these subsets, as ChIP-seq analysis revealed an enrichment of H3K79 methylation marks around the transcription start sites of numerous genes that regulate DC fate. These marks were associated with active transcription, as confirmed by RNA sequencing. To assess the functional role of Dot1l in DC development, the authors used Rosa26Cre-ERT2 × Dot1l^flox/flox mice. Bone marrow (BM) cells from these mice were treated in vitro with tamoxifen and cultured with FLT3L and SCF to induce DC differentiation. Dot1l deletion impaired the development of plasmacytoid DCs (pDCs) and enhanced the generation of conventional DC2 (cDC2), while leaving cDC1 development unaffected. Similarly, in vivo tamoxifen treatment of Rosa26Cre-ERT2 × Dot1l^flox/flox mice for three days led to a comparable impairment of DC development upon in vitro culture of BM cells. Beyond mature DCs, Dot1l deletion also disrupted the ability of BM cells to generate common myeloid progenitors (CMPs), monocyte-dendritic cell progenitors (MDPs), and common DC progenitors (CDPs). These effects were attributed to the methyltransferase activity of DOT1L, as pharmacological inhibition of DOT1L produced similar outcomes. Interestingly, while in vivo tamoxifen treatment altered the frequencies of progenitor populations (MDP, CDP, CMP) in the BM, it did not significantly change the frequency of pDCs in the BM or spleen. Moreover, an increase in the cDC2 population was observed only in the BM, with no effect detected in the spleen. With these findings the authors claim that epigenetic regulation of gene expression by DOT1L is important for proper dendritic cell development.

Major comments.

While this study demonstrates that DOT1L regulates DC development in vitro, its inducible deletion in vivo using tamoxifen does not appear to significantly affect the overall distribution or function of DCs. Therefore, further investigation is needed to clarify the role of DOT1L in regulating DC fate under physiological conditions. The authors analyzed DC populations at only two time points (3 and 12 days) following tamoxifen-induced Dot1l deletion. As noted in the discussion, these time points are relatively early considering the lifespan of DCs, which often extends beyond this period. It would thus be important to assess the effects of Dot1l deletion over a longer duration (e.g., at least one month) to fully evaluate its impact on DC development. In addition to the BM, an extensive analysis of DCs population should be carried in the spleen as well as lymph nodes. Given the broad activity of the Rosa26-Cre system, prolonged deletion may affect overall mouse health and/or the function of other cell types that contribute to DC development; therefore, using a DC-specific Cre driver (e.g., CD11c-Cre) would provide a more targeted approach. Alternatively, competitive BM chimera experiments could be performed by reconstituting irradiated control mice with a 1:1 mixture of BM cells from Rosa26Cre-ERT2 × Dot1l^flox/flox and Rosa26Cre-ERT2 × Dot1l^wt/flox mice, both pre-treated with tamoxifen in vitro. Such experiments would offer more definitive evidence for the role of DOT1L in DC development in vivo. Aside from this point, the data and methods are clearly presented, and the figures are largely self-explanatory. All experiments were adequately replicated three times. Statistical analyses were primarily performed using t-tests, and ANOVA with multiple comparisons when appropriate. Since these are parametric tests that assume a normal distribution, it would be important to confirm whether the analyzed samples meet this assumption. If not, non-parametric tests should be used instead.

Minor comments.

It would be informative to show how specific Dot1l expression is in DCs and their progenitors compared with other immune lineages (e.g., lymphocytes) and their precursors. The data suggest that DOT1L regulates H3K79 methylation of both shared and subset-specific genes among DC populations. The authors could elaborate on how this regulation achieves cell-type specificity-perhaps through differential Dot1l expression levels across DC subsets.

Interestingly, Dot1l deletion both in vitro and in vivo markedly reduces the frequency of common DC progenitors (CDPs), which give rise to cDC1 and cDC2. The authors should discuss how such a substantial loss of progenitors does not proportionally affect downstream cDC populations. Although in vivo tamoxifen-induced deletion of Dot1l in Rosa26Cre-ERT2 × Dot1l^flox/flox mice does not significantly alter the overall distribution of DC subsets (pDCs and cDCs), it appears to modify their phenotype. It would therefore be valuable to examine how Dot1l loss impacts the functional properties of individual DC subsets. While pDC responsiveness to CpG stimulation seems preserved in the absence of Dot1l, assessing how cDCs respond to TLR3 and TLR4 stimulation and their capacity to activate T cells would provide important additional insights.

Significance

General assessment: Bouma et al. present compelling evidence that DOT1L is an important regulator of DC differentiation in vitro from bone marrow-derived cells. They further demonstrate that DOT1L regulates DC development through its lysine methyltransferase activity, mediating histone H3K79 methylation. While these in vitro findings are robust and well supported, the physiological relevance of DOT1L function in vivo remains less clearly established. Additional experiments would help to strengthen the conclusions regarding its role under physiological conditions.

Advance: While numerous transcription factors have been described as key regulators of DC subset development and fate, the role of epigenetic regulation in this process remains relatively understudied and poorly understood. This study addresses this important gap in the literature and provides novel insights into the role of H3K79 methylation mediated by DOT1L in controlling DC development.

Audience: This paper will be of interest for a specialized audience in the field of the regulation of dendritic cell ontogeny. This work could influence additional research to investigate the epigenitc regulation of DCs development.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

We would like to thank all the reviewers for their valuable comments and criticisms. We have thoroughly revised the manuscript and the resource to address all the points raised by the reviewers. Below, we provide a point-by-point response for the sake of clarity.

Reviewer #1

__Evidence, reproducibility and clarity __

Summary: This manuscript, "MAVISp: A Modular Structure-Based Framework for Protein Variant Effects," presents a significant new resource for the scientific community, particularly in the interpretation and characterization of genomic variants. The authors have developed a comprehensive and modular computational framework that integrates various structural and biophysical analyses, alongside existing pathogenicity predictors, to provide crucial mechanistic insights into how variants affect protein structure and function. Importantly, MAVISp is open-source and designed to be extensible, facilitating reuse and adaptation by the broader community.

Major comments: - While the manuscript is formally well-structured (with clear Introduction, Results, Conclusions, and Methods sections), I found it challenging to follow in some parts. In particular, the Introduction is relatively short and lacks a deeper discussion of the state-of-the-art in protein variant effect prediction. Several methods are cited but not sufficiently described, as if prior knowledge were assumed. OPTIONAL: Extend the Introduction to better contextualize existing approaches (e.g., AlphaMissense, EVE, ESM-based predictors) and clarify what MAVISp adds compared to each.

We have expanded the introduction on the state-of-the-art of protein variant effects predictors, explaining how MAVISp departs from them.

- The workflow is summarized in Figure 1(b), which is visually informative. However, the narrative description of the pipeline is somewhat fragmented. It would be helpful to describe in more detail the available modules in MAVISp, and which of them are used in the examples provided. Since different use cases highlight different aspects of the pipeline, it would be useful to emphasize what is done step-by-step in each.

We have added a concise, narrative description of the data flow for MAVISp, as well as improved the description of modules in the main text. We will integrate the results section with a more comprehensive description of the available modules, and then clarify in the case studies which modules were applied to achieve specific results.

OPTIONAL: Consider adding a table or a supplementary figure mapping each use case to the corresponding pipeline steps and modules used.

We have added a supplementary table (Table S2) to guide the reader on the modules and workflows applied for each case study

We also added Table S1 to map the toolkit used by MAVISp to collect the data that are imported and aggregated in the webserver for further guidance.

- The text contains numerous acronyms, some of which are not defined upon first use or are only mentioned in passing. This affects readability. OPTIONAL: Define acronyms upon first appearance, and consider moving less critical technical details (e.g., database names or data formats) to the Methods or Supplementary Information. This would greatly enhance readability.

We revised the usage of acronyms following the reviewer’s directions of defying them at first appearance.

• The code and trained models are publicly available, which is excellent. The modular design and use of widely adopted frameworks (PyTorch and PyTorch Geometric) are also strong points. However, the Methods section could benefit from additional detail regarding feature extraction and preprocessing steps, especially the structural features derived from AlphaFold2 models. OPTIONAL: Include a schematic or a table summarizing all feature types, their dimensionality, and how they are computed.

We thank the reviewer for noticing and praising the availability of the tools of MAVISp. Our MAVISp framework utilizes methods and scores that incorporate machine learning features (such as EVE or RaSP), but does not employ machine learning itself. Specifically, we do not use PyTorch and do not utilize features in a machine learning sense. We do extract some information from the AlphaFold2 models that we use (such as the pLDDT score and their secondary structure content, as calculated by DSSP), and those are available in the MAVISp aggregated csv files for each protein entry and detailed in the Documentation section of the MAVISp website.

• The section on transcription factors is relatively underdeveloped compared to other use cases and lacks sufficient depth or demonstration of its practical utility. OPTIONAL: Consider either expanding this section with additional validation or removing/postponing it to a future manuscript, as it currently seems preliminary.

We have removed this section and included a mention in the conclusions as part of the future directions.

Minor comments: - Most relevant recent works are cited, including EVE, ESM-1v, and AlphaFold-based predictors. However, recent methods like AlphaMissense (Cheng et al., 2023) could be discussed more thoroughly in the comparison.

We have revised the introduction to accommodate the proper space for this comparison.

• Figures are generally clear, though some (e.g., performance barplots) are quite dense. Consider enlarging font sizes and annotating key results directly on the plots.

We have revised Figure 2 and presented only one case study to simplify its readability. We have also changed Figure 3, whereas retained the other previous figures since they seemed less problematic.

• Minor typographic errors are present. A careful proofreading is highly recommended. Below are some of the issues I identified: Page 3, line 46: "MAVISp perform" -> "MAVISp performs" Page 3, line 56: "automatically as embedded" -> "automatically embedded" Page 3, line 57: "along with to enhance" -> unclear; please revise Page 4, line 96: "web app interfaces with the database and present" -> "presents" Page 6, line 210: "to investigate wheatear" -> "whether" Page 6, lines 215-216: "We have in queue for processing with MAVISp proteins from datasets relevant to the benchmark of the PTM module." -> unclear sentence; please clarify Page 15, line 446: "Both the approaches" -> "Both approaches" Page 20, line 704: "advantage of multi-core system" -> "multi-core systems"

We have done a proofreading of the entire article, including the points above

Significance

General assessment: the strongest aspects of the study are the modularity, open-source implementation, and the integration of structural information through graph neural networks. MAVISp appears to be one of the few publicly available frameworks that can easily incorporate AlphaFold2-based features in a flexible way, lowering the barrier for developing custom predictors. Its reproducibility and transparency make it a valuable resource. However, while the technical foundation is solid and the effort substantial, the scientific narrative and presentation could be significantly improved. The manuscript is dense and hard to follow in places, with a heavy use of acronyms and insufficient explanation of key design choices. Improving the descriptive clarity, especially in the early sections, would greatly enhance the impact of this work.

Advance

to the best of my knowledge, this is one of the first modular platforms for protein variant effect prediction that integrates structural data from AlphaFold2 with bioinformatic annotations and even clinical data in an extensible fashion. While similar efforts exist (e.g., ESMfold, AlphaMissense), MAVISp distinguishes itself through openness and design for reusability. The novelty is primarily technical and practical rather than conceptual.

Audience

this study will be of strong interest to researchers in computational biology, structural bioinformatics, and genomics, particularly those developing variant effect predictors or analyzing the impact of mutations in clinical or functional genomics contexts. The audience is primarily specialized, but the open-source nature of the tool may diffuse its use among more applied or translational users, including those working in precision medicine or protein engineering.

Reviewer expertise: my expertise is in computational structural biology, molecular modeling, and (rather weak) machine learning applications in bioinformatics. I am familiar with graph-based representations of proteins, AlphaFold2, and variant effects based on Molecular Dynamics simulations. I do not have any direct expertise in clinical variant annotation pipelines.

Reviewer #2

__Evidence, reproducibility and clarity __

Summary: The authors present a pipeline and platform, MAVISp, for aggregating, displaying and analysis of variant effects with a focus on reclassification of variants of uncertain clinical significance and uncovering the molecular mechanisms underlying the mutations.

Major comments: - On testing the platform, I was unable to look-up a specific variant in ADCK1 (rs200211943, R115Q). I found that despite stating that the mapped refseq ID was NP_001136017 in the HGVSp column, it was actually mapped to the canonical UniProt sequence (Q86TW2-1). NP_001136017 actually maps to Q86TW2-3, which is missing residues 74-148 compared to the -1 isoform. The Uniprot canonical sequence has no exact RefSeq mapping, so the HGVSp column is incorrect in this instance. This mapping issue may also affect other proteins and result in incorrect HGVSp identifiers for variants.

We would like to thank the reviewer for pointing out these inconsistencies. We have revised all the entries and corrected them. If needed, the history of the cases that have been corrected can be found in the closed issues of the GitHub repository that we use for communication between biocurators and data managers (https://github.com/ELELAB/mavisp_data_collection). We have also revised the protocol we follow in this regard and the MAVISp toolkit to include better support for isoform matching in our pipelines for future entries, as well as for the revision/monitoring of existing ones, as detailed in the Method Section. In particular, we introduced a tool, uniprot2refseq, which aids the biocurator in identifying the correct match in terms of sequence length and sequence identity between RefSeq and UniProt. More details are included in the Method Section of the paper. The two relevant scripts for this step are available at: https://github.com/ELELAB/mavisp_accessory_tools/

- The paper lacks a section on how to properly interpret the results of the MAVISp platform (the case-studies are helpful, but don't lay down any global rules for interpreting the results). For example: How should a variant with conflicts between the variant impact predictors be interpreted? Are specific indicators considered more 'reliable' than others?

We have added a section in Results to clarify how to interpret results from MAVISp in the most common use cases.

• In the Methods section, GEMME is stated as being rank-normalised with 0.5 as a threshold for damaging variants. On checking the data downloaded from the site, GEMME was not rank-normalised but rather min-max normalised. Furthermore, Supplementary text S4 conflicts with the methods section over how GEMME scores are classified, S4 states that a raw-value threshold of -3 is used.

We thank the reviewer for spotting this inconsistency. This part in the main text was left over from a previous and preliminary version of the pre-print, we have revised the main text. Supplementary Text S4 includes the correct reference for the value in light of the benchmarking therewithin.

• Note. This is a major comment as one of the claims is that the associated web-tool is user-friendly. While functional, the web app is very awkward to use for analysis on any more than a few variants at once. The fixed window size of the protein table necessitates excessive scrolling to reach your protein-of-interest. This will also get worse as more proteins are added. Suggestion: add a search/filter bar. The same applies to the dataset window.

We have changed the structure of the webserver in such a way that now the whole website opens as its own separate window, instead of being confined within the size permitted by the website at DTU. This solves the fixed window size issue. Hopefully, this will improve the user experience.

We have refactored the web app by adding filtering functionality, both for the main protein table (that can now be filtered by UniProt AC, gene name or RefSeq ID) and the mutations table. Doing this required a general overhaul of the table infrastructure (we changed the underlying engine that renders the tables).

• You are unable to copy anything out of the tables.
• Hyperlinks in the tables only seem to work if you open them in a new tab or window.

The table overhauls fixed both of these issues

• All entries in the reference column point to the MAVISp preprint even when data from other sources is displayed (e.g. MAVE studies).

We clarified the meaning of the reference column in the Documentation on the MAVISp website, as we realized it had confused the reviewer. The reference column is meant to cite the papers where the computationally-generated MAVISp data are used, not external sources. Since we also have the experimental data module in the most recent release, we have also refactored the MAVISp website by adding a “Datasets and metadata” page, which details metadata for key modules. These include references to data from external sources that we include in MAVISp on a case-by-case basis (for example the results of a MAVE experiment). Additionally, we have verified that the papers using MAVISp data are updated in https://elelab.gitbook.io/mavisp/overview/publications-that-used-mavisp-data and in the csv file of the interested proteins.

Here below the current references that have been included in terms of publications using MAVISp data:

SMPD1

ASM variants in the spotlight: A structure-based atlas for unraveling pathogenic mechanisms in lysosomal acid sphingomyelinase

Biochim Biophys Acta Mol Basis Dis

38782304

https://doi.org/10.1016/j.bbadis.2024.167260

TRAP1

Point mutations of the mitochondrial chaperone TRAP1 affect its functions and pro-neoplastic activity

Cell Death & Disease

40074754

https://doi.org/10.1038/s41419-025-07467-6

BRCA2

Saturation genome editing-based clinical classification of BRCA2 variants

Nature

39779848

0.1038/s41586-024-08349-1

TP53, GRIN2A, CBFB, CALR, EGFR

TRAP1 S-nitrosylation as a model of population-shift mechanism to study the effects of nitric oxide on redox-sensitive oncoproteins

Cell Death & Disease

37085483

10.1038/s41419-023-05780-6

KIF5A, CFAP410, PILRA, CYP2R1

Computational analysis of five neurodegenerative diseases reveals shared and specific genetic loci

Computational and Structural Biotechnology Journal

38022694

https://doi.org/10.1016/j.csbj.2023.10.031

KRAS

Combining evolution and protein language models for an interpretable cancer driver mutation prediction with D2Deep

Brief Bioinform

39708841

https://doi.org/10.1093/bib/bbae664

OPTN

Decoding phospho-regulation and flanking regions in autophagy-associated short linear motifs

Communications Biology

40835742

10.1038/s42003-025-08399-9

DLG4,GRB2,SMPD1

Deciphering long-range effects of mutations: an integrated approach using elastic network models and protein structure networks

JMB

40738203

doi: 10.1016/j.jmb.2025.169359

Entering multiple mutants in the "mutations to be displayed" window is time-consuming for more than a handful of mutants. Suggestion: Add a box where multiple mutants can be pasted in at once from an external document.

During the table overhaul, we have revised the user interface to add a text box that allows free copy-pasting of mutation lists. While we understand having a single input box would have been ideal, the former selection interface (which is also still available) doesn’t allow copy-paste. This is a known limitation in Streamlit.

Minor comments

• Grammar. I appreciate that this manuscript may have been compiled by a non-native English speaker, but I would be remiss not to point out that there are numerous grammar errors throughout, usually sentence order issues or non-pluralisation. The meaning of the authors is mostly clear, but I recommend very thoroughly proof-reading the final version.

We have done proofreading on the final version of the manuscript

• There are numerous proteins that I know have high-quality MAVE datasets that are absent in the database e.g. BRCA1, HRAS and PPARG.

Yes, we are aware of this. It is far from trivial to properly import the datasets from multiplex assays. They often need to be treated on a case-by-case basis. We are in the process of carefully compiling locally all the MAVE data before releasing it within the public version of the database, so this is why they are missing. We are giving priorities to the ones that can be correlated with our predictions on changes in structural stability and then we will also cover the rest of the datasets handling them in batches. Having said this, we have checked the dataset for BRCA1, HRAS, and PPARG. We have imported the ones for PPARG and BRCA1 from ProtGym, referring to the studies published in 10.1038/ng.3700 and 10.1038/s41586-018-0461-z, respectively. Whereas for HRAS, checking in details both the available data and literature, while we did identify a suitable dataset (10.7554/eLife.27810), we struggled to understand what a sensible cut-off for discriminating between pathogenic and non-pathogenic variants would be, and so ended up not including it in the MAVISp dataset for now. We will contact the authors to clarify which thresholds to apply before importing the data.

• Checking one of the existing MAVE datasets (KRAS), I found that the variants were annotated as damaging, neutral or given a positive score (these appear to stand-in for gain-of-function variants). For better correspondence with the other columns, those with positive scores could be labelled as 'ambiguous' or 'uncertain'.

In the KRAS case study presented in MAVISP, we utilized the protein abundance dataset reported in (http://dx.doi.org/10.1038/s41586-023-06954-0) and made available in the ProteinGym repository (specifically referenced at https://github.com/OATML-Markslab/ProteinGym/blob/main/reference_files/DMS_substitutions.csv#L153). We adopted the precalculated thresholds as provided by the ProteinGym authors. In this regard, we are not really sure the reviewer is referring to this dataset or another one on KRAS.

• Numerous thresholds are defined for stabilizing / destabilizing / neutral variants in both the STABILITY and the LOCAL_INTERACTION modules. How were these thresholds determined? I note that (PMC9795540) uses a ΔΔG threshold of 1/-1 for defining stabilizing and destabilizing variants, which is relatively standard (though they also say that 2-3 would likely be better for pinpointing pathogenic variants).

We improved the description of our classification strategies for both modules in the Documentation page of our website. Also, we explained more clearly the possible sources of ‘uncertain’ annotations for the two modules in both the web app (Documentation page) and main text. Briefly, in the STABILITY module, we consider FoldX and either Rosetta or RaSP to achieve a final classification. We first classify one and the other independently, according to the following strategy:

If DDG ≥ 3, the mutation is Destabilizing If DDG ≤ −3, the mutation is Stabilizing If −2 We then compare the classifications obtained by the two methods: if they agree, then that is the final classification, if they disagree, then the final classification is Uncertain. The thresholds were selected based on a previous study, in which variants with changes in stability below 3 kcal/mol were not featuring a markedly different abundance at cellular level [10.1371/journal.pgen.1006739, 10.7554/eLife.49138]

Regarding the LOCAL_INTERACTION module, it works similarly as for the Stability module, in that Rosetta and FoldX are considered independently, and an implicit classification is performed for each, according to the rules (values in kcal/mol)

If DDG > 1, the mutation is Destabilizing. If DDG Each mutation is therefore classified for both methods. If the methods agree (i.e., if they classify the mutation in the same way), their consensus is the final classification for the mutation; if they do not agree, the final classification will be Uncertain.

If a mutation does not have an associated free energy value, the relative solvent accessible area is used to classify it: if SAS > 20%, the mutation is classified as Uncertain, otherwise it is not classified.

Thresholds here were selected according to best practices followed by the tool authors and more in general in the literature, as the reviewer also noticed.

• "Overall, with the examples in this section, we illustrate different applications of the MAVISp results, spanning from benchmarking purposes, using the experimental data to link predicted functional effects with structural mechanisms or using experimental data to validate the predictions from the MAVISp modules."

The last of these points is not an application of MAVISp, but rather a way in which external data can help validate MAVISp results. Furthermore, none of the examples given demonstrate an application in benchmarking (what is being benchmarked?).

We have revised the statements to avoid this confusion in the reader.

• Transcription factors section. This section describes an intended future expansion to MAVISp, not a current feature, and presents no results. As such, it should be moved to the conclusions/future directions section.

We have removed this section and included a mention in the conclusions as part of the future directions.

• Figures. The dot-plots generated by the web app, and in Figures 4, 5 and 6 have 2 legends. After looking at a few, it is clear that the lower legend refers to the colour of the variant on the X-axis - most likely referencing the ClinVar effect category. This is not, however, made clear either on the figures or in the app.

The reviewer’s interpretation on the second legend is correct - it does refer to the ClinVar classification. Nonetheless, we understand the positioning of the legend makes understanding what the legend refers to not obvious. We also revised the captions of the figures in the main text. On the web app, we have changed the location of the figure legend for the ClinVar effect category and added a label to make it clear what the classification refers to.

• "We identified ten variants reported in ClinVar as VUS (E102K, H86D, T29I, V91I, P2R, L44P, L44F, D56G, R11L, and E25Q, Fig.5a)" E25Q is benign in ClinVar and has had that status since first submitted.

We have corrected this in the text and the statements related to it.

Significance

Platforms that aggregate predictors of variant effect are not a new concept, for example dbNSFP is a database of SNV predictions from variant effect predictors and conservation predictors over the whole human proteome. Predictors such as CADD and PolyPhen-2 will often provide a summary of other predictions (their features) when using their platforms. MAVISp's unique angle on the problem is in the inclusion of diverse predictors from each of its different moules, giving a much wider perspective on variants and potentially allowing the user to identify the mechanistic cause of pathogenicity. The visualisation aspect of the web app is also a useful addition, although the user interface is somewhat awkward. Potentially the most valuable aspect of this study is the associated gitbook resource containing reports from biocurators for proteins that link relevant literature and analyse ClinVar variants. Unfortunately, these are only currently available for a small minority of the total proteins in the database with such reports. For improvement, I think that the paper should focus more on the precise utility of the web app / gitbook reports and how to interpret the results rather than going into detail about the underlying pipeline.

We appreciate the interest in the gitbook resource that we also see as very valuable and one of the strengths of our work. We have now implemented a new strategy based on a Python script introduced in the mavisp toolkit to generate a template Markdown file of the report that can be further customized and imported into GitBook directly (​​https://github.com/ELELAB/mavisp_accessory_tools/). This should allow us to streamline the production of more reports. We are currently assigning proteins in batches for reporting to biocurator through the mavisp_data_collection GitHub to expand their coverage. Also, we revised the text and added a section on the interpretation of results from MAVISp. with a focus on the utility of the web-app and reports.

In terms of audience, the fast look-up and visualisation aspects of the web-platform are likely to be of interest to clinicians in the interpretation of variants of unknown clinical significance. The ability to download the fully processed dataset on a per-protein database would be of more interest to researchers focusing on specific proteins or those taking a broader view over multiple proteins (although a facility to download the whole database would be more useful for this final group).

While our website only displays the dataset per protein, the whole dataset, including all the MAVISp entries, is available at our OSF repository (https://osf.io/ufpzm/), which is cited in the paper and linked on the MAVISp website. We have further modified the MAVISp database to add a link to the repository in the modes page, so that it is more visible.

My expertise. - I am a protein bioinformatician with a background in variant effect prediction and large-scale data analysis.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Evidence, reproducibility and clarity:

Summary:

The authors present MAVISp, a tool for viewing protein variants heavily based on protein structure information. The authors have done a very impressive amount of curation on various protein targets, and should be commended for their efforts. The tool includes a diverse array of experimental, clinical, and computational data sources that provides value to potential users interested in a given target.

Major comments:

Unfortunately I was not able to get the website to work correctly. When selecting a protein target in simple mode, I was greeted with a completely blank page in the app window. In ensemble mode, there was no transition away from the list of targets at all. I'm using Firefox 140.0.2 (64-bit) on Ubuntu 22.04. I would like to explore the data myself and provide feedback on the user experience and utility.

We have tried reproducing the issue mentioned by the reviewer, using the exact same Ubuntu and Firefox versions, but unfortunately failed to produce it. The website worked fine for us under such an environment. The issue experienced by the reviewer may have been due to either a temporary issue with the web server or a problem with the specific browser environment they were working in, which we are unable to reproduce. It would be useful to know the date that this happened to verify if it was a downtime on the DTU IT services side that made the webserver inaccessible.

I have some serious concerns about the sustainability of the project and think that additional clarifications in the text could help. Currently is there a way to easily update a dataset to add, remove, or update a component (for example, if a new predictor is published, an error is found in a predictor dataset, or a predictor is updated)? If it requires a new round of manual curation for each protein to do this, I am worried that this will not scale and will leave the project with many out of date entries. The diversity of software tools (e.g., three different pipeline frameworks) also seems quite challenging to maintain.

We appreciate the reviewer’s concerns about long-term sustainability. It is a fair point that we consider within our steering group, who oversee and plans the activities and meet monthly. Adding entries to MAVISp is moving more and more towards automation as we grow. We aim to minimize the manual work where applicable. Still, an expert-based intervention is really needed in some of the steps, and we do not want to renounce it. We intend to keep working on MAVISp to make the process of adding and updating entries as automated as possible, and to streamline the process when manual intervention is necessary. From the point of view of the biocurators, they have three core workflows to use for the default modules, which also automatically cover the source of annotations. We are currently working to streamline the procedures behind LOCAL_INTERACTION, which is the most challenging one. On the data manager and maintainers' side, we have workflows and protocols that help us in terms of automation, quality control, etc, and we keep working to improve them. Among these, we have workflows to use for the old entries updates. As an example, the update of erroneously attributed RefSeq data (pointed out by reviewer 2) took us only one week overall (from assigning revisions and importing to the database) because we have a reduced version of Snakemake for automation that can act on only the affected modules. Also, another point is that we have streamlined the generation of the templates for the gitbook reports (see also answer to reviewer 2).

The update of old entries is planned and made regularly. We also deposit the old datasets on OSF for transparency, in case someone needs to navigate and explore the changes. We have activities planned between May and August every year to update the old entries in relation to changes of protocols in the modules, updates in the core databases that we interact with (COSMIC, Clinvar etc). In case of major changes, the activities for updates continue in the Fall. Other revisions can happen outside these time windows if an entry is needed or a specific research project and needs updates too.

Furthermore, the community of people contributing to MAVISp as biocurators or developers is growing and we have scientists contributing from other groups in relation to their research interest. We envision that for this resource to scale up, our team cannot be the only one producing data and depositing it to the database. To facilitate this we launched a pilot for a training event online (see Event page on the website) and we will repeat it once per year. We also organize regular meetings with all the active curators and developers to plan the activities in a sustainable manner and address the challenges we encounter.

As stated in the manuscript, currently with the team of people involved, automatization and resources that we have gathered around this initiative we can provide updates to the public database every third month and we have been regularly satisfied with them. Additionally, we are capable of processing from 20 to 40 proteins every month depending also on the needs of revision or expansion of analyses on existing proteins. We also depend on these data for our own research projects and we are fully committed to it.

Additionally, we are planning future activities in these directions to improve scale up and sustainability:

• Streamlining manual steps so that they are as convenient as fast as possible for our curators, e.g. by providing custom pages on the MAVISp website
• Streamline and automatize the generation of useful output, for instance the reports, by using a combination of simple automation and large language models
• Implement ways to share our software and scripts with third parties, for instance by providing ready made (or close to) containers or virtual machines
• For a future version 2 if the database grows in a direction that is not compatible with Streamlit, the web data science framework we are currently using, we will rewrite the website using a framework that would allow better flexibility and performance, for instance using Django and a proper database backend. On the same theme, according to the GitHub repository, the program relies on Python 3.9, which reaches end of life in October 2025. It has been tested against Ubuntu 18.04, which left standard support in May 2023. The authors should update the software to more modern versions of Python to promote the long-term health and maintainability of the project.

We thank the reviewer for this comment - we are aware of the upcoming EOL of Python 3.9. We tested MAVISp, both software package and web server, using Python 3.10 (which is the minimum supported version going forward) and Python 3.13 (which is the latest stable release at the time of writing) and updated the instructions in the README file on the MAVISp GitHub repository accordingly.

We plan on keeping track of Python and library versions during our testing and updating them when necessary. In the future, we also plan to deploy Continuous Integration with automated testing for our repository, making this process easier and more standardized.

I appreciate that the authors have made their code and data available. These artifacts should also be versioned and archived in a service like Zenodo, so that researchers who rely on or want to refer to specific versions can do so in their own future publications.

Since 2024, we have been reporting all previous versions of the dataset on OSF, the repository linked to the MAVISp website, at https://osf.io/ufpzm/files/osfstorage (folder: previous_releases). We prefer to keep everything under OSF, as we also use it to deposit, for example, the MD trajectory data.

Additionally, in this GitHub page that we use as a space to interact between biocurators, developers, and data managers within the MAVISp community, we also report all the changes in the NEWS space: https://github.com/ELELAB/mavisp_data_collection

Finally, the individual tools are all available in our GitHub repository, where version control is in place (see Table S1, where we now mapped all the resources used in the framework)

In the introduction of the paper, the authors conflate the clinical challenges of variant classification with evidence generation and it's quite muddled together. They should strongly consider splitting the first paragraph into two paragraphs - one about challenges in variant classification/clinical genetics/precision oncology and another about variant effect prediction and experimental methods. The authors should also note that they are many predictors other than AlphaMissense, and may want to cite the ClinGen recommendations (PMID: 36413997) in the intro instead.

We revised the introduction in light of these suggestions. We have split the paragraph as recommended and added a longer second paragraph about VEPs and using structural data in the context of VEPs. We have also added the citation that the reviewer kindly recommended.

Also in the introduction on lines 21-22 the authors assert that "a mechanistic understanding of variant effects is essential knowledge" for a variety of clinical outcomes. While this is nice, it is clearly not the case as we can classify variants according to the ACMG/AMP guidelines without any notion of specific mechanism (for example, by combining population frequency data, in silico predictor data, and functional assay data). The authors should revise the statement so that it's clear that mechanistic understanding is a worthy aspiration rather than a prerequisite.

We revised the statement in light of this comment from the reviewer

In the structural analysis section (page 5, lines 154-155 and elsewhere), the authors define cutoffs with convenient round numbers. Is there a citation for these values or were these arbitrarily chosen by the authors? I would have liked to see some justification that these assignments are reasonable. Also there seems to be an error in the text where values between -2 and -3 kcal/mol are not assigned to a bin (I assume they should also be uncertain). There are other similar seemingly-arbitrary cutoffs later in the section that should also be explained.

We have revised the text making the two intervals explicit, for better clarity.

On page 9, lines 294-298 the authors talk about using the PTEN data from ProteinGym, rather than the actual cutoffs from the paper. They get to the latter later on, but I'm not sure why this isn't first? The ProteinGym cutoffs are somewhat arbitrarily based on the median rather than expert evaluation of the dataset, and I'm not sure why it's even worth mentioning them when proper classifications are available. Regarding PTEN, it would be quite interesting to see a comparison of the VAMP-seq PTEN data and the Mighell phosphatase assay, which is cited on page 9 line 288 but is not actually a VAMP-seq dataset. I think this section could be interesting but it requires some additional attention.

We have included the data from Mighell’s phosphatase assay as provided by MAVEdb in the MAVISp database, within the experimental_data module for PTEN, and we have revised the case study, including them and explaining better the decision of supporting both the ProteinGym and MAVEdb classification in MAVISp (when available). See revised Figure3, Table 1 and corresponding text.

The authors mention "pathogenicity predictors" and otherwise use pathogenicity incorrectly throughout the manuscript. Pathogenicity is a classification for a variant after it has been curated according to a framework like the ACMG/AMP guidelines (Richards 2015 and amendments). A single tool cannot predict or assign pathogenicity - the AlphaMissense paper was wrong to use this nomenclature and these authors should not compound this mistake. These predictors should be referred to as "variant effect predictors" or similar, and they are able to produce evidence towards pathogenicity or benignity but not make pathogenicity calls themselves. For example, in Figure 4e, the terms "pathogenic" and "benign" should only be used here if these are the classifications the authors have derived from ClinVar or a similar source of clinically classified variants.

The reviewer is correct, we have revised the terminology we used in the manuscript and refers to VEPs (Variant Effect Predictors)

Minor comments:

The target selection table on the website needs some kind of text filtering option. It's very tedious to have to find a protein by scrolling through the table rather than typing in the symbol. This will only get worse as more datasets are added.

We have revised the website, adding a filtering option. In detail, we have refactored the web app by adding filtering functionality, both for the main protein table (that can now be filtered by UniProt AC, gene name, or RefSeq ID) and the mutations table. Doing this required a general overhaul of the table infrastructure (we changed the underlying engine that renders the tables).

The data sources listed on the data usage section of the website are not concordant with what is in the paper. For example, MaveDB is not listed.

We have revised and updated the data sources on the website, adding a metadata section with relevant information, including MaveDB references where applicable.

Figure 2 is somewhat confusing, as it partially interleaves results from two different proteins. This would be nicer as two separate figures, one on each protein, or just of a single protein.

As suggested by the reviewer, we have now revised the figure and corresponding legends and text, focusing only on one of the two proteins.

Figure 3 panel b is distractingly large and I wonder if the authors could do a little bit more with this visualization.

We have revised Figure 3 to solve these issues and integrating new data from the comparison with the phosphatase assay

Capitalization is inconsistent throughout the manuscript. For example, page 9 line 288 refers to VampSEQ instead of VAMP-seq (although this is correct elsewhere). MaveDB is referred to as MAVEdb or MAVEDB in various places. AlphaMissense is referred to as Alphamissense in the Figure 5 legend. The authors should make a careful pass through the manuscript to address this kind of issues.

We have carefully proofread the paper for these inconsistencies

MaveDB has a more recent paper (PMID: 39838450) that should be cited instead of/in addition to Esposito et al.

We have added the reference that the reviewer recommended

On page 11, lines 338-339 the authors mention some interesting proteins including BLC2, which has base editor data available (PMID: 35288574). Are there plans to incorporate this type of functional assay data into MAVISp?

The assay mentioned in the paper refers to an experimental setup designed to investigate mutations that may confer resistance to the drug venetoclax. We started the first steps to implement a MAVISp module aimed at evaluating the impact of mutations on drug binding using alchemical free energy perturbations (ensemble mode) but we are far from having it complete. We expect to import these data when the module will be finalized since they can be used to benchmark it and BCL2 is one of the proteins that we are using to develop and test the new module.

Reviewer #3 (Significance (Required)):

Significance:

General assessment:

This is a nice resource and the authors have clearly put a lot of effort in. They should be celebrated for their achievments in curating the diverse datasets, and the GitBooks are a nice approach. However, I wasn't able to get the website to work and I have raised several issues with the paper itself that I think should be addressed.

Advance:

New ways to explore and integrate complex data like protein structures and variant effects are always interesting and welcome. I appreciate the effort towards manual curation of datasets. This work is very similar in theme to existing tools like Genomics 2 Proteins portal (PMID: 38260256) and ProtVar (PMID: 38769064). Unfortunately as I wasn't able to use the site I can't comment further on MAVISp's position in the landscape.

We have expanded the conclusions section to add a comparison and cite previously published work, and linked to a review we published last year that frames MAVISp in the context of computational frameworks for the prediction of variant effects. In brief, the Genomics 2 Proteins portal (G2P) includes data from several sources, including some overlapping with MAVISp such as Phosphosite or MAVEdb, as well as features calculated on the protein structure. ProtVar also aggregates mutations from different sources and includes both variant effect predictors and predictions of changes in stability upon mutation, as well as predictions of complex structures. These approaches are only partially overlapping with MAVISp. G2P is primarily focused on structural and other annotations of the effect of a mutation; it doesn’t include features about changes of stability, binding, or long-range effects, and doesn’t attempt to classify the impact of a mutation according to its measurements. It also doesn’t include information on protein dynamics. Similarly, ProtVar does include information on binding free energies, long effects, or dynamical information.

Audience:

MAVISp could appeal to a diverse group of researchers who are interested in the biology or biochemistry of proteins that are included, or are interested in protein variants in general either from a computational/machine learning perspective or from a genetics/genomics perspective.

My expertise:

I am an expert in high-throughput functional genomics experiments and am an experienced computational biologist with software engineering experience.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Summary:

The authors present MAVISp, a tool for viewing protein variants heavily based on protein structure information. The authors have done a very impressive amount of curation on various protein targets, and should be commended for their efforts. The tool includes a diverse array of experimental, clinical, and computational data sources that provides value to potential users interested in a given target.

Major comments:

Unfortunately I was not able to get the website to work properly. When selecting a protein target in simple mode, I was greeted with a completely blank page in the app window, and in ensemble mode, there was no transition away from the list of targets at all. I'm using Firefox 140.0.2 (64-bit) on Ubuntu 22.04. I would have liked to be able to explore the data myself and provide feedback on the user experience and utility.

I have some serious concerns about the sustainability of the project and think that additional clarifications in the text could help. Currently is there a way to easily update a dataset to add, remove, or update a component (for example, if a new predictor is published, an error is found in a predictor dataset, or a predictor is updated)? If it requires a new round of manual curation for each protein to do this, I am worried that this will not scale and will leave the project with many out of date entries. The diversity of software tools (e.g., three different pipeline frameworks) also seems quite challenging to maintain.

On the same theme, according to the GitHub repository, the program relies on Python 3.9, which reaches end of life in October 2025. It has been tested against Ubuntu 18.04, which left standard support in May 2023. The authors should update the software to more modern versions of Python to promote the long-term health and maintainability of the project.

I appreciate that the authors have made their code and data available. These artifacts should also be versioned and archived in a service like Zenodo, so that researchers who rely on or want to refer to specific versions can do so in their own future publications.

In the introduction of the paper, the authors conflate the clinical challenges of variant classification with evidence generation and it's quite muddled together. The y should strongly consider splitting the first paragraph into two paragraphs - one about challenges in variant classification/clinical genetics/precision oncology and another about variant effect prediction and experimental methods. The authors should also note that they are many predictors other than AlphaMissense, and may want to cite the ClinGen recommendations (PMID: 36413997) in the intro instead.

Also in the introduction on lines 21-22 the authors assert that "a mechanistic understanding of variant effects is essential knowledge" for a variety of clinical outcomes. While this is nice, it is clearly not the case as we are able to classify variants according to the ACMG/AMP guidelines without any notion of specific mechanism (for example, by combining population frequency data, in silico predictor data, and functional assay data). The authors should revise the statement so that it's clear that mechanistic understanding is a worthy aspiration rather than a prerequisite.

In the structural analysis section (page 5, lines 154-155 and elsewhere), the authors define cutoffs with convenient round numbers. Is there a citation for these values or were these arbitrarily chosen by the authors? I would have liked to see some justification that these assignments are reasonable. Also there seems to be an error in the text where values between -2 and -3 kcal/mol are not assigned to a bin (I assume they should also be uncertain). There are other similar seemingly-arbitrary cutoffs later in the section that should also be explained.

On page 9, lines 294-298 the authors talk about using the PTEN data from ProteinGym, rather than the actual cutoffs from the paper. They get to the latter later on, but I'm not sure why this isn't first? The ProteinGym cutoffs are somewhat arbitrarily based on the median rather than expert evaluation of the dataset and I'm not sure why it's even worth mentioning them when proper classifications are available. Regarding PTEN, it would be quite interesting to see a comparison of the VAMP-seq PTEN data and the Mighell phosphatase assay, which is cited on page 9 line 288 but is not actually a VAMP-seq dataset. I think this section could be interesting but it requires some additional attention.

The authors mention "pathogenicity predictors" and otherwise use pathogenicity incorrectly throughout the manuscript. Pathogenicity is a classification for a variant after it has been curated according to a framework like the ACMG/AMP guidelines (Richards 2015 and amendments). A single tool cannot predict or assign pathogenicity - the AlphaMissense paper was wrong to use this nomenclature and these authors should not compound this mistake. These predictors should be referred to as "variant effect predictors" or similar, and they are able to produce evidence towards pathogenicity or benignity but not make pathogenicity calls themselves. For example, in Figure 4e, the terms "pathogenic" and "benign" should only be used here if these are the classifications the authors have derived from ClinVar or a similar source of clinically classified variants.

Minor comments:

The target selection table on the website needs some kind of text filtering option. It's very tedious to have to find a protein by scrolling through the table rather than typing in the symbol. This will only get worse as more datasets are added.

The data sources listed on the data usage section of the website are not concordant with what is in the paper. For example, MaveDB is not listed.

I found Figure 2 to be a bit confusing in that it partially interleaves results from two different proteins. I think this would be nicer as two separate figures, one on each protein, or just of a single protein.

Figure 3 panel b is distractingly large and I wonder if the authors could do a little bit more with this visualization.

Capitalization is inconsistent throughout the manuscript. For example, page 9 line 288 refers to VampSEQ instead of VAMP-seq (although this is correct elsewhere). MaveDB is referred to as MAVEdb or MAVEDB in various places. AlphaMissense is referred to as Alphamissense in the Figure 5 legend. The authors should make a careful pass through the manuscript to address this kind of issues.

MaveDB has a more recent paper (PMID: 39838450) that should be cited instead of/in addition to Esposito et al.

On page 11, lines 338-339 the authors mention some interesting proteins including BLC2, which has base editor data available (PMID: 35288574). Are there plans to incorporate this type of functional assay data into MAVISp?

Significance

General assessment:

This is a nice resource and the authors have clearly put a lot of effort in. They should be celebrated for their achievments in curating the diverse datasets, and the GitBooks are a nice approach. However, I wasn't able to get the website to work and I have raised several issues with the paper itself that I think should be addressed.

Advance:

New ways to explore and integrate complex data like protein structures and variant effects are always interesting and welcome. I appreciate the effort towards manual curation of datasets. This work is very similar in theme to existing tools like Genomics 2 Proteins portal (PMID: 38260256) and ProtVar (PMID: 38769064). Unfortunately as I wasn't able to use the site I can't comment further on MAVISp's position in the landscape.

Audience:

MAVISp could appeal to a diverse group of researchers who are interested in the biology or biochemistry of proteins that are included, or are interested in protein variants in general either from a computational/machine learning perspective or from a genetics/genomics perspective.

My expertise:

I am an expert in high-throughput functional genomics experiments and am an experienced computational biologist with software engineering experience.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

The authors present a pipeline and platform, MAVISp, for aggregating, displaying and analysis of variant effects with a focus on reclassification of variants of uncertain clinical significance and uncovering the molecular mechanisms underlying the mutations.

Major comments:

• On testing the platform, I was unable to look-up a specific variant in ADCK1 (rs200211943, R115Q). I found that despite stating that the mapped refseq ID was NP_001136017 in the HGVSp column, it was actually mapped to the canonical UniProt sequence (Q86TW2-1). NP_001136017 actually maps to Q86TW2-3, which is missing residues 74-148 compared to the -1 isoform. The Uniprot canonical sequence has no exact RefSeq mapping, so the HGVSp column is incorrect in this instance. This mapping issue may also affect other proteins and result in incorrect HGVSp identifiers for variants.
• The paper lacks a section on how to properly interpret the results of the MAVISp platform (the case-studies are useful, but don't lay down any global rules for interpreting the results). For example: How should a variant with conflicts between the variant impact predictors be interpreted? Are certain indicators considered more 'reliable' than others?
• In the Methods section, GEMME is stated as being rank-normalised with 0.5 as a threshold for damaging variants. On checking the data downloaded from the site, GEMME was not rank-normalised but rather min-max normalised. Furthermore, Supplementary text S4 conflicts with the methods section over how GEMME scores are classified, S4 states that a raw-value threshold of -3 is used.
• Note. This is a major comment as one of the claims is that the associated web-tool is user-friendly. While functional, the web app is very awkward to use for analysis on any more than a few variants at once.
  • The fixed window size of the protein table necessitates excessive scrolling to reach your protein-of-interest. This will also get worse as more proteins are added. Suggestion: add a search/filter bar.
  • The same applies to the dataset window.
  • You are unable to copy anything out of the tables.
  • Hyperlinks in the tables only seem to work if you open them in a new tab or window.
  • All entries in the reference column point to the MAVISp preprint even when data from other sources is displayed (e.g. MAVE studies).
  • Entering multiple mutants in the "mutations to be displayed" window is time-consuming for more than a handful of mutants. Suggestion: Add a box where multiple mutants can be pasted in at once from an external document.

Minor comments

• Grammar. I appreciate that this manuscript may have been compiled by a non-native English speaker, but I would be remiss not to point out that there are numerous grammar errors throughout, usually sentence order issues or non-pluralisation. The meaning of the authors is mostly clear, but I recommend very thoroughly proof-reading the final version.
• There are numerous proteins that I know have high-quality MAVE datasets that are absent in the database e.g. BRCA1, HRAS and PPARG.
• Checking one of the existing MAVE datasets (KRAS), I found that the variants were annotated as damaging, neutral or given a positive score (these appear to stand-in for gain-of-function variants). For better correspondence with the other columns, those with positive scores could be labelled as 'ambiguous' or 'uncertain'.
• Numerous thresholds are defined for stabilizing / destabilizing / neutral variants in both the STABILITY and the LOCAL_INTERACTION modules. How were these thresholds determined? I note that (PMC9795540) uses a ΔΔG threshold of 1/-1 for defining stabilizing and destabilizing variants, which is relatively standard (though they also say that 2-3 would likely be better for pinpointing pathogenic variants).
• "Overall, with the examples in this section, we illustrate different applications of the MAVISp results, spanning from benchmarking purposes, using the experimental data to link predicted functional effects with structural mechanisms or using experimental data to validate the predictions from the MAVISp modules."

The last of these points is not an application of MAVISp, but rather a way in which external data can help validate MAVISp results. Furthermore, none of the examples given demonstrate an application in benchmarking (what is being benchmarked?). - Transcription factors section. This section describes an intended future expansion to MAVISp, not a current feature, and presents no results. As such, it should probably be moved to the conclusions/future directions section. - Figures. The dot-plots generated by the web app, and in Figures 4, 5 and 6 have 2 legends. After looking at a few, it is clear that the lower legend refers to the colour of the variant on the X-axis - most likely referencing the ClinVar effect category. This is not, however, made clear either on the figures or in the app. - "We identified ten variants reported in ClinVar as VUS (E102K, H86D, T29I, V91I, P2R, L44P, L44F, D56G, R11L, and E25Q, Fig.5a)"

E25Q is benign in ClinVar and has had that status since first submitted.

Significance

Platforms that aggregate predictors of variant effect are not a new concept, for example dbNSFP is a database of SNV predictions from variant effect predictors and conservation predictors over the whole human proteome. Predictors such as CADD and PolyPhen-2 will often provide a summary of other predictions (their features) when using their platforms. MAVISp's unique angle on the problem is in the inclusion of diverse predictors from each of its different moules, giving a much wider perspective on variants and potentially allowing the user to identify the mechanistic cause of pathogenicity. The visualisation aspect of the web app is also a useful addition, although the user interface is somewhat awkward. Potentially the most valuable aspect of this study is the associated gitbook resource containing reports from biocurators for proteins that link relevant literature and analyse ClinVar variants. Unfortunately, these are only currently available for a small minority of the total proteins in the database with such reports.

For improvement, I think that the paper should focus more on the precise utility of the web app / gitbook reports and how to interpret the results rather than going into detail about the underlying pipeline.

In terms of audience, the fast look-up and visualisation aspects of the web-platform are likely to be of interest to clinicians in the interpretation of variants of unknown clinical significance. The ability to download the fully processed dataset on a per-protein database would be of more interest to researchers focusing on specific proteins or those taking a broader view over multiple proteins (although a facility to download the whole database would be more useful for this final group).

My expertise.

• I am a protein bioinformatician with a background in variant effect prediction and large-scale data analysis.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary: This manuscript, "MAVISp: A Modular Structure-Based Framework for Protein Variant Effects," presents a significant new resource for the scientific community, particularly in the interpretation and characterization of genomic variants. The authors have developed a comprehensive and modular computational framework that integrates various structural and biophysical analyses, alongside existing pathogenicity predictors, to provide crucial mechanistic insights into how variants affect protein structure and function. Importantly, MAVISp is open-source and designed to be extensible, facilitating reuse and adaptation by the broader community.

Major comments:

• While the manuscript is formally well-structured (with clear Introduction, Results, Conclusions, and Methods sections), I found it challenging to follow in some parts. In particular, the Introduction is relatively short and lacks a deeper discussion of the state-of-the-art in protein variant effect prediction. Several methods are cited but not sufficiently described, as if prior knowledge were assumed. OPTIONAL: Extend the Introduction to better contextualize existing approaches (e.g., AlphaMissense, EVE, ESM-based predictors) and clarify what MAVISp adds compared to each.
• The workflow is summarized in Figure 1(b), which is visually informative. However, the narrative description of the pipeline is somewhat fragmented. It would be helpful to describe in more detail the available modules in MAVISp, and which of them are used in the examples provided. Since different use cases highlight different aspects of the pipeline, it would be useful to emphasize what is done step-by-step in each. OPTIONAL: Consider adding a table or a supplementary figure mapping each use case to the corresponding pipeline steps and modules used.
• The text contains numerous acronyms, some of which are not defined upon first use or are only mentioned in passing. This affects readability. OPTIONAL: Define acronyms upon first appearance, and consider moving less critical technical details (e.g., database names or data formats) to the Methods or Supplementary Information. This would greatly enhance readability.
• The code and trained models are publicly available, which is excellent. The modular design and use of widely adopted frameworks (PyTorch and PyTorch Geometric) are also strong points. However, the Methods section could benefit from additional detail regarding feature extraction and preprocessing steps, especially the structural features derived from AlphaFold2 models. OPTIONAL: Include a schematic or a table summarizing all feature types, their dimensionality, and how they are computed.
• The section on transcription factors is relatively underdeveloped compared to other use cases and lacks sufficient depth or demonstration of its practical utility. OPTIONAL: Consider either expanding this section with additional validation or removing/postponing it to a future manuscript, as it currently seems preliminary.

Minor comments:

• Most relevant recent works are cited, including EVE, ESM-1v, and AlphaFold-based predictors. However, recent methods like AlphaMissense (Cheng et al., 2023) could be discussed more thoroughly in the comparison.
• Figures are generally clear, though some (e.g., performance barplots) are quite dense. Consider enlarging font sizes and annotating key results directly on the plots.
• Minor typographic errors are present. A careful proofreading is highly recommended. Below are some of the issues I identified:

Page 3, line 46: "MAVISp perform" -> "MAVISp performs"

Page 3, line 56: "automatically as embedded" -> "automatically embedded"

Page 3, line 57: "along with to enhance" -> unclear; please revise

Page 4, line 96: "web app interfaces with the database and present" -> "presents"

Page 6, line 210: "to investigate wheatear" -> "whether"

Page 6, lines 215-216: "We have in queue for processing with MAVISp proteins from datasets relevant to the benchmark of the PTM module." -> unclear sentence; please clarify

Page 15, line 446: "Both the approaches" -> "Both approaches"

Page 20, line 704: "advantage of multi-core system" -> "multi-core systems"

Significance

General assessment: the strongest aspects of the study are the modularity, open-source implementation, and the integration of structural information through graph neural networks. MAVISp appears to be one of the few publicly available frameworks that can easily incorporate AlphaFold2-based features in a flexible way, lowering the barrier for developing custom predictors. Its reproducibility and transparency make it a valuable resource. However, while the technical foundation is solid and the effort substantial, the scientific narrative and presentation could be significantly improved. The manuscript is dense and hard to follow in places, with a heavy use of acronyms and insufficient explanation of key design choices. Improving the descriptive clarity, especially in the early sections, would greatly enhance the impact of this work.

Advance: to the best of my knowledge, this is one of the first modular platforms for protein variant effect prediction that integrates structural data from AlphaFold2 with bioinformatic annotations and even clinical data in an extensible fashion. While similar efforts exist (e.g., ESMfold, AlphaMissense), MAVISp distinguishes itself through openness and design for reusability. The novelty is primarily technical and practical rather than conceptual.

Audience: this study will be of strong interest to researchers in computational biology, structural bioinformatics, and genomics, particularly those developing variant effect predictors or analyzing the impact of mutations in clinical or functional genomics contexts. The audience is primarily specialized, but the open-source nature of the tool may diffuse its use among more applied or translational users, including those working in precision medicine or protein engineering.

Reviewer expertise: my expertise is in computational structural biology, molecular modeling, and (rather weak) machine learning applications in bioinformatics. I am familiar with graph-based representations of proteins, AlphaFold2, and variant effects based on Molecular Dynamics simulations. I do not have any direct expertise in clinical variant annotation pipelines.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Reply to the Reviewers

I thank the Referees for their...

Referee #1

1. The authors should provide more information when...

Responses + The typical domed appearance of a hydrocephalus-harboring skull is apparent as early as P4, as shown in a new side-by-side comparison of pups at that age (Fig. 1A). + Though this is not stated in the MS 2. Figure 6: Why has only...

Response: We expanded the comparison

Minor comments:

1. The text contains several...

Response: We added...

Referee #2

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Meroni and colleagues present evidence that CIP2A is required to recruit the SMX complex to sites of replication stress in mitotic cells. Whilst the data generated when using U2OS cells seems to support a role for CIP2A in recruiting the SMX complex to sites of replication stress to facilitate MiDAS, as the authors point out, this pathway is not conserved in DLD1 cells. Although the authors suggest that this discrepancy in the data may relate to the fact that U2OS cells are ALT positive and the DLD1 cells are not, there is no experimental evidence to support this hypothesis. It would have been nice if the authors had backed up this hypothesis with data relating to how CIP2A regulates the SMX-MiDAS pathway in other ALT positive and negative cell lines. Taken together, after reading this manuscript, I am left wondering whether CIP2A is really important for SMX-dependent MiDAS or whether it is phenomenon that is found in some commonly used cancer cell lines and not others. Whilst it is important to publish conflicting results as they can explain why some research labs can reproduce published data and others can't, I think this manuscript would benefit from assessment of the role of CIP2A in mediating the recruitment of the SMX complex to carry out MiDAS in a variety of additional cancer cell lines and also non-cancer cell lines, such as RPE1-hTERT cells to obtain some sort of consensus about the importance of CIP2A in dealing with mitotic replication stress.

Comments:

1. Fig.2A-E: Can the authors comment on the difference in number of APH-induced FANCD2, SLX4, Mus81 and XPF foci in mitotic U2OS cells? Given that SLX4 should be recruiting both XPF and Mus81, there is a disparity between the numbers of mitotic foci given that there are approximately 30 FANCD3 foci per mitotic cell following APH treatment. Additionally, why do the XPF foci not increase after APH exposure?
2. Fig.2G: I would say that the 'full rescue' of Mus81 foci in the CIP2A KO cells complemented with WT CIP2A is not hugely convincing since there is only a difference of 1-2 foci between the WT and CIP2A KO cells treated with APH.
3. Fig.3A: I am not really sure how biologically meaningful a difference of 0.03-0.04 EdU foci per chromosome is when comparing BRCA2 KO DLD1 cells treated with control siRNA versus CIP2A siRNA. Would it not have been better to treat the BRCA2 KO DLD1 cells with APH?
4. Fig.3H-I: Given that the reduction in MiDAS in the CIP2A KO cl.7 cell line is likely a clonal artifact not related to the loss of CIP2A, it is unclear how to interpret the data about the EdU foci pattern on chromosomes presented in Fig.3H-I and its relevance to CIP2A. Therefore, I am not sure this data really adds anything to the manuscript.
5. Fig.4H: The difference in Mus81 foci per mitotic cell with/without the expression of B6L is only one focus per mitotic cell. Based on this, it is difficult to make any real conclusions about whether the TOPBP1-CIP2A interaction is really required for the recruitment of Mus81 to sites of mitotic replication stress.

Significance

As mentioned above, it is clear that the role of CIP2A in regulating the mitotic replication stress response by promoting recruitment of the SMX complex to sites of mitotic replication stress to promote MiDAS is complicated and may be specific to some cancer cell lines and not others. Whilst it is not clear what the underlying reason for this is, this manuscript would definitely benefit from additional analysis of this pathway in other cancer and non-cancer cell lines to obtain a consensus about the role of CIP2A.

This manuscript would appeal to fundamental research scientists interested in understanding the mechanisms underlying DNA damage repair, the replication stress response and mitotic regulation.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

In the manuscript entitled "CIP2A Mediates the Recruitment of the SLX4-MUS81-XPF Tri-Nuclease Complex in Mitosis and Protects Against Replication Stress" by Meroni et al the authors have characterized localization of the CIP2A-TopBP1 complex as well as some aspects of its function in U2OS and DLD1 cell lines exposed to different types of stress. They find that replication stress due to BRCA2 KO, APH or ATRi results in increased focus formation of the CIP2A-TopBP1 complex in mitotic cells. Moreover, the authors find significant decrease in EdU incorporartion in mitotic cells when disrupting CIP2A in (i) U2OS exposed to ATRi or Aph; (ii) in DLD1 BRCA2 KO; (iii) in one clone of DLD1 with Cip2A KO, and a non significant decrease the other DLD1 with Cip2A KO that they tested. Thus, under most of the tested conditions CIP2A is facilitating MiDAS. However, the authors find that expression of a previously characterised fragment of TopBP1 called B6L, which disrupts CIP2A-TopBP1 interaction, does not inhibit MiDAS in DLD1 cells.

Major comments:

It is convincing but not surprising that CIP2A-TopBP1 form more foci in mitotic cells after replication stress. The authors statement in the abstract: "We demonstrate that in the absence of CIP2A, cells fail to recruit the SLX4-MUS81-XPF (SMX) tri-nuclease complex to sites of under-replicated DNA in mitosis, resulting in a high incidence of lagging chromosomes during anaphase and subsequent micronuclei formation" is not supported by experiments. The authors indeed show that absence of CIP2A leads to lagging chromosomes during anaphase and subsequent micronuclei formation (which has previously been shown) but they have not shown that it is the failure to recruit the SMX complex that results in the phenotypes they mention. The authors should rephrase or remove this claim.

There is a discrepancy between the B6L-mediated disruption of TopBP1-CIP2A interaction having no effect on MiDAS in DLD1 cells (fig. 4F) whereas knockout of CIP2A in DLD1 cells seem to have an effect (fig 3E). The most obvious explanation for this observation is that the B6L peptide does not fully abolish TopBP1-CIP2A interaction and can still allow for some SLX4-MUS81 recruitment that is not visible as foci but still sufficient to induce MiDAS. To understand whether MiDAS in DLD1 expressing B6L is dependent on the fraction of TopBP1 that can still form foci (according to Fig 4D) the authors must co-stain for TopBP1 together with EdU detection to address whether they observe any colocalization of TopBP1 with MiDAS.

Many of the experiments are only performed with two independent replicates. The authors must perform 3 independent replicates. Also, it is not clear how many cells were analysed for each replicate. This should be clearly stated and the mean of each replicate should always be shown. Statistical analyses should be carried out using the means of the replicates. The authors must provide data showing the efficiency of CIP2A knockdown and CIP2A expression in the complementation assay (Fig. 2G)

Minor comments:

The authors should change "U-2 OS" in the figures to "U2OS" for consistency.

In figure 4D - is the increase with APH and S1 significant compared to S1 alone?

Figure 3 B and C. It is worrying that there is a huge difference in the EdU foci/mitotic cell in untreated condition from panel B to pabel C.

Fig 3F - is the increase in EdU incorporation after complementation significant?

For figure 3I representative images should be added

Significance

The data presented in the manuscript is of high quality but unfortunately does not present a big advance compared to current knowledge. Nevertheless, it is useful to have side-by-side comparison of different cell lines and conditions and IF localization studies. Given the therapeutic interest in the CIP2A-TopBP1 pathway it is important to get all the details right and researches with interest in DNA repair during mitosis will have interest in this work.

Moreover, in this manuscript the authors demonstrate that the impact of CIP2A disruption on MiDAS is variable across different cell lines-and even between individual clones. The concept of MiDAS is still clouded by considerable ambiguity, possibly due to earlier studies overstating the consequences of knockdown or knockout. It is therefore great that this manuscript presents clear, unbiased observations, highlighting both inter-cell line differences and the partial nature of the effects. This kind of nuanced reporting is valuable for the field.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary and Significance

This is a timely and exciting study that provides us with some new molecular insights into mitotic DNA repair. It builds on previous studies that identified the CIP2A-TOPBP1 complex as a molecular tether that connects broken DNA ends that get transmitted from interphase into mitosis (PMID: 30898438, 35842428, 35842428). The results are also largely complementary with those of Martin et al. (BioRxiv preprint at https://doi.org/10.1101/2024.11.12.621593) and de Haan et al. (BioRxiv preprint at https://www.biorxiv.org/content/10.1101/2025.04.03.647079v1).

The authors report three main findings, as summarized below.

1) The CIP2A oncoprotein is involved in the cellular response to replication stress in mitosis.

2) CIP2A is required for the recruitment of SLX4, MUS81, and XPF into foci during mitosis. SLX4 is a well-established protein scaffold for multiple DNA repair factors, including three structure-selective endonucleases called SLX1, MUS81-EME1, and XPF-ERCC1 that together, form the SMX tri-nuclease that removes DNA repair intermediates and chromosome entanglements during mitosis. In some cell lines, the SMX complex is required for mitotic DNA synthesis at sites of under-replicated DNA, thus ensuring complete DNA replication prior to cell division.

3) The role(s) of CIP2A in MiDAS are cell line-dependent/context-dependent.

In general, this is a solid body of microscopy-based work that includes appropriate cell models and experimental controls. The manuscript is well-written, and the data is presented coherently. The main findings will have important implications for researchers interested in mitotic DNA damage, genome stability, and cancer biology. After addressing the points below, I believe this manuscript will be suitable for publication.

Major comments

1) Figure 1C: The CIP2A-TOPBP1 PLA experiments are lacking critical controls, namely cells lacking or depleted of CIP2A and TOPBP1. These controls are necessary to provide confidence for the results presented in Figure 1C. If these controls are too expensive or time-demanding for the manuscript, then I recommend removing the PLA data from Figure 1C.

2) In Figure 2, the authors conclude that the loss of SLX4, XPF, and MUS81 foci in CIP2A depleted cells is synonymous with the loss of recruitment to DNA lesions. However, I can think of many other reasons that could explain the loss of foci. For example, do the authors know that the proteins are expressed to similar levels in cells with and without CIP2A (this should be tested by a simple western blot). Along the same vein, a biochemical fractionation and western blot of the soluble vs chromatin-bound fraction would complement and substantiate their microscopy-based assays in Figure 2. If the fractionation is not possible, then the text should be adjusted accordingly.

3) The experimental set-up in Figure 2 probes whether CIP2A mediates the recruitment of SMX subunits - SLX4, XPF, MUS81 - but not the SMX complex per se, which would require the study of SLX4 point mutants that selectively ablate the interactions with XPF or MUS81 (but not CIP2A). As such, I suggest that they rephrase their wording appropriately.

4) Western blots must be provided to substantiate the experiments performed with siRNA (Figure 1G-J, Figure 2A-E and 2H, Figure 3A-D, Figure 5B-D). Similarly, the authors should provide western blots to confirm the BRCA2 and CIP2A statuses in their KO cell lines, as well as the complementation cell lines. In the absence of this information, it is difficult for someone to make an independent and meaningful interpretation of their data.

5) Most of the data presented in this manuscript is derived from n = 2 biological replicates. All of the experiments reported in the study should be repeated for n = 3 biological replicates.

6) Since the authors report the median of their data, they should also report the interquartile range or confidence interval to display the uncertainty.

Minor comments

1) The references can be improved by acknowledging some of the foundational papers on SLX4 and the SMX tri-nuclease.

1.a) Page 3: Neither Minocherhomji et al. 2015 nor Pedersen et al. 2015 were the first to describe SLX4 as a scaffold for structure-selective endonucleases. The founding papers were published in 2009 (Svendsen et al. 2009, Munoz et al. 2009, Fekairi et al. 2009, Andersen et al. 2009) with important mechanistic studies on nuclease activation reported in 2013 (Wyatt et al. 2013, Castor et al. 2013) and 2017 (Wyatt et al. 2017).

1.b) Page 6: The authors should cite Wyatt et al. 2013, alongside Castor et al. 2013 and Garner et al. 2013 since these 3 articles were published at similar times. They may also want to acknowledge previous work from the Hickson and Rosselli labs showing that XPF-ERCC1 and MUS81-EME1 are recruited to fragile sites in mitosis.

2) To improve broad readability, the authors should remove the following abbreviations: Aph and WT.

3) In several figures, the authors show that a given treatment causes a very small change in the number of foci observed per mitotic cell. Although the values may be statistically different, it is important that they discuss the biological significance of these small effects - for example, I am not convinced that a difference of 2-3 foci per cell is sufficient to induce a robust cellular response.

4) The methods could be expanded to ensure reproducibility, particularly with respect to the drug treatments (e.g., timing, washes, etc.).

Significance

This is a timely and exciting study that provides us with some new molecular insights into mitotic DNA repair. It builds on previous studies that identified the CIP2A-TOPBP1 complex as a molecular tether that connects broken DNA ends that get transmitted from interphase into mitosis (PMID: 30898438, 35842428, 35842428). The results are also largely complementary with those of Martin et al. (BioRxiv preprint at https://doi.org/10.1101/2024.11.12.621593) and de Haan et al. (BioRxiv preprint at https://www.biorxiv.org/content/10.1101/2025.04.03.647079v1).

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

We thank the reviewers for their detailed comments, which have already helped us improve our manuscript. The responses below detail changes we have already made as part of the Review Commons revision plan, and further changes we expect to make in a longer revision period.

__Reviewer #1 __

Major points __ It is mentioned throughout the manuscript that 3 plates were evaluated per line. I believe these are independently differentiated plates. This detail is critical concerning rigor and reproducibility. This should be clearly stated in the Methods section and in the first description of the experimental system in the Results section for Figure 1.__

These experimental details have now been clarified. Unless otherwise stated, all findings were confirmed in three independently differentiated plates from the same line or at least one differentiation from each of three lines.

For the patient-specific lines - how many lines were derived per patient?

This has now been clarified in the methods. Microfluidic reprogramming of a small number of amniocytes produces one line per patient representing a pool of clones. Subcloning from individual cells would not be possible within the timeframe of a pregnancy.

Methods: For patient-specific iPSC lines, one independent iPSC line was obtained per patient following microfluidic mmRNA reprogramming.

Was the Vangl2 variant introduced by prime editing? Base editing? The details of the methods are sparse.

We have now expanded these details:

Methods: VANGL2 knock-in lines were generated using CRSIPR-Cas9 homology directed repair editing by Synthego (SO-9291367-1). The guide sequence was AUGAGCGAAGGGUGCGCAAG and the donor sequence was CAATGAGTACTACTATGAGGAGGCTGAGCATGAGCGA AGGGTGTGCAAGAGGAGGGCCAGGTGGGTCCCTGGGGGAGAAGAGGAGAG. Sequence modification was confirmed by Sanger sequencing before delivery of the modified clones, and Sanger sequencing was repeated after expansion of the lines (Supplementary Figure 5) as well as SNP arrays (Illumina iScan, not shown) confirming genomic stability.

Some additional suggestions for improvement. __ The abstract could be more clearly written to effectively convey the study's importance. Here are some suggestions.__

Line 26: Insert "apicobasal" before "elongation" - the way it is written, I initially interpreted it as anterior-posterior elongation.

Line 29: Please specify that the lines refer to 3 different established parent iPSC lines with distinct origins and established using different reprogramming methods, plus 2 control patient-derived lines. - The reproducibility of the cell behaviors is impressive, but this is not captured in the abstract.

Line 32: add that this mutation was introduced by CRISPR-Cas9 base/prime editing.

The last sentence of the abstract states that the study only links apical constriction to human NTDs, but also reveals that neural differentiation and apical-basal elongation were found. __ The introduction could also use some editing. __ Line 71: insert "that pulls actin filaments together" after "power strokes" __ Line 73: "apically localized," do you mean "mediolaterally" or "radially"? __ Line 75: Can you specify that PCP components promote "mediolaterally orientated" apical constriction __ Lines 127: Specify that NE functions include apical basal elongation and neurodifferentiation are disrupted in patient-derived models__

These text changes have all been made.

Reviewer #2:____ __ __Major comments: __ 1. Figure 1. The authors use F-actin to segment cell areas. Perhaps this could be done more accurately with ZO-1, as F-actin cables can cross the surface of a single cell. In any case, the authors need to show a measure of segmentation precision: segmented image vs. raw image plus a nuclear marker (DAPI, H2B-GFP), so we can check that the number of segmented cells matches the number of nuclei.__

We used ZO-1 to quantify apical areas of the VANGL2-konckin lines in Figure 3. Segmentation of neuroepithelial apical areas based on F-actin staining is commonplace in the field (e.g. Fig 9 of Bogart & Brooks 2025 as a recent example), and is generally robust because the cell junctions are much brighter than any apical fibres not associated with the apical cortex. However, we accept that at earlier stages of differentiation there may be more apical fibres when cells are cuboidal. We have therefore repeated our analysis of apical area using ZO-1 staining as suggested, shown in the new Supplementary Figure 1, analysing a more temporally-detailed time course in one iPSC line. This new analysis confirms our finding of lack of apical area change between days 2-4 of differentiation, then progressive reduction of apical area between days 4-8, further validating our system. Including nuclear images is not helpful because of the high nuclear index of pseudostratified epithelia (e.g. see Supplementary Figure 7) which means that nuclei overlap along the apicobasal axis. Individual nuclei cannot be related to their apical surface in projected images.

__2.Lines 156-166. The authors claim that changes in gene expression precede morphological changes. I am not convinced this is supported by their data. Fig. 1g (epithelial thickness) and Fig. 1k (PAX6 expression) seem to have similar dynamics. The authors can perform a cross-correlation between the two plots to see which Δt gives maximum correlation. If Δt __We are happy to do this analysis fully in revision. __Our initial analysis performing cross-correlation between apical area and CDH2 protein in one line shows the highest cross-correlation at Δt = -1, suggesting neuroepithelial CDH2 increases before apical area decreases. In contrast, the same analysis comparing apical area versus PAX6 shows Δt = 0, suggesting concurrence. This analysis will be expanded to include the other markers we quantified and the manuscript text amended accordingly. We are keen to undertake additional experiments to test whether these cells swap their key cadherins - CDH1 and CDH2 - before they begin to undergo morphological changes (see the response to Reviewer 3's minor comment 1 immediately below).

3. Figure 2d. The laser ablation experiment in the presence of ROCK inhibitor is clear, as I can easily see the cell outlines before and after the experiment. In the absence of ROCK inhibitor, the cell edges are blurry, and I am not convinced the outline that the authors drew is really the cell boundary. Perhaps the authors can try to ablate a larger cell patch so that the change in area is more defined.

The outlines on these images are not intended to show cell boundaries, but rather link landmarks visible at both timepoints to calculate cluster (not cell) change in area. This is as previously shown in Galea et al Nat Commun 2021 and Butler et al J Cell Sci 2019. We have now amended the visualisation of retraction in Figure 2 to make representation of differences between conditions more intuitive.

4. Figure 2d. Do the cells become thicker after recoil?

This is unlikely because the ablated surface remains in the focal plane. Unfortunately, we are unable to image perpendicularly to the direction of ablation to test whether their apical surface moves in Z even by a very small amount. This has now been clarified in the results:

Results: The ablated surface remained within the focal plane after ablation, indicating minimal movement along the apical-basal axis.

5. Figure 3. The authors mention their previous study in which they show that Vangl2 is not cell-autonomously required for neural closure. It will be interesting to study whether this also the case in the present human model by using mosaic cultures.

We agree with the reviewer that this is one of the exciting potential future applications of our model, which will first require us to generate stable fluorescently-tagged lines (to identify those cells which lack VANGL2). We will also need to extensively analyze controls to validate that mixing fluo-tagged and untagged lines does not alter the homogeneity of differentiation, or apical constriction, independently of VANGL2 deletion. As such, the reviewer is suggesting an altogether new project which carries considerable risk and will require us to secure dedicated funding to undertake.

6. Lines 403-415. The authors report poor neural induction and neuronal differentiation in GOSB2. As far as I understand, this phenotype does not represent the in vivo situation. Thus, it is not clear to what extent the in vitro 2D model describes the human patient.

The GOSB2 iPSC line we describe does represent the in vivo situation in Med24 knockout mouse embryos, but is clearly less severe because we are still able to detect MED24 protein expressed in this line. We do not have detailed clinical data of the patient from which this line was obtained to determine whether their neurological development is normal. However, it is well established that some individuals who have spina bifida also have abnormalities in supratentorial brain development. It is therefore likely that abnormalities in neuron differentiation/maturation are concomitant with spina bifida. Our findings in the GOSB2 line complement earlier studies which also identified deficiencies in the ability of patient-derived lines to form neurons, but were unable to functionally assess neuroepithelial cell behaviours we studied. This has now been clarified in the discussion:

Discussion: *Neuroepithelial cells of the GOSB2 line described here, which has partial loss of MED24, similarly produces a thinner neuroepithelium with larger apical areas. Although apical areas were not analysed in mouse models of Med24 deletion, these embryos also have shorter and non-pseudostratified neuroepithelium. *

Our GOSB2 line - which retains readily detectable MED24 protein - is clearly less severe than the mouse global knockout, and the clinical features of the patient from which this line was derived are milder than the phenotype of Med24 knockout embryos68. Mouse embryos lacking one of Med24's interaction partners in the mediator complex, Med1, also have thinner neuroepithelium and diminished neuronal differentiation but successfully close their neural tube85.

7.The experimental feat to derive cell lines from amniotic fluid and to perform experiments before birth is, in my view, heroic. However, I do not feel I learned much from the in vitro assays. There are many genetic changes that may cause the in vivo phenotype in the patient. The authors focus on MED24, but there is not enough convincing evidence that this is the key gene. I would like to suggest overexpression of MED24 as a rescue experiment, but I am not sure this is a single-gene phenotype. In addition, the fact that one patient line does not differentiate properly leads me to think that the patient lines do not strengthen the manuscript, and that perhaps additional clean mutations might contribute more.

We thank the reviewer for their praise of our personalised medicine approach and fully agree that neural tube defects are rarely monogenic. The patient lines we studied were not intended to provide mechanistic insight, but rather to demonstrate the future applicability of our approach to patient care. Our vision is that every patient referred for fetal surgery of spina bifida will have amniocytes (collected as part of routine cystocentesis required before surgery) reprogrammed and differentiated into neuroepithelial cells, then neural progenitors, to help stratify their post-natal care. One could also picture these cells becoming an autologous source for future cell-based therapies if they pass our reproducible analysis pipeline as functional quality control. This has now been clarified in the discussion:

Discussion____: The multi-genic nature of neural tube defect susceptibility, compounded by uncontrolled environmental risk factors (including maternal age and parity102), mean that patient-derived iPSC models are unlikely to provide mechanistic insight. They do provide personalised disease models which we anticipate will enable functional validation of genetic diagnoses for patients and their parents' recurrence risk in future pregnancies, and may eventually stratify patients' postnatal care. We also envision this model will enable quality control of patient-derived cells intended for future autologous cell replacement therapies, as is being developed in post-natal spinal cord injury103.

Minor comments: __ 1.Figure 1c. Text is cropped at the edge of the image.__

This image has been corrected.

Reviewer #2 (Significance (Required)): __ ...In addition, the model was unsuccessful in one of the two patient-derived lines, which limits generalizability and weakens claims of patient-specific predictive value.__

We disagree with the reviewer that "the model was unsuccessful in one of the two patient-derived lines". The GOSB1 line demonstrated deficiency of neuron differentiation independently of neuroepithelial biomechanical function, whereas the GOSB2 line showed earlier failure of neuroepithelial function. We also do not, at this stage, make patient-specific predictive claims: this will require longer-term matching of cell model findings with patient phenotypes over the next 5-10 years.

Reviewer #3: Major comments __ 1) One of my few concerns with this work is that the relative constriction of the apical surface with respect to the basal surface is not directly quantified for any of the experiments. This worry is slightly compounded by the 3D reconstructions Figure 1h, and the observation that overall cell volume is reduced and cell height increased simultaneously to area loss. Additionally, the net impact of apical constriction in tissues in vivo is to create local or global curvature change, but all the images in the paper suggest that the differentiated neural tissues are an uncurved monolayer even missing local buckles. I understand that these cells are grown on flat adherent surfaces limiting global curvature change, but is there evidence of localized buckling in the monolayer? While I believe-along with the authors-that their phenotypes are likely failures in apical constriction, I think they should work to strengthen this conclusion. I think the easiest way (and hopefully using data they already have) would be to directly compare apical area to basal area on a cell wise basis for some number of cells. Given the heterogeneity of cells, perhaps 30-50 cells per condition/line/mutant would be good? I am open to other approaches; this just seems like it may not require additional experiments.__

As the reviewer observes, our cultures cannot bend because they are adhered on a rigid surface. The apical and basal lengths of the cultures will therefore necessarily be roughly equal in length. Some inwards bending of the epithelium is expected at the edges of the dish, but these cannot be imaged. The live imaging we show in Figure 2 illustrates that, just as happens in vivo, apical constriction is asynchronous. This means not all cells will have 'bottle' shapes in the same culture. We now illustrate the evolution of these shapes in more detail in Supplementary Figure 1 (shown in point 2.1 above).

Additionally, the reviewer's comment motivated us to investigate local buckles in the apical surface of our cultures when their apical surfaces are dilated by ROCK inhibition. We hypothesised that the very straight apical surface in normal cultures is achieved by a balance of apical cell size and tension with pressure differences at the cell-liquid interface. Consistent with our expectation, the apical surface of ROCK-inhibited cultures becomes wrinkled (new Supplementary Figure 3). The VANGL2-KI lines do not develop this tortuous apical surface (as shown in Figure 3), which is to be expected given their modification is present throughout differentiation unlike the acute dilation caused by ROCK inhibition.

This new data complements our visualisation of apical constriction in live imaging, apical accumulation of phospho-myosin, and quantification of ROCK-dependent apical tension as independent lines of evidence that our cultures undergo apical constriction.

2) Another slight experimental concern I have regards the difference in laser ablation experiments detailed in Figure 3h-i from those of Figure 2d-e. It seems like WT recoil values in 3h-I are more variable and of a lower average than the earlier experiments and given that it appears significance is reached mainly by impact of the lower values, can the authors explain if this variability is expected to be due to heterogeneity in the tissue, i.e. some areas have higher local tension? If so, would that correspond with more local apical constriction?

There is no significant difference in recoil between the control lines in Figures 2 and 3, albeit the data in Figure 3 is more variable (necessitating more replicates: none were excluded). We also showed laser ablation recoil data in Supplementary Figure 10, in which we did identify a graphing error (now corrected, also no significant difference in recoil from the other control groups).

Minor comments __ 1) There seems to be a critical window at day 5 of the differentiation protocol, both in terms of cell morphology and the marker panel presented in Figure 1i. Do the authors have any data spanning the hours from day 5 to 6? If not, I don't think they need to generate any, but do I think this is a very interesting window worthy of further discussion for a couple of reasons. First, several studies of mouse neural tube closure have shown that various aspects of cell remodeling are temporally separable. For example, between Grego-Bessa et al 2016 and Brooks et al 2020 we can infer that apicobasal elongation rapidly increases starting at E8.5, whereas apical surface area reduction and constriction are apparent somewhat earlier at E8.0. I think it would be interesting to see if this separability is conserved in humans. Second, is there a sense of how the temporal correlation between the pluripotent and early neural fate marker data presented here corroborate or contradict the emerging set of temporally resolved RNA seq data sets of mouse development at equivalent early neural stages?__

Cell shape analysis between days 5 and 6 has now been added (see the response to point 2.1 below). As the reviewer predicted, this is a transition point when apical area begins to decrease and apicobasal elongation begins to increase.

We also thank the reviewer for this prompt to more closely compare our data to the previous mouse publications, which we have added to the discussion. The Grego-Bessa 2016 paper appears to show an increase in thickness between E7.75 and E8.5, but these are not statistically compared. Previous studies showed rapid apicobasal elongation during the period of neural fold elevation, when neuroepithelial cells apically constrict. This has now been added to the discussion:

Discussion In mice, neuroepithelial apicobasal thickness is spatially-patterned, with shorter cells at the midline under the influence of SHH signalling14,77,78. Apicobasal thickness of the cranial neural folds increases from ~25 µm at E7.75 to ~50 µm at E8.579: closely paralleling the elongation between days 2 and 8 of differentiation in our protocol. The rate of thickening is non-uniform, with the greatest increase occurring during elevation of the neural folds80, paralleled in our model by the rapid increase in thickness between days 4-6 as apical areas decrease. Elevation requires neuroepithelial apical constriction and these cells' apical area also decreases between E7.75 and E8.5 in mice79, but we and others have recently shown that this reduction is both region and sex-specific14,81. Specifically, apical constriction occurs in the lateral (future dorsal) neuroepithelium: this corresponds with the identity of the cells generated by the dual SMAD inhibition model we use56. More recently, Brooks et al82 showed that the rapid reduction in apical area from E8-E8.5 is associated with cadherin switching from CDH1 (E-cadherin) to CDH2 (N-cadherin). This is also directly paralleled in our human system, which shows low-level co-expression of CDH1 and CDH2 at day 4 of differentiation, immediately before apical area shrinks and apicobasal thickness increases.

Prompted by the in vivo data in Brooks et al (2025)82, we are keen to further explore the timing of CDH1/CDH2 switching versus apical constriction with new experimental data in revisions.

2) Can the authors elaborate a bit more on what is known regarding apicobasal thickening and pseudo-stratification and how their work fits into the current understanding in the discussion? This is a very interesting and less well studied mechanism critical to closure, which their model is well suited to directly address. I am thinking mainly of the Grego-Bessa at al., 2016 work on PTEN, though interestingly the work of Ohmura et al., 2012 on the NUAK kinases also shows reduced tissue thickening (and apical constriction) and I am sure I have missed others. Given that the authors identify MED24 as a likely candidate for the lack of apicobasal thickening in one of their patient derived lines, is there any evidence that it interacts with any of the known players?

We have now added further discussion on the mechanisms by which the neuroepithelium undergoes apicobasal elongation. Nuclear compaction is likely to be necessary to allow pseudostratification and apicobasal elongation. The reviewer's comment has led us to realise that diminished chromatin compaction is a potential outcome of MED24 down-regulation in our GOSB2 patient-derived line. Figure 4D suggests the nuclei of our MED24 deficient patient-derived line are less compacted than control equivalents and we propose to quantify nuclear volume in more detail to explore this possibility.

Additionally, we have already expanded our discussion as suggested by the reviewer:

Discussion: *Mechanistic separability of apical constriction and apicobasal elongation is consistent with biomechanical modelling of Xenopus neural tube closure showing that both are independently required for tissue bending61. Nonetheless, neuroepithelial apical constriction and apicobasal elongation are co-regulated in mouse models: for example, deletion of Nuak1/283, Cfl184, and Pten79 all produce shorter neuroepithelium with larger apical areas. Neuroepithelial cells of the GOSB2 line described here, which has partial loss of MED24, similarly produces a thinner neuroepithelium with larger apical areas. Although apical areas were not analysed in mouse models of Med24 deletion, these embryos also have shorter and non-pseudostratified neuroepithelium. *

Our GOSB2 line - which retains readily detectable MED24 protein - is clearly less severe than the mouse global knockout, and the clinical features of the patient from which this line was derived are milder than the phenotype of Med24 knockout embryos68. Mouse embryos lacking one of Med24's interaction partners in the mediator complex, Med1, also have thinner neuroepithelium and diminished neuronal differentiation but successfully close their neural tube85. As general regulators of polymerase activity, MED proteins have the potential to alter the timing or level of expression of many other genes, including those already known to influence pseudostratification or apicobasal elongation. MED depletion also causes redistribution of cohesion complexes86 which may impact chromatin compaction, reducing nuclear volume during differentiation.

3) Is there any indication that Vangl2 is weakly or locally planar polarized in this system? Figure 2F seems to suggest not, but Supplementary Figure 5 does show at least more supracellular cable like structures that may have some polarity. I ask because polarization seems to be one of the properties that differs along the anteroposterior axis of the neural plate, and I wonder if this offers some insight into the position along the axis that this system most closely models?

VANGL2 does not appear to be planar polarised in this system. This is similar to the mouse spinal neuroepithelium, in which apical VANGL2 is homogenous but F-actin is planar polarised (Galea et al Disease Models and Mechanisms 2018). We do observe local supracellular cable-like enrichments of F-actin in the apical surface of iPSC-derived neuroepithelial cells. _We propose to compare the length of F-actin cables and coherency of their orientation at the start and end of neuroepithelial differentiation, and in wild-type versus VANGL2-mutant epithelia._

4) I think some of the commentary on the strengths and limitations of the model found in the Results section should be collated and moved to the discussion in a single paragraph. For example ' This could also briefly touch on/compare to some of the other models utilizing hiPSCs (These are mentioned briefly in the intro, but this comparison could be elaborated on a bit after seeing all the great data in this work).

These changes have now been made:

__Discussion: __Some of these limitations, potentially including inclusion of environmental risk factors, can be addressed by using alternative iPSC-derived models93,94. For example, if patients have suspected causative mutations in genes specific to the surface (non-neural) ectoderm, such as GRHL2/3, 3D models described by Karzbrun et al49 or Huang et al95 may be informative. Characterisation of surface ectoderm behaviours in those models is currently lacking. These models are particularly useful for high-throughput screens of induced mutations95, but their reproducibility between cell lines, necessary to compare patient samples to non-congenic controls, remains to be validated. Spinal cell identities can be generated in human spinal cord organoids, although these have highly variable morphologies96,97. As such, each iPSC model presents limitations and opportunities, to which this study contributes a reductionist and highly reproducible system in which to quantitatively compare multiple neuroepithelial functions.

5) While the authors are generally good about labeling figures by the day post smad inhibition, in some figures it is not clear either from the images or the legend text. I believe this includes supplemental figures 2,5,6,8, and 10 (apologies if I simply missed it in one or more of them)

These have now been added.

6) The legend for Figure 2 refers to a panel that is not present and the remaining panel descriptions are off by a letter. I'm guessing this is a versioning error as the text itself seems largely correct, but it may be good to check for any other similar errors that snuck in

This has now been corrected.

7) The cell outlines in Figure 3d are a bit hard to see both in print and on the screen, perhaps increase the displayed intensity?

This has now been corrected.

8) The authors show a fascinating piece of data in Supplementary Figure 1, demonstrating that nuclear volume is halved by day 8. Do they have any indication if the DNA content remains constant (e.g., integrated DAPI density)? I suppose it must, and this is a minor point in the grand scheme, but this represents a significant nuclear remodeling and may impact the overall DNA accessibility.

We agree with the reviewer that the reduction in nuclear volume is important data both because it informs understanding of the reduction in total cell volume, and because it suggests active chromatin compaction during differentiation. Unfortunately, the thicker epithelium and superimposition of nuclei in the differentiated condition means the laser light path is substantially different, making direct comparisons of intensity uninterpretable. Additionally, the apical-most nuclei will mostly be in G2/M phase due to interkinetic nuclear migration. As such, the comparison of DAPI integrated density between epithelial morphologies would not be informative.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

This manuscript by Ampartzidis et al., significantly extends the human induced pluripotent stem cell system originally characterized by the same group as a tool for examining cellular remodeling during differentiation stages consistent with those of human neural tube closure (Ampartzidis et al., 2023). Given that there are no direct ways to analyze cellular activity in human neural tube closure in vivo, this model represents an important platform for investigating neural tube defects which are a common and deleterious human developmental disease. Here, the authors carefully test whether this system is robust and reproducible when using hiPSC cells from different donors and pluripotency induction methods and find that despite all these variables the cellular remodeling programs that occur during early neural differentiation are statistically equivalent, suggesting that this system is a useful experimental substrate. Additionally, the carefully selected donor populations suggest these aspects of human neural tube closure are likely to be robust to sexual dimorphism and to reasonable levels of human genetic background variation, though more fully testing that proposition would require significant effort and be beyond the scope of the current work. Subsequent to this careful characterization, the authors next tested whether this system could be used to derive specific insights into cell remodeling during early neural differentiation. First, they used a reverse genetics approach to knock in a human point mutation in the critical regulator of planar cell polarity and apical constriction, Vangl2. Despite being identified in a patient, this R353C variant has not been directly functionally tested in a human system. The authors find that this variant, despite showing normal expression and phospho-regulation, leads to defects consistent with a failure in apical constriction, a key cell behavior required to drive curvature change during cranial closure. Finally, the authors test the utility of their hiPSC platform to understand human patient-specific defects by differentiating cells derived from two clinical spina bifida patients. The authors identify that one of these patients is likely to have a significant defect in fully establishing early proneural identity as well as defects in apicobasal thickening. While early remodeling occurs normally in the other patient, the authors observe significant defects in later neuronal induction and maturation. In addition, using whole exome sequencing the authors identify candidate variant loci that could underly these defects.

Major comments

1) One of my few concerns with this work is that the relative constriction of the apical surface with respect to the basal surface is not directly quantified for any of the experiments. This worry is slightly compounded by the 3D reconstructions Figure 1h, and the observation that overall cell volume is reduced and cell height increased simultaneously to area loss. Additionally, the net impact of apical constriction in tissues in vivo is to create local or global curvature change, but all the images in the paper suggest that the differentiated neural tissues are an uncurved monolayer even missing local buckles. I understand that these cells are grown on flat adherent surfaces limiting global curvature change, but is there evidence of localized buckling in the monolayer? While I believe-along with the authors-that their phenotypes are likely failures in apical constriction, I think they should work to strengthen this conclusion. I think the easiest way (and hopefully using data they already have) would be to directly compare apical area to basal area on a cell wise basis for some number of cells. Given the heterogeneity of cells, perhaps 30-50 cells per condition/line/mutant would be good? I am open to other approaches; this just seems like it may not require additional experiments.

2) Another slight experimental concern I have regards the difference in laser ablation experiments detailed in Figure 3h-i from those of Figure 2d-e. It seems like WT recoil values in 3h-I are more variable and of a lower average than the earlier experiments and given that it appears significance is reached mainly by impact of the lower values, can the authors explain if this variability is expected to be due to heterogeneity in the tissue, i.e. some areas have higher local tension? If so, would that correspond with more local apical constriction?

Minor comments

1) There seems to be a critical window at day 5 of the differentiation protocol, both in terms of cell morphology and the marker panel presented in Figure 1i. Do the authors have any data spanning the hours from day 5 to 6? If not, I don't think they need to generate any, but do I think this is a very interesting window worthy of further discussion for a couple of reasons. First, several studies of mouse neural tube closure have shown that various aspects of cell remodeling are temporally separable. For example, between Grego-Bessa et al 2016 and Brooks et al 2020 we can infer that apicobasal elongation rapidly increases starting at E8.5, whereas apical surface area reduction and constriction are apparent somewhat earlier at E8.0. I think it would be interesting to see if this separability is conserved in humans. Second, is there a sense of how the temporal correlation between the pluripotent and early neural fate marker data presented here corroborate or contradict the emerging set of temporally resolved RNA seq data sets of mouse development at equivalent early neural stages?

2) Can the authors elaborate a bit more on what is known regarding apicobasal thickening and pseudo-stratification and how their work fits into the current understanding in the discussion? This is a very interesting and less well studied mechanism critical to closure, which their model is well suited to directly address. I am thinking mainly of the Grego-Bessa at al., 2016 work on PTEN, though interestingly the work of Ohmura et al., 2012 on the NUAK kinases also shows reduced tissue thickening (and apical constriction) and I am sure I have missed others. Given that the authors identify MED24 as a likely candidate for the lack of apicobasal thickening in one of their patient derived lines, is there any evidence that it interacts with any of the known players?

3) Is there any indication that Vangl2 is weakly or locally planar polarized in this system? Figure 2F seems to suggest not, but Supplementary Figure 5 does show at least more supracellular cable like structures that may have some polarity. I ask because polarization seems to be one of the properties that differs along the anteroposterior axis of the neural plate, and I wonder if this offers some insight into the position along the axis that this system most closely models?

4) I think some of the commentary on the strengths and limitations of the model found in the Results section should be collated and moved to the discussion in a single paragraph. For example ' This could also briefly touch on/compare to some of the other models utilizing hiPSCs (These are mentioned briefly in the intro, but this comparison could be elaborated on a bit after seeing all the great data in this work).

5) While the authors are generally good about labeling figures by the day post smad inhibition, in some figures it is not clear either from the images or the legend text. I believe this includes supplemental figures 2,5,6,8, and 10 (apologies if I simply missed it in one or more of them)

6) The legend for Figure 2 refers to a panel that is not present and the remaining panel descriptions are off by a letter. I'm guessing this is a versioning error as the text itself seems largely correct, but it may be good to check for any other similar errors that snuck in

7) The cell outlines in Figure 3d are a bit hard to see both in print and on the screen, perhaps increase the displayed intensity?

8) The authors show a fascinating piece of data in Supplementary Figure 1, demonstrating that nuclear volume is halved by day 8. Do they have any indication if the DNA content remains constant (e.g., integrated DAPI density)? I suppose it must, and this is a minor point in the grand scheme, but this represents a significant nuclear remodeling and may impact the overall DNA accessibility.

Significance

Overall, I am enthusiastic about this work and believe it represents a significant step forward in the effort to establish precision medicine approaches for diagnoses of the patient-specific causative cellular defects underlying human neural tube closure defects. This work systematizes an important and novel tool to examine the cellular basis of neural tube defects. While other hiPSC models of neural tube closure capture some tissue level dynamics, which this model does not, they require complex microfluidic approaches and have limited accessibility to direct imaging of cell remodeling. Comparatively, the relative simplicity of the reported model and the work demonstrating its tractability as a patient-specific and reverse genetic platform make it unique and attractive. This work will be of interest to a broad cross section of basic scientists interested in the cellular basis of tissue remodeling and/or the early events of nervous system development as well as clinical scientists interested in modeling the consequences of patient specific human genetic deficits identified in neural tube defect pregnancies.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

The authors' work focuses on studying cell morphological changes during differentiation of hPSCs into neural progenitors in a 2D monolayer setting. The authors use genetic mutations in VANGL2 and patient-derived iPSCs to show that (1) human phenotypes can be captured in the 2D differentiation assay, and (2) VANGL2 in humans is required for neural contraction, which is consistent with previous studies in animal models. The results are solid and convincing, the data are quantitative, and the manuscript is well written. The 2D model they present successfully addresses the questions posed in the manuscript. However, the broad impact of the model may be limited, as it does not contain NNE cells and does not exhibit tissue folding or tube closure, as seen in neural tube formation. Patient-derived lines are derived from amniotic fluid cells, and the experiments are performed before birth, which I find to be a remarkable achievement, showing the future of precision medicine.

Major comments:

1.Figure 1. The authors use F-actin to segment cell areas. Perhaps this could be done more accurately with ZO-1, as F-actin cables can cross the surface of a single cell. In any case, the authors need to show a measure of segmentation precision: segmented image vs. raw image plus a nuclear marker (DAPI, H2B-GFP), so we can check that the number of segmented cells matches the number of nuclei. 2.Lines 156-166. The authors claim that changes in gene expression precede morphological changes. I am not convinced this is supported by their data. Fig. 1g (epithelial thickness) and Fig. 1k (PAX6 expression) seem to have similar dynamics. The authors can perform a cross-correlation between the two plots to see which Δt gives maximum correlation. If Δt < 0, then it would suggest that gene expression precedes morphology, as they claim. Fig. 1j shows that NANOG drops before the morphological changes, but loss of NANOG is not specific to neural differentiation and therefore should not be related to the observed morphological changes. 3.Figure 2d. The laser ablation experiment in the presence of ROCK inhibitor is clear, as I can easily see the cell outlines before and after the experiment. In the absence of ROCK inhibitor, the cell edges are blurry, and I am not convinced the outline that the authors drew is really the cell boundary. Perhaps the authors can try to ablate a larger cell patch so that the change in area is more defined. 4.Figure 2d. Do the cells become thicker after recoil? 5.Figure 3. The authors mention their previous study in which they show that Vangl2 is not cell-autonomously required for neural closure. It will be interesting to study whether this also the case in the present human model by using mosaic cultures. 6.Lines 403-415. The authors report poor neural induction and neuronal differentiation in GOSB2. As far as I understand, this phenotype does not represent the in vivo situation. Thus, it is not clear to what extent the in vitro 2D model describes the human patient. 7.The experimental feat to derive cell lines from amniotic fluid and to perform experiments before birth is, in my view, heroic. However, I do not feel I learned much from the in vitro assays. There are many genetic changes that may cause the in vivo phenotype in the patient. The authors focus on MED24, but there is not enough convincing evidence that this is the key gene. I would like to suggest overexpression of MED24 as a rescue experiment, but I am not sure this is a single-gene phenotype. In addition, the fact that one patient line does not differentiate properly leads me to think that the patient lines do not strengthen the manuscript, and that perhaps additional clean mutations might contribute more.

Minor comments:

1.Figure 1c. Text is cropped at the edge of the image.

Significance

This study establishes a quantitative, reproducible 2D human iPSC-to-neural-progenitor platform for analyzing cell-shape dynamics during differentiation. Using VANGL2 mutations and patient-derived iPSCs, the work shows that (1) human phenotypes can be captured in a 2D differentiation assay and (2) VANGL2 is required for neural contraction (apical constriction), consistent with animal studies. The results are solid, the data are quantitative, and the manuscript is well written. Although the planar system lacks non-neural ectoderm and does not exhibit tissue folding or tube closure, it provides a tractable baseline for mechanistic dissection and genotype-phenotype mapping. The derivation of patient lines from amniotic fluid and execution of experiments before birth is a remarkable demonstration that points toward precision-medicine applications, while motivating rescue strategies and additional clean genetic models. However, overall I did not learn anything substantively new from this manuscript; the conclusions largely corroborate prior observations rather than extend them. In addition, the model was unsuccessful in one of the two patient-derived lines, which limits generalizability and weakens claims of patient-specific predictive value.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

In this manuscript, Ampartzidis et al. report the establishment of an iPSC-derived neuroepithelial model to examine how mutations from spina bifida patients disrupt fundamental cellular properties that underlie neural tube closure. The authors utilize an adherent neural induction protocol that relies on dual SMAD inhibition to differentiate three previously established iPSC lines with different origins and reprogramming methods. The analysis is comprehensive and outstanding, demonstrating reproducible differentiation, apical-basal elongation, and apical constriction over an 8-day period among the 3 lines. In inhibitor studies, it is shown that apical constriction is dependent on ROCK and generates tension, which can be measured using an annular laser ablation assay. Since this pathway is dependent on PCP signaling, which is also implicated in neural tube defects, the authors investigated whether VANGL2 is required by generating 2 lines with a pathogenic patient-derived sequence variant. Both lines showed reduced apical constriction and reduced tension in the laser ablation assays. The authors then established lines obtained from amniocentesis, including 2 control and 2 spina bifida patient-derived lines. These remarkably exhibited different defects. One line showed defects in apical-basal elongation, while the other showed defects in neural differentiation. Both lines were sequenced to identify candidate variants in genes implicated in NTDs. While no smoking gun was found in the line that disrupts neural differentiation (as is often the case with NTDs), compound heterozygous MED24 variants were found in the patient whose cells were defective in apical-basal elongation. Since MED24 has been linked to this phenotype, this finding is especially significant.

Some details are missing regarding the method to evaluate the rigor and reproducibility of the study.

Major points

It is mentioned throughout the manuscript that 3 plates were evaluated per line. I believe these are independently differentiated plates. This detail is critical concerning rigor and reproducibility. This should be clearly stated in the Methods section and in the first description of the experimental system in the Results section for Figure 1. For the patient-specific lines - how many lines were derived per patient? Was the Vangl2 variant introduced by prime editing? Base editing? The details of the methods are sparse.<br /> Some additional suggestions for improvement.<br /> The abstract could be more clearly written to effectively convey the study's importance. Here are some suggestions Line 26: Insert "apicobasal" before "elongation" - the way it is written, I initially interpreted it as anterior-posterior elongation. Line 29: Please specify that the lines refer to 3 different established parent iPSC lines with distinct origins and established using different reprogramming methods, plus 2 control patient-derived lines. - The reproducibility of the cell behaviors is impressive, but this is not captured in the abstract. Line 32: add that this mutation was introduced by CRISPR-Cas9 base/prime editing The last sentence of the abstract states that the study only links apical constriction to human NTDs, but also reveals that neural differentiation and apical-basal elongation were found. The introduction could also use some editing. Line 71: insert "that pulls actin filaments together" after "power strokes" Line 73: "apically localized," do you mean "mediolaterally" or "radially"? Line 75: Can you specify that PCP components promote "mediolaterally orientated" apical constriction Lines 127: Specify that NE functions include apical basal elongation and neurodifferentiation are disrupted in patient-derived models

Significance

This paper is significant not only for verifying the cell behaviors necessary for neural tube closure in a human iPSC model, but also for establishing a robust assay for the functional testing of NTD-associated sequence variants. This will not only demonstrate that sequence variants result in loss of function but also determine which cellular behaviors are disrupted.

Author Response

Reviewer #1:

Summary:

In this paper, the authors utilize CRISPR-Cas9 to generate two different DMD cell lines. The first is a DMD human myoblast cell line that lacks exon 52 within the dystrophin gene. The second is a DMD patient cell line that is missing miRNA binding sites within the regulatory regions of the utrophin gene, resulting in increased utrophin expression. Then, the authors proceeded to test antisense oligonucleotides and utrophin up-regulators in these cell lines.

Overall opinion (expanded in more detail below).

The paper suffers from the following weaknesses:

1) The protocol used to generate the myoblast cell lines is rather inefficient and is not new.

2) Many of the data figures are of low quality and are missing proper controls (detailed in points 5,7,10, 12, 13,14)

Detailed critiques:

1) The title needs to be changed. The method used by the authors is inefficient. The title should instead focus on the two cell lines generated.

We appreciate the reviewer’s comments: thanks to them, we have realized the focus of the manuscript should be in the new models we described and less in the methodology used to create them.

Originally, we wanted to share the problems we faced when applying new CRISPR/Cas9 edition techniques to myoblasts: our conversations with other researchers in the field confirmed that many were having similar problems. However, the reviewer is right in the fact that there are many ways around this problem. We do describe ours and we are working in a new version of the manuscript with additional data to characterize our new models further and where the method used to create them, although included, is not the main focus of the manuscript. In this new version we will change the title accordingly.

2) Line 104: The authors declare that the efficiency of CRISPR/Cas9 is currently too low to provide therapeutic benefit for DMD in vivo. There are lots of papers that show efficient recovery of dystrophin in small and large animals following CRISPR/Cas9 therapy. The authors should cite them properly.

Thank you for your appreciation. We have reviewed the literature again to include new evidences of efficient dystrophin recovery as well as other studies with lower efficiency.

3) Figures 1, 2,3, and 4 can be merged into one figure.

4) Figure 2A and 2B can be moved to supplementary.

5) Figure 2C and 2D are not clear. Are the duplicates the same? Please invert the black and white colors of the blots.

Thank you for your comments. We have inverted the colors of the blots and changed the marks used in figure 2C and 2D to clarify that duplicates are indeed the same sample, assayed in duplicates. We have also merged figures 1 and 4 and moved figures 2 and 3 to supplementary in this new version.

6) Figure 3: In order to optimize the efficiency of myoblast transfection, the plasmids containing the Cas9 and the sgRNA should have different fluorophores (GFP and mCherry). This approach would increase the percentage of positive edited clones among the clones sorted.

We think the reviewer may have misunderstood our methodology: we are not using a plasmid with the Cas9 and another with the sgRNA, we are using two plasmids, both containing Cas9 and each a different sgRNA. We did try to use two different plasmids, one expressing GFP and one expressing puromycin resistance, but we found out that single GFP positive cell selection plus puromycin selection was too inefficient. We could have tried with two different fluorophores, but we tested the tools we had in our hands first and were successful at obtaining enough clones to continue with their characterization, so we did so instead of a further optimization to our editing protocol.

7) Figure 4A: In the text, the authors state that only 1 clone had the correct genomic edit, but from the PCR genotyping in this figure shows at least 2 positive clones (number 4 and 7).

Thank you for your appreciation. As you said, we got two positive clones (as we also indicate in figure 3B) but we completed the full characterization of one of them (clone number 7= DMD-UTRN-Model). In the new version of the manuscript we explain this further.

8) Figure 4C: The authors should address whether one or both copies of the UTRN gene was edited in their clones.

Thank you for your comment. Both copies of the UTRN gene were edited in our clones. We have included this information both in the text and in the figure 4 legend.

9) Figure 4 B and D: The authors should report the sequence below the electropherograms.

Thank you for this correction, we have included the sequence under the electropherograms.

10) Figure 5B: This western blot is of poor quality. Also, the authors should specify that the samples are differentiated myoblasts. Lastly, a standard protein should be included as a loading control.

Thank you for your comment. Poor quality of dystrophin and utrophin western blots was the main reason to validate a new method in our laboratory to measure these proteins directly in cell culture (1) like an alternative to western blotting. Since then, the myoblot method has been routinely used by us and in collaboration with other groups and companies. We included the western blot as it is sometimes easier for those used to this technique to be able to assess a blot in which there is no dystrophin expression. As you pointed out, our samples were all differentiated myotubes, not myoblasts, and we have modified this accordingly. Thank you very much for pointing out this mistake

On the other hand, as described in the methods, Revert TM 700 Total Protein Stain (Li-Cor) and alpha-actinin were included as standards in dystrophin and utrophin western blots, respectively.

11) Figure 5E: We would like to see triplicates for the level of Utrophin expression.

We thank the reviewer for his/her recommendation, but we do not consider western blotting a good quantitative technique, we have included western blots to show the expression/absence of protein at the same level. We have included many more replicates than needed to show at the level of utrophin by myoblots. We acknowledge that western blotting is the preferred method for some reviewers, so in the new version of our manuscript we clearly indicate the value we give to each technique, being myoblots our choice for quantification.

12) Figure 6: A dystrophin western blot should be included to demonstrate protein recovery following antisense oligonucleotide treatment. Also, the RT-PCR data could be biased as you can have preferential amplification of shorter fragments.

Thank you for your recommendation but as we have explained before, myoblots have been validated in our laboratory to replace western blot for accurate dystrophin quantification in cell culture.

13) Figure 6A: Invert the black and white colors. The authors should also report the control sequences and sequences of the clones under the electropherograms.

Thank you for your suggestion, we have inverted the colors and added the sequences under the electropherograms.

14) Figure 6B: Control myoblasts should be included in figure 5C.

Thank you for this correction, we will include control myoblasts in the new manuscript version.

15) Figure S2A: Invert the black and white colors.

Thank you for your suggestion, we have inverted the colors.

Reviewer #2:

The work from Soblechero-Martín et al reports the generation of a human DMD line deleted for exon 52 using CRISPR technology. In addition, the authors introduced a second mutation that leads to upregulation of utrophin, a protein similar to dystrophin, which has been considered as a therapeutic surrogate. The authors provide a careful description of the methodology used to generate the new cell line and have conducted meticulous evaluations to test the validity of the reagents.

However, if the main purpose of this cell line is to perform drug or small molecule compound screenings, a single line might not be sufficient to draw robust conclusions. The generation of additional DMD lines in different genetic backgrounds using the reagents developed in this study will strengthen the work and will be of interest to the DMD field.

Thank you for your appreciation. We think that a well characterized immortalized culture, like the one we describe is sufficient for compound screening, as described in other recently published studies (2), (3). About the other suggestion, we have indeed used our method to generate other cultures for collaborators, but they will be reported in their own publications, as they are interested in them as tools in their own research projects.

Further, the future use of the edited DMD line with upregulated utrophin is unclear. The utrophin upregulation adds a complexity to this line that might complicate the assessment of screened compounds. In contrast, this line could be used to test if overexpression of utrophin generates myotubes that produce increased force compared to the control DMD line.

We think we may have not explained our screening platform well enough. Our suggestion is to offer our newly generated culture ALONGSIDE the original unedited culture: the original is treated with potential drug candidates, while the new one may or may not be treated, if these drug candidates are thought to act by activating the edited region (see an example in the figure below). In this case, the new culture will be a reliable positive control to the effects that may be reported in the unedited cultures by the drug candidates. We will make this clear in the new version of the manuscript.

Created with BioRender.com

In summary, while there is support and enthusiasm for the techniques and methodological approach of the study, the future use of this single line might be dubious and could be strengthened if additional lines are generated.

We share the reviewer’s enthusiasm for this approach, and we have included in the new version of the manuscript further characterization of this new cell culture that we think would demonstrate its usefulness better.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Manuscript number: RC-2025-03220

Corresponding author(s): Ryusuke Niwa, Yuko Shimada-Niwa, and Wei Sun

Dear Editors,

We are pleased to submit our revised manuscript of RC-2025-03220R. The reviewers’ comments from Review Commons are presented in italic.

For submission of our current revised manuscript, we provide two Word files, which are the “clean” and “Track-and-Change” files. Page and line numbers described below correspond to those of the “clean” file. The “Track-and-Change” file might be helpful for Reviewers to find what we have changed for the current revision.

We hope that the revised version is now suitable for the next stage of evaluation.

Sincerely,

Ryusuke Niwa, Yuko Shimada-Niwa, and Wei Sun

1. General Statements [optional]

We sincerely thank the reviewers for their thoughtful feedback on our initial submission. Experiments that we will conduct and the revisions on the manuscript that have already been incorporated are detailed below in the point-by-point response. For this revised submission, two versions of the manuscript are provided: a clean copy and a tracked-changes file. Page and line numbers mentioned below refer to the clean version, while the tracked-changes file is intended to help reviewers easily identify the revisions made.

In preparing the revision plan, we have included additional data, some of which were generated in collaboration with new contributors. Accordingly, we would like to propose adding Yuichi Shichino and Shintaro Iwasaki as co-authors to acknowledge their contributions.

2. Description of the planned revisions__ __

__

- Also, the authors show that two different RNAi lines for NudC give the same defects - it would be good to know if the RNAi lines target the same or different sequences in the NudC transcripts. Alternatively, it would be equally good to show that trans-allelic combinations of NudC mutants have the same defects in the prothoracic glands and the salivary glands as the RNAi. Instead, they examine only overall body size, developmental delays and lethality in the trans-hetero allelic NudC mutants.

Author response:

In response to the second part of the criticism, we will further validate the observed phenotypes by examining tissue and nuclear size, chromosomal structure, and the levels of Fibrillarin and RpS6 proteins in the prothoracic glands and salivary glands of NudC mutants.

__

- It would be quite helpful to characterize the "5 blob" and "shortened polytene chromosome arm" defects shown in Figure 2 and Figure 6. Are these partially polytenized chromosomes or are large sections of the chromosomes missing or just underreplicated? What do the chromosomes look like if you lyse the nuclei, spread the chromosomes and stain with DAPI or Hoechst - this is a pretty standard practice and would reveal much more about the structure of the polytene chromosomes.

Author response:

To address these structural concerns more clearly, we plan to apply established protocols to obtain higher-resolution images and gather more detailed information on chromosome morphology.

__ - Discussion, line 468. I don't think the authors have provided evidence of DNA damage. With the experiments they have shown, the chromosomes look abnormal - not clear what is abnormal.

Author response:

To further confirm DNA damage in NudC knockdown salivary gland cells, we plan to perform a TUNEL assay, which detects DNA fragmentation associated with damage.

We would like to note that, in the current manuscript, we have shown that depletion of NudC, eIF5, RpLP0-like, or Nopp140 increased γH2Av levels, suggesting activation of the DNA damage response (Figures 6B and 6C).

__

*The authors claim that NudC has a dual role as a cell cycle/cytoskeleton regulator and as a ribosome biogenesis factor. However, because NudC knockdown reduces nuclear size and ploidy (Figures 1F and 2H-2I), the authors cannot exclude that decreased rDNA dosage and nucleolar volume contribute to reduced rRNA signals and that the effects seen are due to a NudC involvement in endoreplication, the rRNA reduction being a consequence of lower polyploidy. Different allelic combinations of NudC induce larval growth defects (Figure S5), consistent with a NudC role in endoreplication. To circumvent this, the authors could genetically modulate endocycle progression (e.g., E2F or Fzr overexpression) in the NudC RNAi background to test whether inducing endoreplication rescues rRNA production and nucleolar volume. This would establish causality between the endocycle state and rRNA output and clarify whether NudC's primary role is in RiBi or endocycle control. *

Author response: In response to Reviewer #2’s suggestion, we plan to genetically modify the progression of the endocycle by inducing continuous expression of Cyclin E (CycE), E2F1, and Fzr in NudC RNAi salivary glands to test whether promoting endoreplication can restore rRNA production and nucleolar volume.

In fact, we have attempted to rescue the developmental arrest in animals with NudC-deficient prothoracic glands (PGs) by inducing continuous expression of CycE. Two constructs, UAS-CycE-1 (BDSC#30725) and UAS-CycE-2 (BDSC#30924), were used. UAS-CycE-1 has previously been shown to rescue developmental arrest in PG-specific TOR loss-of-function animals (Ohhara, Kobayashi, and Yamanaka. PLoS Genetics 13 (1): e1006583, 2017). We introduced each construct into NudC knockdown PGs. However, continuous expression of CycE did not restore development (Figure A as shown below), suggesting that NudC functions in the polyploid cells extend beyond endocycle regulation. We do not currently plan to include the PG data shown in Figure A in the revised manuscript. We will evaluate whether it would be meaningful to present PG data alongside salivary gland results once we have obtained and analyzed data from the salivary gland rescue experiment.

__Figure A. _Survival and developmental progression following continuous expression of CycE._ __Control (phtm>dicer2, +), NudC knockdown (phtm>dicer2, NudC RNAi), and NudC RNAi + CycE (phtm>dicer2, NudC RNAi, CycE) flies were analyzed at 10 days after hatching (10 dAH). Dead indicates dead larvae; L3 denotes third-instar larvae. Sample sizes (number of flies) are shown below each bar.

__

*The conclusion that NudC maintains rRNA levels is derived from salivary gland RNAi phenotypes with strong reductions in ITS1/ITS2 and 18S/28S signals (Figure 4B-4K) and reduced 28S by Northern (Figure 4L), plus corroboration in fat body cells (Figure S7). The authors verified knockdown using two independent RNAi lines for growth phenotypes and NudC::GFP reduction (Figure S2) and generated a UAS-FLAG::NudC transgene (Key Resources), but rRNA measurements were reported for only one RNAi line without rescue. Rescue of the rRNA phenotype by transgenic NudC re-expression, or replication of the rRNA decrease with a second, non-overlapping RNAi, would directly attribute the effect to NudC. In the absence of these standard validation controls, an off-target explanation remains plausible. *

Author response:

We plan to analyze rRNA FISH signals in salivary glands and fat bodies using a second, non-overlapping RNAi strain to confirm the reproducibility of the observed effects.

__ - The authors report in Fig. 2 elevated γH2Av in SG cells upon NudC knockdown and interpret this as evidence of chromosome destabilization. They also state that apoptosis is not observed in Fig S10. However, the increase in γH2Av could reflect transient or early apoptotic events or other stress responses triggered by NudC depletion, rather than direct defects in endoreplication or genome stability. I suggest that the authors clarify this important point, for example, by co-expressing apoptotic inhibitors such as P35, or by using the TUNEL assay, which is more sensitive than anti-Caspase3 or Dcp1 antibodies.

Author response:

We plan to perform a TUNEL assay on salivary gland cells to evaluate apoptosis associated with NudC depletion.

__ - Activation of the JNK pathway is often accompanied by apoptosis. It would strengthen the conclusions if the authors included a positive control to confirm that apoptosis is not induced under these experimental conditions, ensuring that the observed effects are specific to autophagy and not confounded by cell death.

Author response:

We will analyze pJNK and autophagy levels in animals expressing a constitutively-active form of hemipterous (hep) (hep[CA] ) under the control of fkh-GAL4 driver as a positive control. hep encodes the Drosophila JNK kinase, and it is well established that forced expression of hep[CA] induces JNK phosphorylation and activation.

__ - In Figure S1, reduction of NudC in the fat body appears to induce a starvation-like phenotype, suggesting a potential impairment of metabolic or nutrient-sensing pathways. It would be important to determine whether modulation of nutrient-responsive signaling could rescue this phenotype. Specifically, have the authors examined whether activation of the TOR or PI3K pathways mitigates the effects of NudC knockdown? Assessing pathway activity (e.g., via phospho-S6K or phospho-Akt levels) or performing genetic rescue experiments with pathway activators could clarify whether the observed phenotypes are mediated through disrupted nutrient signaling rather than a secondary effect of general cellular stress. Such analyses could also provide a mechanistic explanation for the increased autophagy observed in these cells.

Author response:

1. We will analyze phospho-S6K levels in salivary glands and fat bodies by immunostaining.
2. To activate the TOR pathway in NudC RNAi fat bodies, we will overexpress Rheb, an established upstream activator of the TOR pathway in Drosophila, which has been shown to robustly increase TOR signaling and S6K phosphorylation.

   __ - The current images of autophagic vesicles in the SG in Fig. 8B are not clearly visible and quantified. Considering the large size of these polyploid cells, higher-resolution images or alternative imaging approaches should be presented to better visualize and quantify autophagy. This would make the conclusions regarding enhanced autophagy more convincing. In addition, this data could be further strengthened by expanding the analysis of autophagy to other cell types. For example, examining autophagy in fat body cells, where autophagy plays a primary physiological role associated with rRNA accumulation (Fig. S7), rather than a reduction like in SG (Fig. 4), could provide a useful comparison for the function of NudC between polyploid cells.

Author response:

In response to the second part of the reviewer’s comment, we will conduct additional experiments using anti-Atg8a immunostaining and/or LysoTracker staining to analyze autophagy in NudC RNAi fat bodies and prothoracic glands. These experiments will help further characterize the cellular responses associated with NudC depletion.

3. Description of the revisions that have already been incorporated in the transferred manuscript

__

-The title is a bit problematic since they haven't shown that NudC doesn't also affect normal mitotic cells - they only look at polyploid cells, but that doesn't mean normal mitotic cells are not also affected.

Author response:

In response to the suggestion from Reviewer #1, we have revised the title from “NudC moonlights in ribosome biogenesis and homeostasis in Drosophila melanogaster polyploid cells” to “NudC moonlights in ribosome biogenesis and homeostasis in polyploid cells of Drosophila melanogaster” to place greater emphasis on “polyploid cells.”

Regarding mitotic cells, we have added new data in the revised manuscript (Figure S7; lines 249–256 and 417–418) demonstrating that NudC regulates apoptosis and stress responses in mitotic imaginal wing disc cells. However, as the main focus of our study remains polyploid cells, we have chosen to retain the emphasis in the title.

__

- Also, the authors show that two different RNAi lines for NudC give the same defects - it would be good to know if the RNAi lines target the same or different sequences in the NudC transcripts. Alternatively, it would be equally good to show that trans-allelic combinations of NudC mutants have the same defects in the prothoracic glands and the salivary glands as the RNAi. Instead, they examine only overall body size, developmental delays and lethality in the trans-hetero allelic NudC mutants.

Author response:

In response to the first half of criticism, the two RNAi lines used for NudC target distinct sequences. We have added the corresponding RNAi target sites to Figure S4A for clarity.

__

- Results: Lines 261 - 266. Seeing electron dense structures in TEMs and seeing increased Me31B staining by confocal imaging in the cytoplasm is insufficient evidence that the electron dense structures are P-bodies. They could be the P-bodies but they could also be aggregated ribosomes; there is insufficient evidence to "confirm" that they are P-bodies - maybe just say "suggests".

Author response:

In response to Reviewer #1’s suggestion, we have revised lines 261–262 to avoid using the word "confirm." The new sentence reads: “Immunostaining with the P-body marker Me31B reveals numerous cytoplasmic P-bodies in NudC-deficient SG cells,” which appears in lines 293–295.

__

- Abstract, lines 28 - 31. I think this gene has been identified before. The authors probably want to say they have discovered a role for this gene in RiBi.

Author response:

We have followed Reviewer #1’s suggestion and revised the sentence in lines 35–37 to: “In this study, we discovered a role for the gene NudC (nuclear distribution C, dynein complex regulator) in RiBi within polyploid cells of Drosophila melanogaster larvae.”

__

- Introduction, line 66. The protein is imported into the nucleus, where it localizes to the nucleolus - technically the protein is not imported into the nucleolus.

Author response:

To correct the misrepresentation in line 66, we have revised the sentence to: “RP mRNAs are synthesized by RNA polymerase II, and exported to the cytoplasm for translation. Then, RPs are imported into the nucleus, where they localize to the nucleolus.” in lines 70–73.

__ - Introduction, line 70. To be comprehensive in the description of ribosome biogenesis, the authors may want to mention that the 40S and 60S subunits are then exported from the nucleus and form the 80S subunit in the cytoplasm during translation.

Author response:

To improve the representation, we have revised the sentences in lines 73 – 78 as follows: “Within the nucleolus, rRNAs and RPs assemble into pre-40S and pre-60S subunits. immature versions of the small (40S) and large (60S) subunits, respectively, that undergo maturation with numerous ribosome biogenesis factors (RBFs) (Greber, 2016). The 40S and 60S subunits are then transported separately to the cytoplasm, where they combine to form functional 80S ribosomes, capable of sustaining protein synthesis (Pelletier et al., 2018).”

__ - Introduction, line 98. May want to cite paper showing that Minute mutations turn out to be mutations in individual ribosomal protein genes.

Author response:

As Reviewer #1 suggested, we have cited two, Marygold et al. (2007) entitled “The ribosomal protein genes and Minute loci of Drosophila melanogaster” and Recasens-Alvarez et al. (2021) entitled “Ribosomopathy-associated mutations cause proteotoxic stress that is alleviated by TOR inhibition” along with He et al. (2015). The inappropriate citation to Brehme (1939) has been removed.

__ - Results, lines 292. Since they didn't knock down NudC in the fat body cells in this experiment, this comment seems irrelevant.

Author response:

We would like to clarify that the phenotype observed with fkh-GAL4-driven NudC RNAi was specific to salivary glands, and no obvious phenotypes were detected in the surrounding fat body cells, which do not express fkh-GAL4. In this context, the adjacent fat body cells serve as an internal control.

In the revised manuscript, the sentence has been rewritten as: “In contrast, the fat body cells surrounding NudC-deficient SGs did not show this reduction (Figure S9),” in lines 323–324.

__ - Figure 6A. Hoechst is misspelled.

__

- Fig. 2 I - Hoeschest should be Hoescht.

Author response:

We have fixed the error.

__ *- Given that prothoracic gland (PG) size influences ecdysone production, the finding that NudC knockdown alters PG cell size, morphology, and cytoskeletal organization raises the possibility that ecdysone synthesis or signaling may also be affected. This, in turn, could explain the delayed maturation phenotype observed in Figure 1. I recommend testing whether ectopic activation of ecdysone signaling, for instance through 20-hydroxyecdysone (20E) supplementation, can rescue the defects in PG size and developmental timing. Such an experiment would strengthen the link between NudC function, PG morphology, and ecdysone-dependent developmental progression. *

Author response:

We have conducted experiments showing that developmental defects in NudC RNAi animals can be partially rescued by administering 20E. Approximately 32% of NudC RNAi larvae fed with 20E completed pupariation. These new data have been added to Figure S1B and are described in the main text (lines 165-168).

Regarding PG size, our experiments show that PG growth remains inhibited following 20E administration (Figure B as shown below). This observation indicates that treatment with exogenous 20E does not restore PG growth in NudC RNAi animals, suggesting that other factors may be required for normal PG development beyond ecdysone supplementation.

Because this analysis is not the main focus of our manuscript, we currently plan not to include these data in the revised manuscript.

Figure B. Prothoracic gland (PG) size ____after 20E administration.

To assess whether 20E supplementation could restore PG size, control (phtm>dicer2, +) and NudC RNAi (phtm>dicer2, NudC RNAi) larvae were transferred at 60 hours after hatching (hAH) to standard medium containing 20E dissolved in 100% ethanol. Control groups were transferred to medium containing the same volume of 100% ethanol at the same time point. PG size was quantified at the wandering stage. Sample sizes (number of glands) are shown below each bar. Bars represent mean ± SD. **p * *

__ - Additionally, qRT-PCR can be performed to assess the expression levels of ecdysone precursors or target genes in whole larvae, serving as a readout of ecdysone activity, including dilp8, which is usually upregulated when ecdysone levels are reduced.

Author response: To investigate ecdysone biosynthesis, Halloween genes including nvd, spok, sro, phm, dib, and sad were measured by conducting qRT-PCR. In NudC RNAi animals, nvd, sro and phm were suppressed at late L3 stage, indicating that NudC in the PG is required for ecdysone biosynthesis. The new data are described in Figure S1A and in the main text (lines 159-164) in the revised manuscript.

__ - The current images of autophagic vesicles in the SG in Fig. 8B are not clearly visible and quantified. Considering the large size of these polyploid cells, higher-resolution images or alternative imaging approaches should be presented to better visualize and quantify autophagy. This would make the conclusions regarding enhanced autophagy more convincing.

Author response:

Regarding the image quality issue, we have provided improved images of anti-Atg8a immunostaining in the salivary gland mosaic clones (Figure 8B) and included additional data from SG-specific knockdown cells (Supplemental Figures S13A-S13F) to provided quantitative results.

__ - Furthermore, including experiments in other cell types, such as imaginal disc cells, where apoptosis is more readily induced, would help determine whether the effects of NudC knockdown are specific to polyploid cells or are more broadly applicable.

Author response: We found that apoptosis was observed in NudC RNAi wing discs. In the revised manuscript, we have included this data in Figure S7 and referenced it in the main text (lines 249–256).

4. Description of analyses that authors prefer not to carry out

__ - Results, lines 285 to 298. In situs with multiple probes that detect all parts of both the pre-rRNA and processed rRNA indicate that all are down in the SG in NudC knockdowns, but that the 18S and 28S rRNAs are down the internal transcribed spacers go up - can the authors explain or hypothesize how this could happen?

Author response:

As Reviewer #1 indicated, we indeed observed that internal transcribed spacer (ITS) levels decrease in NudC knockdown salivary glands, but increase in knockdown fat bodies. Our hypothesis is that, as noted in the Discussion (lines 529–534), ribosome abundance is typically linked to protein synthesis. Salivary gland cells, which are highly active in protein production, may be particularly sensitive to disruptions in ribosome biogenesis. Therefore, NudC may maintain appropriate levels of rRNA with its impact varying according to the specific regulatory mechanisms of each cell type. We do not have a further explanation for this phenomenon, and therefore we have retained the original sentences without adding new ones.

__ - The data presented in Fig 4 show that NudC knockdown reduces pre-rRNA (ITS1/ITS2) and mature 18S/28S rRNAs in a tissue-specific manner. However, it remains unclear whether these reductions have functional consequences for ribosome assembly and translation. I recommend that the authors perform polysome profiling or an equivalent assay to assess the impact of NudC loss on actively translating ribosomes. This approach would provide a quantitative readout of translation efficiency and clarify whether the observed rRNA defects lead to impaired protein synthesis. Additionally, polysome profiling could help explain the tissue-specific differences observed between salivary glands and fat body cells.

Author response:

We performed ribosome fractionation using wild-type salivary glands and repeated the experiment three times with 56–62 gland pairs per sample. As shown in Figure C, the polyribosome peaks (grey lines) are not prominent, indicating that a much larger number of glands would be required for robust polysome profiling. Given that NudC RNAi salivary glands are significantly smaller than wild-type glands, collecting enough tissue for equivalent profiling would be technically difficult. Therefore, we concluded that obtaining sufficient RNAi samples for polysome profiling is extremely challenging, and these data have not been included in the revised manuscript.

On the other hand, we would like to emphasize that we observed a significant reduction in O-propargyl puromycin (OPP) labeling in NudC-deficient salivary gland cells (Figure 3B), which provides strong evidence for reduced translational activity.

__Figure C. Ribosomal fraction profiles of wild-type salivary glands. __Salivary glands from the late L3 larvae were dissected for analysis. Polyribosome peaks are indicated in grey. The number of salivary gland pairs used for each sample is shown above each bar.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Summary:

NudC (Nuclear Distribution Protein C) is a conserved, dynein-associated protein that plays a critical role in nuclear positioning and neuronal development. It functions as a co-chaperone, stabilizing components of the dynein-motor complex, thereby facilitating proper microtubule-dependent nuclear migration and intracellular transport. In developing neurons, NudC is essential for correct dendritic morphogenesis, ensuring nuclei and dendritic processes attain their proper spatial organization. Loss or knockdown of nudC leads to defects in nuclear localization, aberrant dendritic architecture, and mitotic stress, which can predispose cells to apoptosis. Highlighting NudC as a pivotal regulator of intracellular dynamics, cytoskeletal organization, In this paper, the authors propose a role for the gene in regulating ribosomal biogenesis. However, the interpretation of these results remains somewhat unclear, as the observed effects on ribosome biogenesis could potentially result from nonspecific cellular stress or toxicity caused by gene knockdown in polyploid cells. At this stage, the link between NudC and the regulation of ribosomal biogenesis is not fully convincing. Additional experiments could help clarify whether this relationship is direct or secondary to other cellular effects. I suggest conducting additional experiments to strengthen this hypothesis; for example, by examining whether knocking down NudC would give similar effects as observed for other genes that regulate RiBi in other organs and tissues where ribosomal biogenesis and stress responses have been well-characterized, such as the imaginal discs. Comparing the results across these different tissues would help clarify whether the effects of gene knockdown are specific to polyploid cells or represent a more general cellular response.

Suggested experiments to sustain the paper:

1. Given that prothoracic gland (PG) size influences ecdysone production, the finding that NudC knockdown alters PG cell size, morphology, and cytoskeletal organization raises the possibility that ecdysone synthesis or signaling may also be affected. This, in turn, could explain the delayed maturation phenotype observed in Figure 1. I recommend testing whether ectopic activation of ecdysone signaling, for instance through 20-hydroxyecdysone (20E) supplementation, can rescue the defects in PG size and developmental timing. Such an experiment would strengthen the link between NudC function, PG morphology, and ecdysone-dependent developmental progression.
2. Additionally, qRT-PCR can be performed to assess the expression levels of ecdysone precursors or target genes in whole larvae, serving as a readout of ecdysone activity, including dilp8, which is usually upregulated when ecdysone levels are reduced.
3. The authors report in Fig. 2 elevated γH2Av in SG cells upon NudC knockdown and interpret this as evidence of chromosome destabilization. They also state that apoptosis is not observed in Fig S10. However, the increase in γH2Av could reflect transient or early apoptotic events or other stress responses triggered by NudC depletion, rather than direct defects in endoreplication or genome stability. I suggest that the authors clarify this important point, for example, by co-expressing apoptotic inhibitors such as P35, or by using the TUNEL assay, which is more sensitive than anti-Caspase3 or Dcp1 antibodies.
4. The data presented in Fig 4 show that NudC knockdown reduces pre-rRNA (ITS1/ITS2) and mature 18S/28S rRNAs in a tissue-specific manner. However, it remains unclear whether these reductions have functional consequences for ribosome assembly and translation. I recommend that the authors perform polysome profiling or an equivalent assay to assess the impact of NudC loss on actively translating ribosomes. This approach would provide a quantitative readout of translation efficiency and clarify whether the observed rRNA defects lead to impaired protein synthesis. Additionally, polysome profiling could help explain the tissue-specific differences observed between salivary glands and fat body cells.
5. Activation of the JNK pathway is often accompanied by apoptosis. It would strengthen the conclusions if the authors included a positive control to confirm that apoptosis is not induced under these experimental conditions, ensuring that the observed effects are specific to autophagy and not confounded by cell death.
6. In Figure S1, reduction of NudC in the fat body appears to induce a starvation-like phenotype, suggesting a potential impairment of metabolic or nutrient-sensing pathways. It would be important to determine whether modulation of nutrient-responsive signaling could rescue this phenotype. Specifically, have the authors examined whether activation of the TOR or PI3K pathways mitigates the effects of NudC knockdown? Assessing pathway activity (e.g., via phospho-S6K or phospho-Akt levels) or performing genetic rescue experiments with pathway activators could clarify whether the observed phenotypes are mediated through disrupted nutrient signaling rather than a secondary effect of general cellular stress. Such analyses could also provide a mechanistic explanation for the increased autophagy observed in these cells.
7. The current images of autophagic vesicles in the SG in Fig. 8B are not clearly visible and quantified. Considering the large size of these polyploid cells, higher-resolution images or alternative imaging approaches should be presented to better visualize and quantify autophagy. This would make the conclusions regarding enhanced autophagy more convincing. In addition, this data could be further strengthened by expanding the analysis of autophagy to other cell types. For example, examining autophagy in fat body cells, where autophagy plays a primary physiological role associated with rRNA accumulation (Fig. S7), rather than a reduction like in SG (Fig. 4), could provide a useful comparison for the function of NudC between polyploid cells.
8. Furthermore, including experiments in other cell types, such as imaginal disc cells, where apoptosis is more readily induced, would help determine whether the effects of NudC knockdown are specific to polyploid cells or are more broadly applicable.

Significance

NudC is a conserved dynein-associated protein essential for nuclear positioning, dendritic morphogenesis, and intracellular transport. This study suggests a novel role for NudC in regulating ribosome biogenesis, potentially linking cytoskeletal organization with protein synthesis and cellular homeostasis. Validating this connection across different tissues could reveal whether NudC serves as a general coordinator of intracellular architecture and translational capacity, providing new insights into how cells integrate structural and biosynthetic functions.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary

In this manuscript, Duoduo Shi and colleagues, propose that NudC, previously known for its role in dynein regulation, has a second role as a critical regulator of ribosome biogenesis (RiBi) in Drosophila melanogaster polyploid cells, where its depletion reduces rRNA levels and ribosome abundance, triggering a compensatory homeostatic response that upregulates ribosomal proteins and biogenesis factors, similar to the response observed upon depletion of established ribosome biogenesis factors.

Strengths

The authors propose a novel role for NudC as a regulator of ribosome biogenesis (RiBi) which is dynein-independent and they provide a detailed homeostatic response to RiBi stress.

Weaknesses

NudC downregulation may be affecting the endocycle and an endoreplication defect may drive rRNA reduction.

Major comments

The authors claim that NudC has a dual role as a cell cycle/cytoskeleton regulator and as a ribosome biogenesis factor. However, because NudC knockdown reduces nuclear size and ploidy (Figures 1F and 2H-2I), the authors cannot exclude that decreased rDNA dosage and nucleolar volume contribute to reduced rRNA signals and that the effects seen are due to a NudC involvement in endoreplication, the rRNA reduction being a consequence of lower polyploidy. Different allelic combinations of NudC induce larval growth defects (Figure S5), consistent with a NudC role in endoreplication. To circumvent this, the authors could genetically modulate endocycle progression (e.g., E2F or Fzr overexpression) in the NudC RNAi background to test whether inducing endoreplication rescues rRNA production and nucleolar volume. This would establish causality between the endocycle state and rRNA output and clarify whether NudC's primary role is in RiBi or endocycle control.

The conclusion that NudC maintains rRNA levels is derived from salivary gland RNAi phenotypes with strong reductions in ITS1/ITS2 and 18S/28S signals (Figure 4B-4K) and reduced 28S by Northern (Figure 4L), plus corroboration in fat body cells (Figure S7). The authors verified knockdown using two independent RNAi lines for growth phenotypes and NudC::GFP reduction (Figure S2) and generated a UAS-FLAG::NudC transgene (Key Resources), but rRNA measurements were reported for only one RNAi line without rescue. Rescue of the rRNA phenotype by transgenic NudC re-expression, or replication of the rRNA decrease with a second, non-overlapping RNAi, would directly attribute the effect to NudC. In the absence of these standard validation controls, an off-target explanation remains plausible.

Minor comments

Fig. 2 I - Hoeschest should be Hoescht

Significance

The findings shown in this manuscript introduce a new player in endoreplication/ribosome biogenesis, a protein previously know as a dynein regulator. The strengths of the work lie on its novelty and thorough analysis of the cellular phenotypes induced by NudC depletion. However, its weaknesses are related to some claims not completely backed by the data, with some uncertainties related with a possible function of NudC in endoreplication.

This basic research work will be of interest to a broad cell and developmental biology community as they provide a novel cellular function of a known protein. It is of specific interest to the specialized field of polyploidy and ribosome biogenesis.

Field of expertise:

Drosophila, morphogenesis, tubulogenesis, cytoskeleton, DNA damage and repair.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary: This manuscript describes evidence for a role for the Nuclear distribution C dynein complex regulator (NudC) in ribosome biogenesis (RiBi) independent of its role in microtubule-associated dynein function.

Evidence: NudC was picked up in a screen for genes affecting ecdysteroid biosynthesis, a process that occurs in the prothoracic gland (PG; an endocrine organ). In the absence of ecdysone, larvae fail to pupate. Consistent with this finding, the authors find that prothoracic RNAi knockdown of NudC results in a failure in pupation and a decrease in total PG size. They also show defects in polytene chromosome architecture and a mild decrease in overall DNA content. They then turn to the salivary gland (SG) to further characterize the phenotypes associated with NudC knockdown. First, they show that an endogenously tagged version of NudC is abundant in the cytosol and has very weak nuclear staining in the region of the nucleolus (marked by the very low levels of DAPI staining). Knockdown of NudC using RNAi results in reduced NudC-GFP staining, a reduction in SG size, and a reduction in nuclear size. They also find that the SG polytene chromosomes are abnormal and that the production of a SG glue protein as measured by Sgs3-GFP levels and electron dense secretory granules is significantly reduced with NudC knockdown. Interestingly, they also observe the presence of abundant virus-like particles in the nucleus (these structures are thought to originate from retrotransposons and are an indicator of stress). Consistent with increased cellular stress, the authors show activation of JNK signalling. Ultrastructural analysis reveals an abnormally organized ER with an apparent loss of ER-associated ribosomes. They do see other electron dense structures in the cytosol, which they provide evidence (see below) of being P-bodies (structures associated with mRNA). They show that, consistent with a decrease in ribosomes, protein translation is reduced. This is supported by FISH experiments where they show significant decreases in ribosomal RNA (rRNA) transcript levels and decreased translation. Seeing the significant decreases in rRNA levels prompted them to look at overall changes in gene expression, where they discovered that both ribosomal protein gene expression as well as expression of other genes involved in ribosome biogenesis (RiBi) are upregulated with knockdown of NudC. They confirm the changes in mRNA for two genes by showing that levels of the corresponding proteins are also upregulated based on immunostaining of SG cells in which NudC is knocked down. Linking NudC function to a response to defects in RiBi, they shown that SG knockdown of several ribosomal biogenesis factors (RBFs) have similar chromosome structural defects and result in an increase in expression of ribosomal protein genes and of NudC itself. Finally, they show that knock down of genes encoding proteins linked to NudC function in microtubule dynamics do not have any of the same phenotypes as knockdown of NudC and RBFs. Altogether, their data support a moonlighting function for NudC in ribosome biogenesis. Moreover, defects in RiBi wherein ribosomal RNAs are decreased seem to result in compensatory changes where both RBFs and ribosomal protein genes are upregulated.

Major issues:

The title is a bit problematic since they haven't shown that NudC doesn't also affect normal mitotic cells - they only look at polyploid cells, but that doesn't mean normal mitotic cells are not also affected.

Also, the authors show that two different RNAi lines for NudC give the same defects - it would be good to know if the RNAi lines target the same or different sequences in the NudC transcripts. Alternatively, it would be equally good to show that trans-allelic combinations of NudC mutants have the same defects in the prothoracic glands and the salivary glands as the RNAi. Instead, they examine only overall body size, developmental delays and lethality in the trans-hetero allelic NudC mutants.

Results: Lines 261 - 266. Seeing electron dense structures in TEMs and seeing increased Me31B staining by confocal imaging in the cytoplasm is insufficient evidence that the electron dense structures are P-bodies. They could be the P-bodies but they could also be aggregated ribosomes; there is insufficient evidence to "confirm" that they are P-bodies - maybe just say "suggests".

It would be quite helpful to characterize the "5 blob" and "shortened polytene chromosome arm" defects shown in Figure 2 and Figure 6. Are these partially polytenized chromosomes or are large sections of the chromosomes missing or just underreplicated? What do the chromosomes look like if you lyse the nuclei, spread the chromosomes and stain with DAPI or Hoechst - this is a pretty standard practice and would reveal much more about the structure of the polytene chromosomes.

Minor points:

Abstract, lines 28 - 31. I think this gene has been identified before. The authors probably want to say they have discovered a role for this gene in RiBi.

Introduction, line 66. The protein is imported into the nucleus, where it localizes to the nucleolus - technically the protein is not imported into the nucleolus.

Introduction, line 70. To be comprehensive in the description of ribosome biogenesis, the authors may want to mention that the 40S and 60S subunits are then exported from the nucleus and form the 80S subunit in the cytoplasm during translation.

Introduction, line 98. May want to cite paper showing that Minute mutations turn out to be mutations in individual ribosomal protein genes.

Results, lines 285 to 298. In situs with multiple probes that detect all parts of both the pre-rRNA and processed rRNA indicate that all are down in the SG in NudC knockdowns, but that the 18S and 28S rRNAs are down the internal transcribed spacers go up - can the authors explain or hypothesize how this could happen?

Results, lines 292. Since they didn't knock down NudC in the fat body cells in this experiment, this comment seems irrelevant.

Discussion, line 468. I don't think the authors have provided evidence of DNA damage. With the experiments they have shown, the chromosomes look abnormal - not clear what is abnormal.

Figure 6A. Hoechst is misspelled.

Referee cross-commenting

I think the other reviewers have valid criticisms. I think among the most critical issues to sort out is (1) what is wrong with the chromosomes, (2) are diploid tissues also affected, (3) are the RIBI phenotypes a primary or secondary consequence of nudC loss. I'm not sure how easy it is to do ribosomal profiling on tissues dissected from larvae as the third reviewer is suggesting.

Significance

It is a novel discovery that a protein regulating microtubule dynamics is moonlighting, presumably in the nucleolus, to regulate rRNA synthesis or stabilization. A little information regarding mechanism of action would make this a much more exciting paper - how does it do it? Right now, it is unclear whether rRNA synthesis or maintenance is being regulated and there are no hypotheses regarding how this protein localizes to nucleoli and exactly what it is doing there. Is it regulating all RNA Pol I-dependent transcription? Is it involved in processing or stabilizing rRNAs? The description of the chromosomal defects also fall short of satisfying. As is, this paper probably of most interest to those who study ribosome biogenesis - an important topic, but without more mechanistic insight, not so interesting to a more general audience.

My expertise

I am an experienced Drosophila biologist who is familiar with the system and who fully understands all of the experiments presented in this manuscript and the relevance of the findings.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Summary: This manuscript describes evidence for a role for the Nuclear distribution C dynein complex regulator (NudC) in ribosome biogenesis (RiBi) independent of its role in microtubule-associated dynein function.

Evidence: NudC was picked up in a screen for genes affecting ecdysteroid biosynthesis, a process that occurs in the prothoracic gland (PG; an endocrine organ). In the absence of ecdysone, larvae fail to pupate. Consistent with this finding, the authors find that prothoracic RNAi knockdown of NudC results in a failure in pupation and a decrease in total PG size. They also show defects in polytene chromosome architecture and a mild decrease in overall DNA content. They then turn to the salivary gland (SG) to further characterize the phenotypes associated with NudC knockdown. First, they show that an endogenously tagged version of NudC is abundant in the cytosol and has very weak nuclear staining in the region of the nucleolus (marked by the very low levels of DAPI staining). Knockdown of NudC using RNAi results in reduced NudC-GFP staining, a reduction in SG size, and a reduction in nuclear size. They also find that the SG polytene chromosomes are abnormal and that the production of a SG glue protein as measured by Sgs3-GFP levels and electron dense secretory granules is significantly reduced with NudC knockdown. Interestingly, they also observe the presence of abundant virus-like particles in the nucleus (these structures are thought to originate from retrotransposons and are an indicator of stress). Consistent with increased cellular stress, the authors show activation of JNK signalling. Ultrastructural analysis reveals an abnormally organized ER with an apparent loss of ER-associated ribosomes. They do see other electron dense structures in the cytosol, which they provide evidence (see below) of being P-bodies (structures associated with mRNA). They show that, consistent with a decrease in ribosomes, protein translation is reduced. This is supported by FISH experiments where they show significant decreases in ribosomal RNA (rRNA) transcript levels and decreased translation. Seeing the significant decreases in rRNA levels prompted them to look at overall changes in gene expression, where they discovered that both ribosomal protein gene expression as well as expression of other genes involved in ribosome biogenesis (RiBi) are upregulated with knockdown of NudC. They confirm the changes in mRNA for two genes by showing that levels of the corresponding proteins are also upregulated based on immunostaining of SG cells in which NudC is knocked down. Linking NudC function to a response to defects in RiBi, they shown that SG knockdown of several ribosomal biogenesis factors (RBFs) have similar chromosome structural defects and result in an increase in expression of ribosomal protein genes and of NudC itself. Finally, they show that knock down of genes encoding proteins linked to NudC function in microtubule dynamics do not have any of the same phenotypes as knockdown of NudC and RBFs. Altogether, their data support a moonlighting function for NudC in ribosome biogenesis. Moreover, defects in RiBi wherein ribosomal RNAs are decreased seem to result in compensatory changes where both RBFs and ribosomal protein genes are upregulated.

Major issues:

The title is a bit problematic since they haven't shown that NudC doesn't also affect normal mitotic cells - they only look at polyploid cells, but that doesn't mean normal mitotic cells are not also affected.

Also, the authors show that two different RNAi lines for NudC give the same defects - it would be good to know if the RNAi lines target the same or different sequences in the NudC transcripts. Alternatively, it would be equally good to show that trans-allelic combinations of NudC mutants have the same defects in the prothoracic glands and the salivary glands as the RNAi. Instead, they examine only overall body size, developmental delays and lethality in the trans-hetero allelic NudC mutants.

Results: Lines 261 - 266. Seeing electron dense structures in TEMs and seeing increased Me31B staining by confocal imaging in the cytoplasm is insufficient evidence that the electron dense structures are P-bodies. They could be the P-bodies but they could also be aggregated ribosomes; there is insufficient evidence to "confirm" that they are P-bodies - maybe just say "suggests".

It would be quite helpful to characterize the "5 blob" and "shortened polytene chromosome arm" defects shown in Figure 2 and Figure 6. Are these partially polytenized chromosomes or are large sections of the chromosomes missing or just underreplicated? What do the chromosomes look like if you lyse the nuclei, spread the chromosomes and stain with DAPI or Hoechst - this is a pretty standard practice and would reveal much more about the structure of the polytene chromosomes.

Minor points:

Abstract, lines 28 - 31. I think this gene has been identified before. The authors probably want to say they have discovered a role for this gene in RiBi.

Introduction, line 66. The protein is imported into the nucleus, where it localizes to the nucleolus - technically the protein is not imported into the nucleolus.

Introduction, line 70. To be comprehensive in the description of ribosome biogenesis, the authors may want to mention that the 40S and 60S subunits are then exported from the nucleus and form the 80S subunit in the cytoplasm during translation.

Introduction, line 98. May want to cite paper showing that Minute mutations turn out to be mutations in individual ribosomal protein genes.

Results, lines 285 to 298. In situs with multiple probes that detect all parts of both the pre-rRNA and processed rRNA indicate that all are down in the SG in NudC knockdowns, but that the 18S and 28S rRNAs are down the internal transcribed spacers go up - can the authors explain or hypothesize how this could happen?

Results, lines 292. Since they didn't knock down NudC in the fat body cells in this experiment, this comment seems irrelevant.

Discussion, line 468. I don't think the authors have provided evidence of DNA damage. With the experiments they have shown, the chromosomes look abnormal - not clear what is abnormal.

Figure 6A. Hoechst is misspelled.

Referee cross-commenting

I think the other reviewers have valid criticisms. I think among the most critical issues to sort out is (1) what is wrong with the chromosomes, (2) are diploid tissues also affected, (3) are the RIBI phenotypes a primary or secondary consequence of nudC loss. I'm not sure how easy it is to do ribosomal profiling on tissues dissected from larvae as the third reviewer is suggesting.

Significance

It is a novel discovery that a protein regulating microtubule dynamics is moonlighting, presumably in the nucleolus, to regulate rRNA synthesis or stabilization. A little information regarding mechanism of action would make this a much more exciting paper - how does it do it? Right now, it is unclear whether rRNA synthesis or maintenance is being regulated and there are no hypotheses regarding how this protein localizes to nucleoli and exactly what it is doing there. Is it regulating all RNA Pol I-dependent transcription? Is it involved in processing or stabilizing rRNAs? The description of the chromosomal defects also fall short of satisfying. As is, this paper probably of most interest to those who study ribosome biogenesis - an important topic, but without more mechanistic insight, not so interesting to a more general audience.

My expertise

I am an experienced Drosophila biologist who is familiar with the system and who fully understands all of the experiments presented in this manuscript and the relevance of the findings.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

1. General Statements

*We thank the reviewers for their valuable comments. A common suggestion by all reviewers was that the manuscript would benefit from restructuring. Following their recommendation we have restructured this manuscript to improve its readability. *

2. Point-by-point description of the revisions

__Reviewer #1 (Evidence, reproducibility and clarity (Required)): __ The paper from Louka et al. studies the function of Cep104 during the development of Xenopus embryos. They perform overexpression and knock down experiments and address the consequences on neural tube closure, on ciliogenesis, and MT stability and on apical intercalation. There is a lot of data presented on a wide range of topics. While the data on MTs tracks reasonably well with other reports on Cep104, there are some concerns regarding the quality of some of the data and the interpretations based on the experimental results.

Specific Points: It is difficult to assess the effect on apical constriction with the data provided. Please show zoomed in higher mag images. Also this should be coupled with a quantification of cell number and proliferation rates, as it is possible that Cep104 mildly affects proliferation / cell division which could affect cell size. Overall this experiment is not really addressing apical constriction since there is no before and after data. Lots of things could affect apical surface area, most notably proliferation rates which one might predict would be affected by subtle changes to MT dynamics.

__Response: __Following the reviewer's recommendation we now show zoomed in higher magnification images to more clearly demonstrate the larger cell surface area in the morpholino injected neural plate compared to the control non-injected side in the same embryo. We agree with the reviewer that defects in cell proliferation could affect the cell size. If the effect of Cep104 on the cell surface area is caused by defects in cell proliferation, then we would expect this phenotype to persist in other tissues such as the ectoderm. However, we show that this phenotype is specific to the neural plate. On the other hand, if the cell surface area defect is caused by defects in apical constriction, we would expect this phenotype to be stage specific. Following the reviewer's recommendation, we compared the surface area of neuroectoderm cells before and after extensive apical constriction takes. The new data is shown in Figure S2. Our results show no difference in the surface area of neuroectoderm cells in control tracer injected and morpholino injected neuroepithelial cells at stage 13, before extensive apical constriction whereas significant differences are observed in stage 15 embryos during which cells undergo apical constriction. This data strengthens our conclusion that downregulation of Cep104 affects apical constriction.

"This defect was rescued with expression of exogenous human CEP104-GFP mRNA (300pg mRNA) (Figure 1D-E)." This was partially rescued as the control and the rescue are significantly different.

__Response: __We thank the reviewer for this important clarification. We edited the text to more clearly reflect our data.

I am unclear what is being depicted in Figure 1F and G. What is the intense red staining? Is that the blastopore? Which would imply that the stage of analysis is quite different between C and F which is concerning. The same stages should be used.

__Response: __This is an image of the anterior most region of a stage 15 embryo. Occasionally some embryos do display intense phalloidin staining at the neural plate. We replaced the image with a more clear one and moved this data to Figure S2C.

S1A has a boxed region as if there was going to be a zoomed in image, but there is not. It would be nice to see it zoomed in. While the localization is indeed at the base and tips of cilia the base looks too dispersed and big to be the basal body?

__Response: __Following the reviewer's recommendation we now show a zoomed in image of a primary cilium. The boxed area in figure S2A shows the cilium that was used to generate the fluorescence intensity profile plot shown in S2B. The Cep104 signal at the basal body is much stronger compared to the ciliary tip signal. Exposure that allows simultaneous detection of both the base and the tip signal results in overexposure of the signal at the base. This is consistent with observations in primary cilia in cell culture (please refer to Figure 4 in Frikstad et al. 2019 and Figure 3 in Yamazoe et al 2020).

In other systems the depletion of Cep104 decreases primary cilia length. While the authors claim that neural tube cilia are normal there is no quantification to support that and the provided image is hard to assess.

__Response: __Following the reviewer's recommendation we now show quantifications of the length of floor plate cilia (Figure S3C). Floor plate cilia are longer than the cilia found elsewhere in the neural tube. This inherent variability in the length of cilia will likely prevent the detection of small changes in the cilium length elicited by downregulation of Cep104. Therefore, we chose to examine the length of floor plate cilia only, in control and morpholino injected cells. Our results show that downregulation of Cep104 leads to the formation of shorter floor plate cilia which is in agreement with published data in other systems.

While the authors claim broad expression in humans and MO effects in cells without cilia, there is little data supporting the expression of Cep104 in the Xenopus cells being assayed (e.g. goblet cells).

__Response: __We agree with the reviewer that there is little evidence supporting the expression of Cep104 in Xenopus goblet cells. Cep104 is a very low abundance protein and thus very difficult to detect it at endogenous levels For example, Ryniawec et al. (2023) raised an antibody against Drosophila Cep104 that failed to detect the native (endogenous) protein via western blot or immunofluorescence, but successfully recognized the overexpressed (transgenic) Cep104. A proteomic study by Peshkin et al. 2019 showed that Cep104 levels remain relatively constant throughout Xenopus development suggesting that this protein is expressed ubiquitously. This data is shown in Figure 4 where we plot the relative expression levels of Cep104 along with two motile cilia specific genes: hydin and RSPH9.

The data in Figure 2 regarding the explants is difficult to understand and I think missing some key data. The text refers to the level of Gli increasing in the BF injected explants compared to uninjected explants, but the presentation of that is odd as the levels are normalized against uninjected rather than directly compared. And there are no stats for this key experiment. However, I think a bigger concern is the lack of information regarding the presence of cilia. While elongation and Sox2 expression are important they don't address if this tissue is similar to the neural tube in terms of cilia which is key to the interpretations.

__Response: __Following the reviewer's recommendation we changed the presentation of this data. GLI1 levels are now normalized to XBF2 injected explants. The results are the same, Gli1 levels are 25% lower in morphant XBF2 explants (ttest pWe understand the reviewer's concern regarding the presence of cilia in the explants. To our knowledge there are currently no reports on the presence of cilia in the neural ectoderm in Xenopus. We have made several attempts to determine if cilia are present in this tissue during neurulation. However, we have not been able to detect cilia based on immunofluorescence staining for acetylated tubulin and Arl13b in the neural ectoderm. We conclude from this experiment that downregulation of Cep104 negatively affects hedgehog signaling and it remains to be addressed whether this is due to defects in primary cilia.

The localization of Cep104 GFP in the epidermis and the neuroepithelium does not look similar as stated. Ones does not really see the punctate pattern in the neuroectoderm.

Response: We thank the reviewer for pointing this out. To more clearly present this data we now show a plot of the fluorescence profile of Cep104-GFP along cell-cell junctions to demonstrate the punctate localization in the neuroepithelium.

The experiments linking Cep104 to the tips of paused MTs is not particularly convincing. The depolymerization of MTs with nocodazole, will decrease all MTs as well as MT trafficking which could affect Cep104. Comparing this experiment with taxol treatment to stabilize MTs (and decrease dynamics) would be more convincing. Plus the image provided does not support the claim that the leftover EMTB is marked with Cep104.

__Response: __Following the reviewer's recommendation we have examined the effect of taxol on the density of Cep104 apical puncta. We injected embryos with CEP104-GFP and EMTB-scarlet and exposed them to 20 μm taxol and imaged them live at stage 38. Embryos non treated with taxol served as the control. As shown in Figure S4 treatment with taxol led to an increase in the density of Cep104 puncta. This further supports our conclusion that Cep104 localizes to the ends of stable or paused microtubules. We also revised Figure 5 to more clearly show that Cep104 remains associated with the ends of nocodazole resistant EMTB labeled microtubules.

The data in Figure 6 is very difficult to interpret / believe. The quantified effects on MTs are pretty subtle (which is fine...that is why you quantify), but the massive experimental variability questions the meaningfulness of those quantifications. In Fig 6B There are cells with lots of MTs right next to cells with no MTs and both have similar expression levels of Cep104. The staining just doesn't look consistent enough to accurately quantify. Also the effect of Nocodozole on MT stability is quite rapid, on the order of seconds to minutes, it is unclear what ON treatment with nocodazole would even be measuring since in that time there would be lots of secondary effects.

__Response: __We thank the reviewer for this comment. Some cells in the epidermis lack apical microtubules as the reviewer correctly points out. Cells without strong apical microtubule staining are seen in both control and morpholino injected cells. Here we quantified the number of control and morphant cells per embryo that lack apical microtubules (DMSO treated embryos). Our results show that similar numbers of control and morphant cells per embryo appear to lack apical microtubules. We think that the heterogeneity in tubulin signal is not an artifact of immunofluorescence staining since these cells are adjacent to cells with clear tubulin staining. Although the source of this variability is still unknown, the fact that an equal number of control and morphant cells show this phenotype suggests that this is unlikely to be linked to the injections or drug treatment. Those cells were excluded from the quantifications shown in Figures 6C and 6D It is possible that these cells are preparing to enter mitosis.

We think that the reviewer refers to the acute effects of nocodazole seen in cell cultures. However, in Xenopus tadpoles we didn't observe any effect on microtubules after short nocodazole treatment at low temperatures.

The authors propose that overexpressing Cep104 would lead to stabilized MTs which is a reasonable hypothesis, however, they test this in multiciliated cells that already have a ton of acetylated MTs. If their hypothesis is correct it should lead to an increase in acetylated tubulin in non multiciliated cells which don't have much to begin with. This would be a marked improvement as the side projection quantification seems a little suspect as the analysis requires a precises ROI that eliminates the strong cilia acetylation staining. While I believe that could be done, the image provided looks as if it might cut off some of the apical surface which highlights the challenge.

__Response: __Following the reviewer's recommendation, we examined the effect of Cep104 overexpression in non-MCCs on Xenopus epidermis. We show in Figure 7 that overexpression of Cep104 leads to a significant increase in the levels of acetylated tubulin in the cytoplasm of non-MCCs. We also show that overexpression of GFP alone did not have an effect on microtubule acetylation (Figure S5A). We moved the data on the cytoplasmic levels of acetylated microtubules in MCCs to figure S5B. We would like to clarify that the ROI to mark the cell body of MCCs was drawn right below the apical phalloidin signal to ensure that no signal derived from motile cilia will be included in the quantifications. A more detailed explanation of the quantification methods is included in this revised manuscript.

Minor: Overall the color choice of images does not conform to the color blind favorable options that are becoming standard in the field. Also to the extent possible the colors should be consistent (e.g. Fig 4 A Cep104-GFP is green but in B it is red).

__Response: __We thank the reviewer for this comment. We have changed the color choices in the figures to conform to the color blind.

The recent Xenopus Cep104 paper was referenced with two references, and the wording of those two sentences was redundant.

__Response: __We thank the reviewer for this comment. We edited the text accordingly.

---

__Reviewer #2 (Evidence, reproducibility and clarity (Required)): __ This study by Louka et al., investigates the function of Cep104, a protein associated with Joubert syndrome, in Xenopus. Several aspects are studied at different scales. Loss of function of this protein suggests a role in neural tube closure, apical constriction, and HH signaling. Moving on in the study, the authors investigate the localization of Cep104 in the primary cilia of the neural tube before focusing on its localization in multiciliated cells. They then look at the consequences of loss of function on motile cilia and conclude that it plays a role in the length of the distal segment. They then show an association of Cep104 with cytoplasmic microtubules in non-multiciliated cells of the Xenopus epidermis. They then analyze the function of Cep104 on these microtubules and show that loss of Cep104 function increases the speed of EB1 comets. They then looked at the impact of loss of function on microtubule stability and finally the impact of gain of function. Finally, they returned to the multiciliated cells and described an intercalation defect that correlated with decreases in acetylated tubulin. I think that certain controls are missing and that the choice of illustrations should be reconsidered (better quality, appropriate zoom). In terms of form, the text is not easy to read and the manuscript would benefit from reformatting to highlight the logical links between the different experiences and avoid a catalog-like effect. I would advise the authors to revise their introduction to make it less disjointed and guide readers toward the questions addressed by the manuscript.

Response: We thank the reviewer for the constructive criticism. We have revised the introduction to make it easier to read.

Below are specific comments and remarks: Figure 1: Why the conclusion is a "delay" in neural tube closure? At what stage is this analyzed? Is there a recovery of NT closure at later stage? A: I would suggest to provide control picture of non-injected and tracer only injected embryos. B: Statistics are missing on the graph D: mention what was injected instead of "+ rescue". Close up picture would allow a better appreciation of the differences in surface area.

Response: We thank the reviewer for this comment. The image shown in Figure 1A is from late neurula embryos, stage 18. We conclude that it is a delay in neural tube closure because the neural tube does close and the embryos develop to tailbud stages. To demonstrate the delay in neural tube closure we now include a time lapse sequence of a neurula stage embryo injected with the morpholino unilaterally which shows that the morpholino injected side moves towards the midline slower compared to the control uninjected side (movie 1). We also included a representative image of the dorsal side of a tailbud embryo injected unilaterally with the CEP104 morpholino to show that the neural tube has closed and the embryos develop to tailbud stages (figure S1D).

Following the reviewer's recommendation, we also show images of embryos injected unilaterally with the tracer alone (Figure S2), we included the statistical analysis for graph 1D, revised image 1D to show that the embryo is injected with the morpholino and CEP104-GFP and provide close ups to allow for better appreciation of the differences in surface area.

Figure S1: To illustrate the claim that cilia are not affected, it would be good to show injection of tracer alone and compare to tracer + morpholino. Also, to provide a measure of the cilia size.

__Response: __Following the reviewer's recommendation we quantified the length of floor plate cilia in the neural tube of control and morpholino injected embryos. As explained in our response to a comment by reviewer 1, the floor plate cilia are longer than the cilia found elsewhere in the neural tube. This inherent variability in the length of cilia will likely prevent the detection of small changes in the cilium length elicited by downregulation of Cep104. Therefore, we chose to examine the length of floor plate cilia only in control and morpholino injected cells. Our results show that downregulation of Cep104 leads to the formation of shorter floor plate cilia which is in agreement with published data in other systems (Figure S3C).

Figure 2: Please provide pictures to illustrate graph D.

---

__Response: __The graph in Figure 2D shows RT-qPCR results for CEP104 in BF2 and BF2 and morpholino injected explants as compared to non-injected explants. We do not have a working antibody that would allow us to show the downregulation at the protein level.

Figure 5: "Interestingly, most of the nocodazole-resistant stable microtubules were positive for Cep104 (Figure 5C, arrows). " The variation in density of Cep104-GFP signal is not visible on the pictures provided in C. I would suggest to show higher magnifications. Also, in the DMSO treated picture the Cep104GFP signal looks really different when compared to Cep104-GFP signal shown in B. Arrows should be reported on all channels. However, it not clear what we should see with this arrows. 5C: it seems that in nocodazole treated condition the Cep104-GFP is at the cilia base in MCCs which is different from the DMSO control condition. The basal body signal was not seen in the figure 3A which analyze the localization of Cep104-GFP in MCCs. Why not comment on this? Is it a phenotype on MCCs ?

Response: __Following the reviewer's recommendation, we now show higher magnifications of the images shown in Figure 5C. We removed the arrows as most reviewers found them confusing. To demonstrate the presence of Cep104 at the ends of nocodazole resistant EMTB labeled microtubules we show zoomed images and a representative fluorescence intensity profile plot. __Figure 5B shows an image of a non-MCC whereas Figure 5C shows a larger area on the tadpole epidermis which includes both MCCs and non-MCCs. We thank the reviewer for pointing out that the localization of Cep104 in 5C looks different from 3A. We do not think this is a phenotype on MCCs. In Figure 3A we imaged only the tips of cilia which is why it looks different from 5C in which we imaged the apical surface of the cells as well. We disagree with the reviewer regarding the comment '5C: it seems that in nocodazole treated condition the Cep104-GFP is at the cilia base in MCCs which is different from the DMSO control condition'. The basal body localization of Cep104 is shown in the DMSO image as well. We hope that it will be clear in this revised figure.

Figure 6: Intriguingly, morphant non-MCCs have significantly more mean β-tubulin signal compared to control non-MCCs in embryos treated with DMSO (Figure 6C). impossible to appreciate on the figures. Please specify on the figure what is considered as a morphant non-MCC versus a control non-MCC. The membrane-cherry positive cells (supposedly morphant? it has to be clarified show very heterogenous tubulin expression) If the point here is to show that microtubules are more sensitive to nocodazole in morphant cells as compared to control. I would suggest to show all conditions on a same graph. At least annotate more the graph for a self-explanatory figure (DMSO , Nocodazole).

__Response: __We agree with the reviewer that it impossible to appreciate the difference in β-tubulin signal between control and morphant non-MCCs. Based on the quantifications of mean β-tubulin fluorescence intensity there is 5% difference in the fluorescence intensity between the two groups. Statistical analysis using t-test shows that although very small, this difference is statistically significant which is why we mention it in the manuscript. We have removed this statement and data from the revised manuscript because this is a very subtle phenotype, and it is beyond the scope of this experiment.

Following the reviewer's recommendation, we clarify that mem-cherry positive cells contain the morpholino and mem-cherry negative cells are the control cells. We marked with a white asterisk the morphant non-MCCs. To address the heterogenous tubulin levels we provide quantifications which show that a similar number of control and morphant cells appear to lack microtubules. We think that the heterogeneity in tubulin signal is not an artifact of immunofluorescence staining since these cells are adjacent to cells with clear tubulin staining. Although the source of this variability is still unknown, the fact that an equal number of control and morphant cells show this phenotype suggests that this is unlikely to be linked to the injections or drug treatment. Those cells were excluded from the quantifications shown in figure 6. It is possible that these cells are preparing to enter mitosis. The reviewer is correct; the point of this experiment is to examine the effect of Cep104 downregulation on the sensitivity of microtubules to nocodazole. To more clearly present the results of this experiment we normalize the β-tubulin fluorescence Intensity in morphant cells to the one in control cells in the same embryo and we compare the normalized intensity in DMSO and nocodazole treated embryos.

Figure 7: Statistics are missing on Graph B

__ ____Response: __Following the reviewer's recommendation, we added the statistics on the graph.

Comment on the text: "Cep104 signal shows the characteristic two dot pattern in motile cilia (Figure 3A) that was also observed in a recent study using Xenopus Cep10465 and in the cilia of Tetrahymena50. This is in agreement with a recent study showing the characteristic two dot pattern for Xenopus Cep104 as well66 " ref 65 and 66b are the same (Hong et al., preprint)

__ ____Response: __We thank the reviewer for pointing this out. We edited the text to avoid repetition and corrected the references.

"This data suggests that downregulation of CEP104 affects the stability of cytoplasmic microtubules." I would suggest a more precise conclusion by stating how is it affected? More stable? Less stable? Important for the follow-up demonstration.

__ _Response: _We edited the text according to the reviewer's recommendation to precisely conclude that downregulation of Cep104 makes cytoplasmic microtubules less stable. __

Movies: Please annotate properly movie 2 and 3 so the reader can know what he/she is looking.

---

__Response: __Following the reviewer's comment, we revised the movie annotations to help the reader know what they are looking.

---

__Reviewer #3 (Evidence, reproducibility and clarity (Required)): __ The manuscript entitled "Ciliary and non-ciliary functions of Cep104 in Xenopus" by Louka et al. investigate roles for the centriole and cilia tip protein Cep104 in Xenopus embryos. The authors show that depletion of Cep104 prevents neural tube closure due to inefficient apical constriction of neural cells and defective hedgehog signaling. Cep104 depletion also resulted in structural and functional ciliary defects in multi-ciliated cells. Surprisingly, the authors discover a role for Cep104 in stabilizing cytoplasmic microtubules in non-ciliated and multi-ciliated cells. Reduced microtubule stability in Cep104-depleted cells correlated with reduced apical intercalation of multi-ciliated cells in the epidermis.

Overall, I find this manuscript difficult to understand because the experiments lack description of the findings within a normal developmental context and the findings are not developed into a cohesive narrative. I do find the study to be potentially impactful as the authors characterize Cep104 in a novel system (previous peer-reviewed studies have investigated Cep104 in human cell lines, Drosophila, zebrafish, Tetrahymena, and Chlamydomonas) with disease-relevant biology (neural development); however, mechanistic links are not properly explored. Over the course of their investigation, the authors made the novel finding that Cep104 controls the dynamics of cytoplasmic microtubules. However, this is not directly tested and potential pleiotropic effects of the developmental defects caused by Cep104 depletion confound the results.

Response: We thank the reviewer for their comments. We tried to address this by restructuring the manuscript to describe the results in more detail within a normal developmental context.

Major Critiques: The developmental context of experiments is not made clear. The authors use different tissues at varying developmental stages to perform experiments. However, these findings are not explored in depth and, therefore, the manuscript does not advance our understanding of Cep104's role in any of the processes explored.

__ ____Response:__ We thank the reviewer for their comment. We took advantage of different tissues during Xenopus development to understand the cellular and molecular function of this protein in vivo. In this manuscript we show that Cep104 is involved in neural tube closure likely through its effect on apical constriction. Our data show that Cep104 is important for the stability of cytoplasmic microtubules and this is further demonstrated through its role in apical intercalation of multiciliated cells, a process known to depend on stable microtubules. Although our data do not advance our understanding on developmental processes such as apical constriction and MCC apical intercalation, they do improve our understanding of how Cep104 impacts cytoplasmic microtubules which has not been addressed in vivo yet.

While the potential role of Cep104 in cytoplasmic microtubule regulation is intriguing, the experiments in the manuscript do not directly test this function. Because Cep104 depletion appears to have a profound developmental effect, it is difficult to interpret changes to EB1 velocity as directly attributed to Cep104 function. Additionally, the only evidence for Cep104 localization occurs in cells overexpressing human Cep104. The authors must directly visualize endogenous Cep104 to conclude microtubule or membrane localization, which they can also use to demonstrate Cep104 depletion in the morpholino experiments. Additionally, the assertion that Cep104 is binding plus-ends of cytoplasmic microtubules is not experimentally supported.

__ ____Response: __Unfortunately, we cannot directly visualize endogenous Cep104 because there is no commercially available antibody that works in Xenopus. Cep104 is a very low abundance protein, and this is highlighted in the study by John M.Ryniawec et al. 2023, where they generated an antibody against the drosophila Cep104 which detected the GFP-tagged DmCep104 but failed to detect the endogenous protein. Given that the ciliary and basal body signal of Cep104 represents the cumulative signal from nine microtubules, one can appreciate the difficulty of observing the Cep104 signal in individual microtubules. None of the commercially available Cep104 antibodies that we have tested worked against the Xenopus protein in immunofluorescence or western blot experiments. We agree with the reviewer that we do not experimentally test the binding of Cep104 to the microtubule plus-end. This has been demonstrated by others. In Jiang et al. 2012 it was showed that GFP-Cep104 co-immunoprecipitates with GST-EB1 but not with GST-EB1 that lacks the tail which contains the SxIP binging motif. In Yamazoe et al. 2020 study it was shown that exogenous Cep104 co-immunoprecipitates with exogenous EB1 and Cep104 with mutated SxIP motif (SKNN) fails to co-immunoprecipitate with EB1. This shows that Cep104 interacts with EB1 through its SxIP motif. In addition, overexpression of Cep104 recruits Cep97 to microtubule tips suggesting that it acts as a +TIP protein. A recent study by Saunders et al. 2025 showed that in in vitro microtubule reconstitution assays, Cep104 could not autonomously bind the microtubule plus-end at low concentrations but in the presence of EB3 it could bind the microtubule plus-end and block microtubule polymerization at the same low concentration. This shows that Cep104 interacts with EB3, localizes to the microtubule plus-end and affects its dynamics in vitro. We added this information in the manuscript to more clearly show that the interaction of Cep104 and EB proteins is well documented. We anticipate that this interaction will hold true in all cell types where the two proteins are co-expressed.

Additional Critiques: Figure S1. I only see the emergence of a shorter product after Cep104 depletion. Should PCR using Exon5-7 still work in successful knockdown? If not, then it is unclear what was quantified to determine Cep104 depletion as morpholino bands appear no different than control.

__ ____Response: __We thank the reviewer for this comment. PCR using exon5-7 will not work when splice blocking by the morpholino takes place. This is a knockdown approach and the efficiency of the morpholino is about 90%. Upon completion of the RT-qPCR cycle the samples were analyzed by gel electrophoresis to demonstrate that 1) alternative splicing took place (see two products with exon 3-7 primers) and 2) the presence of a single product for all primer sets used.

Figure 1A. Is this an example of an open or closed NTC? Show data used to determine the statement "no difference during convergent extension".

__ ____Response: __This is an example of an embryo that was unilatterally injected with the morpholino. The left side is the control non-injected side and the right side is the morpholino injected. We added this information on the figure to make it more self-explanatory. In Figure 2 the elongation of the BF2 injected explants is due to convergent extension. The statement "no difference during convergent extension" was removed from the revised manuscript.

Figure S2C. What does "Does not effect formation of cilia" mean? Does Cep104 depletion does not effect number, length, etc? Show quantitation used to determine this?

__ ____Response:__ Following the reviewer's recommendation, we quantified the length of floor plate cilia in control and morpholino injected embryos. As mentioned in our response to reviewer 1 and 2, floor plate cilia are longer than the cilia found elsewhere in the neural tube. This inherent variability in the length of cilia will likely prevent the detection of small changes in the cilium length elicited by downregulation of Cep104. Therefore, we chose to examine the length of floor plate cilia only, in control and morpholino injected cells. Our results show that downregulation of Cep104 leads to the formation of shorter floor plate cilia which is in agreement with published data in other systems.

Figure 5B. Along with strong Cep104 localization to membranes, there also appears to be strong EMTB localization. Is this also present in beta-tubulin immunostaining? Are these localizing to a cortical population of microtubules or to the membrane?

__ ____Response: __We thank the reviewer for their comment. The Cep104 puncta at the cell periphery, are reduced/lost upon nocodazole treatment thus we conclude that Cep104 localizes to microtubules and not the cell membrane (Figure 5C, zoomed images). Of course, we cannot exclude the possibility that microtubules are required to target CEP104 to the plasma membrane. We edited the text to clearly state this conclusion.

Figure 6C and 6D. These two panels have the same labels. The authors should denote that 6D is in nocodazole-treated explants.

__ ____Response:__ We thank the reviewer for this comment. We edited this figure to more clearly present the results of this experiment: We normalized the β -tubulin levels in morphant cells to that of control cells in the same embryo (mosaic morphant embryos were used in this experiment). The graph shows the mean normalized β -tubulin levels per embryo treated with DMSO or nocodazole.

Figure 7. What are Cep104 levels at stage 18-19?

__ ____Response: __Following the reviewer's comment we now show the Cep104 protein expression levels during Xenopus development as reported on Xenbase (Figure 4). Cep104 is expressed at low levels from gastrulation to tailbud stages (Figure 4D).

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

The manuscript entitled "Ciliary and non-ciliary functions of Cep104 in Xenopus" by Louka et al. investigate roles for the centriole and cilia tip protein Cep104 in Xenopus embryos. The authors show that depletion of Cep104 prevents neural tube closure due to inefficient apical constriction of neural cells and defective hedgehog signaling. Cep104 depletion also resulted in structural and functional ciliary defects in multi-ciliated cells. Surprisingly, the authors discover a role for Cep104 in stabilizing cytoplasmic microtubules in non-ciliated and multi-ciliated cells. Reduced microtubule stability in Cep104-depleted cells correlated with reduced apical intercalation of multi-ciliated cells in the epidermis.

Overall, I find this manuscript difficult to understand because the experiments lack description of the findings within a normal developmental context and the findings are not developed into a cohesive narrative. I do find the study to be potentially impactful as the authors characterize Cep104 in a novel system (previous peer-reviewed studies have investigated Cep104 in human cell lines, Drosophila, zebrafish, Tetrahymena, and Chlamydomonas) with disease-relevant biology (neural development); however, mechanistic links are not properly explored. Over the course of their investigation, the authors made the novel finding that Cep104 controls the dynamics of cytoplasmic microtubules. However, this is not directly tested and potential pleiotropic effects of the developmental defects caused by Cep104 depletion confound the results.

Major Critiques:

The developmental context of experiments is not made clear. The authors use different tissues at varying developmental stages to perform experiments. However, these findings are not explored in depth and, therefore, the manuscript does not advance our understanding of Cep104's role in any of the processes explored.

While the potential role of Cep104 in cytoplasmic microtubule regulation is intriguing, the experiments in the manuscript do not directly test this function. Because Cep104 depletion appears to have a profound developmental effect, it is difficult to interpret changes to EB1 velocity as directly attributed to Cep104 function. Additionally, the only evidence for Cep104 localization occurs in cells overexpressing human Cep104. The authors must directly visualize endogenous Cep104 to conclude microtubule or membrane localization, which they can also use to demonstrate Cep104 depletion in the morpholino experiments. Additionally, the assertion that Cep104 is binding plus-ends of cytoplasmic microtubules is not experimentally supported.

Additional Critiques:

Figure S1. I only see the emergence of a shorter product after Cep104 depletion. Should PCR using Exon5-7 still work in successful knockdown? If not, then it is unclear what was quantified to determine Cep104 depletion as morpholino bands appear no different than control.

Figure 1A. Is this an example of an open or closed NTC? Show data used to determine the statement "no difference during convergent extension".

Figure S2C. What does "Does not effect formation of cilia" mean? Does Cep104 depletion does not effect number, length, etc? Show quantitation used to determine this?

Figure 5B. Along with strong Cep104 localization to membranes, there also appears to be strong EMTB localization. Is this also present in beta-tubulin immunostaining? Are these localizing to a cortical population of microtubules or to the membrane?

Figure 6C and 6D. These two panels have the same labels. The authors should denote that 6D is in nocodazole-treated explants.

Figure 7. What are Cep104 levels at stage 18-19?

Significance

Overall, I find this manuscript difficult to understand because the experiments lack description of the findings within a normal developmental context and the findings are not developed into a cohesive narrative. I do find the study to be potentially impactful as the authors characterize Cep104 in a novel system (previous peer-reviewed studies have investigated Cep104 in human cell lines, Drosophila, zebrafish, Tetrahymena, and Chlamydomonas) with disease-relevant biology (neural development); however, mechanistic links are not properly explored. Over the course of their investigation, the authors made the novel finding that Cep104 controls the dynamics of cytoplasmic microtubules. However, this is not directly tested and potential pleiotropic effects of the developmental defects caused by Cep104 depletion confound the results.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

This study by Louka et al., investigates the function of Cep104, a protein associated with Joubert syndrome, in Xenopus. Several aspects are studied at different scales. Loss of function of this protein suggests a role in neural tube closure, apical constriction, and HH signaling. Moving on in the study, the authors investigate the localization of Cep104 in the primary cilia of the neural tube before focusing on its localization in multiciliated cells. They then look at the consequences of loss of function on motile cilia and conclude that it plays a role in the length of the distal segment. They then show an association of Cep104 with cytoplasmic microtubules in non-multiciliated cells of the Xenopus epidermis. They then analyze the function of Cep104 on these microtubules and show that loss of Cep104 function increases the speed of EB1 comets. They then looked at the impact of loss of function on microtubule stability and finally the impact of gain of function. Finally, they returned to the multiciliated cells and described an intercalation defect that correlated with decreases in acetylated tubulin. I think that certain controls are missing and that the choice of illustrations should be reconsidered (better quality, appropriate zoom). In terms of form, the text is not easy to read and the manuscript would benefit from reformatting to highlight the logical links between the different experiences and avoid a catalog-like effect. I would advise the authors to revise their introduction to make it less disjointed and guide readers toward the questions addressed by the manuscript.

Below are specific comments and remarks:

Figure 1:

Why the conclusion is a "delay" in neural tube closure? At what stage is this analyzed? Is there a recovery of NT closure at later stage? A: I would suggest to provide control picture of non-injected and tracer only injected embryos. B: Statistics are missing on the graph D: mention what was injected instead of "+ rescue". Close up picture would allow a better appreciation of the differences in surface area.

Figure S1:

To illustrate the claim that cilia are not affected, it would be good to show injection of tracer alone and compare to tracer + morpholino. Also, to provide a measure of the cilia size.

Figure 2:

Please provide pictures to illustrate graph D.

Figure 5:

"Interestingly, most of the nocodazole-resistant stable microtubules were positive for Cep104 (Figure 5C, arrows). " - The variation in density of Cep104-GFP signal is not visible on the pictures provided in C. I would suggest to show higher magnifications. Also, in the DMSO treated picture the Cep104GFP signal looks really different when compared to Cep104-GFP signal shown in B. Arrows should be reported on all channels. However, it not clear what we should see with this arrows. 5C: it seems that in nocodazole treated condition the Cep104-GFP is at the cilia base in MCCs which is different from the DMSO control condition. The basal body signal was not seen in the figure 3A which analyze the localization of Cep104-GFP in MCCs. Why not comment on this? Is it a phenotype on MCCs ? Figure 6: Intriguingly, morphant non-MCCs have significantly more mean β-tubulin signal compared to control non-MCCs in embryos treated with DMSO (Figure 6C). - impossible to appreciate on the figures. Please specify on the figure what is considered as a morphant non-MCC versus a control non-MCC. The membrane-cherry positive cells (supposedly morphant? it has to be clarified show very heterogenous tubulin expression)

If the point here is to show that microtubules are more sensitive to nocodazole in morphant cells as compared to control. I would suggest to show all conditions on a same graph. At least annotate more the grap for a self-explanatory figure (DMSO , Nocodazole). Figure 7: Statistics are missing on Graph B Comment on the text: "Cep104 signal shows the characteristic two dot pattern in motile cilia (Figure 3A) that was also observed in a recent study using Xenopus Cep10465 and in the cilia of Tetrahymena50. This is in agreement with a recent study showing the characteristic two dot pattern for Xenopus Cep104 as well66 " - ref 65 and 66b are the same (Hong et al., preprint)

"This data suggests that downregulation of CEP104 affects the stability of cytoplasmic microtubules." - I would suggest a more precise conclusion by stating how is it affected? More stable? Less stable? Important for the follow-up demonstration.

Movies:

Please annotate properly movie 2 and 3 so the reader can know what he/she is looking.

Referees cross-commenting

Similar feeling that reviews are consistent

Significance

This study investigates the role of the proprotein Cep104 in Xenopus. Cep104 is a protein associated with Joubert syndrome, whose role in primary cilia has been extensively documented. While its localization at the tip of motile cilia has also been reported, this study provides functional evidence for the role of Cep104 in motile cilia. In addition, the study looks at the role of Cep104 on non-cilial microtubules, which is the original aspect of the paper and may ultimately lead to a better understanding of Joubert syndrome. However, I believe that the evidence provided (controls, illustrations) needs to be improved. This paper will be of interest to a specialized audience with an interest in proteins associated with cilia and microtubules.

I am a cell biologist specialized in the study of multiciliated cells using advanced imaging methods and Xenopus and mice as models. I believe my expertise was a perfect match for this manuscript.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

The paper from Louka et al. studies the function of Cep104 during the development of Xenopus embryos. They perform overexpression and knock down experiments and address the consequences on neural tube closure, on ciliogenesis, and MT stability and on apical intercalation. There is a lot of data presented on a wide range of topics. While the data on MTs tracks reasonably well with other reports on Cep104, there are some concerns regarding the quality of some of the data and the interpretations based on the experimental results.

Specific Points:

It is difficult to assess the effect on apical constriction with the data provided. Please show zoomed in higher mag images. Also this should be coupled with a quantification of cell number and proliferation rates, as it is possible that Cep104 mildly affects proliferation / cell division which could affect cell size. Overall this experiment is not really addressing apical constriction since there is no before and after data. Lots of things could affect apical surface area, most notably proliferation rates which one might predict would be affected by subtle changes to MT dynamics.

"This defect was rescued with expression of exogenous human CEP104-GFP mRNA (300pg mRNA) (Figure 1D-E)." This was partially rescued as the control and the rescue are significantly different.

I am unclear what is being depicted in Figure 1F and G. What is the intense red staining? Is that the blastopore? Which would imply that the stage of analysis is quite different between C and F which is concerning. The same stages should be used.

S1A has a boxed region as if there was going to be a zoomed in image, but there is not. It would be nice to see it zoomed in. While the localization is indeed at the base and tips of cilia the base looks too dispersed and big to be the basal body?

In other systems the depletion of Cep104 decreases primary cilia length. While the authors claim that neural tube cilia are normal there is no quantification to support that and the provided image is hard to assess.

While the authors claim broad expression in humans and MO effects in cells without cilia, there is little data supporting the expression of Cep104 in the Xenopus cells being assayed (e.g. goblet cells).

The data in Figure 2 regarding the explants is difficult to understand and I think missing some key data. The text refers to the level of Gli increasing in the BF injected explants compared to uninjected explants, but the presentation of that is odd as the levels are normalized against uninjected rather than directly compared. And there are no stats for this key experiment. However, I think a bigger concern is the lack of information regarding the presence of cilia. While elongation and Sox2 expression are important they don't address if this tissue is similar to the neural tube in terms of cilia which is key to the interpretations.

The localization of Cep104 GFP in the epidermis and the neuroepithelium does not look similar as stated. Ones does not really see the punctate pattern in the neuroectoderm.

The experiments linking Cep104 to the tips of paused MTs is not particularly convincing. The depolymerization of MTs with nocodazole, will decrease all MTs as well as MT trafficking which could affect Cep104. Comparing this experiment with taxol treatment to stabilize MTs (and decrease dynamics) would be more convincing. Plus the image provided does not support the claim that the leftover EMTB is marked with Cep104.

The data in Figure 6 is very difficult to interpret / believe. The quantified effects on MTs are pretty subtle (which is fine...that is why you quantify), but the massive experimental variability questions the meaningfulness of those quantifications. In Fig 6B There are cells with lots of MTs right next to cells with no MTs and both have similar expression levels of Cep104. The staining just doesn't look consistent enough to accurately quantify. Also the effect of Nocodozole on MT stability is quite rapid, on the order of seconds to minutes, it is unclear what ON treatment with nocodazole would even be measuring since in that time there would be lots of secondary effects.

The authors propose that overexpressing Cep104 would lead to stabilized MTs which is a reasonable hypothesis, however, they test this in multiciliated cells that already have a ton of acetylated MTs. If their hypothesis is correct it should lead to an increase in acetylated tubulin in non multiciliated cells which don't have much to begin with. This would be a marked improvement as the side projection quantification seems a little suspect as the analysis requires a precises ROI that eliminates the strong cilia acetylation staining. While I believe that could be done, the image provided looks as if it might cut off some of the apical surface which highlights the challenge.

Minor:

Overall the color choice of images does not conform to the color blind favorable options that are becoming standard in the field. Also to the extent possible the colors should be consistent (e.g. Fig 4 A Cep104-GFP is green but in B it is red).

The recent Xenopus Cep104 paper was referenced with two references, and the wording of those two sentences was redundant.

Referees cross-commenting

I feel that all three reviews are pretty consistent and I do not have any issues with the other reviews.

Significance

Strengths. Cep104 appears to be a hot topic right now as there are several papers in bioRXiv. I suspect that this led to a bit of a rushed submission. The other papers focus mostly on understanding the mechanisms of the ciliary roles of Cep104 which is well established. In other systems the broad phenotypes associated with Cep104 depletion are assumed to be through loss of cilia mediated HH signaling. This paper proposes a number of non ciliary roles for Cep104 which given its broad distribution could be relevant. If true these findings would add considerably to the field. Given that MTs do lots of things other than make cilia it would not be too surprising for Cep104 to have MT specific phenotypes as proposed here.

Weaknesses. The quality of much of the data makes it difficult to assess the claims of broad importance. Key experiments critical to the interpretation of the data are lacking.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Authors’ reply (____Ono et al)

Review Commons Refereed Preprint #RC-2025-03137

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Ono et al addressed how condensin II and cohesin work to define chromosome territories (CT) in human cells. They used FISH to assess the status of CT. They found that condensin II depletion leads to lengthwise elongation of G1 chromosomes, while double depletion of condensin II and cohesin leads to CT overlap and morphological defects. Although the requirement of condensin II in shortening G1 chromosomes was already shown by Hoencamp et al 2021, the cooperation between condensin II and cohesin in CT regulation is a new finding. They also demonstrated that cohesin and condensin II are involved in G2 chromosome regulation on a smaller and larger scale, respectively. Though such roles in cohesin might be predictable from its roles in organizing TADs, it is a new finding that the two work on a different scale on G2 chromosomes. Overall, this is technically solid work, which reports new findings about how condensin II and cohesin cooperate in organizing G1 and G2 chromosomes.

We greatly appreciate the reviewer’s supportive comments. The reviewer has accurately recognized our new findings concerning the collaborative roles of condensin II and cohesin in establishing and maintaining interphase chromosome territories.

Major point:

They propose a functional 'handover' from condensin II to cohesin, for the organization of CTs at the M-to-G1 transition. However, the 'handover', i.e. difference in timing of executing their functions, was not experimentally substantiated. Ideally, they can deplete condensin II and cohesin at different times to prove the 'handover'. However, this would require the use of two different degron tags and go beyond the revision of this manuscript. At least, based on the literature, the authors should discuss why they think condensin II and cohesin should work at different timings in the CT organization.

We take this comment seriously, especially because Reviewer #2 also expressed the same concern.　

First of all, we must admit that the basic information underlying the “handover” idea was insufficiently explained in the original manuscript. Let us make it clear below:

• Condensin II bound to chromosomes and is enriched along their axes from anaphase through telophase (Ono et al., 2004; Hirota et al., 2004; Walther et al., 2018).
• In early G1, condensin II is diffusely distributed within the nucleus and does not bind tightly to chromatin, as shown by detergent extraction experiments (Ono et al., 2013).
• Cohesin starts binding to chromatin when the cell nucleus reassembles (i.e., during the cytokinesis stage shown in Fig. 1B), apparently replacing condensins I and II (Brunner et al., 2025).
• Condensin II progressively rebinds to chromatin from S through G2 phase (Ono et al., 2013). The cell cycle-dependent changes in chromosome-bound condensin II and cohesin summarized above are illustrated in Fig. 1A. We now realize that Fig. 1B in the original manuscript was inconsistent with Fig. 1A, creating unnecessary confusion, and we sincerely apologize for this. The fluorescence images shown in the original Fig. 1B were captured without detergent extraction prior to fixation, giving the misleading impression that condensin II remained bound to chromatin from cytokinesis through early G1. This was not our intention. To clarify this, we have repeated the experiment in the presence of detergent extraction and replaced the original Fig. 1B with a revised panel. Figs. 1A and 1B are now more consistent with each other. Accordingly, we have modified the correspsonding sentences as follows:

Although condensin II remains nuclear throughout interphase, its chromatin binding is weak in G1 and becomes robust from S phase through G2 (Ono et al., 2013). Cohesin, in contrast, replaces condensin II in early G1 (Fig. 1 B)(Abramo et al., 2019; Brunner et al., 2025), and establishes topologically associating domains (TADs) in the G1 nucleus (Schwarzer et al., 2017; Wutz et al., 2017)*. *

While there is a loose consensus in the field that condensin II is replaced by cohesin during the M-to-G1 transition, it remains controversial whether there is a short window during which neither condensin II nor cohesin binds to chromatin (Abramo et al., 2019), or whether there is a stage in which the two SMC protein complexes “co-occupy” chromatin (Brunner et al., 2025). Our images shown in the revised Fig. 1B cannot clearly distinguish between these two possibilities.

From a functional point of view, the results of our depletion experiments are more readily explained by the latter possibility. If this is the case, the “interplay” or “cooperation” rather than the “handover” may be a more appropriate term to describe the functional collaboration between condensin II and cohesin during the M-to-G1 transition. For this reason, we have avoided the use of the word “handover” in the revised manuscript. It should be emphasized, however, that given their distinct chromosome-binding kinetics, the cooperation of the two SMC complexes during the M-to-G1 transition is qualitatively different from that observed in G2. Therefore, the central conclusion of the present study remains unchanged.

For example, a sentence in Abstract has been changed as follows:

a functional interplay between condensin II and cohesin during the mitosis-to-G1 transition is critical for establishing chromosome territories (CTs) in the newly assembling nucleus.

While the reviewer suggested one experiment, it is clearly beyond the scope of the current study. It should also be noted that even if such a cell line were available, the proposed application of sequential depletion to cells progressing from mitosis to G1 phase would be technically challenging and unlikely to produce results that could be interpreted with confidence.

Other points:

Figure 2E: It seems that the chromosome length without IAA is shorter in Rad21-aid cells than H2-aid cells or H2-aid Rad21-aid cells. How can this be interpreted? This comment is well taken. A related comment was made by Reviewer #3 (Major comment #2). Given the substantial genetic manipulations applied to establish multiple cell lines used in the present study, it is, strictly speaking, not straightforward to compare the -IAA controls between different cell lines. Such variations are most prominently observed in Fig. 2E, although they can also be observed to lesser extent in other experiments (e.g., Fig. 3E). This issue is inherently associated with all studies using genetically manipulated cell lines and therefore cannot be completely avoided. For this reason, we focus on the differences between -IAA and +IAA within each cell line, rather than comparing the -IAA conditions across different cell lines. In this sense, a sentence in the original manuscript (lines 178-180) was misleading. In the revised manuscript, we have modified the corresponding and subsequent sentence as follows:

Although cohesin depletion had a marginal effect on the distance between the two site-specific probes (Fig.2, C and E), double depletion did not result in a significant change (Fig.2, D and E), consistent with the partial restoration of centromere dispersion (Fig. 1G).

• *

In addition, we have added a section entitled “Limitations of the study” at the end of the Discussion to address technical issues that are inevitably associated with the current approach.

Figure 3: Regarding the CT morphology, could they explain further the difference between 'elongated' and 'cloud-like (expanded)'? Is it possible to quantify the frequency of these morphologies? In the original manuscript, we provided data that quantitatively distinguished between the “elongated” and “cloud-like” phenotypes. Specifically, Fig. 2E shows that the distance between two specific loci (Cen 12 and 12q15) is increased in the elongated phenotype but not in the cloud-like phenotype. In addition, the cloud-like morphology was clearly deviated from circularity, as indicated by the circularity index (Fig. 3F). However, because circularity can also decrease in rod-shaped chromosomes, these datasets alone may not be sufficiently convincing, as the reviewer pointed out. We have now included an additional parameter, the aspect ratio, defined as the ratio of an object’s major axis to its minor axis (new Fig. 3F). While this intuitive parameter was altered upon condensin II depletion and double depletion, again, we acknowledge that it is not sufficient to convincingly distinguish between the elongated and cloud-like phenotypes proposed in the original manuscript. For these reasons, in the revised manuscript, we have toned down our statements regarding the differences in CT morphology between the two conditions. Nonetheless, together with the data from Figs. 1 and 2, it is that the Rabl configuration observed upon condensin II depletion is further exacerbated in the absence of cohesin. Accordingly, we have modified the main text and the cartoon (Fig 3H) to more accurately depict the observations summarized above.

Figure 5: How did they assign C, P and D3 for two chromosomes? The assignment seems obvious in some cases, but not in other cases (e.g. in the image of H2-AID#2 +IAA, two D3s can be connected to two Ps in the other way). They may have avoided line crossing between two C-P-D3 assignments, but can this be justified when the CT might be disorganized e.g. by condensin II depletion? This comment is well taken. As the reviewer suspected, we avoided line crossing between two sets of assignments. Whenever there was ambiguity, such images were excluded from the analysis. Because most chromosome territories derived from two homologous chromosomes are well separated even under the depleted conditions as shown in Fig. 6C, we did not encounter major difficulties in making assignments based on the criteria described above. We therefore remain confident that our conclusion is valid.

That said, we acknowledge that our assignments of the FISH images may not be entirely objective. We have added this point to the “Limitations of the study” section at the end of the Discussion.

Figure 6F: The mean is not indicated on the right-hand side graph, in contrast to other similar graphs. Is this an error? We apologize for having caused this confusion. First, we would like to clarify that the right panel of Fig. 6F should be interpreted together with the left panel, unlike the seemingly similar plots shown in Figs. 6G and 6H. In the left panel of Fig. 6F, the percentages of CTs that contact the nucleolus are shown in grey, whereas those that do not are shown in white. All CTs classified in the “non-contact” population (white) have a value of zero in the right panel, represented by the bars at 0 (i.e., each bar corresponds to a collection of dots having a zero value). In contrast, each CT in the “contact” population (grey) has a unique contact ratio value in the right panel. Because the right panel consists of two distinct groups, we reasoned that placing mean or median bars would not be appropriate. This was why no mean or median bars were shown in in the tight panel (The same is true for Fig. S5 A and B).

That said, for the reviewer’s reference, we have placed median bars in the right panel (see below). In the six cases of H2#2 (-/+IAA), Rad21#2 (-/+IAA), Double#2 (-IAA), and Double#3 (-IAA), the median bars are located at zero (note that in these cases the mean bars [black] completely overlap with the “bars” derived from the data points [blue and magenta]). In the two cases of Double#2 (+IAA) and Double#3 (+IAA), they are placed at values of ~0.15. Statistically significant differences between -IAA and +IAA are observed only in Double#2 and Double#3, as indicated by the P-value shown on the top of the panel. Thus, we are confident in our conclusion that CTs undergo severe deformation in the absence of both condensin II and cohesin.

Figure S1A: The two FACS profiles for Double-AID #3 Release-2 may be mixed up between -IAA and +IAA. The review is right. This inadvertent error has been corrected.

The method section explains that 'circularity' shows 'how closely the shape of an object approximates a perfect circle (with a value of 1 indicating a perfect circle), calculated from the segmented regions'. It would be helpful to provide further methodological details about it. We have added further explanations regarding the circularity in Materials and Methods together with a citation (two added sentences are underlined below):

To analyze the morphology of nuclei, CTs, and nucleoli, we measured “circularity,” a morphological index that quantifies how closely the shape of an object approximates a perfect circle (value =1). Circularity was defined as 4π x Area/Perimeter2, where both the area and perimeter of each segmented object were obtained using ImageJ. This index ranges from 0 to 1, with values closer to 1 representing more circular objects and lower values correspond to elongated or irregular shapes (Chen et al, 2017).

Chen, B., Y. Wang, S. Berretta and O. Ghita. 2017. Poly Aryl Ether Ketones (PAEKs) and carbon-reinforced PAEK powders for laser sintering. J Mater Sci 52:6004-6019.

Reviewer #1 (Significance (Required)):

Ono et al addressed how condensin II and cohesin work to define chromosome territories (CT) in human cells. They used FISH to assess the status of CT. They found that condensin II depletion leads to lengthwise elongation of G1 chromosomes, while double depletion of condensin II and cohesin leads to CT overlap and morphological defects. Although the requirement of condensin II in shortening G1 chromosomes was already shown by Hoencamp et al 2021, the cooperation between condensin II and cohesin in CT regulation is a new finding. They also demonstrated that cohesin and condensin II are involved in G2 chromosome regulation on a smaller and larger scale, respectively. Though such roles in cohesin might be predictable from its roles in organizing TADs, it is a new finding that the two work on a different scale on G2 chromosomes. Overall, this is technically solid work, which reports new findings about how condensin II and cohesin cooperate in organizing G1 and G2 chromosomes.

See our reply above.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Summary:

Ono et al use a variety of imaging and genetic (AID) depletion approaches to examine the roles of condensin II and cohesin in the reformation of interphase genome architecture in human HCT16 cells. Consistent with previous literature, they find that condensin II is required for CENP-A dispersion in late mitosis/early G1. Using in situ FISH at the centromere/q arm of chromosome 12 they then establish that condensin II removal causes lengthwise elongation of chromosomes that, interestingly, can be suppressed by cohesin removal. To better understand changes in whole-chromosome morphology, they then use whole chromosome painting to examine chromosomes 18 and 19. In the absence of condensin II, cells effectively fail to reorganise their chromosomes from rod-like structures into spherical chromosome territories (which may explain why CENP-A dispersion is suppressed). Cohesin is not required for spherical CT formation, suggesting condensin II is the major initial driver of interphase genome structure. Double depletion results in complete disorganisation of chromatin, leading the authors to conclude that a typical cell cycle requires orderly 'handover' from the mitotic to interphase genome organising machinery. The authors then move on to G2 phase, where they use a variety of different FISH probes to assess alterations in chromosome structure at different scales. They thereby establish that perturbation of cohesin or condensin II influences local and longer range chromosome structure, respectively. The effects of condensin II depletion become apparent at a genomic distance of 20 Mb, but are negligible either below or above. The authors repeat the G1 depletion experiment in G2 and now find that condensin II and cohesin are individually dispensable for CT organisation, but that dual depletion causes CT collapse. This rather implies that there is cooperation rather than handover per se. Overall this study is a broadly informative multiscale investigation of the roles of SMC complexes in organising the genome of postmitotic cells, and solidifies a potential relationship between condensin II and cohesin in coordinating interphase genome structure. The deeper investigation of the roles of condensin II in establishing chromosome territories and intermediate range chromosome structure in particular is a valuable and important contribution, especially given our incomplete understanding of what functions this complex performs during interphase.

We sincerely appreciate the reviewer’s supportive comments. The reviewer has correctly acknowledged both the current gaps in our understanding of the role of condensin II in interphase chromosome organization and our new findings on the collaborative roles of condensin II and cohesin in establishing and maintaining interphase chromosome territories.

Major comments:

In general the claims and conclusions of the manuscript are well supported by multiscale FISH labelling. An important absent control is western blotting to confirm protein depletion levels. Currently only fluorescence is used as a readout for the efficiency of the AID depletion, and we know from prior literature that even small residual quantities of SMC complexes are quite effective in organising chromatin. I would consider a western blot a fairly straightforward and important technical control.

Let me explain why we used immunofluorescence measurements to evaluate the efficiency of depletion. In our current protocol for synchronizing at the M-to-G1 transition, ~60% of control and H2-depleted cells, and ~30% of Rad21-depleted and co-depleted cells, are successfully synchronized in G1 phase. The apparently lower synchronization efficiency in the latter two groups is attributable to the well-documented mitotic delay caused by cohesin depletion. From these synchronized populations, early G1 cells were selected based on their characteristic morphologies (see the legend of Fig. 1C). In this way, we analyzed an early G1 cell population that had completed mitosis without chromosome segregation defects. We acknowledge that this represents a technically challenging aspect of M-to-G1 synchronization in HCT116 cells, whose synchronization efficiency is limited compared with that of HeLa cells. Nevertheless, this approach constitutes the most practical strategy currently available. Hence, immunofluorescence provides the only feasible means to evaluate depletion efficiency under these conditions.

Although immunoblotting can, in principle, be applied to G2-arrested cell populations, we do not believe that information obtained from such experiments would affect the main conclusions of the current study. Please note that we carefully designed and performed all experiments with appropriate controls: H2 depletion, RAD21 depletion, and double depletion, with outcomes confirmed using independent cell lines (Double-AID#2 and Double-AID#3) whenever deemed necessary.

We fully acknowledge the technical limitations associated with the AID-mediated depletion techniques, which are now described in the section entitled “Limitations of the study” at the end of the Discussion. Nevertheless, we emphasize that these limitations do not compromise the validity of our findings.

I find the point on handover as a mechanism for maintaining CT architecture somewhat ambiguous, because the authors find that the dependence simply switches from condensin II to both condensin II and cohesin, between G1 and G2. To me this implies augmented cooperation rather than handover. I have two further suggestions, both of which I would strongly recommend but would consider desirable but 'optional' according to review commons guidelines.

First of all, we would like to clarify a possible misunderstanding regarding the phrase “handover as a mechanism for maintaining CT architecture somewhat ambiguous”. In the original manuscript, we proposed handover as a mechanism for establishing G1 chromosome territories, not for maintaining CTs.

That said, we take this comment very seriously, especially because Reviewer #1 also expressed the same concern. Please see our reply to Reviewer #1 (Major point).

In brief, we agree with the reviewer that the word “handover” may not be appropriate to describe the functional relationship between condensin II and cohesin during the M-to-G1 transition. In the revised manuscript, we have avoided the use of the word “handover”, replacing it with “interplay”. It should be emphasized, however, that given their distinct chromosome-binding kinetics, the cooperation of the two SMC complexes during the M-to-G1 transition is qualitatively different from that observed in G2. Therefore, the central conclusion of the present study remains unchanged.

For example, a sentence in Abstract has been changed as follows:

a functional interplay between condensin II and cohesin during the mitosis-to-G1 transition is critical for establishing chromosome territories (CTs) in the newly assembling nucleus.

Firstly, the depletions are performed at different stages of the cell cycle but have different outcomes. The authors suggest this is because handover is already complete, but an alternative possibility is that the phenotype is masked by other changes in chromosome structure (e.g. duplication/catenation). I would be very curious to see, for example, how the outcome of this experiment would change if the authors were to repeat the depletions in the presence of a topoisomerase II inhibitor.

The reviewer’s suggestion here is somewhat vague, and it is unclear to us what rationale underlies the proposed experiment or what meaningful outcomes could be anticipated. Does the reviewer suggest that we perform topo II inhibitor experiments both during the M-to-G1 transition and in G2 phase, and then compare the outcomes between the two conditions?

For the M-to-G1 transition, Hildebrand et at (2024) have already reported such experiments. They used a topo II inhibitor to provided evidence that mitotic chromatids are self-entangled and that the removal of these mitotic entanglements is required to establish a normal interphase nucleus. Our own preliminary experiments (not presented in the current manuscript) showed that ICRF treatment of cells undergoing the M-to-G1 transition did not affect post-mitotic centromere dispersion. The same treatment also had little effect on the suppression of centromere dispersion observed in condensin II-depleted cells.

Under G2-arrested condition, because chromosome territories are largely individualized, we would expect topo II inhibition to affect only the extent of sister catenation, which is not the focus of our current study. We anticipate that inhibiting topo II in G2 would have only a marginal, if any, effect on the maintenance of chromosome territories detectable by our current FISH approaches.

In any case, we consider the suggested experiment to be beyond the scope of the present manuscript, which focuses on the collaborative roles of condensin II and cohesin as revealed by multi-scale FISH analyses.

Secondly, if the author's claim of handover is correct then one (not exclusive) possibility is that there is a relationship between condensin II and cohesin loading onto chromatin. There does seem to be a modest co-dependence (e.g. fig S4 and S7), could the authors comment on this?

First of all, we wish to point out the reviewer’s confusion between the G2 experiments and the M-to-G1 experiments. Figs. S4 and S7 concern experiments using G2-arrested cells, not M-to-G1 cells in which a possible handover mechanism is discussed. Based on Fig. 1, in which the extent of depletion in M-to-G1 cells was tested, no evidence of “co-dependence” between H2 depletion and RAD21 depletion was observed.

That said, as the reviewer correctly points out, we acknowledge the presence of marginal yet statistically significant reductions in the RAD21 signal upon H2 depletion (and vice versa) in G2-arrested cells (Figs. S4 and S7).

Another control experiment here would be to treat fully WT cells with IAA and test whether non-AID labelled H2 or RAD21 dip in intensity. If they do not, then perhaps there's a causal relationship between condensin II and cohesin levels?

According to the reviewer’s suggestion, we tested whether IAA treatment causes an unintentional decreases in the H2 or RAD21 signals in G2-arrested cells, and found that it is not the case (see the attached figure below).

Thus, these data indicate that there is a modest functional interdependence between condensin II and cohesin in G2-arrested cells. For instance, condensin II depletion may modestly destabilize chromatin-bound cohesin (and vice versa). However, we note that these effects are minor and do not affect the overall conclusions of the study. In the revised manuscript, we have described these potentially interesting observations briefly as a note in the corresponding figure legends (Fig. S4).

I recognise this is something considered in Brunner et al 2025 (JCB), but in their case they depleted SMC4 (so all condensins are lost or at least dismantled). Might bear further investigation.

Methods:

Data and methods are described in reasonable detail, and a decent number of replicates/statistical analyses have been. Documentation of the cell lines used could be improved. The actual cell line is not mentioned once in the manuscript. Although it is referenced, I'd recommend including the identity of the cell line (HCT116) in the main text when the cells are introduced and also in the relevant supplementary tables. Will make it easier for readers to contextualise the findings.

We apologize for the omission of important information regarding the parental cell line used in the current study. The information has been added to Materials and Methods as well as the resource table.

Minor comments:

Overall the manuscript is well-written and well presented. In the introduction it is suggested that no experiment has established a causal relationship between human condensin II and chromosome territories, but this is not correct, Hoencamp et al 2021 (cell) observed loss of CTs after condensin II depletion. Although that manuscript did not investigate it in as much detail as the present study, the fundamental relationship was previously established, so I would encourage the authors to revise this statement.

We are somewhat puzzled by this comment. In the original manuscript, we explicitly cited Hoencamp et al (2021) in support of the following sentences:

• *

(Lines 78-83 in the original manuscript)

*Moreover, high-throughput chromosome conformation capture (Hi-C) analysis revealed that, under such conditions, chromosomes retain a parallel arrangement of their arms, reminiscent of the so-called Rabl configuration (Hoencamp et al., 2021). These findings indicate that the loss or impairment of condensin II during mitosis results in defects in post-mitotic chromosome organization. *

• *

That said, to make the sentences even more precise, we have made the following revision in the manuscript.

• *

(Lines 78- 82 in the revised manuscript)

*Moreover, high-throughput chromosome conformation capture (Hi-C) analysis revealed that, under such conditions, chromosomes retain a parallel arrangement of their arms, reminiscent of the so-called Rabl configuration (Hoencamp et al., 2021). These findings,together with cytological analyses of centromere distributions, indicate that the loss or impairment of condensin II during mitosis results in defects in post-mitotic chromosome organization. *

• *

The following statement was intended to explain our current understanding of the maintenance of chromosome territories. Because Hoencamp et al (2021) did not address the maintenance of CTs, we have kept this sentence unchanged.

• *

(Lines 100-102 in the original manuscript)

Despite these findings, there is currently no evidence that either condensin II, cohesin, or their combined action contributes to the maintenance of CT morphology in mammalian interphase cells (Cremer et al., 2020).

• *

• *

Reviewer #2 (Significance (Required)):

General assessment:

Strengths: the multiscale investigation of genome architecture at different stages of interphase allow the authors to present convincing and well-analysed data that provide meaningful insight into local and global chromosome organisation across different scales.

Limitations:

As suggested in major comments.

Advance:

Although the role of condensin II in generating chromosome territories, and the roles of cohesin in interphase genome architecture are established, the interplay of the complexes and the stage specific roles of condensin II have not been investigated in human cells to the level presented here. This study provides meaningful new insight in particular into the role of condensin II in global genome organisation during interphase, which is much less well understood compared to its participation in mitosis.

Audience:

Will contribute meaningfully and be of interest to the general community of researchers investigating genome organisation and function at all stages of the cell cycle. Primary audience will be cell biologists, geneticists and structural biochemists. Importance of genome organisation in cell/organismal biology is such that within this grouping it will probably be of general interest.

My expertise is in genome organization by SMCs and chromosome segregation.

We appreciate the reviewer’s supportive comments. As the reviewer fully acknowledges, this study is the first systematic survey of the collaborative role of condensin II and cohesin in establishing and maintaining interphase chromosome territories. In particular, multi-scale FISH analyses have enabled us to clarify how the two SMC protein complexes contribute to the maintenance of G2 chromosome territories through their actions at different genomic scales. As the reviewer notes, we believe that the current study will appeal to a broad readership in cell and chromosome biology. The limitations of the current study mentioned by the reviewer are addressed in our reply above.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Summary:

The manuscript “Condensin II collaborates with cohesin to establish and maintain interphase chromosome territories" investigates how condensin II and cohesin contribute to chromosome organization during the M-to-G1 transition and in G2 phase using published auxin-inducible degron (AID) cell lines which render the respective protein complexes nonfunctional after auxin addition. In this study, a novel degron cell line was established that enables the simultaneous depletion of both protein complexes, thereby facilitating the investigation of synergistic effects between the two SMC proteins. The chromosome architecture is studied using fluorescence in situ hybridization (FISH) and light microscopy. The authors reproduce a number of already published data and also show that double depletion causes during the M-to-G1 transition defects on chromosome territories, producing expanded, irregular shapes that obscure condensin II-specific phenotypes. Findings in G2 cells point to a new role of condensin II for chromosome conformation at a scale of ~20Mb. Although individual depletion has minimal effects on large-scale CT morphology in G2, combined loss of both complexes produces marked structural abnormalities, including irregular crescent-shaped CTs displaced toward the nucleolus and increased nucleolus-CT contact. The authors propose that condensin II and cohesin act sequentially and complementarily to ensure proper post-mitotic CT formation and maintain chromosome architecture across genomic scales.

We greatly appreciate the reviewer’s supportive comments. The reviewer has accurately recognized our new findings concerning the collaborative roles of condensin II and cohesin in the establishment and maintenance of interphase chromosome territories.

Concenrs about statistics:

• The authors provide the information on how many cells are analyzed but not the number of independent experiments. My concern is that there might variations in synchronization of the cell population and in the subsequent preparation (FISH) affecting the final result. We appreciate the reviewer’s important comment regarding the biological reproducibility of our experiments. As the reviewer correctly points out, variations in cell-cycle synchronization and FISH sample preparation can occur across experiments. To address this concern, we repeated the key experiments supporting our main conclusions (Figs. 3 and 6) two additional times, resulting in three independent biological replicas in total. All replicate experiments reproduced the major observations from the original analyses. These results further substantiated our original conclusion, despite the inevitable variability arising from cell synchronization or sample preparation in this type of experiments. In the revised manuscript, we have now explicitly indicated the number of biological replicates in the corresponding figures.

The analyses of chromosome-arm conformation shown in Fig. 5 were already performed in three independent rounds of experiments, as noted in the original submission. In addition, similar results were already obtained in other analyses reported in the manuscript. For example, centromere dispersion was quantified using an alternative centromere detection method (related to Fig. 1), and distances between specific chromosomal sites were measured using different locus-specific probes (related to Figs. 2 and 4). In both cases, the results were consistent with those presented in the manuscript.

• Statistically the authors analyze the effect of cells with induced degron vs. vehicle control (non-induced). However, the biologically relevant question is whether the data differ between cell lines when the degron system is induced. This is not tested here (cf. major concern 2 and 3). See our reply to major concerns 2 and 3.

• Some Journal ask for blinded analysis of the data which might make sense here as manual steps are involved in the data analysis (e.g. line 626 / 627the convex hull of the signals was manually delineated, line 635 / 636 Chromosome segmentation in FISH images was performed using individual thresholding). However personally I have no doubts on the correctness of the work. We thank the reviewer for pointing out that some steps in our data analysis were performed manually, such as delineating the convex hull of signals and segmenting chromosomes in FISH and IF images using individual thresholds. These manual steps were necessary because signal intensities vary among cells and chromosomes, making fully automated segmentation unreliable. To ensure objectivity, we confirmed that the results were consistent across two independently established double-depletion cell lines, which produced essentially identical findings. In addition, we repeated the key experiments underpinning our main conclusions (Figs. 3 and 6) two additional times, and the results were fully consistent with the original analyses. Therefore, we are confident that our current data analysis approach does not compromise the validity of our conclusions. Finally, we appreciate the reviewer’s kind remark that there is no doubt regarding the correctness of our work.

Major concerns:

• Degron induction appears to delay in Rad21-AID#1 and Double-AID#1 cells the transition from M to G1, as shown in Fig. S1. After auxin treatment, more cells exhibit a G2 phenotype than in an untreated population. What are the implications of this for the interpretation of the experiments? In our protocol shown in Fig. 1C, cells were released into mitosis after G2 arrest, and IAA was added 30 min after release. It is well established that cohesin depletion causes a prometaphase delay due to spindle checkpoint activation (e.g., Vass et al, 2003, Curr Biol; Toyoda and Yanagida, 2006, MBoC; Peters et al, 2008, Genes Dev), which explains why cells with 4C DNA content accumulated, as judged by FACS (Fig. S1). The same was true for doubly depleted cells. However, a fraction of cells that escaped this delay progressed through mitosis and enter the G1 phase of the next cell cycle. We selected these early G1 cells and used them for down-stream analyses. This experimental procedure was explicitly described in the legends of Fig. 1C and Fig. S1A as follows:

(Lines 934-937; Legend of Fig. 1C)

From the synchronized populations, early G1cells were selected based on their characteristic morphologies (i.e., pairs of small post-mitotic cells) and subjected to downstream analyses. Based on the measured nuclear sizes (Fig. S2 G), we confirmed that early G1 cells were appropriately selected.

(Lines 1114-1119; Legend of Fig. S1A)

In this protocol, ~60% of control and H2-depleted cells, and ~30% of Rad21-depleted and co-depleted cells, were successfully synchronized in G1 phase. The apparently lower synchronization efficiency in the latter two groups is attributable to the well documented mitotic delay caused by cohesin depletion (Hauf et al., 2005; Haarhuis et al., 2013; Perea-Resa et al., 2020). From these synchronized populations, early G1 cells were selected based on their characteristic morphologies (see the legend of Fig. 1 C).

• *

Thus, using this protocol, we analyzed an early G1 cell population that had completed mitosis without chromosome segregation defects. We acknowledge that this represents a technically challenging aspect of synchronizing cell-cycle progression from M to G1 in HCT116 cells, whose synchronization efficiency is limited compared with that of HeLa cells. Nevertheless, this approach constitutes the most practical strategy currently available.

• Line 178 "In contrast, cohesin depletion had a smaller effect on the distance between the two site-specific probes compared to condensin II depletion (Fig. 2, C and E)." The data in Fig. 2 E show both a significant effect of H2 and a significant effect of RAD21 depletion. Whether the absolute difference in effect size between the two conditions is truly relevant is difficult to determine, as the distribution of the respective control groups also appears to be different. This comment is well taken. Reviewer #1 has made a comment on the same issue. See our reply to Reviewer #1 (Other points, Figure 2E).

In brief, in the current study, we should focus on the differences between -IAA and +IAA within each cell line, rather than comparing the -IAA conditions across different cell lines. In this sense, a sentence in the original manuscript (lines 178-180) was misleading. In the revised manuscript, we have modified the corresponding and subsequent sentence as follows:

Although cohesin depletion had a marginal effect on the distance between the two site-specific probes (Fig.2, C and E), double depletion did not result in a significant change (Fig.2, D and E), consistent with the partial restoration of centromere dispersion (Fig. 1G).

• In Figures 3, S3 and related text in the manuscript I cannot follow the authors' argumentation, as H2 depletion alone leads to a significant increase in the CT area (Chr. 18, Chr. 19, Chr. 15). Similar to Fig. 2, the authors argue about the different magnitude of the effect (H2 depletion vs double depletion). Here, too, appropriate statistical tests or more suitable parameters describing the effect should be used. I also cannot fully follow the argumentation regarding chromosome elongation, as double depletion in Chr. 18 and Chr. 19 also leads to a significantly reduced circularity. Therefore, the schematic drawing Fig. 3 H (double depletion) seems very suggestive to me. This comment is related to the comment above (Major comment #2). See our reply to Reviewer #1 (Other points, Figure 2E).

It should be noted that, in Figure 3 (unlike in Figure 2), we did not compare the different magnitudes of the effect observed between H2 depletion and double depletion. Thus, the reviewer’s comment that “Similar to Fig. 2, the authors argue about the different magnitude of the effect (H2 depletion vs double depletion) ” does not accurately reflected our description.

Moreover, while the distance between two specific loci (Fig. 2E) and CT circularity (Fig. 3G) are intuitively related, they represent distinct parameters. Thus, it is not unexpected that double depletion resulted in apparently different outcomes for the two measurements. Thus, the reviewer’s counter-argument is not strictly applicable here.

That said, we agree with the reviewer that our descriptions here need to be clarified.

The differences between H2 depletion and double depletion are two-fold: (1) centromere dispersion is suppressed upon H2 depletion, but not upon double depletion (Fig 1G); (2) the distance between Cen 12 and 12q15 increased upon H2 depletion, but not upon double depletion (Fig 2E).

We have decided to remove the “homologous pair overlap” panel (formerly Fig. 3E) from the revised manuscript. Accordingly, the corresponding sentence has been deleted from the main text. Instead, we have added a new panel of “aspect ratio”, defined as the ratio of the major to the minor axis (new Fig. 3F). While this intuitive parameter was altered upon condensin II depletion and double depletion, again, we acknowledge that it is not sufficient to convincingly distinguish between the elongated and cloud-like phenotypes proposed in the original manuscript. For these reasons, in the revised manuscript, we have toned down our statements regarding the differences in CT morphology between the two conditions. Nonetheless, together with the data from Figs. 1 and 2, it is clear that the Rabl configuration observed upon condensin II depletion is further exacerbated in the absence of cohesin. Accordingly, we have modified the main text and the cartoon (Fig 3H) to more accurately depict the observations summarized above.

• 5 and accompanying text. I agree with the authors that this is a significant and very interesting effect. However, I believe the sharp bends is in most cases an artifact caused by the maximum intensity projection. I tried to illustrate this effect in two photographs: Reviewer Fig. 1, side view, and Reviewer Fig. 2, same situation top view (https://cloud.bio.lmu.de/index.php/s/77npeEK84towzJZ). As I said, in my opinion, there is a significant and important effect; the authors should simply adjust the description. This comment is well taken. We appreciate the reviewer’s effort to help clarify our original observations. We have therefore added a new section entitled “Limitations of the study” to explicitly describe the constrains of our current approach. That said, as the reviewer also acknowledges, our observations remain valid because all experiments were performed with appropriate controls.

Minor concerns:

• I would like to suggest proactively discussing possible artifacts that may arise from the harsh conditions during FISH sample preparation. We fully agree with the reviewer’s concerns. For FISH sample preparation, we used relatively harsh conditions, including (1) fixation under a hypotonic condition (0.3x PBS), (2) HCl treatment, and (3) a denaturation step. We recognize that these procedures inevitably affect the preservation of the original structure; however, they are unavoidable in the standard FISH protocol. We also acknowledge that our analyses were limited to 2D structures based on projected images, rather than full 3D reconstructions. These technical limitations are now explicitly described in a new section entitled “Limitations of the study”, and the technical details are provided in Materials and Methods.

• It would be helpful if the authors could provide the original data (microscopic image stacks) for download. We thank the reviewer for this suggestion and understand that providing the original image stacks could be of interest to readers. We agree that if the nuclei were perfectly spherical, as is the case for example in lymphocytes, 3D image stacks would contain much more information than 2D projections. However, as is typical for adherent cultured cells, including the HCT116-derived cells used in this study, the nuclei are flattened due to cell adhesion to the culture dish, with a thickness of only about one-tenth of the nuclear diameter (10–20 μm). Considering also the inevitable loss of structural preservation during FISH sample preparation, we were concerned that presenting 3D images might confuse rather than clarify. We therefore believe that representing the data as 2D projections, while explicitly acknowledging the technical limitations, provides the clearest and most interpretable presentation of our results. These limitations are now described in a new section of the manuscript.

• The authors use a blind deconvolution algorithm to improve image quality. It might be helpful to test other methods for this purpose (optional). We thank the reviewer for this valuable suggestion and fully agree that it is a valid point. We recognize that alternative image enhancement methods can offer advantages, particularly for smaller structures or when multiple probes are analyzed simultaneously. In our study, however, the focus was on detecting whole chromosome territories (CTs) and specific chromosomal loci, which can be visualized clearly with our current FISH protocol combined with blind deconvolution. We therefore believe that the image quality we obtained is sufficient to support the conclusions of this manuscript.

Reviewer #3 (Significance (Required)):

Advance:

Ono et al. addresses the important question on how the complex pattern of chromatin is reestablished after mitosis and maintained during interphase. In addition to affinity interactions (1,2), it is known that cohesin plays an important role in the formation and maintenance of chromosome organization interphase (3). However, current knowledge does not explain all known phenomena. Even with complete loss of cohesin, TAD-like structures can be recognized at the single-cell level (4), and higher structures such as chromosome territories are also retained (5). The function of condensin II during mitosis is another important factor that affects chromosome architecture in the following G1 phase (6). Although condensin II is present in the cell nucleus throughout interphase, very little is known about the role of this protein in this phase of the cell cycle. This is where the present publication comes in, with a new double degron cell line in which essential subunits of cohesin AND condensin can be degraded in a targeted manner. I find the data from the experiments in the G2 phase most interesting, as they suggest a previously unknown involvement of condensin II in the maintenance of larger chromatin structures such as chromosome territories.

The experiments regarding the M-G1 transition are less interesting to me, as it is known that condensin II deficiency in mitosis leads to elongated chromosomes (Rabl configuration)(6), and therefore the double degradation of condensin II and cohesin describes the effects of cohesin on an artificially disturbed chromosome structure.

For further clarification, we provide below a table summarizing previous studies relevant to the present work. We wish to emphasize three novel aspects of the present study. First, newly established cell lines designed for double depletion enabled us to address questions that had remained inaccessible in earlier studies. Second, to our knowledge, no study has previously reported condensin II depletion, cohesin depletion and double depletion in G2-arrested cells. Third, the present study represents the first systematic comparison of two different stages of the cell cycle using multiscale FISH under distinct depletion conditions. Although the M-to-G1 part of the present study partially overlaps with previous work, it serves as an important prelude to the subsequent investigations. We are confident that the reviewer will also acknowledge this point.

cell cycle

cond II depletion

cohesin depletion

double depletion

M-to-G1

Hoencamp et al (2021); Abramo et al (2019); Brunner et al (2025);

this study

Schwarzer et al (2017);

Wutz et al (2017);

this study

this study

G2

this study

this study

this study

Hoencamp et al (2021): Hi-C and imaging (CENP-A distribution)

Abramo et al (2019): Hi-C and imaging

Brunner et al (2025): mostly imaging (chromatin tracing)

Schwarzer et al (2017); Wutz et al (2017): Hi-C

this study: imaging (multi-scale FISH)

General limitations:

(1) Single cell imaging of chromatin structure typically shows only minor effects which are often obscured by the high (biological) variability. This holds also true for the current manuscript (cf. major concern 2 and 3).

See our reply above.

(2) A common concern are artefacts introduced by the harsh conditions of conventional FISH protocols (7). The authors use a method in which the cells are completely dehydrated, which probably leads to shrinking artifacts. However, differences between samples stained using the same FISH protocol are most likely due to experimental variation and not an artefact (cf. minor concern 1).

See our reply above.

• The anisotropic optical resolution (x-, y- vs. z-) of widefield microscopy (and most other light microscopic techniques) might lead to misinterpretation of the imaged 3D structures. This seems to be the cases in the current study (cf. major concern 4). See our reply above.

• In the present study, the cell cycle was synchronized. This requires the use of inhibitors such as the CDK1 inhibitor RO-3306. However, CDK1 has many very different functions (8), so unexpected effects on the experiments cannot be ruled out. The current approaches involving FISH inevitably require cell cycle synchronization. We believe that the use of the CDK1 inhibitor RO-3306 to arrest the cell cycle at G2 is a reasonable choice, although we cannot rule out unexpected effects arising from the use of the drug. This issue has now been addressed in the new section entitled “Limitations of the study”.

Audience:

The spatial arrangement of genomic elements in the nucleus and their (temporal) dynamics are of high general relevance, as they are important for answering fundamental questions, for example, in epigenetics or tumor biology (9,10). The manuscript from Ono et al. addresses specific questions, so its intended readership is more likely to be specialists in the field.

We are confident that, given the increasing interest in the 3D genome and its role in regulating diverse biological functions, the current manuscript will attract the broad readership of leading journals in cell biology.

About the reviewer:

By training I'm a biologist with strong background in fluorescence microscopy and fluorescence in situ hybridization. In recent years, I have been involved in research on the 3D organization of the cell nucleus, chromatin organization, and promoter-enhancer interactions.

We greatly appreciate the reviewer’s constructive comments on both the technical strengths and limitations of our fluorescence imaging approaches, which have been very helpful in revising the manuscript. As mentioned above, we have decided to add a special paragraph entitled “Limitations of the study” at the end of the Discussion section to discuss these issues.

All questions regarding the statistics of angularly distributed data are beyond my expertise. The authors do not correct their statistical analyses for "multiple testing". Whether this is necessary, I cannot judge.

We thank the reviewer for raising this important point. In our study, the primary comparisons were made between -IAA and +IAA conditions within the same cell line. Accordingly, the figures report P-values for these pairwise comparisons.

For the distance measurements, statistical evaluations were performed in PRISM using ANOVA (Kruskal–Wallis test), and the P-values shown in the figures are based on these analyses (Fig. 1, G and H; Fig. 2 E; Fig. 3 F and G; Fig. 4 F; Fig. 6 F [right]–H; Fig. S2 B and G; Fig. S3 D and H; Fig. S5 A [right] and B [right]; Fig. S8 B). While the manuscript focuses on pairwise comparisons between -IAA and +IAA conditions within the same cell line, we also considered potential differences across cell lines as part of the same ANOVA framework, thereby ensuring that multiple testing was properly addressed. Because cell line differences are not the focus of the present study, the corresponding results are not shown.

For the angular distribution analyses, we compared -IAA and +IAA conditions within the same cell line using the Mardia–Watson–Wheeler test; these analyses do not involve multiple testing (circular scatter plots; Fig. 5 C–E and Fig. S6 B, C, and E–H). In addition, to determine whether angular distributions exhibited directional bias under each condition, we applied the Rayleigh test to each dataset individually (Fig. 5 F and Fig. S6 I). As these tests were performed on a single condition, they are also not subject to the problem of multiple testing. Collectively, we consider that the statistical analyses presented in our manuscript appropriately account for potential multiple testing issues, and we remain confident in the robustness of the results.

Literature

Falk, M., Feodorova, Y., Naumova, N., Imakaev, M., Lajoie, B.R., Leonhardt, H., Joffe, B., Dekker, J., Fudenberg, G., Solovei, I. et al. (2019) Heterochromatin drives compartmentalization of inverted and conventional nuclei. Nature, 570, 395-399. Mirny, L.A., Imakaev, M. and Abdennur, N. (2019) Two major mechanisms of chromosome organization. Curr Opin Cell Biol, 58, 142-152. Rao, S.S.P., Huang, S.C., Glenn St Hilaire, B., Engreitz, J.M., Perez, E.M., Kieffer-Kwon, K.R., Sanborn, A.L., Johnstone, S.E., Bascom, G.D., Bochkov, I.D. et al. (2017) Cohesin Loss Eliminates All Loop Domains. Cell, 171, 305-320 e324. Bintu, B., Mateo, L.J., Su, J.H., Sinnott-Armstrong, N.A., Parker, M., Kinrot, S., Yamaya, K., Boettiger, A.N. and Zhuang, X. (2018) Super-resolution chromatin tracing reveals domains and cooperative interactions in single cells. Science, 362. Cremer, M., Brandstetter, K., Maiser, A., Rao, S.S.P., Schmid, V.J., Guirao-Ortiz, M., Mitra, N., Mamberti, S., Klein, K.N., Gilbert, D.M. et al. (2020) Cohesin depleted cells rebuild functional nuclear compartments after endomitosis. Nat Commun, 11, 6146. Hoencamp, C., Dudchenko, O., Elbatsh, A.M.O., Brahmachari, S., Raaijmakers, J.A., van Schaik, T., Sedeno Cacciatore, A., Contessoto, V.G., van Heesbeen, R., van den Broek, B. et al. (2021) 3D genomics across the tree of life reveals condensin II as a determinant of architecture type. Science, 372, 984-989. Beckwith, K.S., Ødegård-Fougner, Ø., Morero, N.R., Barton, C., Schueder, F., Tang, W., Alexander, S., Peters, J.-M., Jungmann, R., Birney, E. et al. (2023) Nanoscale 3D DNA tracing in single human cells visualizes loop extrusion directly in situ. BioRxiv 8 of 9https://doi.org/10.1101/2021.04.12.439407. Massacci, G., Perfetto, L. and Sacco, F. (2023) The Cyclin-dependent kinase 1: more than a cell cycle regulator. Br J Cancer, 129, 1707-1716. Bonev, B. and Cavalli, G. (2016) Organization and function of the 3D genome. Nat Rev Genet, 17, 661-678. Dekker, J., Belmont, A.S., Guttman, M., Leshyk, V.O., Lis, J.T., Lomvardas, S., Mirny, L.A., O'Shea, C.C., Park, P.J., Ren, B. et al. (2017) The 4D nucleome project. Nature, 549, 219-226.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Summary:

The manuscript „Condensin II collaborates with cohesin to establish and maintain interphase chromosome territories" investigates how condensin II and cohesin contribute to chromosome organization during the M-to-G1 transition and in G2 phase using published auxin-inducible degron (AID) cell lines which render the respective protein complexes nonfunctional after auxin addition. In this study, a novel degron cell line was established that enables the simultaneous depletion of both protein complexes, thereby facilitating the investigation of synergistic effects between the two SMC proteins. The chromosome architecture is studied using fluorescence in situ hybridization (FISH) and light microscopy. The authors reproduce a number of already published data and also show that double depletion causes during the M-to-G1 transition defects on chromosome territories, producing expanded, irregular shapes that obscure condensin II-specific phenotypes. Findings in G2 cells point to a new role of condensin II for chromosome conformation at a scale of ~20Mb. Although individual depletion has minimal effects on large-scale CT morphology in G2, combined loss of both complexes produces marked structural abnormalities, including irregular crescent-shaped CTs displaced toward the nucleolus and increased nucleolus-CT contact. The authors propose that condensin II and cohesin act sequentially and complementarily to ensure proper post-mitotic CT formation and maintain chromosome architecture across genomic scales.

Concerns about statistics:

(1) The authors provide the information on how many cells are analyzed but not the number of independent experiments. My concern is that there might variations in synchronization of the cell population and in the subsequent preparation (FISH) affecting the final result.

(2) Statistically the authors analyze the effect of cells with induced degron vs. vehicle control (non-induced). However, the biologically relevant question is whether the data differ between cell lines when the degron system is induced. This is not tested here (cf. major concern 2 and 3).

(3) Some Journal ask for blinded analysis of the data which might make sense here as manual steps are involved in the data analysis (e.g. line 626 / 627the convex hull of the signals was manually delineated, line 635 / 636 Chromosome segmentation in FISH images was performed using individual thresholding). However personally I have no doubts on the correctness of the work.

Major concerns:

(1) Degron induction appears to delay in Rad21-AID#1 an Double-AID#1 cells the transition from M to G1, as shown in Fig. S1. After auxin treatment, more cells exhibit a G2 phenotype than in an untreated population. What are the implications of this for the interpretation of the experiments?

(2) Line 178 "In contrast, cohesin depletion had a smaller effect on the distance between the two site-specific probes compared to condensin II depletion (Fig. 2, C and E)." The data in Fig. 2 E show both a significant effect of H2 and a significant effect of RAD21 depletion. Whether the absolute difference in effect size between the two conditions is truly relevant is difficult to determine, as the distribution of the respective control groups also appears to be different.

(3) In Figures 3, S3 and related text in the manuscript I cannot follow the authors' argumentation, as H2 depletion alone leads to a significant increase in the CT area (Chr. 18, Chr. 19, Chr. 15). Similar to Fig. 2, the authors argue about the different magnitude of the effect (H2 depletion vs double depletion). Here, too, appropriate statistical tests or more suitable parameters describing the effect should be used. I also cannot fully follow the argumentation regarding chromosome elongation, as double depletion in Chr. 18 and Chr. 19 also leads to a significantly reduced circularity. Therefore, the schematic drawing Fig. 3 H (double depletion) seems very suggestive to me.

(4) Fig. 5 and accompanying text. I agree with the authors that this is a significant and very interesting effect. However, I believe the sharp bends is in most cases an artifact caused by the maximum intensity projection. I tried to illustrate this effect in two photographs: Reviewer Fig. 1, side view, and Reviewer Fig. 2, same situation top view (https://cloud.bio.lmu.de/index.php/s/77npeEK84towzJZ). As I said, in my opinion, there is a significant and important effect; the authors should simply adjust the description.

Minor concerns:

(1) I would like to suggest proactively discussing possible artifacts that may arise from the harsh conditions during FISH sample preparation..

(2) It would be helpful if the authors could provide the original data (microscopic image stacks) for download

(3) The authors use a blind deconvolution algorithm to improve image quality. It might be helpful to test other methods for this purpose (optional).

Significance

Advance:

Ono et al. addresses the important question on how the complex pattern of chromatin is reestablished after mitosis and maintained during interphase. In addition to affinity interactions (1,2), it is known that cohesin plays an important role in the formation and maintenance of chromosome organization interphase (3). However, current knowledge does not explain all known phenomena. Even with complete loss of cohesin, TAD-like structures can be recognized at the single-cell level (4), and higher structures such as chromosome territories are also retained (5). The function of condensin II during mitosis is another important factor that affects chromosome architecture in the following G1 phase (6). Although condensin II is present in the cell nucleus throughout interphase, very little is known about the role of this protein in this phase of the cell cycle. This is where the present publication comes in, with a new double degron cell line in which essential subunits of cohesin AND condensin can be degraded in a targeted manner. I find the data from the experiments in the G2 phase most interesting, as they suggest a previously unknown involvement of condensin II in the maintenance of larger chromatin structures such as chromosome territories. The experiments regarding the M-G1 transition are less interesting to me, as it is known that condensin II deficiency in mitosis leads to elongated chromosomes (Rabl configuration)(6), and therefore the double degradation of condensin II and cohesin describes the effects of cohesin on an artificially disturbed chromosome structure.

General limitations:

(1) Single cell imaging of chromatin structure typically shows only minor effects which are often obscured by the high (biological) variability. This holds also true for the current manuscript (cf. major concern 2 and 3).

(2) A common concern are artefacts introduced by the harsh conditions of conventional FISH protocols (7). The authors use a method in which the cells are completely dehydrated, which probably leads to shrinking artifacts. However, differences between samples stained using the same FISH protocol are most likely due to experimental variation and not an artefact (cf. minor concern 1).

(3) The anisotropic optical resolution (x-, y- vs. z-) of widefield microscopy (and most other light microscopic techniques) might lead to misinterpretation of the imaged 3D structures. This seems to be the cases in the current study (cf. major concern 4).

(4) In the present study, the cell cycle was synchronized. This requires the use of inhibitors such as the CDK1 inhibitor RO-3306. However, CDK1 has many very different functions (8), so unexpected effects on the experiments cannot be ruled out.

Audience:

The spatial arrangement of genomic elements in the nucleus and their (temporal) dynamics are of high general relevance, as they are important for answering fundamental questions, for example, in epigenetics or tumor biology (9,10). The manuscript from Ono et al. addresses specific questions, so its intended readership is more likely to be specialists in the field.

About the reviewer: By training I'm a biologist with strong background in fluorescence microscopy and fluorescence in situ hybridization. In recent years, I have been involved in research on the 3D organization of the cell nucleus, chromatin organization, and promoter-enhancer interactions.

All questions regarding the statistics of angularly distributed data are beyond my expertise. The authors do not correct their statistical analyses for "multiple testing". Whether this is necessary, I cannot judge.

Literature

1. Falk, M., Feodorova, Y., Naumova, N., Imakaev, M., Lajoie, B.R., Leonhardt, H., Joffe, B., Dekker, J., Fudenberg, G., Solovei, I. et al. (2019) Heterochromatin drives compartmentalization of inverted and conventional nuclei. Nature, 570, 395-399.
2. Mirny, L.A., Imakaev, M. and Abdennur, N. (2019) Two major mechanisms of chromosome organization. Curr Opin Cell Biol, 58, 142-152.
3. Rao, S.S.P., Huang, S.C., Glenn St Hilaire, B., Engreitz, J.M., Perez, E.M., Kieffer-Kwon, K.R., Sanborn, A.L., Johnstone, S.E., Bascom, G.D., Bochkov, I.D. et al. (2017) Cohesin Loss Eliminates All Loop Domains. Cell, 171, 305-320 e324.
4. Bintu, B., Mateo, L.J., Su, J.H., Sinnott-Armstrong, N.A., Parker, M., Kinrot, S., Yamaya, K., Boettiger, A.N. and Zhuang, X. (2018) Super-resolution chromatin tracing reveals domains and cooperative interactions in single cells. Science, 362.
5. Cremer, M., Brandstetter, K., Maiser, A., Rao, S.S.P., Schmid, V.J., Guirao-Ortiz, M., Mitra, N., Mamberti, S., Klein, K.N., Gilbert, D.M. et al. (2020) Cohesin depleted cells rebuild functional nuclear compartments after endomitosis. Nat Commun, 11, 6146.
6. Hoencamp, C., Dudchenko, O., Elbatsh, A.M.O., Brahmachari, S., Raaijmakers, J.A., van Schaik, T., Sedeno Cacciatore, A., Contessoto, V.G., van Heesbeen, R., van den Broek, B. et al. (2021) 3D genomics across the tree of life reveals condensin II as a determinant of architecture type. Science, 372, 984-989.
7. Beckwith, K.S., Ødegård-Fougner, Ø., Morero, N.R., Barton, C., Schueder, F., Tang, W., Alexander, S., Peters, J.-M., Jungmann, R., Birney, E. et al. (2023) Nanoscale 3D DNA tracing in single human cells visualizes loop extrusion directly in situ. BioRxiv https://doi.org/10.1101/2021.04.12.439407.
8. Massacci, G., Perfetto, L. and Sacco, F. (2023) The Cyclin-dependent kinase 1: more than a cell cycle regulator. Br J Cancer, 129, 1707-1716.
9. Bonev, B. and Cavalli, G. (2016) Organization and function of the 3D genome. Nat Rev Genet, 17, 661-678.
10. Dekker, J., Belmont, A.S., Guttman, M., Leshyk, V.O., Lis, J.T., Lomvardas, S., Mirny, L.A., O'Shea, C.C., Park, P.J., Ren, B. et al. (2017) The 4D nucleome project. Nature, 549, 219-226.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

• Ono et al use a variety of imaging and genetic (AID) depletion approaches to examine the roles of condensin II and cohesin in the reformation of interphase genome architecture in human HCT16 cells. Consistent with previous literature, they find that condensin II is required for CENP-A dispersion in late mitosis/early G1. Using in situ FISH at the centromere/q arm of chromosome 12 they then establish that condensin II removal causes lengthwise elongation of chromosomes that, interestingly, can be suppressed by cohesin removal. To better understand changes in whole-chromosome morphology, they then use whole chromosome painting to examine chromosomes 18 and 19. In the absence of condensin II, cells effectively fail to reorganise their chromosomes from rod-like structures into spherical chromosome territories (which may explain why CENP-A dispersion is suppressed). Cohesin is not required for spherical CT formation, suggesting condensin II is the major initial driver of interphase genome structure. Double depletion results in complete disorganisation of chromatin, leading the authors to conclude that a typical cell cycle requires orderly 'handover' from the mitotic to interphase genome organising machinery.

• The authors then move on to G2 phase, where they use a variety of different FISH probes to assess alterations in chromosome structure at different scales. They thereby establish that perturbation of cohesin or condensin II influences local and longer range chromosome structure, respectively. The effects of condensin II depletion become apparent at a genomic distance of 20 Mb, but are negligible either below or above. The authors repeat the G1 depletion experiment in G2 and now find that condensin II and cohesin are individually dispensable for CT organisation, but that dual depletion causes CT collapse. This rather implies that there is cooperation rather than handover per se.

• Overall this study is a broadly informative multiscale investigation of the roles of SMC complexes in organising the genome of postmitotic cells, and solidifies a potential relationship between condensin II and cohesin in coordinating interphase genome structure. The deeper investigation of the roles of condensin II in establishing chromosome territories and intermediate range chromosome structure in particular is a valuable and important contribution, especially given our incomplete understanding of what functions this complex performs during interphase.

Major comments:

• In general the claims and conclusions of the manuscript are well supported by multiscale FISH labelling. An important absent control is western blotting to confirm protein depletion levels. Currently only fluorescence is used as a readout for the efficiency of the AID depletion, and we know from prior literature that even small residual quantities of SMC complexes are quite effective in organising chromatin. I would consider a western blot a fairly straightforward and important technical control.

• I find the point on handover as a mechanism for maintaining CT architecture somewhat ambiguous, because the authors find that the dependence simply switches from condensin II to both condensin II and cohesin, between G1 and G2. To me this implies augmented cooperation rather than handover.

• I have two further suggestions, both of which I would strongly recommend but would consider desirable but 'optional' according to review commons guidelines.

Firstly, the depletions are performed at different stages of the cell cycle but have different outcomes. The authors suggest this is because handover is already complete, but an alternative possibility is that the phenotype is masked by other changes in chromosome structure (e.g. duplication/catenation). I would be very curious to see, for example, how the outcome of this experiment would change if the authors were to repeat the depletions in the presence of a topoisomerase II inhibitor.

Secondly, if the author's claim of handover is correct then one (not exclusive) possibility is that there is a relationship between condensin II and cohesin loading onto chromatin. There does seem to be a modest co-dependence (e.g. fig S4 and S7), could the authors comment on this? Another control experiment here would be to treat fully WT cells with IAA and test whether non-AID labelled H2 or RAD21 dip in intensity. If they do not, then perhaps there's a causal relationship between condensin II and cohesin levels?

• I recognise this is something considered in Brunner et al 2025 (JCB), but in their case they depleted SMC4 (so all condensins are lost or at least dismantled). Might bear further investigation.

Methods:

Data and methods are described in reasonable detail, and a decent number of replicates/statistical analyses have been. Documentation of the cell lines used could be improved. The actual cell line is not mentioned once in the manuscript. Although it is referenced, I'd recommend including the identity of the cell line (HCT116) in the main text when the cells are introduced and also in the relevant supplementary tables. Will make it easier for readers to contextualise the findings.

Minor comments:

Overall the manuscript is well-written and well presented. In the introduction it is suggested that no experiment has established a causal relationship between human condensin II and chromosome territories, but this is not correct, Hoencamp et al 2021 (cell) observed loss of CTs after condensin II depletion. Although that manuscript did not investigate it in as much detail as the present study, the fundamental relationship was previously established, so I would encourage the authors to revise this statement.

Significance

General assessment: Strengths: the multiscale investigation of genome architecture at different stages of interphase allow the authors to present convincing and well-analysed data that provide meaningful insight into local and global chromosome organisation across different scales. Limitations: As suggested in major comments.

Advance: Although the role of condensin II in generating chromosome territories, and the roles of cohesin in interphase genome architecture are established, the interplay of the complexes and the stage specific roles of condensin II have not been investigated in human cells to the level presented here. This study provides meaningful new insight in particular into the role of condensin II in global genome organisation during interphase, which is much less well understood compared to its participation in mitosis.

Audience: Will contribute meaningfully and be of interest to the general community of researchers investigating genome organisation and function at all stages of the cell cycle. Primary audience will be cell biologists, geneticists and structural biochemists. Importance of genome organisation in cell/organismal biology is such that within this grouping it will probably be of general interest.

My expertise is in genome organization by SMCs and chromosome segregation.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #1

Evidence, reproducibility and clarity

Ono et al addressed how condensin II and cohesin work to define chromosome territories (CT) in human cells. They used FISH to assess the status of CT. They found that condensin II depletion leads to lengthwise elongation of G1 chromosomes, while double depletion of condensin II and cohesin leads to CT overlap and morphological defects. Although the requirement of condensin II in shortening G1 chromosomes was already shown by Hoencamp et al 2021, the cooperation between condensin II and cohesin in CT regulation is a new finding. They also demonstrated that cohesin and condensin II are involved in G2 chromosome regulation on a smaller and larger scale, respectively. Though such roles in cohesin might be predictable from its roles in organizing TADs, it is a new finding that the two work on a different scale on G2 chromosomes. Overall, this is technically solid work, which reports new findings about how condensin II and cohesin cooperate in organizing G1 and G2 chromosomes.

Major point:

They propose a functional 'handover' from condensin II to cohesin, for the organization of CTs at the M-to-G1 transition. However, the 'handover', i.e. difference in timing of executing their functions, was not experimentally substantiated. Ideally, they can deplete condensin II and cohesin at different times to prove the 'handover'. However, this would require the use of two different degron tags and go beyond the revision of this manuscript. At least, based on the literature, the authors should discuss why they think condensin II and cohesin should work at different timings in the CT organization.

Other points:

• Figure 2E: It seems that the chromosome length without IAA is shorter in Rad21-aid cells than H2-aid cells or H2-aid Rad21-aid cells. How can this be interpreted?

• Figure 3: Regarding the CT morphology, could they explain further the difference between 'elongated' and 'cloud-like (expanded)'? Is it possible to quantify the frequency of these morphologies?

• Figure 5: How did they assign C, P and D3 for two chromosomes? The assignment seems obvious in some cases, but not in other cases (e.g. in the image of H2-AID#2 +IAA, two D3s can be connected to two Ps in the other way). They may have avoided line crossing between two C-P-D3 assignments, but can this be justified when the CT might be disorganized e.g. by condensin II depletion?

• Figure 6F: The mean is not indicated on the right-hand side graph, in contrast to other similar graphs. Is this an error?

• Figure S1A: The two FACS profiles for Double-AID #3 Release-2 may be mixed up between -IAA and +IAA.

• The method section explains that 'circularity' shows 'how closely the shape of an object approximates a perfect circle (with a value of 1 indicating a perfect circle), calculated from the segmented regions'. It would be helpful to provide further methodological details about it.

Significance

Ono et al addressed how condensin II and cohesin work to define chromosome territories (CT) in human cells. They used FISH to assess the status of CT. They found that condensin II depletion leads to lengthwise elongation of G1 chromosomes, while double depletion of condensin II and cohesin leads to CT overlap and morphological defects. Although the requirement of condensin II in shortening G1 chromosomes was already shown by Hoencamp et al 2021, the cooperation between condensin II and cohesin in CT regulation is a new finding. They also demonstrated that cohesin and condensin II are involved in G2 chromosome regulation on a smaller and larger scale, respectively. Though such roles in cohesin might be predictable from its roles in organizing TADs, it is a new finding that the two work on a different scale on G2 chromosomes. Overall, this is technically solid work, which reports new findings about how condensin II and cohesin cooperate in organizing G1 and G2 chromosomes.

Note: This response was posted by the corresponding author to Review Commons. The content has not been altered except for formatting.

Learn more at Review Commons

Reply to the reviewers

Reviewer #1 (Evidence, reproducibility and clarity (Required)): * Summary: * In this manuscript, Turner AH. et al. demonstrated the viral replication in cells depleting Rab11B small GTPase, which is a paralogue of Rab11A. It has been reported that Rab11A is responsible for the intracellular transport of viral RNP via recycling endosomes. The authors showed that Rab11B knockdown reduced the viral protein expression and viral titer. This may be caused by reduced attachment of viral particles on Rab11B knockdown cells.

• Major comments:*
• Comment 1 Fig 2-4: The authors should provide Western blot results with equal amount of loading control (GAPDH). The bands shown in these figures lack quantifiability and are not reliable as data.*

We have rerun these western blots with more equal loading, and included a second loading control (beta-actin) in addition to the GAPDH. These blots can be seen in new Figures 2 and 3, and the quantification against both GAPDH (Figure 2/3) as well as actin (Fig S2) is now included. We have also included additional biological replicates for Fig 2 B-D. These additional experiments have strengthened our conclusion that Rab11B is required for efficient protein production in cells infected with recent H3N2, but not H1N1, isolates.

Comment 2 Fig 2-4: Why are the results different between Rab11B knockdown alone and Rab11A/B double knockdown? If the authors claims are correct, the results of Rab11B knockdown should be reproducible in Rab11A/B double knockdown cells.

Prior literature indicates that the Rab11A and Rab11B isoforms can play opposing roles in the trafficking of some cargos (ie, with one isoform transporting a molecule to the cell surface, while the other isoform takes it off again). In this scenario, it is possible that removing both 'halves' of the trafficking loop can ablate a phenotype. However, since our double knockdown used half the amount of siRNA for each isoform (for the same total amount), it is also possible this observation is simply the result of less efficient knockdown. In order to distinguish between these possibilities we depleted Rab11A or Rab11B individually, with this same 'half dose' of siRNA (see new Figure S3). We observed that Rab11B was still robustly required for H3N2 viral protein production. These results suggest that Rab11A and Rab11B could be playing mutually opposing roles in this case, which is consistent with prior Rab11 literature.

Comment 3 Fig 6: For better understanding, please provide a schematic illustration of experimental setting.

We have added a new graphical overview to this figure (see new Figure 6A).

Comment 4: It is necessary to test other siRNA sequences or perform a rescue experiment by expressing an siRNA-resistant clone in the knockdown cells. There seems to be an activation of host defense system, such as IFN pathways.

In order to rule out the possibility of off-target effects we created a novel cell line that inducibly expresses a Rab11B shRNA sequence (see new Fig 4). This knockdown strategy used a completely different method (shRNA delivered by lentiviral vector vs transient transfection of siRNA), in a different cellular background (H441 "club like" cells vs A549 lung adenocarcinoma). This new depletion strategy showed that the Rab11B dependent H3N2 protein production phenotype is seen across multiple knockdown strategies and cellular backgrounds.

**Referees cross-commenting**

I agree with other reviewers' comments in part.

Reviewer #1 (Significance (Required)):

The authors propose a novel role for Rab11B in modulating attachment pathway of H3N2 influenza A virus by unknown mechanism. Although previous studies focus on the function of Rab11A on endocytic transport, the function and specificity of Rab11B has remained less clear. The findings may be of interest to a broad audience, including researchers in cell biology, immunology, and host-pathogen interactions. However, the study remains at a superficial level of analysis and does not lead to a deeper understanding of the underlying mechanisms.

We agree with the reviewer that a strength of this manuscript is its multi-disciplinary nature, particularly with regard to advances in our understanding of Rab11B function. We have added a significant number of experiments and new figures to bolster the rigor and reproducibility of our findings. We have also added a new figure (Fig 7) that uses reverse genetics to map the Rab11B phenotype to the HA gene of the H3N2 isolate under study. By creating '7+1' reassortant viruses with the H3 HA or the N2 NA on a PR8 (H1N1) background (see Fig 7E-H) we were able to demonstrate that Rab11B is acting specifically on one of the HA-mediated entry steps. This provides additional mechanistic insight, by mapping the Rab11B-phenotype to a step at or prior to fusion. Fundamentally, we believe the novelty and rigor of our observation that recent H3N2 viruses enter through a different route than H1N1 isolates is worthy of observation in this updated form, so that the field can begin follow up studies.

Reviewer #2 (Evidence, reproducibility and clarity (Required)): Summary: The authors compare the effect of RAB11A and RAB11B knockdown on replication of contemporary H1N1 and H3N2 influenza A virus strains in A549 cells (human lung epithelials cells). They find a reduction in viral protein expression for tested H3N2 but not for H1N1 isolates. Mechanistically they suggest that RAB11A affects virion attachment to the cell surface.

Major comments: The provided data do not conclusively support the suggested mechanism of action and essential controls are missing to substantiate the authors claims: • Knockdown efficacy has to be confirmed on protein level, showing reduced levels of RAB11A and B by Western blot. This is a standard in the field. Off target effects cannot be avoided by RNAi approaches and are usually ruled out by using multiple siRNAs or by complementing the targeted protein in trans.

We have verified knockdown efficacy at the protein level in new Fig 1A/B. However, due to the high degree of protein level conservation between Rab11A and Rab11B it is very difficult to develop isoform specific antibodies, and we were unable to obtain a Rab11B-specific antibody that can detect endogenous protein (despite testing 6 commercially available antibodies for specificity). Using an antibody that detects both 11A and 11B (Fig1A) we were able to observe very slight changes in the molecular weight of the Rab11 band(s) detected upon knockdown of 11A vs 11B (suggestive of the two isoforms running as a dimer, with Rab11A the lower band and Rab11B the upper band). Cells depleted of both isoforms simultaneously showed a near complete loss of signal. Using a Rab11A antibody (that we confirmed as specific) we were able to observe loss of the Rab11A signal in both the 11A and 11A+B knockdowns (Fig 1B).

• Viral titers should be presented as absolute titers not as % (here the labelling is actually misleading in all graphs indicating pfu/ml)

This data is now shown in new Figure S1, where it is clear that the trends remain consistent across biological replicates. The axis labels of Fig 1D/E and Fig 3A have been corrected as requested to make clear we are normalizing to account for experiment-to-experiment variation in peak titer.

• Reduction of viral protein expression goes hand in hand with a reduction in GAPDH. While this is accounted for in the quantification a general block of protein expression cannot be ruled out since the stability of house keeper proteins and viral proteins might be different. Testing multiple house keeping proteins could overcome this issue.

We have included a second loading control (beta-actin) in addition to the GAPDH for new Figure 2 and 3. The quantification of viral protein production compared to beta actin is now included in new Fig S2. We have also included additional biological replicates for Fig 2 B-D. These additional experiments have strengthened our conclusion that Rab11B is required for efficient protein production in cells infected with recent H3N2, but not H1N1, isolates.

• The FACS data in Fig 5 are not convincing. The previous figures showed modest reduction in viral protein expression and the fluorescence is indicated here on a logarithmic scale. Quantification and indication of mean fluorescence intensity from the same data would be a better readout to convincingly show that less cells are infected.

We have reanalyzed the existing data to quantify the geometric mean of viral protein expression in the infected cell populations (new Figure 5D, E). This analysis shows no significant difference in geometric mean of HA (Fig 5D) or M2 (Fig 5E) expression between cells treated with NT, 11A or 11B siRNA. This additional analysis strengthens our original conclusion that when Rab11B is knocked down, fewer cells get infected, but those that do produce the same level of viral proteins.

• During the time of addition experiment in Fig 6, the authors are testing for HA/M2 positive cells after 16h of infection. This is a multicycle scnario so in a second round they would measure the effect of knockdown in absence of amonium chloride. Shorter infections up to 8h with higher MOI would overcome this problem.

By maintaining cells in ammonium chloride throughout the infection we are preventing endosomal acidification at any point in the infection period, so this experiment should be measuring solely the effect of one round of infection. The 16 hr timepoint was chosen to allow for optimized staining and analysis of samples by flow cytometry, within the available hours of the flow cytometry facility.

• Standard error of mean is not an appropriate way of representing experimental error for the provided results and should be replaced by SD. Correct labeling of axis with units is required.

We have updated the axes throughout the manuscript as requested. We have obtained additional statistical expertise (reflected in the updated author list) regarding the issue of SD vs SEM. Standard deviation (SD) would show a measure of the spread of the data, however the full distribution can be clearly seen as we plotted every individual data point. Standard error of the mean (SEM) is a measure of confidence for the mean of the population which takes into account SD and also sample size. SEM is not obvious to estimate by eye in the same way as SD, and we feel is more helpful to the reader to understand how likely the two population means differ from each other on a given graph.

Minor comments: • The authors show a rescue of viral replication upon double knockdown of RAB11A and B. Maybe this is just a consequence of inefficient knockdown since only half of the siRNAs were used?

In order to determine if this was the case we depleted Rab11A or Rab11B individually, with this same 'half dose' of siRNA (see new Figure S3). We observed that Rab11B was still robustly required for H3N2 viral protein production. These results suggest that Rab11A and Rab11B could be playing mutually opposing roles in this case (ie, Rab11B transporting a molecule to the surface, while Rab11A recycles it off), which is consistent with prior Rab11 literature.

• Specific experimental issues that are easily addressable. • Are prior studies referenced appropriately? • Are the text and figures clear and accurate? • Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

• Reviewer #2 (Significance (Required)): Significance The authors claim an H3N2 specific dependency on RAB11B for early steps of infection. While this is per se interesting the provided data do not fully support the claims and lack a mechanistic explanation. What is the difference between H1 and H3 strains (virion shape, HA load per virion, attachment force of H1 vs H3). The readouts used are not close enough to the events with regards to timing and could be supported by established entry assays in the field.

We have provided additional discussion of the differences between H1s and H3s, including sialic acid binding preferences and changes in the HA-sialic acid avidity (lines 76-84). Notably, we have included a new assay (new Fig 7) that provides additional mechanistic insight into the observation that recent H3N2 but not H1N1 isolates depend on Rab11B early in infection. Using reverse genetics we were able to map the Rab11B phenotype to the HA gene of the H3N2 isolate under study. By creating '7+1' reassortant viruses with either the H3 HA or the N2 NA on a PR8 (H1N1) background (see Fig 7E) we are able to demonstrate that Rab11B is acting specifically at one of the HA-mediated entry steps. This excludes several non-HA dependent steps early in the life cycle (uncoating, RNP transport to the nucleus, nuclear import), thus providing additional confirmation that Rab11B acts at one of the earliest steps in the viral life cycle (and by definition, at or prior to fusion). Fundamentally, we believe the novelty and rigor of our observation that recent H3N2 viruses enter through a different route than H1N1 isolates is worthy of observation in this updated form, so that the field can begin follow up studies.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Manuscript Reference: RC-2025-03007 TITLE: Rab11B is required for binding and entry of recent H3N2, but not H1N1, influenza A isolates Allyson Turner, Sara Jaffrani, Hannah Kubinski, Deborah Ajayi, Matthew Owens, Madeline McTigue, Conor Fanuele, Cailey Appenzeller, Hannah Despres, Madaline Schmidt, Jessica Crothers, and Emily Bruce

Summary Here, Turner et al. build upon existing knowledge of Influenza A virus (IAV) dependence on the Rab11 family of proteins and provide insights into the specific role of Rab11B isoform in H3N2 virus binding and entry. The introduction is clearly written and provides sufficient background on prior research involving Rab11. It effectively identifies the current gap in knowledge and justifies the investigation of more clinically relevant, circulating strains of IAV. The methods section provides sufficient detail to ensure reproducibility. Similarly, the discussion is well structured, aligns with the introduction, and thoughtfully outlines relevant follow-up experiments. The authors present data from a series of experiments which suggest that the reduced H3N2 infection and viral protein production in Rab11B-depleted cells is due to impaired virus binding. While the evidence supports a Rab11B-specific phenotype in the context of H3N2 infection, we recommend additional experiments (outlined below), to further validate and strengthen these findings. These would help solidify the mechanistic link between Rab11B depletion and the observed phenotype for H3N2 strains of IAV.

Major comments Figure 1. (B) & (C) The authors normalise viral titers to the non-targeting control (NTC) siRNA set at 100. While this approach allows for relative comparisons, we recommend including the corresponding raw PFU/ml values, at least in the supplementary materials. This will better illustrate the biological significance of gene depletion and variability of the results.

We have included the raw PFU/mL values in new Figure S1, while peak viral production varied by biological replicate (pasted below, with each biological replicate having a differently shaped data point). While the depletion-induced trends are clearly visible across biological replicates, normalization to average titer in the NT condition for each replicate allows for cleaner visualization.

In addition, the current protocol uses a high MOI (1), and a relatively short infection period (16 hours) to capture single-cycle replication. However, to better assess the impact of gene knockdown on virus production and spread, we suggest performing a multicycle replication assay using a lower MOI (e.g, 0.01-0.001) over an extended time period, such as 48 hours before titration, provided that cell viability under these conditions is acceptable.

We appreciate this suggestion and repeatedly attempted to carry out a multicycle growth curve to obtain this data. Unfortunately, out of four independent biological replicates we attempted, we were only able to maintain cell viability and adherence in one biological replicate (shown below). We have not included this data in the revised manuscript due to the limited replicates we were able to obtain, though we can add it in a further revision if the reviewer feels it is warranted.

Figure 7. (B) & (C) The authors present interesting data showing that siRNA-mediated depletion of Rab11B reduces virion binding of a recently circulating strain of H3N2, but not H1N1, suggesting a subtype-specific role. However, we strongly recommend complementing this assay with a single-cell resolution approach such as immunofluorescence detection of surface-bound viruses through HA staining and image quantification. This would allow the authors to directly assess virion binding per cell and visualise the phenotype, strengthening the mechanistic insight on H3N2 binding in Rab11B-depleted cells. Furthermore, the data, particularly for H1N1 (Figure 7.C), shows substantial variance, which suggests a suboptimal assay sensitivity and limits the strength of the conclusion that the knockdown does not affect H1N1 binding, this limitation may be overcome by implementing the above experimental suggestion.

We have made substantial efforts to include this data, but were ultimately unable to include this assay due to technical difficulties in implementation (NA stripping caused cells to lift off coverslips, difficulties in antibody sensitivity and specificity, among other issues). We also piloted single cell-based flow cytometry assays to attempt to measure signal from bound virions, but were unable to achieve sufficient differentiation between mock and bound samples with the antibodies we could obtain. However, we have included a new experimental approach that is able to genetically map the 11B-dependent phenotype to the HA gene, thus providing additional mechanistic insight and confirming that Rab11B acts on one of the earliest steps in the viral life cycle (prior to or at fusion).

Minor comments General The authors should state which statistical test was used for each dataset in the respective figure legends.

This information is now included in each figure legend.

Figure 1. Suggest changing Y axis title to PFU/ml [relative to NTC]

We have changed the axis titles of normalized data to "PFU as % of NT" throughout.

The co-depletion of Rab11A and Rab11B appears to be less efficient than individual knockdowns, based on RT- qPCR data (Figure 1.A). It is possible that the partial 'rescue' phenotype observed in Figures 2-4 is due to incomplete knockdown, rather than a true biological interaction. This possibility should be acknowledged.

In order to distinguish between a partial 'rescue' and inefficient knockdown, we depleted Rab11A or Rab11B individually, with the same 'half dose' of siRNA used in the double knockdown (see new Figure S3). We observed that Rab11B was still robustly required for H3N2 viral protein production. These results suggest that Rab11A and Rab11B could be playing mutually opposing roles in this case, which is consistent with prior Rab11 literature, rather than simply inefficient knockdown.

Furthermore, knockdown efficiency is assessed only at the mRNA level. To strengthen the conclusions, the authors are encouraged to provide western blot data confirming protein-level depletion of Rab11A and Rab11B, particularly in the double knockdown condition. This would help clarify whether co-transfection of siRNAs affect the efficiency of each individual knockdown at the protein level.

We have verified knockdown efficacy at the protein level in new Fig 1A/B. However, due to the high degree of protein level conservation between Rab11A and Rab11B it is very difficult to develop isoform specific antibodies, and we were unable to obtain a Rab11B-specific antibody that can detect endogenous protein (despite testing 6 commercially available antibodies for specificity). Using an antibody that detects both 11A and 11B (Fig1A) we were able to observe very slight changes in the molecular weight of the Rab11 band(s) detected upon knockdown of 11A vs 11B (suggestive of the two isoforms running as a dimer, with Rab11A the lower band and Rab11B the upper band). Cells depleted of both isoforms simultaneously showed a near complete loss of signal. Using a Rab11A antibody (that we confirmed as specific) we were able to observe loss of the Rab11A signal in both the 11A and 11A+B knockdowns (Fig 1B).

Figure 6. (A) & (B) are missing error bars, particularly the Rab11B knockdown data points.

Error bars are plotted in each graph, but due to very limited experimental variation these error bars are too small to appear on the graph (11B points in Fig 6B, D).

Figure 7. If including any repeats in the binding assay, authors are encouraged to use appropriate controls in each experiment such as exogenous neuraminidase treatment or sialidase treatment.

When attempting to establish a microscopy based binding assay we included exogenous neuraminidase in each experiment. Unfortunately, the combination of glass coverslips and treatment with exogenous neuraminidase at incubation times sufficient to strip virus also removed cells from the coverslips.

Reviewer #3 (Significance (Required)):

General assessment: Provides a conceptual advancement of subtype specific receptor preferences.

Advance: The study raises interesting observations regarding influenza virus subtype differences in cell surface receptor binding, in a Rab11B-dependent manner.

Audience: Influenza virologists, respiratory virologists

Expertise: Virus entry, Virus cell biology

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #3

Evidence, reproducibility and clarity

Title: Rab11B is required for binding and entry of recent H3N2, but not H1N1, influenza A isolates

Allyson Turner, Sara Jaffrani, Hannah Kubinski, Deborah Ajayi, Matthew Owens, Madeline McTigue, Conor Fanuele, Cailey Appenzeller, Hannah Despres, Madaline Schmidt, Jessica Crothers, and Emily Bruce

Summary

Here, Turner et al. build upon existing knowledge of Influenza A virus (IAV) dependence on the Rab11 family of proteins and provide insights into the specific role of Rab11B isoform in H3N2 virus binding and entry. The introduction is clearly written and provides sufficient background on prior research involving Rab11. It effectively identifies the current gap in knowledge and justifies the investigation of more clinically relevant, circulating strains of IAV. The methods section provides sufficient detail to ensure reproducibility. Similarly, the discussion is well structured, aligns with the introduction, and thoughtfully outlines relevant follow-up experiments. The authors present data from a series of experiments which suggest that the reduced H3N2 infection and viral protein production in Rab11B-depleted cells is due to impaired virus binding. While the evidence supports a Rab11B-specific phenotype in the context of H3N2 infection, we recommend additional experiments (outlined below), to further validate and strengthen these findings. These would help solidify the mechanistic link between Rab11B depletion and the observed phenotype for H3N2 strains of IAV.

Major comments

Figure 1. (B) & (C)

The authors normalise viral titers to the non-targeting control (NTC) siRNA set at 100. While this approach allows for relative comparisons, we recommend including the corresponding raw PFU/ml values, at least in the supplementary materials. This will better illustrate the biological significance of gene depletion and variability of the results. In addition, the current protocol uses a high MOI (1), and a relatively short infection period (16 hours) to capture single-cycle replication. However, to better assess the impact of gene knockdown on virus production and spread, we suggest performing a multicycle replication assay using a lower MOI (e.g, 0.01-0.001) over an extended time period, such as 48 hours before titration, provided that cell viability under these conditions is acceptable.

Figure 7. (B) & (C)

The authors present interesting data showing that siRNA-mediated depletion of Rab11B reduces virion binding of a recently circulating strain of H3N2, but not H1N1, suggesting a subtype-specific role. However, we strongly recommend complementing this assay with a single-cell resolution approach such as immunofluorescence detection of surface-bound viruses through HA staining and image quantification. This would allow the authors to directly assess virion binding per cell and visualise the phenotype, strengthening the mechanistic insight on H3N2 binding in Rab11B-depleted cells. Furthermore, the data, particularly for H1N1 (Figure 7.C), shows substantial variance, which suggests a suboptimal assay sensitivity and limits the strength of the conclusion that the knockdown does not affect H1N1 binding, this limitation may be overcome by implementing the above experimental suggestion.

Minor comments

General

The authors should state which statistical test was used for each dataset in the respective figure legends.

Figure 1.

Suggest changing Y axis title to PFU/ml [relative to NTC] The co-depletion of Rab11A and Rab11B appears to be less efficient than individual knockdowns, based on RT- qPCR data (Figure 1.A). It is possible that the partial 'rescue' phenotype observed in Figures 2-4 is due to incomplete knockdown, rather than a true biological interaction. This possibility should be acknowledged. Furthermore, knockdown efficiency is assessed only at the mRNA level. To strengthen the conclusions, the authors are encouraged to provide western blot data confirming protein-level depletion of Rab11A and Rab11B, particularly in the double knockdown condition. This would help clarify whether co-transfection of siRNAs affect the efficiency of each individual knockdown at the protein level.

Figure 6.

(A) & (B) are missing error bars, particularly the Rab11B knockdown data points.

Figure 7.

If including any repeats in the binding assay, authors are encouraged to use appropriate controls in each experiment such as exogenous neuraminidase treatment or sialidase treatment.

Significance

General assessment: Provides a conceptual advancement of subtype specific receptor preferences.

Advance: The study raises interesting observations regarding influenza virus subtype differences in cell surface receptor binding, in a Rab11B-dependent manner.

Audience: Influenza virologists, respiratory virologists

Expertise: Virus entry, Virus cell biology

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

Referee #2

Evidence, reproducibility and clarity

Summary:

The authors compare the effect of RAB11A and RAB11B knockdown on replication of contemporary H1N1 and H3N2 influenza A virus strains in A549 cells (human lung epithelials cells). They find a reduction in viral protein expression for tested H3N2 but not for H1N1 isolates. Mechanistically they suggest that RAB11A affects virion attachment to the cell surface.

Major comments:

The provided data do not conclusively support the suggested mechanism of action and essential controls are missing to substantiate the authors claims:

• Knockdown efficacy has to be confirmed on protein level, showing reduced levels of RAB11A and B by Western blot. This is a standard in the field. Off target effects cannot be avoided by RNAi approaches and are usually ruled out by using multiple siRNAs or by complementing the targeted protein in trans.
• Viral titers should be presented as absolute titers not as % (here the labelling is actually misleading in all graphs indicating pfu/ml)
• Reduction of viral protein expression goes hand in hand with a reduction in GAPDH. While this is accounted for in the quantification a general block of protein expression cannot be ruled out since the stability of house keeper proteins and viral proteins might be different. Testing multiple house keeping proteins could overcome this issue.
• The FACS data in Fig 5 are not convincing. The previous figures showed modest reduction in viral protein expression and the fluorescence is indicated here on a logarithmic scale. Quantification and indication of mean fluorescence intensity from the same data would be a better readout to convincingly show that less cells are infected.
• During the time of addition experiment in Fig 6, the authors are testing for HA/M2 positive cells after 16h of infection. This is a multicycle scnario so in a second round they would measure the effect of knockdown in absence of amonium chloride. Shorter infections up to 8h with higher MOI would overcome this problem.
• Standard error of mean is not an appropriate way of representing experimental error for the provided results and should be replaced by SD. Correct labeling of axis with units is required.

Minor comments:

• The authors show a rescue of viral replication upon double knockdown of RAB11A and B. Maybe this is just a consequence of inefficient knockdown since only half of the siRNAs were used?
• Specific experimental issues that are easily addressable.
• Are prior studies referenced appropriately?
• Are the text and figures clear and accurate?
• Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

Significance

The authors claim an H3N2 specific dependency on RAB11B for early steps of infection. While this is per se interesting the provided data do not fully support the claims and lack a mechanistic explanation. What is the difference between H1 and H3 strains (virion shape, HA load per virion, attachment force of H1 vs H3). The readouts used are not close enough to the events with regards to timing and could be supported by established entry assays in the field.